TW202018080A - Rna nanostructures, methods of making, and uses thereof - Google Patents

Abstract

Disclosed herein are high Tm RNA nanostructures that can be composed of one or more modules or motifs to build RNA nanostructures with or without layers. The RNA nanostructures can have a core domain and three or more double-stranded arms and formulations thereof to conjugate high copy numbers of therapeutics, pH responsive or enzyme cleavable drug cargo. Also described herein is a design strategy for generation of synthetic RNA oligonucleotides that can self assemble into highly thermostable RNA structures. Also described herein are uses of the RNA nanostructures described herein.

Description

RNA nanostructure, its preparation method and use

Cross-reference of related applications

This application claims to be filed on February 9, 2018, with the name "RNA nanostructure having a Tm of 70°C to 100°C for dissolving and carrying high copy number paclitaxel or derivatives for delivery to tumors." Application No. 62/628, 591, the entirety of which is incorporated herein by reference.

This application claims the rights and interests of US Provisional Application No. 62/755, 696, filed on November 5, 2018, and titled "RNA Nanostructures, Methods of Preparation and Use", the entire contents of which are incorporated herein by reference.

Statement on federally funded research or development

This application is completed with the government support of the CA207946, CA186100, CA151648, CA168505, CA209045, and EB019036 fund numbers granted by the National Institutes of Health, and the government support of the W81XWH-15-1-0052 fund numbers granted by the US Department of Defense of. The government has certain rights in this application.

Sequence Listing

This application contains a sequence listing submitted in electronic form, which is an ASCII.txt file named "321501-2160_ST25" created on November 9, 2018. The contents of the sequence listing are incorporated in its entirety.

The present invention relates to an RNA, especially an RNA nanostructure, its preparation method and use.

Chemotherapy still plays a key role in cancer treatment. However, the most frequently used anti-cancer drugs, including paclitaxel, which is one of the most active chemotherapeutic agents for various cancer treatments, are small hydrophobic molecules. The poor water solubility of these small molecules often leads to serious side effects, non-specific toxicity and low efficacy. There is a need for an efficient and controlled drug delivery and release platform.

In some aspects, described herein are RNA motifs that can be composed of at least three segments of synthetic RNA oligonucleotides, wherein the at least three segments of synthetic RNA oligonucleotides can be coupled to each other, wherein the at least three segments of synthetic RNA oligonucleotides Nucleotides may form a central nuclear domain, and at least three double-stranded arms arranged around the nuclear domain and extending away from the central nuclear domain, wherein the melting temperature of the RNA motif may be greater than 65 degrees Celsius . The modular RNA motif may include 3 to 9 synthetic RNA oligonucleotide strands. One or more of the at least three synthetic RNA oligonucleotides may include one or more modified nucleotides. The one or more modified nucleotides may be terminal nucleotides or non-terminal nucleotides. The modification may be an alkyne linked to one or more modified nucleotides. The modification may be a linker connected to one or more modified nucleotides. The modular RNA motif may further include a cargo compound molecule connected to the at least three synthetic RNA oligonucleotides of the synthetic RNA oligonucleotide. At least 3 to 100 cargo compound molecules can be linked to the synthetic RNA oligonucleotide. The modular RNA motif may further include a functional group connected to one or more nucleotides in the at least three synthetic RNA oligonucleotides. The functional group may be attached to the terminal nucleotide. The functional group can be attached to a non-terminal nucleotide. The modular RNA motif may further include a cargo compound attached to a functional group. Each of the at least three synthetic RNA oligonucleotides may include an oligonucleotide sequence having a sequence that is approximately 80-100% identical to any of SEQ ID NOs: 1-54. The at least three segments of synthetic RNA oligonucleotides can be configured to self-assemble to form the modular RNA motif. The Tm of the modular RNA motif may be greater than about 70 degrees Celsius. The Tm of the modular RNA motif may range from about 70 degrees Celsius to about 100 degrees Celsius. The Tm of the modular RNA motif may range from about 65 degrees Celsius to about 100 degrees Celsius.

In some aspects, also described herein are modular RNA motifs that can be composed of at least four segments of synthetic RNA oligonucleotides, wherein the at least three segments of synthetic RNA oligonucleotides can be coupled to each other, wherein the at least The three-stage synthetic RNA oligonucleotide may form a central nuclear domain, and at least three double-stranded arms may be arranged around the nuclear domain and may extend away from the central nuclear domain. The modular RNA motif may include 4 to 9 synthetic RNA oligonucleotide strands. One or more of the at least three synthetic RNA oligonucleotides may include one or more modified nucleotides. The one or more modified nucleotides may be terminal nucleotides or non-terminal nucleotides. The modification may be an alkyne linked to one or more modified nucleotides. The modification may be a linker connected to one or more modified nucleotides. The modular RNA motif may further include a cargo compound molecule connected to the at least three synthetic RNA oligonucleotides of the synthetic RNA oligonucleotide. In some aspects, at least 3 to 100 cargo compound molecules can be linked to the synthetic RNA oligonucleotide. The modular RNA motif may further include a functional group connected to one or more nucleotides in the at least three synthetic RNA oligonucleotides. The functional group may be attached to the terminal nucleotide. The functional group is attached to a non-terminal nucleotide. The modular RNA motif may further include a cargo compound attached to a functional group. Each of the at least three synthetic RNA oligonucleotides may be composed of an oligonucleotide sequence having a sequence that is approximately 70-100% identical to any of SEQ ID NOs: 1-54. The at least three segments of synthetic RNA oligonucleotides can be configured to self-assemble to form the modular RNA motif.

In some aspects, RNA nanostructures are also described herein, which may include at least two modular RNA motifs as described herein, wherein the at least two modular RNA motifs may be connected to each other. The RNA nanostructure may include a central core, wherein the central core may include a first modular RNA motif; a first layer, wherein the first layer may include at least three modular RNA motifs, wherein the Each of the at least three modular RNA motifs of the first layer may be connected to the first modular RNA motif; and a second layer, wherein the second layer contains at least three Modular RNA motifs, wherein each of the at least three modular RNA motifs of the second layer can be combined with the modular RNA of the at least three modular motifs of the first layer Motifs are connected. In some aspects, all of the modular RNA motifs in the nanostructure can have the same number of double-stranded arms. In some aspects, the number of double-stranded arms on the first layer of modular RNA motifs may be different from that on the first layer of modular RNA motifs and on the second layer of modular RNA motifs Or the number of double-stranded arms on both the first modular RNA motif and the second layer of modular RNA motifs. In some aspects, the number of double-stranded arms on the modular RNA motif of the second layer may be different from that on the modular RNA motif of the first layer and on the modular RNA motif of the first layer Or the number of double-stranded arms on both the first modular RNA motif and the first-layer modular RNA motif. The number of double-stranded arms on the first modular RNA motif may be different from the modular RNA motif on the first layer, the modular RNA motif on the second layer, or the The number of double-stranded arms on both the modular RNA motifs of the first layer and the second layer. The melting temperature (Tm) of the RNA nanostructure may be greater than 70 degrees Celsius. The Tm of the RNA nanostructure may range from 70 degrees Celsius to about 100 degrees Celsius. The first modular RNA motif may have a larger Tm than the modular RNA motif of the first layer and the modular RNA motif of the second layer. The modular RNA motif of the first layer may have a larger Tm than the modular RNA motif of the second layer. One or more of the RNA motifs can be coupled to one or more cargo compounds. One or more of the RNA motifs can be coupled to one or more functional groups. The cargo compound may be an anti-cancer compound, chelating agent, radioisotope, fluorophore, miRNA, anti-miRNA, siRNA, pH-responsive prodrug, enzyme-cleavable prodrug, or any combination thereof. One or more of the RNA motifs are coupled to two or more cargo compounds, wherein at least two of the two or more cargo compounds are cargo compounds of different types.

In some aspects, also described herein are methods that can include the steps of administering a modular RNA motif as described herein or an RNA nanostructure as described herein. The subject may have or be suspected of having cancer.

In some aspects, also described herein are methods of treating cancer or disease in a subject, which may include administering to the subject a modular RNA motif as described herein or an RNA nanometer as described herein Structural steps.

In some aspects, also described herein are RNA nanostructures as described herein, which are used in the preparation of medicaments for the treatment of disease or cancer.

In some aspects, this document also describes a system that can include a computing device and an application executable on the computing device, where, when executed, the application can be such that the computing device at least: generates a theoretical dual Chain arm (DA) sequence, which can be based at least in part on the GC content of the theoretical DA sequence, the melting temperature (Tm) of the theoretical DA sequence, and the ability to spontaneously dimerize; select the One or more DAs, which can be based at least in part on the calculated cross-complementarity of the saved set of DAs, where the DA with the lowest overall complementarity is selected; the oligomer sequence can be calculated, which can include calculating the DA sequence Reverse complementary sequence, calculation of extended oligomer sequence and calculation of termination oligomer sequence; and selection of oligomers can be based at least in part on the ability of oligomers to spontaneously dimerize or form dimers, where spontaneous dimerization is not performed Those oligomers that are chemically formed and do not form dimers are selected.

In some aspects, this article also describes a method that includes at least the steps of generating a theoretical double-stranded arm (DA) sequence based at least in part on the GC content of the theoretical DA sequence, the melting temperature of the theoretical DA sequence (Tm ), and the ability of spontaneous dimerization; based at least in part on the calculated cross-complementarity of a set of saved DAs, one or more DAs for a set of oligomers are selected, where the DA with the lowest overall complementarity is selected Selection; calculating the oligomer sequence, which may include calculating the reverse complementary sequence of the DA sequence, calculating the extended oligomer sequence, and calculating the termination oligomer sequence; and based at least in part on spontaneous dimerization or dimerization of the oligomer The ability of the body to select oligomers, wherein those oligomers that do not spontaneously dimerize and do not form dimers are selected.

In some aspects, the use of nucleotides, RNA or RNA structures described herein is also described herein, which is used to make hydrophobic or low-solubility drugs soluble, thereby reducing the dose of the drug, for reducing drug toxicity or side effects , Or avoid using oil or organic solvents to dissolve drugs in cancer chemotherapy.

In some aspects, it is also described herein that hydrophobic materials are used to generate RNA micelle structures to carry anticancer compounds, therapeutic agents, miRNA, anti-miRNA, siRNA, chelating agents, radioisotopes, fluorophores, pH-responsive prodrugs or The use of cracking prodrugs.

The details of one or more aspects of the present application are set forth in the following drawings and description. Other features, purposes, and advantages of this application will be apparent from the description and drawings, and the scope of patent applications.

Before describing this application in more detail, it should be understood that the present disclosure is not limited to the specific aspects described, and as such should be subject to change. It should also be understood that the terminology used herein is for the purpose of describing particular aspects and is not intended to be limiting.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, only the preferred methods and materials are described so far.

All publications and patents cited in this specification are cited to disclose and describe the methods and/or materials related to the cited publications. All such publications and patents are incorporated herein by reference, which is equivalent to specifying and individually specifying that each individual publication or patent is incorporated by reference. Such incorporation by reference is expressly limited to the methods and/or materials described in the cited publications and patents, and does not extend to any dictionary definitions derived from the cited publications and patents. Any dictionary definitions in cited publications and patents that are not explicitly repeated in this application should not be considered as such, and should not be construed as defining any terms appearing in the scope of the patents of the attached applications. References to any publications refer to their disclosures before the filing date, and should not be construed as an admission that this application is not entitled to precede these publications due to prior disclosure. In addition, the disclosure date provided may be different from the actual disclosure date that may need to be independently confirmed.

After reading this application, it will be apparent to those skilled in the art that each of the various aspects described and illustrated herein has independent elements and features, which may be without departing from the scope or spirit of the present disclosure In the case of, it is easy to separate or combine with any other features of several aspects. Any recited method can be performed in the order of events recited or in any other order that is logically possible.

It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed in the form of ranges herein. It should also be understood that the endpoint of each range is both significantly related to and independent of the other endpoint. It should also be understood that many values ​​are disclosed herein, and that each value is also described herein as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. In this context, a range may be expressed from "about" one particular value, and/or to "about" another particular value. Similarly, when values ​​are expressed as approximations by using the antecedent "about," it will be understood that the particular values ​​shown form further aspects. For example, if the value "about 10" is disclosed, then "10" is also disclosed.

In the case of expression ranges, further aspects include from one specific value and/or to another specific value. Where a range of values is provided, it should be understood that each intermediate value based on one-tenth of the unit of the lower limit between the upper and lower limits of the range (unless the context clearly indicates otherwise) and within the stated range Any other stated values or intermediate values are included in this application. The upper and lower limits of these smaller ranges can be independently included in the smaller range, and are also included in the present application, subject to any specifically excluded limit in the range. When the stated range includes one or both of the stated limits, ranges excluding either or both of those included limits are also included in this disclosure. For example, when the stated range includes one or two limits, ranges excluding any one or two of those included limits are also included in this application, for example, the phrase "x to y" includes from "x" to "y "And the range greater than "x" and less than "y". The range can also be expressed as an upper limit, for example, "about x, y, z or less", and should be interpreted to include the specific range of "about x", "about y" and "about z", and "less than The range of "x", "less than y" and "less than z". Likewise, the phrase "about x, y, z or greater" should be interpreted to include the specific ranges of "about x", "about y" and "about z", as well as "greater than x", "greater than y" and The range of "greater than z". In addition, the phrase "about'x' to'y'", where'x' and'y' are numeric values, includes "about'x' to about'y'".

It should be understood that the use of such a range form is for convenience and brevity, and therefore should be interpreted in a flexible manner as including not only the numerical values explicitly stated as the limits of the range, but also all individual numerical values included in the range or Subranges, as each numerical value and subrange are clearly recorded. For illustration, the numerical range of "about 0.1% to 5%" should be interpreted to include not only the values explicitly stated as about 0.1% to about 5%, but also individual values within the indicated range (eg, about 1% , About 2%, about 3% and about 4%) and sub-ranges (eg, about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4% , And other possible sub-ranges).

Unless the context clearly indicates otherwise, the singular forms "a (an)" and "said" used in the specification and appended patent applications include plural indicators.

As used herein, "about", "approximately", "substantially" and the like, when used in conjunction with a numerical variable, can generally refer to the value of the variable and all values of the variable within experimental error (eg , Within the 95% confidence interval for the average) or within ±10% of the indicated value, whichever is greater. As used herein, the terms "about", "approximately", "is or about" and "substantially" may mean that the quantity or value in question may be an exact value, or be provided as described in the scope of the patent application or herein The value of the equivalent result or equivalent effect taught. That is, it should be understood that the amount, size, formula, parameters, and other quantities and characteristics are not and need not be precise, but can be approximated and/or larger or smaller as required, reflecting tolerances, conversion factors, Rounding, measurement errors, etc., as well as other factors known to those skilled in the art, to obtain equivalent results or effects. In some cases, values that provide equivalent results or effects cannot be reasonably determined. Generally, whether or not explicitly stated for this purpose, the amount, size, formulation, parameter, or other quantity or characteristic is "about", "approximately", or "for or about." It should be understood that where “about”, “approximately”, or “is or about” is used before the quantitative value, unless otherwise specifically stated, the parameter also includes the specific quantitative value itself.

Unless otherwise indicated, aspects of the present disclosure will employ techniques such as molecular biology, microbiology, organic chemistry, biochemistry, physiology, cell biology, cancer biology, physics, etc., which are within the skill of the art . These techniques are fully explained in the literature.

Before describing various aspects of the present disclosure in detail, it should be understood that the present disclosure is not limited to specific materials, reagents, reaction materials, manufacturing methods, etc. unless otherwise stated, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing particular aspects and is not intended to be limiting. Unless the context clearly indicates otherwise, where it is logically possible, in this application it is also possible that the steps are performed in a different order.

definition

As used herein, "active agent" or "active ingredient" refers to a component of the composition to which all or part of the effect of the composition is attributed. The active agent may be a pharmaceutically active compound, molecule (including but not limited to chemical molecules and biological molecules) or other substances, which can be administered when it is in contact with the RNA nanostructure and/or when it is not in contact with the RNA nanostructure Triggers effects (eg drug effects and/or biological effects) in the subject.

As used herein, the term "administering" refers to any method of providing a composition to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, intracardiac administration, oral administration, transdermal administration, inhalation administration, nasal administration, topical administration, intravaginal administration, ocular administration Administration, intraaural administration, intracerebral administration, rectal administration, sublingual administration, oral administration, and parenteral administration, including injection administration such as intravenous administration, intraarterial administration, intramuscular administration Administration and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, the article can be administered therapeutically; that is, administered to treat an existing disease or disorder. In further various aspects, the product can be administered prophylactically; that is, administered to prevent a disease or disorder.

As used herein, "anti-infective agent" may include, but is not limited to, antibiotics, antibacterial agents, antifungal agents, antiviral agents, and antiprotozoal agents.

As used herein, "aptamer" may refer to a single-stranded DNA or RNA molecule that can bind a preselected target including protein with high affinity and specificity. Their specificity and characteristics are not directly determined by their primary sequence, but by their tertiary structure.

As used herein, "linked", "linked", and the like may refer to the formation of a covalent or non-covalent bond (eg, a bond) between two or more molecules, or two or more molecules Conjugation. As used herein, "linked", "connected", and the like may refer to two or more molecules directly bonded together, with no intermediate molecules between those molecules that are connected together, or refer to Two or more molecules mediated by multiple linkers are indirectly linked together. When the binding is non-covalent, this can include charge interaction, affinity interaction, metal coordination, physical adsorption, host-guest interaction, hydrophobic interaction, TT stacking interaction, hydrogen bonding interaction, van der Waals interaction Action, magnetic interaction, electrostatic interaction, dipole-dipole interaction, and/or combinations thereof. In the case where the binding is covalent, this can encompass a bond that shares a pair of electrons between one or more atoms in each molecule involved.

As used herein, the term "contacting" refers to bringing together the disclosed composition or peptide or pharmaceutical product with cells, target receptors, or other biological entities in such a way that the compound can be directly (ie, by The target itself interacts), or indirectly (that is, by interacting with another molecule, cofactor, factor, or protein on which the target activity depends) affecting the activity of the target (eg, receptor, transcription factor, cell, etc.).

As used herein, a “control” is an alternative subject or sample used for comparison purposes in an experiment, and it is included to minimize or distinguish the effects of variables other than independent variables. The "control" can be a positive control or a negative control.

As used herein, "coupled" or "coupled to" refers to the direct or indirect connection or bonding or other joining of two or more components of a larger structure or system.

As used herein, "conjugated" has the same meaning as "linked".

As used herein, "deoxyribonucleic acid (DNA)" and "ribonucleic acid (RNA)" can generally refer to any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA, or Modified RNA or DNA. RNA can be in the form of non-coding RNA or encoding mRNA (messenger RNA), such as tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), antisense RNA, RNAi (RNA interference construct) , SiRNA (short interfering RNA), micro RNA (miRNA) or ribozyme, aptamer, guide RNA (gRNA).

As used herein, "dose", "unit dose", or "amount" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined amount of nanoparticle composition or formulation, which is calculated to produce Expected response related to its administration.

As used herein, the term "effective amount" refers to an amount sufficient to achieve a desired result or have an effect on an undesired state. For example, in one aspect, an effective amount of polymeric nanoparticles is an amount that kills and/or inhibits cell growth without causing additional damage to surrounding non-cancer cells. For example, "therapeutically effective amount" refers to an amount sufficient to achieve the desired therapeutic result or have an effect on undesirable symptoms, but usually not sufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the condition being treated and the severity of the condition; the specific composition used; the patient's age, weight, overall health, gender, and diet; time of administration; Route of administration; excretion rate of the specific compound used; duration of treatment; drugs used in combination or concurrent use with the specific compound used and similar factors well known in the pharmaceutical art.

As used herein, "identity", "identity", and the like may refer to the relationship between two or more nucleotide or polypeptide sequences as determined by comparing sequences. In the art, "identity" also refers to the degree of sequence relatedness between nucleotides or polypeptides as determined by matching between such sequence strings. "Identity" can be easily calculated by known methods, including but not limited to (Computational Molecular Biology, Lesk, AM Editor, Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Project, Smith, DW Editor, Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG Editor, Humana Press, New Jersey, 1994; Molecular Biology Sequence Analysis, Von Heinje, G., Academic Press, 1987; and Introduction to Sequence Analysis, Gribskov, M. and Devereux, J. Editor, Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIAM J. Applied Mathematics, 1988, 48: 1073). The preferred method of determining identity is designed to give the largest match between the tested sequences. The method for determining identity is encoded in a publicly available computer program. The percent identity between the two sequences can be obtained by using analysis software (eg, NBLAST and XBLAST) that incorporates the Needelman and Wunsch (J. Mol. Biol., 1970, 48:443-453) algorithms (eg, Madison, Wisconsin, USA) Sequence analysis software package of the Genetics Computer Group) to determine. Unless otherwise stated, the default parameters are used to determine the identity of the polypeptides of the present disclosure.

As used herein, "immunomodulatory agent" may refer to an agent capable of modulating or modulating one or more immune functions or responses, such as a therapeutic agent.

As used herein, the term "motif" with respect to the nanoparticle stage is intended to refer to double-stranded or single-stranded ribonucleic acid or its analogs. By being connected to each other, the various motifs join together to form larger particles. Ligation can occur through non-covalent bonding.

The term "nano particles" as used herein is intended to refer to particles having a diameter from 1 nm up to 1,000 nm. The nano particles may be 5 nm to 30 nm, 10 nm to 50 nm, 10 nm to 40 nm, 10 nm to 30 nm, 10 nm to 20 nm, and 10 nm to 15 nm. RNA can be obtained from any source, such as bacteriophage phi 29, HIV, Drosophila, ribosome or can be synthetic RNA.

The term "nano structure" as used herein is intended to refer to a structure ranging from 1 nm up to 1,000 nm when measured along its maximum dimension in any direction. The nanostructure can be 5 nm to 30 nm, 10 nm to 50 nm, 10 nm to 40 nm, 10 nm to 30 nm, 10 nm to 20 nm, and 10 nm to as measured along its maximum dimension in any direction 15 nm.

The terms "nucleic acid" and "polynucleotide" as used herein generally refer to a sequence string of at least two base-sugar-phosphate combinations, and particularly refer to single-stranded and double-stranded DNA, single-stranded and double-stranded DNA mixed with regions, single-stranded and double-stranded RNA, RNA mixed with single-stranded and double-stranded regions, hybrid molecules containing DNA and RNA, the DNA and RNA may be single-stranded, or more typically double-stranded , Or a mixture of single-stranded and double-stranded regions. In addition, as used herein, a polynucleotide refers to a triple-stranded region containing RNA or DNA or both RNA and DNA. The chains in such regions can be derived from the same molecule or from different molecules. This region may include all of the one or more of the molecules, but more typically a region that involves only some of the molecules. One of the molecules with triple helix regions is usually an oligonucleotide. "Polynucleotide" and "nucleic acid" also include such chemically modified, enzymatically or metabolically modified polynucleotide forms, as well as chemical forms of DNA and RNA characteristic of viruses and cells, including simple cells in particular And complex cells. For example, the term polynucleotide includes DNA or RNA containing one or more modified bases as described above. Thus, DNA or RNA that includes unusual bases such as inosine, or modified bases such as tritylated bases (to name just two examples) are polynucleotides as used herein. "Polynucleotide nucleic acid" and "nucleic acid" also include PNA (peptide nucleic acid), phosphorothioate, and other variants of the phosphate backbone of natural nucleic acids. Natural nucleic acids have a phosphate backbone, and artificial nucleic acids may contain other types of backbones, but contain the same bases. Thus, DNA or RNA having a backbone modified for stability or other reasons is a "nucleic acid" or "polynucleotide" as that term means herein. In particular, "polynucleotide" and "nucleic acid" also include 2'fluoro, 2'O-methylation, LNA (locked nucleic acid), and 2'modified others of the ribose (sugar) portion of natural nucleic acids Variants. Natural nucleic acids (DNA and RNA respectively) have protons or hydroxyl groups at the 2'ribose position, and artificial nucleic acids may contain other forms of 2'modifications to increase thermodynamics and enzyme stability. Therefore, DNA or RNA having a 2'ribose position modified for stability or other reasons is a "nucleic acid" or "polynucleotide" as the term herein means. As used herein, "nucleic acid sequence" and "oligonucleotide" also encompass nucleic acids and polynucleotides as defined above.

The term "pharmaceutically acceptable" describes materials that are not biologically or otherwise undesirable, that is, do not cause unacceptable levels of undesirable biological effects or do not affect each other in a harmful manner.

As used herein, "pharmaceutically acceptable carrier or excipient" refers to a carrier or excipient that can be used to prepare a pharmaceutical formulation that is generally safe, non-toxic, and not biologically or It is undesirable in other ways and includes carriers or excipients acceptable for veterinary use as well as human pharmaceutical use. "Pharmaceutically acceptable carrier or excipient" as used in the specification and patent application includes one and more than one such carrier or excipient. As used herein, "pharmaceutically acceptable carrier" refers to sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions immediately before use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents or carriers include water, ethanol, polyols (such as glycerin, propylene glycol, polyethylene glycol, etc.), carboxymethyl cellulose and suitable mixtures thereof, vegetable oils (Such as olive oil) and injectable organic esters such as ethyl oleate. For example, by using a coating material such as lecithin, by maintaining the required particle size in the case of a dispersion, and by using a surfactant, proper fluidity can be maintained. These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. By containing various antibacterial and antifungal agents, such as paraben, chlorobutanol, phenol, sorbic acid, etc., the prevention of the action of microorganisms can be ensured. It is also desirable to include isotonic agents, such as sugar, sodium chloride and the like. Prolonged absorption of injectable pharmaceutical forms is caused by the inclusion of agents such as aluminum monostearate and gelatin, which delay absorption. An injectable depot type is prepared by forming a drug microcapsule matrix in biodegradable polymers such as polylactide-polyglycolide, poly(orthoester), and poly(anhydride). Depending on the ratio of drug to polymer and the nature of the particular polymer used, the rate of drug release can be controlled. Injectable depot preparations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. Injectable preparations can be sterilized, for example, by filtration through a bacteria-retaining filter or by adding a sterilizing agent in the form of a sterile solid composition, which can be dissolved or dispersed in sterile water or other injectable sterile medium before use. Suitable inert carriers may include sugars such as lactose. In some aspects, at least 95% by weight of the active component particles have an effective particle size in the range of 0.01 to 10 microns.

As used herein, the term "prevention" refers to excluding, avoiding, eliminating, preventing, stopping, or hindering the occurrence of certain things (such as disease or its symptoms), especially through early action. It should be understood that unless specifically stated otherwise, the use of the other two words in the context of "reducing", "inhibiting" or "preventing" is also clearly disclosed. For example, in one aspect, "prevention" can refer to preventing the replication of cancer cells or preventing the metastasis of cancer cells. The term "prevention" includes maintaining or restricting the disease in a subclinical state.

As used herein, "self-assembly" refers to nucleic acids (and in some cases pre-formed nucleic acid nanostructures (eg, crystals)) in a sequence-specific manner, in a predictive manner, and without external The ability to anneal to each other under controlled circumstances. In some aspects, nucleic acid nanostructure self-assembly methods include combining nucleic acids (eg, single-stranded nucleic acids or oligonucleotides) in a single container and allowing the nucleic acids to anneal to each other based on sequence complementarity. In some aspects, this annealing process involves placing the nucleic acid at high temperature and then gradually lowering the temperature to facilitate sequence-specific binding. Various nucleic acid nanostructures or self-assembly methods are known and described herein.

