TW202214875A - Screening methods of fgfr inhibitor - Google Patents

Abstract

The invention relates to a screening method of FGFR inhibitor. 1) Applying FGFR inhibitors to be tested to cell lines with different expression levels of FGFR1OP2 protein, test the efficacy of the FGFR inhibitor to be tested. 2) Determining the correlation between the drug efficacy of different cell lines and the expression levels of FGFR1OP2 protein between different cell lines. The invention further relates to a screening method for cell models adapted to specific FGFR inhibitors. 1) Detecting the expression levels of FGFR1OP2 protein in the cell model to be tested. 2) Determining the expression levels of the FGFR1OP2 protein. The method has the advantages of high sensitivity and accurate indication. It is adapted to the promotion and application of drugs.

Description

Screening methods for FGFR inhibitors

The present invention claims the priority of Chinese patent application 2020109548271 with an application date of September 11, 2020 and Chinese patent application 2021110457367 with an application date of September 7, 2021. The present invention cites the full text of the above Chinese patent application.

The invention belongs to the field of biomedicine, and particularly relates to a screening method for an FGFR inhibitor.

The FGFR1OP2 protein is mainly expressed in the cytoplasm, and the function of FGFR1OP2 has been rarely studied so far. Currently, the main reports are that FGFR1OP2-FGFR1 fusion may be involved in EMS (myeloproliferative syndrome) (Grand et al., 2004) and FGFR1OP2-FGFR1 fusion can induce myeloid leukemia (Qin et al., 2015). FGFR1OP2 may be involved in the FGFR1 signaling pathway.

FGFR1 is a transmembrane protein. The FGFR signaling pathway receives signals through the extracellular segment and activates the TK domain by autophosphorylation. Tyrosine kinase affects downstream important proteins, including PTPN11, SOS, FRS2, etc. It is involved in JAK/STAT, PI3k/ATK /mTOR, RAS/RAF/MAPK and other signaling pathways. (Brewer, et al., 2016) JM is an important regulatory region of FGFR1 protein, and some other TKIs or GPCRs bind to the JM region through adapters and are involved in regulating the autoactivation of FGFR1. Inhibitors targeting FGFRs have the potential to treat related diseases, and more and more research institutions and pharmaceutical companies regard them as promising therapeutic targets. FGFRs inhibitors have become one of the hotspots in targeted drug research. However, the overall response rate of FGFR inhibitors is low, and there are no obvious useful biomarkers to indicate their efficacy and screen suitable patients. At present, the effective biomarker is FGFR2 fusion, and the proportion of these fusions in tumorigenesis is low, which is not suitable for the promotion and application of drugs.

Therefore, a new biomarker is urgently needed to indicate FGFR efficacy or to screen suitable patients.

In order to overcome the defects in the prior art, the present invention provides a screening method for FGFR inhibitors.

To achieve the above object, the present invention provides the following technical solutions:

One of the technical solutions of the present invention is to provide a screening method for an FGFR inhibitor, comprising the following steps:

(1) respectively administering the FGFR inhibitor to be detected to cell lines with different FGFR1OP2 protein expression levels, and testing the efficacy of the FGFR inhibitor to be detected;

(2) To determine the correlation between the efficacy of the FGFR inhibitor to be tested on different cell lines and the expression levels of FGFR1OP2 proteins in different cell lines.

Wherein, the different cell lines described in step (1) are preferably the same cell line, so as to facilitate parallel comparison. For example, all other cells are in the same state, but only the KATOIII cell lines with different expression levels of FGFR1OP2 protein.

In step (2): if the drug effect is positively correlated with the expression level of FGFR1OP2 protein, the FGFR inhibitor to be detected is an effective FGFR inhibitor.

The efficacy (ie: the efficacy of the inhibitor) described in the present invention can be conventional in the art, and is usually expressed as IC50, EC50, ED50, pIC50, Ki, Kd and Score. The specific explanation is as follows.

EC50 value: The concentration at which the drug achieves 50% of its maximum clinical efficacy (which can be inhibition or stimulation). This is a medicinal term.

ED50 value: The effective dose (rather than the concentration) of a drug at which 50% of individuals exhibit a specific effect.

