TW202112245A - Method for bioconversion of mogroside extracts into siamenoside i - Google Patents

Abstract

The present invention provides a method for bioconversion of mogroside extracts into siamenoside I, comprising: using (1) DbExg1 protein or (2) a microorganism expressing the DbExg1 protein to contact or to cultivate with the mogroside extracts. The present invention can convert the mogroside extracts into siamenoside I, which has a higher sweetening power and better taste than other mogrosides. The method of the present invention uses a microorganism expressing the responsible enzyme, DbExg1, which was identified as a mediator of mogroside V conversion into siamenoside I in the present invention, so that siamenoside I was preferentially produced. Thus, the use of the method of the present invention provides a feasible approach to produce large quantities of the natural sweetener, siamenoside I, which can then be applied in several industries.

Description

Method for biologically converting mogroside saponins extract into siamenoside I

The present invention relates to a biotransformation method of mogroside saponins extract. More specifically, the present invention relates to a method for biologically converting mogroside extracts into siamenoside I.

In the past few decades, due to concerns about the long-term consumption of artificial sweeteners (NAS) as sugar substitutes, the global demand for natural sweeteners has increased substantially. So far, the US Food and Drug Administration has only approved two high-sweetness natural sweeteners, including purified steviol glycosides (from the leaves of Stevia rebaudiana ) and mogroside extracts (from the fruit of Siraitia grosvenorii) .

Mogroside is composed of triterpenoid aglycone (mogrol), which has different numbers of attached glucose molecules. The sweetness of mogroside can be determined by the number and location of glucose moieties. For example, Mogroside V contains five glucose moieties in its molecular structure, and its sweetness is 392 times that of 5% sucrose in water. In addition, siamenoside I and mogroside IV each have four glucose parts, but the positions are different, and the sweetness is 563 and 465 times that of 5% sucrose aqueous solution, respectively. On the other hand, Mogroside III E has three glucose moieties, and its sweetness is low. Simenoside I is indeed the mogroside with the highest sweetness currently considered. In addition, it is reported that the taste of siamenoside I is more popular than mogroside IV and V. However, the content of siamenoside I in the natural mogroside extract is limited. because Therefore, methods such as separation, purification or concentration are conducive to the production of high-concentration natural siamenoside I. There have been many attempts to convert mogroside V into siamenoside I, including chemical hydrolysis, enzyme treatment and microbial fermentation. Unfortunately, the complexity of the glucose branched side chain in mogroside makes the production or isolation of pure siamenoside I extremely challenging.

Exg1p in Saccharomyces cerevisiae is a glycoside hydrolase family 5 (GH5) enzyme, which is known to hydrolyze the O-β-D-glycosidic bond at the non-reducing end of the polymer chain to release glucose. It has been found that the substrates of Exg1p include flavonoid glucosides, such as naringenin 7-O-β-glucopyranoside and luteolin-7-O. -Glucoside (luteolin 7-O-glucoside), and it has been determined that Exg1p is the main exo-(1,3)-β-glucanase (exo-(1,3)-β-glucanase involved in initiating the biotransformation of mogroside saponins). ). During the fermentation process, Exg1p hydrolyzes mogroside V to produce a mixture of siamenoside I and mogroside IV intermediate products, of which mogroside IV is the main product. In wild-type S. cerevisiae , Mogroside III E is finally produced as the final product.

According to reports, there are 62 different enzymes in the biotransformation of mogrosides, of which only β-galactosidase from Aspergillus oryzae (Sigma company G5160 reagent) and polydextrose from Penicillium sp. Enzyme (DEXC reagent from Worthington, USA) can concentrate siamenoside I in mogroside saponins extract. It is reported that when the extract is treated with specific microbial enzymes at 37°C and pH 5 for 7 hours or 37°C and pH 6 for 24 hours, the concentration can reach up to 44% of all mogrosides. % And 31%. However, these enzymes may eventually convert mogroside V into mogroside III E or other mogrosides as the final product. Another study pointed out that Mogroside V can produce non-specific stereoisomeric mixtures of Mogroside and other by-products through acid or alkali treatment, which is an undesirable situation and shows a low yield.

