TW201945537A - Cloning vector, kit, and method for specifically inducing mutagenesis in chloroplast genes, and transgenic plant cells and agrobacterium generated by the same - Google Patents

Abstract

The present application provides a method for generating chloroplast gene modified plant cells, comprising: constructing a pair of nuclear gene modifying vectors; transforming the pair of nuclear gene modifying vectors into plant cells via Agrobacterium; and selecting and culturing the plant cells. The nuclear gene modifying vectors comprises a promoter, a recombinant gene conferred the chloroplast transit peptide and TALEN protein domain, a terminator as well as right border and left border of T-DNA regions. Thus, by using nuclear transformation to mutate chloroplast gene, the problems such as low transformation efficiency, long selection time, labor-intensive and high cost encountering in chloroplast transformation would be avoided.

Description

Transplantation vector, kit, method and method for specifically causing chloroplast gene variation in plants, and transgenic plant cells and Agrobacterium produced by using same

The invention relates to a plant gene transgenic vector and method, in particular to a plant cell nuclear gene transgenic vector and method, which can be used to cause chloroplast gene mutation.

Traditionally, to silence, modify and edit plant chloroplast genes, it is necessary to first construct a chloroplast expression vector containing the gene sequence to be modified, and then use gene gun bombardment to introduce the expression vector into the chloroplast and then replace it by homologous recombination. Original gene sequence (Bock, 2015). However, the technical threshold of the gene gun bombardment method is high, which requires highly trained and experienced technicians and expensive instruments to operate and perform, and the cost of gene gun consumables is high, and the efficiency of chloroplast translocation is low. In addition, since a plant cell contains tens to hundreds of chloroplasts, and a chloroplast also contains tens or hundreds of genomes, the time required for the screening process of the gene gun bombardment is lengthy.

In addition to the gene gun bombardment method, PEG (polyethylene glycol) vector method can also be used for chloroplast gene transfer, and it has been reported that the expression vector can be successfully introduced into chloroplasts of a few plants via protoplasts (Bock, 2015). Although this method does not require expensive equipment, protoplasts need to be prepared. The protoplasts are fragile and difficult to operate, and plants need to be regenerated from the protoplasts after transplantation. Although the cost of consumables is low, the threshold for the regeneration technology of protoplasts is high and the time required for the regeneration process is long. Most plants have not yet established this technology, and currently only a few plants are feasible. In addition, the PEG-mediated method may also produce problems such as polyploid cells, low transfection efficiency, and lengthy screening time.

All in all, the existing chloroplast gene conversion technology still has many shortcomings and problems to be overcome and improved, including high thresholds, low conversion efficiency, lengthy screening process, and the need to invest a lot of manpower and material resources. In addition, because the chloroplast genome is small and the gene density is high, exogenous genes are generally inserted into the genome by means of homologous recombination. Compared with the method of randomly inserting the nuclear genome into the nuclear genome, the chloroplast has a low efficiency of colonization. a lot of.

In view of the problems of the foregoing prior art, the object of the present invention is to provide a nuclear gene transgenic vector, kit and method for causing chloroplast gene mutation, which can effectively improve the traditional chloroplast gene with low efficiency, long screening time and high cost. Human and material issues.

According to one object of the present invention, a nuclear gene transgenic vector is provided, which includes: a promoter; a chloroplast message protein gene located downstream of the promoter; a recombinant TALEN protein domain, including the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22 The sequence shown; and the first and second boundary regions, such as the left and right boundary regions of the T-DNA. The promoter, chloroplast message protein gene, recombinant TALEN protein domain and sequentially located between the first boundary region and the second boundary region.

Preferably, the promoter may be an rbcS promoter.

Preferably, the recombinant TALEN protein domain may include a DNA sequence encoding a DNA recognition protein and an endonuclease. More preferably, the endonuclease may be Fok I, and the DNA recognition protein may recognize a fragment of the rpoB gene of the chloroplast. Optimally, the DNA sequence encoding the DNA recognition protein may include a sequence as shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Preferably, the transgenic vector may further include a selection gene, and the selection gene may be a drug resistance selection gene, a non-drug resistance selection gene, or a combination thereof. More preferably, the screening gene may include a kanamycin resistance gene or a methionine sulfoximine (MSO) herbicide resistance gene. Most preferably, the kanamycin resistance gene includes nptII or the sulfonylimidine herbicide resistance gene includes bar .

Preferably, the transgenic vector may further include a sequence encoding a marker. More preferably, the marker may comprise a molecule selected from the group consisting of a luminescent molecule, a chemiluminescent molecule, a fluorescent dye, a fluorescence quencher, a lipid, a colored molecule, a radioisotope, a scintillator, biotin, avidin, streptavidin , Protein A, protein G, antibody or fragment thereof, polyhistidine, Ni ²⁺ , Flag tag, myc tag, HA tag, and detectable markers in a group of enzymes.

Preferably, the transgenic vector may comprise a sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

Preferably, the transgenic vector may further include a 3 terminal non-transcribed region of the rbcS gene, which is located downstream of the recombinant TALEN protein domain.

According to yet another object of the present invention, a set of genes that specifically cause plant chloroplast gene mutations is provided, comprising: a pair of the aforementioned nuclear gene transgenic vectors. Preferably, the kit may include a first transgenic vector and a second transgenic vector. The first transgenic vector includes: a first promoter; a first chloroplast message protein gene located downstream of the first promoter; a first recombinant TALEN protein domain comprising the sequence shown in SEQ ID NO: 21; and a first border Region and a second boundary region, wherein the first promoter, the first chloroplast message protein gene, and the first recombinant TALEN protein domain are sequentially located between the first boundary region and the second boundary region. The second transgenic vector includes: a second promoter; a second chloroplast message protein gene located downstream of the second promoter; a second recombinant TALEN protein domain comprising the sequence shown in SEQ ID NO: 22; and a third border Region and the fourth boundary region, in which the second promoter, the second chloroplast information protein gene, and the second recombinant TALEN protein domain are sequentially located between the third boundary region and the fourth boundary region.

According to yet another object of the present invention, a method for generating nuclear gene transgenic plant cells and causing chloroplast gene mutations is provided. The method includes: constructing a pair of the aforementioned nuclear gene transgenic vectors; and translocating the pair of nuclear genes through Agrobacterium. Vectors are incorporated into plant cells; and plant cells are screened and cultured.

Preferably, the incorporation may include a homology-oriented repair mechanism or a non-homologous end junction-oriented repair mechanism.

Preferably, the method may further include transducing a nuclear gene transgenic vector into Agrobacterium.

Preferably, the method may further include analyzing the plant cell and confirming the incorporation of the nuclear gene transgenic vector into the plant cell.

According to still another object of the present invention, a nuclear gene transgenic plant cell is proposed, which is constructed by the aforementioned method.

According to another object of the present invention, an Agrobacterium is provided, which includes the aforementioned nuclear gene transgenic vector.