IC50 value: The concentration of inhibitor at which 50% inhibitory effect is achieved.

pIC50 value: negative logarithm of 10 of the IC50 value.

Ki value: concentration of inhibitor (calculated using Michaelis-Menten kinetics) at which 50% inhibition is detected.

Kd value: The equilibrium constant at which a complex of two or more biomolecules separates into components; eg, the pIC50 value when an inhibitor or substrate is separated from an enzyme.

Score value: refers to the score of docking, which evaluates the binding affinity between small molecules and proteins or between proteins and proteins. S is generally a negative value. The larger the absolute value, the stronger the binding affinity and the higher the activity of the small molecule or protein.

The present invention preferably uses IC50 to characterize the efficacy of the FGFR inhibitor to be tested.

Preferably, the cell line is derived from a solid tumor patient or a leukemia patient's cell line.

The present invention focuses on studying the effect of FGFR1OP2 protein expression on the efficacy of inhibitors in cell lines, so the cell lines refer to cell lines derived from other variables that have been excluded. For example, KATOIII, KG1, NCIH716, SKNO1, SKNO1, SUPB15, OPM2, BDCM, NCIH2009, HGC27, MFE296, NCIH1703, REH, G401, G292CLONEA141B1, NCIH1703, AN3CA, A375, HCT116, NCIH460, MFE280, L1, ALD498, NCIH , SNU423, NUGC3, HCC1954, BGC823, CAPAN1, CAMA1, SNU449, MKN7.

Regarding the result judgment of the above-mentioned screening method, in a specific embodiment of the present invention:

When the first cell line has a lower expression level of FGFR1OP2 protein and a higher IC50 value compared with the second cell line, it indicates that the FGFR inhibitor to be detected is effective.

The second technical solution of the present invention is to provide a screening method for a cell model of a specific FGFR inhibitor, comprising the following steps:

(1) Detect the expression of FGFR1OP2 protein in the cell model to be tested;

(2) Judging the level (numerical value) of the expression level of the FGFR1OP2 protein.

In a specific embodiment of the present invention, based on the value of the protein expression level in step (2), a cell model in which the FGFR1OP2 protein expression level is higher than the general level is selected for a specific FGFR inhibitor.

Preferably, the cell model is a cell line derived from a solid tumor patient or a leukemia patient.

In the present invention, the detection method can be conventional in the field, such as qPCR detection. When using qPCR for detection, the nucleotide sequence of the forward primer used is shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2; or the nucleotide sequence of the forward primer The sequence is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 4.

The third technical solution of the present invention is to provide an application of a reagent for determining the expression level of FGFR1OP2 in screening FGFR inhibitors or screening cell models suitable for specific FGFR inhibitors.

The method for determining the expression level of FGFR1OP2 can be routine in the art, for example, it can include wafers (protein wafers and microfluidic wafers, etc.), digital single-molecule immunoarray, ELISA, radioimmunoassay, immunoturbidimetry, immunohistochemistry method, Western blotting, etc., as well as other known methods that can be based on the use of antibodies.

Wherein, the "cell line" in the above technical scheme includes clinically derived cell samples; the "cell model" includes cells from all sources such as cell lines, cell lines, clinical samples, etc. The cell model in the present invention mainly refers to It is a cell model for drug screening.

The positive progressive effect of the present invention is:

The present invention uses FGFR1OP2 expression amount as a biomarker to indicate drug efficacy or to screen suitable patients, has the advantages of accurate indication, high sensitivity and good overall response rate, and is suitable for drug promotion and application.

The present invention is further described below by way of examples, but the present invention is not limited to the scope of the described examples. The experimental methods that do not specify specific conditions in the following examples are selected according to conventional methods and conditions, or according to the product description. The reagents and raw materials used in the present invention that are not otherwise specified are commercially available.

experimental method

1 Experimental sample preparation

Name: MAX-40279-01, its chemical composition is N-[7-(4-fluoro-2-methoxyphenyl)-6-methylthieno[3,2-d]pyrimidin-2-yl] -1-(Piperidin-4-yl)-1H-pyrazol-4-amine fumarate. Its chemical structural formula:

The molecular weight is 496.56.