Because the fifth family of glycoside hydrolases (GH5) is widely distributed in bacteria and fungi, it has a wide range of sequence diversity and protein specificity. There is a need in the art to find enzymes similar to Exg1 from bacteria or yeasts, which can specifically produce saimenoside I from mogroside extracts.

Therefore, the main purpose of the present invention is to provide a method for bioconversion of mogroside saponins extract into siamenoside I, including: using (1) Db Exg1 protein or (2) contacting or cultivating mogroside saponins extraction with a microorganism expressing Db Exg1 protein Things.

Further, the mogroside extract is mogroside V.

Furthermore, the microorganism is brechleromyces ( Dekkera bruxellensis ).

Further, the microorganism is a yeast, which contains a vector carrying the DbExg1 gene or a modification with a natural DbExg1 gene promoter.

Further, the yeast strain is Saccharomyces cerevisiae (Saccharomyces cerevisiae) lacking Exg1.

Further, the Db Exg1 protein is a recombinant Db Exg1 protein.

Further, the biotransformation is performed at a pH value of 3.0 to 7.0.

Further, the biotransformation is performed at a pH value of 5.0 to 7.0.

Further, the biotransformation is carried out in a temperature range of 30°C to 60°C.

Further, the biotransformation is carried out at 50°C to 60°C.

As mentioned above, the present invention has the following advantages compared with the conventional technology:

1. The method of the present invention converts the mogroside saponins extract into siamenoside I which has higher sweetness and better taste than other mogrosides.

2. The present invention uses microorganisms expressing Db Exg1 enzyme, which act as a medium for the conversion of mogroside V into siamenoside I in the present invention to preferentially produce siamenoside I.

Therefore, the method of the present invention provides a feasible method for producing a large amount of natural sweetener ─ siamenoside I, so that siamenoside I can be applied to various industries, such as the beverage or baking industry.

Figure 1 is a HPLC-MS chromatogram of mogrosides, showing the analysis of mogrosides after biotransformation by different yeast strains for 4 days. (A) Unfermented mogroside extract (B) Saccharomyces cerevisiae las21Δ mutant ( S.cerevisiae las21Δ mutant) (C) Saccharomyces cerevisiae ( S.cerevisiae Meyen ex Hansen EC) (D) Kluyveromyces marxianus ( Kluyveromyces marxianus (EC Hansen) van der Walt) (E) Saccharomyces pastorianus (F) Candida kefyr (Beijerinck) van uden and Buckley) (G) High protein Candida ( Candida utilis ) (H) Yarrowia lipolytica (I) Debaryomyces hansenii (J) Dekkera bruxellensis . Peak 1: Mogroside V; Peak 2: Siammonin I; Peak 3: Mogroside IV; Peak 4: Mogroside III E. The arrow indicates the chemical structure of mogroside corresponding to the peak.

Figure 2 shows the cell growth of individual strains with or without 1% mogroside extract. (A) Saccharomyces cerevisiae ( S. cerevisiae ) (B) Debaryomyces hansenii (C) Yarrowia lipolytica (D) D. bruxellensis Grow in YPD or YM medium with or without 1% Mogroside extract; Mogroside extract is expressed as LHK (Lo Han Kuo). The cell growth at different time points was determined by measuring the optical density at 600 nm using a spectrophotometer. The data shown is the mean ± standard deviation of three independent experiments.

Figure 3 shows the characteristic analysis of recombinant Sc Exg1 and Db Exg1. Purify the recombinant enzyme, and determine the effects of pH (A and C) and temperature (B and D) on the stability and activity of recombinant Sc Exg1 (A and B) and Db Exg1 (C and D). The data shown is the mean ± standard deviation of three independent experiments.

Figure 4 shows the HPLC-MS/MS analysis of mogrosides bioconversion. (A) Biotransformation of mogroside extracts after induction of recombinant Db Exg1 expression during fermentation. (B) Purified recombinant Db Exg1 was used to transform pure mogroside V in a water bath at 45°C at pH 5.0 for 24 hours. (C) Standard mogroside saponins mixture. (D) Unfermented pure mogroside V. (E) The transformation of pure mogroside V by Debaryomyces hansenii (D.hansenii ) and (F) Y. lipolytica (Y. lipolytica). The yeast was inoculated into a medium containing 1% pure Mogroside V and fermented for 11 days. Peak 1: Mogroside V; Peak 2: Siammonin I; Peak 3: Mogroside IV; Peak 4: Mogroside III E.