In general, this case caused the chloroplast gene mutation by expressing the recombinant TALEN protein in the nucleus, which can at least solve the aforementioned problem of traditional chloroplast gene translocation and provide at least the following advantages:

(1) Improve the efficiency of transplantation and solve the problem of high threshold of traditional chloroplast gene transplantation technology.

(2) Due to the use of nuclear gene transfer, the screening time is shorter.

(3) The cost of nuclear gene transfection using the Agrobacterium-mediated method is low, so expensive equipment and protoplasts are not required.

The above and other objects, features, and advantages of the invention claimed in this case will become apparent after referring to the following detailed description and preferred embodiments and the accompanying drawings.

The details of each specific example of the present invention will be described later. Other features of the present invention will be clearly presented through the detailed description and the scope of patent application in each specific example below.

Without further elaboration, it is believed that those with ordinary knowledge in the technical field to which the present invention pertains can utilize the present invention to the widest extent based on the foregoing description. Therefore, it can be understood that the following description is only for illustrative purposes, and is not intended to limit the rest of the disclosure in any way.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Unless otherwise stated, all percentages, parts, ratios, etc. are by weight.

As used herein, the term "produced from" is synonymous with "comprising." As used herein, the terms "includes, including", "comprises, including", "has, having", "contains, containing", or any other variation thereof, are It is intended to cover non-exclusive inclusion. For example, a composition, process, method, article, or device that contains a plurality of elements listed is not necessarily limited to those elements listed on the list, but may include those that are not explicitly listed but are the composition, Other elements inherent to the process, method, article, or device. The term "comprising" is generally used in the sense of including, which allows the existence of one or more other features or components.

The purpose of this application is to provide a nuclear gene transgenic vector, which can be transfected into the nucleus of a plant cell by Agrobacterium or other methods known to those skilled in the art to which the present invention belongs, and can be transferred to the cytoplasm after being transcribed. Translated and synthesized recombinant TALEN protein. Recombinant TALEN protein can be guided by the N-terminal message protein to reach the chloroplast matrix through the chloroplast membrane transmission channel (Toc-Tic translocon), and then the recombinant TALEN protein can specifically bind to a specific location of the target chloroplast DNA. Recombinant TALEN protein is then acted by endonucleases (such as Fok I), which causes the double-stranded chloroplast DNA to break, which in turn initiates chloroplast DNA repair mechanisms, including homologous recombination (HR) or non-identical repair Non-homologous end joining (NHEJ). When the repair mechanism of non-homologous recombination of chloroplast DNA is used, the target gene is often mutated, which will further cause the target gene to lose its activity.

In one embodiment, as shown in FIG. 1, a nuclear gene transgenic vector is provided, including: a promoter; a chloroplast message protein gene (TP) located downstream of the promoter; a recombinant TALEN protein domain (TALEN), It is located downstream of the chloroplast message protein gene; and the T-DNA left border region (LB-T border) and T-DNA right border region (RB-T border), in which the promoter, chloroplast message protein gene and recombinant TALEN protein domain are in order Located between the left border region of T-DNA and the right border region of T-DNA.

In one embodiment, the nuclear gene transgenic vector may have a sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the nuclear gene transgenic vector is named pTpTalen-L or pTpTalen-R.

It is worth noting that those with ordinary knowledge in the technical field to which the present invention belongs can design the sequence of the recombinant TALEN protein domain according to the region recognized or cut by the desired recombinant TALEN protein. Other elements in the transgenic vector, such as promoters, selection markers, and terminators, etc., those with ordinary knowledge in the technical field to which the present invention pertains can select suitable elements for replacement according to the needs of the experiment.

In one embodiment, a method for generating a nuclear gene transgenic plant cell is provided, comprising: constructing a pair of the aforementioned nuclear gene transgenic vectors; incorporating the pair of nuclear gene transgenic vectors into a plant cell via Agrobacterium; and Screen and culture plant cells.

In still another embodiment, through the aforementioned method, a nuclear gene transgenic plant cell or a nuclear gene transgenic plant can be provided, or an Agrobacterium comprising the aforementioned nuclear gene transgenic vector can be provided.

The terms "plant", "plant cell", and "recombinant plant cell" as used herein may be used interchangeably with each other in this context. They may refer to plant cells such as dicotyledons, monocots, gymnosperms, etc., such as tobacco, Arabian mustard, potato, soybean, tomato, orchid, rice, corn, wheat, barley, sorghum, sugar cane, etc. One or more of the vectors described in the present invention or the vectors into which a gene to be expressed can be inserted by a genetic engineering method can be introduced into the plant cell. As understood by those of ordinary skill in the technical field to which the present invention pertains, the above terms not only refer to specific cells, but also to the progeny or potential progeny of such cells. Because of genetic mutations or environmental influences, changes may occur in subsequent generations, such cell offspring will not be substantially the same as the parental cells, but are still included within the scope of the term used herein.

The "chloroplast message protein gene" referred to herein refers to a nucleotide sequence that can be synthesized into an information protein after transcription of the nucleus and translation of the cytoplasm. This message protein is expressed at one end of the protein, such as the N-terminus. This message protein contains the guiding information needed to transport the protein to the chloroplast. Like the "address tag", this message protein directs the protein to the chloroplast surface. There is a special transmission channel (Toc-Tic translocon) on the surface of the chloroplast, which can identify this "address tag". After identification, the receiver will transfer the protein containing the correct "address tag" into the chloroplast matrix. After entering the chloroplast matrix, this extra piece of information protein is excised.

The "screening genes" referred to herein are used to confirm whether the aforementioned vectors have successfully transformed into the host. The aforementioned screening gene may be, but is not limited to, a drug resistance screening gene, a non-drug resistance screening gene, or a combination thereof. In a feasible implementation aspect, the aforementioned screening gene may be a drug resistance screening gene. For example, the aforementioned resistance screening gene may be a kanamycin or a neomycin resistance gene. In this feasible embodiment, a plant cell (for example, tobacco or Arab mustard) that has been successfully transformed with the aforementioned vector can develop resistance to kanamycin or neomycin and can survive kanamycin-containing Or neomycin environment.

The term "non-resistance screening gene" as used herein refers to genes that do not confirm the transformation by the resistance to antibiotics. The aforementioned non-drug resistant selection gene is, for example, but not limited to: Phosphinothricin N-acetyltransferase gene ( bar or pat ). As a selection gene, glufosinate or sulfonylimidine, which is a herbicide component, can be used as a selection gene. (Methionine sulfoximine; MSO) and other compounds are acetylated to remove their toxicity. Therefore, herbicides such as glufosinate and other compounds can be used to screen transgenic plants. In addition, mutations or overexpression of 5‐enolpyruvoyl‐shikimate‐3‐phosphate synthetase (EPSPS) gene can not be inhibited by the herbicide containing Glyphosate (N- (phosphonomethyl) glycine), so it can also be used as a screening gene To screen transgenic plants with herbicides such as Jiasaifo.