Physical properties: powder Storage conditions: 2-8℃

Carrier solution: 1% PVP K90-0.1% Tween 80 in water

Preparation method: weigh 1000 mg of PVP K90 into 1000 mL of pure water, add 0.1 mL of Tween 80 at the same time, put the carrier solution on a magnetic stirrer, and stir until it becomes clear. Stir at 300 rpm for 30 minutes, add MAX-40279-01 to 1% PVP K90-0.1% Tween 80 aqueous solution, store at 2-8°C, and stir again at 300 rpm for 30 minutes before use.

2 FGFR1OP2 detection method:

RNA-seq sequencing; threshold was TPM=9.

Probe method qPCR detection. In the dye-based qPCR detection, with GAPDH as the control, the expression of FGFR1OP2 was 0.016 times greater than that of GAPAH. The primer sequences are shown in Table 1 below. Table 1 Introductory name primer sequence Product length (bp) FGFR1OP2-F (SEQ ID NO: 1) AGCGAGTAGAAGCCATGAAACA 91 FGFR1OP2-R1 (SEQ ID NO: 2) CCCATAACTAACGTGGACCGT FGFR1OP2-F2 (SEQ ID NO: 3) GCGAGTAGAAGCCATGAAAC 101 FGFR1OP2-R2 (SEQ ID NO: 4) CTTGCTGGATTCCCATAACTAAC ACTB-F (SEQ ID NO: 5) CAGCAGATGTGGATCAGCAAG 66 ACTB-R (SEQ ID NO: 6) GCATTTGCGGTGGACGAT GAPDH-F (SEQ ID NO: 7) ATTCCACCCATGGCAAATTC 74 GAPDH-R (SEQ ID NO: 8) GATGGGATTTCCATTGATGACA

2.1 Experimental samples The cDNA sample was diluted 10 times as a template for on-board detection.

2.2 Real-time quantitative PCR test materials and instruments Quantitative PCR reagent: 2X SG Fast qPCR Master Mix (B639271, BBI). Quantitative PCR instrument: LightCycler 480 type II fluorescence quantitative PCR instrument (Roche, Rotkreuz, Switzerland).

2.3 PCR reaction steps Preparation of reaction mixture Table 2 reagent concentration Volume (µl) SybrGreen qPCR Master Mix 2X 10 Primer F (10 µM) 10 µM 0.4 Primer R (10 µM) 10 µM 0.4 Ultra-pure water 7.2 Template (cDNA) 2 Total 20

1) PCR cycle conditions Table 3 equipment name time and temperature melt curve initial 45 loops According to the instrument instructions transsexual Annealing/Extension LightCycler480 II each cycle 3 min 95℃ 5 s 95℃ 30s 60℃

2) Operation of the instrument

After completing the above steps, the 96/384-well plate loaded with samples was placed in a LightCycler480 II (Roche) for the reaction.

3 cell line experiments:

The compound MAX-40279-01 was determined on various cell lines using the CellTiter-Glo assay (this method is based on detecting the content of ATP in living cells during cell proliferation, which has the advantages of good sensitivity and convenient testing) Inhibitory activity on cell proliferation.

a. Prepare complete medium (usually basal medium plus fetal bovine serum plus double antibody, individual special medium needs to add corresponding supplementary factors), and mix well.

b. Resuscitate the cells, pass them for about two generations, and select a cell line with a good growth state.

c. Take the cell culture flask out of the incubator (Thermo 3111), and check the cell name, medium type and cell number marked on the flask.

d. Adherent cells: Aspirate the medium, wash with trypsin, discard the waste liquid, add 3ml of fresh trypsin to the culture flask to digest. When the cells are loosened and detached from the bottle wall, add 8 ml of complete medium to stop trypsinization, and mix gently. Transfer the cell suspension into a centrifuge tube with a pipette and centrifuge at 800-1000 rpm for 3-5 minutes.

e. Suspended cells: transfer the cell suspension into a centrifuge tube with a pipette and centrifuge at 800-1000 rpm for 3-5 minutes.

f. Aspirate the cell supernatant in the centrifuge tube.

g. Add an appropriate volume of medium to the centrifuge tube and gently pipet to resuspend the cells evenly.

h. Counted using a Vi-Cell XR cell counter (Backman).

i. Adjust the cell suspension to an appropriate concentration.

j. Add the cell suspension to a 96-well plate with white bottom, 100 μl/well. Label details such as cell name, seed plate density, date, etc., and place the plate in a CO ₂ incubator overnight.

k. Compounds were formulated as 2 mM stock solutions in DMSO.

