TW201930601A - Systems and methods for writing, reading, and controlling data stored in a polymer - Google Patents

Abstract

The disclosure provides a novel system of storing information using a charged polymer, e.g., DNA, the monomers of which correspond to a machine-readable code, e.g., a binary code, and which can be synthesized and/or read using a novel nanochip device comprising nanopores; novel methods and devices for synthesizing oligonucleotides in a nanochip format; novel methods for synthesizing DNA in the 3' to 5' direction using topoisomerase; novel methods and devices for reading the sequence of a charged polymer, e.g., DNA, by measuring capacitive or impedance variance, e.g., via a change in a resonant frequency response, as the polymer passes through the nanopore; and further provides compounds, compositions, methods and devices useful therein.

Description

   System and method for writing, reading and controlling data stored in polymers   

The present invention relates to novel methods, compositions, and devices that can be used for information storage and retrieval by using nanopore devices to synthesize and sequence polymers such as nucleic acids.

There is a continuing need to store more data on or in physical media, storage devices are becoming smaller and smaller, and their capacity is becoming larger and larger. According to reports, the amount of stored data doubles every two years, and according to one study, by 2020, the amount of data we create and copy each year will reach 44 ZetaBytes, or 44 trillion gigabytes. Moreover, existing data storage media such as hard drives, optical media, and magnetic tapes are unstable and damaged after long-term storage.

Alternative methods are urgently needed to store large amounts of data for long periods, such as decades or centuries.

Some have proposed using DNA to store data. DNA is extremely stable and can theoretically encode large amounts of data and store it for long periods of time. See, for example, Long-term Storage of Information in DNA by Bancroft, C, et al., Science (2001) 293: 1763-1765. In addition, DNA as a storage medium is not vulnerable to the security risks of traditional digital storage media. But there is no practical way to implement this idea.

For example, WO 2014/14991 describes a method for storing data on a DNA oligonucleotide, in which information is encoded in a binary format, with one bit per nucleotide having 96 bits (96 nucleotides) ) Data blocks, 19 nucleotide address sequences, and flanking sequences for amplification and sequencing. Next, to read the code, the sequence is amplified using PCR and sequenced using a high-speed sequencer such as an Illumina HiSeq machine. Then, the address block sequence is used to arrange the data block sequence in the correct order, the address and flanking sequences are filtered, and the sequence data is converted into binary code. These methods have severe limitations. For example, the 96-bit metadata block may encode only 12 letters (using traditional one byte or 8 bits per letter or space). The ratio of stored useful information to "housekeeping" information is low-about 40% of the sequence information is occupied by addresses and flanking DNA. This specification describes the use of 54,898 oligonucleotides to encode the book. The inkjet printing of high-fidelity DNA microchips used to synthesize oligonucleotides limits the size of the oligonucleotides (the 159 meters is the upper limit). Moreover, reading oligonucleotides requires amplification and isolation, which introduces additional possibilities for error. See also WO 2004 / 088585A2; WO 03/025123 A2; C BANCROFT: "Long-Term Storage of Information in DNA", Science (2001) 293 (5536): 1763c-1765; COX JPL: "Long-term data storage in DNA ", Trends in Biotechnology (2001) 19 (7): 247-250.

DNA sequencing devices include nanopore-based devices from Oxford Nanopore, Genia, and others. In many of these devices, nanopores are often used in fluid-filled cells to read DNA data by measuring changes in the current as the DNA passes through the nanopore, and the current changes are usually in the nanoamp range. The industry has proposed measurements based on changes in capacitance, but they have not been commercialized; the changes are in the pico / fempto / attofarad range. Accordingly, it is difficult to reliably and reproducibly detect such small changes because they have difficulty distinguishing typical background noise. And the difficulty is further enhanced because DNA can pass through the nanopore at a rate of about 1 million bases per second, which is so fast that it cannot be read accurately with the existing methods. It is necessary to use a protein nanopore to slow down the DNA through the nanopore Speed, and impractical for reading large amounts of data.

Existing nanopore-based DNA data readers cannot overcome these problems, and therefore cannot provide high-precision, repeatable, reliable, automated, and robust DNA data reading results. Therefore, it is desirable to have a device that provides high-quality, reliable DNA reading results, and also provides a scalable method to reliably read data stored on multiple DNA molecules at the same time.

Although DNA's potential information density and stability make it an attractive medium for data storage (as realized for more than 25 years), there is no practical way to read and write large amounts of data in this form .

We have developed a new nucleic acid storage method that synthesizes a nucleic acid sequence using a nanofluidic system and reads that sequence using a nanopore reader. Our method allows the synthesis, storage, and reading of hundreds, thousands, or even millions of bases of DNA strands. Because the sequence is long, the identification information occupies only a small part of the sequence, so the information density is much higher than the information density in the above method. Moreover, in some embodiments, the synthesized nucleic acid will have a specific position on the nanochip, so the sequence can be identified even without identification information. The sequencing performed in the nano-chamber is very fast, and reading sequences through the nanopore can be extremely fast, on the order of one million bases per second. Since only two base types are required, this sequencing is faster and more accurate than a sequencing process that must distinguish between four nucleotide base types (adenine, thymine, cytosine, guanine). In specific embodiments, the two bases will not pair with each other and form a secondary structure, and will also have different sizes. For this reason, for example, adenine and cytosine are better than adenine and thymine (which tends to be heterozygous) or adenine and guanine (which have similar sizes).

In some embodiments, this system can be used to synthesize long polymers of encoded data, which can be amplified and / or released, and then sequenced on different sequencers. In other embodiments, the system can be used to provide custom DNA sequences. In other embodiments, the system can be used to read DNA sequences.

The nanochip used in a specific embodiment includes at least two spaced apart reaction compartments connected by at least one nanopore, which prevents at least some of the components from mixing, but only A single molecule of DNA or other charged polymer, such as RNA or peptide nucleic acid (PNA), is allowed to pass from one reaction compartment to another in a controlled manner. The transfer of the polymer (or at least the end of the polymer to which the monomer is added) from one chamber to another allows the use of enzymes (prevents the enzymes from passing through the nanopore, for example because they are too large or because they are tethered The matrix or most of the polymers are subjected to sequential manipulations / reactions, such as adding bases. Nanopore sensors report the movement or location of the polymer and its status, such as its sequence and whether the attempted response was successful. This allows data to be written, stored, and read, for example where the base sequence corresponds to a machine-readable code, such as a binary code, and each base or base group corresponds to a 1 or 0.

Accordingly, the present invention includes, among other things, the following specific embodiments,

A nanowafer for synthesizing a charged polymer (eg, DNA) comprising at least two different monomers, the nanowafer comprising two or more reaction chambers separated by one or more nanopores, wherein, Each reaction chamber includes an electrolyte to introduce the charged polymer into one or more electrodes in the chamber, and to facilitate the addition of monomers or oligomers to the polymer, one or more reagents. Optionally, the nanochip may be configured with functional elements to guide, guide, and / or control the DNA, and if necessary, it may be coated with or made of a material selected to allow DNA to flow smoothly or adhere to the DNA. And it may include nano circuit elements to provide and control electrodes adjacent to the nano hole. For example, if desired, the one or more nanopores may be individually associated with an electrode, the electrode may control the movement of the polymer through the nanopore and / or detect the interface between the nanopore and the polymer Changes in potential, current, resistance, or capacitance at the point where the polymer's sequence is detected as the polymer passes through the one or more nanopores. In a specific embodiment, the oligomer is synthesized using a polymerase or a site-specific recombinase. In some embodiments, the polymer is sequenced during synthesis to allow errors to be detected and corrected as needed. In some embodiments, the polymer thus obtained is stored on the nanowafer and can be sequenced when it is desired to access the information encoded in the polymer sequence.

A method and device for determining the sequence of a polymer (eg, DNA) in a nanopore wafer by measuring the amount of resonance in a RF circuit when the DNA is pulled through the nanopore by a DC bias Capacitance changes.

-A method for synthesizing a polymer (eg, DNA) using the nano wafer.

● Single-stranded DNA molecules, in which the sequence consists essentially of non-hybrid nucleotides, for example, adenine and cytosine nucleotides (A and C), which are sequentially set to correspond to binary codes, such as Used in data storage methods.

● Double-stranded DNA, including a series of nucleotide sequences corresponding to binary code, wherein the double-stranded DNA also includes

● A method of reading binary code encoded in DNA, including using a nanopore sequencer.

A data storage method and a device for data storage, using the nano chip above to manufacture a charged polymer (eg, DNA) including at least two different monomers, wherein the monomers are sequentially set to correspond to a binary code .

A method and system for storing and reading data in-situ on a storage string (such as DNA or polymer) on a nanopore-based wafer includes: providing a unit having at least three chambers having a The polymer adds an "1" bit to the Add "1" chamber and an Add "0" cell set to add "0" bits to the polymer, and an "deprotection" chamber set to separate from the polymer When the object enters the Add "1" or Add "0" chamber, the polymer can receive the "1" bit and the "0" bit; and then guide the polymer from the "deprotection" chamber based on a predetermined digital data pattern. Pass through the nanopore to the Add "1" or "Add" 0 chamber to create the digital data pattern on the polymer; and use the nanopore-polymer resonator (nanopore- (polymer resonator; NPR) is responsive to reading the digital data stored on the polymer as the polymer passes through the nanopore.

A method and system for reading data stored in a polymer include providing a resonator having an inductor and a unit having a nano hole and a polymer that can pass through the nano hole, the resonator being The probe frequency has an AC output voltage frequency response in response to the AC input voltage at the probe frequency; providing the AC input voltage with at least the probe frequency; and monitoring the AC output voltage at least at the probe frequency, in the The AC output voltage of the probe frequency indicates the data stored in the polymer during monitoring, wherein the polymer includes at least two monomers, which have different properties, thereby causing different resonance frequency responses.

Other aspects and areas of application of the present invention will become clearer through the detailed description provided below. It should be understood that although the detailed description and specific examples indicate preferred embodiments of the invention, they are for illustration purposes only and are not intended to limit the scope of the invention.

1‧‧‧electrical control layer

2‧‧‧ fluid layer

3‧‧‧ Electrical ground plane

4‧‧‧ Nanocon

5‧‧‧Nanoporous membrane

6‧‧‧ go to the protection room

7‧‧‧ polymer

9‧‧‧ location

11‧‧‧contact

12‧‧‧ Voltage Control

13‧‧‧Control electrode

4800‧‧‧unit

Room 4802, 4804, 6206, 6537, 6539‧‧‧

4806‧‧‧ film

4808‧‧‧Namicon

4810‧‧‧DNA Molecules

4812‧‧‧ Base

4814‧‧‧medium bases

4816‧‧‧ lower base

4818, 4820‧‧‧ electrode

4830‧‧‧ Equivalent Circuit Diagram

4900‧‧‧Circuit

4952‧‧‧Amplitude response

4954, 5130, 5132, 5230, 5232‧‧‧ graphics

5002‧‧‧Amplitude response curve

5003‧‧‧phase curve

5004, 5006, 5111, 5211‧‧‧ dashed

5010, 5012, 5018, 5020, 5022, 5028‧‧‧ amplitude response curve

5100‧‧‧ DNA Read Time Series

5102, 5104, 5106, 5108, 5110, 5202, 5204, 5206, 5208, 5210‧‧‧ columns

5112, 5114, 5116, 5118, 5120‧‧‧ Response curves

5200‧‧‧Outline example

5300‧‧‧block diagram

5302, 5304, 5306‧‧‧Resonators (NPR)

5308‧‧‧AC input voltage, AC input source

5310‧‧‧ Attenuator

5312, 5314, 5316‧‧‧ equivalent circuits

5320‧‧‧amplifier

5322, 5326, 5330, 5710, 5712, 5716, 6410, 6412, 6710, 6712, 6714, 6716, 6720, 6722, 6808‧‧‧ lines

5324‧‧‧A / D converter

5328‧‧‧Frequency analysis (or decomposition) logic

5502, 5510, 5550, 5570‧‧‧ curves

5512, 5514, 5516, 5518‧‧‧ Frequency components

5600, 5620‧‧‧phase

5602, 5604, 5606‧‧‧ amplitude line

5700‧‧‧Top Block Diagram

5702, 5704, 5706, 5708‧‧‧

5714‧‧‧Box

5800‧‧‧Unit

5802‧‧‧Top contact

5804‧‧‧Dielectric layer

5806‧‧‧Vertical connection

5808‧‧‧Inductor

5810‧‧‧input line

5812‧‧‧Capacitor

6000‧‧‧circuit

6002‧‧‧left unit

6004‧‧‧Right Unit

6100‧‧‧Chip Design

6102‧‧‧board

6200‧‧‧device

6202, 6502, 6602‧‧‧ left ventricle

6203, 6205

6204, 6504, 6604 ‧‧‧ right ventricle

6210, 6212, 6214, 6620, 6622, 6624, 6626, 6630, 6632, 6634, 6636‧‧‧ electrodes

6220, 6222‧‧‧ input line

6300‧‧‧device

6302, 6304‧‧‧ Entry Line

Units 6500, 6600, 6606, 6608, 6610, 6612‧‧‧

6503, 6505, 6652‧‧‧ arrows

Room 6506, 6508, 6510, 6512‧‧‧

6514, 6516‧‧‧‧Protection electrode

6520, 6522‧‧‧Common electrode

6528‧‧‧Namicon

6529‧‧‧film

6530, 6532, 6534, 6536‧‧‧ go to the protection room

6540, 6542, 6544, 6546‧‧‧ arrows

6550‧‧‧Storage String

6552‧‧‧points

6554‧‧‧ beads

6590‧‧‧transverse electrode

6642‧‧‧to protect the electrodes together

6650‧‧‧Polymer

6700, 6702‧‧‧Memory Chip

6704‧‧‧fluid unit

6800‧‧‧Storage System

6802‧‧‧Read / Write Controller

6804‧‧‧write controller

6810, 6856‧‧‧ box

6812‧‧‧cyclic clock

6814, 6820, 6822, 6852, 6854, 7102, 7504, 7506‧‧‧ lines

6850‧‧‧Read controller logic

6858‧‧‧Frequency Oscillator Logic

6860‧‧‧read signal

6862‧‧‧A / D conversion logic

6864‧‧‧FFT logic

6870‧‧‧Computer System

6872‧‧‧Confluence

6874‧‧‧Processor

6876‧‧‧controller

6878‧‧‧user

6880‧‧‧Display

6900‧‧‧Table

6902, 7000, 7004, 7006, 7008, 7010, 7012

6906, 6908‧‧‧Column

6910, 6912, 6914‧‧‧

6916‧‧‧Partial square wave

6918, 6922, 6924, 6928, the first part of the graphic segment

6920, 6926, 6930‧‧‧‧Partial square wave

7002‧‧‧ write cycle diagram

7014‧‧‧arrow

7020‧‧‧data word

7030‧‧‧flow chart

7032, 7034, 7036, 7038, 7040, 7042, 7044, 7046‧‧‧ blocks

7104‧‧‧bit

7106‧‧‧Address Segment

7108‧‧‧data segment

7110‧‧‧Data format, error checking section

7112‧‧‧Save Word

7120, 7130‧‧‧ Data Format

7122, 7124, 7126‧‧‧ special bits or sequences

7132, 7134, 7136‧‧‧ special bits

7140‧‧‧Data Section

Units 7202, 7204, 7206, 7208‧‧‧

7210, 7212, 7214, 7216, 7302, 7310, 7312, 7314, 7316‧‧‧ storage strings

7304, 7306, 7308‧‧‧ data string

7402, 7404, 7406‧‧‧ specific units

7410, 7412‧‧‧Stored words

7502‧‧‧ Instrument

7700‧‧‧Relationship

7702, 7704, 7706, 7708, 7710‧‧‧

7712‧‧‧AC signal

7714‧‧‧Voltage

7716‧‧‧ dotted line

7800‧‧‧Unit

7802‧‧‧ Upper room

7804‧‧‧medium

7806‧‧‧ Lower room

7808‧‧‧up electrode

7809‧‧‧electrode

7810‧‧‧Middle electrode

7811‧‧‧Wire

7812‧‧‧Lower electrode

7814‧‧‧Namicon

7815, 7817, 7906‧‧‧ membrane

7816‧‧‧ Nano hole, DC voltage V1dc

7818‧‧‧DC voltage V2dc

7820‧‧‧DNA

7822, 7824‧‧‧ arrows

7826‧‧‧AC component V1ac

7828‧‧‧AC component V2ac

7830, 7832‧‧‧T Type Bias Connection

7850‧‧‧ equivalent circuit

7852‧‧‧Resonator NPR1

7854‧‧‧Resonator NPR2

7856, 7858, 7860‧‧‧ dashed

7900‧‧‧Unit

7902, 7904‧‧‧ fluid chamber

7908‧‧‧Namicon

7910‧‧‧DNA Molecules

7912, 7914, 7918, 7920, 8130, 8132‧‧‧ electrodes

7922‧‧‧DC input voltage source V1dc

7924‧‧‧AC voltage V2ac

7970‧‧‧Circuit

8000‧‧‧ units

8002‧‧‧AC component V1ac

8004‧‧‧ "T-bias" connection

Units 8100, 8200‧‧‧

8102, 8104, 8106, 8108, 8110‧‧‧ electrode pair

8112, 8114, 8116, 8118, 8120

8122‧‧‧DNA molecule

8124‧‧‧AC input voltage Vac

8128, 8154, 8314, 8602‧‧‧ lines

8134‧‧‧DC input voltage Vdc

8136, 8156‧‧‧ dashed line

8148‧‧‧AC input voltage

8150‧‧‧AC output voltage signal

8201‧‧‧Nano Channel

8202, 8204, 8206, 8208, 8210‧‧‧ electrode pair

8222‧‧‧DNA

8240, 8242‧‧‧ electrodes

8250‧‧‧ Matrix

8252, 8326, 9402, 9404‧‧‧ Upper room

8254, 8328, 9406‧‧‧ lower room

8300‧‧‧Resonator

8302‧‧‧Input port

8304‧‧‧Output port

8305‧‧‧ dotted line

8306‧‧‧Supply Line

8307‧‧‧Port

8308‧‧‧ Split ring

8310‧‧‧ Clearance

8312‧‧‧ Nanocon

8316‧‧‧Horizontal AC coupling distance Dcpl

8320‧‧‧up electrode

8322‧‧‧Lower electrode

8324‧‧‧ film

8330‧‧‧Double Room Unit

8332‧‧‧DNA

8604‧‧‧Vertical AC coupling distance Dvcpl

8802‧‧‧Straight

8902‧‧‧area

9002‧‧‧Straight

9004‧‧‧Top Row

9006‧‧‧Central Bank

9008‧‧‧ bottom row

9102‧‧‧area

9202, 9204‧‧‧ electrodes

9210, 9212‧‧‧‧ dotted line

9302‧‧‧Silicon

9304‧‧‧Resonator layer

9306‧‧‧SiN layer

9308‧‧‧ Etching

9310‧‧‧Si nitride layer

9312‧‧‧heterostructure

9314‧‧‧ opening

9316‧‧‧Second opening

9318‧‧‧ Nanocon

9320‧‧‧Supply line contact

9322‧‧‧fluid chip

9324‧‧‧CMOS chip

9326‧‧‧FPGA Read PCB

9408‧‧‧Nano Channel

9410, 9412

9416‧‧‧ bottom electrode

The invention will be more fully understood from this detailed description and the accompanying drawings, in which:

Figure 1 shows a simple two-chamber nanowafer design with a diaphragm perforated with nanoholes and electrodes on both sides of the film.

Figures 2 and 3 show how a charged polymer (such as DNA) is pulled towards the anode.

Figures 4 and 5 show that the polymer can be moved back by reversing the polarity of the electrodes.

Figure 6 shows a two-chamber nanochip for DNA synthesis in which the polymerase is located in one chamber and the deprotection enzyme is located in another chamber, and neither can pass through the nanopore.

Figure 7 shows the addition of adenine nucleotides when 3'-protected dATP (A) flows through the left ventricle and the current is set to "forward" to introduce DNA into the compartment.

Figure 8 shows deprotection of the oligonucleotide so that additional nucleotides can be added. For example, deprotection occurs after DNA has entered the chamber by setting the current to "reverse".

Figure 9 shows the addition of 3'-protected dCTP (C). In some embodiments, fluid flow is used to replace the contents of this chamber, for example, as shown, previously having "A" in this chamber.

Figure 10 shows how multiple independent retention chambers can be provided, while the flow chamber becomes a single channel to provide reagents.

Figure 11 shows that DNA is maintained by attaching DNA to the chamber (upper DNA fragment in the drawing) or by coupling the DNA to large groups that cannot pass through the nanopore (lower DNA fragment in the drawing). Room correlation method. In this system, one end of the DNA can still enter the flow chamber and receive additional nucleotides, while the other end remains in the retention chamber.

Figure 12 shows a configuration where DNA is attached to the wall and controlled by multiple electrodes.

Figure 13 shows how DNA can be retained in the chamber when needed simply by controlling the polarity of the electrodes.

Figure 14 shows a free-flowing reagent array on both sides with DNA bound to the surface of the chamber.

Figure 15 shows an alternative design with electrodes on the side adjacent the diaphragm, which allows for cheaper manufacturing.

Figure 16 shows a three-compartment arrangement in which DNA can be moved between compartments and compartments by electrodes. This system does not require significant flow of reagents during synthesis.

Figure 17 shows an example of how reagents can be arranged in a three-compartment arrangement.

Figure 18 shows oligonucleotides tethered adjacent to a nanopore, where the nanopore has electrode elements on both sides of the membrane.

Figure 19 shows a series of DNA molecules attached along a membrane including a nanopore and under the control of electrodes adjacent to the nanopore, respectively, with flow channels on both sides of the membrane. For example, as shown, the left channel provides a buffer wash / 3'-protected dATP (A) / buffer wash / 3'-protected dCTP (C) / buffer wash stream, where only DNA molecules are introduced into the flow cell only when an acid is present. The right channel provides a deprotection agent to deprotect the 3 ' end of the nucleotide and allow the addition of another nucleotide. In a specific embodiment, the deprotecting agent flows when the left channel is washed with a buffer. In another specific embodiment, the deprotecting agent is too large to pass through the nanopore to the left channel.

Figures 20 to 22 schematically show a proof of concept experiment in which the bits used to encode the data are short oligomers attached using a topoisomerase.

Figure 23 shows a format for a nanopore sequencer in which a polymer sequence is read using a change in capacitance. In this capacitance readout scheme, the electrodes form the top and bottom plates of a capacitor, separated by a film including nanopores. The capacitor is embedded in a resonant circuit, where a pulsating DC can draw the charged polymer through the nanopore. By using high-frequency impedance spectroscopy, capacitance changes are measured as the polymer (e.g., DNA) passes through the nanopore. The main advantage of this method (especially for DNA) is that the measurement frequency can be extremely high (effectively measured for each cycle, so 100MHz frequency corresponds to 100 million measurements per second), and is far greater than the monomer transfer through the nanopore (DNA, for example, unless it is limited to some extent, it will respond to current passing through the nanopore at a rate of 100 million nucleotides per second).

Figure 24 shows a dual addition chamber layout suitable for adding two different types of monomers or oligomers, for example for 2-bit or binary coding. The top view of the figure shows the top view. The lower section shows the side view profile. The entire device in this embodiment can be assembled from up to 3 independently manufactured layers and connected by wafer bonding, or can be formed by etching a single substrate. The wafer includes an electrical control layer (1); a fluid layer (2) including two addition chambers on top of the retention chamber, and a charged polymer (eg, DNA) is fixed to the first and second addition chambers. Between nanohole entrances; and an electrical ground plane (3).