In a preferred embodiment, the aforementioned non-drug resistant selection genes are nutritional deficiency selection genes (eg, cytosine deaminase ( codA )), carbohydrate metabolism genes (eg, phosphomannose isomerase (manA) ; xylose isomerase ( xylA )), Plant hormone-related genes (eg, isopentenyltransferase (ipt) ), heavy metal resistance genes (eg, cadmium resistance gene), D-amino acid racemase (eg, alanine racemase) genes, heat shock proteins (heat shock protein) protein) gene or reporter gene (for example, β-glucuronidase ( GUS ); luciferase ( LUC ) ; fluorescent proteins ( FPs) ).

The terms "incorporated", "incorporated", or "delivering nucleic acid into cells" as used herein refer to the use of any method to make extracellular nucleic acids (such as carriers) in the presence or absence of accompanying substances (such as A vector or oligonucleotide) into the host cell. The terms "cell incorporation" or "incorporated cell" refer to the nucleic acid that is introduced into the plant cell or its progeny cells, and therefore the plant cell contains the nucleic acid outside the cell. The nucleic acid is sent into the cell, so that the nucleic acid can be combined with the chromosome into a fragment or copied as an extrachromosomal element, or the nucleic acid destroys the expression of endogenous genes in the cell.

In one embodiment, there are several ways to force the vector containing the foreign gene into the Agrobacterium, namely, electroporation and three-parent hybridization. The electroporation method is a method of electroporation of Agrobacterium to make a temporary through hole to allow the carrier to enter the Agrobacterium. The three-parent hybridization method is to culture Escherichia coli containing special plastids (called helper strains) with E. coli containing foreign genes and Agrobacterium containing helper plastids. The vector contains the foreign genes. It will enter the Agrobacterium containing helper plastids. In one embodiment, the Agrobacterium containing the foreign gene vector is further used to send the foreign gene into a target cell, such as a plant cell.

The indefinite articles "a" and "an" preceding an element or ingredient herein are intended to be a non-limiting illustration of the number of instances (ie, occurrences) of the element or ingredient. Therefore, "a" or "an" should be understood to include one or at least one, and the singular form of the element or ingredient also includes the plural unless the number obviously refers to the singular.

The materials, methods, and examples herein are illustrative only and are not intended to limit the present invention unless specifically stated otherwise. Although methods or materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, those described herein are suitable methods and materials.

Construction of a transcription-activating factor nuclease ( Transcription activator-like effector nuclease; TALEN )

TALEN is formed via a DNA recognition binding domain and an endonuclease active region of a Transcription activator-like effector (TALE). TALE is a protein secreted by Xanthomonas bacteria. This protein contains a nuclear entry signal (NLS) and a transcriptional activator, which can help TALE protein enter the nucleus from the cytoplasm and then specifically bind to the promoter of the host gene , Which in turn activates transcription.

The middle region of TALE is a tandem repeat region composed of multiple tandem repeat units. Each tandem repeat unit generally contains 34 amino acids, of which the amino acids at positions 12 and 13 have high variability and are called repeatable variable. Area (repeat-variable diresidue, RVD). RVD in each tandem repeat unit can identify different bases of DNA and have a simple one-to-one correspondence. For example, if RVD is NI (Asn-Ile) can identify A, HD (His-Asp) can identify C, NG (Asn-Gly) can recognize T, and NN (Asn-Asn) can recognize G / A.

On the other hand, the active region of the endonuclease may be a Fok I endonuclease, and the Fok I endonuclease needs to form a binary body to cut DNA. Therefore, it is currently possible to synthesize a pair of TALENs to pair with any desired binding DNA sequence and specifically to cleave its double-stranded DNA (Cermak et al., 2011).

In one embodiment, the user can design a recombinant TALEN protein domain based on the target gene, so that the repeated variable region of the recombinant TALEN protein domain can recognize the target nucleic acid sequence. For example, the recombinant TALEN protein domain may comprise a sequence as shown in SEQ ID NO: 21 or SEQ ID NO: 22, wherein the repeating variable region is represented by "NNNNNN", that is, N may be selected from A, T, and C And G, so that the repetitive variable regions shown are NI (Asn-Ile) that can recognize A, HD (His-Asp) that can recognize C, and NG (Asn-Gly) that can recognize T, Or NN (Asn-Asn) that can identify G or A. In one embodiment, a pair of nuclear gene transgenic vectors is designed. As shown in FIG. 1, the Talen-L and Talen-R encoded in pTpTalen-L and pTpTalen-R are a pair of TALEN genes. In one embodiment, the sequences of Talen-L and Talen-R in pTpTalen-L and pTpTalen-R are designed so that the translated protein can recognize the chloroplast rpoB gene sequence of Arabidopsis or tobacco.

design TALEN Target sequence of chloroplast gene

In this embodiment, the tobacco chloroplast rpoB gene is taken as an example, and Talen-L and Talen-R are designed according to the sequences. The rpoB gene is located in the operational genome (Operon) of rpoB-rpoCl-rpoC2 in chloroplast DNA (Little et al., 1988; Inada et al., 1996; Hajdukiewicz et al., 1997). According to previous research, if the rpoB gene is deleted from the chloroplast DNA of tobacco, although RNA-synthesizing enzymes encoded by the nucleus still maintain part of the chloroplast function, it will not cause plant death, but it will promote tobacco to have a white appearance and Growth also develops more slowly than normal tobacco plants (Allison et al., 1996). Because it is easier to observe, the rpoB gene was selected as the target gene for chloroplast gene editing of TALENs.

First, download the rpoB gene sequences (Accession numbers of NC_000932.1 and NC_001879.2, respectively) from Arabidopsis thaliana and tobacco from the NCBI database, perform sequence alignment, and extract a sequence with high common retention, and use TAL Effector Nucleotide Targeter 2.0 (https://talent.cac.corne-ll.edu/node/add/talen) Target bits for web design TALENs. In an embodiment, the target DNA sequences identified by the Talen-L and the Talen-R are selected to be 5'-TCCAAAAATTGAA-3 '(SEQ ID NO: 11) and 5'-TAATTGAAATTCA -3' (SEQ ID NO: 12).

Nuclear recombination TALEN Gene expression vector

According to the aforementioned target DNA sequence, the target DNA sequences SEQ ID NO: 11 and SEQ ID NO: 12 located in the chloroplast rpoB gene were respectively synthesized using the Golden Gate TALEN assembly kit (Cermak et al., 2011) and constructed into a pair. TALEN gene, the RVD sequences of the repeated variable regions it translated were N'-HD-HD-NI-NI-NI-NI-NI-NG-NG-NN-NI-NI-C 'and N' -NI-NI-NG-NG-NN-NI-NI-NI-NG-NG-HD-NI-C ', which can specifically recognize and bind to the target DNA sequences SEQ ID NO: 11 and SEQ ID NO: 12 . In one embodiment, according to the operating instructions of the Golden Gate TALEN assembly kit, when constructing the aforementioned RVD sequence, it needs to be divided into a front stage and a back stage, which are named pTALEN-L1, pTALEN-L2, pTALEN-R1, and pTALEN-R2, respectively, and Its RVD sequences are N'-HD-HD-NI-NI-NI-NI-C ', N'-NI-NG-NG-NN-NI-C', N'-NI-NI-NG-NG- NN-NI-C 'and N'-NI-NI-NG-NG-HD-C'.