The detailed description and technical content of the present invention will now be described in conjunction with the drawings as follows. Furthermore, the figures in the present invention are not necessarily drawn according to actual proportions for the convenience of description, and these figures and their proportions are not used to limit the scope of the present invention, and are described here first.

Unless otherwise defined, all scientific and technical terms used in this article have meanings generally understood by those skilled in the art. The following terms used throughout this application shall have the following meanings.

Unless otherwise stated, the term "or" includes "and/or". The term "include" or "include" used means that in addition to the described components, steps, operating instructions and/or elements, it does not exclude one or more other components, steps, operating instructions and/or the existence or additional elements. Similarly, "include" and "include" are interchangeable and are not restricted. The singular forms "a" and "the/above" used in this specification and the scope of the appended application include plural references unless the context clearly dictates otherwise. For example, the terms "a", "the", "one or more" and "at least one" are used interchangeably in this article.

The present invention relates to a method for biologically converting mogroside saponins extracts into siamenoside I, including: contacting or cultivating mogrosides extracts with (1) Db Exg1 protein or (2) microorganisms expressing Db Exg1 protein.

"Mogrosides" as used herein refers to the natural sweeteners of mogrosides that have been used as sugar substitutes on the table. In particular, Mogroside III E and Simenoside I are well known as sweeteners and flavor enhancers. Saimenoside I is a trace compound in Momordica grosvenori, and usually exists as an intermediate product of the metabolism of mogroside saponins during the fermentation process. In a preferred embodiment, the mogroside extract of the present invention is mogroside V.

Exg1 protein is the main exo-1,3-β-glucanase (exo-1,3-β-glucanase) in the cell wall of yeast. In a preferred embodiment, the microorganism is Dekkera bruxellensis (Dekkera bruxellensis). In a preferred embodiment, the microorganism is a yeast, which contains a vector carrying the DbExg1 gene or a modification with a natural DbExg1 gene promoter. In a preferred embodiment, the yeast strain Saccharomyces cerevisiae lacking Exg1 . In a preferred embodiment, the Db Exg1 protein is a recombinant Db Exg1 protein.

The biotransformation of the present invention can be carried out under a preferable condition, such as but not limited to a preferable pH value and/or temperature. In a preferred embodiment, the biotransformation is performed at a pH value of 3.0 to 7.0, such as pH 3.0 to 7.0, pH 3.0 to 6.5, pH 3.0 to 6.0, pH 3.0 to 5.5, pH 3.0 to 5.0, pH 3.0 to 4.5 , PH 3.0 to 4.0, pH 3.0 to 3.5, pH 3.5 to 7.0, pH 3.5 to 6.5, pH 3.5 to 6.0, pH 3.5 to 5.5, pH 3.5 to 5.0, pH 3.5 to 4.5, pH 3.5 to 4.0, pH 4.0 to 7.0 , PH 4.0 to 6.5, pH 4.0 to 6.0, pH 4.0 to 5.5, pH 4.0 to 5.0, pH 4.0 to 4.5, pH 4.5 to 7.0, pH 4.5 to 6.5, pH 4.5 to 6.0, pH 4.5 to 5.5, pH 4.5 to 5.0 , PH 5.0 to 7.0, pH 5.0 to 6.5, pH 5.0 to 6.0, pH 5.0 to 5.5, pH 5.5 to 7.0, pH 5.5 to 6.5, pH 5.5 to 6.0, pH 6.0 to 7.0, pH 6.0 to 6.5 Or pH 6.5 to 7.0. In a more preferred embodiment, the biotransformation is performed at a pH value of 5.0 to 7.0, such as pH 5.0, pH 5.1, pH 5.2, pH 5.3, pH 5.4, pH 5.5, pH 5.6, pH 5.7, pH 5.8, pH 5.9 , PH 6.0, pH 6.1, pH 6.2, pH 6.3, pH 6.4, pH 6.5, pH 6.6, pH 6.7, pH 6.8, pH 6.9, or pH 7.0. In a preferred embodiment, the biotransformation is carried out in a temperature range of 30°C to 60°C, such as 30 to 60°C, 30 to 55°C, 30 to 50°C, 30 to 45°C, 30 to 40°C, 30 to 35°C, 40 to 60°C, 40 to 55°C, 40 to 50°C, 40 to 45°C, 45 to 60°C, 45 to 55°C, 45 to 50°C, 50 to 60°C, 50 to 55°C or 55 to 60°C. In a more preferred embodiment, the biotransformation is performed at 50°C to 60°C, such as 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C Or 60°C.