Figure 25 shows the operation of the double add room layout of Figure 24. It will be observed that at the base of each addition chamber, there are nanopores (4). The nanopore is made, for example, by drilling with FIB, TEM, wet or dry etching, or by dielectric breakdown. The film (5) including the nanopores is, for example, from 1 atomic layer to several 10 nanometers thick. It is made of, for example, SiN, BN, SiOx, graphene, transition metal disulfides such as WS ₂ or MoS ₂ . Under the nanoporous membrane (5) there is a retention or deprotection chamber (6), which contains reagents to deprotect the polymer after adding a monomer or oligomer in one of the addition chambers (remember, the monomer or The oligomers are added in end-protected form so that only a single monomer or oligomer is added at a time). The polymer (7) can be introduced into or out of the addition chamber by changing the polarity of the electrode in the electrical control layer (1).

Figure 26 shows a top view of a layout similar to Figures 24 and 25, but here there are four additional chambers that share a common retention or deprotection chamber and the polymer is tethered to each of the four chambers (9 ). The cross-section of this layout will be as shown in Figures 24 and 25, and the charged polymer can be entered into each of the four addition chambers by the operation of the electrodes in the electrical control layer (1 in Figure 24).

Figure 27 shows a top view of a nanopore wafer with multiple sets of dual addition chambers as shown in Figures 24 and 25 to allow multiple polymers to be synthesized in parallel. Monomers (here, dATP and dGTP nucleotides designated as A and G) were loaded into each chamber by a tandem flow path. One or more common deprotection flow cells allow the polymer to be deprotected after the monomer or oligomer is added to one of the addition chambers. This also allows the polymer to be isolated as needed (e.g. using restriction enzymes in the case of DNA, or chemically detaching from the surface of adjacent nanopores, and external collection. In some embodiments, the deprotected flow cell is perpendicular to A fluid loading channel to fill the addition chamber.

Figure 28 shows the wiring for a dual add room layout in further detail. The electrical control layer (1) includes a line made of metal or polycrystalline silicon. The circuit density is increased by three-dimensional stacking, and electrical isolation is provided by electrical deposition (for example, by PECVD, sputtering, ALD, etc.). In a specific embodiment, the contact (11) to the top electrode in the addition chamber is performed by Deep Reactive Ion Etch (DRIE) (cryo (low temperature) or BOSCH process) using Through Silicon Via (Through Silicon Via ; TSV) made. Separate voltage control (12) allows each addition chamber to be processed separately, thus allowing fine control of the sequence of multiple polymers in parallel. The right side of the figure shows a top view illustrating the route to multiple added units. The electrical ground planes (3) can be common (as shown) or spaced to reduce cross-coupling between cells.

Fig. 29 shows an alternative configuration in which the control electrode (13) of the addition chamber can be deposited on the side of the chamber in a clad manner instead of being located on the top of the chamber.

Figure 30 shows that the SDS-PGAE gel confirms that the topoisomerase addition protocol described in Example 3 is effective, and the bands corresponding to the expected A5 and B5 products are clearly visible.

Figure 31 shows that the agarose gel confirms that the PCR product of Example 5 is the correct size. Channel 0 is a 25 base pair ladder; channel 1 is the product of the experiment, and the line corresponds to the expected molecular weight; channel 2 is negative control # 1; channel 3 is negative control # 2; channel 4 is negative control # 4.

Figure 32 shows that an agarose gel confirms that the restriction enzyme as described in Example 5 produces the expected product. The ladder on the left is the 100 base pair ladder. Channel 1 is unrestricted NAT1 / NAT9c, and channel 2 is unrestricted NAT1 / NAT9c. Channel 3 is unrestricted NAT1 / NAT9cI, and channel 4 is unrestricted NAT1 / NAT9cI.

Figure 33 shows DNA fixation near the nanopore. Cell (1) shows DNA with an origami structure on one end in the left chamber (in actual nanowafers, there are many such origami structures in the left chamber initially). Panel (2) shows that the anode of the system is on the right, which drives the DNA to the nanopore. Although the DNA strand can pass through the nanopore, the origami structure is too large to pass, so the DNA is "stuck". Turning off the current (frame 3) spreads the DNA apart. With suitable chemistry, when the ends of the DNA strand come into contact with the surface near the nanopore, it can bind. In box (4), a restriction enzyme is added, which cuts the origami structure from the DNA. The chamber was washed to remove enzymes and residual DNA. The end result is a single DNA molecule attached near the nanopore and able to move back and forth through the nanopore.

Figure 34 shows the basic function of nanopores. In each division, the y-axis is the current (nA) and the x-axis is the time (s). The left pane "Shielding of RF Noise" shows the function of a Faraday cage. A wafer without nanopores was set in the flow cell and 300 mV was applied. When the cover of the Faraday cage is closed (first arrow), noise reduction is seen. When the latch is closed (second arrow), small spikes appear. Note that the current is ~ 0nA. After the hole is manufactured (middle division), the application of 300mV (arrow) results in a current of ~ 3.5nA. When DNA is applied to the grounded chamber and +300 mV is applied, when the instantaneous current decreases, DNA shift can be observed (right division). (Note that in the case of TS buffer: 50 mM Tris, pH 8, 1 M NaCl). Lambda DNA was used for this DNA translocation experiment.

Figure 35 shows a simplified diagram illustrating the main features of the DNA origami structure: a large single-stranded region, a cubic origami structure, and the presence of two restriction sites (SwaI and AlwN1) near the origami structure.

Figure 36 shows an electron microscope image of the fabricated DNA origami structure and shows the expected topology. Origami was made in 5 mM Tris base, 1 mM EDTA, 5 mM Nacl, 5 mM MgCl2. To maintain this origami structure, it is preferred to have a Mg ⁺⁺ concentration of ~ 5mM or a Na ⁺ / K ⁺ concentration of about 1M. The origami structure was stored at 500 nM at 4 ° C.

Figure 37 shows restriction enzyme-cut DNA origami to confirm correct assembly and function. The leftmost channel provides the MW standard. Restriction sites were tested by digesting origami with AlwN1 and Swa1. The four test channels contain the following reagents (in microliters):

Test channels (1) are negatively controlled; (2) are digested with Swa1; (3) are digested with AlwN1; and (4) are digested with Swa1 / AlwN1. Digestion was performed for 60 minutes at room temperature, followed by 90 minutes at 37 ° C. Agarose gel 1 / 2x TBE-Mg (1 / 2x TBE and 5mM MgCl2) was observed by staining with ethidium bromide. Digestion with either enzyme alone showed no movement effect in the gel, but digestion of the two enzymes together (channel 4) resulted in two fragments with different lengths, as expected.

Figure 38 shows the binding of biotin-labeled oligonucleotides to streptavidin-coated beads relative to the control of BSA-coated beads. The Y-axis is the fluorescence unit. The "pre-binding" is the oligonucleotide fluorescence from the test solution before binding the beads. (-) Control is seen after binding to two different batches of BSA-conjugated beads. The resulting fluorescence, SA-1 and SA-2, were seen after binding to two different batches of streptavidin-conjugated beads. A small amount of apparent binding was observed with BSA-conjugated beads, but a larger binding was seen with streptavidin-conjugated beads.

Figure 39 shows the binding of biotin-labeled oligonucleotides to streptavidin-coated beads relative to controlling the binding of BSA-coated beads in different buffer systems, MPBS and HK buffers. The vertical bar "Neg Ctrl" on the left is the oligonucleotide fluorescence from the test solution before the beads were bound. After binding to BSA or streptavidin beads, the vertical bar in the middle shows the fluorescence of "BSA beads", and the vertical bar on the right shows the fluorescence of "SA beads". In both buffer systems, the relative control of streptavidin beads reduced fluorescence, indicating that in different buffer systems, biotin-labeled oligonucleotides bind well to streptavidin-coated beads.

Figure 40 shows functional conjugated SiO ₂ nanopores, where the surface is coated with streptavidin on one side and BSA on the other. The x-axis is time and the y-axis is current. The dots show the points where the current is reversed. There is a short overshoot when the current is reversed, and then the current is fixed at approximately the same absolute value. The nanopore shows currents between 200mV ~ + 3nA and -200mV ~ -3nA.

Figure 41 shows a representation of the structure of an origami DNA inserted into a nanopore.

Figure 42 shows a representation of single-stranded DNA attached to a streptavidin-coated surface adjacent to a nanopore.

Figure 43 shows the results of an experiment in which origami DNA was attached to a surface near a nanopore. The current is + or-~ 2.5nA in both directions, which is less than the initial current of + or-~ 3nA, reflecting that it is partially obstructed by the origami structure. The x-axis is time (s), the y-axis is current (nA), and the circle represents the voltage switching point.

Figure 44 shows the insertion of origami DNA, resulting in a slight drop in current. When the current is released, the origami immediately exits the nanohole. The x-axis is time (s), the y-axis is current (nA), and the circle represents the voltage switching point.

Figure 45 shows a representation of controlled movement of a DNA strand back and forth through a nanopore by applying a current. On the left, the DNA is in the well, so the observed current will be lower than if there was no DNA in the well. When the current is reversed (right), there is no DNA in the well, so the current will not change.

Figure 46 shows the experimental results confirming this representation. When a positive voltage is applied, the current is ~ 3nA, which is comparable to the current usually observed when the hole is open. When the voltage is reversed, the current is ~ -2.5nA. This is lower than the current usually seen when the pore is open, and the current usually observed when the pore is blocked by the DNA strand. Several sequential voltage switches show consistent results, indicating that the DNA alternates in configuration as shown in Figure 45.

Figure 47 shows the different conjugate chemistry used to link DNA to the surface of adjacent nanopores.

Figures 48A, 48B, and 48C show three views of polymers and nanopores and equivalent circuits according to a specific embodiment of the present invention.

FIG. 49A is an equivalent circuit of a resonator made of a nano-hole unit according to a specific embodiment of the present invention.

Fig. 49B is an amplitude and phase diagram of the output response of the resonator of Fig. 49A according to a specific embodiment of the present invention.

FIG. 50 shows a set of curves of the amplitude and phase ranges of the output response of the resonator of FIG. 49A according to a specific embodiment of the present invention.

Figure 51 shows a time series of the amplitude and phase of the resulting resonator through the nanopore and the output response at the probe frequency according to a specific embodiment of the invention.

Figure 52 shows a time series of the amplitude and phase of the resulting resonator through the nanopore and the output response at the second probe frequency according to a specific embodiment of the invention.

FIG. 53 shows an equivalent circuit of a plurality of parallel nanopore-polymer resonators and signal processing according to an embodiment of the present invention.

FIG. 54 shows a frequency diagram of several resonant frequency bandwidths according to a specific embodiment of the present invention.

FIG. 55A shows a frequency diagram of the AC input voltage Vin according to a specific embodiment of the present invention.

FIG. 55B shows a time-frequency diagram of an alternative AC input voltage Vin according to a specific embodiment of the present invention.

FIG. 56 shows amplitude and phase frequency diagrams at three probe frequencies according to a specific embodiment of the present invention.

FIG. 57 shows a block diagram of a two-dimensional array nano-hole-polymer resonator according to a specific embodiment of the present invention.

FIG. 58 is a side cross-sectional view of a nano-hole memory chip according to an embodiment of the present invention.

FIG. 59 shows a top view of an inductor used in the wafer of FIG. 58 according to a specific embodiment of the present invention.

FIG. 60 shows an equivalent circuit diagram of a “T-bias-tee” configuration for connecting AC and DC signals according to a specific embodiment of the present invention.

FIG. 61 shows a partial view of the “T-type biaser” configuration of FIG. 60 according to a specific embodiment of the present invention.

FIG. 62 shows a side cross-sectional view of another embodiment of a nano-hole memory chip having two inductors (one on each Add chamber on the top) according to a specific embodiment of the present invention.

FIG. 63 shows a side cross-sectional view of another embodiment of a nano-hole memory chip having an inductor on one of the top Add chambers according to the embodiment of the present invention.

Figure 63A illustrates a plurality of parallel nano-hole-polymer resonators and signal processing having a single common inductor connected to the top electrode of the resonator and having a fixed capacitance in each resonator unit according to a specific embodiment of the present invention; Equivalent Circuit.

FIG. 63B shows a side cross-sectional view of another embodiment of a nano-hole memory chip having the configuration of FIG. 63A according to a specific embodiment of the present invention.

FIG. 64 is a side cross-sectional view of another embodiment of a nano-hole memory chip having an inductor on the bottom of a deprotection chamber according to the embodiment of the present invention.

Fig. 64A shows an equivalent circuit diagram of a "T-type biaser" configuration for connecting the AC and DC signals to the configuration of Fig. 64 according to a specific embodiment of the present invention.

Fig. 64B shows a plurality of parallel nano-hole-polymer resonators and a signal processing equivalent circuit having a single common inductor and a fixed capacitance in each resonator unit according to a specific embodiment of the present invention.

Fig. 64C shows a side sectional view of another embodiment of a nano-hole memory chip having the configuration of Fig. 64B according to the embodiment of the present invention.

Figure 65 shows a partial perspective view of a group of connected 3-chamber unit nanopore devices with transparent top and bottom electrodes according to a specific embodiment of the invention.

Figure 66 shows a partial perspective view of an alternative embodiment of a set of connected 3-chamber unit nanopore devices with a transparent top and electrodes according to a specific embodiment of the present invention.

FIG. 67 shows a block circuit diagram of a nano-hole cell array connected according to FIG. 65 according to a specific embodiment of the present invention.

FIG. 68 is a block diagram of a read / write memory controller and a nano-hole memory chip according to an embodiment of the present invention.

68A is a block diagram of a computer system according to an embodiment of the present invention.

FIG. 69 shows a table and graph of a memory addition cycle and a pilot voltage required to execute the cycle according to a specific embodiment of the present invention.

FIG. 70 shows a graph and a data map of how to fill the memory for various data inputs using an alternate write cycle according to a specific embodiment of the present invention.

FIG. 70A shows a flowchart of a controller logic for executing a write cycle shown in FIG. 70 according to a specific embodiment of the present invention.

FIG. 70B is a table showing steps of writing “1” and “0” by configuring a nano-hole wafer as shown in FIG. 66 according to a specific embodiment of the present invention.

FIG. 71 shows a list of three different data formats of bits on a storage string according to a specific embodiment of the present invention.

FIG. 72 shows a data format list of bits on a storage string for each unit in a row according to a specific embodiment of the present invention.

FIG. 73 shows a list of alternative data formats for bits on a storage string of each cell in a row according to a specific embodiment of the present invention.

FIG. 74 shows a list of alternative parallel data storage formats for bits on a memory string of cells in a row according to a specific embodiment of the present invention.

Figure 75 shows a block diagram showing a nano / memory memory system of a read / write memory controller and an instrument for fluid / reagent according to a specific embodiment of the present invention.

Figure 76 is a gel electrophoresis preparation showing topoisomerase-mediated addition of an oligonucleotide cassette ("bit") to a DNA molecule.

Figure 77 shows the DNA origami molecule of Example 7.

FIG. 77A shows an input voltage graph of DC and AC voltages having different DC voltage levels over time according to a specific embodiment of the present invention.

Fig. 78A shows a side view of a dual nano-hole device having two longitudinal nano-hole resonators according to an embodiment of the present invention.

FIG. 78B illustrates an equivalent circuit of the dual nanopore device of FIG. 78A according to a specific embodiment of the present invention.

Fig. 79A shows a side view of a two-chamber nano-hole device having a lateral resonator according to an embodiment of the present invention.

FIG. 79B shows an equivalent circuit of a portion of the dual-chamber device of FIG. 79A according to a specific embodiment of the present invention.

FIG. 79C shows an equivalent circuit of the lateral resonator of FIG. 79A according to a specific embodiment of the present invention.

Figure 80A shows a side view of a two-chamber nanohole device having a lateral resonator and a longitudinal resonator using different AC sources according to a specific embodiment of the present invention.

Fig. 80B shows a side view of the two-chamber nanohole device of Fig. 80A having a lateral resonator and a longitudinal resonator using the same AC source according to a specific embodiment of the present invention.

FIG. 81A shows a side view of a nanohole device having a plurality of lateral resonators using the same AC source according to a specific embodiment of the present invention.

FIG. 81B shows a side view of the nanohole device of FIG. 81A with a plurality of lateral resonators (using different AC sources for each lateral resonator) according to a specific embodiment of the present invention.

Figure 82A shows a side view of a device having multiple lateral resonators (having nano channels and using the same AC source) according to a specific embodiment of the invention.

Figure 82B shows a side view of the nanochannel and electrodes of Figure 82A according to a specific embodiment of the present invention.

Figure 82C shows a side view of the nanochannel and electrodes of Figure 82A according to a specific embodiment of the invention.

Figure 83 shows a top view of a split ring resonator having a square split ring according to a specific embodiment of the present invention.

Figure 84 shows a top view of a split ring resonator having a circular split ring according to a specific embodiment of the present invention.

Fig. 85 shows a side view of the split ring resonator of Figs. 83 and 84 along line 8314 according to a specific embodiment of the present invention.

Figure 86 shows a top view of a split ring resonator having a square split ring and a vertically offset supply line according to a specific embodiment of the present invention.

Figure 87 shows a side view of the split ring resonator of Figure 86 along line 8304 according to a specific embodiment of the present invention.

Fig. 88 shows a top view of a plurality of split ring resonators driven by a common supply line according to a specific embodiment of the present invention.

FIG. 89 shows an enlarged view of one of the resonators of FIG. 88 according to a specific embodiment of the present invention.

Figure 90 shows a top view of a plurality of alternative geometric split ring resonators driven by a common supply line according to a specific embodiment of the present invention.

FIG. 91 shows an enlarged view of one of the resonators of FIG. 90 according to a specific embodiment of the present invention.

FIG. 91A shows a perspective view of one of the resonators of FIG. 90 according to a specific embodiment of the present invention.

Figures 92A, 92B, 92C, 92D, 92E, and 92F show top views of various geometries of the ends of the lateral electrodes of the lateral resonator according to a specific embodiment of the present invention.

Fig. 92G shows a side view of a lateral electrode of a lateral resonator according to an embodiment of the present invention.

FIG. 93 shows a process of a two-chamber unit using a split ring resonator according to a specific embodiment of the present invention.

Figure 94 shows a side view of a three-chamber nanopore device having a nanochannel in a lower common channel according to a specific embodiment of the present invention.

Fig. 95 shows a side view of a three-chamber nanopore device having an alternative nanochannel configuration in a common channel below according to a specific embodiment of the present invention.

Figure 96 shows SDS-PAGE of a charged topoisomerase.

The following detailed description of the preferred embodiments is merely exemplary, and is not intended to limit the invention, its application, or uses.

The ranges used in this article are used to quickly illustrate each value within this range. You can choose any value within this range as the end of the range. In addition, all references cited herein are incorporated by reference in their entirety. If the definitions in this disclosure conflict with the definitions of the references cited, then this disclosure is dominant.

Unless otherwise indicated, all percentages and quantities expressed herein and elsewhere in this specification should be understood to mean weight percentages. The quantities given are based on the effective weight of the material.

As used herein, a "nano wafer" refers to a nanofluidic device that includes a plurality of chambers containing a fluid and a channel that allows fluid to flow as needed, wherein the key dimensions of the characteristics of the nanowafer are, for example, The width of these spaced-apart elements ranges from 1 atom to 10 microns thick, for example, less than 1 micron, such as 0.01-1 micron. The flow of material in the nanowafer can be adjusted by electrodes. For example, when DNA and RNA are negatively charged, they are drawn to positively charged electrodes. See, for example, Recapturing and Trapping Single Molecules with a Solid State Nanopore, Nat Nanotechnol. (2007) 2 (12): 775-779 by Gershow, M, et al., Which is incorporated herein by reference. In some cases, the fluid flow can be adjusted by the gate element and by rinsing, injecting, and / or drawing fluid into or out of the nanochip. The system supports precise multiplexed analysis of nucleic acids (DNA / RNA). In some embodiments, the nano chip may be made of a silicon material, such as silicon dioxide or silicon nitride. Silicon nitride (e.g., Si ₃ N ₄₎ are particularly suitable for this purpose, because it is relatively inert chemically and even if only a few nanometers thick can effectively block the diffusion of ions and water. Silicon dioxide (as used in the examples herein) can also be used because it is a good surface for chemical modification. Alternatively, in certain embodiments, the nanowafer can be made in whole or in part from a material that can form as thin as a single molecule (sometimes referred to as a single-layer material), such as graphene, such as Heerema Graphene nanodevices for DNA sequencing by SJ et al., Nature Nanotechnology (2016) 11: 127-136; Graphene as a subnanometre trans-electrode membrane by Garaj S et al., Nature (2010) 467 (7312), 190-193 Its content is incorporated herein by reference, or a transition metal disulfide, such as molybdenum disulfide (MoS2), such as the Identification of single nucleotides in MoS ₂ nanopores by Feng et al., (2015) 10 (12) : 1070-1076, the contents of which are incorporated herein by reference, or boron nitride, as described in Gilbert et al. Fabrication of Atomically Precise Nanopores in Hexagonal Boron Nitride, eprint arXiv: 1702.01220 (2017).

In some embodiments, the nano-wafer includes such single-layer materials that are relatively hard and inert, for example, at least as inert and hard as graphene, such as MoS ₂ . A single layer of material can be used, for example, as all or part of a film including nanopores. The nanowafer may be lined with a metal portion, for example, may be a layered wall (for example, metal-silicon nitride-metal), and then the metal may be configured to provide a controllable electrode pair near the nanopore, so that Nucleic acids are moved back and forth through the nanopores by electric force. In addition, nucleic acids can be sequenced by measuring potential changes as the nucleic acids pass through the nanopores.

Nanofluidic nanofluidic devices for sequencing DNA are well known, for example, Solid-state nanopore for detecting individual biopolymers, Methods Mol Biol. (2009) 544: 81-93; Smeets RM et al. Noise in solid-state nanopores, PNAS (2008) 105 (2): 417-21; Differentiation of short, single-stranded DNA homopolymers in solid-state nanopores, Venta K et al., ACS Nano. (2013) 7 (5) : 4629-36; Automated fabrication of 2-nm solid-state nanopores for nucleic acid analysis by Briggs K et al., Small (2014) 10 (10): 2077-86; and Chen Z's DNA translocation through an array of kinked nanopores Nat Mater. (2010) 9 (8): 667-75, the entire content of each document is incorporated herein by reference, for example, for their design and manufacture of nano-wafers including nano-holes. teaching.

As used herein, "nanopores" are pores having a diameter of less than 1 micron, such as 2-20 nanometers in diameter, for example on the order of 2 to 5 nanometers. Single-stranded DNA can pass through 2 nanometer pores; single-stranded or double-stranded DNA can pass through 4 nanometer pores. Having very small nanopores such as 2-5 nanometers allows DNA to pass through, but larger proteases do not, allowing for controlled synthesis of DNA (or other charged polymers). If a larger nanopore (or smaller protease) is used, the protease can be conjugated to a matrix that prevents the protease from passing through the nanopore, such as a larger molecule such as a larger protein and a bead Yoke, or conjugate to a surface in the chamber. Different types of nanopores are known. For example, biological nanopores are formed by assembling pore-forming proteins in a membrane such as a lipid bilayer. For example, alpha-hemolysin and similar protein pores are naturally present in cell membranes, where they act as channels for ions or molecules to enter and exit cells, and such proteins can be reused as nanochannels. For example, by using feedback-controlled low-energy ion beam sculpting (IBS) or high-energy electron beam lighting, solid-state nanopores are formed in a composite material such as silicon nitride or graphene by arranging holes in a composite film. Hybrid nanopores can be made by embedding pore-forming proteins in synthetic materials. If there are metal surfaces or electrodes at both ends or both sides of the nanopore, the current flowing through the nanopore can be established through the nanopore through the electrolyte medium. The electrode may be made of any conductive material, such as silver, gold, platinum, copper, titanium dioxide, such as silver coated with silver chloride.