Next, a nuclear expression vector for the recombinant TALEN gene was constructed using pTALEN-L1, pTALEN-L2, pTALEN-R1, and pTALEN-R2. In short, the synthesized TALEN gene fragment was recombined into the plant expression vector pImpactVector 4-1, and the final composition of the gene expression cassette was rbcS chloroplast message protein and HA tag or Flag tag recombined at the N-terminus of TALEN, and was transformed by rbcS Gene promoter to regulate the expression of recombinant TALEN. The gene expression cassettes were then recombined into the Agrobacterium duality vector pBinPlus (containing the nptII gene as a selection marker) or pZGB9R (including the bar gene as a selection marker) to obtain the nuclear expression vectors pTpTalen-R and pTpTalen-L, respectively ,As shown in Figure 1. Here are the experimental steps in detail:

Construction of pTALEN-L1 and pTALEN-R1 vectors:

Using primer pairs pFUSA-M6-R (AGCGGCGCCGGTCTCGATAGCC; SEQ ID NO: 13) and pFUS-A-Del-F (AGCAAGCGGGTCTCACGGTGCAGCGGCTGTTG; SEQ ID NO: 14) PCR amplification was performed using the pFUS-A vector as a template to obtain 2,573 bp DNA fragment. The PCR amplified fragment of pFUS-A was cut with the restriction enzyme BsaI, separated by 1% agar gel electrophoresis, and a 2,560 bp DNA fragment was purified. Then use the primer pair pTC14-F3 (TCTGATGTTACATTGCACAAGA; SEQ ID NO: 15) and pTC14-R3 (TGAACGCTCTCCTGAGTAGG; SEQ ID NO: 16) with the Module plasmid vector (pTALEN-L1: pHD1, pHD2, pNI3, pNI4, pNI5, pNI6; pTALEN-R1: pNI1, pNI2, pNG3, pNG4, pNN5, pNI6) were used as templates for PCR amplification and quantification. The PCR amplified fragments of the Module plasmid were mixed, cut with the restriction enzyme BsaI, and separated by 2% agar gel electrophoresis, and a 79-100 bp DNA fragment was purified. The DNA fragment of the PCR product of the Module plasmid cut by BsaI and the DNA fragment of the PCR product of pFUS-A cut by BsaI were subjected to an adhesion reaction. After transformation into E. coli, it was screened at 100 mg / L Spectinomycin to obtain 3,087 bp pTALEN-L1 and 3,087 bp pTALEN-R1 vectors, respectively.

Construction of pTALEN-L2 and pTALEN-R2 vectors:

PFUS-B5 was cut with the restriction enzyme BsaI, separated by 1% agarose electrophoresis, and a 2,557 bp DNA fragment was purified. Use primer pairs pTC14-F3 (TCTGATGTTACATTGCACAAGA; SEQ ID NO: 15) and pTC14-R3 (TGAACGCTCTCCTGAGTAGG; SEQ ID NO: 16) with Module plasmid vectors (pTALENL2: pNI1, pNG2, pNG3, pNN4, pNI5; pTALEN-R2: pNI1 , PNI2, pNG3, pNG4, pHD5) as templates for PCR amplification. The PCR amplified fragments of the Module plasmid were mixed, cut with the restriction enzyme BsaI, and separated by 2% agar gel electrophoresis, and a 79-100 bp DNA fragment was purified. The BsaI-cut DNA fragment of the PCR product of the Module plasmid and the BsaI-cut fragment of pFUS-B5 were subjected to an adhesion reaction. After transformation to E. coli and screening with 100 mg / L Spectinomycin, 3,007 bp pTALEN-L2 and 3,007 bp pTALEN-R2 vectors were obtained.

Construction of pTALEN-L carrier:

The pCS2TAL3-DD, pTALEN-L1 and pTALEN-L2 vectors were cut with the restriction enzyme Esp3I, separated by 1% agar gel electrophoresis, and 5,309 bp, 616 bp, and 536 bp DNA fragments were purified respectively. The pLR-NI vector was cut with the restriction enzyme Esp3I, separated by 2% agarose electrophoresis, and a 89 bp DNA fragment was purified. Esp3I-cut fragments of pCS2TAL3-DD, TALEN-L1, TALEN-L2, and pLR-NI were subjected to an adhesion reaction. After transformation into E. coli, it was screened at 100 mg / L Ampicillin to obtain a 6,550 bp pTALEN-L vector.

Construction of pTALEN-R vectors:

The pCS2TAL3-RR, pTALEN-R1 and pTALEN-R2 vectors were cut with the restriction enzyme Esp3I, and then separated by 1% agar gel electrophoresis, and 5,339 bp, 616 bp, and 536 bp DNA fragments were purified respectively. The pLR-NI vector was cut with the restriction enzyme Esp3I, separated by 2% agarose electrophoresis, and a 89 bp DNA fragment was purified. Esp3I-cut fragments of pCS2TAL3-DD, TALEN-L1, TALEN-L2, and pLR-NI were subjected to an adhesion reaction. After transformation into E. coli, it was screened at 100 mg / L Ampicillin to obtain a 6,580 bp pTALEN-R vector.

Construction of plant tissue-specific expression vectors: Utilizing the rbcS (Ribulose-1,5-bisphosphate carboxylase / oxygenase small subunit) gene promoter from Chrysanthemum spp. (Outchkourov et al., 2003) to regulate gene expression. Initiation of expression of downstream genes in tissues that perform photosynthesis. Therefore, a vector containing the rbcS promoter was constructed, including pTpTalen-L and pTpTalen-R and other transition vectors in the construction of these two vectors.

Construction of pIV4-TL vector:

Using primer pair TAL-BamHI-F (CATGGCTCCAAAGAAGGATCCTAAGGTA; SEQ ID NO: 17) and TAL-NsiI-R (GCACCCGTCAGTGCATTGC; SEQ ID NO: 18), PCR amplification was performed using pTALEN-L as a template, and the restriction enzyme Nsi was used I and BamH I cut the PCR fragments and separated them by 1% agar gel electrophoresis. The 460 bp DNA fragments were purified. At the same time, pTALEN-L and ImpactVector ^TM 1.4 were cut with the restriction enzymes Not I / Nsi I and Not I / BamH I, respectively, and separated by 1% agar gel electrophoresis, and 2,233 bp and 4,906 bp DNA fragments were purified respectively. Then after the restriction enzyme cleavage by ^{ImpactVector TM 1.4 (4,906 bp),} pTALEN-L (2,233 bp) and the pTALEN-L PCR product (460 bp) of the DNA fragment bonding reaction, after Transformation of E. coli, and then by Screening at 100 mg / L Ampicillin yielded a 7,598 bp pIV4-TL vector.