As used herein, the term "subject" refers to the target of administration, for example, an animal, human, cell, or cell population. Thus, the subject of the methods disclosed herein may be vertebrates, such as mammals, fish, birds, reptiles or amphibians. The subject of the methods disclosed herein may be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not specify a specific age or gender. Therefore, it is intended to cover both adult and newborn subjects, as well as embryos, whether male or female. In one aspect, the subject shown is a patient. A patient refers to a subject suffering from a disease or disorder such as, for example, cancer and/or abnormal cell growth. The term patient includes human and veterinary subjects. In one aspect, the subject has been diagnosed as needing treatment for cancer and/or abnormal cell growth.

discuss

RNA nanotechnology provides great prospects for treating diseases including but not limited to cancer. RNA nanoparticles can be used as carriers for various active agents. However, current RNA nanoparticles cannot be delivered based on RNA nanotechnology. For example, current RNA nanoparticles are limited in that they can only be conjugated with one active agent per RNA strand of RNA nanoparticles. Because the RNA nanoparticles are larger in size than the conjugated active agent, the molar concentration of the active agent carried by the RNA nanoparticles is low. In other words, the loading efficiency of RNA nanoparticles is low. This results in low and ineffective amounts of active agent delivered to the subject through these RNA particles, making current RNA nanoparticles not suitable carriers for delivering active agents to treat and/or prevent disease.

Although the direct way to solve this problem is to conjugate more active agent molecules to each RNA nanoparticle, attempts to solve the problem of low load efficiency in this way have failed. This failure can be at least partially attributed to the folding energy and melting temperature (Tm) of RNA. Covalently binding each RNA nanoparticle to multiple active agent molecules leads to dissociation of RNA nanoparticles. In addition to the current low loading efficiency of RNA nanoparticles, current RNA nanoparticles can also occur after systemic injection Dissociate. This may be due to physical barriers, low Tm and/or low thermal stability of current RNA nanoparticles.

Considering the shortcomings of current RNA nanoparticles, described herein are RNA nanostructures that can be composed of one or more modular RNA motifs. The RNA nanostructure can be loaded with one or more active agents and can have ultra-high thermal stability, ultra-high melting temperature, and other physical properties that help increase loading efficiency and/or capacity. The RNA nanostructures described herein with or without active agents can be administered to a subject. Other compositions, compounds, methods, features, and advantages of the present disclosure will be apparent or become apparent to those of ordinary skill in the art by reviewing the drawings, specific embodiments, and examples below. All of these additional compositions, compounds, methods, features, and advantages are intended to be included within this specification and within the scope of this disclosure.

RNA nanostructure

Described herein are RNA nanostructures that can be composed of one or more modular RNA motifs. The modular RNA motifs may each be composed of 3-9 individual synthetic RNA oligonucleotides designed (or configured) to self-assemble into a highly ordered modular RNA motif. During assembly, the modular RNA motif may be composed of multiple double-stranded arms (DA) that can be arranged around the core domain. Multiple modular RNA motifs can be connected to each other to form RNA nanostructures. Figures 41A-45B show various aspects of modular RNA motifs and RNA nanostructures. After forming an overall understanding of RNA nanostructures in mind, the aspects of modular RNA motifs and RNA nanostructures are now described in more detail.

Modular RNA motif

As mentioned above, the RNA nanostructure may include one or more modular RNA motifs. Figures 41A-41G show various aspects of modular RNA motifs. As shown in FIGS. 41A-41G, the modular RNA motif may be composed of 3, 4, 5, 6, 7, 8, or 9 synthetic single-stranded RNA oligonucleotides, the synthesized single-stranded RNA oligonucleosides Acids can self-assemble into modular RNA motifs by hybridization. Each synthesized single-stranded RNA oligonucleotide may be about 16 to about 120 bases in length. The exact sequence of each synthetic single-stranded RNA oligonucleotide in each modular RNA motif can be designed so that they are specific when assembled with 2 or more other synthetic single-stranded RNA oligonucleotides Physical characteristics. The RNA motif may consist of 3, 4, 5, 6, 7, 8 or 9 synthetic RNA oligonucleotides. Synthetic RNA oligonucleotides can be designed so that they form highly ordered 2-D and/or 3-D structures after self-assembly. During self-assembly, synthetic RNA oligonucleotides form a highly ordered structure, which is referred to herein as a modular RNA motif. For example, as shown in FIGS. 41A-41G, the 2-D structure may depend at least in part on the number of synthetic RNA oligonucleotides. The RNA nanostructure may have 3, 4, 5, 6, 7, 8 or 9 double-stranded arms (DA) from the core domain. DA can be arranged symmetrically or asymmetrically around the core domain.

The core domain may have 0-4 protruding nucleotides that are symmetrical or asymmetrical, separating the DAs, which may allow optimization of the thermodynamic stability, spatial constraints, and/or structural arrangement of the loops. Changes in the number of double-stranded sequences (DA) and unpaired core nucleotides can affect the thermodynamic stability of modular RNA motifs and/or RNA nanostructures. Therefore, physical and functional properties can be optimized by changing the sequence of synthetic RNA oligonucleotides that form modular RNA motifs. For example, Figure 1B shows a modular RNA motif with 3 DAs, and an asymmetric protrusion (5'UUU3') between H2 and H3 DA and an asymmetric protrusion (5' between H1 and H2 DA U3'). In another example, FIG. 29C shows a modular RNA motif containing three DAs with different asymmetric protrusions but the same DA (between their H1 | H2 | H3 DA is U | UUU | -,-| GG |-and-| C | CU), resulting in different annealing Tm values (Figure 30A). In addition, Figures 38A to 38G show modular RNA motifs with 3-9 DAs, with symmetric protrusions (5'UG3') between each DA.

As shown in 41A to 41G, RNA oligonucleotides self-assemble so that the modular RNA motif contains 3, 4, 5, 6, 7, 8, or 9 DAs (the black parts shown in FIGS. 41A to 41B) The core domain (the light gray area inside the dotted frame in Figures 41A to 41G). The DA may be arranged around the core area so that an angle (θ) is formed between any two adjacent DAs. For example, in FIG. 41A, the modular RNA motif contains 3 segments of synthetic RNA oligonucleotides, which self-assemble to form a modular RNA motif with 3 DAs. The angle formed between DA1 and DA2 is recorded as θ2, the angle formed between DA1 and DA3 is recorded as θ3, and the angle formed between DA3 and DA2 is recorded as θ1. Figures 41B to 41G have similar symbolic labels for the modular RNA motifs shown in each figure. DA can be positioned substantially symmetrically around the core domain. In other aspects, DA is not positioned symmetrically around the core domain. Table 1 shows the angular range of each modular RNA motif cited in Figures 41A to 41G.

Table 1. Perspectives of modular RNA motifs.

The melting temperature (Tm) of the modular RNA motif can be about 65°C or higher. In some aspects, the melting temperature of the modular RNA motif can be greater than 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C. In some aspects, the Tm of the modular RNA motif can be 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃. In some aspects, the melting temperature of the modular RNA motif can range from 65°C to 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 66 to 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82 , 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 67 to 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 68 to 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 , 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 69 to 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 , 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 70 to 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 , 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 71 to 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 , 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 72 to 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 , 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 73 to 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 74 to 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 75 to 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 76 to 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 77 to 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 78 to 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94 , 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 79 to 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 , 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 80 to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 81 to 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 , 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 82 to 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 , 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 83 to 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 Or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 84 to 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the modular RNA motif can range from 85 to 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. range. In some aspects, the melting temperature of the modular RNA motif can range from 86 to 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 87 to 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 88 to 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 89 to 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 90 to 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 91 to 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 92 to 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 93 to 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 94 to 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 95 to 96, 97, 98, 99, or 100 °C. In some aspects, the melting temperature of the modular RNA motif can range from 96 to 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 97 to 98, 99, or 100 °C. In some aspects, the melting temperature of the modular RNA motif can range from 98 to 99 or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 99 to 100°C.

Synthetic RNA Oligonucleotide

As mentioned previously, the modular RNA motif may consist of 3-9 separate synthetic RNA oligonucleotides, which may self-assemble to form a modular RNA motif. The synthetic RNA oligonucleotide may be single-stranded. Each individual synthetic RNA oligonucleotide can consist of 16-120 nucleotides. The nucleotide may be a natural ribonucleotide or may be modified. In some aspects, synthetic RNA oligonucleotides can be 2' modified. 2'modification or other modification may be 2'fluoro-, 2'O-methylated-, LNA- or any other backbone, sugar or base modified ribonucleotide, or natural ribonucleotide, backbone, sugar And any combination of base-modified ribonucleotides. Modifications are discussed further in other parts of this article. Each synthetic RNA oligonucleotide can be composed of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 or 120 nucleotides or any range of nucleotides. Each synthetic RNA oligonucleotide can be designed and configured so that it can self-assemble with 2, 3, 4, 5, 6, 7, or 8 other synthetic RNA oligonucleotides as described elsewhere in this article Modular RNA motif. The rational design of synthetic RNA oligonucleotides is described elsewhere in this article.

The nucleotide may be an unmodified nucleotide or a modified nucleotide. The modification may be 5'-end modification and/or 3'-end modification and/or 2'-internal sugar modification and/or internal base modification. Typical 5'end modifications include amino, carboxyl, phosphate, thiol, maleimide, alkyne, cholesterol, aldehyde, carbon spacer, PEG-spacer, doubler, and trebler , Photodegradable amino groups, photodegradable spacers, fluorophores (for example, anthocyanins 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxin, quencher (Dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 5'modifications known to users experienced in the art. Typical 3'end modifications include amino, carboxyl, phosphate, thiol, alkyne, cholesterol, carbon spacer, PEG-spacer, fluorophore (eg, anthocyanin 3, 3.5, 5, 5.5, 7, fluorescein Etc.), biotin, desthiobiotin, digoxin, quenchers (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 3'modifications known to users experienced in the art. Typical internal modifications include amino-dA, amino-dC, amino-dT, carboxy-dT, 2'O-propargyl, 2'-amino, 2'-fluoro, 2'-methoxy, 5-acetylene -DU, C8-yne-dC, C8-yne-dT, carbon spacer, PEG-spacer, fluorophore (eg anthocyanin 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, Desulfated biotin, digoxin, quencher (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 5'modifications known to users experienced in the art. The modification may be an alkynyl group attached to a nucleotide. The modification may be a functional group attached to the nucleotide. Suitable functional groups are described elsewhere herein. The alkynyl groups or functional groups present in each synthetic RNA oligonucleotide can facilitate conjugation of the cargo compound at sites containing alkynyl groups via, for example, click chemistry. See, for example, Figure 3A. In synthetic RNA oligonucleotides, one or more end (e.g., 5'end and/or 3'end) nucleotides may be modified. One or both ends of the synthetic RNA oligonucleotide can be modified. In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 or 120 nucleotides can be modified . In some aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 or 120 nucleotides may not be modified. If each nucleotide in the synthetic RNA oligonucleotide is considered in order from the 5'end to the 3'end, the modified nucleotide may be nucleotides 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57 , 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82 , 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107 , 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 or 120, or any combination thereof. In the presence of multiple modified nucleotides, the modified nucleotides may be adjacent to each other, or may be separated by one or more unmodified nucleotides. In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more unmodified nucleotides may be between two modified nucleotides.

In some aspects, the synthetic RNA oligonucleotide may have a sequence according to any one of SEQ ID NOs: 1-54. In some aspects, the synthetic RNA oligonucleotide may have 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or about 90% of any one of SEQ ID NOs: 1-54. 99 consistent sequences.

Method for preparing synthetic RNA oligonucleotide

Standard molecular biology and biochemical techniques can be used to synthesize the synthetic RNA oligonucleotides, polynucleotide functional groups, and polynucleotide cargo compounds. In other words, various nucleic acids that can form RNA nanoparticles can be synthesized de novo as needed or produced from various nucleic acid expression vectors or transcribed in vitro. Such synthesis techniques are known to those skilled in the art.

RNA nanostructure

In some aspects, a single modular RNA motif can be an RNA nanostructure. Also described herein are RNA nanostructures that can include two or more modular RNA motifs. For example, as shown in FIGS. 42A to 42G, the RNA nanostructure may be ordered. Primary modular RNA motifs (such as the black modular RNA motifs in Figures 42A to 42G) can be connected or otherwise coupled to 3-9 additional modular RNA motifs to form an intermediate layer (such as Figure 42A To the dark gray modular RNA motif in 42G). Each modular RNA motif in the middle layer can be connected or otherwise coupled to 3-9 additional modular RNA motifs. In some aspects, modular RNA motifs connected or otherwise coupled to the intermediate layer of the RNA nanostructure can form the end or outer layer of the RNA nanostructure (e.g., light gray modular RNA in Figures 42A to 42G Motif). In other embodiments, a modular RNA motif connected or otherwise coupled to the intermediate layer of the RNA nanostructure can form another intermediate layer. In some aspects, RNA nanostructures can have a middle layer of modular RNA motifs. It will be understood that the total number of modular RNA motifs that can be connected or otherwise coupled thereto is only limited by the number of DAs in the modular RNA motif. Ligation or coupling can occur at the 3'end and/or 5'end of the synthetic oligonucleotides that make up the modular RNA motif.

In some aspects, the RNA nanostructure can be homogeneous (eg, all modular RNA motifs contained in the RNA nanostructure can be the same). In some aspects, RNA nanostructures can be heterogeneous (eg, at least two modular RNA motifs contained in RNA nanostructures differ from each other in one or more of the following characteristics: number of DAs, oligonucleotide sequences The length and/or oligonucleotide sequence). The layers of the RNA nanostructure can be homogeneous (for example, each modular RNA motif in a given layer can be the same). The layers of the RNA nanostructure may be heterogeneous (for example, at least two modular RNA motifs contained in the layer differ from each other in at least one of the following characteristics: the number of DAs, the length of the oligonucleotide sequence, and /Or oligonucleotide sequence). In some aspects, one or more layers of the RNA nanostructure can each be homogeneous, but the RNA nanostructure can be heterogeneous because two or more modular RNA motifs in the RNA nanostructure are related to the following One or more of the features are different from each other: the number of DAs, the length of the oligonucleotide sequence, and/or the oligonucleotide sequence. Figures 42A to 42G show aspects of homogeneous RNA nanostructures comprising homogeneous layers. Figure 43 shows an aspect of a heterogeneous RNA nanostructure containing a homogeneous layer. As shown in FIG. 43, in some aspects, each layer may be composed of modular RNA motifs with different numbers of DAs. In some aspects, the heterogeneous RNA nanostructure may contain a homogeneous layer and at least one heterogeneous layer. In some aspects, if an RNA nanostructure is loaded with one or more different cargo compounds in a motif, in a layer, or across one or more layers, the RNA nanostructure may be considered heterogeneous.

The RNA nanostructures described herein may have high thermal stability or ultra-high thermal stability, as defined herein by Tm measurement via particle annealing in qPCR or particle dissociation in thermal gradient gel analysis (TGGE). The RNA nanostructure described herein may have a high melting temperature or an ultra-high melting temperature (Tm). RNA oligonucleotides usually exhibit a length-dependent melting temperature, which is stable at 70-75°C for long hybridized double strands. The modification of the double-strand and the conjugation of hydrophobic molecules reduce the stability of the RNA double-strand and thus lead to a lower melting temperature and dissociation to form separate strands, resulting in enzymatic digestion in vivo. RNA nanostructures suitable for carrying high-density functional groups have a Tm of about 70°C or higher. In some aspects, the melting temperature of RNA nanostructures can be higher than 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82 , 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃. In some aspects, the melting temperature of the RNA nanostructure can be 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃. In some aspects, the melting temperature of RNA nanostructures can range from 65°C to 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 66 to 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 67 to 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 , 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 68 to 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 , 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 69 to 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 , 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 70 to 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 , 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 71 to 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 , 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 72 to 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 73 to 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 74 to 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 75 to 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 76 to 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 77 to 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94 , 95, 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of the RNA nanostructure can range from 78 to 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 , 96, 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 79 to 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 80 to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 , 98, 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 81 to 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 , 99 or 100 ℃ range. In some aspects, the melting temperature of RNA nanostructures can range from 82 to 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 Or 100 ℃ range. In some aspects, the melting temperature of the RNA nanostructure can range from 83 to 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 ℃ range. In some aspects, the melting temperature of the RNA nanostructure can range from 84 to 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C range. In some aspects, the melting temperature of the RNA nanostructure can range from 85 to 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 86 to 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 87 to 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 88 to 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 89 to 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 90 to 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 91 to 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 92 to 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 93 to 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 94 to 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 95 to 96, 97, 98, 99, or 100 °C. In some aspects, the melting temperature of the RNA nanostructure can range from 96 to 97, 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 97 to 98, 99, or 100°C. In some aspects, the melting temperature of the RNA nanostructure can range from 98 to 99 or 100°C. In some aspects, the melting temperature of RNA nanostructures can range from 99 to 100°C.

In some aspects, the Tm of the core modular RNA motif may be greater than the Tm of the modular RNA motif forming the middle layer, which may be greater than the Tm of the modular RNA motif forming the terminal layer or outermost layer. It should be understood that in the presence of multiple intermediate layers, the Tm of the modular RNA motif forming the innermost intermediate layer may be greater than the Tm of the modular RNA motif forming the outermost intermediate layer. Any intermediate layer located between the innermost intermediate layer and the outermost intermediate layer may have a Tm lower than the Tm of the modular RNA motif forming the innermost intermediate layer, and higher than the modular RNA motif forming the outermost intermediate layer Tm, and the modular RNA motif that can decrease with distance from the innermost layer. This feature can lead to thermodynamically driven nanostructure assembly that can occur at temperatures above the measured Tm value of the modular RNA motif (Figure 33A). This further allows a thermodynamic mechanism that allows the release of the payload by detaching each layer at a rate proportional to the Tm of each modular RNA motif (Figure 33D).

When measured along its longest or largest dimension, RNA nanostructures can have sizes up to microns. When measured along its longest or largest dimension, the size of the RNA nanostructure can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 , 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800 or about 900 nm. In some aspects, the size of the RNA nanostructure can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, when measured along its longest or largest dimension. 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 nm or any range of values therein. In some aspects, when measured along its longest or largest dimension, the size of the RNA nanostructure can be about 1-30, 1-40, 1-50, 10-50, 10-40, 10-30, 30- 50, 30-40 or 40-50 nm. In some aspects, the RNA nanostructure can be substantially spherical. In other aspects, RNA nanostructures can be triangular planes, triangular pyramids, T-shaped, tetrahedral, square planes, interactive, triangular bipyramids, square pyramids, pentagonal planes, octahedrons, triangular prisms, pentagonal vertebrae Body, pentagonal double-cone, four-corner anti-prism, three-cap triangular prism, single-covered four-corner anti-prism, arrow shape, arrow tail shape, X shape, or any deformed form of these shapes.

Loaded and/or functionalized RNA nanostructures

The modular RNA motifs that make up the RNA nanostructures described herein can provide various sites at which cargo compounds and/or functional groups can be attached or otherwise coupled to the modular RNA motif. By attaching or otherwise coupling cargo compounds and/or functional groups to modular RNA motifs, RNA nanostructures can be loaded with one or more cargo compounds and/or functionalized with one or more functional groups. The cargo compound and/or functional group may be connected to or otherwise coupled to the modular RNA motif before or after the RNA nanostructure is assembled.

The cargo compound and/or functional group can be attached to or otherwise coupled to the 5'end and/or 3'end of one or more DAs of the modular RNA motif in the RNA nanostructure (see, eg, Figure 1C ). As previously discussed, one or more nucleotides of the synthetic RNA oligonucleotide constituting the modular RNA motif can be modified so that the connection or coupling of functional groups or cargo compounds can occur on the nucleotide . In some aspects, the modified nucleotides can be present in RNA oligonucleotides at such positions that when assembled into a modular RNA motif, the modified nucleotides are present in DA (see, eg, Figure 16A- 16B and Figure 18). Thus, the modular RNA motif can load cargo compounds and/or functional groups at one or more nucleotides in the DA of the modular RNA motif. The modular RNA motifs present in the RNA nanostructure can be at the 5'end and/or 3'end of each DA and/or one or more internal nucleotides in each DA (eg, modified core Glycosidic acid).

In some aspects, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, modular RNA motifs in RNA nanostructures 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, to 600 or more ends can be used for attachment or coupling to cargo compounds or functional groups. In some aspects, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 , 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 , 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200 , 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 to 1000 or more nucleotides can be used to modify and/or connect or couple to Cargo compounds or functional groups. Therefore, as long as the RNA nanostructure is stable when loaded and the load does not violate chemical or physical limitations (eg, steric hindrance), the cargo compound and/or can be connected to or otherwise coupled to the RNA nanostructure The number of functional groups may be the same as those available for loading.

RNA nanostructures can carry a single type of cargo compound. RNA nanostructures can carry a single type of functional group. RNA nanostructures can carry 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more types of cargo compounds . RNA nanostructures can carry 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more types of functional groups.

In RNA nanostructures containing multiple layers, all layers can be loaded with the same cargo compound and/or functional group type. In some aspects, in a RNA nanostructure that includes multiple layers, two or more layers can be loaded with different cargo compounds and/or functional group types. In a non-limiting example, the three-layer RNA nanostructure can load one or more types of cargo compounds (for example, 20 to 100 molecules of one or more types of cargo compounds) in the core layer to escape from the loadable endosome And/or the second layer (or middle layer) of the radio-MRI-fluorescence imaging morphology and is finally protected by the end layer or the outermost layer, which carries the target and/or enhances the biodistribution at the end of the end layer exposed to the solvent Functional group (Figure 46B). As shown in FIG. 32D, the two layers are connected by coupling the synthetic oligonucleotide of the inner layer with one of the synthetic oligonucleotides of the outer layer. Therefore, the binding of the layers is controlled by the Tm of the layers that make up the particles, which can then be used to determine the release profile of the specific functional layer. Alternatively, the layers can be coupled through pH, light, or enzyme-sensitive chemical groups to induce release once the desired environmental conditions are met, such as when cells take up low pH endosomes or lysosomes.

44A to 44B show aspects of RNA nanostructures loaded with a single type of cargo compound or functional group. The black modular RNA motif indicates the core or primary modular RNA motif contained in the RNA nanostructure. Dark gray modular RNA motifs indicate secondary or intermediate level modular RNA motifs contained in RNA nanostructures. Light gray modular RNA motifs indicate modular RNA motifs contained at the end or outermost level in the RNA nanostructure.

Figures 45A-45B show aspects of RNA nanostructures loaded with various types of cargo compounds and/or functional groups (including but not limited to active agents). The black modular RNA motif indicates the core or primary modular RNA motif contained in the RNA nanostructure. Dark gray modular RNA motifs indicate secondary or intermediate level modular RNA motifs contained in RNA nanostructures. Light gray modular RNA motifs indicate modular RNA motifs contained at the end or outermost level in the RNA nanostructure.

Figures 46A-46B show aspects of RNA nanostructures loaded with various types of cargo compounds and/or functional groups, including but not limited to paclitaxel. Figure 46A. Nanostructures with modular RNA motifs that contain an elongated core with internal modifications that allow the active agent to specifically attach to the core of the nanostructure. Figure 46B. Nanostructures with different functional groups attached to the 5'end or 3'end of the oligonucleotide in each layer.

Cargo compounds and functional groups

As mentioned above, the RNA nanostructure may contain one or more cargo compounds and/or one or more functional groups. In some aspects, a single compound or molecule that can be linked or otherwise coupled to an RNA nanostructure can be a cargo compound and functional group. As used in this context, the term "cargo compound" means that it can be loaded onto an RNA nanostructure as described herein and can be delivered to a subject (eg, by releasing from the RNA nanostructure, or even when Any molecule, compound, or composition that is linked or otherwise coupled to an RNA nanostructure and triggers a physiological response in the subject upon contact with the subject). The term "functional group" as used in this context refers to a compound that adds functionality to an RNA nanostructure. The cargo compound or functional group may be any biomolecule, chemical molecule, synthetic molecule, or any other molecule, which may be encapsulated by the RNA nanostructure described herein, linked to and/or bound to the RNA as described herein, as described herein Nanostructure. The cargo compound and/or functional group may be an active agent. In some aspects, the cargo compound can be encapsulated by the RNA nanostructure or components thereof, attached to and/or bound to the RNA nanostructure or components thereof.

In some aspects, the cargo compound and/or functional group can be DNA, RNA, modified ribonucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, aptamer enzymes, riboswitches, ribozymes, essential tumor proteins and genes for inhibition Ribozyme leader sequences for translation or transcription, hormones, immunomodulators, antipyretics, sedatives, antipsychotics, analgesics, antispasmodics, anti-inflammatory drugs, antihistamines, anti-infectives and chemotherapeutics (Anticancer drugs). Other suitable cargo compounds include sensitizers (eg, radiation sensitizers) that can make cells or subjects more responsive (or sensitive) to treatment or prevention and imaging or other diagnostic agents. RNA nanostructures can be used as monotherapy or in combination with other active agents to treat or prevent diseases or disorders.

Suitable hormones include, but are not limited to, amino acid-derived hormones (eg, melatonin and thyroxine), small peptide hormones, and protein hormones (eg, thyrotropin releasing hormone, antidiuretic hormone, insulin, growth hormone, luteinizing hormone, progestin Follicle hormones, and thyroid stimulating hormones), arachidic acid (such as arachidonic acid, lipoxygen, and prostaglandin), and steroid hormones (such as estradiol, testosterone, and tetrahydrotestosterone cortisol).

Suitable immunomodulators include but are not limited to prednisone, azathioprine, 6-MP, cyclosporine, tacrolimus, methotrexate, interleukins (eg IL-2, IL-7 and IL-12 ), cytokines (eg interferon (eg IFN-α, IFN-β, IFN-ε, IFN-κ, IFN-ω, and IFN-γ), granulocyte colony-stimulating factor, and imiquimod), Chemical factors (eg, CCL3, CCL26, and CXCL7), cytosine guanosine phosphate, oligodeoxynucleotides, dextran, antibodies, and aptamers).

Suitable antipyretics include but are not limited to non-steroidal anti-inflammatory drugs (eg ibuprofen, naproxen, ketoprofen, and nimesulide), aspirin and related salicylates (eg salicylate bile Alkali, magnesium salicylate, and sodium salicylate), acetaminophen/acetaminophen, analgin, nabumetone, antipyrine, and quinine.

Suitable sedatives include, but are not limited to, benzodiazepines (e.g., alprazolam, brozepam, chlordiazepoxide, clonazepam, cloramic acid, diazepam, fluazepam, lorazepam Pan, oxazepam, temazepam, triazolam, and tofisopam), serotenergic antidepressants (eg, selective serotonin reuptake inhibitors, tricyclic antidepressants, and monoamine oxidase Inhibitors), mebicar, afobazole, selank, bromantane, emoxypine, azapirone, barbiturate, hydroxyzine, pregabalin, validol and β-receptor Body blocker.