1. Take 2 mM as the highest concentration, and dilute 3-fold stepwise with DMSO to obtain 10 concentration gradient compounds.

m.STS was used as a positive control drug. With 0.4 mM as the highest concentration, 3-fold dilution with DMSO was performed to obtain 10 concentration gradient compounds.

n. Pipette 0.5 [mu]l from the corresponding compound plate to the overnight culture plate.

o. Incubate for 72 hours in a 37°C incubator.

p. After 72 hours of compound treatment, the cell morphology was observed under an inverted microscope (DMILLED), and the cells in the DMSO control wells were in normal growth state, and no contamination was observed.

q. Allow the cell culture plate to equilibrate at room temperature for 30 minutes.

r. Preparation of CellTiter Glo assay detection reagent: Dissolve the CellTiter Glo Buffer in the CellTiter Glo assay kit in a water bath in advance, add it to the CellTiter Glo Substrate, mix evenly, and let it stand.

s. Add 100 μl/well of CellTiter Glo assay reagent to the culture plate.

t. Mix on a shaker for 2 minutes to induce cell lysis.

u. Place the 96-well plate at room temperature for 10 minutes to stabilize the luminescence signal.

v. Paste the white bottom film on the bottom of the culture plate and use EnSpire (PE) to measure the plate.

w. Record the experimental results obtained from the analysis.

x.XLfit software: Fit model: Dose response one site/ f(x)205[fit=(A+((B-A)/(1+((C/x)^D))))]

y. Inhibition rate calculation formula: Inhibition%=[1-(T72 _sample -T72 _blank )/(T72 _DMSO - T72 _blank )]×100%. After 72 hours of drug and cell action, T72 _sample , T72 _blank and T72 _DMSO were respectively Refers to the reading value of the dosing well, the reading value of the blank control and the reading value of the 0.5% DMSO negative control.

4 Experimental methods of MiniPDX:

laboratory animal

BALB/c-nude mice are purchased from domestic companies with qualifications for the breeding and sales of experimental animals, and are generally 5-6 weeks old. Mice were kept in SPF laboratory animal center. Before the formal experiment, the animals were firstly reared adaptively for 3 days.

Environmental Conditions of Laboratory Animal Breeding Room

The experimental animals were kept in experimental animal centers that have passed the AAALAC international certification. The experimental animal center has an independent ventilation system, the temperature of the rearing room is 24.0-27.0 ℃, the relative humidity is 40-60%, the ventilation frequency is 10-20 times/hour, and the light and dark alternating time of day and night is 12h/12h; continuous supply of cobalt 60 radiation sterilized mice with full price Granules, unlimited free intake; continuous supply of high-pressure steam sterilized drinking water, free intake of water.

Experimental observation

During the whole experiment, the use and observation of experimental animals were carried out in accordance with the relevant regulations of AAALAC animal use and management. After the experimental animals were inoculated with tumor cells, according to the routine experimental procedure, the experimental mice were observed daily, and the behavior, food intake, water intake, body weight, hair gloss and other abnormal conditions of the mice were recorded and monitored.

Example 1 Cytological detection

The IC50 of MAX-40279-01 is low in cell lines with high FGFR1OP2 expression.