Construction of pIV4-TR vectors:

Using primer pairs TAL-BamHI-F (CATGGCTCCAAAGAAGGATCCTAAGGTA; SEQ ID NO: 17) and TAL-NsiI-R (GCACCCGTCAGTGCATTGC; SEQ ID NO: 18), PCR amplification was performed using pTALEN-R as a template, and the restriction enzyme Nsi was used I and BamH I cut the PCR amplified fragments and separated them by 1% agarose electrophoresis. The 490 bp DNA fragment was purified. At the same time, pTALEN-R and ImpactVector ^TM 1.4 were cut with restriction enzymes Not I / Nsi I and Not I / BamH I, respectively, and separated by 1% agar gel electrophoresis. 2,233 bp and 4,906 bp DNA fragments were purified respectively. Then after the restriction enzyme cleavage by ^{ImpactVector TM 1.4 (4,906 bp),} pTALEN-R (2,233 bp) and the pTALEN-R PCR product (490 bp) DNA fragment bonding reaction, after Transformation of E. coli, and then by 100 Screened with mg / L Ampicillin to obtain a 7,628 bp pIV4-TR vector.

Construction of pZGB-IV4 vector

Use primer pairs AscI-IV-F (TGGCGCGCCAGACAAACACCCCTTGTTATAC; SEQ ID NO: 19) and H3-PacI-IV-R (CATAAGCTTTTAATTAATGCGTCCACTATAGAC; SEQ ID NO: 20) PCR amplification using ImpactVector ^TM 1.4 as template, and then use restriction enzymes HindIII and AscI were used to cut PCR amplified fragments and separated by 1% agarose gel electrophoresis. A 2,293 bp DNA fragment was purified. At the same time, pZGB9R was cut with the restriction enzymes Hind III and Asc I, and separated by 1% agarose electrophoresis, and 8,479 bp DNA fragments were purified. The restriction enzyme cleaved pZGB9R (8,479 bp) and ImpactVector ^TM 1.4 PCR product (2,293 bp) DNA fragments were subjected to an adhesion reaction. After transformation to E. coli, screening was performed at 100 mg / L Kanamycin to obtain a 10,747 bp pZGB-IV4 vector.

Construction of pTpTalen-L vector:

PIV4-TL and pZGB-IV4 were cut with restriction enzymes Asc I and Pac I, respectively, and separated by 1% agarose electrophoresis. 4,953 bp and 8,478 bp DNA fragments were purified respectively. The restriction enzyme cleaved pZGB-IV4 (8,478 bp) and pIV4-TL (4,953 bp) DNA fragments were subjected to an adhesion reaction. After transformation to E. coli, screening was performed with 100 mg / L Kanamycin to obtain 13,435 bp pTpTalen. -L vector. The sequence of the repeatable variable region in the recombinant TALEN protein domain of the pTpTalen-L vector includes the nucleotide sequence shown in SEQ ID NO: 3.

Construction of pTpTalen-R Vector:

PIV4-TR and pBinPLUS were cut with restriction enzymes Asc I and Pac I, respectively, and separated by 1% agarose electrophoresis. 4,983 bp and 12,328 bp DNA fragments were purified respectively. The restriction enzyme cleaved pBinPLUS (12,328 bp) and pIV4-TR (4,983 bp) DNA fragments were subjected to an adhesion reaction. After transformation into E. coli, screening was performed with 100 mg / L Kanamycin to obtain 17,311 bp pTpTalen-R Carrier. The sequence of the repeatable variable region in the recombinant TALEN protein domain of the pTpTalen-R vector includes the nucleotide sequence shown in SEQ ID NO: 4

Transplantation of expression vectors

Transplantation of performance vectors into tobacco:

In brief, the previously constructed nuclear recombinant TALEN expression vectors were respectively transferred into Agrobacterium by electroporation, and after screening with appropriate antibiotics (kanamycin or hygromycin), transgenic Agrobacterium containing different vectors were obtained. The agrobacterium culture medium into which pTpTalen-L and pTpTalen-R are transferred are mixed at the same concentration ratio of the bacterial solution, and then placed in the tobacco leaf disc tissue for co-transplantation (Chang et al., 2007).

Specifically, 2 μL of the Agrobacterium bacillus liquid (GV3101) was drawn from the frozen bacteria tube and added to a test tube containing 10 ml of LB (containing 100 mg / L Rifomycin and 100 mg / L Gentamycin) at 150 rpm at 28 ° C. Shake for 1 day. 200 μL was drawn from the bacterial culture for 1 day and added to a test tube containing 4 mL of LB (containing 100 mg / L Rifomycin and 100 mg / L Gentamycin), and cultured at 28 ° C with shaking at 150 rpm for 4 hours. Take 1.5 mL into a microcentrifuge tube, centrifuge at 6,000 rpm, 4 ° C for 3 minutes, remove the supernatant, and repeat this step until all the bacteria settle in the microcentrifuge tube. Add 200 μL of sterile 10% glycerol pre-chilled on ice, dissolve the bacteria after precipitation, and centrifuge at 4 ° C for 3 minutes at 6,000 rpm. Pour the supernatant into the waste bottle and repeat This step is once. Add 100 μL of sterile 10% glycerol pre-chilled on ice, reconstitute the bacteria, and place on ice for 5 minutes. Add 1.5 μg of plastid. Place the stun tube on ice before shock. The bacterial solution was transferred to an electric shock tube and shocked at 2,500 volts and 100 ohms (BTX ECM399 Electroporation Generator, USA). Transfer the bacterial solution to a new microcentrifuge tube, add 1 mL of LB, and incubate with shaking at 150 rpm for 1 hour at 28 ° C. Centrifuge the bacterial solution at 5,000 rpm for 1 minute, remove about 950 μL of the supernatant, mix the remaining supernatant with the bacterial cells, and transfer to LB solid medium to spread evenly. Cultivate at room temperature. You can observe the appearance of transformed Agrobacterium colonies on the culture plate for about 2-3 days.