Suitable antipsychotics include, but are not limited to, benpiridol, bromideridol, droperidol, haloperidol, motiperon, pipaperone, telmipirone, flupirin, Pentafluridol, pimozide, acepromazine, chlorpromazine, cyanomelazine, dizyrazine, fluphenazine, levomepromazine, mesoridazine, prolaprazine, piperacin Azine, hydroperazine, piperazine, prochlorperazine, promazine, promethazine, azirazine, thiopromazine, thioetherazine, trifluoperazine, triflupromazine, cloprom Thioxanthin, clopithioxine, flupentixol, tilvothione, chlorothiatan, clothipine, quetiapine, azirazine, capipramine, chlorcapramine, morpholine indone, Mosapamine, sulpiride, verapride, amisulpride, amoxapine, aripiprazole, asenapine, clozapine, buranserin, iloperidone, lurasidone , Meperone, nemopril, olanzapine, paliperidone, perippirone, quetiapine, remipril, risperidone, sertindole, trimethoprim, ziprasidone , Zotepine, alstonie, biphene, bioptopterin, epiperazole, cannabidiol, caliprazine, pimofanserin, pomaglumetad methionil, pencarxerin, nomeline, and zilol Zicronapine.

Suitable analgesics include, but are not limited to, acetaminophen/acetaminophen, nonsteroidal anti-inflammatory drugs (eg, ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 Inhibitors (eg, rofecoxib, celecoxib, and etoricoxib), opioids (eg, morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, butyl (Prenorphine), tramadol, norepinephrine, fluoxetine, nefopam, orphenadrine, pregabalin, gabapentin, cyclobenzaprine, scopolamine, methadone, ketomidone, pipenimide , And aspirin and related salicylates (eg, choline salicylate, magnesium salicylate, and sodium salicylate).

Suitable antispasmodic agents include, but are not limited to, mebeverine, paverine, cyclobenzaprine, caripordol, orphenadrine, tizanidine, metaxalone, Methocarbamol, chlorzoxazone, baclofen, dantrolene, baclofen, tizanidine and dantrolene.

Suitable anti-inflammatory drugs include but are not limited to prednisone, non-cholesterol anti-inflammatory drugs (such as ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (such as rofecoxib) , Celecoxib and etoricoxib), and immunoselective anti-inflammatory derivatives (eg, submandibular peptide-T and its derivatives).

Suitable antihistamines include, but are not limited to, H1-receptor antagonists (eg, atorvastatin, azelastine, piracetin, brompheniramine, buclizine, bromazine, card Bisamin, Cetirizine, Chlorpromazine, Secrizine, Chlorpheniramine, Chloromastatin, Cyproheptadine, Desloratadine, D-Brompheniramine, D-Chlorphenamine, Tea dimenhydrinate, dimethoxidine, diphenhydramine, doxylamine, doxylamine, ebastine, embramin, fexofenadine, hydroxyzine, levocetirzine (levocetirzine) , Loratadine, meclizine, mirtazapine, olopatadine, orphenadrine, benzenamine, pheniramine, phentoxamine, promethazine, pyrimidinamine, quetiapine, Rupatadine, Trippiramine, and Triprolidine), H2-receptor antagonists (eg, cimetidine, famotidine, lafutidine, nizatidine, ranitidine (rafitidine ) And Roxatidine), Tratoquinoline, Catechin, Cromoglicate, Nedocromil, and β2-adrenergic agonists.

Suitable anti-infective agents include, but are not limited to, anti-amebic drugs (eg, nitazoxanide, paromomycin, metronidazole, tnidazole, chloroquine, and diiodoquinoline), Aminoglycosides (eg, paromomycin, tobramycin, gentamicin, amikacin, kanamycin, and neomycin), anthelmintic drugs (eg, thiamidine, mebendazole, Ivermectin, praziquantel, albendazole, mitofosin, thiabendazole, olniquiquin), antifungal agents (for example, azacarbo antifungal agents (for example, itraconazole, Fluconazole, posaconazole, ketoconazole, clotrimazole, miconazole, and voriconazole), echinocandins (for example, caspofungin, anifene, and micafungin), gray Flavomycin, terbinafine, flucytosine, and polyenes (eg, nystatin and amphotericin b), antimalarial drugs (eg, pyrimethamine/sulfadoxine, artemisinin methyl ether/ Phenfluorenol, atovaquone/proguanil, quinine, hydroxychloroquine, mefloquine, chloroquine, doxycycline, pyrimethamine, and haflutriline), anti-tuberculosis agents (eg, salicylate (Eg, aminosalicylic acid), isoniazid/rifampin, isoniazid/pyrazinamide/rifampin, bedaquinoline, isoniazid, ethambutol, rifampin, rifampin Ting, rifapentine, crimpycin, and cycloserine), antiviral agents (eg, amantadine, amantadine ethylamine, abacavir/lamivudine, emtricitabine/tenofovir , Compistat/elvitegravir/emtricitabine/tenofovir, efavirenz/emtricitabine/tenofovir, abacavir/lamivudine/zidovudine, lamivudine /Zidovudine, emtricitabine/tenofovir, emtricitabine/lobinavir/ritonavir/tenofovir, interferon alpha-2v/ribavirin, PEG interferon Alpha-2b, Maraviro, Retevir, Dulutvir, Enfuvirtide, Foscarnet, Formimivir, Oseltamivir, Zanamivir, Nevirapine, Efavirenz, Etravir Velin, Lipivirin, Derivadine, Nevirapine, Entecavir, Lamivudine, Adefovir, Sofosbuvir, Didanoxin, Tenofovir, avacivr, Zidovudine, Stavudine, Entrica, Zalcitabine (xalcitabin), telbivudine, cimipirvir, popprevir, trapivir, lopinavir/ritona Wei, fusanavir, darunavir, ritonavir, tilanavir, atazanavir, nelfinavir, amprenavir, indinavir, sawuinavir, Ribavirin, valcyclovir, acyclovir, famciclovir, ganciclovir, and valganciclovir), carbapenems (eg, doripenem, meropenem, ertapem) South, and cilastatin/imipenem), cephalosporins (eg, cefadroxil, cefradine, cefazolin, cefalexin, cefepime, ceflaroline, cephalosporin, Cefotetan, cefuroxime, ceftazidime, chlorcarbazone, cefoxitin, cefaclor, cefbutene, ceftriaxone sodium, cefotaxime, cefpodoxime, cephalosporin Dine, cefixime, cefditoren, cefizoxime, and ceftazidime, glycopeptide antibiotics (eg, vancomycin, dalbavancin, oritavancin, and telavancin ( telvanci n)), glycines (eg, tigecycline), anti-leprosy drugs (eg, clofazimine and thalidomide), lincomycin and its derivatives (eg, clindamycin) And lincomycin), macrolides and their derivatives (eg, telithromycin, fidaxomicin, erythromycin, azithromycin, clarithromycin, dirithromycin, and acetocin) , Linezolid, sulfamethoxazole/trimethoprim, rifaximin, chloramphenicol, fosfomycin, metronidazole, aztreonam, bacitracin, β-lactam antibiotics (benzylpenicillin (benzene Chaxen and benzyl penicillin), phenoxymethyl penicillin, cloxacillin, flucoxacillin, methicillin, temoxicillin, mecillin, azlocillin, mezlocillin, piperacillin, amoxicillin Xicillin, ampicillin, baxicillin, carbenicillin, piperacillin, ticarcillin, amoxicillin/clavulanic acid, ampicillin/sulbactam, piperacillin/tazobactam, ravic acid/ti Casillin, penicillin, procaine penicillin, oxacillin, dicloxacillin, nefcillin, cefazolin, cephalexin C, cephalosporin, cefaclor, cefaclor, cefadazole, cefuroxime, Cefotetan, cefoxitin, cefiximine, cefotaxime, cefpodoxime, ceftazidime, ceftriaxone sodium, cefepime, cefpirome, ceftaroline, biapenem, doripenem , Ertapenem, faropenem, imipenem, meropenem, panipenem, azupenem, tibipenem, sanamycin, aztreonam (azrewonam), tigemonan, novo Carmycin A, taboxinine, and β-lactam), quinolones (eg, lomefloxacin, norfloxacin, ofloxacin, qatifloxacin, moxifloxacin, ciprofloxacin, levofloxacin, gemimifloxacin, Cifloxacin, Cinofloxacin, Nalidixic acid, Enoxacin, Grefloxacin, Gatifloxacin, Travafloxacin, and Sparfloxacin), Sulfas (eg, sulfamethoxazole/methoxazole) Benzidine, sulfasalazine, and sulfisoxazole), tetracyclines (eg, doxycycline, demeclocycline, minocycline, doxycycline/salicylic acid, doxycycline/omega-3 Unsaturated fatty acids, and tetracycline), and urinary system anti-infectives (eg, nitrofurantoin, urotropine, fosfomycin, cinoxacin, nalidixic acid, trimethoprim, and methylene blue).

Suitable chemotherapeutic agents include, but are not limited to, paclitaxel, camptothecin, brentuximab vedotin, doxorubicin, 5-FU (fluorouracil), everolimus, pemetrexed, mecli Falen, pamidronate, anastrozole, exemestane, neirabine, ofatumumab, bevacizumab, belimastab, tosimumab, carmustine, bo Lemycin, bosutinib, busulfan, alemtuzumab, irinotecan, vandetanib, bicalutamide, lomustine, daunorubicin, clofarabine, carbotinib , Actinomycin D, ramucirumab, cytarabine, cyclophosphamide, cyclophosphamide nitrogen mustard, decitabine, dexamethasone, docetaxel, hydroxyurea, nitrimidide, leucine Propulin, epirubicin, oxaliplatin, asparaginase, estramustine, cetuximab, vemodegi, Erwinia chrysanthemum asparaginase, amifostine, etoposide Glycosides, flutamide, toremifene, fulvestrant, letrozole, degarelix, pratrixa, methotrexate, fluorouridine, atorizumab, gemcitabine, alfa Tinib, imatinib mesylate, carmustine, ibrimlin, trastuzumab, hexamemelamine, topotecan, panatinib, idarubicin, ifosfamide, ibrux Tinib, acitinib, interferon alpha-2a, gefitinib, romidepsin, ixabepilone, ruzotinib, cabazitaxel, ado-trastuzumab maytansin conjugate Substances, carfilzomib, chlorambucil, sagrostim, cladribine, mitotane, vincristine, procarbazine, megestrol, trametinib, mesna sodium, chloride Strontium-89, dichloromethyldiethylamine, mitomycin, busulfan, gemtuzumab ozogamicin, vinorelbine, filgrastim, PEG filgrastim, sorafenib , Nirumide, pentostatin, tamoxifen, mitoxantrone, pepartenase, deneukin diftitox, alleviate acid, carboplatin, pertuzumab, cisplatin , Pomalidomide, prednisone, aldesleukin, mercaptopurine, zoledronic acid, lenalidomide, rituximab, octreotide, dasatinib, regofenib, histamine relin, Sunitinib, situximab, homoharringtonine, guanine (tioguanine), dabrafenib, erlotinib, bexarotene, temozolomide, thiotepa, thali Doxamine, BCG, temsirolimus, bendamustine hydrochloride, triptorelin, aresnic trioxide, lapatinib, pentorubicin, panitumumab, vinblastine, Bortezomib, retinoic acid, azacitidine, pazopanib, teniposide, leucovorin, crizotinib, capecitabine, enzalutamide, ipilimumab, gosere Lin, Vorinostat, Idelaris, Seretinib, Abiraterone, Epothilone, tafluposide, imazathiopurine, deoxyfluorouridine, vindesine, all-trans Retinoic acid, and other anticancer agents listed elsewhere herein.

Suitable sensitizers may include, but are not limited to, radiosensitizers, insulin sensitizers (eg, metformin, thiazolidinedione,) and photosensitizers used in photodynamic therapy (eg, aminolevulinic acid (ALA), Silicon phthalocyanine Pc4, m-tetrahydroxyphenyl chlorin (mTHPC), and mono-L-aspartyl chlorin e6 (NPe6).

Suitable imaging agents include, but are not limited to, fluorescent molecules (eg, Cy3, Cy5, ICG, and other commercially available fluorophores), paramagnetic ions, nanoparticles that may contain paramagnetic ions, superparamagnetic iron oxide Molecules and their nanoparticles, 18F-fluorodeoxyglucose and other PET imaging agents, gadolinium-containing contrast agents, radionuclides, and combinations thereof.

In some aspects, the functional group can be a targeting moiety. As used in this context, the phrase "targeting moiety" refers to a location, cell type, organ that can cause RNA nanostructures to be specifically directed to the subject after delivery to the subject , Or structural compounds, molecules, or any other composition. Targeting moieties can include compounds and molecules such as antibodies, aptamers, and receptor ligands.

Suitable targeting moieties include but are not limited to aptamers and ligands that bind to: epidermal growth factor receptor (EGFR), prostate specific membrane antigen receptor (PSMA), epithelial cell adhesion molecule (EpCam), vascular endothelium Growth factor (VEGF), galactose receptor, folic acid receptor, G protein coupled receptor (GPCR), CD receptor, integrin, transferrin receptor, fibroblast growth factor (FGFR), σ receptor Body (SR), and/or epidermal growth factor receptor (EGFR), or chemical ligands such as folic acid, galactose, and GalNAc.

In some aspects, the functional group/cargo compound can be a chelating agent. Suitable chelating agents include, but are not limited to, NOTA, DOTA, EDTA, Exjade, dimercaptosuccinic acid, deferoxamine methanesulfonate, deferiprone, Jadenu, and Syprine hydrochloride.

In some aspects, the functional group/cargo compound can be hydrophobic. In some aspects, the functional group and/or cargo compound may be hydrophilic. In some aspects, the functional group and/or cargo compound can be positively charged. In some aspects, the functional group and/or cargo compound can be negatively charged. In some aspects, the functional group and/or cargo compound may be electrically neutral. In some aspects, the functional group and/or cargo compound may be uncharged.

In some aspects, the targeting moiety specifically targets cancer cells. In some aspects, the targeting moiety is EGFR, HER2, and/or EP-CAM aptamer or PSM antigen, or folic acid. In some aspects, the targeting moiety is the ligand for EGFR. In other aspects, the targeting moiety targets blood, lung, kidney, brain tissue, neurons, muscle, heart, tendon, ligament, liver, pancreas, or other specific tissues.

In some aspects, functional groups can facilitate the attachment of cargo molecules. As described elsewhere herein, the nucleotides that make up synthetic RNA oligonucleotides can be modified. In addition to alkyne, synthetic RNA oligonucleotides can be modified with functional groups such as linkers. Using thermodynamic, acid-labile, light-sensitive, or enzyme-labile chemical groups for timed triggered release, individual functional groups can be linked or otherwise coupled to synthetic RNA oligonucleotides and/or cargo compounds Or additional functional groups. In some aspects, the functional group can be a stimuli-responsive linker, such as a photolysable linker, a pH-responsive linker, or an enzyme-cleavable linker. Photolyzable linkers are molecules that contain photolabile groups that can be cleaved by light at a specific wavelength. The photolysable linker can cleavably connect the cargo molecule or other functional moiety (eg, targeting moiety) to the RNA nanoparticle. This is another mechanism in which the release of cargo molecules from RNA nanoparticles can be regulated and controlled. The photolysable joint can be activated (eg, cleaved) by electromagnetic radiation sources (including but not limited to visible light, infrared radiation, ultraviolet radiation). The use of photolyzable linkers may allow temporal and spatial control of the release of cargo molecules from RNA nanoparticles. Exemplary photolysable linkers can include, but are not limited to, phosphoramidite (see, for example, Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link catalog number 26-6888), photodegradable biotin (see, for example, Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link catalog number 26-6691), photodegradable amino C6 (see for example, Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link catalog number 26-6890), photodegradable spacers (see for example, see for example, Olejnik et al ., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848 -3855, Gene Link catalog number 26-6889); 2-ylbenzyl linker (see, for example, Bai et al., (2003) PNAS, 100: 409-413). Those of ordinary skill in the art will understand other suitable photoresolvable joints.

In some aspects, the linker may be a pH-responsive linker. The pH-responsive connector can be any compound that can degrade (eg, hydrolyze) at a certain pH. Therefore, the pH-responsive linker may be acid-responsive or alkaline-responsive. The pH-responsive linker may be a polymer. Suitable pH-responsive linkers are generally known in the art, and include but are not limited to those described in: Choy et al. (Bioconjugate. Chem. (2016) 27:824-830; Schmaljohann (2008) Adv. Drug Deliv. Rev. (2006) 58:1655-1670, Balamuralidhara et al. (2011) Am. J. Drug Disc. Devel. 1:24-48; Biomedical Nanomaterials, ed. Zhao and Shen (2016), Chapter 6; Masson et al. (2004) J. Control Release. 99:423-434; Karimi et al., Nanomed. and Nanobiotech. (2016) 8:696-716; International Patent Application Publication WO2016/028700; and Patil et al., 2012. Int. J. Mol. Sci. 13:11681-11693.

In some aspects, the linker may be an enzyme-cleavable linker. An enzyme cleavable linker is a linker that contains an enzyme cleavage site. In some aspects, the linker may be a nucleic acid containing a sequence for an endonuclease. Those of ordinary skill in the art will understand endonuclease cleavage sites and how to generate nucleic acid molecules containing them. Other cleavage sites that can be included can be RNase or DNase cleavage sites. In some aspects, the enzyme cleavable site may be a cleavage site for an enzyme specific for the target cell. Therefore, in this way, the release can be controlled so that it occurs only at the target cell through interaction with the target cell-specific enzyme. In some aspects, the linker can be a chemical group that can be cleaved or hydrolyzed by an enzyme such as an esterase. Those skilled in the art will immediately understand other cleavage sites that can be added to the enzyme cleavable linker.

Rational design of modular RNA motifs and RNA nanostructures

The principle of designing a self-assembled nucleic acid nanostructure is to encode sequence complementarity in the nucleic acid strand so that the nucleic acid strand self-organizes into a predetermined nanostructure by pairing complementary fragments under appropriate physical conditions. Based on this basic principle (see, for example, Seeman NCJ Theor. Biol. 99: 237, 1982, incorporated herein by reference), researchers have created various synthetic nucleic acid nanostructures (see, for example, Seeman NC Nature 421 : 427, 2003; Shih WM et al. Curr. Opin. Struct. Biol. 20: 276, 2010, each of which is incorporated herein by reference). Examples of nanostructures of nucleic acids (eg, DNA) and methods of producing such structures that can be used according to the present disclosure are known and include, but are not limited to, grids (see, eg, Winfree E. et al. Nature 394: 539, 1998; Yan H. et al. Science 301: 1882, 2003; Yan H. et al. Proc. Natl. Acad. ofSci. USA 100; 8103, 2003; Liu D. et al. J. Am. Chem. Soc. 126: 2324, 2004; Rothemund PWK et al. PLoS Biology 2: 2041, 2004, each of which is incorporated herein by reference), ribbon (see, for example, Park SH et al. Nano Lett. 5: 729, 2005; Yin P. et al. Science 321: 824, 2008, each of which is incorporated by reference), tubular (see for example, Yan H. Science, 2003; P. Yin, 2008 each of which is cited and Incorporated herein), finite two- and three-dimensional objects with defined shapes (see, for example, Chen J. et al. Nature 350: 631, 1991; Rothemund PWK, Nature, 2006; He Y. et al. Nature 452: 198, 2008 ; Ke Y. et al. Nano. Lett. 9: 2445, 2009; Douglas SM et al. Nature 459: 414, 2009; Dietz H. et al. Science 325: 725, 2009; An dersen ES et al. Nature 459 : 73, 2009; Liedl T. et al. Nature Nanotech. 5: 520, 2010; Han D. et al. Science 332: 342, 2011, each of which is incorporated herein by reference), and macrocrystalline (see eg , Meng JP et al. Nature 461: 74, 2009, incorporated herein by reference). The synthetic RNA oligonucleotide may be single-stranded nucleic acid, double-stranded nucleic acid, or a combination of single-stranded and double-stranded nucleic acid.

RNA nanostructure components (synthetic RNA oligonucleotides and modular RNA motifs can be designed using the computer-aided design methods described herein. Although specific RNA nanostructures have been used to demonstrate computer design, it should be understood that this Those skilled in the art can extrapolate the principles taught therein to any desired RNA nanostructure.

Each synthetic RNA oligonucleotide can be designed such that when it is combined with 2 or more additional synthetic RNA oligonucleotides, base pairing occurs to produce 3 or more with surrounding core domains DA's highly ordered 2-D and 3-D structures, the core domain may or may not include base pairing between chains, and may include 0- to form symmetric or asymmetric protrusions between DA 4 nucleotides. Each synthetic RNA oligonucleotide can be designed to include 16-120 nucleotides. Each synthetic RNA oligonucleotide can be designed to include 1 or more modified nucleotides. Nucleotide modifications are described elsewhere herein. Synthetic RNA oligonucleotides designed to include more than one modification can be designed such that modified nucleotides are separated by one or more unmodified nucleotides. In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more unmodified nucleotides can separate two modified nucleotides.

The rational design of synthetic RNA oligonucleotides and/or RNA nanostructures described herein can be performed in a computing environment. The computing environment may include one or more computing devices, which may include at least one processor circuit, for example, it may have a processor and a memory. According to aspects of the present disclosure, various applications and/or other functions may be performed in the computing environment. Moreover, various data may be stored in one or more data stores accessible by the computing environment.

Components that are executed in a computing environment may include, for example, a reasonable RNA design system and other applications, services, processes, systems, engines, or functions not discussed in detail herein. The rational RNA design system can be implemented to facilitate the design of synthetic RNA oligonucleotides and/or RNA nanostructures as described herein. A reasonable RNA design system can also perform various back-end functions that can be related to the design of RNA oligonucleotides (such as those described herein to synthesize RNA oligonucleotides and/or RNA nanostructures).

As shown in FIG. 48, a rational RNA design system can be implemented to dynamically create synthetic RNA oligonucleotide sequences that can be used to generate RNA nanostructures as described herein. The rational RNA design system can generate, identify, and/or select compatible with one or more other synthetic RNA oligonucleotide sequences (which can also be generated by a rational RNA design system) and self-assemble to form as described herein The synthetic RNA oligonucleotide sequence of the RNA nanostructure described above. The rational RNA design system can also identify synthetic RNA oligonucleotide sequences that are not compatible with one or more other synthetic RNA oligonucleotide sequences to form the RNA nanostructure as described herein.

The rational RNA design system can apply one or more optimization algorithms to determine a suitable or optimal synthetic RNA oligonucleotide sequence that is compatible and forms an RNA nanostructure as described herein, the algorithm is based at least in part on The GC content of RNA oligonucleotides and/or RNA nanostructures, the Tm of two or more RNA oligonucleotides and/or RNA nanostructures, the probability of spontaneous dimerization of RNA oligonucleotides and/or Or capabilities, cross-complementarity of synthetic RNA oligonucleotides, conversion between RNA and oligonucleotides containing modified nucleic acids, and/or other data or attributes of synthetic RNA oligonucleotides.

As shown in FIG. 48, a reasonable RNA design system can generate various theoretical double-stranded arms (DA) as described elsewhere herein (DA sequence is generated in FIG. 48). When the rational RNA design system is executed, it can then determine whether the GC content of the theoretical DA formed is within the desired GC range. The desired GC range can be set by the user. In some aspects, the GC range may be from about 50% to 51, 52, 53, 54, 55, 56, 57, 58, 59, or about 60%. In some aspects, the GC range can be about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or about 60%. If the theoretical DA formed is not within the desired GC range, within the desired Tm range, and/or can spontaneously dimerize, then the theoretical DA is discarded. If the theoretical DA is within the expected GC range, within the expected Tm, and does not spontaneously dimerize, then the theoretical DA can be saved. The accepted DA can then be used by the rational RNA design system to select a set of oligomers that can form the accepted DA.

As shown in FIG. 48, the rational RNA design system can select DA for a set of oligomers. The rational RNA design system can calculate the cross-complementarity of a set (two or more) DAs that are saved. The DA with the highest cross complementarity can be discarded, and the DA with the lowest overall cross complementarity can be saved.

As shown in FIG. 48, the rational RNA design system can use the DA with the lowest overall cross-complementarity to calculate the oligomer sequence. The rational RNA design system can calculate the reverse complement sequence of the DA sequence, the extended RNA oligomer sequence, and the termination oligomer sequence. By determining whether the calculated RNA oligomer sequence spontaneously dimerizes and/or can form a dimer, the rational RNA design system can determine the appropriate oligomer sequence from various calculated RNA oligomer sequences . The rational RNA design system can save those calculated RNA oligomer sequences that do not spontaneously dimerize and do not form dimers, and can discard those calculated RNA oligomers that do spontaneously dimerize or form dimers物SEQ. If the saved calculated RNA oligomer sequence is generated using a DNA sequence (eg, cDNA), the rational RNA design system can be converted to an RNA sequence. The converted sequence can be saved.

Next, a discussion of the technical equipment of the computing environment is provided. Stored in memory are data and several components that can be executed by the processor. Data storage and other data can also be stored in the memory. Many software components are stored in memory and can be executed by the processor. In this regard, the term "executable" means a program file in a form that is ultimately executable by the processor. An example of an executable program can be, for example, a compiled program that can be translated into machine code (which is a format that can be loaded into the random access portion of one or more memory devices and run by the processor), can be used such as a target Code that can be loaded into the random access portion of one or more memory devices and executed by the processor, or can be interpreted by another executable program to be generated in the random access portion of the memory device Code of instructions to be executed by the processor. The executable program can be stored in any part or component of the memory device including, for example, random access memory (RAM), read only memory (ROM), hard disk drive, solid state drive, USB flash drive, memory card, Optical discs such as high-density compact discs (CD) or digital versatile discs (DVD), floppy disks, magnetic tape, or other memory components.

The memory may include both volatile and non-volatile memory and data storage components. Furthermore, a processor may represent multiple processors and/or multiple processor cores, and one or more memory devices may represent multiple memories that operate separately in parallel processing circuits. The memory device may also represent a combination of various types of storage devices, such as RAM, mass storage devices, flash memory, or hard disk storage. In this case, the local interface may be an appropriate network that facilitates communication between any two of the multiple processors or between any processor and any memory device. The local interface may include additional systems designed to coordinate this communication, including, for example, performing load balancing. The processor may have an electrical configuration or some other available configuration.

Although the rational RNA design system and various other systems described herein may be embodied in software or code executed by general-purpose hardware as discussed above.

The flowchart shows an example of the functionality and operation of the implementation of parts of the components described herein. If embodied in software, each block may represent a module, segment, or portion of code, which may include program instructions that implement prescribed logical functions. The program instructions may be embodied in the form of source code, which may include human-readable statements or machine code written in a programming language, and the machine code may include appropriate execution of a processor such as a computer system or other system Digital commands recognized by the system. The machine code can be converted from source code. If embodied in hardware, each block may represent a circuit or multiple interconnected circuits to implement specified logical functions.

Although the flowchart shows a specific order of execution, it should be understood that the order of execution may differ from that described. For example, the execution order of two or more frames may be shuffled relative to the displayed order. In addition, two or more frames displayed consecutively may be executed simultaneously or partially simultaneously. Further, in some examples, one or more blocks shown in the drawings may be skipped or omitted.