Methods of disposing solid nanopores such as silicon nitride, films are known. In one method, a silicon substrate is coated with a film material such as silicon nitride, and the overall configuration of the film is created by photolithography and wet chemical etching to provide a silicon nitride film of a desired size for inclusion in a nano wafer, For example about 25x25 microns. An initial 0.1 micron diameter hole or cavity is made in the silicon nitride film by using a focused ion beam (FIB). Ion beam engraving can be configured with nanopores, or by reducing larger pores (for example, by inducing lateral mass transport by particle beams on the membrane surface), or by transmitting from the flat side of the membrane containing the cavity on the opposite side Layer ion beam sputtering removes the film material and thus has sharp-edged nanopores when it finally reaches the cavity. The ion beam is extinguished and the ion current transmitted through the hole is adapted to the desired hole size. See, for example, Solid-state nanopore for detecting individual biopolymers by Li et al., Methods Mol Biol. (2009) 544: 81-93. Alternatively, the nanopore can be configured by using high energy (200-300keV) electron beam illumination in the TIM. By using semiconductor process technology, electron beam lithography, reactive ion etching of SiO2 mask layer, and anisotropic KOH etching of Si, tapered 20x20 nm and larger holes are made in a 40 nm thick film . This larger 20 nm hole was reduced to a smaller hole using an electron beam in a TEM. The TEM allows the reduction process to be observed in real time. By using a thinner film (eg, <10 nm thick), a nano-hole can be drilled with a high-energy focused electron beam in a TEM. See generally Storm AJ et al. Fabrication of solid-state nanopores with single-nanometre precision. Nature Materials (2003) 2: 537-540; Storm AJ et al. Translocation of double-stranded DNA through a silicon oxide nanopore. Phys. Rev E (2005) 71: 051903; Heng JB, et al. Sizing DNA Using a Nanometer-Diameter Pore. Biophys. J (2004) 87 (4): 2905-11, the contents of each document are incorporated herein by reference.

In other specific embodiments, nanopores are made by dielectric breakdown by using a higher voltage potential on the membrane, where the voltage is raised until a current is detected, for example, "Nanopore Fabrication by Controlled" by Kwok et al. Dielectric Breakdown, "PLOS ONE (2014) 9 (3): e92880, the contents of which are incorporated herein by reference.

By using these techniques, and of course, depending on the precise technique used and the thickness and composition of the film, the overall shape of the nanopores in a solid material such as silicon nitride can roughly resemble two funnels, and their tips meet At the narrow point, that is, the actual nanopore. These biconicals help guide the polymer through the nanopore and back. Imaging techniques such as atomic force microscopy (AFM) or transmission electron microscopy (TEM) (especially TEM) can be used to verify and measure the size of the nanofilm, FIB hole or cavity, and the final nanopore size, Location and configuration.

In some embodiments, one end of the polymer (eg, DNA) is tethered to the nanopore or to the inner wall of the funnel leading to the nanopore. If one end of the polymer is tethered near the nanopore, since the polymer initially approaches the nanopore by diffusion, and then is driven by an electrical gradient, the gradient-driven motion is maximized and the diffusion motion is minimized, thereby enhancing Speed and efficiency. See, for example, Wanunu M's Electrostatic focusing of unlabelled DNA into nanoscale pores using a salt gradient, Nat Nanotechnol. (2010) 5 (2): 160-5; Recapturing and trapping single molecules with a solid-state nanopore.Nat by Gershow M. Nanotechnol. (2007) 2 (12): 775-9; Recapturing and Trapping Single Molecules with a Solid State Nanopore. Gerat, M. (2007) 2 (12): 775-779.

In a specific embodiment, one end of a polymer (eg, DNA) is attached to a bead and drives the polymer through the pore. Attachment to the beads will prevent the polymer from completely passing through the nanopores on the opposite side of the diaphragm in the adjacent chamber, and then, the current is turned off, and the polymer (such as DNA) is attached to the Nanopores are adjacent to the surface. For example, in one embodiment, one end of the ssDNA is covalently attached to 50 nanometer beads and the other end is biotinylated. Streptavidin is bound to the area at the desired attachment point in the chamber on the other side of the septum. DNA is pulled through the nanopore by a potential, and the biotin is attached to the streptavidin. This attachment to the surface of the beads and / or adjacent nanopores may be a covalent junction or a strong non-covalent junction (similar to a biotin-streptavidin junction). Then, the beads were cut with an enzyme and washed away. In some embodiments, single-stranded DNA is cut with a restriction enzyme, which cuts single-stranded DNA, such as Type II restriction endonucleases cleave single-stranded DNAs in general. Nucleic Acids Res. (1985) 13 (16): K. Nishigaki 5747-5760, which is incorporated herein by reference. In other embodiments, complementary oligonucleotides are provided to form double-stranded restriction sites, which can then be cleaved with corresponding restriction enzymes.

As the polymer passes through the nanopore, changes in the potential, capacitance, or current on the nanopore caused by the partial blockage of the nanopore when the polymer passes through can be detected and used to identify the sequence of monomers in the polymer, because Different monomers can be identified by their different sizes and electrostatic potentials.

The prior art does not disclose the use of nano wafers including nano holes in DNA manufacturing methods as described herein, but such wafers are known and commercially available for rapid sequencing of DNA. For example, MinION (Oxford Nanopore Technologies, Oxford, UK) is small and can be connected to a laptop. As single-stranded DNA passes through protein nanopores at 30 bases per second, MinION measures current. The DNA strand in the well disrupts the ion current, causing a change in current corresponding to the nucleotides in the sequence. A first look at the Oxford Nanopore MinION sequencer by Mikheyev, AS et al., Mol. Ecol. Resour. (2014) 14, 1097-1102. Although MinION has poor accuracy and requires repeated resequencing, if the read DNA contains only two easily identified bases, such as A and C, the speed and accuracy of sequencing using the nanochip of the present invention can be greatly improved. Promotion.

In some embodiments, a film including nanopores may have a three-layer configuration with metal surfaces on both sides of an insulating core material such as a silicon nitride film. In this specific embodiment, the metal surface is configured, for example, by photolithography to provide a microcircuit with paired electrodes, with one electrode at each end of each nanohole, for example, so that it can be between the electrodes. And through the electrolyte medium through the nanopore to establish a current flow through the nanopore, the current can pull the polymer through the nanopore and can pull it back by reversing the polarity. As the polymer passes through the nanopore, the electrode measures the change in potential across the nanopore to identify the sequence of monomers in the polymer.

In some embodiments, the sequence of the polymer is designed to store data. In some embodiments, the data is stored in binary codes (1 and 0). In some embodiments, each base corresponds to 1 or 0. In other specific embodiments, the sequence of two or more bases that are easy to recognize corresponds to 1 and the sequence of two or more bases that is easy to recognize corresponds to 0. In other embodiments, the data may be stored in ternary, quaternary, or other codes. In a specific embodiment, the polymer is DNA, such as single-stranded DNA, wherein the DNA includes only two base types and does not include any base capable of self-hybridization. For example, the DNA includes adenine and Guanine, adenine and cytosine, thymine and guanine, or thymine and cytosine. In some embodiments, the two bases may be interspersed with one or more additional bases, for example, A and C may include T, so as to not cause severe self-hybridization, such as by marking in the coding sequence Disconnect to "interrupt" the sequence from time to time. In other embodiments, for example, if the nucleic acid is double-stranded, some or all of the available bases may be used.

Nucleotide bases may be natural or may consist of or include unnatural bases in some embodiments, for example, as "A semi-synthetic organism with an expanded genetic alphabet" by Malyshev D et al. , Nature (2014) 509: 385-388, which is incorporated herein by reference.

In a specific embodiment, the data is stored by adding a single monomer to the polymer, such as a single nucleotide in the case of DNA. In a specific embodiment, the polymer is DNA and the monomers are adenine (A) and cytosine (C) residues. A and C residues have advantages because (i) A and C have large size differences and therefore should help differentiate through the nanopore, (ii) A and C will not pair with each other, so that no significant The secondary structure, which may complicate the interpretation of the nanopore signal, and (iii) G is not very good for the same reason, as they are known to form guanine quadruplexes. Nucleotides are added by a terminal transferase (or polynucleotide phosphorylase), but the nucleotides are 3 'protected so that only a single nucleotide is added at a time. This protection is removed before the next nucleotide is added.

In some embodiments, the DNA is retained in a nanochip. In other specific embodiments, the DNA is removed and optionally converted to double-stranded DNA and / or converted to a crystalline form as needed, for example, to enhance long-term stability. In other embodiments, the DNA can be amplified and removed for long-term storage, while the original template DNA, such as DNA bound to the walls of the chamber in the nanochip, can be retained in the nanochip. This DNA is read and / or used as a template to form additional DNA.

In some embodiments, DNA or other polymers are immobilized to a surface adjacent to a nanopore during synthesis. For example, in a specific embodiment, the single-stranded DNA molecule is attached to the surface of the adjacent nanopore at the 5 ′ end, wherein the current in each nanopore can be independently adjusted for the nanopore by the electrode, so that the The 3 'end of the DNA molecule can be pulled from the retention chamber through the nanopore and drawn into the flow chamber (the flow chamber contains a 3' protected dNTP stream and a polymerase or terminal transferase to add 3 'protected dNTP), or it can be Retained in a retention chamber, where nanopores prevent enzymes from entering, so that no dNTP is added. See, for example, the illustrations of FIGS. 12-16 and FIGS. 18 and 19. In other embodiments, single-stranded DNA is constructed by adding to the 5 'end (3' end attachment) by using a topoisomerase, as described in more detail below. By controlling whether each DNA molecule participates in each cycle, the sequence of each DNA molecule can be precisely controlled, for example as follows: A flow = 3 'protect dATP C flow = 3' protect DCtp

In this diagram, nanopore 1 and nanopore 2 are associated with different DNA strands and their positions (in or out of the flow cell) can be controlled independently. DNA can be deprotected, by retaining specific enzymes in the chamber, or by altering the flow in the flow chamber to provide deprotection by enzyme, chemical, photocatalytic, or other means. In a specific embodiment, the deprotecting agent flows between the circulation of the A and C flows, such as when the flow cell is washed with a buffer, so that the deprotecting agent does not deprotect the nucleotide building blocks. In other embodiments, the deprotecting agent is too large to pass through the nanopore to the flow cell.

The final result of the above example will be: A and C are added to the DNA of nanopore 1 and C and C are added to the DNA of nanopore 2.

In another specific embodiment, the compartment configuration is similar, but the double-stranded DNA is immobilized to the surface of the adjacent nanopore and a site-specific recombinase (i.e., for example, a topoisomerase charged oligo as described below) is used. Nucleotide, an enzyme that spontaneously recognizes and cleaves at least one strand of a double-stranded nucleic acid within a sequence segment known as a site-specific recombination sequence) sequentially adds, for example, two or more types of oligonucleotide fragments (respectively Corresponding to binary code).

In certain embodiments, it may be desirable to maintain a charged polymer (eg, DNA) in a condensed state after synthesis. There are several reasons for this:

● The polymer should be more stable in this form,

Agglomerating the polymer will reduce crowding and allow the use of small amounts of longer polymers,

● Ordered aggregation reduces the possibility of knots or tangles in the polymer,

-If any of these chambers are interconnected, it will help prevent the polymer from becoming so long that when a current is applied, it passes through a different hole than it would otherwise.

● Agglomeration will help keep the polymer away from the electrode, where electrochemistry may damage the polymer.

Human cells are about 10 microns but contain 8 billion DNA base pairs. Unrolling it will be more than one meter long. DNA can be incorporated into cells because it entangles histones. In certain embodiments, histones or similar proteins provide similar functions in the nanowafers of the invention. In some embodiments, the inner surface of the nanowafer is slightly positively charged, so that the charged polymer (such as DNA) tends to weakly adhere to these surfaces.

In certain embodiments, a charged polymer, such as single-stranded or double-stranded DNA, is bound to the surface of an adjacent nanopore. This can be implemented in various ways. Generally, to locate the polymer in the nanopore, the polymer is attached to a larger structure (e.g., a bead, protein, or DNA origami structure (described below)) that has a diameter that is too large to pass through Through the nanopore, for example> 10 nanometer, for example, about 20-50 nanometers), the electric current is used to pull the charged polymer through the nanopore, and the end of the polymer away from the large structure is fixed to the vicinity The surface of the nanopore, for example, wherein the surface is modified to accept a linking group attached to the distal end of the polymer chain, thereby attaching the polymer chain and cutting away the large structure.

The step of fixing the end of the polymer away from the large structure to a surface adjacent to the nanopore can be performed in various ways. In a specific embodiment, the polymer is single-stranded DNA and has a pre-attached DNA strand (about 50 bp (base pairs)) that is complementary to a portion of the single-stranded DNA such that the single-stranded DNA and the pre-attached DNA Strands can be bound by base pairing. If the pairing is strong enough, it is sufficient to keep the DNA fixed even when the DNA is manipulated. The advantage of this attachment method is that it allows the DNA to be removed from the nanochip as needed for long-term storage of the DNA. Alternatively, by using a conjugate chemistry such as the streptavidin-biotin conjugate or "click" chemistry described in Example 1 below (see Kolb et al.'S Angew. Chem. Int. Ed. (2001) 40: 2004-2021 (incorporated herein by reference) and / or using enzyme attachment such as by covalently pre-attaching oligonucleotides to the distal surface and then ligating them using DNA ligase) covalently attach the strands to the surface .

Once the distal end of the strand is attached to the surface adjacent to the nanopore, the large structure is excised, for example, using an endonuclease to cut at a restriction site near the large structure.

The large structure can be a bead, a large molecule, such as a protein that reversibly binds to a DNA strand, or a DNA origami structure. DNA origami involves using base pairing to create three-dimensional DNA structures. The DNA origami technique is outlined in Bell et al. Nano Lett. (2012) 12: 512-517, which is incorporated herein by reference. For example, in the current invention, DNA origami can be used to attach a single DNA molecule to the surface of an adjacent nanopore. In a specific embodiment, the structure is a "honeycomb cube", such as about 20 nanometers per side. This prevents this part of the DNA from passing through the nanopore (as in the attachment). Long-stranded DNA (single or double-stranded) is attached to the origami structure. The DNA strand passes through the nanopore until the origami cube meets the nanopore and prevents further progress. Next, the current is turned off and the chain is attached to the surface adjacent to the nanopore.

In another specific embodiment, a charged polymer (eg, DNA) with an origami structure is located in the middle chamber of a three-chamber configuration. The origami will prevent the DNA from completely entering the other 2 compartments (or another compartment in the 2 compartment example). Therefore, in this example, the polymer need not be fixed to the surface. This reduces the risk of knotting the polymer and eliminates the need to bond the polymer to the surface at one end and cut most of the steps at the other end. The volume of the chamber with the origami should be kept as small as possible so that the polymer stays closer to the pores, which will help ensure that the polymer displaces quickly when an electric current is applied. It should be noted that although the intermediate chamber containing the origami portion of the polymer cannot be interconnected with other intermediate chambers (otherwise different polymers would be mixed together), other chambers (or groups of chambers in the 3-chamber example) may be interconnection. If desired, these other chambers can have a larger volume because when the DNA is moved to the chamber, the polymer must be close to the well (some of which will actually be in the well).

In some embodiments, the device includes three series chambers, where the addition chambers are adjacent to allow flow and have a common electrode, while the "deprotection" chamber is fluidly isolated except for the nanopores Flows and has separate electrodes.

In other specific embodiments, the DNA or other charged polymer is not fixed, but can be moved between the synthesis chamber and the deprotection chamber under the control of electrodes in the chamber, while restricting the polymerase and deprotection agent between the chambers. Move because they are too large to pass through the nanoholes that connect the chambers, and / or because they are fixed to the surface in the chamber. See, for example, Figures 1-9 and 16-17.

The current required to pass a charged polymer through the nanopores depends on, for example, the nature of the polymer, the size of the nanopores, the material of the membrane containing the nanopores, and the salt concentration, so it will be optimized for the specific system as needed. In the case of DNA used in the examples herein, examples of voltage and current will be, for example, 50-500mV, usually 100-200mV, and 1-10nA, such as about 4nA, with a salt concentration in the order of 100mM to 1M.

Charged polymers (such as DNA) often move through nanopores, such as 1 to 5us per base, so at the order of 1 million bases per second (1MHz, if we use the term of frequency), this Challenges arise in obtaining accurate readings that are distinct from noise in the system. By using current methods, (i) it is necessary to repeat nucleotides in the sequence, for example, about 100 times in succession to produce a measurable change in properties, or (ii) use a protein pore such as Alpha hemolysin (aHL) or Mycobacterium smegmatis (MspA), which provides longer pores, has the possibility of being read multiple times as bases pass, and in some cases can be adjusted to provide DNA one base at a time Controlled supply through the wells, and in some cases each base is cleaved with exonuclease as it passes. Various methods can be used, for example, ● slow down the speed of the polymer from about 1 MHz to about 100-200 Hz, for example, using a medium including an electrorheological fluid, which becomes thicker when applied with a voltage, thereby slowing the polymer through The speed of a micropore; or a plasma fluid system in which the viscosity of the medium can be controlled by light; or a molecular motor or ratchet; ● providing a sequence in a polymer, such as in single-stranded DNA, which will form a large secondary structure, For example a "hairpin", "hammer" or "dumbbell" configuration, which will have to be linearized to fit through the nanohole, making the information less dense and providing a signal with a longer duration; ● providing the same Multiple reads of a sequence, for example by using a fast AC current to allow multiple reads of the same sequence frame, combined with short pulses of DC current to pull the molecule to the next sequence frame; by multiple reads The entire sequence; or by reading multiple identical sequences in parallel, in each case collating those reads to provide a consistent read, which amplifies the signal; when a monomer (e.g., a nucleotide) passes through Mikon To measure impedance changes in high-frequency signals induced by capacitance changes, rather than directly measuring changes in current flow or resistance; ● Enhance differences in current, resistance, or capacitance between different bases, such as by using Unnatural bases that are significantly different or otherwise modified to emit different signals; or by forming larger secondary structures within the DNA, such as "hairpin", "hammerhead" or "dumbbell" configurations, these Structures provide enhanced signals due to their larger size; use an optical reading system, such as an integrated optical antenna adjacent to the nanopore, which acts as an optical converter (or optical signal enhancer) to complement or replace standard ions Flow measurements, for example, as described in "Graphene Nanopore with a Self-Integrated Optical Antenna" by Nano et al., Nano Lett. (2014) 14: 5584-5589, the contents of which are incorporated herein by reference. In some embodiments, a monomer, such as a DNA nucleotide, is labeled with a fluorescent dye, so that different monomers emit fluorescence with a characteristic intensity when passing through the junction of the nanopore and its optical antenna. In some embodiments, when the polymer passes through the nanopore at high speed, the solid nanopore detaches the fluorescent label, resulting in a series of detectable photon bursts. For example, "Optical recognition of converted DNA nucleotides for single" by McNally et al. molecule DNA sequencing using nanopore arrays ", Nano Lett. (2010) 10 (6): 2237-2244 and" Towards Optical DNA Sequencing Using Nanopore Arrays "by Meller A., J Biomol Tech. (2011) 22 (Suppl): S8 -S9, the content of each document is incorporated herein by reference.

In a specific embodiment, the charged polymer is a nucleic acid, such as single-stranded DNA, where the sequence provides a secondary structure, Nat Nanotechnol by Bell et al. (2016) 11 (7): 645-51 (by reference and (Incorporated herein) illustrates the use of shorter sequences of dumbbell configurations that can be detected in solid-state nanopore formats to label antigens in immunoassays. The nanopore used in Bell et al. Is larger, so the entire dumbbell structure can pass through the hole, but by using nanopores smaller than the diameter of the dumbbell configuration, the DNA will be "uncompressed" and linearized. More complex configurations can be used, for example, where each corresponds to a tRNA-like sequence (see, eg, Nanoleyt by Henley et al. (2016) 16: 138-144, which is incorporated herein by reference). Accordingly, the present invention provides a charged polymer having at least two types of secondary structures, such as single-stranded DNA, wherein the secondary structure encodes data (e.g., binary data, where one secondary structure type is 1 and the other is 0). In other embodiments, the secondary structure is used to slow down the speed of DNA passing through the nanopore or to provide interruptions in the sequence to facilitate sequence reading.

In another specific embodiment, the invention uses a DNA molecule comprising a series of at least two different DNA motifs, wherein each motif specifically binds a particular ligand, such as a double-stranded DNA gene regulatory protein or a single-stranded DNA tRNA Wherein, the at least two different DNA motifs encode information in binary code, for example, one of the motifs is 1 and the other is 0, for example, when the DNA passes through the nanopore, the ligand enhances the nanopore Signal differences (such as changes in current or capacitance).

As mentioned above, when different monomers pass through the nanopore, they affect the current flow through the nanopore, mainly by physically blocking the nanopore and changing the conductivity on the nanopore. In existing nanopore systems, this current change is directly measured. The problem with the current reading system is that there is considerable noise in the system, and in the case of DNA, for example, when measuring the current fluctuation of different nucleotide units passing through the nanopore, a long integration time is required. On the order of a fraction of a second to accurately detect differences between different monomers, such as different bases. Recently, research has shown that changes in impedance and capacitance can be used to study cells and biological systems, although complex interactions with salts and biomolecules are possible. For example, Nade Nano. Of Laborde et al. (2015) 10 (9): 791-5 (incorporated by reference) demonstrates that high-frequency impedance spectroscopy can be used to detect small capacitance changes under physiological salt conditions and imaging beyond Debye limits Microparticles and living cells.

Therefore, in a specific embodiment of the present invention, we measure the change in capacitance instead of directly measuring the change in current. For example, when a monomer (eg, a nucleotide) passes through a nanopore, the change in capacitance is measured by Phase changes in induced RF signals to identify sequences of charged polymers.

Simply put, capacitance exists in any circuit with a gap between one electrical conductor and another. Although the current varies directly with the capacitance, it does not change simultaneously with the capacitance. For example, if we were to plot current and voltage over time in a capacitor circuit with AC current, we would see that although the current and voltage each form a sine wave, the waves are out of phase. When there is a change in current, there is a change in capacitance, which is reflected in the phase change of the signal. The RF AC current provides a signal with a fixed frequency and amplitude, and the phase of the signal will vary with the capacitance of the circuit. In our system, we use a pulsating DC (that is, an AC signal with a DC offset) instead of a pure AC current (that is, the voltage alternates between two values, but the voltage does not pass through the "zero" line, thus The polarity is maintained and one electrode remains positive while the other electrode remains negative), so that the charged polymer can be drawn through the nanopore (toward the positive electrode in the case of DNA). When there is nothing in the nanopore, the capacitance has a value. When different monomers of the polymer pass through the nanopore, the capacitance value changes. In some embodiments, a suitable frequency range is in the radio frequency range, such as 1 MHz to 1 GHz, such as 50-200 MHz, such as about 100 MHz, such as lower microwave frequencies that may cause significant dielectric heating of the media. Other frequencies can be used, as described herein. To reduce the possibility of interference, different frequencies can be applied to different nanopores, so that multiple nanopores can be measured simultaneously with a single RF input line.