Screening of transgenic tobacco tissue and plant regeneration:

In short, plant tissues co-transplanted with two expression vectors will be screened according to the selection marker genes carried on the expression vectors in combination with two different drugs (kanamycin, methionine sulfoximine (MSO)). Colonization turn differentiate into tobacco plant tissue by regeneration process by the self-pollinated to give seed transfected colonization tobacco (T ₁ progeny). The T ₁ progeny can be obtained by self-pollination to obtain the transgenic T ₂ progeny. The detailed process of tobacco nuclear gene translocation is as follows:

A single colony of Agrobacterium containing recombinant plastids was stained with a platinum inoculation loop, mixed in 5 mL of LB containing antibiotics (including 150 μg / L Rifampicin and 150 μg / L Kanamycin), and cultured at 28 ° C with shaking at 150 rpm 18 to 24 hours. The next day, the bacterial culture was scaled up to 50 mL of LB medium containing appropriate antibiotics (150 μg / L Rifampicin and 150 μg / L Kanamycin), 1 mL of 500 mM MES, and 5 μL of 0.2M Acetosyringone. 24 hours. The cultured bacterial solution was centrifuged at 1,700 xg at room temperature for 10 minutes, and the supernatant was removed. Add 5 mL of infiltration buffer (10 mM MES 1 mL, 10 mM MgCl ₂ ), and shake back the lysosomes evenly. Measure the OD _{600 of the} bacterial solution, and adjust the bacterial solution to an OD ₆₀₀ of 1. Mix the bacterial solution with 0.2 M Acetosyringone solution (1000: 1 ratio), and shake and culture at 150 rpm for 3 to 4 hours. Then, the microtubule bundle tissue on the back of tobacco leaf was lightly scraped with a sterile needle. Suck 0.1-0.3 mL of bacterial solution with a syringe, hold the injection syringe against the back of the leaf, and gently press the leaf surface with your fingers. Begin to slowly inject the bacterial solution into the inside of the tobacco leaves. It can be seen that the liquid diffuses in the leaves and fills the inside. Mark the injection area after injection.

The injected tobacco plants were placed in a cardboard box and cultured in the dark for 2 days in the dark, and then cultured for 3 days in the light. After that, the tissues within the injection range of the leaves were cut out and sterilized by shaking with 1.2 to 2% bleach for 10 minutes. Rear. Use a scalpel to cut the wound on the periphery of the blade, cut the leaves into an appropriate size, with the back of the leaves facing up, place in Tobacco shooting medium (TSM) medium containing the appropriate antibiotic, seal with a breathable tape, and place in a 25 ° C plant growth box After 16 hours of sunlight, callus and stems and leaves were grown, and then root culture was carried out and finally transferred to the soil.

Analysis of transgenic plants

a. PCR molecular detection:

According to the foregoing examples, many tobacco transgenic lines were cultured. Six transgenic lines M0, M11, M14, M17, M29, and M42 were selected for PCR amplification to detect foreign genes (TpTalen-L and TpTalen- R) Whether it is inserted into tobacco DNA at the same time.

In one embodiment, a plant genomic DNA mini kit (Geneaid, Taiwan) is used to extract plant leaf tissue DNA. First, weigh 0.1 g of plant leaf tissue and grind it into powder with liquid nitrogen. Add 400 μL of GP1 buffer and 5 μL of RNase A, mix and transfer to a 1.5 mL microcentrifuge tube, heat at 60 ° C for 10 minutes, and preheat Elution buffer (200 μL / sample) at this time for later use. Add another 100 μL GP2 buffer and mix well, and place on ice for 3 minutes. Transfer the plant tissue fluid to the Filter column and centrifuge at 1,000 xg for 1 minute. Transfer the filtrate to a new 1.5 mL microcentrifuge tube, add 1.5 times the volume of GP3 buffer, and shake for 5 seconds. Transfer 700 μL of the plant tissue mixture to the GD column and centrifuge at 14,000 xg for 2 minutes. Remove the filtrate and repeat this step until the plant tissue mixture is completely removed. Add 400 μL W1 buffer to the GD column and centrifuge at 14,000 xg for 30 seconds, then remove the filtrate. Add 600 μL Wash buffer to the GD column and centrifuge at 14,000 xg for 30 seconds, then remove the filtrate. Centrifuge at 14,000 xg for 3 minutes and remove the column into a new 1.5 mL microcentrifuge tube. Add 50 to 100 μL of Elution buffer to the column membrane, leave it for 5 minutes, and centrifuge at 14,000 xg for 30 seconds to filter the DNA solution out of the column and collect it into a 1.5 ml microcentrifuge tube. ° C Save.

Next, the control group (WT) and transgenic tobacco DNA (150 ng) were subjected to PCR with a pair of primers Check-F (SEQ ID NO: 5; AATTCACTCATTGGATTCATAGAAG) and Check-R (SEQ ID NO: 6; CTGTAGCCGAGCGTGCGTAG). To confirm whether the foreign genes (TpTalen-L and TpTalen-R) were inserted into the tobacco DNA at the same time. The three-stage conditions for the reaction temperature and time of PCR are as follows: the first stage is performed at 95 ° C for 2 minutes. The second stage is divided into three parts: Denaturation at 95 ° C for 30 seconds, Annealing at 61 ° C for 30 seconds, and Elongation at 72 ° C for 45 seconds. This stage is repeated approximately 45 times. The third stage was reacted at 72 ° C for 5 minutes. An additional 2.2% agar was used for electrophoretic separation at 100 volts for 40 minutes.

The electrophoresis results are shown in Part B of Figure 2. In the electrophoresis results of the six different transgenic lines, PCR products of 452 bp and 482 bp can be detected simultaneously, that is, the Talen-L and Talen-R genes are simultaneously expressed in 6 Among the transgenic lines, no talen-L and talen-R genes were detected in WT. This indicates that the Talen-L and Talen-R genes have been successfully transfected into tobacco.

b. Observe the appearance of transgenic plants:

Observe the differences in external traits and growth between different transgenic plant lines and control groups. The results are shown in Fig. 3, and the appearance traits, growth and development of the transgenic plants showed diversity. Some lines of transgenic plants do not have any appearance traits, and the leaves of some lines of transgenic plants show speckled albino or localized albino (such as M29), or the entire leaf is white (yellow) (such as M11, M17), while some transgenic plants Albino (light yellow) plants (such as M0). In addition, the growth and development of transgenic plants are also delayed to varying degrees. As reported in previous studies, when tobacco chloroplast rpoB genes are mutated, they can cause albino appearance in plants (Allison et al., 1996). Therefore, it is speculated that the difference in the degree of albinoization of transgenic plants may be related to the amount of recombinant TALEN protein expressed in the leaves of transgenic plants, which caused the chloroplast rpoB gene to be damaged to different degrees, resulting in these leaves having different degrees of appearance traits.

c. High-resolution dissociation analysis of chloroplast rpoB gene mutations:

To investigate whether the albino traits caused by plants are related to chloroplast rpoB gene mutations. Therefore, the albino leaf tissues of two different transgenic lines (M11 and M17) were selected, and after DNA extraction, a pair of primers (SEQ ID NO: 7; GGATTTAATCAGATACAATTTGAAG) and (SEQ ID NO: 8; TTCCAAATTAATCCCGCGGATAC) were used for quantitative PCR (Q -PCR, Fast Evagreen ^® qPCR Master Mixer, Biotium) to amplify the amplified DNA sequence of the recombinant TELEN protein in the vicinity of the rpoB gene (expected PCR product size is 229 bp), and perform high-resolution dissociation analysis of the PCR product (high resolution melting (HRM) analysis, and compared with the control group (normal tobacco) to observe whether the DNA sequence has changed.