In addition, any logic or applications described herein including software or code may be presented in any non-transitory computer-readable medium for use by an instruction execution system (such as, for example, a processor in a computer system or other system) Or use it in combination. In this sense, the logic may include, for example, program code, instructions, and statements that can be obtained from a computer-readable medium and executed by an instruction execution system. In the context of this application, a "computer-readable medium" may be any medium that can contain, store, or maintain the logic or applications described herein, which is used by or in conjunction with an instruction execution system.

RNA nanostructured preparation

Also provided herein is a pharmaceutical formulation, which may include an amount of the RNA nanostructure described herein and a pharmaceutical carrier suitable for administration to an individual in need thereof. The individual in need thereof may have or may be suspected of having cancer, genetic diseases or conditions, viral, bacterial, fungal and/or parasitic infections, or other diseases or conditions that require treatment or prevention. In some aspects, a subject in need thereof requires a diagnostic procedure, such as an imaging procedure. The pharmaceutical formulation may include an amount of the RNA nanostructures described herein, which can effectively treat or prevent cancer, genetic diseases or disorders, viral, bacterial, fungal and/or parasitic infections, or other diseases or disorders, or The imaging of the subject or part thereof is effective.

The formulation can be administered by any suitable route of administration. For example, the formulation (and/or composition) can be administered orally, intravenously, ocularly, intraocularly, intramuscularly, intravaginally, intraperitoneally, rectally, parenterally, topically, intranasally or subcutaneously to a subject in need thereof . This article describes other suitable approaches. In some aspects, the RNA nanostructure contains an effective amount of a cargo molecule.

Parenteral preparation

RNA nanostructures can be formulated for parenteral delivery, such as injection or infusion, in the form of solutions or suspensions. The formulation can be administered by any route, such as blood flow or directly to the organ or tissue to be treated.

Parenteral formulations can be prepared as aqueous compositions using techniques known in the art. Generally, such compositions can be prepared as injectable preparations, for example, solutions or suspensions; solid forms, suitable for preparing solutions or suspensions before addition of reconstituted media before injection; emulsions, such as water-in-oil ( w/o) emulsion, oil-in-water (o/w) emulsion, and its microemulsion, liposome or milk fat body.

The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, one or more polyols (eg, glycerin, propylene glycol, and liquid polyethylene glycol), such as vegetable oils (eg, peanut oil, corn oil, sesame oil, etc.) Oil, and combinations. Appropriate fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining a desired particle size in the case of a dispersant, and/or by using a surfactant. In many cases, it is preferable to include isotonic agents, such as sugar or sodium chloride.

Solutions and dispersants of RNA nanostructures as described herein can be prepared in water or another solvent or dispersion medium suitably mixed with one or more pharmaceutically acceptable excipients, including, But not limited to, surfactants, dispersants, emulsifiers, pH adjusters, and combinations thereof.

Suitable surfactants can be anionic surfactants, cationic surfactants, amphoteric surfactants or nonionic surfactants. Suitable anionic surfactants include, but are not limited to those containing carboxylate, sulfonate, and sulfate ions. Suitable anionic surfactants include sodium, potassium, and ammonium salts of long-chain alkyl sulfonates and alkyl aryl sulfonates, such as sodium dodecylbenzenesulfonate; dialkyl sodium sulfosuccinate, such as Bis-(2-ethylsulfoxy)-sodium sulfosuccinate; and alkyl sulfates, such as sodium lauryl sulfate. Suitable cationic surfactants include, but are not limited to quaternary ammonium compounds, such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene and coconut oil amine. Suitable nonionic surfactants include ethylene glycol monostearate, propylene myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4-oleate, acylated sorbitol Ester, acylated sucrose, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbate, polyoxyethylene octyl phenyl ether, PEG-1000 cetyl Ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, Poloxamer® 401, stearyl monoisopropanolamine, and polyoxyethylene hydrogenated tallow amide. Examples of amphoteric surfactants include sodium N-dodecyl-β-alanine, sodium N-lauryl-β-iminodipropionate, myristoyl amphoteric acetate, lauryl betaine, and lauryl sulfonate Betaine.

The formulation may contain preservatives to prevent the growth of microorganisms. Suitable preservatives include but are not limited to parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. The formulation may also contain antioxidants to prevent the degradation of RNA nanostructures.

The formulation can be buffered to pH 3-8 and used for parenteral administration after reconstitution. Suitable buffers include but are not limited to phosphate buffers, acetate buffers, and citrate buffers.

Water-soluble polymers can be used in formulations for parenteral administration. Suitable water-soluble polymers include, but are not limited to, polyvinylpyrrolidone, dextran, carboxymethyl cellulose, and polyoxyethylene. Sterile injectable solutions can be prepared by adding the required amount of RNA nanostructures to a suitable solvent or dispersion medium with one or more excipients listed above, as required, followed by filter sterilization. Dispersions can be prepared by adding various sterilized RNA nanostructures to a sterile carrier that contains a basic dispersion medium and the required other ingredients from those listed above. Sterile powders used to prepare sterile injectable solutions can be prepared by vacuum drying and freeze-drying techniques, which produce powders of RNA nanostructures plus any additional desired ingredients from previously sterilized filtered solutions. The powder can be prepared in such a way that the particles are porous in nature, which can increase the dissolution of the particles. Methods for preparing porous particles are well known in the art.

Pharmaceutical preparations for parenteral administration can be in the form of sterile aqueous solutions or particle suspensions formed from one or more RNA nanostructures. Acceptable solvents include, for example, water, Ringer's solution, phosphate buffered saline (PBS), and isotonic sodium chloride solution. The formulation may also be a sterile solution, suspension or emulsion, in a non-toxic parenterally acceptable diluent or solvent (eg 1,3-butanediol).

In some cases, the formulation may be dispersed or packaged in liquid form. In other aspects, formulations for parenteral administration can be packaged as solids, for example, obtained by freeze-drying a suitable liquid formulation. The solid can be reconstituted with a suitable carrier or diluent before application.

Solutions, suspensions or emulsions for parenteral administration can be buffered with an effective amount of buffer necessary to maintain a pH suitable for ocular administration. Suitable buffers include but are not limited to acetate, borate, carbonate, citrate, and phosphate buffers.

Solutions, suspensions or emulsions for parenteral administration may also contain one or more tonicity agents to adjust the isotonic range of the formulation. Suitable tonicity agents include but are not limited to glycerin, mannitol, sorbitol, sodium chloride, and other electrolytes.

Solutions, suspensions or emulsions for parenteral administration may also contain one or more preservatives to prevent bacterial contamination of ophthalmic products. Suitable preservatives include, but are not limited to, polyhexamethylene biguanide hydrochloride (PHMB), benzalkonium chloride (BAK), stable oxychloride complex (also known as Purite®), benzene acetate Mercury, chlorobutanol, sorbic acid, chlorhexidine, benzyl alcohol, parabens, thimerosal, and mixtures thereof.

Solutions, suspensions, or emulsions for nanotechnology (including nanoformulations for parenteral administration) may also contain one or more excipients, such as dispersing agents, wetting agents, and suspending agents.

Topical preparations

RNA nanostructures as described herein can be formulated for topical application. Suitable dosage forms for topical application include creams, ointments, salves, sprays, gels, lotions, emulsions, liquids, and transdermal patches. The formulation can be formulated for transmucosal, transepithelial, transendothelial, or transdermal administration. The topical formulation may include one or more chemical penetration enhancers, membrane permeability agents, membrane delivery agents, emollients, surfactants, stabilizers, and combinations thereof.

In some aspects, the RNA nanostructure can be administered in a liquid formulation (such as a solution or suspension), a semi-solid formulation (such as a lotion or ointment), or a solid formulation. In some aspects, the RNA nanostructure can be formulated as a liquid, including solutions and suspensions, such as eye drops, or as a semi-solid preparation, such as for topical application to the skin, to mucous membranes (such as the eye), to the vagina, Or ointment or lotion to the rectum.

The formulation may contain one or more excipients, such as softeners, surfactants, emulsifiers, penetration enhancers, and the like.

Suitable softeners include, but are not limited to, almond oil, castor oil, carob extract, cetearyl alcohol, cetyl alcohol, cetyl alcohol wax, cholesterol, cottonseed oil, cyclomethicone, ethylene glycol palm hard Fatty acid esters, glycerin, glyceryl monostearate, glyceryl monooleate, isopropyl myristate, isopropyl palmitate, lanolin, lecithin, light mineral oil, medium chain triglycerides, minerals Oil and lanolin alcohol, petrolatum, petrolatum and lanolin alcohol, soybean oil, starch, stearyl alcohol, sunflower oil, xylitol and combinations thereof. In some aspects, the softener may be ethylhexyl stearate and ethylhexyl palmitate.

Suitable surfactants include but are not limited to emulsifying wax, glyceryl monooleate, polyoxyethylene alkyl ether, polyoxyethylene castor oil derivatives, polysorbate, sorbitan ester, benzyl alcohol, benzoic acid Benzyl ester, cyclodextrin, glyceryl monostearate, poloxamer, povidone, and combinations thereof. In some aspects, the surfactant may be stearyl alcohol.

Suitable emulsifiers include but are not limited to gum arabic, metal soap, certain animal and vegetable oils, and various polar compounds, anionic emulsifying wax, calcium stearate, carbomer, cetearyl alcohol, cetyl alcohol, cholesterol, Diethanolamine, ethylene glycol palmitate stearate, glyceryl monostearate, glyceryl monooleate, hydroxypropyl cellulose, hypromellose, lanolin, hydrated, lanolin alcohol, egg Phospholipids, medium chain triglycerides, methyl cellulose, mineral oil and lanolin alcohol, sodium dihydrogen phosphate, monoethanolamine, non-ionic emulsifying wax, oleic acid, poloxamer, various poloxamers, polyoxyethylene Alkyl ether, polyoxyethylene castor oil derivative, polyoxyethylene sorbitan fatty acid ester, polyoxyethylene stearate, propylene glycol alginate, self-emulsifying glyceryl monostearate, sodium citrate dehydration Compound, sodium lauryl sulfate, sorbitan ester, stearic acid, sunflower oil, tragacanth, triethanolamine, xanthan gum and combinations thereof. In some aspects, the emulsifier may be glyceryl stearate.

Suitable classes of penetration enhancers include but are not limited to fatty alcohols, fatty acid esters, fatty acids, fatty alcohol ethers, amino acids, phospholipids, lecithin, cholate, enzymes, amines and amides, complexing agents (liposomes, cyclodextrins, Modified cellulose, and diimides), macrocyclic compounds (such as macrolides, ketones, and anhydrides and cyclic ureas), surfactants, N-methylpyrrolidone and its derivatives, DMSO and related compounds , Ionic compounds, azone, and related compounds, as well as solvents (such as alcohols, ketones, amides, polyols (eg, diols).

Suitable emulsions include but are not limited to oil-in-water emulsions and water-in-oil emulsions. Either or both phases of the emulsion may include surfactants, emulsifiers, and/or liquid non-volatile non-aqueous materials. In some aspects, the surfactant may be a nonionic surfactant. In other aspects, the emulsifier is an emulsifying wax. In a further aspect, the liquid non-volatile non-aqueous material is a glycol. In some aspects, the glycol is propylene glycol. The oily phase may contain other suitable oily pharmaceutically acceptable excipients. Suitable oily pharmaceutically acceptable excipients include but are not limited to hydroxylated castor oil or sesame oil, which can be used as surfactants or emulsifiers in the oil phase.

Lotions comprising RNA nanostructures as described herein are also provided. In some aspects, the lotion is in the form of an emulsion having a viscosity of 100 centistokes to 1000 centistokes. The fluidity of the lotion can allow rapid and uniform application over a wide surface area. The lotion can be formulated to dry on the skin, leaving a thin coating of its medicinal components on the skin surface.

Creams containing RNA nanostructures as described herein are also provided. The cream may contain emulsifiers and/or other stabilizers. In some aspects, the cream is in the form of a cream having a viscosity greater than 1000 centistokes (typically in the range of 20,000-50,000 centistokes). Compared to ointments, creams are easier to spread and easier to remove.

One difference between creams and lotions is viscosity, which depends on the amount/use of various oils and the percentage of water used to prepare the formulation. Creams can be thicker than lotions, can have a variety of uses, and can have more different oils/butters, depending on the desired effect on the skin. In some aspects of cream formulations, the water-based percentage can be about 60% to about 75% of the total amount, and the oil-based percentage can be about 20% to about 30% of the total amount, with the other percentages being emulsifiers, preservatives and The total amount of additives reached 100%.

Ointments containing RNA nanostructures as described herein and suitable ointment bases are also provided. Suitable ointment bases include hydrocarbon bases (eg, petrolatum, white petrolatum, yellow ointment, and mineral oil); absorption bases (hydrophilic petrolatum, anhydrous lanolin, lanolin, and cold cream); water-removable bases ( For example, hydrophilic ointment) and water-soluble base (for example, polyethylene glycol ointment). Pastes are usually different from ointments because they contain a large percentage of solids. Pastes are generally more absorbent and less greasy than ointments prepared with the same components.

Also described herein are gels, gelling agents, and liquid carriers containing RNA nanostructures as described herein. Suitable gelling agents include, but are not limited to, modified celluloses such as hydroxypropyl cellulose and hydroxyethyl cellulose; carbomer homopolymers and copolymers; thermoreversible gels and combinations thereof. Suitable solvents in the liquid carrier include, but are not limited to: diethylene glycol monoethyl ether; alkylene glycols, such as propylene glycol; isosorbide dimethyl; alcohols, such as isopropyl alcohol and ethanol. The solvents can be selected according to their ability to dissolve the drug. Other additives that can improve the skin feel and/or softening effect of the formulation can also be added. Such additives include but are not limited to isopropyl myristate, ethyl acetate, C12-C15 alkyl benzoates, mineral oil, squalane, cyclomethicone, capric/caprylic triglycerides, and combinations thereof .

Also described herein are foams that can include RNA nanostructures as described herein. The foam may be an emulsion combined with a gas propellant. The gas propellant may include hydrofluoroalkanes (HFA). Suitable propellants include HFA, such as 1,1,1,2-tetrafluoroethane (HFA 134a) and 1,1,1,2,3,3,3-heptafluoropropane (HFA 227), but are currently approved or Mixtures and additives of these and other HFAs that can be approved for medical use are suitable. The propellant may lack hydrocarbon propellant gas, which may generate flammable or explosive vapors during spraying. In addition, the foam may not contain volatile alcohol, which may generate flammable or explosive vapors during use.

Buffers can be used to control the pH of the composition. The buffer can buffer the composition as follows: from about pH 4 to about 7.5, from about pH 4 to about 7, or from about pH 5 to about 7. In some aspects, the buffer can be triethanolamine.

Preservatives can be included to prevent the growth of fungi and microorganisms. Suitable preservatives include, but are not limited to, benzoic acid, butyl paraben, ethyl paraben, methyl paraben, propyl paraben, sodium benzoate, sodium propionate, benzalkonium chloride , Benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenethyl alcohol, and thimerosal.

In certain aspects, the formulation can be provided by continuously delivering one or more formulations to a patient in need. For topical applications, repeated applications can be performed, or patches can be used to provide continuous administration of noscapine analogs for an extended period of time.

Enteral preparation

The RNA nanostructures described herein can be prepared in enteral formulations, such as for oral administration. Suitable oral dosage forms include tablets, capsules, solutions, suspensions, syrups, and lozenges. Tablets can be prepared using compression or molding techniques known in the art. Gelatin or non-gelatin capsules can be prepared as hard capsule shells or soft capsule shells, which can encapsulate liquid, solid and semi-solid filling materials using techniques well known in the art.

Formulations containing RNA nanostructures as described herein can be prepared using pharmaceutically acceptable carriers. "Carriers" as commonly used herein include, but are not limited to, diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof. Polymers used in dosage forms include, but are not limited to, suitable hydrophobic or hydrophilic polymers and suitable pH-dependent or independent polymers. Suitable hydrophobic and hydrophilic polymers include, but are not limited to, hydroxypropyl methyl cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, carboxymethyl cellulose, polyethylene glycol, ethyl cellulose, micro Crystalline cellulose, polyvinylpyrrolidone, polyvinyl alcohol, polyvinyl acetate, and ion exchange resins. "Carrier" also includes all components of the coating composition, which may include plasticizers, pigments, colorants, stabilizers, and glidants.

Formulations containing RNA nanostructures as described herein can be prepared using one or more pharmaceutically acceptable excipients, including diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers , Stabilizers, and combinations thereof.

Delayed release dosage formulations containing RNA nanostructures as described herein can be prepared as described in standard references, such as "Pharmaceutical dosage form tablets", eds. Liberman et. al. (New York, Marcel Dekker, Inc. , 1989), "Remington – The science and practice of pharmacy", 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, and "Pharmaceutical dosage forms and drug delivery systems", 6th Edition, Ansel et al., ( Media, PA: Williams and Wilkins, 1995). These references provide information about the excipients, materials, equipment, and methods used to prepare tablets and capsules and delayed-release dosage forms of tablets, capsules, and granules. These references provide information about carriers, materials, equipment and methods for preparing tablets and capsules and delayed release dosage forms of tablets, capsules and granules.

Formulations containing RNA nanostructures as described herein can be coated with a suitable coating material, for example, to delay release once the particles pass through the acidic environment of the stomach. Suitable coating materials include but are not limited to cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, hydroxypropyl methyl cellulose phthalate and Hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic polymers and copolymers, and available under the trade name EUDRAGIT® (Roth Pharma, Weiterstadt) (Westerstadt, Germany) commercially available methacrylic resin, zein, shellac, and polysaccharides.

The coating may be formed in different proportions of water-soluble polymers, water-insoluble polymers and/or pH-dependent polymers, and may or may not have water-insoluble/water-soluble non-polymer excipients to produce the desired release profile. The coating can be carried out on (matrix or simple) dosage forms, which include, but are not limited to, tablets (compressed with or without coated pills), capsules (with or without coated pills), pills, granules The composition, "as is" is formulated as, but not limited to, in the form of a suspension or in the form of a spray.

In addition, the coating material may contain conventional carriers such as plasticizers, pigments, colorants, glidants, stabilizers, pore formers, and surfactants. Optional pharmaceutically acceptable excipients include, but are not limited to, diluents, binders, lubricants, disintegrants, colorants, stabilizers, and surfactants.

Diluents, also known as "fillers", can be used to increase the volume of solid dosage forms to provide a practical size for compressing tablets or forming pills and granules. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starch, pre-treated Gelatinized starch, silica gel, titanium oxide, magnesium aluminum silicate and powdered sugar. Common diluents include inert powdered materials (such as starch), powdered cellulose (especially crystalline and microcrystalline cellulose), sugars (such as fructose, mannitol and sucrose), grain flour and similar edible powders. Typical diluents include, for example, various types of starch, lactose, mannitol, kaolin, calcium phosphate or sulfate, inorganic salts such as sodium chloride and powdered sugar. Powdered cellulose derivatives are also useful.

Binders can impart agglomeration properties to solid dosage forms, and thus can ensure that tablets or pills or granules remain intact after forming the dosage form. Suitable binder materials include, but are not limited to, starch, pregelatinized starch, gelatin, sugar (including sucrose, glucose, dextrose, lactose and sorbitol), polyethylene glycol, wax, natural and synthetic gums such as Acacia, tragacanth, sodium alginate, cellulose, including hydroxypropyl methyl cellulose, hydroxypropyl cellulose, ethyl cellulose, and veegum, and synthetic polymers such as acrylic acid and Acrylic acid copolymer, methacrylic acid copolymer, methyl methacrylate copolymer, aminoalkyl methacrylate copolymer, polyacrylic acid/polymethacrylic acid and polyvinylpyrrolidone. Typical tablet binders include substances such as starch, gelatin, and sugars such as lactose, fructose, and glucose. Natural gums and synthetic gums, including gum arabic, alginate, methyl cellulose, and polyvinylpyrrolidone can also be used. Polyethylene glycol, hydrophilic polymers, ethyl cellulose and wax can also be used as binders.

Lubricants may be included to facilitate tablet manufacturing. Suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glyceryl behenate, polyethylene glycol, talc, and mineral oil. Lubricants can be included in tablet formulations to prevent the tablets and punches from sticking in the die. The lubricant may be selected from smooth solids such as talc, magnesium and calcium stearate, stearic acid and hydrogenated vegetable oil.

Disintegrants can be used to promote the disintegration or "disintegration" of the dosage form after administration, and generally include, but are not limited to, starch, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethyl cellulose, hydroxypropyl Cellulose, pregelatinized starch, clay, cellulose, alginine, gum or cross-linked polymers, such as cross-linked PVP (Polyplasdone® XL from GAF Chemicals).

Stabilizers can be used to inhibit or delay drug decomposition reactions, which include, for example, oxidation reactions. Suitable stabilizers include, but are not limited to, antioxidants, butylated hydroxytoluene (BHT); ascorbic acid, its salts and esters; vitamin E, tocopherol and its salts; sulfites such as sodium metabisulfite; cysteine and its derivatives Citric acid; propyl gallate, and butylated anisole (BHA).

Extra active agent

In some aspects, a certain amount of one or more additional active agents is included in a pharmaceutical formulation containing RNA nanostructures. Suitable additional active agents include, but are not limited to, DNA, RNA, modified ribonucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, ribozymes that inhibit the translation or transcription of essential tumor proteins and genes Leading sequences, hormones, immunomodulators, antipyretics, sedatives, antipsychotics, analgesics, antispasmodics, anti-inflammatory drugs, antihistamines, anti-infectives, and chemotherapeutics (anticancer drugs). Other suitable additional active agents include sensitizers (such as radiation sensitizers). RNA nanostructures can be used as monotherapy or in combination with other active agents to treat or prevent diseases or disorders.

Suitable hormones include, but are not limited to, amino acid-derived hormones (eg, melatonin and thyroxine), small peptide hormones, and protein hormones (eg, thyrotropin releasing hormone, antidiuretic hormone, insulin, growth hormone, luteinizing hormone, progestin Follicle hormones, and thyroid stimulating hormones), arachidic acid (such as arachidonic acid, lipoxygen, and prostaglandin), and steroid hormones (such as estradiol, testosterone, and tetrahydrotestosterone cortisol).

Suitable immunomodulators include but are not limited to prednisone, azathioprine, 6-MP, cyclosporine, tacrolimus, methotrexate, interleukins (eg IL-2, IL-7 and IL-12 ), cytokines (eg interferon (eg IFN-α, IFN-β, IFN-ε, IFN-κ, IFN-ω, and IFN-γ), granulocyte colony stimulating factor, and imiquimod), Chemokines (eg, CCL3, CCL26, and CXCL7), cytosine guanosine phosphate, oligodeoxynucleotides, dextran, antibodies, and aptamers).

Suitable antipyretics include but are not limited to non-steroidal anti-inflammatory drugs (eg ibuprofen, naproxen, ketoprofen, and nimesulide), aspirin and related salicylates (eg salicylate bile Alkali, magnesium salicylate, and sodium salicylate), acetaminophen/acetaminophen, analgin, nabumetone, antipyrine, and quinine.

Suitable sedatives include, but are not limited to, benzodiazepines (e.g., alprazolam, brozepam, chlordiazepoxide, clonazepam, cloramic acid, diazepam, fluazepam, lorazepam Pan, oxazepam, temazepam, triazolam, and tofisopam), serotonin antidepressants (eg, selective serotonin reuptake inhibitors, tricyclic antidepressants, and monoamine oxidase inhibitors) , Mebicar, afobazole, selank, bromantane, emoxypine, azapirone, barbiturate, hydroxyzine, pregabalin, validomide, and beta-blockers Agent.

Suitable antipsychotics include, but are not limited to, benpiridol, bromideridol, droperidol, haloperidol, motiperon, pipaperone, telmipirone, flupirin, Pentafluridol, pimozide, acepromazine, chlorpromazine, cyanomelazine, dizyrazine, fluphenazine, levomepromazine, mesoridazine, prolaprazine, piperacin Azine, hydroperazine, piperazine, prochlorperazine, promazine, promethazine, azirazine, thiopromazine, thioetherazine, trifluoperazine, triflupromazine, cloprom Thioxanthin, clopithioxine, flupentixol, tilvothione, chlorothiatan, clothipine, quetiapine, azirazine, capipramine, chlorcapramine, morpholine indone, Mosapamine, sulpiride, verapride, amisulpride, amoxapine, aripiprazole, asenapine, clozapine, buranserin, iloperidone, lurasidone , Meperone, nemopril, olanzapine, paliperidone, perippirone, quetiapine, remipril, risperidone, sertindole, trimethoprim, ziprasidone , Zotepine, alstonie, biphene, bioptopterin, epiperazole, cannabidiol, caliprazine, pimofanserin, pomaglumetad methionil, pencarxerin, nomeline, and zilol Zicronapine.

Suitable analgesics include, but are not limited to, acetaminophen/acetaminophen, nonsteroidal anti-inflammatory drugs (eg, ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 Inhibitors (eg, rofecoxib, celecoxib, and etoricoxib), opioids (eg, morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, butyl (Prenorphine), tramadol, norepinephrine, fluoxetine, nefopam, orphenadrine, pregabalin, gabapentin, cyclobenzaprine, scopolamine, methadone, ketomidone, pipenimide , And aspirin and related salicylates (eg, choline salicylate, magnesium salicylate, and sodium salicylate).

Suitable antispasmodic agents include, but are not limited to, mebeverine, paverine, cyclobenzaprine, caripordol, orphenadrine, tizanidine, metaxalone, Methocarbamol, chlorzoxazone, baclofen, dantrolene, baclofen, tizanidine and dantrolene.

Suitable anti-inflammatory drugs include but are not limited to prednisone, non-cholesterol anti-inflammatory drugs (such as ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (such as rofecoxib) , Celecoxib and etoricoxib), and immunoselective anti-inflammatory derivatives (eg, submandibular peptide-T and its derivatives).

Suitable antihistamines include, but are not limited to, H1-receptor antagonists (eg, atorvastatin, azelastine, piracetin, brompheniramine, buclizine, bromazine, card Bisamin, Cetirizine, Chlorpromazine, Secrizine, Chlorpheniramine, Chloromastatin, Cyproheptadine, Desloratadine, D-Brompheniramine, D-Chlorphenamine, Tea dimenhydrinate, dimethoxidine, diphenhydramine, doxylamine, doxylamine, ebastine, embramin, fexofenadine, hydroxyzine, levocetirzine (levocetirzine) , Loratadine, meclizine, mirtazapine, olopatadine, orphenadrine, benzenamine, pheniramine, phentoxamine, promethazine, pyrimidinamine, quetiapine, Rupatadine, Trippiramine, and Triprolidine), H2-receptor antagonists (eg, cimetidine, famotidine, lafutidine, nizatidine, ranitidine (rafitidine ) And Roxatidine), Tratoquinoline, Catechin, Cromoglicate, Nedocromil, and β2-adrenergic agonists.