The present invention is explained in more detail through the following exemplary embodiments. Although exemplary embodiments are disclosed herein, it should be understood that these embodiments are used to illustrate the present invention, but not to limit the scope of the present invention.

Example 1:

A. Experiment

(1) Screening the transformation of mogrosides

Eighteen yeast strains and 13 lactic acid bacteria (LABs) (Table 1) were obtained from the Biological Resources Conservation and Research Center of the Food Industry Development Institute (Hsinchu, Taiwan) (Table 1), which were used to screen the transformation of mogrosides. The mogroside extract containing 25.9% mixed mogrosides was purchased from Changsha Huirui Biotechnology Co., Ltd. (Hunan, China). The yeast or lactic acid bacteria were respectively placed in yeast extract-peptone-dextrose (YPD) (Difco, Sparks, Maryland, U.S.) or MRS (Man-Rogosa-Sharpe) (Difco, U.S. Sparks, Maryland) activated in the medium. A medium containing mogroside is prepared by dissolving 1% (w/v) mogroside extract in YPD or MRS medium. Place the yeast on a rotary shaker and conduct aerobic culture at 200 rpm at 25°C The lactic acid bacteria are cultured anaerobic at 37°C. The conversion of mogrosides was terminated by adding a volume of pure methanol to the medium, and the content of mogrosides was analyzed by HPLC-MS/MS.

Table 1: List of strains

(2) HPLC-MS/MS analysis of mogrosides

First, a solid phase extraction column (C-18, 500 mg/3 mL, Chrome Expert, Sacramento, California, USA) was used to purify an aliquot of the fermentation medium. Use 45% methanol to clean unbound impurities, and use pure methanol to extract mogroside. As mentioned in the previous study, collect the extracted part of mogroside saponins for HPLC-ESI-MS/MS (YMC Hydrosphere C18 analytical column, YMC Company, Kyoto, Japan; Thermo Finnigan brand LXQ model linear ion trap mass spectrometer, San Jose, California, USA) analysis with slight modification. Inject 10 μL of the prepared sample to analyze mogrosides. The following electron spray ionization (ESI) parameters were used: spray voltage -4.8kV, capillary temperature 400°C, atomizing gas 25 arb, auxiliary gas 8 arb, collision energy 20%, and isolation width 2.0 Da. The mass scanning range is 50 to 2000 m/z . Xcalibur 2.0.7 software (San Jose, California, USA) was used for data analysis. The main molecular ion of mogroside in the ESI/MS ⁿ spectrum is [M+Na] ⁺ ; in the collision-induced dissociation mode, the continuous glucose loss (-162 m/z ) is observed in fragmentation mode. According to the presence of ions with m/z values of 1309, 1147, 1147, and 985, respectively, [M+Na] ^{+ can identify mogroside V, simenoside I, mogroside IV and mogroside III E.}