A change in impedance at high frequencies (due to, for example, a change in capacitance) increases the available signal-to-noise ratio over a specific time span because it reduces the effect of 1 / f noise or "pink" noise inherent in electronic measurement circuits. Use high-frequency signals to enhance the signal-to-noise ratio because many measurements are made within a given time span, providing a more stable signal that is easily distinguished from changes in impedance due to environmental or device changes and fluctuations.

By applying these principles to the current invention, the present invention provides, in a specific embodiment, a method for measuring impedance changes in high-frequency signals induced by capacitance changes as monomers (e.g., nucleotides) pass through a nanopore. Method, for example, a method of reading a monomer sequence of a charged polymer (eg, a DNA molecule) including at least two different types of monomers, including applying a RF pulsating DC current to the nanopore, for example, at a frequency of 1 MHz to 1 GHz , For example, 50-200 MHz, for example, about 100 MHz, wherein the pulsating DC current draws the charged polymer through the nanopore, and by measuring the charge on the nanopore when the charged polymer passes through the nanopore The capacitance changes to read the monomer sequence.

For example, referring to FIGS. 48A, 48B, and 48C, the nanopore-based unit 4800 is shown to have an upper (or top) chamber 4802, a lower (or bottom) chamber 4804, and a membrane 4806, which separates the two chambers 4802, 4804. . The film is made of a material as described above. In addition, there is a nano-hole 4808 (or nano-sized hole) in the unit, which has the shape and dimensions described herein, allowing fluid communication between the chambers 4802 and 4804.

Within the unit 4800 is a polymer molecule such as a single-stranded DNA molecule 4810 (or ssDNA), such as described above. In this embodiment, DNA 4810 has three units or bases: upper base 4812, middle base 4814, and lower base 4816. Each of the bases 4812 to 4816 or a set of bases in DNA 4810 may be referred to as an information "bit" used to represent or store data, as also described herein. If desired, any other polymer or DNA molecule (single or double stranded) can be used, as described above.

The chambers 4802, 4804 of the unit 4800 may be filled with, for example, a fluid as described herein, which allows the DNA 4810 to float and move between the chambers 4802, 4804. The unit 4800 also has a pair of electrodes 4818, 4820: an upper (or top) electrode 4818 connected to the input voltage Vin, and a lower (or bottom) electrode 4820 connected to the ground (or GND or 0 volts). In some embodiments, the lower electrode 4820 can also be connected to a non-zero DC voltage, but it can still be connected by using an AC coupling capacitor (connected to this electrode with a capacitance value (discussed in detail below)) of the AC voltage at AC (or rf or radio frequency) "ground". The movement of the DNA 4810 in the voltage determining unit 4800 applied to the electrodes 4818, 4820. In particular, when the DNA strand 4810 is in the presence of an electric field or voltage or charge difference, the DNA 4810 Will be attracted to a positive charge or voltage because the DNA molecule 4810 has a net negative charge, as previously described with reference to Figures 1 to 5.

In this case, when the top electrode 4818 has a positive voltage relative to the bottom electrode 4820 (shown here as ground or 0 volts), the DNA 4810 (if it is in the lower chamber 4804) will move through the nano hole 4808 to the top electrode 4818. And into the upper room 4802. Conversely, when the top electrode 4818 has a negative voltage relative to the bottom electrode 4820, the DNA 4810 will move through the nanopore 4808 toward the bottom electrode 4818 and enter the lower chamber 4804. Figures 48A, 48B, and 48C show that DNA 4810 moves through the nanopore 4808 from the upper chamber 4802 to the lower chamber 4804.

Referring to Figures 48A to 48C, the unit 4800 (or nanopore and DNA system) can be electrically simulated as the equivalent circuit diagram 4830, which is shown as a capacitor C1 and a resistor R1 connected in parallel. In particular, the top electrode 4818 sees the capacitance C1 and the resistance R1 to the ground set by the local environment. Among them, the capacitor C1 represents the capacitance of the unit 4800, which is determined by the properties of the two electrodes 4818, 4820 (that is, the capacitor plate) and their The properties of the dielectric material are determined at least by the fluid within cell 4800 and the membrane 4806 with nanopores 4808. Resistor R1 represents the DC resistance associated with cell 4800, defined at least by the loss associated with the dielectric material of the cell described above, which is shown as the DC leakage current between the two electrodes.

As the DNA 4810 passes through the nanopore 4808, both the cell capacitance and resistance (or cell impedance, Z cell) change. Different DNA bases have different sizes and therefore have different effects on capacitance and resistance, resulting in different equivalent circuit models, as shown in Figures 48A to 48C. In particular, in Figure 48A, DNA 4810 is outside the nanopore 4808, resulting in a set of values C1, R1 (or Z unit 1). In Figure 48B, base 4814 of DNA 4810 is in the nanopore, resulting in another set of values C2, R2 (or Z unit 2). Similarly, in Figure 48C, base 4812 of DNA 4810 is in the nanopore, resulting in another set of values C3, R3 (or Z unit 3).

Referring to Figures 49A and 49B, the capacitor C and resistor R (nanopore and DNA system) of the unit 4800 can be combined with the inductor L to form an "inductor-unit" as shown in the circuit 4900 (Figure 49A). Or "unit-inductor" RLC resonant circuit or resonator or filter (or band stop filter, or notch filter, or band stop filter) with the amplitude frequency response shown by figure 4952, and by figure 4954 Displayed phase frequency response. The center or resonance frequency f _{res of the} circuit 4900 is given by: ω _res = 2πf _res = Sqrt (1 / LC) x Sqrt (1- (L / C) / R ² ) Eq.1 where C and R are respectively Is the capacitance and resistance of the unit at a given time, and L is the value of the inductor (its position relative to the DNA in the unit is a constant). There may also be an equivalent coil resistor (not shown) in series with the inductor L, indicating the DC resistance of the inductor coil winding. However, if the coil resistance is negligible, it need not be shown in the circuit diagram or in the resonance frequency _fres formula.

When the value of the cell resistance R is large, Equation 1 becomes: ω _res = 2πf _res = Sqrt (1 / LC) Eq.2

Referring to 49B, FIGS, magnitude of the resonance circuit 4900 in response to 4952 (for a given value of C, and R) is having a maximum attenuation (minimum impedance) at the resonant frequency f _res, the and narrow band around the resonant frequency f _res (or stop Frequency band) Δf _stp has a steep amplitude attenuation response, Δf _stp is a frequency range where the amplitude response (Vout / Vin) is lower than the standard threshold, such as 3dB (or 20Log [SQRT (2)]). For all other frequencies, the output amplitude is essentially constant and does not decay. The corresponding phase shift response curve 4954 of the resonance circuit 4900 has a phase shift of 45 degrees at the resonance frequency f _res (at this time the reactance or imaginary part of the complex impedance is equal to zero), and a narrow stop band △ on each side of the resonance frequency f _res f _stp has a steep phase response such that at frequencies above f _res and outside frequencies with Δf _stp , the phase shift is at or close to 180 degrees, and at frequencies below f _res and outside frequencies with Δf _stp , The phase shift is at or near 0 degrees. In addition, the phase response output is substantially constant and does not move at all other frequencies.

Please refer to FIG. 50, which shows a set of resonance frequency response amplitude curves 5002 and phase curves 5003 of the resonant circuit (or filter), which respond to DNA (or other polymers or molecules with varying sizes along the length) through the nanopore And change the measured capacitance (or impedance) to ground (for example, 0 volts), thereby changing the resonance frequency f _res , as shown in the amplitude response curve 5010-5018 and the corresponding phase response curve 5020-5028. In particular, as shown in Equation 2 above, increasing the measured capacitance to ground reduces the resonance frequency f _res . In addition, increasing the "base" size of the DNA (more blocking nanopores) can increase the cell capacitance (depending on the dielectric constant of the DNA), thereby reducing the resonance frequency _fres . Conversely, reducing the size of the DNA base (more non-blocking nanopores) can reduce the unit capacitance (depending on the dielectric constant of the DNA), thereby increasing the resonance frequency f _res . By using standard DNA bases (G, C, A, T), the size order will be: G (largest), A, T, C (smallest). Accordingly, assuming that the dielectric constant of DNA changes appropriately with the DNA base, when DNA is in the nanopore, when the largest base such as base G is in the nanopore, _fres will be the lowest, and when the minimum base is When bases such as base C are in the nanopore, _fres will be highest. In addition, when the nanopore is open (unblocked), that is, when there is no DNA or polymer in the nanopore, _fres will be the highest frequency. The range or frequency band of this resonance frequency is shown as Δf _{res in} FIG. 50. In addition, for the resonator response curve 5010-5018 for amplitude and 5020-5028 for phase shown in Figure 50, the total bandwidth of the resonator (the amplitude and phase above it is substantially affected by the resonator) is at 50th It is shown as Δf _{BW in the} figure.

In addition, assuming all other unit conditions that affect impedance remain fixed, the total resonance frequency band Δf _res for a given unit-inductor resonant circuit (or resonator or filter) will be open in the nanopore (or not blocked by the polymer) ) Has the largest resonance frequency f _res-max , and has the smallest resonance frequency f _res-min when the nanopore is closed (or blocked by the polymer), and the unit resonance frequency f _res can be determined at a given time. The size of the polymer in the meter hole changes (or adjusts or changes), and therefore may be referred to herein as a nano hole-polymer resonator (or NPR). In addition, the total bandwidth Δf _{BW of the} resonator (the amplitude and phase thereon are substantially affected by the resonator) will be similarly determined based on the resonance frequency band Δf _res .

When an AC voltage is applied to the resonator and observed at a fixed frequency f _probe (e.g. near the center of the resonance frequency range of the DNA base shown as a vertical dashed line 5004, not necessarily aligned with the center (or resonance) frequency _fres ) (or When monitoring the output voltage signal (Vout) of the resonator, the resonator at this frequency f _probe provides four different possible output signals (or amplitude attenuation or phase shift amount), depending on the specific DNA base passing through the nanopore Base (size), and a fifth output voltage state when DNA is not in a nanopore ("open hole" state). These five output signals are displayed by the positions where the response curve groups 5002 and 5003 intersect with the line 5004 corresponding to the monitoring frequency f _probe , that is, the amplitudes V1-V5, and the phases Ph1-Ph5.

Alternatively, if the output voltage is monitored at a different frequency f _{probe 2} (for example, near the resonance frequency of the lowest frequency response curve 5010, shown as a vertical dashed line 5006, which is, for example, at a frequency lower than the f _probe ), then at the frequency f _probe The output voltage of _{pin 2} will be 5 amplitude output voltages V6-V10 (different from the output voltages V1-V5 seen at the f _probe ) and 5 output phase shifts ph6-ph10 (different from those seen at the f _probe Output voltage ph1-ph5). In particular, these five different output signals are displayed by the positions where the response curve groups 5002 and 5004 intersect with the line 5006 corresponding to the monitoring frequency f _{probe 2} , namely, the amplitude V6-V10, and the phase ph6-ph10. The values of V1-V10 and Ph1-Ph10 are arbitrarily named and are only used for identification or marking purposes. The value or position of the probe or monitoring frequency f _probe , f _{probe 2} can be set based on the required response value, as described below. As shown below, a useful range of output values can be provided by using probes or monitoring frequency values in the resonant frequency range seen when the polymer is in a nanopore. If needed, other measurement or probe frequencies can be used as long as they meet the required functional and performance requirements.

In particular, if four bases will pass through the nanopore (ie, G, A, T, C) in order of magnitude, the resonance frequency f _res when the largest base (for example, base G) passes through the nanopore. It will be the lowest (highest capacitance), and the corresponding response will be displayed by (leftmost) amplitude and phase curves 5010, 5020, respectively. In this case, the output voltage at the frequency f _probe where the curves 5010, 5020 and the line 5004 intersect will correspond to the output voltage V2 and the output phase ph1, respectively. Alternatively, if the output voltage is monitored at the monitoring frequency f _{probe 2, the} output voltage at the frequency f _{probe 2} at the intersection of the curves 5010, 5020 and the line 5006 will correspond to the output voltage V10 and the output phase Ph6, respectively.

Similarly, when the next smaller base (for example, base A) passes through the nanopore, the resonance frequency f _res will be slightly higher than the resonance frequency of the previous base, and the response is shown by the amplitude and phase curves 5012, 5022, respectively . In this case, the output voltage at the frequency f _probe where the curves 5012, 5022 and line 5004 intersect will correspond to the output voltage V5 and the output phase Ph2, respectively. Alternatively, if the output voltage is monitored at the monitoring frequency f _{probe 2, the} output voltage at the frequency f _{probe 2} where the curves 5012, 5022 and the line 5006 intersect will correspond to the output voltage V9 and the output phase Ph7, respectively.

Similarly, when the next smaller base (for example, base T) passes through the nanopore, the resonance frequency f _res will be slightly higher than the resonance frequency of the previous base, and the response is shown by the amplitude and phase curves 5014, 5024, respectively . In this case, the output voltage at the frequency f _probe where the curves 5014, 5024 and line 5004 intersect will correspond to the output voltage V4 and the output phase Ph3, respectively. Alternatively, if the output voltage is monitored at the monitoring frequency f _{probe 2, the} output voltage at the frequency f _{probe 2} where the curves 5014, 5024 intersect with the line 5006 will correspond to the output voltage V8 and the output phase Ph8, respectively.

When the smallest base (for example, base C) passes through the nanopore, the resonance frequency f _res will be slightly higher than the resonance frequency of the previous base, and the response is shown by the amplitude and phase curves 5016, 5026, respectively. In this case, the output voltage at the frequency f _probe where the curves 5016, 5026 and line 5004 intersect will correspond to the output voltage V3 and the output phase Ph4, respectively. Alternatively, if the output voltage is monitored at the monitoring frequency f _{probe 2, the} output voltage at the frequency f _{probe 2} where the curves 5016, 5026 and the line 5006 intersect will correspond to the output voltage V7 and the output phase Ph9, respectively.

Finally, when the DNA is not nanopore, the resonance frequency f _res will be the highest (lowest capacitance), and the amplitude and phase response curves, respectively, by displaying 5018,5028. In this case, the output voltage at the frequency f _probe where the curves 5018, 5028 and the line 5004 intersect will correspond to the output voltage V1 and the output phase Ph5, respectively. Alternatively, if the output voltage is monitored at the monitoring frequency f _{probe 2, the} output voltage at the frequency f _{probe 2} where the curves 5018, 5028 intersect with the line 5006 will correspond to the output voltage V6 and the output phase Ph10, respectively.

Referring to Figure 51, DNA display read time according to specific embodiments of the present disclosure examples outlined 5100 sequence for the probe by a fixed (or monitor) the frequency f measured by the _probe of the present disclosure "inductor - A "unit" resonator or "capacitive-resonant" DNA data reading technology reads data stored in DNA using two bits (eg, two bases) in DNA strand 4810. The DNA read time series has 5 time periods or stages T1-T5, shown as 5 columns of 5102 to 5110, and the advancement between time periods is shown by the dotted line 5111. For each time period T1 to T5, there are images showing the DNA 4810 (Figure 48) and its position relative to the nanopore 4808 for this time period, and the amplitude and phase response curves 5112 for the time periods T1-T5, respectively. -5120 to display the intersection of the response curve with the monitoring frequency f _probe (corresponding to the curve in the curve group shown in Figure 50), and two output value graphs 5130 and 5132 to display T1 at each time stage The corresponding output signals (eg, voltage values) for the amplitude and phase response at the monitoring frequency f _probe on -T5, respectively. The values V1-V5 and Ph1-Ph5 of the graphs 5130 and 5132 can be arbitrary voltage values, indicating the output values of the parameters with appropriate ranges and ratios to provide the functions described herein.

Regarding the position and movement of the DNA 4810 in each of the five time states T1-T5 in the example in FIG. 51, in the time period T1 (5102) = no DNA in the nanopore (open hole), in the time period T2 (5104) = base A in the nanopore, at time period T3 (5106) = base G in the nanopore, at time period T4 (5108) = base A in the nanopore, and at time Stage T5 (5110) = No DNA in the nanopore (open well).

Please refer to Figures 50 and 51. At the beginning of time period T1, DNA 4810 is located outside hole 4808, the capacitance to ground is low (as described in this article), the resonance frequency f _{res is} high, and it is measured at the monitoring frequency f _probe The amplitude output signal is high and the phase value is very low (for example, about 0 degrees), corresponding to the response curves 5018, 5028 shown in Figure 50, and the output at the f _probe where the curves 5018, 5028 and line 5004 intersect The values correspond to the output voltage V1 and the output phase Ph5, respectively. At time T2, the DNA base 4816 (base A, in this example) enters hole 4808, the capacitance to ground increases, the resonance frequency _fres moves to a lower center frequency, and the amplitude measured at the f _probe is output The signal is low and the phase value is intermediate (for example, about 90 degrees), corresponding to the response curves 5012, 5022 shown in Figure 50, and the output values at the f _probes where the curves 5012, 5022 and line 5004 intersect, respectively Corresponds to output voltage V5 and output phase Ph2. At time T3, DNA base 4814 (base G, the largest base in this example) enters hole 4808, the capacitance to ground is extremely high, and the resonance frequency f _res moves to lower, but at the f _probe The amplitude output signal is an intermediate value, and the output value is upper-middle (for example, about 135 degrees), corresponding to the response curves 5010, 5020 shown in Figure 50, at the f _probe where the curves 5010, 5020 and line 5004 intersect The output values correspond to output voltage V2 and output phase Ph1, respectively.

At time T4, DNA nucleotide 4812 (in this example base A) access hole 4808 (again), to reduce the capacitance (value from T3) of the resonance frequency to the center frequency f _RES, and _probe at f The amplitude output signal measured by the _needle is low and the phase value is intermediate (for example, about 90 degrees), corresponding to the response curves 5012 and 5022 shown in Fig. 50. The f _probe at the intersection of the curves 5012 and 5022 with the line 5004 The output values at the _pins correspond to the output voltage V5 and the output phase Ph2, respectively. At time T5, DNA 4810 is located outside the hole 4808 (again), the capacitance to ground is low, the resonance frequency _fres (again) moves to a high frequency, and the amplitude output signal measured at the f _probe is high, corresponding to Figure 50 The response curves 5018 and 5028 shown in the figure, the output values at the f _probes where the curves 5018 and 5028 intersect with the line 5004 correspond to the output voltage V1 and the output phase Ph5, respectively.

Please refer to FIG. 52, which shows another overview example of time series (T1-T5), 5200, for using different fixed probe (or monitoring) frequency f _{probe 2} by the capacitor-resonant DNA data reading technology disclosed in this disclosure Read data stored in DNA using two bits (eg, two bases) in a DNA strand. The sequence has 5 time periods or stages T1-T5, shown as 5 columns 5202 to 5210, and the advancement between time periods is shown by dashed line 5211. For each time period T1 to T5, there are images showing the DNA 4810 (Figure 48) and its position relative to the nanopore 4808 for this time period, and the amplitude and phase response curves 5112 for the time periods T1-T5, respectively. -5120 to display the intersection of the response curve with the monitoring frequency f _{probe 2} (corresponding to the curve in the curve group shown in Figure 50), and two output value graphs 5230, 5232 to display at each time stage The corresponding output signals (eg, voltage values) for the amplitude and phase response at the monitoring frequency f _{probe 2} are respectively on T1-T5. The values V1-V5 and Ph1-Ph5 of the graphs 5130 and 5132 can be arbitrary voltage values, indicating the output values of the parameters with appropriate ranges and ratios to provide the functions described herein.

Regarding the position and movement of the DNA 4810 in each of the five time states T1-T5 in the example in FIG. 52, in the time period T1 (5202) = there is no DNA in the nanopore (open hole), and in the time period T2 (5204) = base A in the nanopore, T3 at the time period (5206) = base G in the nanopore, at time period T4 (5208) = base A in the nanopore, and at time Stage T5 (5210) = No DNA in the nanopore (open well).

Please refer to Figures 50 and 52. At the beginning of time period T1, DNA 4810 is located outside hole 4808, the capacitance to ground is low (as described in this article), the resonance frequency f _{res is} high, and the measured amplitude output signal is high and The phase value is very low (for example, about 0 degrees), corresponding to the response curves 5018, 5028 shown in Figure 50, and the output values at f _{probe 2} where the curves 5018, 5028 and line 5006 intersect correspond to the output voltage, respectively. V6 and output phase Ph10. At time T2, DNA base 4816 (base A, in this example) enters hole 4808, the capacitance to ground increases, the resonance frequency _fres moves to a lower center frequency, and the amplitude measured at f _{probe 2} The output signal is a middle value and the phase value is a low median value (for example, about 45 degrees), corresponding to the response curves 5012, 5022 shown in Figure 50, and the f _{probe 2} where the curves 5012, 5022 and line 5006 intersect The output values at V1 and V7 correspond to output voltage V9 and output phase Ph7, respectively.

At time T3, DNA nucleotide 4814 (nucleotide G, in this case, the maximum base) access hole 4808, a high capacitance to ground, and the resonant frequency f _RES moved lower, f is ₂ at _{the probe} amplitude of the output signal is low and the output value of the output phase around an intermediate value (e.g., about 90 degrees), corresponding to the response curve shown in FIG. 50 5010,5020, f 5006 _probe intersects at the line in the graph 5010,5020 The output values at _{pin 2} correspond to the output voltage V10 and the output phase Ph6, respectively. At time T4, DNA nucleotide 4812 (in this example base A) access hole 4808 (again), to reduce the capacitance (value from T3) of the resonance frequency to the center frequency f _RES, and _probe at f The amplitude output signal measured by _{pin 2} is the middle value and the phase value is low, corresponding to the response curves 5012 and 5022 shown in Figure 50. The output at the f _{probe 2} where the curves 5012 and 5022 intersect with the line 5006. The values correspond to the output voltage V9 and the output phase Ph7, respectively. At time T5, DNA 4810 is located outside hole 4808, the capacitance to ground is low, the resonance frequency _fres (again) moves to a higher frequency, and the amplitude output signal measured at f _{probe 2} is high and the phase signal is extremely low (For example, about 0 degrees), corresponding to the response curves 5018 and 5028 shown in Fig. 50. The output values at the f _{probe 2} where the curves 5018 and 5028 intersect with the line 5006 correspond to the output voltage V6 and the output phase, respectively. Ph10.

Please refer to the two examples in Figures 51 and 52 and compare the output patterns 5130, 5132 and 5230, 5232. You can see that the required output value can be selected based on the measurement or monitoring frequency f _probe , f _{probe 2} .

Although the above illustrates DNA using two and four bits (bases) to represent the data to be read, any number of "bits" (or monomers or bases) can be used for the data if desired For storage polymers, as long as the change in unit capacitance or impedance (and corresponding resonant frequency, or frequency response) is sufficient to produce an output amplitude and / or phase that can be distinguished from each other bit for each bit. Although these capacitance changes can be implemented by changing the physical molecular size (e.g., diameter) of the base, if desired, any attribute of the base can be used, which creates a unique capacitance value of the unit as it passes through the nanopore. For example, bases with different dielectric properties, different ion (or charge) properties, and / or different quantum mechanical / electric properties can be used as long as they meet the required functional and performance requirements.