Suitable anti-infective agents include, but are not limited to, anti-amebic drugs (eg, nitazoxanide, paromomycin, metronidazole, tnidazole, chloroquine, and diiodoquinoline), Aminoglycosides (eg, paromomycin, tobramycin, gentamicin, amikacin, kanamycin, and neomycin), anthelmintic drugs (eg, thiamidine, mebendazole, Ivermectin, praziquantel, albendazole, mitofosin, thiabendazole, olniquiquin), antifungal agents (for example, azacarbo antifungal agents (for example, itraconazole, Fluconazole, posaconazole, ketoconazole, clotrimazole, miconazole, and voriconazole), echinocandins (for example, caspofungin, anifene, and micafungin), gray Flavomycin, terbinafine, flucytosine, and polyenes (eg, nystatin and amphotericin b), antimalarial drugs (eg, pyrimethamine/sulfadoxine, artemisinin methyl ether/ Phenfluorenol, atovaquone/proguanil, quinine, hydroxychloroquine, mefloquine, chloroquine, doxycycline, pyrimethamine, and haflutriline), anti-tuberculosis agents (eg, salicylate (Eg, aminosalicylic acid), isoniazid/rifampin, isoniazid/pyrazinamide/rifampin, bedaquinoline, isoniazid, ethambutol, rifampin, rifampin Ting, rifapentine, crimpycin, and cycloserine), antiviral agents (eg, amantadine, amantadine ethylamine, abacavir/lamivudine, emtricitabine/tenofovir , Compistat/elvitegravir/emtricitabine/tenofovir, efavirenz/emtricitabine/tenofovir, abacavir/lamivudine/zidovudine, lamivudine /Zidovudine, emtricitabine/tenofovir, emtricitabine/lobinavir/ritonavir/tenofovir, interferon alpha-2v/ribavirin, PEG interferon Alpha-2b, Maraviro, Retevir, Dulutvir, Enfuvirtide, Foscarnet, Formimivir, Oseltamivir, Zanamivir, Nevirapine, Efavirenz, Etravir Velin, Lipivirin, Dilavudine, Nevirapine, Entecavir, Lamivudine, Adefovir, Sofosbuvir, Didanoxin, Tenofovir, avacivr, Qi Dovudine, Stavudine, Entrica, Zalcitabine (xalcitabin), telbivudine, cimipirvir, popprevir, trapavir, lopinavir/ritonavir , Fosanavir, darunavir, ritonavir, tilanavir, atazanavir, nelfinavir, amprenavir, indinavir, sawuinavir Bavelin, valcyclovir, acyclovir, famciclovir, ganciclovir, and valganciclovir), carbapenems (eg, doripenem, meropenem, ertapenem , And cilastatin/imipenem), cephalosporins (eg, cefadroxil, cefradine, cefazolin, cefalexin, cefepime, ceflaroline, cephalosporin, cephalosporin) Tetan, Cefuroxime, Cefalozil, Cefaclor, Cefoxitin, Cefaclor, Cefbutene, Ceftriaxone sodium, Cefotaxime, Cefpodoxime, Cefpodoxime Dine, cefixime, cefditoren, cefizoxime, and ceftazidime, glycopeptide antibiotics (eg, vancomycin, dalbavancin, oritavancin, and telavancin ( telvanci n)), glycines (eg, tigecycline), anti-leprosy drugs (eg, clofazimine and thalidomide), lincomycin and its derivatives (eg, clindamycin) And lincomycin), macrolides and their derivatives (eg, telithromycin, fidaxomicin, erythromycin, azithromycin, clarithromycin, dirithromycin, and acetocin) , Linezolid, sulfamethoxazole/trimethoprim, rifaximin, chloramphenicol, fosfomycin, metronidazole, aztreonam, bacitracin, β-lactam antibiotics (benzylpenicillin (benzene Chaxen and benzyl penicillin), phenoxymethyl penicillin, cloxacillin, flucoxacillin, methicillin, temoxicillin, mecillin, azlocillin, mezlocillin, piperacillin, amoxicillin Xicillin, ampicillin, baxicillin, carbenicillin, piperacillin, ticarcillin, amoxicillin/clavulanic acid, ampicillin/sulbactam, piperacillin/tazobactam, ravic acid/ti Casillin, penicillin, procaine penicillin, oxacillin, dicloxacillin, nefcillin, cefazolin, cephalexin C, cephalosporin, cefaclor, cefaclor, cefadazole, cefuroxime, Cefotetan, cefoxitin, cefiximine, cefotaxime, cefpodoxime, ceftazidime, ceftriaxone sodium, cefepime, cefpirome, ceftaroline, biapenem, doripenem , Ertapenem, faropenem, imipenem, meropenem, panipenem, azupenem, tibipenem, sanamycin, aztreonam (azrewonam), tigemonan, novo Carmycin A, taboxinine, and β-lactam), quinolones (eg, lomefloxacin, norfloxacin, ofloxacin, qatifloxacin, moxifloxacin, ciprofloxacin, levofloxacin, gemimifloxacin, Cifloxacin, Cinofloxacin, Nalidixic acid, Enoxacin, Grefloxacin, Gatifloxacin, Travafloxacin, and Sparfloxacin), Sulfas (eg, sulfamethoxazole/methoxazole) Benzidine, sulfasalazine, and sulfisoxazole), tetracyclines (eg, doxycycline, demeclocycline, minocycline, doxycycline/salicylic acid, doxycycline/omega-3 Unsaturated fatty acids, and tetracycline), and urinary system anti-infectives (eg, nitrofurantoin, urotropine, fosfomycin, cinoxacin, nalidixic acid, trimethoprim, and methylene blue).

Suitable chemotherapeutic agents include, but are not limited to, paclitaxel, brentuximab vedotin, doxorubicin, 5-FU (fluorouracil), everolimus, pemetrexed, melphalan, par Midronate, anastrozole, exemestane, nairabine, ofatumumab, bevacizumab, belistastat, tosimumab, carmustine, bleomycin, Bosutinib, busulfan, alemtuzumab, irinotecan, vandetanib, bicalutamide, lomustine, daunorubicin, clofarabine, carbotinib, actinomycin D, ramucirumab, cytarabine, cyclophosphamide, cyclophosphamide nitrogen mustard, decitabine, dexamethasone, docetaxel, hydroxyurea, nitrimidamine, leuprolide, Epirubicin, oxaliplatin, asparaginase, estramustine, cetuximab, vemodegi, Erwinia chrysanthemum asparaginase, amifostine, etoposide, flutamide Mite, toremifene, fulvestrant, letrozole, degarelix, pratrexa, methotrexate, fluorouridine, atorizumab, gemcitabine, afatinib, alpha Itatinib sulfonate, carmustine, ireblin, trastuzumab, hexamethonamine, topotecan, panatinib, idarubicin, ifosfamide, ibrutinib, a Cetinib, interferon alpha-2a, gefitinib, romidepsin, ixabepilone, rusotinib, cabazitaxel, ado-trastuzumab maytansin conjugate, carfil Zomi, chlorambucil, sagrostim, cladribine, mitoxantine, vincristine, procarbazine, megestrol, trimetinib, mesna sodium, strontium chloride-89, Dichloromethyldiethylamine, mitomycin, busulfan, gemtuzumab ozogamicin, vinorelbine, filgrastim, PEG filgrastim, sorafenib, nilumi Tetra, pentostatin, tamoxifen, mitoxantrone, pemenidase, deneukin diftitox, alivet A acid, carboplatin, pertuzumab, cisplatin, pomalidol Amine, prednisone, aldesleukin, mercaptopurine, zoledronic acid, lenalidomide, rituximab, octreotide, dasatinib, regofenib, histamine relin, sunitinib , Stupimab, homoharringtonine, thioguanine (tioguanine), dabrafenib, erlotinib, bexarotene, temozolomide, thiotepa, thalidomide, BCG, temsirolimus, bendamustine hydrochloride, triptorelin, aresnic trioxide, lapatinib, penrorubicin, panitumumab, vinblastine, bortezomib , Retinoic acid, azacitidine, pazopanib, teniposide, leucovorin, crizotinib, capecitabine, enzalutamide, ipilimumab, goserelin, volta Linotastat, Idelaris, Seretinib, Abiraterone, Epothilone, tafluposide, imazathiopurine, deoxyflurouridine, vindesine, all-trans retinoic acid , And other anti-cancer agents listed elsewhere in this article.

Method for using RNA nanostructure and its preparation

RNA nanostructures and their formulations can be used to deliver one or more cargo compounds to subjects or cells in need thereof. In some aspects, the RNA nanostructure can be used to deliver RNA or DNA molecules for replacement gene/transcript therapy, delivering RNAi or similar RNA (eg, microRNA) to a subject to specifically inhibit RNA transcription To reduce the gene expression of a particular gene or multiple genes, deliver imaging agents, deliver small molecule drugs, and/or deliver any other cargo compounds that can be encapsulated in the RNA nanostructures provided herein. Therefore, the RNA nanostructure can be used to deliver therapeutic, prophylactic and/or diagnostic compounds to subjects in need thereof.

In some aspects, the RNA nanostructures described herein can be contacted with cells or their populations. In some aspects, the cell or population thereof is sensitized to treatment or prevention delivered by the RNA nanostructure. In some aspects, the RNA nanostructure is delivering sensitizers. In some aspects, the delivered cargo compound is not a sensitizer. In one aspect, after administration of the RNA nanostructure, the subject can be sensitized for treatment. In one aspect, the increased sensitivity to treatments such as therapeutic agent treatments (such as provided by cargo compounds delivered by the RNA nanostructure) can be measured according to one or more methods known in the art for specific treatments Or reduced sensitivity. In one aspect, methods of measuring sensitivity to treatment include, but are not limited to, cell proliferation assays and cell death assays. In one aspect, the sensitivity of a cell or subject to treatment can be determined by comparing the sensitivity of the cell or subject after administration of the disclosed therapeutic agent composition with cells or subjects that have not been administered the disclosed therapeutic agent composition The sensitivity of the person is compared or measured or determined.

For example, in one aspect, after administration of the sensitizer and/or the RNA nanostructure (such as an RNA nanostructure carrying a sensitizer), the cells may be more sensitive to treatment than cells not administered the sensitizer Sensitive 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14 -Times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times or more. In one aspect, after administration of the disclosed therapeutic agent composition, cells may be less resistant to treatment than cells that are not administered a sensitizer (such as a sensitizer delivered by the RNA nanostructure described herein). 2 ​- times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times Times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times or more. Determining the sensitivity or resistance of cells or subjects may be routine in the art and within the skill of ordinary clinicians and/or researchers.

In one aspect, determining the sensitivity or resistance of a cell or subject to treatment can be monitored. For example, in one aspect, data on sensitivity and resistance may be obtained periodically, such as for the lifespan of a subject (eg, a human subject or a patient with cancer and/or abnormal cell growth) per week , Every other week, every month, every other month, every 3 months, 6 months, 9 months, or every year, every other year, every 5 years, every 10 years. In one aspect, data on sensitivity and resistance can be obtained at different times rather than at periodic times. In one aspect, the subject's treatment can be altered based on data about the sensitivity or resistance of the cell or subject to the treatment. For example, in one aspect, the treatment can be changed by changing the dosage of the disclosed composition, the route of administration of the disclosed composition, the frequency of administration of the disclosed composition, and the like.

In some aspects, where the RNA nanostructure includes a photodegradable linker that links a targeting moiety and/or cargo compound, the RNA nanostructure can be applied to a subject or cell population. After administration, light can be applied to the area and/or population of cells in need of treatment or prevention in a subject in need thereof to cause the release of the RNA nanostructure and/or cargo molecule.

RNA nanostructures as provided herein can be administered to a subject, cell, or population thereof in need thereof. The subject in need thereof may have cancer, genetic disease or condition, virus, bacteria, parasites and/or fungal infections, or will benefit from any effective agent being delivered (such as cargo compounds described herein) Other diseases or conditions. The amount delivered can be an effective amount of the RNA nanostructure provided herein. The subject in need thereof may be symptomatic or asymptomatic. In some aspects, the RNA nanostructures provided herein can be co-administered with another active agent. It will be understood that co-administration may refer to additional compounds included in the formulation or provided in a dosage form separate from the RNA nanostructure or formulation thereof. The effective amount of the RNA nanostructure or its formulation (such as those disclosed herein) may range from about 0.1 mg/kg to about 500 mg/kg. In some aspects, the effective amount ranges from about 0.1 mg/kg to 10 mg/kg. In another aspect, the effective amount ranges from about 0.1 mg/kg to 100 mg/kg. If a further aspect, the effective amount ranges from about 0.1 mg to about 1000 mg. In some aspects, the effective amount may be about 500 mg to about 1000 mg.

The administration of the RNA nanostructure and its formulation can be systemic or local. The compounds and formulations described herein can be administered to a subject in need thereof one or more times per day. In one aspect, the compound and/or formulation thereof can be administered once a day. In some aspects, the compound and/or formulations thereof can be administered once a day. In another aspect, the compound and/or formulation thereof can be administered twice a day. In some aspects, when administered, an effective amount of the compound and/or formulation is administered to a subject in need thereof. The compound and/or formulations thereof can be administered once or multiple times per week. In some aspects, the compound and/or formulation thereof can be administered 1 day per week. In other aspects, the compound and/or formulation thereof can be administered for 2 to 7 days per week.

In some aspects, the RNA nanostructure and/or formulations thereof can be administered in a dosage form. The amount or effective amount of the compound and/or its preparation can be divided into multiple dosage forms. For example, the effective amount can be divided into two dosage forms, and the first dosage form can, for example, be administered in the morning, and the second dosage form can be administered in the evening. Although the effective amount was given in two doses throughout the day, the subject received the effective amount. In some aspects, the effective amount is from about 0.1 to about 1000 mg per day. The effective amount in the dosage form may range from about 0.1 mg/kg to about 1000 mg/kg. The dosage form can be formulated for oral, vaginal, intravenous, transdermal, subcutaneous, intraperitoneal, or intramuscular administration. The preparation of dosage forms for various routes of administration is described elsewhere herein.

The modular RNA motifs described herein and the RNA nanostructures described herein can be used to prepare drugs for treating diseases or cancers.

Many aspects of the application have been described. However, it will be understood that various modifications can be made without departing from the spirit and scope of the present application. Therefore, other aspects are within the scope of the attached patent application.

Examples

Example 1: RNA-based micelles: a platform for chemotherapeutic drug loading and delivery.

RNA can be used as a powerful building module for bottom-up manufacturing of nanostructures for biotechnology and biomedical applications. In addition to current self-assembly strategies that utilize base pairing, motif stacking, and tertiary interactions, we report for the first time the construction of RNA-based micelle nanostructures with pRNA 3-way junctions (3WJ) conjugated to branches Cholesterol molecule on the helix end of the motif. The obtained amphiphilic RNA micelles consist of a hydrophilic RNA head and a covalently attached hydrophobic lipid tail, which can assemble spontaneously in an aqueous solution through hydrophobic interaction. Using the characteristics of the pRNA 3WJ branch structure, assembled RNA micelles can escort a variety of functional modules. As a proof of concept for the delivery of therapeutic agents, paclitaxel is loaded onto the RNA micelles with significantly improved water solubility. The successful construction of drug-loaded RNA micelles was confirmed and characterized by agarose gel electrophoresis, atomic force microscopy (AFM), dynamic light scattering (DLS), and Nile Red fluorescence encapsulation assay. The critical micelle formation concentration is as low as about 100 nM. Paclitaxel-loaded RNA micelles can internalize into cancer cells and inhibit their proliferation. Further research showed that paclitaxel-loaded RNA micelles induced cancer cell apoptosis in a Caspase-3 dependent manner, but RNA micelles alone showed low cytotoxicity. Finally, paclitaxel-loaded RNA micelles target tumors in the body without accumulating in healthy tissues and organs. There is also no or very low induction of proinflammatory responses. Therefore, multivalence, cancer cell permeability, combined with controlled assembly, low or no toxicity, and tumor targeting are all promising features that make our pRNA micelles a suitable platform for potential drug delivery.

Introduction

Functional nanoparticles prepared by molecular self-assembly have great application prospects in biotechnology and biomedicine [1-4]. Among these, RNA has been used as a unique biological material to construct a wide variety of nanoparticles through self-assembly [Li, H. et al. Adv. Mater. 28 (2016) 7501-7507; Guo, P. Nature Nanotechnology 5 (2010) 833-842; Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Shu, Y. et al. Methods 54 (2011) 204-214; Haque, F. et al. Nano Today 7 (2012) 245-257; Afonin, KA et al. Nano.Lett. 12 (2012) 5192-5195; Shu, Y. et al. Nat.Protoc. 8 (2013) 1635-1659; Khisamutdinov, E. et al. Nucleic Acids Res. 42 (2014) 9996-10004; Jasinski, D. et al. ACS Nano 8 (2014) 7620-7629; Khisamutdinov, EF et al. Advanced Materials 28 (2016) 100079-100087; Afonin, KA et al. Nano Lett. 14 (2014) 5662-5671; Dibrov, SM et al. Proc.Natl.Acad.Sci.USA 108 (2011) 6405-6408; Afonin, KA et al. Nat.Nanotechnol. 5 (2010 ) 676-682]. It has been demonstrated that these RNA nanoparticles are further functionalized for biomedical applications [Lee, JB et al. Nat. Mater. 11 (2012) 316-322; Lee, TJ et al. Oncotarget 6 (2015) 14766-14776; Cui , D. et al. Scientific reports 5 (2015) 10726; Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Rychahou, P. et al. ACS Nano 9 (2015) 1108-1116; Binzel, D. Et al. Molecular Therapy 24 (2016) 1267-1277; Afonin, KA et al. Nat.Protoc. 6 (2011) 2022-2034]. The strategy of RNA nanoparticle self-assembly has been previously reported. The use of RNA base pairing and tertiary interaction provides a multifunctional RNA assembly with nanometer-level precise control of their composition, structure, and function [Shu, Y. et al. Nat.Protoc. 8 ( 2013) 1635-1659; Khisamutdinov, EF et al. Methods Mol Biol 1316 (2015) 181-193]. In this study, we examined the strategy for making RNA self-assembly with micellar properties through intermolecular hydrophobic interaction.

Described herein is the design and manufacture of a stable phi29 pRNA 3-way junction (3WJ) motif, which can be used to construct multivalent RNA nanoparticles with high chemical and thermodynamic stability Skeleton [Guo, P. Nature Nanotechnology 5 (2010) 833-842; Haque, F. et al. Nano Today 7 (2012) 245-257]. The size and shape of the obtained branched RNA nanoparticles are uniform. They can perform different functions while maintaining their third-level folding and independent functions both in vitro and in vivo [Haque, F. et al. Nano Today 7 (2012) 245-257; Jasinski, D. et al. ACS Nano 8 (2014) 7620-7629; Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Shu, Y. et al. RNA 19 (2013) 766-777; Khisamutdinov, EF et al. ACS Nano. 8 (2014) 4771-4781; Li, H. et al. Nucleic Acid Ther. (2015) 25(4):188-97; Lee, TJ et al. Mol Ther. (2017) 25(7):1544-1555; Shu, D. et al. Nucleic Acids Res. (2014) 42(2):e10]. Fluorescent dye molecules [Shu, D. et al. EMBO J. 26 (2007) 527-537] and specific cell targeting ligands [Shu, D. et al. ACS Nano 9 (2015) 9731-9740 are also shown ; Rychahou, P. et al. ACS Nano 9 (2015) 1108-1116; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Lee, TJ et al. Mol Ther. (2017) 25(7 ): 1544-1555; Pi, F. et al. Nat Nanotechnol. (2018) 13(1): 82-89] can be covalently linked to the RNA strand by RNA solid-phase synthesis or by post-transcription chemical conjugation [ Shu, Y. et al. Methods 54 (2011) 204-214; Shu, Y. et al. Nat.Protoc. 8 (2013) 1635-1659; Raouane, M. et al. Bioconjug.Chem 23 (2012) 1091 -1104]. The feasibility of RNA molecules modified by different chemical and functional parts proves the potential of RNA nanoparticles as a multifunctional drug delivery platform.

The DNA micelle construct has been described [Gosse, C. et al. J Phys Chem B 108 (2004) 6485-6497; Wu, Y. et al. Proc Natl Acad Sci US A 107 (2010) 5- 10; Liu , H. et al. Chemistry 16 (2010) 3791-3797; Chen, T. et al. Angew. Chem Int. Ed Engl. 52 (2013) 2012-2016; Jeong, JH et al. Bioconjug. Chem 12 (2001 ) 917-923; Dentinger, PM et al. Langmuir 22 (2006) 2935-2937; Alemdaroglu, FE et al. Angew.Chem Int.Ed Engl. 45 (2006) 4206-4210; Trinh, T. et al. Chem Commun. (Camb.) 52 (2016) 10914-10917; Li, Z. et al. Nano Letters 4 (2004) 1055-1058; Alemdaroglu, FE et al. Adv. Mater. 20 (2008) 899-902]. By fusing the lipophilic portion to one of the helix ends of the pRNA-3WJ branch, the hydrophilic RNA molecule can be converted into an amphiphilic construct. This amphiphilic construct behaves like a phospholipid, while it spontaneously self-assembles into a monodisperse three-dimensional micelle nanostructure with a lipid core and branched RNA outer crown as an aqueous solution The result of hydrophobic interaction between molecules. And current DNA micelle systems (their applications are limited by their single functionality) [Wu, Y. et al. Proc Natl Acad Sci US A 107 (2010) 5-10; Jeong, JH et al. Bioconjug.Chem 12 (2001) 917-923] different, pRNA micelles can covalently link different types of functional moieties to a single particle, including chemical drugs for cancer treatment, imaging parts for nanoparticle tracking and for combination therapy The co-delivered RNAi component.

Paclitaxel (PTX) isolated from the bark of Taxus brevifolia [Wani, MC et al. J Am. Chem Soc 93 (1971) 2325-2327] is one of the most effective chemotherapeutic drugs for various cancer types One [Spencer, CM et al. Drugs 48 (1994) 794-847; Rowinsky, EK et al. N. Engl. J Med. 332 (1995) 1004-1014; Jordan, MA et al. Nat Rev. Cancer 4 ( 2004) 253-265]. The mechanism of paclitaxel for cancer treatment is to promote and stabilize microtubules and further inhibit the G2 or M phase of the cell cycle, and then cell death [Horwitz, S.B. et al. Trends Pharmacol. Sci 13 (1992) 134-136]. However, according to the Biopharmaceutical Classification System (BCS), paclitaxel has been classified as a Type IV chemical because of its low water solubility (~ 0.4 μg/mL) and low permeability. The first paclitaxel formulation used was in a 1:1 (v: v) mixture of Cremophor EL (polyoxyethylene castor oil) and dehydrated ethanol, diluted with 0.9% sodium chloride or 5% dextrose solution 5 ~ 20 times for intravenous administration [Singla, AK et al. Int. J Pharm 235 (2002) 179-192]. However, it has been observed that formulations containing Cremophor oil cause severe side effects [Gelderblom, H. et al. Eur. J Cancer 37 (2001) 1590-1598] and unexpectedly non-linear plasma pharmacokinetics [Sparreboom, A.. et al. Cancer Res 56 (1996) 2112-2115]. Therefore, alternative paclitaxel formulations have been extensively explored, especially with nanoparticle-based delivery systems [Kim, S.C. et al. J Control Release 72 (2001) 191-202]. Taking advantage of nano-sized size, targeted tumor delivery and biocompatibility, encapsulation of paclitaxel in the nano delivery system can increase the half-life of the drug circulation, reduce its systemic toxicity, reduce side effects, improve pharmacokinetics and pharmacodynamic properties And show better patient coordination. Paclitaxel albumin-bound nanoparticles (Abraxane®) were approved by the FDA in 2005. Paclitaxel liposomes (Lipusu®), polymer micelles (Genexol PM®) and polymeric conjugates with polyglutamate (Xyotax®) are currently commercially available paclitaxel formulations. In addition, there are various types of paclitaxel nanoparticle formulations that are either under development or in clinical trials, such as polymer-based nanoparticles [Hamaguchi, T. et al. Br.J Cancer 97 (2007) 170-176; Dong, Y. et al. Biomaterials 25 (2004) 2843-2849; Kim, K. et al. J Control Release 146 (2010) 219-227], lipid-based nanoparticles [Yoshizawa, Y. et al. Int. J Pharm 412 (2011) 132-141; Yuan, H. et al. Int. J Pharm 348 (2008) 137-145], polymer-drug conjugates [Khandare, JJ et al. Bioconjug. Chem 17 (2006) 1464 -1472; Bedikian, AY et al. Melanoma Res 14 (2004) 63-66], inorganic nanoparticles [Hwu, JR et al. J Am.Chem Soc 131 (2009) 66-68], carbon nanotubes [Lay, CL et al. nanotechnology 21 (2010) 065101], nanocrystals [Deng, J. et al. Int. J Pharm 390 (2010) 242-249], etc. However, the formulation of paclitaxel to RNA-based nano delivery platforms has never been reported.

This example particularly describes the design and construction of a well-defined RNA-micelle system to encapsulate paclitaxel by conjugation with pRNA-3WJ-lipid. This is the first report of an RNA-paclitaxel micelle with significantly enhanced paclitaxel water solubility and tumor permeability. The obtained RNA micelles showed low critical micelle formation concentration (CMC), excellent cell binding and permeability, and effective inhibition of cancer cell proliferation by inducing Caspase-3 dependent apoptosis in vitro. Finally, it was demonstrated that these drug-loaded RNA micelles can be delivered systemically to tumors with favorable tumor targeting, thereby minimizing drug retention in healthy tissues and key organs. There is also no or very low induction of proinflammatory responses. All these findings indicate the strong potential of the RNA-micelle system as a suitable drug delivery platform for cancer treatment. These RNA micelles can be used for tumor-specific targeting, reducing the effective dose of drugs and further reducing the side effects of chemotherapy. The RNA micelles described herein may be a robust and safe nano delivery system to carry anti-cancer drugs for specific tumor targeting and treatment with minimal side effects to fight cancer and improve the quality of life of patients.

Materials and Method

Synthesis of RNA chains conjugated with paclitaxel by "click chemistry"

To synthesize PTX-azide, a 1:2:2:1 equivalent of paclitaxel (Alfa Aesar), 6-azidohexanoic acid (azido-HA) (Chem-Impex International Corporation) ), N,N'-dicyclohexylcarbodiimide (DCC) (Acros Organics) and 4-(dimethylamino)pyridine (DMAP) (Sigma Aldrich) weighed to a double neck Bottom flask. The reaction mixture was dissolved in about 20 mL of dry methylene chloride (DCM) and reacted at room temperature while stirring under a nitrogen atmosphere for 24 hours. The reaction solution was filtered and concentrated on a rotary gasifier. The concentrated reaction solution was further purified by silica gel chromatography with n-hexane: ethyl acetate series solvent cleaning. The fractions containing the purified product were combined and dried. The purified final product PTX-azide is characterized by nuclear magnetic resonance (NMR) spectroscopy.

5'-alkynyl-RNA was synthesized by standard RNA solid phase chemical synthesis using 5'-hexynyl phosphoramidite (Glen Research). The theoretical yield of labeled RNA strands is about 68% (0.9819 = 0.68), with an average coupling efficiency of 98%.