(3) Molecular selection, expression and purification of recombinant protein

Cloning using the Gateway cloning system from Brettanomyces (Dekkera bruxellensis) Similarity Exg1 β- glucosidase (Exg1 -like β-glucosidase, DbExg1 ). In short, the coding region of DbExg1 is first amplified by PCR, the forward primer is 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGAAGTTTATTTTATTGTC -3' (SEQ ID NO: 1, underlined indicates the coding region of the gene), and the reverse primer is 5' -GGGGACCACTTTGTACAAGAAAGCTGGGTC GAAGCTACACTGGTTAGG -3' (SEQ ID NO: 2, underlined indicates the gene coding region). The genomic DNA extracted from D. bruxellensis was used as a template. The yeast expression vector (pYES-DEST52) was further introduced to produce galactose-inducible plastids with the correct DbExg1 sequence. The yeast is then amplified and converted to vector deleted Exg1 Saccharomyces cerevisiae (S.cerevisiae) (exg1Δ mutant), galactose for induction of the protein expression assay Db Exg1. The DbExg1 gene is also integrated into ( exg1Δ mutant) through the GPD promoter. In order to purify the protein, a 30kDa molecular weight cutoff (MWCO) ultrafiltration membrane (brand name Vivaspin 20, Singularity Co., Ltd., Taipei, Taiwan) was used to concentrate the medium. The extracellular protein concentrate was purified using Ni ^{2+ affinity chromatography.} The protein homogeneity in each traction was evaluated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and silver staining.

(4) β-glucosidase activity and conversion of mogroside V by recombinant Db Exg1

The optimal conditions for determining β-glucosidase activity. The optimal pH is obtained by monitoring the enzyme activity in a pH range (from pH 3 to pH 9) in the reaction buffer. Incubate at 60°C for 30 minutes. In order to analyze the stability of the enzyme, the same buffer system and pH range were used, but the reaction was carried out at 4°C for 1 hour. Measure the optimum temperature in 20 mM acetate buffer under the condition of pH 5 and temperature range of 20°C to 90°C. In order to analyze the temperature stability, after incubating in 20 mM acetate buffer (pH 5) for 1 hour, β-glucosidase was extracted and its activity was monitored. Add the newly purified recombinant Db Exg1 (recombinant Db Exg1, r Db Exg1) to 10mM p-nitrophenyl β-D-glucoside (pNPG), o-nitrophenol β-D- Glucoside (o-nitrophenol β-D-glucoside, oNPG) or original Mogroside V (final concentration 2mg/mL) in acetate buffer. Cultivate the mixture of enzyme and substrate under the optimal enzymatic reaction conditions at 60°C and pH 5. After glucosidase hydrolyzes glucose, the activity of β-glucosidase is determined by measuring the degree of p-nitrophenol (pNP) or o-nitrophenol (o-nitrophenol, oNP) released from pNPG or oNPG . Detect the released pNP or oNP at a wavelength of 405nm, and calibrate it with a standard curve. At a specific time point, the conversion of mogrosides was stopped by adding a volume of pure methanol. The converted product is then purified for HPLC-MS/MS analysis.

B. Results

(1) Screening the transformed strains of mogroside saponins

According to previous reports on glucosidase activity during isoflavone biotransformation, several microbial strains (18 yeasts and 13 lactic acid bacteria) were selected for the conversion test of mogrosides. The mogroside extract mainly containing mogroside V was used as the substrate for biotransformation (Figure 1A). Unexpectedly, none of the selected lactic acid bacteria showed mogroside biotransformation activity. Conversely, most yeast strains that may play a biological flavoring function can convert Mogroside V into a mixture of Mogroside IV, Simenoside I and Mogroside III E after 4 days of fermentation (Figures 1D to G); only solution Two yeast strains, Yarrowia lipolytica and Debaryomyces hansenii , did not show transformation activity (Figure 1H and I). Due to the excessive loss of Exg1 β-glucosidase and the effective conversion of mogrosides, S. cerevisiae ( las21Δ mutant) lacking LAS 21 can completely biotransform mogroside V into mogroside III E (Figure 1B) ). Saccharomyces cerevisiae ( S. cerevisiae Meyen ex Hansen EC) can also effectively convert mogroside V into mogroside III E after 4 days of fermentation (Figure 1C). Interestingly, only Brettanomyces ( D. bruxellensis ) significantly converted mogroside V to siamenoside I intermediate product (Figure 1J), without the significant increase in mogroside IV and mogroside III E.