Please refer to FIG. 53, which shows the equivalent circuit and block diagram 5300 of the DNA data reading network array of the present disclosure, which has a parallel array resonant circuit or a nanopore polymer resonator (NPR) 5302-5306 (NPR1- NPR3), Each resonant circuit is connected in parallel with a common AC input voltage source 5308 by a separate coupling capacitor C _CPL (described below). This AC input voltage source provides an AC voltage Vin with a frequency including at least for each resonant circuit NPR1-NPR3 (hereinafter (Detailed description) (f _probe ). Each resonator NPR1-NPR3 (explained in detail below) has a unique inductor value L1-L3, which is connected in series with the equivalent circuit 5312-5316 of the corresponding unit (similar to the unit 4800 described in Figures 48A-48C, and Similar to the equivalent circuit 4900 described in Figure 49A), this equivalent circuit has a variable capacitor C and a variable resistor R, which are opposite to the nanopore 4808 in unit 4810 based on the polymer (or DNA in unit 4800) ) 4810 (Figure 48A) changes in position (as described above). Each unique inductor value L1-L3 sets a unique resonance frequency band Δf _res (FIG. 50) and a corresponding total resonator bandwidth Δf _BW (FIG. 50), which will be described in detail below with reference to FIG. 54. Therefore, multiple resonators NPR1-NPR3 are connected in parallel in a frequency multiplexed (or frequency division multiplexed) arrangement to create an array of resonators NPR1-NPR3, all of which are driven by a single AC input voltage 5308, and Each corresponds to its own probe input frequency.

Please refer to Figure 53. Before connecting the parallel array resonators NPR1-NPR3, an optional AC RF attenuator 5310 can be connected in series with the AC input source 5308 to provide a voltage divider or impedance matching the resonators NPR1-NPR3 and / Or adjust the AC output voltage Vout range based on the range of the impedance value of the resonator over the operating frequency range of interest. The attenuator 5310 may be a constant or switched or variable RF attenuator, depending on the frequency range used, the impedance of the array and the load, and / or the required functional and performance characteristics.

Referring to FIG. 53, the AC output voltage Vout of the parallel array resonators NPR1-NPR3 can be provided to an amplifier (or preamplifier) 5320, which performs signal conditioning on the output signal Vout, such as removing noise, and measuring frequencies around interest Filtering to isolate the impedance of the resonator array from downstream devices or components, improve measurement sensitivity, amplify or attenuate the Vout signal, and / or perform other required signals of the AC output voltage signal Vout required to provide the required function and / or performance Adjustment. In some embodiments, the amplifier may also be an active filter that filters the AC output voltage signal around one or more of the probe frequencies. The amplifier 5320 provides an analog AC regulated output voltage Vout signal to the A / D converter 5324 (eg, an integrated circuit or a chip) through a line 5322. The A / D converter digitally samples the regulated AC output voltage Vout and provides it through a line 5326. The digital output data indicates that the sampling regulates the AC output voltage Vout signal. The sampling rate of the A / D converter can be any rate, which provides sufficient sampling of the output signal to maintain the ability to perform frequency analysis at a desired measurement frequency (eg, a probe frequency). The AC output voltage can also be down-converted to a lower intermediate frequency or DC, such as if the basic probe frequency is too high (or fast) to be accurately sampled directly by the A / D converter (or, for other reasons Design or performance reasons), by mixing the AC output signal with the same (similar) frequency, such as homodyne or heterodyne demodulation, or any other type or demodulation or frequency conversion, as long as it maintains accurate measurements of the required parameters The required amplitude and / or phase components. The A / D converter 5234 may have on-board memory storing the sampling output data and / or may be connected or communicating with a separate memory device (not shown) that may store all or part of the sampling output data. The digital signal processing frequency analysis (or decomposition) logic 5328 is provided with the digital sample output data through line 5326, such as FFT (or Fast Fourier Transform) logic or a chip, which performs digital signal processing (DSP) on the digital sample data Digital data is provided through line 5330 to indicate the amplitude and / or phase of the frequency component (or harmonic) present in the sampled AC output signal Vout. If desired, any other frequency analysis hardware, firmware, and / or software can be used in place of the FFT logic 5328, as long as it provides the functions and performance described in this article and adequately measures the amplitude and / or phase of the output signal at the desired frequency of interest ( (For example, at least at the desired probe or measurement frequency).

Amplifier 5320, A / D converter 5324, and FFT logic 5329 are all known hardware or firmware components available from integrated circuit providers such as Texas Instruments, Analog Devices, National Instruments, Intel, or other similar manufacturers (It may have a computer programmable part). An example of a component that can be used for digitization includes: Xilinx FFT LogiCORE, part no. 4DSP FMC103, 1126, Alazartec 9360, 9370. If needed, other components can be used as long as they provide the functionality and performance described in this article. In addition, the FFT logic can be implemented by a field programmable gate array (FPGA).

In addition, instead of sampling the output voltage with an A / D converter and performing digital signal processing to determine the frequency component, the output signal Vout may be provided with one or more analog filters (not shown), which are adjusted to the required Frequency to identify the amplitude and / or phase of a desired frequency component and provide an analog output voltage signal indicating the amplitude and / or phase of the frequency component.

Please refer to FIG. 54. The frequency diagram 5400 shows the sampling frequency separation of the plurality of resonators NPR1-NPR3 of FIG. 53 of the present disclosure. In particular, as described above with reference to FIG. 53, each of the resonators NPR1-NPR3 has a unique resonator bandwidth Δf _BW1 , Δf _BW2 , and Δf _BW3 , which are respectively set or determined by unique inductor values L1-L3. Bandwidths △ f _BW1 , △ f _BW2 , and △ f _{BW3 of the} resonators NPR1-NPR3 can be separated from adjacent resonator bandwidths by frequency separation or gap △ f _gap , so that the resonator bandwidth of adjacent resonators △ f _BW Does not overlap and does not cause interference or crosstalk between adjacent resonators. In some specific embodiments, the bandwidths can be overlapped as long as the frequency response of each base is different, so it does not affect the ability to identify the response of each resonator.

Similarly, in FIG. 54, a set of probes or monitoring frequencies f _p1 , f _p2 , f _p3 corresponding to the bandwidths Δf _BW1 , Δf _BW2 , and Δf _BW3 of the resonators NPR1 to NPR3 are shown, which can be Frequency within each resonator bandwidth Δf _BW1 , Δf _BW2 , Δf _BW3 that provides the desired output signal described herein, such as in the range of resonant frequencies seen when a polymer is in a nanopore (As described above with reference to Figures 50-52). If required, other measurement or probe frequencies can be used as long as it meets the required functional and performance requirements.

Although the gap frequency is mainly determined by selecting the inductor L value, the amount of separation between adjacent frequency bands required to avoid undesirable overlap during operation caused by changes in system parameters that may occur under system operating conditions can also be achieved by Determination of various factors, including but not limited to unit design parameter tolerances (e.g., electrodes, inductors, capacitors, fluids, cell walls, membranes, materials, dimensions, and any other unit design parameters that vary from unit to unit), environmental operating range , Such as temperature, pressure, humidity, etc., electromagnetic interference or noise parameters / effects, any unit-to-unit (or room-to-room) interaction, and / or any other design practices, safety or regulatory requirements or tolerances, or that may affect required Any other factor of function or performance. Such factors can cause the bandwidth of a given resonator to change from its ideal state, so frequency separation over time and environment should be considered in the overall design tolerance parameters.

Please refer to Figures 55A and 55B. The AC input voltage Vin disclosed in this disclosure includes at least the required measurement or probe frequency. Frequency analysis will be performed on the output AC voltage Vout at this frequency (for example, using the FFT logic 5330 in Figure 53). . Please refer to FIG. 55A. The AC input voltage Vin may be a continuous broadband AC frequency signal shown by the curve 5502, with all frequencies from the smallest possible measurement frequency f _minimum to the smallest possible measurement frequency f _maximum , or from the first The probe frequency f _p1 to the last probe frequency f _PN . In this case, all the resonators NPR1-NPR3 are excited by the wideband frequency signal and will respond in the frequency component of the output signal. Alternatively, the AC input voltage Vin may be a broadband AC frequency signal shown by the curve 5510, which has only the required probes or monitoring frequencies f _p1 , f _p2 , f _p3 , and f _pN , such as separate frequency components 5512, 5514, 5516, 5518 shown. In addition, the total frequency range of the AC input voltage Vin for all resonators in the array can be from about 1.0 MHz to 100 GHz (or higher). If desired, other frequencies can be used as long as it meets the functions and performance described in this article. The AC input voltage Vin can be provided by a known oscillator chip (which can be adjustable and / or programmable) that provides the required AC frequency components for the desired design configuration and excitation, such as the FMC2850, TIDAC900, or Xilinx DS558. Where Vin contains multiple separate probe frequencies, Vin can be created by electronically combining independent AC frequencies, or directly mathematically synthesized and programmed into an oscillator (either hard-wired or micro-connected to it). Processor programming).

Please refer to Figure 55B. The AC input voltage Vin can be the time-scanned AC frequency signal shown by the curve 5550, scanning the input frequency from the minimum possible measurement frequency f _minimum to the minimum possible measurement frequency f _maximum , or from the first probe The frequency f _p1 to the last probe frequency f _{PN is} then repeated in a repeating time period T. In this case, the frequency of the input voltage Vin is only at one frequency at any given time, and all the resonators NPR1-NPR3 respond to the single input frequency and will present a response to the frequency at the output signal. In addition, in this case, because the system only responds to one frequency at a time, and the system knows the frequency sweep timing of the input voltage Vin, no frequency analysis is needed, because the system can sample the amplitude and / or at the time associated with the desired probe frequency Phase and directly determine the value.

Alternatively, the AC input voltage Vin may be a time-step AC frequency signal shown by the curve 5570, where the input frequency is stepped from the first probe frequency f _p1 to the last probe frequency f _PN and waits for a predetermined dwell time at each frequency T _D , followed by a repeating period T. In this case, similar to the scan-frequency curve 5550, the frequency of the input voltage Vin is at only one frequency at any given time, and all the resonators NPR1-NPR3 respond to the single input frequency and will output signals to the frequency at this time. Render the response. The dwell time T _D allows the system more time to sample the output signal at each probe frequency. In addition, in this case, because the system only responds to one frequency at a time and the system knows the timing, there is no need for frequency analysis (or decomposition) because the system can sample the amplitude and / or phase at the time associated with the desired probe frequency and Determine the value directly.

In addition, the total frequency range (and probe measurement frequency) of the AC input voltage Vin for all resonators in the array can be from about 1.0 MHz to 100 GHz (or higher). If desired, other frequencies can be used as long as they meet the functional and performance requirements described herein. The AC input frequency should be set to a value that supports a sufficient number of input frequency cycles (periods) to allow the impedance of the unit to be fully sampled. This may be based in part on the speed of DNA (or other polymers) passing through the nanopore. For example, if DNA is passing through a nanopore at a rate of about 1 MHz (that is, 1 million bases per second), and if the AC input frequency is 100 MHz, the cell impedance will be received (or experienced) for each base 100 input frequency cycles, which correspond to a 100: 1 "sampling" rate. If needed, other input frequencies and sampling rates can be used as long as they provide the required functionality and performance. For example, the minimum sampling frequency required to digitally parse a given input frequency is the Nyguist sampling frequency, which is twice the input frequency. In this case, for a 1 MHz input signal (the rate at which DNA passes through the nanopore), the minimum (or Nyquist) sampling rate will be 2 MHz.

Please refer to FIG. 56. For some specific embodiments of the present disclosure, examples of frequency spectrum diagrams showing the amplitude and phase of the AC output voltage Vout 5600 and 5620 are shown. In particular, for the AC output voltage signal Vout, three amplitude lines 5602, 5604, and 5606 are displayed, corresponding to the frequency responses of NPR1, NPR2, and NPR3, respectively. For this example, the probe frequency used is f _{probe 2} and has only two bits, similar to the example shown in Figure 52. When this output is obtained for this example, NPR1 has the situation shown in column 5206 at time T3 (FIG. 52), and the corresponding frequency response line 5602 indicates the amplitude V10 and the phase Ph6. Meanwhile, NPR2 has the situation shown in column 5204 at time T2 (FIG. 52), and the corresponding frequency response line 5604 indicates the amplitude V9 and the phase Ph7. At the same time, NPR3 has the situation shown in column 5210 at time T5 (Fig. 52), and the corresponding frequency response line 5606 (Fig. 56) indicates amplitude V6 and phase Ph10.

In some embodiments, the probe or measurement frequency used may vary based on the resonator frequency response, polymer properties, and other factors such as system noise that may affect the quality of the output signal. In some embodiments, the system can switch between measurement frequencies in real time to ensure the best quality output signal is obtained, or multiple different measurement frequencies can be used to perform error checking or verification of data reading. In this case, Vin's AC input frequency should include the measurement frequency, such as by changing or adjusting accordingly (synchronizing with the measurement) or making the measurement frequency a part of the continuous AC input frequency component provided.

Referring to FIG. 57, a top-level block diagram 5700 is shown for a specific embodiment of the present disclosure. In particular, when a resonator (or NPR) array is laid out on a wafer, it can be configured as a two-dimensional array of MxN resonators, where there are M rows 5702-5708 and each row has N resonators, and all resonators are connected in parallel ( (Shown as line 5716) and all NPRs are driven by the same AC input voltage Vin 5308 (Figure 53) on line 5710 and all NPRs contribute to a common frequency division multiplexed AC output voltage Vout on line 5712, which can be The output voltage is supplied to an amplifier (or preamplifier) 5320 (Figure 53). In this case, each line 5702-5708 may correspond to a frequency band, such as 100 MHz-199 MHz (for line 5702), 200 MHz-299 MHz (for line 5704), 300 MHz-399 MHz (for line 5706), and so on for other lines. Within each row 5702-5708, there may be multiple resonators (or NPRs), each resonator is shown as a box 5714, with the name f _{row, column} . Each NPR in a given row has a resonator bandwidth Δf _BW in the frequency band associated with the row, and is separated from adjacent NPRs by a gap band Δf _gap to avoid interference or interference between adjacent resonators. Crosstalk, as described above with reference to Figure 54.

For example, if the first line specifying the top 5702 has a frequency band of 100MHz-199MHz, then NPR f _1,1 to f _{1, N} in this line 5702 will be in this frequency band and separated from each other by a gap frequency band, as above and Refer to Figure 54. Therefore, in this format, the reading system can be regarded as a two-dimensional array of data elements, and these data elements can be read individually by a single input and output line. If needed, other frequency bands and ranges can be used.

Refer to Figure 58 for a cross-sectional view of the multilayer chip structure 5800, including unit 4800 (Figure 48A), inductor L (Figures 49A, 53), and coupling capacitor C _CPL , and includes a top contact 5802, which can be contacted here The input (and output) I / O voltage lines are connected here, and they are collectively referred to herein as nano-hole-polymer resonators (NPR). The matching components of unit 4800 (Figure 48A) are similarly labeled in Figure 58. Above the upper electrode 4818 is a vertical connection 5806 to the center of the chip inductor 5808 (FIG. 59) L, and the other end of the chip inductor 5808 is connected to the coupling chip capacitor 5812. The upper side of the chip capacitor 5812 is connected to the I / O contact 5802. Multi-layer three-dimensional stacking allows the unit 4800 and circuit components to be added to the package, thereby making the unit 5804 tightly packed. In particular, please refer to Figures 48A and 58, unit 4800. There may also be a dielectric layer 5804 that separates each functional circuit element. Multiple copies of the resonator or NPR structure 5800 can be connected together in a one- or two-dimensional array to create a "wafer" with the NPR array described above, for example, with reference to Figures 53 and 57. In addition, by "flip-chip" bonding or any other technology that provides the required functionality and performance, an amplifier can be integrated into the chip structure in the output line contact layer 5802 at a suitable location (such as after the last NPR 5800 in the array). 5320 (Figure 53), such as a CMOS amplifier or preamp. In addition, please refer to FIG. 59, which shows a top view of an inductor L that can be used in the wafer 5800, which can be manufactured by using a known wafer-inductor manufacturing technique, such as photolithography or other manufacturing techniques. As described herein, there may also be a DC voltage applied to the electrodes to move or guide the DNA or polymer floating in the chamber to a specific desired chamber. As described herein, applying AC voltage to all NPRs 5800 through I / O contacts can be common to all NPRs, and can be supplied by AC input voltage on line 5812, and can be applied to each through line 5810. The electrodes separately apply DC voltage, and each NPR has its own independent DC voltage input line 5810 to control the electrodes 4818 individually.

Please refer to Figures 60 and 61. To allow AC and DC voltages to drive the same unit, the AC and DC lines can be connected to the structure 5800 by using a "T-bias tee" connection, which is a "T-bias "Connect the circuit 6000 shown in Figure 60 and the sample physical wafer design 6100 shown in Figure 61. Please refer to Figure 60. The AC RF (high frequency) input signal Vin is coupled to the inductor L through the coupling capacitor C _CPL (as described above) and the DC input can be on the same side of the inductor L through the high resistance line Rw Connection, the high-impedance line has sufficient self-inductance to "block" high-frequency AC signals from the circuit via the DC input source path. Alternatively, if necessary, the resistance line Rw may be connected to the other side (electrode side) of the inductor L. However, in this case, the value of the resistance line Rw will be used to suppress resonance (as another resistor in parallel with a unit capacitor connected to AC ground).

Refer to Figure 61 for an example of a physical design 6100 for a "T-biaser" connection, which shows an enlarged view of the "T-biaser" connection. The high-frequency AC input signal Vin is capacitively coupled to the inductor L via a transmission line (eg, top I / O contact 5802-58), which has a gap with the second board 6102 to create a coupling AC and block DC voltage Coupling capacitor CCPL. In addition, the DC input voltage (or DC “boot” voltage) can be connected to the same side of the inductor L by a high-impedance line Rw, which has sufficient self-inductance to “block” high-frequency AC signals through the DC input source The path leaves the circuit as described above with reference to Figure 60. As a result of the “T-bias” connection, the voltage applied to the inductor L is an AC input voltage with a DC offset determined by the DC input voltage.

Referring to Figure 62, a cross-sectional view of a multi-layer wafer structure 6200 is shown. The structure includes a three-chamber unit similar to that shown in Figures 24, 25, 28, and 29 and described herein, and has two integrated inductors L1A. , L1B. In this case, there is an upper (or top) left chamber 6202, which has a top left electrode 6210 and a nano hole 6203 (for adding bits, such as "0"); a top right chamber 6204, which has a top right electrode 6212 And nano hole 6205 (for adding bits, such as "1"); and the lower "deprotection" chamber 6206, which is common to both the top left 6002 and the top right 6004 rooms, has a corresponding electrode 6214, which can be grounded ( (For example, 0 volts). For this three-chamber unit, it can be seen as having two capacitors in parallel, each with their own impedance over time. In this case, the left inductor L1A is connected to the left top electrode 6210, and the right inductor L1B is connected to the right top electrode 6212. The remaining components and elements may be the same as described previously for the two-chamber unit design. By using the "T-bias" connection as described above, the AC RF I / O input line can be capacitively coupled to the inductor, and each DC 6220, 6222 input line is coupled to the inductor through a resistor or resistance line . If the inductors L1A and L1B have different values, the left and right chambers will have different resonance frequencies and different resonance bandwidths. In this case, each three-chamber unit will have two resonators that have two resonance bandwidths that can be located on interrogated or monitored as described above to read the polymer (or DNA) Data in the frequency space. If the inductors L1A, L1B have the same value, DNA can still be read for each chamber, because the system can only read one chamber at a time, because each unit has only one polymer (or DNA) strand. Therefore, it is inherently chronological or time dependent, so they do not need to be separated in frequency to implement data reading. However, you may want to separate them to ensure (or verify) that the correct chamber is actually being read.

Referring to FIG. 63, a cross-sectional view of a multilayer wafer structure 6300 is shown, which includes a three-chamber unit similar to that shown in FIG. 62, with a single integrated inductor L1A. In some embodiments, depending on the data read and write protocol, it may be desirable to read polymer data using only one unit, such as the top left unit 6002, and another unit, such as 6004, may not be configured for reading Therefore, there is no inductor and no resonator is formed. In this case, the AC input voltage Vin and the DC pilot voltage can be coupled to the inductor L1A by using a “T-bias” connection (as described above for other specific embodiments) to drive the left top electrode 6210, DC The pilot voltage enters line 6302, and for the right top electrode 6212, a DC pilot input voltage can be directly connected as shown by line 6304. The remaining components and components can be the same as described above for the three-chamber unit design with reference to Figure 62.

Referring to Figures 64 and 64A, instead of one or two inductors attached to the top electrode, a single integrated inductor L1 can be connected to the bottom electrode 6214, and the top electrodes 6210, 6212 are connected to the wires 6410, 6412, respectively. The corresponding DC pilot voltage for this electrode is individually connected. In this case, there will be "T-bias" type connections at the top and bottom of the circuit (see Figure 64A). In this case, the AC RF input voltage can be provided to the bottom electrode, which can be coupled to the inductor L1 through the coupling capacitor C _CPL AC, and the AC is coupled to the AC RF ground through the coupling capacitor on the top. DC lines 6410, 6412 (Figure 64) are coupled to their respective electrodes via Rw (Figure 64A), and DC passes through the unit and inductor and passes through the bottom Rw to DC to ground. The bottom contact can act as an AC rf I / O line, and the top contact 4610 can act as a DC I / O line. In addition, the DC ground can also be a DC input line. The only requirement is to define a DC potential difference between the top and bottom electrodes. With a common inductor L1, DNA can still be read for each chamber because the system can only read one chamber at a time because each unit has only one polymer (or DNA) strand (or storage string, as in this article) Said) (as described above). Therefore, it is inherently chronological or time-dependent. Please refer to FIGS. 63, 63A, and 63B. In some embodiments, instead of using a separate inductor L (for example, as shown in FIG. 63) for each resonator to set a unique resonance frequency and frequency bandwidth, For all the resonators in the array, a single common inductor L is used in _common and a separate capacitor C _R can be provided in parallel with each unit, the value of which sets the resonant frequency of each resonator. In this case, the memory chip may have a built-in fixed chip resonator capacitor C _R for each chamber from the top electrode to the bottom electrode, which is measured to set a resonance frequency for each unit together with a common inductor. When the polymer passes through the nanopores 6203 and 6205 and the capacitance of the unit changes, this capacitance change will adjust the total parallel capacitance combination and adjust the resonance frequency accordingly. And L is a separate inductor Similarly, the fixed value of the resonant capacitor C _R to provide a unique resonance frequency response is arranged for each of the resonators of the resonator array. As described above for the specific embodiment of the inductor, only one capacitor (one resonator) may be required to perform the measurement, or if two are used, they may be the same value (due to the inherent time sequence as described above), or if required, Can be different values for verification, redundancy or other purposes. FIG. 63A shows an example of an equivalent circuit diagram of a plurality of cells _{common to} the fixed resonance capacitors C _R1 , C _R2 , C _R3 and the common inductor L.

Please refer to Figures 64, 64B, and 64C. In some specific embodiments, instead of using a separate inductor L (such as shown in Figure 64) on the bottom of each resonator to set a unique resonance frequency and frequency bandwidth For each resonator in the array, a single common bottom inductor L can be used in _common and a separate capacitor C _R can be provided in parallel with each unit, the value of which sets the resonant frequency of each resonator. A similar variation using a fixed manner may be performed for the bottom inductor, in which the resonant capacitors C _R1 , C _R2 , C _R3 and the common inductor L may be used in _common . In this case, the memory chip may have a built-in fixed chip resonator capacitor C _R (FIG. 64C) for each cell from the top electrode to the bottom electrode, which is measured to set resonance with the common inductor L _together for each unit frequency.