To 5 μL of 2 mM RNA-alkyne aqueous solution, add 2 μL of PTX-azide (50 mM, 5 equivalents, 3:1 (v/v) DMSO (dimethyl sulfoxide, extremely dry, Acros Organics) /tBuOH (tert-butanol, anhydrous, Sigma-Aldrich)), 3 μL of freshly prepared “click solution”, which contains a 1:2 molar ratio of 0.1 in DMSO/tBuOH 3:1 M CuBr (copper (I) bromide, Sigma-Aldrich) and 0.1 M TBTA (tri[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine, Sigma-Aldrich Derich). The reaction mixture was mixed well and reacted at room temperature for 3 hours. The success of the reaction was determined by 20% 8 M urea PAGE in TBE (89 mM Tris base-borate, 2 mM EDTA) buffer. The reaction solution was then diluted with 100 μL of 0.3 M NaOAc (sodium acetate) and 1 mL of 100% ethanol for RNA precipitation. The precipitate was dissolved in water and used for purification on an Agilent PLRP-S 4.6x 250 mm 300 Å column using ion pair reverse phase HPLC. PTX labeled RNA was separated from unreacted RNA-alkynes in an acetonitrile ramp. The flow rate of 1.5 mL/min was equilibrated in 95% solvent A (0.1 M TEAA, HPLC grade H2O) and 5% solvent B (0.1 M TEAA, 75% acetonitrile, 25% HPLC grade H2O). The sample was filtered through a 0.2 μm rotary filter, loaded on the column, and then eluted by a gradient from 5% to 100%B in the course of 30 minutes. Collect fractions, combine and exchange buffers. The final RNA-PTX conjugate was characterized by mass spectrometry.

Design and construction of 2’-F modified pRNA-3WJ-PTX micelle

A bottom-up approach was used to construct RNA micelles [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667]. The pRNA-3WJ-PTX micelle consisting of three fragments, a3WJ, b3WJ and c3WJ is functionalized as follows: Paclitaxel (Alfa Aesa) (a3WJ-5'PTX) on the 5'-end of a3WJ as a treatment Module; cholesterol at the 3'-end of b3WJ (b3WJ-3'chol) as a lipophilic module; and Alexa 647 (Alexa Fluor® 647, Invitrogen) at the 3'-end of c3WJ (c3WJ-3' Alexa647) as a near infrared (NIR) imaging module. The control RNA nanoparticles are not a therapeutic module called pRNA-3WJ micelles, no lipophilic module called pRNA-3WJ-PTX, and not both a lipophilic module called pRNA-3WJ and a therapeutic module particle.

Use the following pRNA-3WJ scaffold [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667] sequence: a3WJ 5'-UUgCCaUgUgUaUgUggg-3' (SEQ ID NO: 16); b3WJ 5'-CCCaCaUaCUUUgUUgaUCC-3 '(SEQ ID NO: 17); c3WJ 5'-ggaUCaaUCaUggCaa-3' (SEQ ID NO: 18) (capital letters indicate 2'fluoro (2'-F) modified nucleotides). Use commercially available 2'-TBDMS adenosine (n-bz) CED, 2'-TBDMS guanosine (n-ibu) CED, 2'-fluorocytidine (n-ac) CED and 2'-fluorouridine The phosphoric acid monomer of CED was synthesized by standard solid-phase chemical synthesis method [Lay, CL et al. nanotechnology 21 (2010) 065101], and then deprotected according to the experimental protocol provided by the manufacturer (Azco Biotech). A chemically selective Cu(I)-catalyzed Huisgen 1,3-dipolar cycloaddition reaction ("click chemistry") to conjugate paclitaxel (PTX) to the a3WJ 5'-terminus and reverse phase as described above HPLC purification. Following the manufacturer's instructions, cholesterol was attached to the 3'-end of the b3WJ chain by using a 3'-cholesteryl-TEG CPG vector (Glen Research Corporation). The theoretical yield of b3WJ-3’chol is ~ 68% (0.9819 = 0.68), with an average coupling efficiency of 98%. Ion-pair reverse phase columns are used to purify synthesized RNA from the terminated strand, which usually produces a complete label of cholesterol during solid-phase synthesis. The RNA chain labeled with Alexa647 was purchased from Trilink Bio Technologies (LLC).

By mixing in equimolar concentration in TMS buffer (50 mM Tris pH 8.0, 100 mM NaCl, 10 mM MgCl2) or PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 2 mM KH2PO4, pH 7.4) 3WJ chains (a3WJ, b3WJ, and c3WJ) to assemble pRNA-3WJ-PTX micelles, then heated to 80°C for 5 minutes, and slowly cooled to 37°C during 40 minutes, followed by incubation at 37°C for 1 hour.

Characterization of assembled pRNA-3WJ micelles

The assembly of functionalized 3WJ nanoparticles was characterized by a 1% (w/v) agarose gel migration assay in TAE (40 mM Tris-acetate, 1 mM EDTA) buffer. After electrophoresis, the gel was stained with ethidium bromide and visualized by Typhoon FLA 7000 (GE healthcare).

Pre-assembled pRNA-3WJ-PTX (20 μM in PBS buffer) and pRNA-3WJ-PTX micelles were measured by Zetasizer nano-ZS (Malvern Instrument, Ltd) at 25 ℃ (10 μM in PBS buffer) apparent hydrodynamic diameter. The data comes from three independent measurements. The zeta potential of pRNA-3WJ-PTX micelles (1 μM in PBS buffer) was also measured by Zetasizer nano-ZS (Malver Instruments Co., Ltd.) at 25°C.

The size and shape of RNA micelles are also determined by atomic force microscopy (AFM). For AFM, 10 μM pRNA-3WJ-PTX micelle solution dissolved in TMS buffer was deposited onto freshly cut mica and dried overnight. After two consecutive rinsing steps with HPLC-grade water, the mica was mounted on Bruker Multimode IV AFM and imaged in tap mode.

The successful formation of RNA micelles is also determined by the Nile red encapsulation assay as previously reported [Edwardson, TGW et al. Nature Chemistry 5 (2013) 868-875; Zhang, A. et al. Soft Matter 9 (2013) 2224 -2233]. A 5 mM Nile Red stock solution in acetone was used for all experiments. Briefly, pRNA-3WJ micelles assembled at 0 µM, 1 µM, 5 µM and 10 µM were incubated with 100 µM Nile Red in TMS buffer, respectively. The mixture was heated to 80°C for 5 minutes and slowly cooled to 37°C in 40 minutes, followed by incubation at 37°C for 1 hour. The fluorescence intensity of Nile red relative to the concentration of RNA micelles was measured on a Fluorolog spectrofluorometer (Horiba Jobin Yvon) with an excitation wavelength of 535 nm and an emission spectrum of 560 nm to 760 nm. pRNA-3WJ was used as a control.

Determine the critical micelle formation concentration (CMC)

The CMC of pRNA-3WJ micelles was determined by fluorescent Nile red-red encapsulation assay [Zhang, A. et al. Soft Matter 9 (2013) 2224-2233] and agarose gel electrophoresis as previously reported. Briefly, a 2-fold serial dilution of RNA micelle samples (in the range of 5 μM to 0.005 μM) was incubated with 100 μM Nile Red in a final volume of 50 μL. The sample was heated to 80°C for 5 minutes and slowly cooled to 37°C within 40 minutes, followed by incubation at 37°C for 1 hour. The fluorescence intensity of Nile Red relative to the concentration of RNA micelles was measured using a Fluorolog spectrofluorometer (Horiba Jobin Yvon) with an excitation wavelength of 535 nm and an emission spectrum of 560 nm to 760 nm. A 2-fold serially diluted RNA micelle sample (in the range of 2.5 nM to 0.0390625 μM) was directly loaded onto a 1% (w/v) agarose gel for electrophoresis in TAE buffer at 120V. The gel was stained with ethidium bromide and visualized by Typhoon FLA 7000.

Formulation stability determination

The 2 μM solution of pRNA-3WJ micelles was incubated at 37 ℃ for 1 hour in acidic (pH=4), neutral (pH=7.4) and alkaline (pH=12) buffers. The final 2 μM pRNA-3WJ micelles were also incubated for 1 hour at different temperatures (4 ℃, 37 ℃, and 65 ℃). All samples after incubation were loaded on a 1% (w/v) agarose gel for electrophoresis in TAE buffer at 120V. The gel was stained with ethidium bromide and visualized by Typhoon FLA 7000.

Cell culture

Human KB cells (American Type Culture Collection, ATCC) were grown and cultured in RPMI-1640 (Thermo Scientific) containing 10% FBS in a 37°C incubator under 5% CO2 and humid atmosphere . Mouse macrophage-like RAW 264.7 cells were moistened with 5% CO2 in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 units/mL penicillin and 100 mg/mL streptomycin at 37°C. Cultivate in the air.

In vitro binding assay using flow cytometry

250 nM, 500 nM, and 1 μM Alexa647-labeled pRNA-3WJ-PTX micelles and control pRNA-3WJ-PTX nanoparticles without lipophilic modules were each incubated with 2×105 KB cells at 37°C for 1 hour. After washing twice with PBS, the cells were resuspended in PBS. Flow cytometry was performed by UK flow cytometry & cell sorting core equipment to observe the cell binding efficacy of Alexa647 labeled pRNA-3WJ-PTX micelles. The data was analyzed by FlowJo 7.6.1 software.

In vitro binding and internalization assays using confocal microscopy

KB cells were grown overnight on glass slides. 1 μM Alexa647-labeled pRNA-3WJ-PTX micelles and control pRNA-3WJ-PTX nanoparticles without lipophilic modules were each incubated with cells at 37°C for 1 hour. After washing with PBS, the cells were fixed with 4% paraformaldehyde (PFA) and washed 3 times with PBS. The cytoskeleton of the fixed cells was treated with 0.1% Triton-X100 in PBS for 5 minutes to increase the permeability of the cell membrane, and then stained with Alexa Fluor 488 phalloidin (Life Technologies) for 30 minutes at room temperature, and then with PBS Rinse for 3×10 minutes. Cells were encapsulated with Prolong® Gold anti-quenching reagent containing DAPI (Life Technologies), and DAPI was used for nuclear staining. Cell binding and cell internalization were then measured by FluoView FV1000 filter confocal microscope system (Olympus Corp.).

In vitro drug release assay of pRNA-3WJ-PTX

10 μM pRNA-3WJ-PTX conjugate was incubated with 50% FBS at 37° C. and at different time points (1 hour, 4 hours, 8 hours, 12 hours, 15 hours, 22 hours, 28 hours, and 36 hours) Collect samples and immediately freeze at -80 ℃. After sample collection was completed over the entire time course, all samples were electrophoresed on TBM buffer (89 mM Tris base-borate, 5 mM MgCl2) on 15% non-denaturing PAGE. The gel bands were quantified by ImageJ, and the percentage of intact particles was calculated as% of intact particles = [(strength of upper band)/(strength of upper band + strength of lower band)] × 100%. The upper band represents the complete RNA-drug conjugate, while the lower band represents the RNA oligonucleotide after drug release.

MTT determination

To determine the cytotoxic effect from pRNA-3WJ-PTX micelle therapy, follow the manufacturer's instructions and use the CellTiter 96 non-radioactive cell proliferation assay (Promega) to measure changes in cell viability. Briefly, 1×104 KB cells were seeded into 96-well plates the day before the assay. On the next day, pRNA-3WJ-PTX micelles of 1 μM, 800 nM, 600 nM, 400 nM and 200 nM were added to the wells and repeated three times. Paclitaxel alone, pRNA-3WJ micelles, pRNA-3WJ-PTX and pRNA-3WJ were used as controls at the same test concentration. The plate was incubated at 37°C for 48 hours in a humidified 5% CO2 atmosphere. After incubation, add 15 μl of staining solution to each well and incubate the plate at 37°C for up to 4 hours in a humidified 5% CO2 atmosphere. Next, add 100 μL of solubilizing solution/stop mixture to each well and incubate for 1 hour. Finally, the contents of the wells were mixed to obtain a uniformly colored solution and their absorbance at 570 nm was recorded on a Synergy 4 microplate reader (Bio-Tek).

Apoptosis in an in vitro cell model

As previously reported, the FITC Annexin V cell apoptosis detection kit (BD Pharmingen) and the Caspase-3 assay kit (BD Pharmingen) were used to study the apoptosis induced by pRNA-3WJ-PTX micelle therapy. For FITC Annexin V staining assay, KB cells were seeded in 12-well plates overnight. Then, cells were treated with 1 μM pRNA-3WJ-PTX micelles (~ 30% fusion). Controls included paclitaxel, pRNA-3WJ micelles, and pRNA-3WJ. According to the manufacturer's instructions, after incubation with RNA micelles for 48 hours, KB cells were trypsinized into a single cell suspension. After two PBS washes, the cells were resuspended in 100 μL 1× Annexin V-FITC binding buffer. Then 5 μL of Annexin V-FITC and 5 μL of propidium iodide (PI) were added to each sample and incubated at room temperature for 25 minutes. Finally, the sample was added to a flow tube containing 200 μL of 1× binding buffer and used for FACS analysis within 1 hour.

For the Caspase-3 assay, KB cells were seeded on 24-well plates overnight. The cells were then treated with 1 μM pRNA-3WJ-PTX micelles (approximately 30% fusion). Controls included paclitaxel, pRNA-3WJ micelles, and pRNA-3WJ. Following the manufacturer's instructions, the Caspase-3 activity of the cells was measured and compared by the Caspase-3 assay kit (BD Pharmingen). Briefly, at different time points (4 hours, 8 hours, 12 hours, and 24 hours) after induction of apoptosis, the cell lysate (1-10×106 cells/cell) was prepared using the cold cell lysis buffer provided by the kit. mL) and incubate on ice for 30 minutes. For each sample, add 2 μL of reconstituted Ac-DEVD-AMC in 80 μL 1×HEPES buffer to 25 μL of cell lysate and incubate at 37°C for 1 hour. The amount of AMC released from Ac-DEVD-AMC was measured on a Fluorolog fluorescence spectrometer (Horiba Jobin Yvon) with an excitation wavelength of 380 nm and an emission wavelength of 400-500 nm.

Animal model

All experimental protocols involving animals are implemented under the supervision of the University of Kentucky Animal Protection and Utilization Committee (IACUC). To generate xenograft models, 4-8 week old female athymic nu/nu mice were purchased from Taconic. Subcutaneous tumor xenografts were established by injecting KB cells resuspended in sterile PBS into the left shoulder of nude mice at 2×106 cells/site. When tumor nodules reached a volume of 50 mm3 approximately 5 days after injection, mice were used for tumor targeting studies.

NIR fluorescence imaging to detect RNA micelles targeting cancer xenografts in vivo

In order to study the delivery of pRNA-3WJ-PTX micelles in vivo, 100 μL 20 μM Alexa 647-labeled pRNA-3WJ-PTX micelles and pRNA-3WJ -PTX were injected into the tail vein of mice bearing KB tumors, respectively. The estimated final concentration in the blood is about 1 μM) after which a fluorescence imaging study is performed. Mice injected with PBS were used as negative fluorescence controls. Full-body images were taken at 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, and 24 hours. 24 hours after injection, the mice were sacrificed by inhaling CO2 and subsequent neck-breaking, and the main internal organs including the heart, lung, liver, spleen, and kidney from the sacrificed mice were collected together with the tumor, and IVIS was used. A spectroscopy workstation (Caliper Life Science) performs fluorescence imaging with 640 nm excitation and 680 nm emission to evaluate biodistribution patterns.

Evaluate the proinflammatory induction of pRNA-3WJ micelles

For in vitro evaluation of pro-inflammatory cytokine induction, 2.5 × 105 RAW 264.7 cells were seeded per well in 24 well plates and cultured overnight. Dilute pRNA-3WJ micelles (1 μM or 200 nM) and lipopolysaccharide (LPS, 3.6 μg/mL, equal to 200 nM pRNA-3WJ micelles) in DMEM (Life Technologies) and add to The cells were incubated three times. After 16 hours of incubation, the cell culture supernatant was collected and immediately stored at -80°C for further analysis. Following the manufacturer's instructions, use the mouse ELISA MAX Deluxe kit (BioLegend, San Diego, California, USA) to detect TNF-α and IL6 in the collected supernatant, while using the mouse IFN α ELISA kit ( PBL Assay Science, Piscataway, New Jersey, USA) detects IFN-α.

For in vivo evaluation of proinflammatory cytokine and chemokine induction, pRNA-3WJ micelles (1 μM), LPS (10 μg per mouse) and DPBS controls were injected into 4 to 6 week old male C57BL via tail vein /6 mice. Three hours after injection, blood samples were collected from mice by cardiac puncture and centrifuged at 12,800×g for 10 minutes to collect serum. Following the manufacturer's instructions, the serum levels of TNF-α, IL6 and IFN-α were measured by ELISA as described above. Following the manufacturer's instructions, chemokine induction was measured using a mouse chemokine chip kit (R & D Systems, Minneapolis, Minnesota, USA). LiCor is used to quantify dots.

Statistical Analysis

For each sample tested,

Each experiment was repeated 3 times. Unless otherwise stated, the results are presented as mean ± SD. Statistical differences were assessed using student T-tests, and p> 0.05 was considered significant.

Results and discussion

Construction and characterization of pRNA-3WJ micelles

The pRNA-3WJ-PTX micelle utilizes a modular design consisting of three short RNA fragments from the pRNA 3WJ motif [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667] (Figure 1A). By considering the global folding structure of the pRNA 3WJ motif, the lipophilic modular cholesterol was conjugated to the 3'-end of b3WJ. The crystal structure of the pRNA 3WJ motif shows that the angles of the three helices (H1, H2, and H3) spanning pRNA 3WJ are about 60° (H1-H2), about 120° (H2-H3), and about 180° (H1- H3) [Zhang, H. et al. RNA 19 (2013) 1226-1237] (Figure 1B). In order to avoid the steric hindrance of the formation of micelles due to the branched 3WJ structure, cholesterol molecules are placed on H3, which is farthest from the other two helices H1 and H2. Our current design involves the use of a therapeutic module (paclitaxel) and an imaging module (Alexa 647 dye) to functionalize H1 without interfering with micelle formation (Figure 1C, Figure 1D). As shown in the following study, the functions of conjugated chemotherapeutic drugs and detection dyes are also fully retained. The unoccupied helix H2 can be further activated with RNAi modules (such as siRNA or microRNA) for combination therapy to produce enhanced or synergistic therapeutic effects.

After mixing the chains in PBS or TMS buffer at an equimolar ratio, the complex was assembled at high efficiency, as shown in the 1% agarose gel migration assay (Figure 1E). The RNA micelles labeled with Alexa 647 also showed fluorescent bands, which corresponded to the band indicating the successful formation of micelles (Figure 1E). The assembly of RNA micelles was further demonstrated by AFM, which showed a uniform spherical structure (Figure 2A). DLS measurement showed that the average hydrodynamic diameter of pRNA-3WJ-PTX micelles was 118.7±14.50 nm compared with 7.466±1.215 nm of the core framework of pRNA-3WJ (Figure 2B). The constructed pRNA-3WJ-PTX micelles are also negatively charged. As shown in Figure 2C, the zeta potential is -26.1 ± 10.4 mV. Finally, RNA micelle formation was analyzed by Nile red encapsulation assay. Nile Red is a hydrophobic dye and hardly emits light in a large amount of aqueous solution, but its inclusion in a non-polar microenvironment (such as a lipid core of a micelle structure) leads to a strong fluorescence enhancement [Greenspan, P. et al. J Cell Biol 100 (1985) 965-973]. Therefore, the increase in fluorescence intensity associated with the incubation of different concentrations of RNA micelles with a fixed amount of Nile Red dye indicates the formation of RNA micelles in the buffer solution (Figure 2D). In contrast, no significant increase in fluorescence intensity was observed in the control pRNA-3WJ without lipid core (Figure 2D).

In order to make pRNA-3WJ micelles chemically stable in vivo, 2'-F modified U and C nucleotides were used during RNA strand synthesis [Behlke, MA Oligonucleotides. 18 (2008) 305-319; Vestweber, H. et al . Synthetic Metals 68 (1995) 263-268]. The 2'-F modified RNA nanoparticles proved to be chemically stable and showed a longer circulation half-life than their unmodified RNA counterparts [Shu, D. et al. Nature Nanotechnology 6 (2011) 658- 667; Behlke, MA Oligonucleotides. 18 (2008) 305-319]. The presence of 2'-F nucleotides not only makes RNA nanoparticles resistant to RNase degradation, but also enhances the melting temperature of pRNA-3WJ [Binzel, DW et al. Biochemistry 53 (2014) 2221-2231], and Does not damage the true folding and functionality of the core and incorporated modules [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Liu, J. et al. ACS Nano 5 (2011) 237-246 ].

The stability of the pRNA-3WJ formulation relative to pH (acidic pH 4, neutral pH 7.4, and alkaline pH 12) and temperature (4 ℃, 37 ℃, and 65 ℃) was further determined. The results show that pRNA-3WJ micelles are stable under a wide range of temperatures and acidic and neutral conditions. Although the pRNA-micelle shows dissociation under alkaline conditions as reported in Figure 8, the pRNA-3WJ micelle formulation is significantly chemically and thermodynamically stable under physiological conditions (pH 7.4, 37°C).

Synthesis of RNA chains conjugated with paclitaxel by "click chemistry"

To load the pRNA micelles with a therapeutic module, PTX was first functionalized with -azido (-N3) to further react with the alkyne-modified RNA. In the presence of N,N'-dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino)pyridine (DMAP), in anhydrous dichloromethane, using a 6-azidohexanoic acid linker to pass the ester The azido group on 2'-OH is introduced into PTX to provide azido-functionalized PTX (PTX-N3) as the main product (Figure 9A). Although both hydroxyl groups at the 7'and 2'positions of PTX are chemically reactive, 2'-OH generally shows higher reactivity than 7'-OH because 7'-OH is acetylated in aqueous media It is very unstable and loses the C -7 substituent quickly [Skwarczynski, M. et al. J Med. Chem 49 (2006) 7253-7269]. After purification, PTX-N3 functional at the 2'position was obtained with a yield of 73%. 1H NMR mass spectrometry was used to confirm the chemical structure of PTX-N3 in CDCl3. In the 1H NMR mass spectrum of PTX-N3, 7'-CH resonates at 4.40 ppm, and no significant chemical shift changes in the 7-CH-OH signal (at 4.4 ppm) were observed before and after esterification. (Figure 9B), and the resonance of the 2'-CH proton shifted from 4.78 ppm (before esterification) to 5.46 ppm (after esterification) (Figure 9C).

As shown in FIG. 3A, PTX-N3 reacts with -alkyn modified RNA (a3WJ) with an efficiency greater than 90% through copper I-mediated click reaction. Successful conjugation was confirmed by 20% 8 M urea PAGE (Figure 3B) and mass spectrometry. The experimental mass of a3WJ-PTX measured by mass spectrometry is 6939.2 (m/z), which is close to the theoretical mass (6936.82 (m/z)) calculated based on the chemical structure (Figure 3C). The ester bond formed between paclitaxel and RNA can be hydrolyzed in the presence of an esterase or in an aqueous solution, which allows for slow release of the loaded drug in a controlled manner as indicated by in vitro drug release assays (Figure 3A, 3D). This is the first report of the RNA molecule "clicking" with the chemotherapy drug paclitaxel. PTX conjugation does not interfere with the gradual assembly of pRNA-3WJ (Figure 10A). This is also the first time that it has been demonstrated that the fusion of paclitaxel with RNA oligonucleotides increases the water insolubility. The 1 mM RNA-paclitaxel conjugate dissolved in DEPC H2O showed a clear solution compared to the cloudy solution prepared with equal concentrations of paclitaxel in DEPC H2O (Figure 10B). The significantly improved water solubility of paclitaxel after conjugation to RNA and assembly into micelle nanostructures allows the use of physiological saline solutions for in vivo administration instead of Cremophor EL formulations. In addition to click chemistry, use other chemical coupling reactive groups, such as -NH2/-NHS -NH2/-COOH, or -SH/-maleimide to functionalize RNA oligonucleotides and drug candidates Chemical is also a feasible RNA-drug conjugation method, which can be applied to drug candidates that are not suitable for click chemistry.

Determination of critical micelle formation concentration

To determine the critical micelle formation concentration (CMC) of pRNA-3WJ-PTX micelles, the Nile Red assay as previously reported was used [Zhang, A. et al. Soft Matter 9 (2013) 2224-2233]. Nile Red is a hydrophobic dye that has low fluorescence in water and other polar solvents, but emits strong fluorescence in non-polar environments (such as the lipid core of micelles). Therefore, the Nile Red fluorescence emission intensity is used as an indicator of micelle formation. To determine CMC, the fluorescence intensity of Nile Red is plotted as a function of sample concentration. As shown in FIG. 11A, Nile Red exhibits low fluorescence intensity at a concentration below 0.078 μM, indicating that Nile Red is in water and there are few micelles. As the concentration increased, the fluorescence intensity increased significantly, indicating that Nile Red was encapsulated in the lipid core of the RNA micelles. The CMC can be estimated as the intersection of the tangent of a horizontal line with a relatively constant intensity ratio and a diagonal line with a rapidly increasing intensity ratio (FIG. 11B ). The CMC was approximately 100 nM and the 1% TAE agarose gel further confirmed that the CMC was approximately 150 nM due to sensitivity limitations (Figure 11C). All pRNA micelle concentrations used in in vitro and in vivo experiments are higher than CMC to ensure the formation of micelles.

pRNA-3WJ-PTX micro-united and internalized into KB cells

To determine tumor cell targeting in vitro, pRNA-3WJ-PTX micelles and control pRNA-3WJ-PTX without lipophilic modules were incubated with KB cells, trypsinized, washed, and then sorted by fluorescence-activated cells ( FACS) determination for analysis. Compared with the pRNA-3WJ-PTX scaffold control (0% binding), pRNA-3WJ-PTX micelles were observed to have strong binding (almost 100%) (Figure 4A). Confocal microscopy imaging further confirmed that pRNA-3WJ-PTX micelles effectively bind and internalize into cancer cells, as evidenced by the excellent overlap of fluorescent RNA nanoparticles (Figure 4B) and cytoplasm (Figure 4B). For the control pRNA-3WJ-PTX without the lipophilic module, a very low signal was observed. These results indicate that RNA micelles have a high affinity for cancer cell binding. Although the current RNA micelle design does not include a tumor-specific targeting module, highly charged RNA micelles (because RNA is negatively charged, also shown in zeta potential studies) can be similar to DNA micelles as previously reported in When interacting with cells, it disintegrates itself and inserts into the cell membrane [Liu, H. et al. Chemistry 16 (2010) 3791-3797]. Without being bound by theory, it is believed that the internalization of RNA micelles may be mediated by subsequent endocytosis after insertion into the cell membrane.

Effect of pRNA-3WJ-PTX micelles on the growth and apoptosis of cancer cells in vitro

To determine the cellular effect of RNA micelle treatment, MTT assay was performed to analyze the cell viability after treatment. Compared to RNA micelles alone and the 3WJ control without paclitaxel conjugate, RNA micelles containing PTX can successfully inhibit tumor cell growth at 250 nM or more (Figure 5A). No concentration below 125 nM was evaluated to maintain above CMC. The inhibition of cell growth caused by pRNA-3WJ-PTX micelles indicates that paclitaxel is released from the RNA chain due to the hydrolysis of the linker ester in the aqueous solution. Since all RNA-PTX conjugates undergo HPLC purification, the possibility of free paclitaxel contaminating the test construct is very small. In addition, the pRNA-3WJ micelles that do not contain paclitaxel have no effect on cell viability and proliferation, suggesting the low cytotoxicity of the RNA micelle backbone and its potential as a safe drug delivery platform.