The activity of MAX-40279-01 in 33 cells (purchased from ATCC), and the performance of FGFR1OP2 (RNA-sequencing data, TPM) were tested. form below. When the IC50 value is greater than 0.1 μM, the drug is ineffective to cells, and vice versa. The results showed that cells with high expression of FGFR1OP2 corresponded to low IC50 values, indicating that the drug was effective on cells. See Table 4 and Figure 1. Table 4 Name AbsIC50(μM) FGFR1OP2 KATOIII 0.005 3.613337598 KG1 0.006 5.030047587 NCIH716 0.012 3.702227547 KASUMI6 0.022 3.986885456 SKNO1 0.024 4.508990388 SUPB15 0.032 4.367407552 OPM2 0.038 4.06962431 BDCM 0.039 3.757764971 NCIH2009 0.044 4.266025864 HGC27 0.055 3.326853242 MFE296 0.061 3.769260478 NCIH1703 0.061 4.47737273 REH 0.061 3.498917361 G401 0.071 3.74754888 G292CLONEA141B1 0.075 3.787424552 NCIH1703 0.076 4.477372773 AN3CA 0.081 3.306633865 A375 0.095 3.706112867 HCT116 0.096 3.880019907 NCIH460 0.11 2.296113688 MFE280 0.263 2.550651448 DLD1 0.267 0 NCIH1975 0.297 2.925180621 LP1 0.384 2.999522153 A498 0.446 2.493087908 SNU423 0.515 2.691638957 NUGC3 0.622 2.25622784 HCC1954 0.929 2.011589669 BGC823 1.076 0 CAPAN1 1.225 2.952059303 CAMA1 1.312 2.605143423 SNU449 1.339 2.975725368 MKN7 1.983 2.907307421

Example 2 mini-PDX model

1. Immerse the patient's surgical sample in a culture bottle containing RPMI-1640 medium (serum-free) and send it to the laboratory immediately.

2. Use sterilized ophthalmic scissors to remove the visible non-tumor tissue and tumor necrosis tissue, wet the tumor tissue with a little RPMI-1640 medium (serum-free) and cut it into pieces as soon as possible. In a 50ml centrifuge tube, add 10-15ml of collagenase solution (Sigma) (collagenase 4 is dissolved in D-hanks, the final concentration is 1mg/ml, filter sterilized), and incubate in a 37°C water bath for 1 hour . After 1 hour, take out a 50ml centrifuge tube, dilute it with serum-free 1640 medium, repeat pipetting, filter the cell suspension with a sterilized 70-mesh filter, and centrifuge at 1200 rpm for 8 minutes, remove the supernatant, take 20ml of RPMI-1640 medium (serum-free) to suspend the precipitated cells (which contain lymphocytes, fibroblasts, stromal cells and tumor necrosis cells), and mix gently, repeat 2 ~3 times, the tumor tissue cell suspension can be obtained.

3. Resuspend the cells, adjust the cell concentration, and fill them into the MiniPDX experimental device. The special pore size of these dedicated MiniPDX devices allows free entry and exit of small molecule drugs, macromolecular antibody drugs and various growth factors below 500KD, while tumor cells remain in the device. Mice were inoculated subcutaneously with the MiniPDX device and dosing started on the day of inoculation. The administration method of the medication group was: 12mpk, PO, BID*7 (PO: oral BID: 2 times a day), and the control group was not administered.

4. The test continued for 7 days. After the end of the test, the MiniPDX device was taken out, and the ATPase activity in tumor tissue cells was tested by ATPase Kinetic ELIPA Assay Kit (Cat#BK051, product of cytoskeleton.Inc) After different dosing regimens were detected. cell viability.

5. The calculation method of the proliferation inhibition rate TCGI(%) is: [1-(T7-T0)/(C7-C0)]×100% (T is the medication group, C is the control group, and T7 and C7 represent the Vitality value, C0, T0 are the activity value before medication, C0=T0). There were 6 MiniPDX experimental devices in each of the medication group and the control group. Two-way ANOVA was used for P value statistics. The effectiveness of various dosing regimens was assessed based on changes in the rate of proliferation inhibition.

6. The medication group and the control group were weighed every day, and the data was valid if there was no obvious weight change and difference between the control group and the medication group.

7. Two additional cells in the MiniPDX experimental device of the unmedicated group were taken for RNA detection. The performance of FGFR1OP2 was detected by the following steps:

(1) Nanodrop8000 was used to identify the concentration of Total RNA, and Agilent 2100 was used to identify the integrity of Total RNA.

(2) Illumina RNA library building kit was used to build the library and sequenced on Hiseq X ten, and the expression of FGFR1OP2 was detected by quantitative PCR.