`Disclosure does not require a separate addressing unit to read the data in each unit. In addition, this disclosure allows the use of frequency division multiplexing to read data stored on the polymer in each unit by using a single source input line and a single output line. In addition, the data reading technology of the present invention is applicable to any type of nanopore, such as solid state, protein-based, or any other type of nanopore. In addition, the disclosed system and method use a high rf frequency to read the storage string (or DNA or polymer), for example, about 1MH-100GHz (or higher), which basically eliminates 1 / f noise, so the system does not use these High frequency measurement methods will likely have higher sensitivity (or granularity or fidelity) than systems. In addition, the use of high-frequency methods also provides a fast time scale to read (or sample) the storage string passing through the nanopore, thereby eliminating the need to intentionally slow down the storage string for sampling or measurement purposes.

In some embodiments, the present invention provides a nanochip for sequencing a charged polymer (eg, DNA) including at least two different monomers, the nanochip including at least first and second reaction chambers, each chamber An electrolyte medium is included, and is separated by a membrane including one or more nanopores, wherein a pair of electrodes (for example, In the form of opposing plates), the electrodes are separated by a distance of 1 to 30 micrometers, such as about 10 micrometers, so that when an RF pulsating DC current, such as about 1 MHz to 100 GHz (or higher) is applied to the electrodes, between the electrodes The gap has capacitance to draw the charged polymer through the nanopore, for example, from one chamber to the next, and when the charged polymer passes through the nanopore, the phase of the pulsating DC RF current changes with the capacitance. Instead, allowing detection of the monomer sequence of the charged polymer. In some embodiments, the nano-chip includes a plurality of sets of reaction chambers, wherein the reaction chambers in a group are separated by a membrane having one or more nano-pores, and the reaction chamber group is shielded by The layers are separated to minimize electrical interference between the groups of reaction chambers and / or to separate multiple linear polymers and allow them to be sequenced in parallel.

For example, in a specific embodiment, the electrodes constitute the top and bottom plates of a capacitor embedded in a resonant circuit, and the change in capacitance is measured as the DNA passes through a hole located between the plates.

In certain embodiments, such as any of the nano wafers according to the following nano wafers 1 and the like, the nano wafers also include reagents for synthesizing polymers such as DNA.

Therefore, in a specific embodiment, the present invention provides a method for synthesizing at least two different kinds of wafers in a nanowafer (for example, a nanohole-based device such as a nanowafer 1 or the like). Method (method 1) of a charged polymer (e.g., nucleic acid (e.g., DNA or RNA)) of the body, the nanochip includes one or more addition chambers, containing reagents, in a blocked form One or more monomers (e.g., nucleotides) or oligomers (e.g., oligonucleotides) are added to the charged polymer in the buffer solution, so that only a single monomer or oligomer can be added in one reaction cycle And one or more retention chambers containing a buffer solution, but not all reagents required to add the one or more monomers or oligomers, wherein the chambers are One or more membranes are separated, and wherein the charged polymer can pass through the nanopore, but at least one of the reagents for adding one or more monomers or oligomers cannot pass through the nanopore. The method includes a) using electrical attraction The first end of the charged polymer having a first end and a second end enters the addition chamber, so that a monomer or oligomer is added to the first end in a protected form, b) the added monomer or The first end of the charged polymer of the oligomer enters the retention chamber, and c) deprotects the added monomer or oligomer, and d) repeats step ac, wherein the added in step a) The monomers or oligomers are the same or different until the desired polymer sequence is obtained.

For example, the invention provides

1.1 Method 1, wherein the polymer is a nucleic acid, for example, wherein the polymer is DNA or RNA, for example, where it is DNA, such as dsDNA or ssDNA.

1.2 Any of the above methods, wherein the polymer such as the second end of the nucleic acid is protected or bound to a matrix adjacent to the nanopore.

1.3 Any of the above methods, wherein the electrical attraction is provided by applying a potential between electrodes in each chamber, wherein the polarity and current between the electrodes can be controlled, for example, to attract the nucleic acid to the positive electrode.

1.4 Any of the above methods, wherein the polymer is a nucleic acid and (i) the first end of the nucleic acid is a 3 'end, and the addition of the nucleotide is in a 5' to 3 'direction and catalyzed by a polymerase, such as Wherein the polymerase is prevented from passing through the nanopore (for example, due to its size or because it is tethered into the matrix in the first chamber), the nucleotide is 3 'protected when added, and at the 3 After the 'protected nucleotide is added to the 3' end of the nucleic acid, for example, the 3 'protecting group on the nucleic acid is removed in the retention chamber; or (ii) the first end of the nucleic acid is the 5' end, so It is said that the nucleotide is added in the 3 'to 5' direction, the nucleotide is 5 'protected when added, and after the 5' protected nucleotide is added to the 5 'end of the nucleic acid, for example, at the second The 5 'protecting group is removed from the chamber; (eg, where the phosphate on the 5' protecting nucleotide is a nucleus coupled to the large group that cannot pass through the nanopore through the 5 'protecting group Phosphoamidite, so that after coupling to the nucleic acid, unreacted nucleotides are washed away, the large 5 'protecting group is cut from the nucleic acid and washed away, The 5 'end of the nucleic acid can be allowed to enter the retention chamber); wherein the addition of nucleotides to the nucleic acid is controlled by the first end of the nucleic acid in and out of the one or more addition chambers, and the cycle is continued Until the desired sequence is obtained.

1.5 Any of the above methods, wherein the monomer or oligomer sequence (for example, the nucleotide sequence in the nucleic acid) in the polymer thus synthesized corresponds to a binary code.

1.6 Any of the above methods, wherein the polymer thus synthesized is single-stranded DNA.

1.7 Any of the above methods, wherein, by sequencing the monomer or oligomer as the monomer or oligomer passes through the nanopore, examining the polymer (e.g., the nucleic acid) during the process or synthesis The sequence to identify errors in the ordering.

1.8 Any of the above methods, wherein the polymer thus synthesized is single-stranded DNA, wherein at least 95%, such as at least 99%, in the sequence, for example, substantially all of the bases are selected from those that are not related to other bases in the chain Two bases that are heterozygous, for example, bases selected from adenine and cytosine.

1.9 Any of the above methods, wherein multiple polymers (e.g., oligonucleotides) are independently synthesized in parallel to obtain different sequences by independently controlling whether they are in one or more addition chambers or one or more retention chambers Polymer (oligonucleotide).

1.10 Any of the above methods, wherein there are at least two addition chambers containing reagents suitable for adding different monomers or oligomers, such as different nucleotides, for example, wherein there are at least two addition chambers containing reagents suitable for adding a first monomer or oligomer One or more addition chambers of reagents and one or more addition chambers of reagents suitable for adding a second different monomer or oligomer, for example, wherein one has one of reagents suitable for adding adenine nucleotides Or more addition chambers and one or more addition chambers containing reagents suitable for adding cytosine nucleotides.

1.11. Any of the above methods, wherein at least one of the addition chambers is a flow chamber, providing a flow cycle, comprising (i) supplying the flow chamber with a reagent suitable for adding a first monomer or oligomer, (ii) rinsing, (iii) The flow cell is provided with a reagent suitable for adding a second different monomer or oligomer, and (iv) rinsing, and the cycle is repeated until the synthesis is completed, wherein the monomer or oligomer in the polymer is The sequence is controlled by introducing or preventing the first end of the polymer from entering the flow cell during step (i) or (iii) in each cycle;

1.12. Any of the above methods, wherein the polymer is DNA and at least one addition chamber is a flow chamber, providing a flow cycle, comprising (i) supplying the flow chamber with a reagent suitable for adding a first type of nucleotide, and (ii) rinsing , (Iii) providing the flow cell with a reagent suitable for adding a second type of nucleotide, and (iv) rinsing, and repeating the cycle until the synthesis is completed, wherein the sequence is controlled by controlling the first end of the DNA (E.g., the 3 'end) is controlled with or without the flow cell.

1.13. Any of the above methods, wherein the polymer is DNA and at least one addition chamber is a flow chamber, providing a flow cycle, comprising (i) supplying the flow chamber with a reagent suitable for adding a first type of nucleotide, and (ii) rinsing , (Iii) providing the flow cell with a reagent suitable for adding a second type of nucleotide, and (iv) rinsing, (i) providing the flow cell with a reagent suitable for adding a third type of nucleotide, (ii) Rinsing, (iii) providing the flow cell with a reagent suitable for adding a fourth type of nucleotide, and (iv) rinsing, and repeating the cycle until the synthesis is complete, wherein when there is a nucleoside suitable for adding the different type In the case of an acid reagent, the sequence is controlled by controlling whether the first end (e.g., the 3 'end) of the DNA is in or not in the flow cell.

1.14 Any of the above methods, wherein the polymer is DNA and the nanochip includes two addition chambers, the two addition chambers are flow chambers, (a) the first flow chamber provides a flow cycle, and (i) the first flow chamber A flow cell provides a reagent suitable for adding a first type of nucleotide, (ii) a rinse, (iii) provides the first flow cell with a reagent suitable for adding a second different type of nucleotide, and (iv) a rinse, And repeating the cycle until the cycle is complete, and (b) providing a flow cycle to the second flow chamber, including (i) supplying the second flow chamber with a reagent suitable for adding a third type of nucleotide, (ii) rinsing, ( iii) providing the second flow cell with a reagent suitable for adding a fourth different type of nucleotide, and (iv) rinsing, and repeating the cycle until the synthesis is completed, wherein the nucleotide is selected from dATP, dTTP, dCTP And dGTP, and wherein the sequence is controlled by directing the first end (eg, the 3 'end) of the DNA into a flow cell that provides the next desired nucleotide.

1.15. Any of the above methods, wherein the polymer is DNA and the nanopore wafer includes one or more addition chambers for adding dATP, one or more addition chambers for adding dTTP, and one for adding dCTP. Or more addition chambers, and one or more addition chambers for adding dGTP.

1.16. Any of the above methods, wherein the synthesized polymers (eg, nucleic acids) are bound to the surface of the adjacent nanopore by their second ends, respectively.

1.17. Any of the above methods, wherein the polymer (e.g., nucleic acid) is determined after each cycle by detecting changes in potential, current, resistance, capacitance, and / or impedance as the polymer passes through the nanopore. The sequence.

1.18 Any of the above methods, wherein the polymer is a nucleic acid and the synthesis of the nucleic acid occurs in a buffer solution, for example, the solution includes a buffering agent at pH 7-8.5, such as about pH 8, such as trismethylaminomethane (Tris), suitable Acid, and optionally a chelating agent such as ethylenediaminetetraacetic acid (EDTA), such as a TAE buffer containing a mixture of Tris base, acetic acid, and EDTA, or a mixture of Tris base, boric acid, and EDTA TBE buffer; for example, the solution includes 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCL, or, for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9@25°C.

1.19 Any of the above methods, wherein the polymer is single-stranded DNA, and further comprising converting the synthetic single-stranded DNA to double-stranded DNA.

1.20 Any of the above methods, further comprising removing the polymer (e.g., nucleic acid) from the nanowafer after the polymer synthesis is complete.

1.21 Any of the above methods, wherein the polymer is a nucleic acid, further comprising using appropriate primers and a polymerase (eg, Phi29) to amplify and retrieve a copy of the synthetic nucleic acid.

1.22 Any of the above methods, wherein the polymer is a nucleic acid, further comprising cutting the synthetic nucleic acid with a restriction enzyme and removing the nucleic acid from the nanochip.

1.23. Any of the above methods, wherein the polymer is a nucleic acid, further comprising amplifying the nucleic acid thus synthesized.

1.24 Any of the above methods, further comprising removing the polymer (eg, nucleic acid) from the nanowafer and crystallizing the polymer.

1.25 Any of the above methods, wherein the polymer is a nucleic acid and further comprises stabilizing the nucleic acid, for example, by drying the nucleic acid and one or more buffers (e.g., borate buffers), antioxidants, humectants such as polyols are included And optionally a chelating agent solution, such as described in US 8283165B2, which is incorporated herein by reference; or by forming a matrix between the nucleic acid and the polymer, such as poly (ethylene glycol) -poly (l- lysine) (PEG-PLL) AB block copolymer; or by adding a complementary nucleic acid chain or a protein that binds to the DNA.

1.26 Any of the above methods, comprising: (i) reacting a nucleic acid with a 3 'protected nucleotide in an addition chamber in the presence of a polymerase, the polymerase catalyzing the 3' protected nucleotide to 3 'of the nucleic acid End addition; (ii) at least the 3 'end of the 3' protected nucleic acid thus obtained is pulled out of the addition chamber, through the at least one nanopore, and into a retention chamber, wherein the polymerase is blocked (for example, (By virtue of its size or by the substrate tethered in the first compartment) through the nanopore; (iii) the 3 'protected nucleic acid is deprotected, for example, chemically or enzymatically; and (iv) if necessary to the oligo Adding an additional 3'-protected dNTP to a nucleotide, then pull the 3 'end of the oligonucleotide into the same or a different addition chamber, thereby repeating steps (i)-(iii), or allowing it if not needed The 3 'end of the nucleic acid remains in the retention chamber until the next cycle, where the required 3' protected dNTP is provided to the addition chamber; and (v) the cycle of steps (i)-(iv) is repeated until Obtain the desired nucleic acid sequence.

1.27 Any of the above methods, wherein the polymer is nucleic acid single-stranded DNA (ssDNA) and the one or more nanopores have a diameter that allows ssDNA to pass but not double-stranded DNA (dsDNA), for example, about 2 nanometers diameter of.

1.28 Any of the above methods, wherein the monomer is a 3 'protected nucleotide, for example, deoxynucleoside triphosphate (dNTP), for example, selected from deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate ( dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), such as dATP or dCTP.

1.29. Any of the above methods, wherein the polymer is a nucleic acid and the adding the nucleotide to the nucleic acid is catalyzed by a polymerase, such as a template independent polymerase, such as a terminal deoxynucleotidyl transferase (TdT), Or polynucleotide phosphorylase, for example, where the polymerase catalyzes the incorporation of deoxynucleotides at the 3'-hydroxyl terminus of DNA.

1.30 Any of the above methods, wherein the membrane comprises a plurality of nanopores and a plurality of polymers, such as a plurality of nucleic acids, respectively bound to the surface of the adjacent nanopores, respectively through their 5 'ends and the surface of the adjacent nanopores. Combined.

1.31 Any of the above methods, wherein a plurality of polymers respectively bound to the surface of the nanopore are separately synthesized, for example, a plurality of nucleic acids each bound to the surface of the nanopore at the 5 ′ end, wherein each nanopore is Has an associated electrode pair, wherein one electrode of the pair is adjacent to one end of the nanopore and the other electrode is adjacent to the other end of the nanopore, so that each polymer can be made independent by the current provided by the electrode pair The ground moves between the first and second chambers.

1.32. Any of the methods described above, wherein the polymer is a 3 'protected nucleic acid that binds to the surface of the nanopore adjacent to the 5' end and pulls the polymer by using electricity, such as by using electricity applied from an electrode in an adjacent chamber. The 3 'end of the 3' protected nucleic acid passes through the nanopore.

1.33 Method 1.20, wherein the new 3'-protected dNTP is the same as or different from the first 3'-protected dNTP.

1.34 Method 1.20, wherein the 3 'protected dNTP used in step (i) of the cycle alternates between 3' protected dATP and 3 'protected dCTP in each cycle.

1.35. Any of the above methods, wherein the polymer is a nucleic acid, and deprotection of the nucleic acid is performed by an enzyme to remove a 3 'protecting group on ssDNA instead of 3' protecting dNTP.

1.36 Any of the above methods, further comprising the step of detecting the sequence of the polymer as the polymer passes through the nanopore to confirm that the desired sequence has been synthesized.

1.37 Any of the above methods, including the step of detecting the sequence of the polymer as the polymer passes through the nanopore to measure the change in capacitance in the resonant RF circuit as the DNA is pulled through the nanopore Confirm that the desired sequence has been synthesized.

1.38. Any of the above methods, wherein the reagent for adding one or more monomers or oligomers to the charged polymer includes a reagent selected from the group consisting of topoisomerase, DNA polymerase, or a combination thereof.

1.39 Any of the above methods, wherein the adding one or more monomers or oligomers to the charged polymer is performed according to any one of methods 2 and the like or method A and the like.

For example, the present invention provides a method for synthesizing a nucleic acid in a nanochip, the nanochip including at least a first chamber and a second chamber separated by a membrane including at least one nanopore, The nucleotide addition cycle of the first end of the nucleic acid at one end and the second end performs the synthesis in a buffer solution, wherein the first end of the nucleic acid is electrically attracted in one or more addition chambers (which contain Nucleotide-added reagents) and one or more retention chambers (which do not contain reagents needed to add nucleotides), these chambers by one or more The membrane is separated, wherein the nanopore is large enough to allow the nucleic acid to pass, but is too small to allow at least one reagent necessary for the addition of nucleotides to pass, for example, where the method corresponds to the method 1 and so on. Arbitrary method.

For example, Method 1A, which is a method, for example, according to any one of Methods 1 and the like, for synthesizing a charged polymer including at least two different monomers or oligomers in a nanopore-based device, the Nanopore-based devices include: one or more addition chambers or channels containing buffer solutions and reagents for adding one or more monomers or oligomers to the charged polymer in a protected form, thereby allowing a single reaction cycle Only a single monomer or oligomer can be added to the system; and one or more deprotection chambers or channels containing a buffer solution and a deprotection reagent for self-protecting the one or more monomers added to the charged polymer. The protective group is removed by a polymer or oligomer, wherein the addition chamber or channel is separated from the deprotection chamber by one or more membranes including one or more nanopores, and wherein the charged polymer The nanopore can pass through and at least one of the reagents for adding one or more monomers or oligomers cannot pass through the nanopore, and at least one of the deprotecting agent cannot pass through the nanopore, the Method package a. The first end of the charged polymer having a first end and a second end is brought into the addition chamber or channel by electrical attraction, so that a monomer or oligomer is added to the first end in a protected form, b. Allowing the first end of the charged polymer with the added monomer or oligomer in a protected form to enter a retention chamber, thereby removing the protecting group on the added monomer or oligomer, and c. Repeating the step a and b, wherein the monomers or oligomers added in step a) are the same or different until the desired polymer sequence is obtained; for example, wherein the device includes: one or more first An addition chamber or channel containing a reagent suitable for adding a first type of monomer or oligomer; and one or more second addition chambers containing a reagent suitable for adding a second different type of monomer or oligomer, and therein In step a, the first end of the charged polymer is allowed to enter the first addition chamber or the second addition chamber, depending on whether the first type of monomer or oligomer or the second different type of monomer is to be added. Or oligomers.

In certain embodiments, the sequence of the polymer corresponds to a binary code, for example, wherein the polymer is a nucleic acid and the sequence corresponds to a binary code, wherein each bit (0 or 1) consists of a base such as A or C means.

In certain embodiments, the polymer is DNA.

In certain other specific embodiments, each bit is represented by a short-sequence monomer rather than a single monomer. For example, in one such specific embodiment, DNA blocks are synthesized, where each block generates a unique signal through the nanopore and corresponds to zero or one. This particular embodiment has a particular advantage: it is more difficult to detect single nucleotides in nanopores, especially in solid-state nanopores, so using blocks is less prone to read errors, although the density of information in the polymer is correspondingly reduced.

For example, by using a site-specific recombinase (i.e., an enzyme that spontaneously recognizes and cleaves at least one strand of a double-stranded nucleic acid within a sequence segment known as a site-specific recombination sequence), nucleotides can be added Block (double stranded). In one such specific embodiment, the site-specific recombinase is a topoisomerase, which is used to link a topologically conjugated dsDNA oligonucleotide block to the sequence. These oligonucleotides themselves will not have structures compatible with additional ligation until they are cleaved with restriction enzymes. Vaccinia virus topoisomerase I specifically recognizes the DNA sequence 5 '-(C / T) CCTT-3'. The topoisomerase binds to double-stranded DNA and cuts the DNA at a 5 '-(C / T) CCTT-3' cleavage site. It should be noted that the cleavage is incomplete, because the topoisomerase cuts the DNA on only one strand (although a nearby gap on the other strand can cause double-strand breaks), and the topoisomerism occurs during cleavage The enzyme is covalently attached to the 3 'phosphate of the 3' nucleotide. The enzyme then remains covalently bound to the 3 'end of the DNA and can reattach the covalently retained strand (which occurs during DNA relaxation) at the same bond as the initial cleavage, or it can differ from the isomeric with compatible overhangs The source receptor DNA is religated to form a recombinant molecule. In this specific example, we create a dsDNA donor oligonucleotide (for example, including one of at least two different sequences directed to "0" and the other directed to "1",) with topological heterogeneity on the side Enzymatic recombination sites and restriction sites that generate topoisomerase ligation sites. These cassettes are Topo-charged, that is, they are covalently bound to a topoisomerase, which will bind them to the topoisomerase attachment site on the recipient oligonucleotide. When the recipient's growing DNA strand is cleaved with a restriction enzyme, the strand can be linked to a topological loading cassette. Therefore, individuals only need to continuously grow DNA from restriction enzymes to the topological charge cassette, adding another donor oligonucleotide each cycle. Related methods have been described for cloning, see, for example, Shuman S's Novel approach to molecular cloning and polynucleotide synthesis using vaccinia DNA topoisomerase. J Biol Chem. (1994); 269 (51): 32678-84, the contents of which are incorporated herein by reference. .

A similar strategy can be used to add a single base. In the presence of a suitable single-stranded "deprotection" "receptor" DNA, the topologically-loaded DNA is enzymatically and covalently linked ('added') to the receptor by the topoisomerase, in the process from The DNA removes the topoisomerase. Next, type IIS restriction enzymes can cleave all added DNA except a single base (the base being "added"). This deprotection-addition process can be repeated to add additional bases (positions). As shown in the examples herein, it is feasible to add a single nucleotide to the 5 &apos; end of the target single-stranded DNA using a topology / type IIS restriction enzyme combination. Use type IIS restriction enzymes to support cutting DNA at positions different from the recognition sequence (you can find other types of IIS restriction enzymes at https://www.neb.com/tools-and-resources/selectioncharts/type-iis-restriction-enzymes) . The use of inosine (which acts as a "universal base" and pairs with any other base) in this system allows this reaction to occur without having any specific sequence requirements in the target DNA. The identity of the nucleotide added to the single-stranded target DNA is a 3 'nucleotide, and vaccinia topoisomerase is conjugated to it by a 3' phosphate. Since the recognition sequence of vaccinia topoisomerase is (C / T) CCTT, we use this system to add "T" to the target DNA. The related topoisomerase SVF can use the recognition sequence CCCTG (https://www.ncbi.nlm.nih.gov/pubmed/8661446). Therefore, G can be added using SVF instead of "T". Matching with vaccinia topology, binary data can be encoded with T and G.

In another method of single base addition, a 5 'phosphate provides a protective group to provide a single base addition in the 3' to 5 'direction. The loading reaction causes a topoisomerase to load a single T (or G, or other desired nucleotide) with a 5 &apos; phosphate group. When a load topoisomerase "sees" a free 5 'unprotected (unphosphorylated) single-stranded DNA strand, it will add the T to that strand, thus having DNA added to the 5' T. The presence of a linker DNA having a sequence that can bind the topoisomerase and the single-stranded receptor DNA facilitates this addition. (Note that this linker DNA is catalytic-it can be reused as a template in repeated reactions). The added nucleotide has a 5 'phosphate on it, so it will not serve as a substrate for further addition until it is exposed to phosphatase, which removes the 5' phosphate. This process was repeated, adding a single "T" to the 5 'end of the target single-stranded DNA using vaccinia topoisomerase and adding a single "G" using SVF topoisomerase, thereby allowing the construction of sequences that encode binary information with T and G. Other topoisomerases can be used to add A 'or C', but this reaction is less efficient.