As shown in FIG. 5B, FITC-labeled Annexin V staining confirmed that most cancer cell death was due to apoptosis. Loss of plasma membrane is one of the earliest features of apoptotic cells. Membrane phospholipid phosphatidylserine (PS) externalizes from the inner layer to the outer layer of the plasma membrane so that FITC-labeled annexin V binds to PS to detect cells undergoing apoptosis. FITC annexin V staining is used in conjunction with PI to identify early apoptotic cells (Q3: PI negative, FITC annexin V positive) and cells in late apoptosis or have died (Q2: FITC annexin V and PI Positive). In our study, more than 30% of cells were treated with pRNA-3WJ-PTX micelles for 48 hours compared to control micelles without PTX (4.52%) or pRNA-3WJ without PTX (3.7%) After undergoing apoptosis, this indicates that the change in cancer viability is due to the induction of apoptosis.

Caspase-3 is a marker of early apoptosis. The increase of Caspase-3 activity is closely related to apoptosis. The increase in Caspase-3 activity, as reflected by the increased fluorescence intensity, appeared 12 hours after treatment with pRNA-3WJ-PTX micelles (Figures 12A-12F). It was found that compared to the control nanoparticles (pRNA-3WJ micelles and pRNA-3WJ), pRNA-3WJ-PTX micelle-treated cell lysate showed the highest fluorescence emission similar to paclitaxel alone, which indicated apoptosis Was induced in a Caspase-3 dependent manner (Figure 5C).

Targeting tumors in xenograft animal models by using NIR fluorescent pRNA-3WJ-PTX micelle imaging

The tumor targeting efficiency of pRNA-3WJ-PTX micelles was studied by collecting in situ fluorescence images of tumor xenografts in nude mice at different time points after injection. The image of the tumor area becomes easy to determine 4 hours after injection (Figures 6A-6D and Figure 13). Ex vivo images of normal tissues, organs and tumors obtained from mice injected with RNA micelles showed that tumors taken 24 hours after injection showed the strongest signal (Figure 6E-6G). Figures 6H-6I show that RNA micelles bind and internalize to cancer cells in vitro. Flow cytometry compared the binding affinity to KB cells after 1 hour of treatment. The confocal microscope shows the internalization distribution. Blue: cell nucleus; green: cytoskeleton; red: RNA nanoparticles. 6J-6L show in vitro studies of RNA micelles carrying anti-miR21. The dual-luciferase assay demonstrated the delivery of anti-miR21 to KB cells. qRT-PCR showed the effect of miR21 knockdown on the expression of target gene PTEN. Caspase-3 assay showed that it induced apoptosis after treatment. 6M-6N show in vivo biodistribution studies in mice with xenografts. Whole body imaging. Ex vivo organ imaging 8 hours after injection. Figures 6-6R show the in vivo therapeutic effect of RNA micelles in mice with xenografts. Tumor regression curve during 5 injections (red arrow shows injection day). Body weight curve of mice during treatment. qRT-PCR and Western blotting showed that PTEN was up-regulated after delivery of anti-miR21 in vivo. In terms of kinetics of tumor accumulation, RNA nanoparticles reached their highest accumulation 4 hours after injection, and remained longer in tumors than in healthy organs and tissues, which indicates a high tumor of constructed RNA micelles Targeting efficiency and tumor retention ability. This unique tumor retention behavior of RNA micelles indicates that the delivery system takes advantage of the EPR (enhanced permeability and retention) effect in view of its nanoscale size and particle shape. In addition, the RNA micelle construct showed prolonged tumor retention due to its larger particle size. By including, for example, folic acid on the empty helix branch of the RNA micelle [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Lee, TJ et al. Mol Ther. (2017) 25(7): 1544-1555; Zhang, H. et al. RNA 19 (2013) 1226-1237; Rychahou, P. et al. Methods Mol Biol 1297 (2015) 121-135; Guo, S. et al. Gene Ther 13 (2006 ) 814-820] and RNA aptamers [Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Pi, F. et al . Nanomedicine 13 (2016) 1183-1193]'s tumor targeting module can further ensure the specificity of RNA micelle nanoparticles in vivo tumor targeting.

pRNA-3WJ micelles did not induce or induce a pro-inflammatory response

The pro-inflammatory response may potentially be composed of the RNA component [Guo, S. et al. Mol Ther Nucleic Acids. 2017 9:399-408] and the cholesterol component [Tall, AR et al. Nat Rev. Immunol. 15 (2015) 104-116] Both are induced. To address this concern, the production of pro-inflammatory cytokines and chemokines after pRNA-3WJ micelle treatment was evaluated both in vitro and in vivo. Tumor necrosis factor-α (TNF-α) is a cytokine involved in systemic inflammation and is one of the cytokines causing acute phase reactions [Jaffer, U. et al. HSR Proc Intensive Care Cardiovasc. Anesth. 2 (2010) 161-175]. Interleukin 6 (IL6) is an interleukin that acts as both a pro-inflammatory cytokine and an anti-inflammatory myokine. IL6 is secreted during infection to stimulate the immune response [Scheller, J. et al. Biochim. Biophys Acta 1813 (2011) 878-888]. IFN-α interferon (which belongs to type I interferon) is also a cytokine involved in the pro-inflammatory response released in response to the presence of viral pathogens. The results in Figure 7A show that when incubated with mouse macrophage-like cells in vitro, the high-dose (1 μM) and low-dose (200 nM) pRNA-3WJ micelles neither induced IL6 production when compared to the LPS positive control. Nor does it induce IFN-α production. The induction of TNF-α was undetectable under the treatment of low dose pRNA-3WJ- micelles, but increased slightly when treated with high dose RNA RNA micelles. As shown in FIG. 7B, compared with the LPS control, all three cytokines were not induced after intra-injection of pRNA-3WJ-microbodies into immunocompetent C57BL/6 mice.

Chemokines are the main proinflammatory mediators [Wang, Z.M. et al. J Biol Chem 275 (2000) 20260-20267; Turner, M.D. et al. Biochim. Biophys Acta 1843 (2014) 2563-2582]. After processing within the pRNA-microgroup, an increase in the production of 25 chemokines was detected. As shown in Figure 7C, it can be demonstrated that compared with the PBS group, the pRNA-3WJ micelles did not induce new chemokines. As highlighted by the red box in Figure 14, there are three chemokines (macrophage inflammatory protein-1 γ (MIP-1γ), chemokine 10 (C10) and monocyte chemotaxis compared to the PBS control Protein 2 (MCP2)) showed elevated induction. In conclusion, the pRNA-3WJ micelle formulation did not induce or only induced a very low proinflammatory response.

In summary, the design and construction of micelles based on well-defined pRNA, which consist of a hydrophobic lipid core and a hydrophilic pRNA-3WJ corona, are described in particular in this example. The chemotherapy drug paclitaxel has been loaded into RNA micelles, with significantly improved water solubility. It is also proved that the paclitaxel-loaded pRNA micelles exhibit excellent tumor cell binding and internalization, and effectively induce cytotoxic effects on tumors in vitro. After injection of pRNA-micelles, there was no or very low induction of proinflammatory response. Systemic injection of pRNA micelles into a xenograft mouse model achieved tumor targeting without accumulating into normal organs and tissues. Figure 13 shows the time course of tumor targeting within the pRNA-3WJ-PTX microgroup. P: PBS; M-PTX: pRNA-3WJ-PTX micelles.

The branched pRNA-3WJ outer crown confers unparalleled versatility, which can be designed and constructed in any desired combination. For example, a multifunctional pRNA-3WJ micelle can be constructed by combining targeting, imaging and therapeutic modules in one nanoparticle. The pRNA-3WJ micelle can also deliver siRNA or microRNA simultaneously to multiple genes or different positions of a gene to produce a synergistic effect. In addition, different types of anticancer drugs can be loaded onto a pRNA-3WJ micelle to enhance the therapeutic effect or overcome drug resistance through combination therapy. Therefore, this innovative RNA-based micelle nano delivery platform has great potential for clinical application.

Example 2: RNA nanoparticles, three-way junction, multi-branch or multi-arm RNA nanostructures carry multiple copies of paclitaxel and its derivatives for the treatment of cancer and other diseases.

15A to 19 show RNA nanoparticles, three-way junctions, multi-branch or multi-arm RNA nanostructures to carry multiple copies of paclitaxel and its derivatives for the treatment of cancer and other diseases.

Example 3: RNA-drug conjugation

Figures 20A to 24B show RNA-Taxol sequence design and drug conjugation (Figures 20A to 20C), in vitro characterization (Figures 21A to 21C), thermal stability (TGGE & qPCR, Figures 22A and 22B), and in vitro toxicity ( Figure 23) and the results of treatment studies in animal experiments (Figures 24A and 24B).

[Figures 25A to 28 show RNA-CPT design and drug conjugation (Figures 25A to 25C), in vitro characterization (assembly of gels and TGGE, Figures 26A to 26C), in vitro toxicity (Figure 27), and animal experiments The results of the treatment study (Figure 28).

Example 4: Computer design of thermodynamically stable multilayer branched RNA nanostructures.

Figures 29A to 31B show the design of the branched 3WJ with different cores and helices (Figures 29A and 29B), thermal stability (qPCR&TGGE, Figures 30A to 30C) and enzyme stability (serum stability determination, Figures 31A and 31B) ).

Figures 32A to 36B show the design of branched 3WJ (Figures 32A to 32C), in vitro characterization (gel electrophoresis and DLS, Figures 33A to 33C), thermal stability (qPCR and TGGE, Figures 34A and 34B), enzymes Stability (serum stability assay, Figures 35A to 35C), and shielding properties (cell binding assay, Figures 36A and 36B).

design

Natural RNA structural elements (such as the phi29 3WJ motif) have evolved for centuries to serve specific purposes, and they can be structural skeletons or structural dynamic elements for biological functions. For drug delivery, nano-sized particles with adjustable size and shape, high structural/thermodynamic stability, and the ability to carry high-density cargo to specific targets in the body without inducing immune response or toxicity are desired .

To achieve this, a platform was designed that allowed the formation of highly stable three-dimensional RNA nanostructures assembled from 3-9 separate synthetic oligonucleotides of 16-120 nt in length. Solid phase synthesis can be used to synthesize the oligomers, which allows for site-specific modification and thus incorporating modified nucleotides to 1) increase enzyme stability, 2) increase thermodynamic stability, or 3) increase use For the connection of high-density cargo. Each oligomer is synthesized according to its specific functional requirements, and uses self-assembly to assemble all component chains at equimolar concentrations into the desired nanostructure.

In order to achieve efficient self-assembly from a large number of separate chains (3-9), oligomer sequence design needs to consider some concepts: i) the interlocking domain needs to be highly thermodynamically stable, ii) the sequence needs to be specific, iii) oligomerization The object should not have a strong internal structure, and iv) the cargo molecule and the core should be sufficiently separated from each other.

The stability of the interlocking domain determines the stability of the final 3D structure. Since each chain can contain different modules of particles (treatment, targeting, imaging), it is necessary for the nanostructure to remain intact to deliver all modules. Although this can be achieved on linear double-stranded oligomers, the use of a more ordered structure provides benefits such as control of particle size and shape, which affects biodistribution and EPR effects; protects the cargo from being exposed during delivery, which allows delivery Hydrophobic molecules; and reduced enzyme activity due to steric hindrance. To achieve a more ordered structure, the oligomer is divided into at least two interlocking domains that can be separated by or without structural connections. In our branched nanostructure, by example, each oligomer is divided into three domains: 5'DA, core protrusions, and 3'DA (Figure 47C). The number of chains constituting the nanostructure is equal to the number of DA domains in the structure. In addition, the number of DA domains is equal to the number of independent sequences in the nanostructure. Therefore, any 3'DA sequence is a specific 5'DA reverse complement and vice versa. Then, the 8-branched nanostructure is defined by 8 independent DA domains, which are interlocked with their reverse complements by the specific design of the synthesized oligomers. Then oligomers are designed into two types: extension oligomers and termination oligomers. By defining the DA number (1,2,...,9) and whether the sequence is normal or its reverse complement (rev), oligomers can be fully identified. Extension oligomers are usually connected to continuous DA domains, such as 12rev, 23rev, 34rev, while terminating oligomers close the loop by connecting the last DA with the reverse complement of the first DA (such as 41rev), in this case A 4-DA nanostructure with tetrahedral arrangement is formed (Figure 47A-B). Similarly, 12rev, 23rev, 34rev, 45rev, 56rev plus 61rev can form a 6-DA nanostructure, and DA domains with equal spacing can be assembled into an octahedral arrangement around the nanoparticle core (Figure 47A).

Calculation-oriented design of spherical sequences:

According to the above embodiment, the 6-DA structure will use certain sequences identical to the 4-DA structure (12rev, 23rev, 34rev). Therefore, in order to manufacture a series of 3-9 DA nanostructures, 8-segment extension chains and 7-segment termination chains are required. Computationally, this requires identifying thermodynamically stable sequences for 9 DA domains of predefined length (number of nucleotides), determining the desired core protrusion linking nucleotides, and optimizing the sequence to achieve minimal self-complementarity and crossover Complementarity to achieve effective self-assembly of thermodynamically stable nanostructures.

The flow of the algorithm is outlined in Figure 48. In the first step, the user defines the following input parameters: 1) the number of DA domains, 2) the length of the DA domain, 3) the identity of the nucleotides in the connecting domain, 4) the range of the melting temperature (Tm) of the DA domain , 5) the range of allowed GC content, 6) the percentage of self-complementarity allowed, 7) the percentage of cross-complementarity allowed.

Then, the algorithm uses random number generation to generate a DA sequence and tests whether the sequence falls within the expected GC content and TM range. If the sequence falls within the range, it is saved and the process is repeated until the 25×# DA sequence has been determined. Once enough # sequences have been identified, test their self-complementarity. Then, based on their degree of cross-complementarity with other preserved DA sequences, the sequences showing low self-complementarity are classified. The sequence with the lowest overall complementarity is then used to calculate nanometers for the extended oligonucleotide according to (seq1+UG ligation+seq2 reverse complement) and for the termination oligonucleotide according to (seq2+UG ligation+seq1 reverse complement) Sequence of structural chain. Retest the self-complementarity and cross-complementarity of the full-length oligomer chain to ensure that reverse complementation does not adversely affect the overall specificity of the sequence. If the nanostructure sequences pass the QC test, they are converted into RNA letter codes and saved to a file, otherwise the procedure is repeated until a suitable oligomer group is found.

Figures 37A-37C show the design and construction of branched 3WJ-based modular RNA motifs and variants with different numbers of arms. Figure 37A Different highly ordered junctions (cores) are used as building blocks for modular RNA motifs. Figure 37B The nucleotide sequence of the modular RNA motif used for synthesis. Figure 37C 3D structure of one of the modular RNA motifs using 6WJ as the core and 4WJ as the arm (or branch).

Figures 38A to 38G show 3WJ (Figure 38A), 4WJ (Figure 38B), 5WJ (Figure 38C), 6WJ (Figure 38D), 7WJ (Figure 38E), 8WJ (Figure 38F) and 9WJ (Figure 38G) modular RNA The 2D structure of the motif shows an example of a synthetic RNA oligonucleotide sequence.

Figures 39A-39C show the thermal stability of various modular RNA motifs. Figure 39A qPCR shows the annealing curve. Figure 39B TGGE shows the melting curve. Figure 39C Comparison of Tm for annealing and melting of modular RNA motifs.

Figures 40A and 40B show in vitro characterization of branched 3WJ-based modular RNA motifs. Figure 40A. Size comparison gel: 2% agarose gel, showing 4-6WJ (from left to right: molecular weight standard, phi29-3WJ, monomer, dimer, trimer, 4WJ, 5WJ, 6WJ) Assemble. Figure 40B Size distribution of 4-6WJ measured by dynamic light scattering (DLS).

An exemplary sequence generated using the method described in this embodiment.

12REV

GACUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG (SEQ ID NO: 1).

23REV

CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC (SEQ ID NO: 2).

31REV

GGGAACAGUACCACAACUAGUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 3).

34REV

GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA (SEQ ID NO: 4).

41REV

UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 5).

45REV

UGUAUGUCCCUAUCCCGGGAUGCUCCGCAUGAUGAAUACAGC (SEQ ID NO: 6).

51REV

GCUGUAUUCAUCAUGCGGAGUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 7).

56REV

GCUGUAUUCAUCAUGCGGAGUGGGCAUUGGGAUCGUAUGAGC (SEQ ID NO: 8).

61REV

GCUCAUACGAUCCCAAUGCCUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 9).

67REV

GCUCAUACGAUCCCAAUGCCUGAACAAACAGAGCAAGCCUCC (SEQ ID NO: 10).

71REV

GGAGGCUUGCUCUGUUUGUUUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 11).

78REV

GGAGGCUUGCUCUGUUUGUUUGCGCGAUUUCCGCGUUACACA (SEQ ID NO: 12).

81REV

UGUGUAACGCGGAAAUCGCGUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 13).

89REV

UGUGUAACGCGGAAAUCGCGUGCCUGCUCGCGUACGUCUUAC (SEQ ID NO: 14).

91REV

GUAAGACGUACGCGACGAGGUGCCCAGGCCUAACAUAUACUC (SEQ ID NO: 15).

a3WJ

UUGCCAUGUGUAUGUGGG (SEQ ID NO: 16).

b3WJ

CCCACAUACUUUGUUGAUCC (SEQ ID NO: 17).

c3WJ

GGAUCAAUCAUGGCAA (SEQ ID NO: 18).

aPhi29-Mod

AUUCGCUGUGUGGUAGUG (SEQ ID NO:19)

bPhi29-Mod

CACUACCACUUUGUCCUACG (SEQ ID NO: 20).

cPhi29-Mod

CGUAGGACCAGCGAAU (SEQ ID NO: 21).

aPhi29-30

GCGUGCUGUGUGCUACCG (SEQ ID NO: 22).

bPhi29-30

CGGUAGCACUUUGCUGUGCG (SEQ ID NO: 23).

cPhi29-30

CGCACAGCCAGCACGC (SEQ ID NO: 24).

aSF5-30

GCGUGCUGGUGCUACCG (SEQ ID NO: 25).

bSF5-30

CGGUAGCACGGGCUGUGCG (SEQ ID NO: 26).

cSF5-30

CGCACAGCCAGCACGC (SEQ ID NO: 27)

aM2-30

GCGUGCUGGUGCUACCG (SEQ ID NO: 28).

bM2-30

CGGUAGCACCGCUGUGCG (SEQ ID NO: 29).

cM2-30

CGCACAGCCUCAGCACGC (SEQ ID NO: 30).

aPhi29-32

ACGCGACGUGUGCAUGCC (SEQ ID NO: 31).

bPhi29-32

GGCAUGCACUUUGCGUUGCG (SEQ ID NO: 32).

cPhi29-32

CGCAACGCCGUCGCGU (SEQ ID NO: 33).

aSF5-32

ACGCGACGGUGCAUGCC (SEQ ID NO: 34)

bSF5-32

GGCAUGCACGGGCGUUGCG (SEQ ID NO: 35)

cSF5-32

CGCAACGCCGUCGCGU (SEQ ID NO: 36).

aM2-32

ACGCGACGGUGCAUGCC (SEQ ID NO: 37)

bM2-32

GGCAUGCACCGCGUUGCG (SEQ ID NO: 38)

cM2-32

CGCAACGCCUCGUCGCGU (SEQ ID NO: 39)

Mod-a/WT-b

AUUCGCUGUGUGGUAGUGCCCACAUACUUUGUUGAUCC (SEQ ID NO: 40)

Mod-b/WT-b

CACUACCACUUUGUCCUACGCCCACAUACUUUGUUGAUCC (SEQ ID NO: 41)

Mod-c/WT-b

CGUAGGACCAGCGAAUCCCACAUACUUUGUUGAUCC (SEQ ID NO: 42)

30a/Mod-b

GCGUGCUGUGUGCUACCGCACUACCACUUUGUCCUACG (SEQ ID NO: 43)

30b/Mod-b

CGGUAGCACUUUGCUGUGCGCACUACCACUUUGUCCUACG (SEQ ID NO: 44)

30c/Mod-b

CGCACAGCCAGCACGCCACUACCACUUUGUCCUACG (SEQ ID NO: 45)

Ext30-a/Mod-b

CCUAUUCAGGUGCGUGCUGUGUGCUACCGAUGUAAUUCAACACUACCACUUUGUCCUACG (SEQ ID NO: 46)

Ext30-b/Mod-b

UUGAAUUACAUCGGUAGCACUUUGCUGUGCGAGGCUGAACAGCACUACCACUUUGUCCUACG (SEQ ID NO: 47)

Ext30-c/Mod-b

CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGCACUACCACUUUGUCCUACG (SEQ ID NO: 48)

WT-b/Mod-a

CCCACAUACUUUGUUGAUCCAUUCGCUGUGUGGUAGUG (SEQ ID NO: 49)

WT-b/Mod-c

CCCACAUACUUUGUUGAUCCCGUAGGACCAGCGAAU (SEQ ID NO: 50)

SF5-4WJ-a

UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA (SEQ ID NO: 51)

SF5-4WJ-b

UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG (SEQ ID NO: 52)

SF5-4WJ-c

CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG (SEQ ID NO: 53)

SF5-4WJ-d

CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA (SEQ ID NO: 54)

Example 5 Nanostructure for imaging

Figures 49A-49C The fluorophore is conjugated to a nucleic acid nanostructure (also referred to herein as nanoparticles) for in vivo cancer imaging. Figure 49A PAGE analysis demonstrates that RNA oligomers and nanoparticles can carry multicolor fluorescent materials. Figure 49B Assembly gel shows that oligomers can be assembled efficiently after modification with fluorophores. Figure 49C Biodistribution of Phi29 3WJ nanoparticles coupled with ICG fluorophore.

Figures 50A-50C DOTA chelator is conjugated to RNA oligomers and nanoparticles at high density. Figures 50A-50B Amine-modified and DOTA-conjugated oligomers are assembled into RNA nanoparticles. Figure 50B-50C Comparison of RNA nanoparticles with DOTA conjugates of different densities with and without chelated Gd3+.

Figures 51A-51C NOTA chelating agent is conjugated to oligomers and nanoparticles at high density. Figure 51A Schematic diagram of NOTA chelating Cu64 to RNA nanoparticles for PET imaging. Figures 51B-51C Assembly gel and reverse phase HPLC purification of NOTA conjugated RNA nanoparticles.

52A-52E show the design and synthesis of pRNA strands with multiple aldehyde groups to conjugate drugs for pH-responsive drug release. Figure 52A Schematic diagram of conjugation of multiple drugs on the 3WJ core. Figure 52B is an example of a drug carrying a free amine group for imine linkage. Figure 52C Examples of drugs that carry hydroxyl groups for acetal attachment. Figure 52D An example of a pH-sensitive connector design using hydrazine bonds. Figure 52E. An example of an acid labile linker conjugating PI103 prodrug to a nucleic acid oligomer.

Figures 53A-53H show the design and preparation of RNA-based thermostable micelles for delivery of erlotinib for cancer treatment. Figure 53A Amphiphilic RNA strand with adjustable hydrophobic modification used to form RNA micelles. Figure 53B Schematic representation of RNA-tocopherol micelles conjugated to functional moieties. Figure 53C-53H Critical micelle concentration determination of 5 amphiphilic RNA strands with adjustable hydrophobic modification.

54A-54Q show the design and preparation of CPT-RNA conjugates for inhibiting the growth of KB tumor xenografts. Figures 54A-54C CPT-RNA conjugation.

Figures 54B-54D are solubilized by drugs conjugated to RNA. 54C-54H Assembly, thermodynamic stability and size distribution of RNA nanoparticles carrying CPT. Figures 54D-54I CPT release profile from RNA nanoparticles. Figure 54J-54K Cell binding and internalization of CPT-RNA nanoparticles. Figure 54 Cytotoxicity and apoptosis effects of 54L-54M CPT RNA nanoparticles. Figure 54N-54P CPT RNA NP tumor inhibition in KB tumor xenograft mouse model.

Figures 1A to 1E show the structural basis and assembly principle of pRNA-3WJ-PTX micelles. Figure 1A. The pRNA-3WJ motif derived from phage phi29 packaging RNA. Figure 1B. Angled branching structure of pRNA-3WJ. Figure 1C. Conjugation of pRNA-3WJ with lipophilic module (cholesterol, blue), therapeutic module (PTX, green), and reporting module (Alexa dye, red). Figure 1D. Illustrates the formation of pRNA-3WJ by hydrophobic interaction of conjugated lipophilic modules in aqueous solution. Figure 1E. Analysis of pRNA-3WJ micelle assembly by 1% TAE agarose gel electrophoresis. Upper gel: EtBr channel; lower gel: Alexa647 channel (M: 1kb plus DNA molecular weight standard (DNA ladder)).

Figures 2A to 2D show the characteristics of pRNA-3WJ micelles. Figure 2A AFM image. Scale bar: 200 nm. Figure 2B Apparent hydrodynamic diameter measurement by DLS. Top panel: 3WJ in TMS buffer; bottom panel: pRNA-3WJ-PTX micelle in TMS buffer. Figure 2C Zeta potential measurement by DLS. Figure 2D Verification of the assembly of pRNA-3WJ micelles by Nile Red binding analysis.

Figures 3A to 3D show RNA-PTX conjugates. Figure 3A Design principle of RNA-PTX conjugate. PTX-N3 can react with terminal alkyne-labeled RNA through click chemistry, and PTX can then be released from the RNA strand by hydrolysis. Figure 3B. Successful RNA-PTX conjugation was analyzed by 20% 8M urea PAGE in TBE buffer. Figure 3C Experimental mass prediction of a3WJ-PTX conjugate by mass spectrometry. Figure 3D in vitro PTX release curve over time.

Figures 4A and 4B show the analysis of tumor cell binding and internalization of pRNA-3WJ-PTX micelles in vitro by flow cytometry (Figure 4A) and confocal microscopy (Figure 4B). Shown is nuclear staining (blue); cytoskeletal staining (green); binding to pRNA-3WJ-PTX micelles (red).

5A to 5D show the cytotoxicity and apoptosis of pTX-3WJ micelles loaded with PTX in vitro. Figure 5A. The cytotoxic effect of pRNA-3WJ-PTX micelles was determined by MTT analysis. Figure 5B. The apoptosis of pRNA-3WJ-PTX micelles was determined by PI/Annexin V-FITC double staining and FACS analysis. Figure 5C Caspase-3 determination. Figure 5D shows in vivo tumor targeting of pRNA-3WJ-PTX micelles in mouse xenografts. Left: Full-body image obtained 4 hours after injection. Right: Organ images obtained 24 hours after injection.