31 tumor patient-derived samples, including 10 brain cancer, 8 pancreatic cancer, 3 bile duct cancer, 1 bile duct cancer, 1 colon cancer, 1 duodenal cancer, 2 gastric cancer, 3 liver cancer, 1 For germ cell carcinoma and 2 rhabdoid tumors, pharmacodynamic results were obtained by MiniPDX, and MiniPDX drug susceptibility was tested using the method described in step 2. At the same time, the gene expression status was obtained by the method described in step 7. The results are shown in Figures 2 and 3. The tumor cells derived from patients with high expression of FGFR1OP2 had a good inhibitory effect of MAX-40279-01.

Example 3 Detection of FGFR1OP2 in clinical samples

1. Detection of FGFR1OP2 in leukemia patients

(1) Use a PAXgene blood RNA tube to collect 2.5 mL of whole blood from the patient, and invert it gently 8-10 times to ensure that the protective agent and blood in the tube are well mixed. After 1 to 4 hours at room temperature, after 24 hours at -20°C, long-term storage at -70°C. Alternatively, store at -20°C until shipping on dry ice.

(2) Refer to the instruction manual for RNA extraction using PAX Blood RNA Kit.

(3) Total RNA concentration was identified by Nanodrop8000, and Total RNA integrity was identified by Agilent 2100.

(4) The library was constructed using the illumina RNA library construction kit and sequenced on HiseqXten.

(5) The RNA in 3 was used for detection by quantitative PCR to determine the expression of FGFR1OP2.

2. Detection of FGFR1OP2 in patients with solid tumors

(1) About 5 white sheets of 3-5 micron paraffin thin slices are required, at least 2 sheets. The size of the tissue should be about 5mm*5mm, and it should be attached to the anti-detachment glass slide (glass slide) to avoid delamination.

(2) The selection principle of paraffin section is to try to select the lesion tissue, the margin of the lesion, or the tissue wax block at the junction of the lesion and the normal tissue, and try to avoid the tissue with more blood clots, calcification and fat; the proportion of tumor cells is greater than 20%, and the proportion of necrotic cells is less than 5%.

(3) In order to prevent the paraffin slides from being damaged or rubbing against each other, all paraffin slides should be placed in the slide box.

(4) RNA extraction was performed on the white slices in the paraffin section by FFPE RNA extraction kit (thermo).

(5) Total RNA concentration was identified by Nanodrop8000, and Total RNA integrity was identified by Agilent 2100.

(6) The library was constructed using the illumina RNA library construction kit and sequenced on HiseqXten.

(7) The RNA in 4 was used for detection by quantitative PCR to determine the expression of FGFR1OP2.

Example 4 Clinical experiment

Preliminary clinical trials have shown that patients with high FGFR1OP2 expression benefit from the efficacy of MAX-40279-01. table 5 cancer Numbering FGFR1OP2 dose group Effect AML 001-1001 8.29 20mg/d PD AML 001-3003 4.67 70mg/d PD AML 004-1002 34.61 20mg/d SD AML 004-2002 41.84 40mg/d SD AML 004-2004 34.97 40mg/d SD AML 004-3004 10.31 70mg/d SD Esophageal cancer Solid01001 7.17 40mg/d PD Vulvar cancer Solid01002 32.15 40mg/d SD

Example 5 Molecular Simulation

Since there is currently no available crystal structure of FGFR1OP2, we performed a sequence alignment and template search in the crystal structure protein database in MOE 2019.0101 based on its sequence. We modeled 10 models through the Homology model module, and used the Amber10:EHT force field to optimize the models, and selected the best structure for superposition analysis. The crystal structure of FGFR1 was obtained from the PDB database.