When loaded with a topoisomerase, there is a mixture of loaded and unloaded products, which represents a balance between the two species. The "overhangs" left by topoisomerases can be designed in many ways to optimize the efficiency of the reaction. GC-rich overhangs tend to have faster load responses, but have load balances that tend to produce lower product yields. We have found that having some base mismatches (or using inosine) instead of "normal" pairings reduces the "reverse" response and improves yield. In addition, performing the reaction in the presence of a polynucleotide kinase (plus ATP) improves the yield by phosphorylation reaction "by-products" (which reduces the rate of the reverse reaction). In certain embodiments, topoisomerases can "accumulate" by adding additional amino acid sequences that do not damage functionality to ensure that they are large enough that they cannot pass through the nanopore.

One advantage of using a topoisomerase-mediated strategy is that the monomers are covalently attached to the topoisomerase and therefore cannot "escape" to interfere with other reactions. When a polymerase is used, the monomers can diffuse so that the polymerase and / or deprotection agent should be specific (e.g., selectivity for C versus A), or that the monomer is provided by a stream so they have no chance mixing.

In one aspect, the present invention provides a topoisomerase carrying a single nucleotide, that is, a topoisomerase conjugated to a single nucleotide, for example, wherein the topoisomerase uses the nucleoside The 3 'phosphate of the acid is conjugated and the nucleotides are protected at the 5' position by "phosphorylation".

In another aspect, the present invention provides a method for synthesizing a DNA molecule by using a topoisomerase-mediated linkage by adding a single nucleotide or oligomer to a DNA strand in a 3 'to 5' direction (Method A ), Including (i) reacting a DNA molecule with a topoisomerase enzyme carrying a desired nucleotide or oligomer, wherein the 5 'end prevents the nucleotide or oligomer from being further added, followed by (ii) the The 5 'end of the DNA thus formed is deprotected, and steps (i) and (ii) are repeated until the desired nucleotide sequence is obtained, for example,

A1.1 Method A, which is a method of synthesizing a DNA molecule by adding a single nucleotide along the 3 'to 5' direction, including (i) giving the DNA molecule and a load a 5 'protected form such as a 5' phosphorylated form A topoisomerase reaction of the desired nucleotide, thereby adding the desired nucleotide in a 5 'protected form to the 5' end of the DNA, and then (ii) by using a phosphatase to the DNA thus formed Deprotection at the 5 'end, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained; or

A1.2 Method A, which is a method of synthesizing DNA molecules by adding oligomers in the 3 'to 5' direction, including (i) reacting the DNA molecules with the topoisomerase of the desired oligomer, Thus ligating the oligomer to the DNA molecule, then (ii) using a restriction enzyme to provide a 5 'site for the topoisomerase-mediated ligation of another oligomer, and repeating steps (i) and (ii) Until the desired oligomer sequence is obtained.

A1.3 Any of the above methods, including providing a ligase and ATP to seal the gap in the DNA (Note: the topoisomerase ligation only connects one strand).

A1.4 Any of the above methods, wherein the topoisomerase-loaded donor oligonucleotide includes a 5 'overhang on a strand complementary to the strand carrying the topoisomerase, including a polyinosine sequence (Note : Inosine acts as a "universal group" and pairs with any other base).

A1.5 Any of the above methods, wherein the restriction enzyme is a type IIS restriction enzyme, which can cleave all added DNA except a single base (the base being "added").

A1.6 Any of the above methods, wherein the topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.

A1.7 Any of the above methods, wherein dTTP nucleotides are added using vaccinia topoisomerase (which recognizes (C / T) CCTT) and dGTP nucleotides are added using SVF topoisomerase I (which recognizes CCCTG), such as To provide binary code.

A1.8 Any of the above methods, wherein the DNA is double-stranded and the retention chamber further includes a ligase and ATP to repair a DNA strand not connected by the topoisomerase.

A1.9 Any of the above methods, including using a topoisomerase inhibitor to inhibit the binding and activity of a free topoisomerase with a DNA oligomer, for example, wherein the inhibitor is selected from the group consisting of neomycin and coumarin .

A1.10 Any of the above methods, wherein the DNA strand thus provided has a sequence including a thymine (T) nucleoside and a deoxyguanosine (G) nucleoside.

A1.11 Any of the above methods, wherein the topoisomerase adds a single base, and the restriction enzyme cuts at a position of one nucleotide in the 5 'direction from the base added by the topoisomerase.

A1.12 Any of the above methods, wherein the DNA strand thus provided has a sequence including "TT" and "TG" dinucleotide sequences.

A1.13 Any of the above methods, wherein the DNA is single-stranded.

A1.14 Any of the above methods, wherein the DNA is double-stranded.

A1.15 Any of the above methods, wherein the DNA is located on a substrate or a magnetic bead, wherein it can be selectively exposed to or removed from a reagent required to provide a desired sequence.

A1.16 Any of the above methods, wherein some or all of the reagent for adding or deprotecting the DNA is supplied by a stream and removed by rinsing.

A1.17 Any of the above methods, wherein the presence of a linker DNA promotes the attachment of the single nucleotide or oligomer to single-stranded DNA, the linker DNA having the ability to bind to the topoisomerase and the single-stranded receptor DNA the sequence of.

A1.18 Any of the above methods is performed in a system, wherein a nanopore separates a chamber including the topoisomerase from a chamber including the phosphatase or a restriction enzyme, wherein the nanopore allows the Attraction moves the DNA instead of the enzyme, for example, as described in any of Methods 2 and the like.

One possible problem is that the polymerized-G sequence may form a G-quadruplex secondary structure. By moving the restriction enzyme back one base (5 'to the topological sequence) and following a similar topology / IIS strategy, "TT" or "TG" can be added, which can represent different bits, respectively. Although this would require 2 bases to encode a bit, it has the advantage of avoiding polymerizing the -G sequence. In other specific embodiments, other bases in the 3 'end of the topological recognition sequence (although less efficient compared to (C / T) CCTT) may allow comparison with (C / T) CCTA, (C / T ) CCTC and (C / T) CCTG use poxvirus topoisomerase conjugates (https://www.ncbi.nlm.nih.gov/pubmed/17462694). Protein engineering / selection techniques can also be used to increase the efficiency of these reactions, and similar methods can be used to add unconventional bases.

In some embodiments, the method of synthesizing DNA by this method includes treating the DNA with ligase and ATP. The topoisomerase ligates only one side of the DNA (the other side is essentially gapped). The ligase will repair the gap and ensure that the topoisomerase itself does not recut the reaction product and cut it.

In certain embodiments, the method includes using a topoisomerase inhibitor to inhibit the binding and activity of a free topoisomerase to the DNA oligomer. Suitable inhibitors include neomycin and coumarin. It is important to note that complete inhibition is not desired, as low levels of topoisomerase activity can help "relax" helical DNA, which is especially useful when synthesizing long DNA strands.

Therefore, in another specific embodiment, the present disclosure provides a method for synthesizing DNA in a nanochip (Method 2), the nanochip comprising: one or more addition chambers including a topoisomerase-load Oligonucleotides (i.e., oligonucleotides that bind to the topoisomerase at the 3 'end); and one or more retention chambers, including restriction enzymes or deprotections, such as phosphatases, which also contain Compatible with buffer solutions and separated by a membrane including at least one nanopore, where the topoisomerase and the restriction enzyme are prevented from passing through the nanopore (e.g., because they are too large and / or because they are separated by Tethered to the matrix in the first and second compartments), the synthesis is performed by a cycle of adding a single nucleotide or short oligonucleotide block to the first end of a nucleic acid having a first end and a second end, where , The first end of the nucleic acid is moved between the addition chamber and the retention chamber by electrical attraction, for example, in a specific embodiment as follows: (i) the recipient DNA (for example, double-stranded DNA) by electricity 5 'end into the first addition chamber, (ii) in the first addition chamber Topoisomerase-loaded donor oligonucleotide, wherein the donor oligonucleotide includes a topoisomerase binding site, an information sequence (for example, selected from at least two different nucleotides or sequences, For example, where one sequence corresponds to "0" and the other corresponds to "1" in the binary code), and a restriction site that will produce a topoisomerase attachment site when cleaved by a restriction enzyme; (iii ) Allow sufficient time for the donor oligonucleotide to ligate to extend the recipient DNA; (iv) The 5 'end of the recipient DNA thus extended into the retention chamber by electricity, for example, thereby The restriction enzyme cuts the recipient's DNA to provide a topoisomerase attachment site, or in the case of a single nucleotide addition, the deprotection such as a phosphatase generates a 5 'unprotected nucleoside on the single-stranded DNA Acid; and (v) repeat the cycle of steps (i)-(iv), adding oligonucleotides with the same or different information sequences until the desired DNA sequence is obtained.

For example, the invention provides

2.1 Method 2, wherein the 3 'end of the recipient's DNA is adjacent to the nanopore, and the 5' end of the recipient's oligonucleotide includes a topoisomerase attachment site, and includes steps after step (iv) : Adding an additional oligonucleotide to the 5 'end of the recipient's DNA by flushing the first addition chamber and providing a new topoisomerase-loaded donor oligonucleotide to the first addition chamber, wherein the The new donor oligonucleotide has a different information sequence than the previous donor oligonucleotide; and if the new donor oligonucleotide needs to be added to the recipient DNA, the 5 'of the recipient nucleic acid is pulled The end is returned to the first chamber and steps (i)-(iii) are repeated, or if not required, the recipient DNA is allowed to remain in the second chamber until the desired donor oligonucleotide is provided to The first chamber.

2.2 Any of the above methods, wherein a plurality of recipient DNA molecules are independently synthesized in parallel, thereby obtaining DNA molecules with different sequences by independently controlling whether they are in the first chamber.

2.3 Any of the above methods, wherein a plurality of receiver DNA molecules bound to the surface of the adjacent nanopores at the 3 ′ end are separately synthesized, wherein each nanopore has an associated electrode pair, and one of the electrodes in the pair Adjacent to one end of the nanopore and the other electrode is adjacent to the other end of the nanopore, so that the current provided by the electrode pair allows each recipient's DNA molecule to move independently between the first and second chambers .

2.4 Any of the above methods, wherein the donor oligonucleotide used in step (i) of the cycle is between a donor oligonucleotide comprising a first information sequence and a donor oligonucleotide comprising a second information sequence The acids alternate between each cycle.

2.5 Method 2 including the steps of: adding the 5 'end of the recipient's DNA to the first addition chamber to add an oligonucleotide having the same information sequence or bringing the 5' end of the recipient's DNA into A second addition chamber of a donor oligonucleotide having a 'top bound to a topoisomerase to add an additional oligonucleotide to the 5' end of the recipient DNA, wherein the donor in the second addition chamber The donor oligonucleotide has a different information sequence than the donor oligonucleotide in the first addition chamber.

2.6 Any of the above, wherein the donor oligonucleotide includes the following structure: (SEQ ID NO 1) 5'CGAAGGG <Informational sequence A or B> GTCGACNNNNN 3'GCTTCCC <--------- Complement-- --------> CAGCTGNNNNN

Wherein, N refers to any nucleotide and the restriction enzyme is Acc1, which can cut the DNA (for example, GTCGAC in the above sequence) to provide a suitable overhang.

2.7 Any of the above methods, wherein the donor oligonucleotide has a hairpin structure, for example, 2.6, wherein the NNNNN group on the bottom strand is bound at the top.

2.8 Any of the above methods, wherein at least one of the topoisomerase-loaded oligonucleotides has the following structure: (SEQ ID NO 1) 5'CGAAGGG <Informational sequence A or B> GTCGACNNNNN 3 '* TTCCC <- ------- Complement ----------> CAGCTGNNNNN (* = topoisomerase)

2.9 Any of the above methods, wherein at least one of the topoisomerase-loaded oligonucleotides has the following structure: 5’pCACGTCAGGCGTATCCATCCCTT * 3’GTGCAGTCCGCATAGGTAGGGAAGCGC

2.10 The above method, wherein the topoisomerase is loaded with an oligonucleotide.

2.11 Any of the above methods, wherein the sequence of the synthetic DNA is determined after each cycle by detecting changes in potential, current, resistance, capacitance, and / or impedance when the oligonucleotide passes through the nanopore.

2.12 Any of the above methods, wherein the synthesis of the DNA occurs in a buffer solution, for example, the solution includes a buffering agent at pH 7-8.5, such as about pH 8, including, for example, trismethylaminomethane (Tris), a suitable acid, and Chelating agents, such as buffers of ethylenediaminetetraacetic acid (EDTA), such as TAE buffers containing Tris base, a mixture of acetic acid and EDTA, or TBE buffers containing a mixture of Tris base, boric acid, and EDTA, as needed; For example, the solution includes 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCL, or, for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9@25°C.

2.13 Any of the above methods, further comprising removing the DNA from the nanochip.

2.14 Any of the above methods, further comprising amplifying the DNA thus synthesized.

2.15 Any of the above methods, further comprising removing the DNA from the nanowafer and crystallizing the DNA.

2.16 Any of the above methods, further comprising stabilizing the DNA, for example, by drying the DNA including the DNA and one or more buffers (e.g., borate buffers), antioxidants, humectants such as polyols, and chelating agents as needed A solution, such as described in US 8283165B2, which is incorporated herein by reference; or by forming a matrix between the nucleic acid and the polymer, such as poly (ethylene glycol) -poly (l-lysine) (PEG-PLL) AB Block copolymer.

2.17 Any of the above methods, including providing a ligase and ATP to seal a gap in the DNA (note: the topoisomerase ligation only connects one strand).

2.18 Any of the above methods, wherein the topoisomerase-loaded donor oligonucleotide includes a 5 'overhang on a strand complementary to the strand carrying the topoisomerase, including a polyinosine sequence (Note: muscle The glycoside serves as a "universal group" and pairs with any other base).

2.19 Any of the above methods, wherein the restriction enzyme is a type IIS restriction enzyme that can cleave all added DNA except a single base (the base being "added").

2.20 Any of the above methods, wherein the topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.

2.21 Any of the above methods, wherein dTTP nucleotides are added using vaccinia topoisomerase (which recognizes (C / T) CCTT) and dGTP nucleotides are added using SVF topoisomerase I (which recognizes CCCTG), for example to provide Binary code information.

2.22. Any of the above methods, wherein the retention chamber further comprises a ligase and ATP to repair a DNA strand that is not connected by the topoisomerase.

2.23 Any of the above methods, including using a topoisomerase inhibitor to inhibit the binding and activity of a free topoisomerase with a DNA oligomer, for example, wherein the inhibitor is selected from the group consisting of neomycin and coumarin.

2.24 Any of the above methods, wherein the DNA strand thus provided has a sequence including a thymine (T) nucleoside and a deoxyguanosine (G) nucleoside.

2.25 Any of the above methods, wherein the topoisomerase adds a single base, and the restriction enzyme cuts at a position of one nucleotide in the 5 'direction from the base added by the topoisomerase.

2.26 Any of the above methods, wherein the DNA strand thus provided has a sequence including a "TT" and a "TG" dinucleotide sequence.

2.27 Any of the above methods, which is a method of synthesizing a DNA molecule by adding a single nucleotide in the 3 'to 5' direction, including (i) giving the DNA molecule and a load a 5 'protected form, such as a 5' phosphorylated form A topoisomerase reaction of a desired nucleotide, thereby adding the desired nucleotide in a 5 'protected form to the 5' end of the DNA, followed by (ii) by using a phosphatase to the DNA thus formed The 5 'end is deprotected, and steps (i) and (ii) are repeated until the desired nucleotide sequence is obtained.

2.28 Any of the above methods, which is a method of synthesizing a DNA molecule by adding oligomers in the 3 'to 5' direction, including (i) reacting the DNA molecule with a topoisomerase of a desired oligomer, thereby Ligating the oligomer to the DNA molecule, then (ii) using a restriction enzyme to provide a 5 'site for the topoisomerase-mediated ligation of another oligomer, and repeating steps (i) and (ii), Until the desired oligomer sequence is obtained.

2.29 Any of the above methods, which is a method according to any of the methods A and so on.

The synthetic reaction product can be tested, reviewed for quality control purposes, and read to extract data encoded on the polymer. For example, the DNA can be amplified and sequenced by conventional methods to confirm that the nanopore sequencing is robust.

In another specific embodiment, the present invention provides an oligonucleotide comprising a topoisomerase binding site, an information sequence (for example, selected from at least two different sequences, for example, wherein one sequence corresponds to "0" and The other corresponds to the "1" in the binary code, and a restriction site that will generate a topoisomerase attachment site when cleaved by a restriction enzyme, for example, including the following sequence: (SEQ ID NO 2) 5 'CGAAGGG <Informational sequence A or B> GTCGAC 3'GCTTCCC <--------- Complement ----------> CAGCTG

Wherein, the information sequence A or B is 3-12 (for example, about 8) nucleotide sequences.

In another specific embodiment, the present invention provides a topoisomerase-loaded oligonucleotide, wherein the oligonucleotide includes a topoisomerase binding site, an information sequence (for example, selected from at least two different sequences) For example, where one sequence corresponds to "0" and the other corresponds to "1" in the binary code), and a restriction site that generates a topoisomerase attachment site when cleaved by a restriction enzyme, such as The topoisomerase-loaded oligonucleotide has the following structure: (SEQ ID NO 1) 5'CGAAGGG <Informational sequence A or B> GTCGACNNNNN 3 '* TTCCC <--------- Complement ----- -----> CAGCTGNNNNN

Wherein, the information sequence A or B is a 3-12 (eg, about 8) nucleotide sequence and * is a topoisomerase covalently bound to the oligonucleotide, for example, wherein the topoisomerase is Vaccinia virus topoisomerase I.

In certain embodiments, by using a computerized chip controller, for example, controlling a nanopore wafer to perform synthesis and / or read polymer according to method 1 and the like, method A and the like, or method 2 and the like Methods.

For example, please refer to FIG. 65. For some specific embodiments of the present disclosure, the selective transparent surface of a set of 3-chamber nano-hole-based units 6500 (each unit is similar to the above) of a nano-hole memory chip is shown. Partial perspective view. In particular, a group of four 3-chamber units 6506, 6508, 6510, 6512 are connected together, thereby fluidly connecting the upper (or top) left chamber 6502 (Add "0" chamber) of each connection unit 6506-6512, To form an Add "0" flow channel or Add "0" chamber 6502. In addition, the upper (or top) right chamber 6504 (Add "1" chamber) of each connection unit 6506-6512 is also fluidly connected together to form an independent Add "1" flow channel or Add "1" chamber 6504. In addition, the Add “0” chamber (or channel) 6502 has a common electrode 6520, and the Add “1” chamber (or channel) 6504 has a different common electrode 6522. In some embodiments, there may be a single metal or conductive strip to provide the common electrode for each additional channel, and in some embodiments, there may be independent electrodes that are connected by wiring in the chip.

Below the common Add channel 6502, 6504 are separate "deprotection" chambers 6530-6536. Similar to the above, these "deprotection chambers" are fluidly and electrically isolated from other chambers. On the bottom of each deprotection chamber 6530-6536 is a corresponding individually controllable "deprotection" electrode. For example, the deprotection electrodes 6514 and 6516 visible in Figure 65 correspond to the deprotection chambers 6534 and 6536, respectively. In addition, the upper chambers of the units 6506-6512 each have corresponding nano holes 6528 through the membrane 6529. In addition, in this example, the fluid unit 6512 has a left top Add “0” chamber 6537 and a right top Add “1” chamber 6539. Although the Add "0" chamber of the fluid unit 6502-6512 is fluidly connected by the fluid channel 6502, and the Add "1" chamber of the fluid unit 6502-6512 is fluidly connected by the fluid channel 6504, each fluid unit 6506-6512 has an independent Memory storage string (eg, DNA or polymer) 6550. One end of the storage string passes through the nano hole 6550 into the Add "1" or Add "0" chamber and returns to its corresponding deprotection chamber 6530-6536. The deprotection The chamber is fluidly and electrically isolated from other chambers (in this example). Therefore, each 3-chamber fluid unit 6506-6512 represents an independent memory storage unit or memory unit (discussed in detail below).

Since the configuration of Fig. 65 has all Add "0" electrodes connected together and all Add "1" electrodes connected independently, and the deprotection electrode is controlled separately, writing (or adding) can occur at Write (or add) a "loop", for example, Add "0" loop. At this time, all cells that need to write "0" can be written at the same time, and then Add "1" loop. At this time, "1" needs to be written. All cells can be written simultaneously. If necessary, other data write cycles or methods can be used.

In addition, fluids can be filled (or rinsed, or washed or emptied) from front or back with Add "0" and Add "1" channels 6502, 6504, as shown by arrows 6503-6505, respectively, and can be filled with fluid from the side (or Rinse, or wash or empty) to the protection room 6530-6536, as shown by arrows 6540-6546. There is no requirement to fluidly and electrically connect each Add "1" chamber or fluidly and electrically to each Add "0" chamber. If a large number of rooms are connected in this way, the efficiency can be improved; in general, the more units connected, the higher the efficiency can be achieved.

In addition, by binding (or tethering or attaching) one end of the polymer 6550 to the surface of the central deprotection chamber 6536, such as shown as point 6552 in the deprotection chamber 6536, the entire polymer (or DNA) or " The "string" or storage string 6550 exits the central deprotection chamber completely. The polymer can be tethered elsewhere in the deprotection chamber 6536 as long as it meets the required functional and performance requirements. In some embodiments, structures 6554, such as beads, particles, or origami, or other structures may be attached to one end of the polymer 6550 and prevent the polymer from leaving the protection chamber 6536 through the nanopore 6550. Similar standards apply to polymer storage strings 6550 in other deprotected chambers 6530-6534.

The polymer 6550 used to store the data may be DNA described herein, or it may be any other polymer or other material having the properties described herein. The polymer 6550 used to store data may also be referred to herein as a "storage polymer" or "storage string" (due to its string-like appearance).

Please refer to FIG. 66, a partial perspective view showing a selective transparent surface of a set of 3 chamber nano-hole-based units 6600 (each unit is similar to the above) of a nano-hole memory chip for some specific embodiments of the present disclosure. . In particular, similar to Fig. 65, a group of four 3-chamber units 6606, 6608, 6610, 6612 are connected together, thereby connecting the upper (or top) left chamber 6602 (Add "0") of each connection unit 6606-6612. The fluids are connected together to form an Add "0" flow channel 6602. In addition, the upper (or top) right chamber 6604 (Add "1" chamber) of each connection unit 6606-6612 is also fluidly connected together to form an independent Add "1" flow channel 6604. However, in this specific embodiment, the Add "0" chamber associated with cell 6606-6612 has independent electrodes 6620-6626, and the Add "1" chamber associated with cell 6606-6612 also has independent electrodes 6630- 6636. This fluid and electrode arrangement is similar to that described and shown above with reference to Figure 27. In some embodiments, the upper chambers (Add "0" and Add "1") can be fluidly separated or isolated from each other to avoid potential electrical crosstalk between adjacent Add chambers when trying to control the path of DNA. .

In addition, for Fig. 65, even if the electrodes are independently controlled, the deprotection chamber can be fluidly connected. In this case, there may be crosstalk between the channels, for example, nearby DNA is attracted by the electric field and / or current seen by neighboring cells.