(2) Brettanomyces ( D. bruxellensis ) uniquely produces siamenoside I

Previous studies have pointed out that the alpha-amylase and protease secreted by bacteria can be regulated by the growth stage and the utilization of nutrients. Therefore, we suspect that slow cell growth will lead to a decrease in the level of extracellular enzymes secreted in the fermentation medium, especially in Y. lipolytica (Y.lipolytica), D.hansenii ( D.hansenii ) and Brettanomyces ( D. bruxellensis ). Indeed, Debaryomyces hansenii ( D.hansenii ), Y. lipolytica (Y.lipolytica ) and Brettanomyces ( D.bruxellensis ) showed similar growth rates (Figure 2B to D). In YPD and YM media, whether with or without mogroside extract, their growth rate was significantly slower than that of S. cerevisiae Meyen ex Hansen EC (Figure 2A) and other S. cerevisiae ( S. cerevisiae) ) Growth rate of the strain (data not shown). However, the uniqueness of D. bruxellensis is that with the degradation of mogroside V, the content of siamenoside I steadily accumulates, while the content of mogroside IV and III E did not change significantly (Figure 1J). ). Therefore, our data do not exclude the Y. lipolytica yeast (Y.lipolytica) and Debaryomyces yeast (D.hansenii) low rate of biotransformation of mogroside is the cause in these cells β- Low efficiency of glucosidase or different substrate specificity.

Next, this example extends the fermentation time to maximize bioconversion. We compare the profiles of mogrosides with or without crude mogroside extracts fermented in the culture medium for 7 days (Table 2). The results showed that the las21Δ mutant with cell wall defects and releasing a large amount of Exg1p into the medium can completely convert mogroside V into mogroside III E (Table 2). Similarly, Saccharomyces cerevisiae ( S. cerevisiae Meyen ex Hansen EC) (data not shown) and S. pastorianus (S. pastorianus) also convert mogroside V into mogroside III E. However, after 7 days of fermentation, Kluyveromyces marxianus (EC Hansen) van der Walt, Candida kefyr (Beijerinck) van uden and Buckley and Candida high protein (Kluyveromyces marxianus (EC Hansen) van der Walt) Candida utilis ) can convert mogroside V into siamenoside I and mogroside III E (Table 2). Unexpectedly, after 7 days of fermentation, Y. lipolytica (Y.lipolytica), D.hansenii ( D.hansenii ) and Brettanomyces ( D.bruxellensis ) all showed poor performance. As a result of the transformation, a large amount of mogroside V and some mogroside IV remained in the medium (Table 2). Among the final fermentation products of D. bruxellensis , Mogroside IV (1.48±0.38%) and Mogroside III E (10.74±1.13%) accounted for the lowest percentages. Although Debaryomyces hansenii ( D.hansenii ) showed similar transformation conditions to that of D. bruxellensis , it was compared with the fermentation of crude mogroside saponins extract and D. bruxellensis. Medium, crude mogroside extract and Debaryomyces hansenii ( D.hansenii ) fermentation medium, the percentage of mogroside IV and III E in the fermentation medium increased significantly (Table 2). These results indicate that Debaryomyces hansenii ( D.hansenii ) may convert mogroside V in the mogroside extract into simenosin I and mogroside IV, which can explain the observed gradual progress of mogroside III E Cumulative phenomenon. On the contrary, D. bruxellensis seems to have a unique enzyme that can hydrolyze mogroside V into a better product, namely saimenoside I, rather than mogroside IV; therefore, mogroside IV and mogroside The total percentage of saponin III E (approximately 12% of all mogrosides) is similar to the total percentage of mogroside IV and mogroside III E in the mogroside extract.

Table 2: After 7 days of biotransformation of crude mogroside extracts by different yeasts

(3) The characteristics of Exg1p of Brettanomyces (D. bruxellensis)

Because it is known that mogroside is hydrolyzed by Exg1p ( Sc Exg1) of S. cerevisiae , we assume that D. bruxellensis is similar to Exg1 glucan-β-glucosidase (that is Db Exg1) may be responsible for the observed conversion of mogrosides. To test this hypothesis, Db Exg1 was cloned using a galactose-induced promoter sequence and a six-histidine tag (6xHis-tag) located at the C-terminal of the gene. As mentioned earlier, this plastid was transformed and expressed in S. cerevisiae. After 6 hours of galactose induction, analysis was performed by Western blot transfer method. The results showed that the size of Db Exg1 protein slightly increased to about 55 kDa due to histidine tag (data not shown). The recombinant Db Exg1 (called r Db Exg1) was purified by ^{Ni 2+} affinity chromatography (data not shown).