Specifically, Q-PCR was performed on a mixture containing 2X Fast Evagreen ^® qPCR Master Mixer (Biotium) with a total reaction volume of 20 μL, 2.5 mM MgCl ₂ , 0.2 μM of the aforementioned primers, and 20 ng of transgenic tobacco DNA. The expected product was 229 bp. Q-PCR and HRM are performed using Roche Light Cycler ^® Nano. First, the process is performed at 95 ° C for 180 seconds, followed by a two-stage cycle step. Each cycle is performed at 95 ° C for 10 seconds and 60 ° C for annealing / extension for 50 seconds. Double-stranded DNA was completely dissociated at 95 ° C for 60 seconds, and then treated at 40 ° C for 60 seconds to form a heterozygous structure. Finally, the temperature was gradually increased from 65 ° C to 95 ° at 0.05 per second. C for HRM analysis.

The results in Figure 4 show, white leaf tissue colonization transfected plant (M11-W and M17-W) compared to the control group, there are significant differences of the melting curve, which represents the rpoB gene in these two lines are transferred Colonization Nucleotide mutations occur.

d. Sequence analysis of chloroplast rpoB gene:

In order to study whether the performance of recombinant TALEN protein in transgenic plants finally caused mutations in the chloroplast rpoB sequence, leaf tissues of the control group (WT) and 4 different transgenic lines (M0, M11, M17 and M29) were extracted, of which M11 and The DNA of M17 plants was extracted from white (M11-W and M17-W) and green (M11-G and M17-G) leaf tissues, respectively. A pair of primers (SEQ ID NO: 9; AGCAGAAGTCTGTTTCTAGGGATGT) and (SEQ ID NO: 10; TAGCTGATGATAGAACTAGAATA) were used to amplify and amplify the sequence of the recombinant TALEN protein in the vicinity of the rpoB gene by PCR, and sequence the PCR product. Sequence results were multiplexed using CLC Genomics Workbench 9.5.2 software.

The results are shown in Fig. 5. In the transgenic lines M0, M11, M17, and M29, the white or yellow leaf tissues (M0, M11-W, M17-W, M29) showed significant A to T mutations in rpoB -295. Situation, as indicated by the arrow. However, the rpoB gene sequence in the green leaf tissues (M11-G, M17-G) of M11 and M17 was the same as that of the control group. This means that tobacco can be transfected with pTpTalen-L and pTpTalen-R to mutate specific chloroplast genes, such as mutations in the chloroplast rpoB gene, which can lead to changes in plant appearance.

What has been described above is merely exemplary and not restrictive. Those with ordinary knowledge in the technical field to which the present invention belongs can design repetitive variable regions in the recombinant TALEN protein domain according to the requirements and targeted nucleotide sequences, so that the recombinant TALEN protein can specifically identify the target nucleic acid sequence. Any equivalent modification or change made without departing from the spirit and scope of the present invention shall be included in the scope defined by the scope of patent application.

References: Allison, LA, Simon, LD and Maliga, P. Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. The European Molecular Biology Organization Journal 15, 2802-2809, 1996. Bock, R. Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology. Annual Review of Plant Biology , 66 , 211-241, 2015. Cermak, T., Doyle, EL, Christian, M., Wang, L., Zhang, Y ., Schmidt, C., Baller, JA, Somia, NV, Bogdanove, AJ and Voytas, DF Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Research 39, e28, 2011. Chang , CC, Huang, PS, Lin, HR, & Lu, CH. Transactivation of protein expression by rice HSP101 in planta and using Hsp101 as a selection marker for transformation. Plant and cell physiology , 48 (8), 1098-1107, 2007 Hajdukiewicz, PT, Allison, LA and Maliga, P. The two RNA polymerases encoded by the nuclear and the plastid compartments transcribe dis tinct groups of genes in tobacco plastids. The European Molecular Biology Organization Journal 16, 4041-4048, 1997. Inada, H., Kusumi, K., Nishimura, M. and Iba, K. Specific expression of the chloroplast gene for RNA polymerase ( rpoB ) at an early stage of leaf development in rice. Plant and Cell Physiology 37, 229-232, 1996. Little, MC and Hallick, RB Chloroplast rpoA , rpoB , and rpoC genes specify at least three components of a chloroplast DNA- dependent RNA polymerase active in tRNA and mRNA transcription. The Journal of Biological Chemistry 263, 14302-14307, 1988. Outchkourov, NS, Peters, J., de Jong, J., Rademakers, W. and Jongsma, MA The promoter-terminator of chrysanthemum rbcS1 directs very high expression levels in plants. Planta 6, 1003-1012, 2003.

no

FIG. 1 is a map of a nuclear gene transgenic vector according to an embodiment of the present invention. Among them, part A and part B are pTpTalen-L and pTpTalen-R, both of which are Agrobacterium-dual vectors expressed by nuclear genes and are expression vectors with leaf tissue specificity. The backbone of pTpTalen-L is derived from pZGB9R and has the KanR ( npt II ) gene as a selection marker; the backbone of pTpTalen-R is derived from pBinPlus and has the bar gene as a selection marker. The meanings of each abbreviation are: LB-T Border and RB-T Border are the left and right borders of Agrobacterium T-DNA, respectively. CaMV 35S is the promoter of the Califlower mosaic virus 35S transcript. 35S polyA is the 3'UTR of the 35S transcript of Califlower mosaic virus. RbcS promoter is the promoter of the rbcS gene. The RbcS terminator is the 3'UTR of the rbcS gene. KanR ( npt II ) is a selection marker gene for kanamycin resistance, while bar is a selection marker gene for herbicide resistance (Methionine sulfoximine, MSO). TP is the sequence of the chloroplast message protein. Flag is a Flag tag and HA is an HA tag.

Fig. 2 is an example of the invention requested by the present case to confirm whether the gene is embedded in the tobacco genome after co-transplantation of pTpTalen-L and pTpTalen-R by PCR. (A) The PCR primer pairs Check-F (SEQ ID NO: 5; AATTCACTCATTGGATTCATAGAAG) and Check-R (SEQ ID NO: 6; CTGTAGCCGAGCGTGCGTAG) used in the PCR primer pairs are located on the pTpTalen-L and pTpTalen-R vectors. (B) Six co-transplanted tobacco lines (M0, M11, M14, M17, M39, M42), a control group (Wt is untransplanted tobacco), pTpTalen-L (Lp), and pTpTalen-Rp (Rp) vectors The amplified DNA was amplified using specific primer pairs (Check-F and Check-R), and the PCR products were separated by 2.2% agar gel electrophoresis. In the figure, M is a 100 bp DNA marker. The arrows indicate the expected PCR product sizes of 482 bp and 452 bp, respectively.