First, the MOE site finder function was used to search for the potential active pockets of the three crystal structures; then FGFR1OP2 docked the three active pockets (JM region and two TK regions) respectively. The docking is performed under the Protein-Protein docking method of the MOE Dock module. Using the prepared FGFR1OP2 and FGFR1 as the Receptor, the entire FGFR1 as the site, FGFR1OP2 as the ligand, and the entire structure as the ligand site, the hydrophobic patch potential was used to fit the GBVI/WSA dG score, and the structure was optimized in the rigid docking of the Rigid Body. , Pre-Placement outputs 10000 conformations, Placement outputs 1000 conformations, and finally inputs 100 Refinement conformations. Through Browse analysis of 100 output conformations, combined and scored, the conformation that FGFR1OP2 and FGFR1 are bound to be stable was finally selected for interaction analysis. Use the Protein contacts function to search for interactions in bound conformations, including hydrogen bonds, ionic bonds, π-π or H-π, van der Waals interactions, and more. Similar docking searches and scoring were then performed using the FGFR1OP2-FGFR1 complex as the site; the small molecule as the ligand, and interactions in the bound conformation were searched. Through protein simulation and molecular docking, the mechanism was analyzed. FGFR1OP2 can bind to MAX-40279-01. FGFR1OP2 and MAX-40279-01 jointly bind to the juxtamembrane (JM) region of FGFR1 protein, which together inhibit the FGFR1 signaling pathway. Enhanced inhibition of FGFR1 by MAX-40279-01. In addition, AI is used to analyze the interaction between small molecules and proteins. Table 6 Score values of the interaction force between different small molecules and FGFR1-FGFR1OP2 Small molecule Score value Max-40279-01 -7.27 AZD4547 -6.21 pemigatinib -6.83 Erdafitinib -6.27 Infigratinib -6.86

Figure 4 shows the binding of FGFR1OP2 to the JM region of FGFR1, green is FGFR1OP2, and purple is the JM region of FGFR1.

Figure 5 shows that MAX-40279-01 inhibits the JM region of FGFR1 by means of the FGFR1OP2 protein, thereby mechanism of the FGFR1 signaling pathway. achieve tumor-inhibiting effect.

Figures 6 and 7 show the binding results of MAX-40279-01 with FGFR1-FGFR1OP2: there are three interactions, which are the strong hydrogen bond interaction with Leu417 and Gln426 of FGFR1, and the formation of H-π with Gln70 of FGFR1OP2. interaction.

Figures 8 and 9 show the results of binding of AZD4547 to FGFR1-FGFR1OP2: There is an H-π interaction between AZD4547 and Gln71 of FGFR1OP2.

Figures 10 and 11 show that pemigatinib does not have a relatively strong non-bond interaction with FGFR1-FGFR1OP2, and mainly interacts with van der Waals.

Figure 12 and Figure 13 show the binding results of Erdafitinib with FGFR1-FGFR1OP2: there are three interactions, which are H-π interaction with Leu417 of FGFR1, H-π interaction with Ser420, and H-π interaction with Ile69 of FGFR1OP2. pi interactions.

Figures 14 and 15 show the results of Infigratinib binding to FGFR1-FGFR1OP2: There is an H-π interaction between Infigratinib and Ser420 of FGFR1.

Summary: Compared with MAX-40279-01, Pemigatinib and Infigratinib are about 5 times worse in binding; AZD4547 and Erdafitnib are about 10 times worse.

Example 6 Testing of 4 candidate compounds against 6 cell lines by CellTiter Glo assay

Experimental steps:

1. Cell Seeding

1) Prepare complete medium: add FBS and appropriate additives according to the information sheet provided by the supplier. Mix gently.

2) Check the cell name and complete medium and passage number marked on the flask.

3) Use a vacuum pump to remove and discard the medium.

4) Briefly rinse the cell layer with 0.25% (w/v) Trypsin-0.038% (w/v) EDTA solution to remove all traces of trypsin inhibitor-containing serum.

5) Add 3.0 ml of Trypsin-EDTA solution to the flask, observe the cells under an inverted microscope until the cell layer is dispersed.

6) Add 9.0 ml of complete growth medium and gently pipette out the cells.

7) Transfer the cell suspension to a centrifuge tube and centrifuge at 1000 rpm for 5 minutes.

8) Discard the supernatant using a vacuum pump.

9) Add an appropriate volume of complete medium. Resuspend the cell pellet by gently pipetting.

10) Count the number of cells with Vi-cell XR and adjust the cells to the appropriate density.