In order to evaluate the better pH, better temperature and hydrolysis ability of r Db Exg1, we used pNPG substrate and compared the results with Sc Exg1. r Db Exg1 retains half of its activity in the range of pH 3.0 to 7.0, and is stable under the condition of pH 5.0 to 7.0. In the sodium phosphate buffer system, the optimal pH value is 5.0 (Figure 3C). These results are similar to those of Sc Exg1, but the pH stability is slightly different (Figure 3A). The optimum temperature of r Db Exg1 is 60℃. However, r Db Exg1 only retains 40% of its activity after incubating at 60°C for 30 minutes. In contrast, Sc Exg1 showed the highest hydrolysis activity at 50°C (Figure 3B). Sc Exg1 and r Db Exg1 are in a stable state at temperatures below 50°C (Figure 3B and D). In addition, the Michaelis constant ( K _m ) and the maximum reaction rate ( V _max ) of r Db Exg1 and r Sc Exg1 were compared and calculated (Table 3). Overall, the results show that r Db Exg1 is a hypothetical glucosidase that can hydrolyze the glycosidic bonds of oNPG and pNPG. Interestingly, in terms of oNPG and pNPG substrates, no significant difference in enzyme kinetics was observed between r Db Exg1 and Sc Exg1 (Table 3).

Table 3: Dynamic parameters of recombinant Db Exg1 and Sc Exg1 proteins on oNPG and pNPG substrates

(4) Enzymatic hydrolysis of mogrosides

To test whether r Db Exg1 may be involved in the conversion mogroside, with the present embodiment will be introducing plastid gene rDbExg1 not hydrolyze mogroside exg1Δ mutant of Saccharomyces cerevisiae (S.cerevisiae exg1Δ mutant) in. After 9 hours of galactose induction, the expression of extracellular r Db Exg1 can be easily detected (data not shown). Indeed, the mutants transformed by rDbExg1 not only restored the ability to transform mogrosides, but also showed the ability to convert the components of mogroside saponins into mogrosides I, while the yield of mogrosides III E within 24 hours was very small (Figure 4A). Next, pure mogroside V was used to test whether r Db Exg1 can specifically bioconvert this molecule into siamenoside I, and whether there would be residual conversion to mogroside III E. As shown in Figure 4B, r Db Exg1 can specifically hydrolyze the β-1,6-bonded glucose moiety at the C-3 position of mogroside V to produce siamenoside I. Therefore, the mogroside III E in the mogroside saponins extract fermented by D. bruxellensis (Figure 4A) is most likely due to the mogroside IV in the original mogroside saponins extract. It is worth noting that Debaryomyces hansenii ( D.hansenii ) can biologically convert pure mogroside V into siamenoside I and mogroside III E (Figure 4E), while Y. lipolytica (Y. lipolytica ) can convert mogroside V into a mixture of mogroside IV, simenoside I and mogroside III E after 11 days of fermentation (Figure 4F). These results clearly show that among the strains tested, D. bruxellensis (D. bruxellensis) transforms mogroside and produces saimenoside I is unique.

In summary, the present invention describes an enzyme (ie Db Exg1) that hydrolyzes β-1,6 glucopyranoside (β-1,6glucopyranoside) at the C3 position of mogroside V in the biotransformation of mogroside V. ) Instead of β-1,6 glucopyranoside at position C24. The enzymatic activity of Db Exg1 is characterized by its ability to hydrolyze the glycosidic bonds of oNPG and pNPG. The present invention also shows that D. bruxellensis (D. bruxellensis) has a rare ability to biologically convert mogroside V into siamenoside I.

Saimenoside I is a minor compound in momordica grosvenori, and usually exists as an intermediate product of the metabolism of momordica grosvenori during fermentation. Through fermentation screening, it was found that D. bruxellensis has a limited ability to completely hydrolyze mogrosides. This strain converts the mogroside extract from about 80% of mogroside V, about 8% of mogroside I, about 10% of mogroside IV and 3% of mogroside III E to about 86% of mogroside I And about 14% of Mogroside III E. According to the example using purified mogroside V, it can be concluded that the accumulation of mogroside III E is caused by the conversion of mogroside IV (Table 2 and Figure 4); the pure fermentation with D. bruxellensis Mogroside V only produces siamenoside I (Figure 4B).