FIG. 3 is a plant phenotype of a tobacco line transfected with a nuclear gene according to an embodiment of the present invention. As shown in the figure, four different transgenic lines transplanted with nuclear genes showed the appearance of leaf whitening or yellowing to varying degrees. WT is the control group (non-transplanted tobacco). M0 is an albino plant line. M11 is two different individuals growing in culture or soil. M17 is two different individuals growing in culture or soil. M29 is two different individuals growing in the soil.

FIG. 4 is an analysis of mutations in the rpoB gene of tobacco chloroplasts according to an embodiment of the present invention by using High Resolution Melting (HRM). DNA was extracted from leaf tissue of the WT control group (non-transplanted tobacco) and white leaf tissue of two different transgenic lines (M11 and M17), followed by a pair of primers (SEQ ID NO: 7; GGATTTAATCAGATACAATTTGAAG) and (SEQ ID NO: 8; TTCCAAATTAATCCCGCGGATAC) perform Q-PCR (Fast Evagreen ^® qPCR Master Mix, Biotium) to amplify and amplify the DNA near the action area of recombinant TELEN protein (229 bp), and perform high-resolution dissociation analysis (HRM, LightCycler ^® Nano, Roche). The results showed that the white leaf tissues (M11-W and M17-W) of the transgenic plants had obvious melting curve differences from the WT control group. Therefore, it was speculated that the nucleotide variation of the rpoB gene occurred.

FIG. 5 shows that the recombinant TALEN protein caused variation in the chloroplast rpoB gene sequence of tobacco leaves according to an embodiment of the present invention. The leaf tissues of the control group (WT) and 4 different transgenic lines (M0, M11, M17 and M29) were extracted. The DNA of the M11 and M17 plants was extracted from the white (M11-W and M17-W) and green respectively. (M11-G and M17-G) Leaf tissue. A pair of primers (SEQ ID NO: 9; AGCAGAAGTCTGTTTCTAGGGATGT) and (SEQ ID NO: 10; TAGCTGATGATAGAACTAGAATA) were used to amplify the amplified DNA by PCR, and the PCR products were sequenced. The sequencing results were obtained using CLC Genomics Workbench 9.5.2 The software performs multiple sequence alignments. The results showed that the Apo-T mutation occurred at the rpoB- 295 position of the white or yellow leaf tissues (M0-W; M11-W, M17-W, M29) of the transgenic lines M0, M11, M17 and M29. . However, the rpoB gene sequence in the green leaf tissues (M11-G, M17-G) of M11 and M17 was the same as that of the control group. The arrow is the mutated nucleotide.

In the following detailed description, in order to explain the present invention, many specific details are provided to enable a thorough understanding of the disclosed embodiments. However, it is apparent that one or more embodiments can be implemented without the specific details. In other cases, to simplify the drawings, conventional structures and processes will be shown in a schematic manner.

Claims (21)

A nuclear gene transgenic vector, comprising: a promoter; a chloroplast message protein gene located downstream of the promoter; a recombinant TALEN protein domain comprising the sequence shown in SEQ ID NO: 21 or SEQ ID NO: 22; And a first boundary region and a second boundary region, wherein the promoter, the chloroplast information protein gene, and the recombinant TALEN protein domain are sequentially located between the first boundary region and the second boundary region. The transgenic vector according to claim 1, wherein the promoter is an rbcS promoter. The transgenic vector according to claim 1, wherein the recombinant TALEN protein domain comprises a DNA sequence encoding a DNA recognition protein and a DNA sequence of an endonuclease. The transgenic vector according to claim 3, wherein the endonuclease is Fok I. The transgenic vector according to claim 3, wherein the DNA recognition protein recognizes a fragment of a chloroplast rpoB gene. The transgenic vector according to claim 5, wherein the DNA sequence encoding the DNA recognition protein has a sequence as shown in SEQ ID NO: 3 or SEQ ID NO: 4. The transgenic vector according to claim 1, further comprising a screening gene. The transgenic vector according to claim 7, wherein the selection gene is a drug resistance selection gene, a non-drug resistance selection gene, or a combination thereof. The transgenic vector according to claim 7, wherein the screening gene comprises a kanamycin resistance gene or a methionine sulfoximine (MSO) herbicide resistance gene. The transgenic vector according to claim 9, wherein the kanamycin resistance gene includes nptII or the sulfamelimide herbicide resistance gene includes bar . The transgenic vector according to claim 1, further comprising a sequence encoding a marker. The transgenic carrier according to claim 11, wherein the marker comprises a member selected from the group consisting of a luminescent molecule, a chemiluminescent molecule, a fluorescent dye, a fluorescence quencher, a lipid, a colored molecule, a radioisotope, a scintillator, biotin, an anti- Detectable labels in a group consisting of biotin, streptavidin, protein A, protein G, antibodies or fragments thereof, polyhistidine, Ni ²⁺ , Flag tags, myc tags, HA tags, and enzymes Thing. The transgenic vector according to claim 1, which comprises the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. The transgenic vector according to claim 1, further comprising a non-transcribed region at the 3 end of the rbcS gene, which is located downstream of the recombinant TALEN protein domain. N. spp. To N., N. provides a. A set of chloroplast gene-specific mutations in a plant includes: a first transgenic vector including: a first promoter; a first chloroplast message protein gene located downstream of the first promoter; a first recombination The TALEN protein domain includes the sequence shown in SEQ ID NO: 21; and a first border region and a second border region, wherein the first promoter, the first chloroplast message protein gene, and the first recombinant TALEN protein The domains are sequentially located between the first boundary region and the second boundary region; and a second transgenic vector, including: a second promoter; a second chloroplast information protein gene, which is located in the second promoter gene Downstream; a second recombinant TALEN protein domain comprising the sequence shown in SEQ ID NO: 22; and a third border region and a fourth border region, wherein the second promoter, the second chloroplast message protein gene and The second recombinant TALEN protein domain is sequentially located between the third boundary region and the fourth boundary region. A method for generating a nuclear gene transgenic plant cell, comprising: constructing a pair of nuclear gene transgenic vectors as described in claim 1; incorporating the nuclear gene transgenic vector into a plant cell through an Agrobacterium; and screening and culturing The plant cell. The method of claim 16, wherein the incorporation comprises a homology-oriented repair mechanism or a non-homologous end junction-oriented repair mechanism. The method according to claim 16, further comprising transplanting the nuclear gene transgenic vector into the Agrobacterium. The method according to claim 16, further comprising analyzing the plant cell and confirming that the nuclear gene transgenic vector is incorporated into the plant cell. A nuclear gene transgenic plant cell constructed by the method described in claim 16. An Agrobacterium comprising a nuclear gene transgenic vector according to claim 1.