11) Add 100 μL of cell suspension into a 96-well opaque-walled clear bottom plate according to the planned plate layout. Table 7 DLD-1 HCC1954 KG-1 NCI-H716 FGFR1OP2 (TPM) 0 2.925181 5.030048 3.702228 AZD4547(μM) 12.82 2.2863 0.01 0 Erdafitinib(μM) 2.9 9.09 0 0 Infigratinib(μM) 2.22 4.04 0 0 Pemigatinib (μM) 1.36 15.28 0 0

The data in the above table further suggest that the expression of FGFR1OP2 can be used to determine the effectiveness of other FGFR inhibitors.

Figure 1 shows the relationship between the efficacy of FGFR inhibitors on different cell lines and their FGFR1OP2 expression levels. Figure 2 shows the FGFR1OP2 expression results of different samples in the PDX model. The relationship between the efficacy of FGFR inhibitors on different cell samples and their FGFR1OP2 expression in the 3-position PDX model. Figure 4 is a molecular simulation of the binding of cellular FGFR1OP2 to the JM region of FGFR1. Figure 5 is a molecular simulation of the inhibition of the JM region of FGFR1 by FGFR inhibitors via the FGFR1OP2 protein. Figure 6 shows the binding mode of MAX-40279-01-FGFR1-FGFR1OP2. Figure 7 shows the MAX-40279-01-FGFR1-FGFR1OP2 interaction. Figure 8 is the AZD4547-FGFR1-FGFR1OP2 binding mode. Figure 9 is an AZD4547-FGFR1-FGFR1OP2 interaction. Figure 10 is a pemigatinib-FGFR1-FGFR1OP2 binding mode. Figure 11 is a pemigatinib-FGFR1-FGFR1OP2 interaction. Figure 12 is the binding mode of Erdafitinib-FGFR1-FGFR1OP2. Figure 13. Erdafitinib-FGFR1-FGFR1OP2 interaction. Figure 14. Infigratinib-FGFR1-FGFR1OP2 binding mode. Figure 15. Infigratinib-FGFR1-FGFR1OP2 interaction.

Claims (9)

A screening method for FGFR inhibitors, wherein, it comprises the following steps: (1) respectively administering the FGFR inhibitor to be detected to cell lines with different FGFR1OP2 protein expression levels, and testing the efficacy of the FGFR inhibitor to be detected; (2) To determine the correlation between the efficacy of different cell lines and the expression of FGFR1OP2 protein between different cell lines. The screening method according to claim 1, wherein, in step (2): if the drug effect is positively correlated with the expression level of FGFR1OP2 protein, the FGFR inhibitor to be detected is an effective FGFR inhibitor. The screening method according to claim 1, wherein the drug effect is reflected in the IC50 value of the FGFR inhibitor to be detected; And/or, the cell line is KATOIII, KG1, NCIH716, SKNO1, SKNO1, SUPB15, OPM2, BDCM, NCIH2009, HGC27, MFE296, NCIH1703, REH, G401, G292CLONEA141B1, NCIH1703, AN3CA, A375, HCT116, NCIH460, MFE280 , DLD1, NCIH1975, LP1, A498, SNU423, NUGC3, HCC1954, BGC823, CAPAN1, CAMA1, SNU449, or MKN7. The screening method according to any one of claims 1 to 3, wherein the cell line is derived from a solid tumor patient or a leukemia patient's cell line. A screening method suitable for a cell model of a specific FGFR inhibitor, wherein, it comprises the following steps: (1) Detect the expression of FGFR1OP2 protein in the cell model to be tested; (2) Determine the value of the expression level of the FGFR1OP2 protein. The screening method of claim 5, wherein, based on the value of the protein expression level in step (2), a cell model in which the FGFR1OP2 protein expression level is higher than the general level is selected for the specific FGFR inhibitor. The screening method according to claim 6, wherein the cell model is a cell line derived from a solid tumor patient or a leukemia patient; And/or, the detection method is qPCR detection. The screening method according to claim 7, wherein the nucleotide sequence of the forward primer detected by the qPCR is as shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO: 2 or the nucleotide sequence of the forward primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 4. Application of a reagent for determining the expression level of FGFR1OP2 in screening FGFR inhibitors or screening cell models suitable for specific FGFR inhibitors.

Images