In this example, we also compared Db Exg1 with other yeast exoglucanases (data not shown) through enzyme cluster analysis. The results showed that the Exg1 protein in the 18 yeast strains tested is closely related to Db Exg1 glucosinolates and may be derived from a common ancestral gene. However, the fermentation conditions of mogroside saponins between these strains are completely different. Interestingly, some yeasts preferentially accumulate mogroside III E as the main final fermentation product, such as high protein Candida ( C.utilis ), while other yeasts tend to accumulate mogroside extracts after 7 days of fermentation. For the production of siamenoside I, such as Candida kefyr (Beijerinck) van uden and Buckley (Table 2).

These findings led to several possibilities together. First, there may be other Exg1 homologues in the yeast strains we used in the examples. Therefore, the production of mogroside III E or siamenoside I may be mediated by different Exg1 homologs. In fact, in S. cerevisiae , there are three homologues with highly conserved 1,3-β-glucanase regions (exo-1,3-β-glucanase regions), including Exg1 , Exg2 and Spr1. Previous studies have pointed out that Sc Exg1 is responsible for the biotransformation of mogrosides. In the present invention, Db Exg1 used to complement the S. cerevisiae mutants defective exg1Δ (S.cerevisiae exg1Δ mutant), and specific mogroside V siamenoside converted to I. Second, when mogroside is used as substrate, Exg1 homologues may show different enzyme specificities. Therefore, the difference in catalysis between strains may be due to the different affinity of the substrate in the active site of Exg1 homologue.

As mentioned above, compared with the conventional technology, the present invention has the following advantages: the method of the present invention converts the mogroside extract into saimenoside I, which has higher sweetness and better taste than other mogrosides; the present invention uses A microorganism expressing the Db Exg1 enzyme, which acts as a mediator for the conversion of mogroside V into siamenoside I in the present invention, for the preferential production of siamenoside I. Therefore, the use of the method of the present invention provides a feasible method for producing a large amount of natural sweetener-siamenoside I, so that siamenoside I can be applied to various industries.

The present invention has been described in more detail through the preferred exemplary embodiments. Although exemplary embodiments have been disclosed herein, it should be understood that other variations are also possible. Such changes should not be regarded as departing from the spirit and scope of the exemplary embodiments of the present application, and all modifications obvious to those skilled in the art are included in the scope of the appended application.

<110> National Taiwan University

<120> Method of biologically converting mogroside saponins extract into siamenoside I

<130> P191723TW

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer

<220>

<221> Introduction_Combination

<222> (1)..(54)

<400> 1

<210> 2

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer

<220>

<221> Introduction_Combination

<222> (1)..(48)

<400> 2

Claims (10)

A method for the biological conversion of mogroside saponins extracts into siamenoside I includes: contacting or culturing the mogrosides saponins extract with (1) Db Exg1 protein or (2) microorganisms expressing Db Exg1 protein. The method described in item 1 of the scope of patent application, wherein the mogroside extract is mogroside V. The method described in item 1 of the scope of patent application, wherein the microorganism is Dekkera bruxellensis (Dekkera bruxellensis). The method described in item 1 of the scope of the patent application, wherein the microorganism is a yeast, and the yeast comprises a vector with a DbExg1 gene or a modification with a natural DbExg1 gene promoter. The method described in item 4 of the scope of patent application, wherein the yeast strain is Saccharomyces cerevisiae (Saccharomyces cerevisiae) lacking Exg1. The method described in item 1 of the scope of patent application, wherein the Db Exg1 protein is a recombinant Db Exg1 protein. The method described in item 1 of the scope of the patent application, wherein the biotransformation is performed at a pH value of 3.0 to 7.0. The method described in item 7 of the scope of the patent application, wherein the biotransformation is performed at a pH value of 5.0 to 7.0. The method described in item 1 of the scope of the patent application, wherein the biotransformation is carried out in a temperature range of 30°C to 60°C. The method described in item 9 of the scope of patent application, wherein the biotransformation is carried out at 50°C to 60°C.

Images