Figures 6A-6R RNA micelles for micro RNA (micro RNA) delivery. Figures 6A-6D 3WJ motifs illustrating the formation of 3WJ RNA micelles, the 2D structure of 3WJ/FA/anti-miR21 micelles, and the assembly of RNA micelles analyzed by 2% agarose gel. (Lane from left to right: 3WJ, 3WJ micelles, 3WJ/anti-miR21, 3WJ/anti-miR21 micelles, 3WJ/FA/anti-miR21, 3WJ/FA/anti-miR21 micelles), 3WJ/FA/anti-miR21 Size distribution and zeta potential of micelles. Figure 6E-6G CMC determined by Nile Red encapsulation analysis and the stability study of RNA micelles under different temperature, pH and RNase conditions. Figures 6H-6I show the in vitro binding and internalization of RNA micelles to cancer cells. After 1 hour of treatment, flow cytometry was used to compare the binding affinity to KB cells. The confocal microscope shows the internalization distribution. Blue: cell nucleus; green: cytoskeleton; red: RNA nanoparticles. Figures 6J-6L show in vitro studies of RNA micelles carrying anti-miR21. The dual luciferase assay showed delivery of anti-miR21 to KB cells. qRT-PCR showed the effect of miR21 knockout on the expression of target gene PTEN. Caspase-3 assay showed induction of apoptosis after treatment. Figures 6M-6N show in vivo biodistribution studies in mice with xenografts. Full body image. Images of isolated organs 8 hr after injection. Figures 6-6R show the in vivo therapeutic effect of RNA micelles in mice with xenografts. Tumor regression curve during 5 injections (red arrow shows injection day). Body weight curve of mice during treatment. qRT-PCR and Western blotting showed that PTEN was up-regulated after delivery of anti-miR21 in vivo.

7A and 7C show the determination of the induction of pro-inflammatory cytokines and chemokines by the pRNA-3WJ micelle preparation. Figure 7A After incubation of pRNA-3WJ micelles with mouse macrophage-like RAW 264.7 cells, in vitro evaluation of TNF-α, IL6 and IFN-α production by ELISA analysis. Figure 7B In vivo evaluation of TNF-α, IL6 and IFN-α production by ELISA analysis after pRNA-3WJ micelles were injected into C57BL/6 mice. Figure 7C In vivo chemokine induction profile for pRNA-3WJ micelle preparations.

Figure 8 shows the stability of pRNA-3WJ micelle formulations relative to different pH and temperature.

Figures 9A to 9C show the synthesis of PTX-N3 (Figure 9A), 1H NMR (400 MHz) spectra of PTX (Figure 9B) and PTX-N3 (Figure 9C).

Figures 10A and 10B show the RNA-PTX conjugate. Fig. 10A pRNA-3WJ is assembled step by step using an unmodified a3WJ chain, a 5'-alkyn modified a3WJ chain and a 5'-PTX modified a3WJ chain. (M: ultra-low DNA molecular weight standard). Figure 10B Solubility of 1 mM free PTX and RNA-PTX in DEPC water.

Figures 11A-11C show graphs and gel images confirming the formation of micelles. 11A and 11B show the concentration of micelle formation according to Nile Red binding analysis. Figure 11C shows 1% TAE agarose gel electrophoresis (molecular weight standard: 1kb plus DNA molecular weight standard).

12A to 12F show the time course of apoptosis induced by pRNA-3WJ-paclitaxel micelles in a Caspase-3 dependent manner.

Figure 13 shows the results from the time course of tumor targeting within the pRNA-3WJ-PTX microgroup. P: PBS; M-PTX: pRNA-3WJ-PTX micelles.

Figure 14 shows blot images of pRNA-3WJ micelle-treated mouse serum and control PBS-treated mouse serum.

Figures 15A to 15D show the shape, size and orientation of modular RNA motifs for high melting temperature (Tm). Figure 15A 3WJS with different sequences and thermal stability. Figure 15B Tm analysis by TGGE (thermal gradient gel electrophoresis). Figure 15C Tm determination by qPCR. Figure 15D Exemplary RNA design to change shape and cholesterol labeling strategy to optimize membrane anchoring efficiency.

16A and 16B show the secondary structure of a multi-branched or multi-arm modular RNA motif modified by multiple alkyne groups. Figure 16A 3WJ modular RNA motif modified by 18 alkyne groups. Figure 16B 4WJ modular RNA motif modified by 24 alkyne groups.

Figure 17 shows the optimal ratio of water/organic media for efficient conjugation of multiple paclitaxels to RNA strands.

Figure 18 shows the step-by-step self-assembly of 3WJ and 4WJ RNA nanostructures conjugated to 18 paclitaxel and 24 paclitaxel, respectively, according to non-denaturing PAGE (molecular weight standard: ultra-low range DNA marker).

Fig. 19 shows the Tm (M: monomer) of the 3WJ nanostructure conjugated to 18 paclitaxel according to TGGE.

Figures 20A and 20B show the sequence design and drug conjugation of synthetic RNA oligonucleotides. Figure 20A. Sequence design of expanded 3WJ and 4WJ RNA vectors conjugated with paclitaxel (PTX). 6-PTX was conjugated to a 4WJ synthetic RNA oligonucleotide. Figure 20B HPLC chromatogram of purified 4WJ synthetic RNA oligonucleotides with and without 6-PTX conjugation.

Figures 21A to 21C show in vitro characterization. Figure 21A The stepwise self-assembly of 3WJ with 18 PTX and 4WJ with 24 PTX (M, D, T represent monomer, dimer and trimer, respectively). Figure 21B Size distribution of 4WJ-24 PTX measured by DLS. Figure 21C Enhanced solubility of PTX by conjugation to RNA.

22A and 22B show thermal stability. Figure 22A TGGE of 4WJ empty vector and 4WJ-24 PTX. Figure 22B qPCR of 4WJ empty vector and 4WJ-24 PTX.

Figure 23 shows the in vitro cytotoxicity of 4WJ with multiple Taxols using MTT assay. At the same PTX concentration, 4WJ with 24 PTX showed higher cytotoxicity compared to PTX alone.

Figures 24A and 24B show the results of animal experiments used to test the therapeutic effect. Figure 24A Daily records of tumor volume and body weight in mice. Figure 24B Comparison of tumor weights before and after sacrifice. Compared with the negative control group, the 4WJ-FA-Taxol group showed slower tumor growth. No significant weight loss of mice was observed after treatment, which may indicate no significant toxicity.

Figures 25A to 25C show the design and drug conjugation. Figure 25A Click reaction scheme of modified oligonucleotide and camptothecin (CPT) prodrug. Figure 25B Denatured PAGE to monitor conjugation (* indicates 2'-F 4 alkyne;> indicates 2'-F 4 CPT). Figure 25C HPLC chromatogram of purified 3WJ chain with and without 4CPT conjugation (black: 2'-Fb 4 alkyne; red: 2'-Fb 4CPT).

Figures 26A to 26C show the assembly and in vitro characterization of 3-arm modular RNA motifs loaded with cargo compounds. Figure 26A illustrates 3WJ-FA-7CPT. Figure 26B FA-7CPT-3WJ and 3WJ controls, stepwise assembled non-denatured PAGE (lane 1, 2'-Fa 3CPT; lane 2, 2'-Fa 3CPT+2'-Fc folic acid; lane 3, FA-7CPT-3WJ ; Lane 4, 7CPT-3WJ; Lane 5, FA-3CPT-3WJ; Lane 6, FA-4CPT-3WJ; Lane 7, FA-3WJ; Lane 8, 3WJ). Figure 26C FA-7CPT-WJ temperature gradient gel electrophoresis.

Figure 27 shows the KB cell viability test with one CPT RNA. At the same CPT concentration, it was observed that 3WJ with one CPT had slightly greater cytotoxicity than CPT alone.

Figure 28 shows a comparison of tumor growth between 3WJ-FA-7CPT and PBS. It was observed that 3WJ-FA-CPT caused slower tumor growth compared to the negative control group.

Figures 29A to 29C show the design and sequence of a branched 3WJ modular RNA motif with three different cores (Phi29, SF5, M2) and four sets of helices (WT, Mod, 30, 32). Figure 29A shows a schematic design of different combinations of core and spiral. Figure 29B Sequence design of seven 3WJ modular RNA motifs (Phi29-Mod, Phi29-30, SF5-30, M2-30, Phi29-32, SF5-32, M2-32). Figure 29C Comparison of branched 3WJ modular RNA motifs with the same set of helixes (DA) and different protrusions separating DA in the core.

Figures 30A to 30C show the thermal stability of branched 3WJ modular RNA motifs in TES buffer. Figure 30A qPCR shows the annealing curve. Figure 30B TGGE shows the melting curve. Figure 30C Comparison of measured Tm for annealing and melting of branched 3WJ modular RNA motifs.

Figures 31A and 31B show the enzymatic stability of the branched 3WJ modular RNA motif. Figure 31A Serum degradation curve. Figure 31B. Half-life of 3WJ in 50% serum.

Figures 32A to 32D show the design and construction of a branched 3WJ RNA nanostructure made from branched 3WJ modular RNA motifs. Figure 32A Three 3WJ modular RNA motifs with different thermal stability, which are used as structural elements of branched 3WJ RNA nanostructures. Figure 32B 2D schematic of a branched 3WJ RNA nanostructure with different layers. Figure 32C 3D schematic of a branched 3WJ RNA nanostructure with different layers. Figure 32D 3WJ modular RNA motif composition and coupling of each branch to form a 3-layer branched nanostructure.

Figures 33A to 33D show the thermal stability of the branched 3WJ RNA nanostructure. Figure 33A. qPCR shows the annealing curve. Figure 33B. TGGE shows the melting curve. Figure 33C Comparison of annealing and melting Tm. Figure 33D. TGGE shows the thermodynamic stack release curve of the branched 3WJ RNA module.

Figures 34A and 34B show in vitro characterization of branched 3WJ RNA nanostructures. Figure 34A Size comparison gel showing the assembly of 2 and 3 layers of 3WJ RNA nanostructures. Figure 34B Size distribution of 2 and 3-layer 3WJ RNA nanostructures measured by dynamic light scattering (DLS).

35A to 35C show the enzymatic stability of branched 3WJ RNA nanostructures. Figure 35A Serum stability gel. Figure 35B Serum degradation curve. Figure 35C. Half-life of 3WJ RNA nanostructure in 50% serum.

Figures 36A and 36B show the comparison of cell binding of 3L-FA-free, 3L-core FA and 3L-external FA in vitro by flow cytometry (Figure 36A) and confocal microscopy (Figure 36B).

Figures 37A to 37C show the design and construction of branched 3WJ-based modular RNA motifs and variants with different numbers of arms. Figure 37A Different high-order junctions (cores) are used as structural elements of modular RNA motifs. Figure 37B The nucleotide sequence of the synthesized modular RNA motif. Figure 37C 3D structure of a modular RNA motif using 6WJ as the core and 4WJ as the arm (or branch).

Figures 38A to 38G show 3WJ (Figure 38A), 4WJ (Figure 38B), 5WJ (Figure 38C), 6WJ (Figure 38D), 7WJ (Figure 38E), 8WJ (Figure 38F) and 9WJ (Figure 38G) modular RNA bases The ordered 2D structure shows an exemplary synthetic RNA oligonucleotide sequence.

Figures 39A to 39C show the thermal stability of various modular RNA motifs. Figure 39A qPCR shows the annealing curve. Figure 39B TGGE shows the melting curve. Figure 39C Comparison of Tm for annealing and melting of modular RNA motifs.

Figures 40A and 40B show in vitro characterization of branched 3WJ-based modular RNA motifs. Figure 40A. Size comparison gel: 2% agarose gel showing 4-6WJ assembly (from left to right: molecular weight standard, phi29-3WJ, monomer, dimer, trimer, 4WJ, 5WJ, 6WJ) . Figure 40B Size distribution of 4-6WJ measured by dynamic light scattering (DLS).

Figures 41A to 41G show aspects of modular RNA motifs. The black area identifies the double-stranded arm (DA), and the gray area indicates the core domain of the modular RNA motif. The core domain is also designated as the modular RNA motif region contained within the dotted frame.

42A to 42G show aspects of RNA nanostructures each containing a single type of modular RNA motif. The black modular RNA motifs indicate the core or primary module RNA motifs contained in the RNA nanostructure. Dark gray modular RNA motifs indicate modular RNA motifs at the secondary or intermediate levels contained in the RNA nanostructure. Light gray modular RNA motifs indicate modular RNA motifs contained at the end or outermost level in the RNA nanostructure.

Figure 43 shows an aspect of RNA nanostructures containing different types of modular RNA motifs. The black modular RNA motif indicates the core or primary modular RNA motif contained in the RNA nanostructure. Dark gray modular RNA motifs indicate modular RNA motifs at the secondary or intermediate levels contained in the RNA nanostructure. Light gray modular RNA motifs indicate modular RNA motifs contained at the end or outermost level in the RNA nanostructure.

44A to 44B show aspects of RNA nanostructures loaded with a single type of cargo compound or functional group. The black modular RNA motif indicates the core or primary modular RNA motif contained in the RNA nanostructure. Dark gray modular RNA motifs indicate modular RNA motifs at the secondary or intermediate levels contained in the RNA nanostructure. Light gray modular RNA motifs indicate modular RNA motifs contained at the end or outermost level in the RNA nanostructure.

Figures 45A-45B show aspects of RNA nanostructures loaded with various types of cargo compounds and/or functional groups (including but not limited to active agents). The black modular RNA motif indicates the core or primary modular RNA motif contained in the RNA nanostructure. Dark gray modular RNA motifs indicate modular RNA motifs at the secondary or intermediate levels contained in the RNA nanostructure. Light gray modular RNA motifs indicate modular RNA motifs contained at the end or outermost level in the RNA nanostructure.

Figures 46A-46B show aspects of RNA nanostructures loaded with various types of cargo compounds and/or functional groups, including but not limited to paclitaxel. Figure 46A Nanostructures with modular RNA motifs that contain an elongated core with internal modifications that allow the active agent to specifically link to the core of the nanostructure. Figure 46B Nanostructures with different functional groups attached to the 5'or 3'end of the oligonucleotide in each layer.

47A to 47D show the design concept of computer-derived RNA nanostructures. Figure 47A. 2D and 3D representative diagrams showing RNA nanostructures of 3-6 branches. Figure 47B shows the design of the oligomer sequence and interlocking domains of the 3-6 branched RNA nanostructure. Figure 47C shows the composition of RNA nanostructure oligomers alone.

Figure 48 shows a flow chart of a calculation algorithm used for computer design of RNA nanostructure oligomer sequences.

Figures 49A to 49C conjugate fluorophores to nucleic acid nanoparticles for in vivo cancer imaging. Figure 49A PAGE analysis demonstrates that RNA oligomers and nanoparticles can carry multicolor fluorescent materials. Figure 49B assembles the gel, demonstrating that the oligomer can be assembled efficiently after being modified with a fluorophore. Figure 49C Biodistribution of Phi29 3WJ nanoparticles coupled with ICG fluorophore.

Figures 50A to 50C DOTA chelator is conjugated to RNA oligomers and nanoparticles at high density. Figures 50A to 50B assemble oligomers modified with amine and conjugated with DOTA into RNA nanoparticles. Figures 50B to 50C Comparison of RNA nanoparticles with DOTA conjugates with different densities, with and without chelated Gd3+.

Figures 51A to 51C NOTA chelating agent is conjugated to oligomers and nanoparticles at high density. Figure 51A Schematic diagram of NOTA chelating Cu64 to RNA nanoparticles for PET imaging. 51B to 51C Assembly gel and reverse-phase HPLC purification of RNA nanoparticles conjugated to NOTA.

52A to 52E show the design and synthesis of pRNA strands with multiple aldehyde groups to conjugate drugs for pH-responsive drug release. Figure 52A Schematic diagram of multiple drugs conjugated to the 3WJ core. Fig. 52B is an example of a drug containing a free amine group for imine bonding. Figure 52C Examples of drugs containing hydroxyl groups for acetal bonding. Figure 52D An example of a pH-sensitive joint design using hydrazine bonds. Figure 52E An example of an acid labile linker coupling PI103 prodrug to a nucleic acid oligomer.

Figures 53A to 53H show the design and preparation of RNA-based thermostable micelles for delivery of erlotinib for cancer treatment. Figure 53A has an adjustable hydrophobically modified amphiphilic RNA strand used to form RNA micelles. Figure 53B illustrates RNA-tocopherol micelles conjugated to functional ligands. Figure 53C to 53H Critical micelle concentration determination of 5 amphiphilic RNA strands with adjustable hydrophobic modification.

Figures 54A to 54P show the design and preparation of CPT-RNA conjugates for inhibiting the growth of KB tumor xenografts. Figures 54A to 54C CPT-RNA conjugation. Figures 54B-54D dissolve drugs by conjugation to RNA. 54C to 54H Assembly, thermodynamic stability and size distribution of RNA nanoparticle-carrying CPT. Figures 54D to 54I CPT release curves from RNA nanoparticles. Figure 54J to 54K Cell binding and internalization of CPT-RNA nanoparticles. Figure 54 Cytotoxicity and apoptotic effects of 54L to 54M CPT RNA nanoparticles. Figure 54N to 54P CPT RNA NP tumor inhibition in KB tumor xenograft mouse model.

Claims (53)

A modular RNA motif, including: At least three segments of synthetic RNA oligonucleotides, wherein the at least three segments of synthetic RNA oligonucleotides are coupled to each other, wherein the at least three segments of synthetic RNA oligonucleotides form a central nuclear domain, and surrounding the central nuclear domain At least three double-stranded arms aligned and extending away from the central nuclear domain, where the melting temperature of the RNA motif is greater than 65 degrees Celsius. The modular RNA motif according to claim 1, wherein the modular RNA motif includes 3 to 9 synthetic RNA oligonucleotide strands. The modular RNA motif according to any one of claims 1 to 2, wherein one or more of the at least three synthetic RNA oligonucleotides comprise one or more modified nucleotides. The modular RNA motif of claim 3, wherein the one or more modified nucleotides are terminal nucleotides or non-terminal nucleotides. The modular RNA motif of claim 3, wherein the modification is an alkyne linked to the one or more modified nucleotides. The modular RNA motif of claim 3, wherein the modification is a linker connected to the one or more modified nucleotides. The modular RNA motif according to any one of claims 1 to 6, further comprising a cargo compound molecule connected to the at least three synthetic RNA oligonucleotides of the synthetic RNA oligonucleotide. The modular RNA motif of claim 7, wherein the at least 3 to 100 cargo compound molecules are linked to the synthetic RNA oligonucleotide. The modular RNA motif according to any one of claims 1 to 6, further comprising a functional group connected to one or more nucleotides in the at least three synthetic RNA oligonucleotides. The modular RNA motif according to claim 9, wherein the functional group is connected to the terminal nucleotide. The modular RNA motif according to claim 9 or 10, wherein the functional group is connected to a non-terminal nucleotide. The modular RNA motif according to any one of claims 9 to 11, which further includes a cargo compound linked to a functional group. The modular RNA motif according to any one of claims 1 to 12, wherein each of the at least three segments of synthetic RNA oligonucleotides comprises approximately 80 with any of SEQ ID NOs: 1-54 -Oligonucleotide sequence of 100% identical sequence. The modular RNA motif according to any one of claims 1 to 13, wherein the at least three segments of synthetic RNA oligonucleotides are configured to self-assemble to form the modular RNA motif. The modular RNA motif according to any one of claims 1 to 14, wherein the Tm of the modular RNA motif is greater than about 70 degrees Celsius. The modular RNA motif according to any one of claims 1 to 15, wherein the Tm of the modular RNA motif is in the range of about 70 degrees Celsius to about 100 degrees Celsius. The modular RNA motif according to any one of claims 1 to 16, wherein the Tm of the modular RNA motif is in the range of about 65 degrees Celsius to about 100 degrees Celsius. A modular RNA motif, including: At least four synthetic RNA oligonucleotides, wherein at least three synthetic RNA oligonucleotides are coupled to each other, wherein the at least three synthetic RNA oligonucleotides form a central nuclear domain, and at least three double-stranded arms surround the The nuclear domain is aligned and extends away from the central nuclear domain. The modular RNA motif according to claim 18, wherein the modular RNA motif includes 4 to 9 synthetic RNA oligonucleotide strands. The modular RNA motif according to any one of claims 18 to 19, wherein one or more of the at least three synthetic RNA oligonucleotides comprise one or more modified nucleotides. The modular RNA motif of claim 20, wherein the one or more modified nucleotides are terminal nucleotides or non-terminal nucleotides. The modular RNA motif of claim 20, wherein the modification is an alkyne linked to the one or more modified nucleotides. The modular RNA motif of claim 20, wherein the modification is a linker to the one or more modified nucleotides. The modular RNA motif according to any one of claims 18 to 23, further comprising a cargo compound molecule connected to the at least three synthetic RNA oligonucleotides of the synthetic RNA oligonucleotide. The modular RNA motif according to claim 24, wherein at least 3 to 100 cargo compound molecules are connected to the synthetic RNA oligonucleotide. The modular RNA motif according to any one of claims 18 to 23, further comprising a functional group connected to one or more nucleotides in the at least three segments of synthetic RNA oligonucleotides. The modular RNA motif of claim 26, wherein the functional group is attached to the terminal nucleotide. Modular RNA motif as in claim 26 or 27, wherein the functional group is attached to a non-terminal nucleotide. The modular RNA motif according to any one of claims 26 to 28, which further includes a cargo compound linked to a functional group. The modular RNA motif according to any one of claims 18-29, wherein each of the at least three segments of synthetic RNA oligonucleotides comprises approximately 70 with any of SEQ ID NOs: 1-54 -Oligonucleotide sequence of 100% identical sequence. The modular RNA motif of any one of claims 18 to 30, wherein the at least three segments of synthetic RNA oligonucleotides are configured to self-assemble to form the modular RNA motif. An RNA nanostructure, including: At least two modular RNA motifs as described in any one of claims 1 to 31, wherein the at least two modular RNA motifs are connected to each other. The RNA nanostructure according to claim 32, wherein the RNA nanostructure includes: A central core, where the central core includes a first modular RNA motif; A first layer, wherein the first layer includes at least three modular RNA motifs, wherein each of the at least three modular RNA motifs of the first layer is the same as the first modular RNA motif connection; and A second layer, wherein the second layer includes at least three modular RNA motifs, wherein each of the at least three modular RNA motifs of the second layer and the at least three modules of the first layer Modular RNA motifs in chemical motifs are connected. The RNA nanostructure according to claim 33, wherein all modular RNA motifs in the nanostructure have the same number of double-stranded arms. The RNA nanostructure of claim 33, wherein the number of double-stranded arms on the modular RNA motif of the first layer is different from the modular RNA of the second layer on the first modular RNA motif The number of double-stranded arms on the motif, or on both the first modular RNA motif and the second-layer modular RNA motif. The RNA nanostructure according to claim 33, wherein the number of double-stranded arms on the modular RNA motif of the second layer is different from the number of double-stranded arms on the first modular RNA motif, the first The number of double-stranded arms on the modular RNA motif of one layer, or the number of double-stranded arms on both the first modular RNA motif and the modular RNA motif of the first layer. The RNA nanostructure of claim 33, wherein the number of double-stranded arms on the first modular RNA motif is different from the number of double-stranded arms on the modular RNA motif of the first layer, the first The number of double-stranded arms on the two-layer modular RNA motif, or the number of double-stranded arms on both the first-layer and second-layer modular RNA motifs. The RNA nanostructure according to any one of claims 32 to 37, wherein the melting temperature (Tm) of the RNA nanostructure is greater than 70 degrees Celsius. The RNA nanostructure according to any one of claims 32-37, wherein the RNA nanostructure has a Tm in the range of 70 degrees Celsius to about 100 degrees Celsius. The RNA nanostructure according to any one of claims 33-39, wherein the first modular RNA motif has a modular RNA motif higher than that of the first layer and a modular RNA motif of the second layer Greater Tm. The RNA nanostructure of claim 40, wherein the modular RNA motif of the first layer has a larger Tm than the modular RNA motif of the second layer. The RNA nanostructure of any of claims 33-41, wherein one or more of the RNA motifs are coupled to one or more cargo compounds. The RNA nanostructure of any of claims 33-42, wherein one or more of the RNA motifs are coupled to one or more functional groups. The RNA nanostructure according to any one of claims 33-43, wherein the cargo compound is an anti-cancer compound, chelating agent, radioisotope, fluorophore, miRNA, anti-miRNA, siRNA, pH-responsive prodrug, enzyme may Cracking prodrug, or any combination thereof. The RNA nanostructure according to any one of claims 33-41, wherein one or more of the RNA motifs are coupled to two or more cargo compounds, and wherein the two or more At least two of the cargo compounds are different types of cargo compounds. A method, including: The subject is administered the modular RNA motif according to any one of claims 1 to 31 or the RNA nanostructure according to any one of claims 32 to 45. The method of claim 46, wherein the subject has or is suspected of having cancer. A method of treating cancer or disease in a subject, the method comprising: The modular RNA motif according to any one of claims 1 to 31 or the RNA nanostructure according to any one of claims 32 to 45 is administered to a subject. Use of a modular RNA motif according to any one of claims 1 to 31 or an RNA nanostructure according to any one of claims 32 to 45 in the preparation of a medicament for treating a disease or cancer . A system including: A computing device; and An application executable on the computing device, wherein, when executed, the application causes the computing device to at least: Based at least in part on the GC content of the theoretical DA sequence, the melting temperature (Tm) of the theoretical DA sequence and the ability to spontaneously dimerize, a theoretical double-stranded arm (DA) sequence is generated; One or more DAs for a group of oligomers are selected based at least in part on the calculated cross-complementarity of the saved group of DAs, where the DA with the lowest overall complementarity is selected; Calculate the oligomer sequence, which includes calculating the reverse complement of the DA sequence, calculating the extended oligomer sequence, and calculating the termination oligomer sequence; and Based at least in part on the ability of oligomers to spontaneously dimerize or form dimers, oligomers are selected, where those oligomers that do not spontaneously dimerize and do not form dimers are selected. A method, including: Generate a theoretical double-stranded arm (DA) sequence based at least in part on the GC content of the theoretical DA sequence, the melting temperature (Tm) of the theoretical DA sequence, and the ability to spontaneously dimerize; One or more DAs for a group of oligomers are selected based at least in part on the calculated cross-complementarity of the saved group of DAs, where the DA with the lowest overall complementarity is selected; Calculate the oligomer sequence, which includes calculating the reverse complement of the DA sequence, calculating the extended oligomer sequence, and calculating the termination oligomer sequence; and Based at least in part on the oligomer's ability to spontaneously dimerize or form dimers, oligomers are selected, wherein those oligomers that do not spontaneously dimerize and do not form dimers are selected. The use of the nucleotide, RNA or RNA structure as set forth in any one of claims 1 to 52, which is used to make a hydrophobic or low-solubility drug soluble, thereby reducing the drug dose to reduce drug toxicity or Side effects, or avoid the use of oil or organic solvents to dissolve drugs in cancer chemotherapy. A method for generating RNA micelle structures using hydrophobic materials to carry anti-cancer compounds, therapeutic agents, miRNA, anti-miRNA, siRNA, chelating agents, radioisotopes, fluorophores, pH-responsive prodrugs or enzymes that can be cleaved Prodrug.

Images