In some embodiments, the electrode may have a three-dimensional shape, such as a triangle or a cone, rising from the bottom of the cell or protruding downward into the cell. In this case, the electrodes can be configured to generate an electric field that is more targeted, concentrated, or closer to the nanopores of the cell, thereby reducing crosstalk between adjacent cells that are fluidly connected but electrically separated.

If the storage string (or DNA or polymer) is too long, it may be entangled from one addition chamber through the top of another. To avoid this problem, part of the wall is arranged between adjacent cells along the flow channel so that the distance between adjacent nanopores is longer for long DNA.

Below this Add chamber is a common "deprotection" chamber 6640, which is common to all upper ADD chambers, similar to that described above. On the bottom of the common deprotection chamber 6540 is a common deprotection electrode 6642. In addition, the upper chambers of the units 6606-6612 may each have a nano-hole 6528 through the membrane 6529, similar to that described above.

In addition, the protection chamber 6540 can be filled with fluid from the side (depending on the structural configuration of the unit). In some embodiments, the deprotection chamber can be filled from the left (or right), as shown by arrow 6650. In other embodiments, the deprotection chamber can be filled from the front (or rear) side, as shown by arrow 6652.

In addition, by binding (or tethering) one end of the polymer 6550 to the surface of the central deprotection chamber 6650, such as point 6652 shown as unit 6612, the entire DNA or polymer "string" (or storage string) 6550 can be prevented Exit the center completely to the protection room. A similar configuration applies to other units 6606-6610. The polymer can be tethered elsewhere, as long as it meets the required functional and performance requirements.

Please refer to FIG. 67, which shows a schematic circuit block diagram of a nano-hole-based “memory chip” 6700 for a specific embodiment of the present disclosure. In particular, the memory chip 6700 may have a plurality of nano-hole-based "memory units" 6702 (or "storage units" or "data storage units"), each of which has the ability to store data. Each "memory cell" 6702 has a multi-chamber nanopore-based fluid cell 6704 having a cell structure similar to that described above (e.g., having a membrane including nanopores and a "storage string" 6550 (e.g., DNA Or other polymers, as described herein)). The "memory unit" 6702 may also include any solid-state or semiconductor passive or active circuits or wafer layers or components that interface with the fluid unit 6704 to provide the data storage (or write or addition) and / or data described herein Search (or read or sequence) functions.

Memory units 6702 can be connected together (electrically and fluidly), such as a 3-chamber unit with a common fluid "Add" channel, a common "Add" electrode, and a separate "deprotection" chamber, see, for example, Figure 65 Shown and described. If desired, any number of chambers and any unit configurations described herein can be used.

The "memory cell" 6702 can be configured as an MxN array with M rows and N columns, and each cell 6702 is labeled as C _{M, N.} More specifically, cells 6702 in the first row are labeled C _1,1 -C _{1, N} and cells 6702 in the last row are labeled C _{M, 1} -C _{M, N.} M and N can be any value that provides the required function and performance, and M and N can be as small as 1 and as large as 1 million, 10 million, 100 million, 1 billion, or 1 trillion, or more, It depends on the required footprint size of the memory chip and the size of each memory cell.

The memory chip 6700 has an Add "0" input DC voltage on the line 6710, which is electrically connected to each of the Add "0" electrodes (directly or through on-chip circuits or components, as described herein). The Add "0" input DC voltage on line 6710 drives the Add "0" electrode to the desired voltage state (as described herein) to help locate (or move or guide) the storage string 6550 (DNA or other aggregates) (As described herein) to the desired chamber of the fluid unit 6704. In this configuration, all Add “0” electrodes of each memory cell are common or common, or electrically connected, as shown in FIG. 65.

The memory chip 6700 also has an Add "1" input DC voltage on the line 6712, which is electrically connected to each of the Add "1" electrodes (directly or through on-chip circuits or components, as described herein). The Add "1" input DC voltage on line 6710 drives the Add "1" electrode to the desired voltage state (as described herein) to help locate (or move or guide) the storage string 6550 (DNA or other aggregates) (As described herein) to the desired chamber of the fluid unit 6704. In this configuration, all the Add "1" electrodes 6522 of each of the memory cells are common or common, as shown in FIG. 65.

The memory chip 6700 also has "deprotected" input DC voltages on multiple lines (or buses) 6714, which are electrically connected to the corresponding "deprotected" electrodes in each unit 6702 (directly or through on-chip circuits or components) , As described in this article). This deprotected input DC voltage drives the corresponding deprotected electrode of a given cell to a desired voltage state (as described herein) to help locate (or move or control) a storage string 6550 (DNA or other polymer, as described herein) As described) to the desired chamber of the fluid unit 6704. In this configuration, each of the deprotected electrodes is driven independently, as shown in FIG. 65, so multiple electrical connections or buses (or deprotected buses) 6714 are required. Each row of memory cells 6702 will be provided with a corresponding number of deprotected input DC voltage lines. For example, the first row has a set of N deprotection lines 6716 for the N cells 6702 in the row, and the last row M has an independent set of N deprotection lines 6718 for the N cells 6702 in the row M.

The DC input voltages Add "0", Add "1" on line 6710, 6712, 6714 and deprotection may be referred to herein as the DC "boot" voltage V _ST (or polymer or DNA boot voltage or storage string Pilot voltage) as they are used to "guide" the polymer storage string to the appropriate compartment of fluid cell 6704 at the appropriate time to obtain the desired result, such as writing or adding "0" or " 1 ", or idle, or move the storage string to a specific room to support writing or reading data, or performing verification tests, etc. DC input voltages Add "0", Add "1" and deprotection on line 6710, 6712, 6714 can be provided from computer-based controller circuits or logic or devices, respectively, as described herein, with suitable logic to Perform the functions described in this article.

The memory chip 6700 also has AC input voltage Vin and AC output voltage Vout on lines 6720 and 6722, respectively. As described herein, the AC input voltage Vin on line 6720 is electrically connected to each memory cell 6702 in parallel. The AC Vin provides AC signals, such as rf or radio frequency signals, to each memory unit 6702 through a line 6720, and the memory units are configured as resonators or nano-hole polymer resonators (NPR). AC Vin has a different frequency response, as described in this article. Unlike shown in Figure 67, the line 6720 can connect the electronic components, electrodes on the memory unit 6702 and / or the chip, and the fluid unit 6704 therein, depending on the type used in the nanopore polymer resonator (NPR). Circuit configuration, fluid cell configuration, electrode configuration, or other factors, as described herein. The AC input voltage Vin on line 6720 may be provided from a computer-based controller circuit or logic or device, as described herein, which has the appropriate logic to provide the appropriate AC input voltage Vin and perform the functions described herein .

The combined frequency response from each memory unit 6702 can be provided to an on-chip amplifier (or preamplifier) 5320 (Figure 53), which provides an AC input voltage Vout on line 6722 to indicate the combined frequency response. The AC output voltage Vout on line 6722 can be provided to a computer-based processing computer or logic or device with appropriate logic, such as analog-to-digital (A / D) conversion and digital signal processing (DSP) logic , As described herein, to read data stored on storage string 6550 and perform other functions as described herein.

Please refer to FIG. 68. According to a specific embodiment of the present disclosure, a top layer of a read / write memory storage system 6800 having a nano-hole-based memory chip 6700 (FIG. 67) and a memory read / write controller 6802 is shown. Hardware block diagram. In particular, the memory read / write controller 6802 may have a write controller logic 6804 that receives input data to be written to the memory chip 6700 via a line and receives an address (or tag or Pointer or the like), and provide the DC boot voltages Add "0", Add "1", and deprotection to the nano hole memory chip 6700 through the lines 6710, 6712, and 6714, respectively. Write controller 6804 has the appropriate hardware, software, and firmware (including any microprocessor or microcomputer-based processor chip or device and / or memory storage) required to provide the functions described in this document, as shown in block 6810. Show.

In addition, the write controller 6804 can also provide a write (or add) loop clock 6812 (or oscillator) that determines when the memory chip 6700 writes (or adds or stores) a "0" or "1" bit. In particular, the write controller chip 6804 provides the DC boot voltage (Add "0", Add "1", deprotection) based on the write cycle clock 6812, so that the memory chip 6700 writes "1" or "0". As described above with reference to Figure 65, in a specific unit configuration, for example, when all Add "0" electrodes are connected together and independently, all Add "1" electrodes are connected together, and the deprotection electrode is controlled separately (For example, in Figure 65), the writing (or adding) of data bits can occur in the writing (or adding) "loop", such as Add "0" loop, at which time all cells that need to write "0" Can be written at the same time, and then add "1" cycle, at this time, all cells that need to write "1" can be written at the same time. The write cycle clock provides a write cycle signal on line 6814, so that the write request device or platform or computer bus can determine the write status of the memory chip. If needed, other data write cycles, timings, or methods can be used.

In some embodiments, the write controller 6802 can also receive control signals, such as a write request (W-REQ) signal, from the system or computer via a line 6820 to request specific data to be written to the memory chip 6700, and The write controller 6802 can also provide a write (or add) completion (W-COM) signal through the line 6822 to indicate when the requested data has been written to the memory chip 6700.

The memory read / write controller 6802 may also have a memory read controller logic 6850 that can receive a read address (or tag or pointer) corresponding to the storage location of the data that is to be read from the memory chip 6700 via a line 6852. Or the like), and the requested data read from the memory chip 6700 is provided through the line 6854. The read controller 6850 may also have the necessary logic and components to provide the AC input voltage signal Vin to the memory chip 6700 through the line 6720. As described herein, the AC input voltage Vin is an AC rf (radio frequency) signal, which has a frequency component corresponding to the bandwidth of a nano hole resonator (NPR) in the memory chip 6700. To provide the Vin signal, the read controller 6850 may have a frequency oscillator logic 6858 (programmable or non-programmable), which provides the necessary frequency components (as described herein) to enable the read controller logic to operate from nanometers. The hole memory chip 6700 reads the requested data. As described herein, the AC Vin signal can be directly synthesized, combining multiple probe frequencies, and can be a single broadband signal, or a time sweep or step frequency signal, or any other AC that provides the functionality described herein signal.

The read controller 6850 also receives the output AC Vout voltage from the memory chip 6700 through the line 6722, and performs A / D conversion and digital signal processing on the Vout signal (for example, by using the on-board A / D conversion logic 6862 and FFT Logic 6864), as described herein, determines the value of the required data at a particular read address and provides output data through a read data output line 6854.

The read controller 6850 has the appropriate hardware, software, and firmware (including any microprocessor or microcomputer-based processor chip or device and / or memory storage) required to provide the functions described herein, as shown in block 6856. Show.

In addition, the read controller 6850 can also receive the write (or add) cycle clock signal from the write cycle clock 6812 (or oscillator) via line 6814. As described above, it determines when the memory chip 6700 will write ( Or add or store) "0" or "1" bit. In particular, the controller chip 6804 will provide a DC boot voltage (Add "0", Add "1", deprotection) based on the write cycle clock 6812, so that the memory chip 6700 writes "1" or "0" to the memory cell. ". Since the action of writing by this disclosure requires DNA (or polymer or storage string) to pass through the nanopore to enter the required chamber to add bits, and also passes through the nanopore when returning to the protection chamber, the write cycle clock signal also It can be used by the read controller 6850 to determine when it is the best time to read the data, which is discussed in detail below with reference to FIG. 69.

In some embodiments, the read controller may provide a read signal 6860 to the write controller 6804 to request the controller 6804 to provide the necessary pilot voltage (Add "0", Add "1", Deblock) via lines 6710-6714. ), So that the storage string passes through the nano hole to realize reading of the storage string.

In some specific embodiments, the read controller 6850 can also receive a read request (RD-REQ) signal through line 6870 to request specific data from the memory chip 6700, and the read controller 6850 can also provide read completion through line 6822 (RD-COM) signal to indicate when the requested data has been read from the memory chip 6700. If desired, the memory controller 6802 can perform only one function, such as reading or writing to a nano-hole chip, or it can perform both functions (read and write) if needed.

Please refer to Figure 68A. The nano-hole memory system 6800 can be part of a larger computer system. It can interact with the address / data / control bus 6870 and can also interact with an independent memory controller 6876. All of these are Interact with one or more CPUs / processors 6874. For example, one or more of the read / write address and / or data input, output, and / or control line, such as the component symbols 6820, 6822, 6808, 6814, 6852, 6854, 6872, 6870 shown in Figure 68 It can be received from or provided to the sink 6872 or the memory controller 6876. Computer system 8670 can interact with user 6878 and display 6880.

Please refer to FIG. 69, which shows a table 6900 of the sampled DC boot voltage (V _ST ) for the configuration shown in FIG. 65 and the corresponding time chart 6902 of the boot voltage V _ST according to a specific embodiment of the present disclosure and the memory Related results on bulk wafer 6700. In particular, Table 6900 shows the DC pilot voltage V _ST (for example, Add “0”, Add “1”, deprotection, or V _ST0 , V _ST1 , V _STDB ) to be provided to the corresponding electrodes of the memory cell 6904. Based on the write cycle timing, the memory chip 6700 writes "1" or "0" to the memory unit, such as the Add "0" cycle. At this time, all units that need to write "0" can be written at the same time. Then add "1" loop, at this time, all cells that need to write "1" can be written at the same time.

Referring to FIGS. 69 and 65, the sampling pilot voltage for Add “1” cycle is displayed in column 6906 (FIG. 69), and the pilot voltage for Add “0” is displayed in column 6908. More specifically, during the Add "1" cycle, it is desired to pass the storage string (DNA or polymer) 6550 through the nanopore 6528 to the Add "1" chamber 6539 of the fluid unit 6512 (Fig. 65). To this end, the Add "1" electrode voltage V _{ST1 can} be ground (GND) or 0 volts, the Add "0" electrode voltage V _{ST0 can} be a negative voltage (relative to the Add "1" voltage), and the deprotection electrode voltage V _STDB is Negative voltage (as opposed to Add "1" voltage) until the "1" bit is written (or added) to the string 6550. After writing the "1" bit, by changing the deprotection voltage to a positive voltage (relative to the Add "1" voltage and the Add "0" voltage) (if the storage string has a net negative charge, such as DNA, this will attract This storage string) can pull the string 6550 back into the deprotection chamber 6536 (prepare for the next write instruction).

The time chart 6902 shows the values of the pilot voltages for the write cycles of Add "1" and Add "0". In this case, for FIG. 6910, for the Add “1” cycle, it is shown that the voltage value of “Add 1” is maintained at a constant value of GND (0 volts) throughout the Add “1” cycle, and FIG. 6912 shows Add “0” The value of the voltage is maintained at a constant value of negative voltage (eg, -1.0 volts) throughout the Add "1" cycle. Figure 6914 for the "deprotected" voltage shows a square wave with two parts 6916 and 6920, which starts at a negative voltage value (as described above), releases the storage string from the deprotection chamber 6536 (Figure 65) and allows the storage string One end of 6550 passes from the protection chamber 6536 through the nano hole 6528 to the Add "1" chamber 6539. The Add "1" bit reaction occurs as shown in Figure 6914. For the writing of the "1" bit, the "1" bit is written by " W1 ". The first part of the graphic segment 6918 (labeled "T1") is the time required for the storage string (DNA or polymer) to pass through the nanopore 6528 into the Add "1" chamber 6539. Thereafter, during time "W1", An "addition" chemical reaction occurs. The amount of time W1 should be set long enough to complete the "1" bit addition reaction, which may have a reaction time of, for example, about .01-100 Hz or about 10 seconds to 100 milliseconds. If desired, other addition reaction times can be used for the addition reaction, depending on the chemistry used, as described herein.

Next, in the deprotection time graphic segment 6920, the deprotection voltage becomes positive relative to the Add "1" voltage, which pulls the storage string 6550 back through the nano hole 6528 to the deprotection chamber, and then keeps it held period (Hold time, T _H1) long enough to allow the deprotection reaction, as described herein (and similar Add reaction time). The time "T2" indicated by the component symbol 6922 is the time required for the storage string 6550 to pass through the nano hole 6528. In 1920 the remaining time (holding time, T _H1) in this part of the cycle, the string is held in the deprotection chamber, waiting for a write request. Therefore, with the exception of the deprotection reaction, no activity (NA) occurs on the string during this hold time.

The write cycle is then repeated, this time for the Add "0" cycle, column 6908. Referring to FIGS. 69 and 65, column 6908 shows the sampling pilot voltage for the Add “0” cycle. More specifically, during the Add "0" cycle, it is desired to pass the storage string (DNA or polymer) 6550 through the nanopore 6528 to the Add "0" chamber 6537 of the fluid unit 6512 (Fig. 65). To this end, the Add "0" electrode voltage V _{ST0 can} be implemented as ground (GND) or 0 volts, the Add "1" electrode voltage V _{ST1 is} at a negative voltage (relative to the Add "0" voltage), and the Deblock (deprotect) electrode The voltage V _{STDB is} at a negative voltage (relative to the Add "0" voltage) until the "0" bit is written (or added) to the string 6550. After writing the "0" bit, by changing the deprotection voltage to a positive voltage (relative to the Add "1" voltage and the Add "0" voltage) (if the storage string has a net negative charge, such as DNA, this will attract This storage string) can pull the string 6550 back into the deprotection chamber 6536 (prepare for the next write instruction).

Similarly, for the Add "0" cycle, Figure 6912 for the Add "0" cycle shows that the Add "0" voltage value is maintained at a constant value of GND (0 volts) throughout the Add "0" cycle, and Figure 6910 shows that Add The value of the "0" voltage is maintained at a constant value of negative voltage (eg, -1.0 volts) throughout the Add "0" cycle. Figure 6914 of the "deprotected" voltage for the Add "0" cycle shows a square wave with two parts 6926 and 6930, which starts at a negative voltage value (as described above) and is released from the deprotection chamber 6536 (picture 65) Store the string and allow one end of the storage string 6550 to go from the protection chamber 6536 through the nano hole 6528 to the Add "0" chamber 6537. The Add "0" bit reaction occurs as shown in Figure 6914. For the write bit "0" "Also marked by" W0 ". The first part of the graphic segment 6924 (labeled "T3") is the time required for the storage string (DNA or polymer) to pass through the nanopore 6528 into the Add "0" chamber 6537, and thereafter, during time "W0" The "Add" bit "0" chemical reaction occurs. The amount of time W0 should be set long enough to complete the addition reaction, which may have a reaction time of, for example, about 10-100 Hz or about 10 seconds to 100 milliseconds. If desired, other addition reaction times can be used for the addition, depending on the chemistry used, as described herein.

Then, in the deprotection time graphic segment 6930, the deprotection voltage becomes positive relative to the Add "0" voltage, which pulls the storage string 6550 back through the nano hole 6528 to the deprotection chamber 6536, and then keeps it The time period T _{H2 is} kept sufficient, which is long enough for the deprotection reaction to occur, as described herein (similar to the Add reaction time). The time "T4" indicated by the element symbol 6928 is the time required for the storage string 6550 to pass through the nano hole 6528 and re-enter the protection room. During the remaining time (hold time, _TH2 ) in this part of the write cycle 1930, the string is held in the deprotection chamber, waiting for the next write request. Therefore, with the exception of the deprotection reaction, no activity (NA) occurs on the string during this hold time.

Therefore, for the specific embodiment, the deprotection voltage can be controlled to write "1" or "0", release the storage string into the corresponding Add chamber, and remove the storage string from the chamber after writing and place it in the deprotection chamber. Keep the string. Therefore, if a given write cycle or part of it is needed, by adjusting the "hold" time during the cycle, the deprotection voltage can create an inactive (NA) state or an idle state. By adjusting the write time W1, W0 during the cycle, it is also possible to determine when the write (or add) time starts and ends. In addition, depending on the transit time T1-T4 used for the storage string to completely pass through the nanohole, it may be necessary to adjust the write time W1 (Add "1"), W0 (Add "0") to ensure sufficient time in the Add room Perform the required write (or add) response in. Accordingly, the read / write controller 6802 (FIG. 68) discussed above may have logic for measuring and adjusting these states in real time for any configuration and specific embodiment of the fluid, electrode, or other configurations described herein. In addition, the transit time will depend on the number of bases, the more bases, the longer the time. For example, for 100K bases, passing through a nanopore at a rate of 1 million bases per second (a typical average speed of DNA passing through a nanopore) would take about 100 milliseconds to pass through the nanopore. There may also be a delay in entering the hole, for example about 100 milliseconds, although other values can be used.

In addition, during the transit time T1-T4 shown on the graph 6914, the read / write controller 6802 can read (or sequence) through the nanometer while the storage string (or DNA or polymer) is passing through the nanometer hole. The value of the bit of Mikong is as described herein. Therefore, for each write cycle (Add "1" cycle or Add "0" cycle), there are two time periods T1, T2 or T3, T4 respectively. At this time, the system can read the data stored on the storage string . Continuous reading of data can be used to verify the data, provide multiple data reads, flag errors in the data, and for other reasons.

Regarding the self-memory string reading data disclosed in this disclosure, there are many possible methods and factors to consider, including timing (e.g., time and frequency of reading), fluids and electrodes, and other related configurations (e.g., how to provide guidance signals to perform Reading), and other factors, which can be determined based on the disclosure, design, function, and performance requirements of the overall memory system.

In some embodiments, the storage string (or DNA or polymer) can only be read when no writing has occurred and the Add chamber has been flushed and the chemical "Add" function (eg, adding enzymes, etc.) has been removed. In this case, the read controller can be used to guide the storage string in and out of the desired nanohole, and the information is stored by the read controller for later use. In this case, the read controller can communicate with another memory storage device to keep the retrieved data for later use.

The transit time (T1, T2, T3, T4) of the storage string (or DNA or polymer) through the nanopore (in or out of the Add chamber) can be changed based on the length of the storage string (bits on the string The more it takes, the longer it takes) and the speed of string transfer through the nanopore (the slower the string passes through the nanopore, the longer it takes). The transfer speed can vary based on several factors, including the angle of the string approaching the nanopore, the geometry of the nanopore (cone, cylinder, etc.), the diameter of the nanohole compared to the diameter of the string (which can vary along its length), and the string The amount of entanglement, wrapping, or coiling in the medium, how the speed varies along the length of the string, hydrodynamic effects, friction / attraction / combination with the walls of the chamber, viscous effects, sound waves in the fluid, and other factors.

Without accurate knowledge of the speed, the system may not be able to accurately determine the number of bits in a word with a long list of identical bit states, such as 000000 or 1111111. However, the system and method of the present disclosure can determine or correct the speed by writing predetermined "speed correction sequence" data on the storage string (or DNA or polymer) of the unit, such as alternating 1's and 0's (also (That is, 101010101010), and place it in stored data on a string in a known or determinable location, such as near the beginning of the string or after writing a certain number of words, or after detecting a special attribute such as The extra large "special" bits are described in detail below. When the system reads this alternating "1010" pattern, it can determine the speed of the string because it knows the pattern. If necessary, this speed correction sequence can be placed at multiple positions along the storage string to implement multiple speed corrections.

In some embodiments, if there is a "baseline resolution" between bits (that is, if the bit signal returns to the baseline value before the next bit), then the speed may not be necessary to correct. However, with nanopores that are equal to or longer than the bit, baseline resolution is not expected. In this case, the system will read several bits simultaneously and evaluate how it changes over time, for example, for the sequence 1101110, from 110011 to 100111 to 001110, and so on. To effectively explain this scenario, as many unit time measurements as possible are needed. In addition, the system can perform multiple reads of the same DNA to at least some of the changes in the average time domain, many of which are random.

The sampling voltage value of the pilot voltage V _ST shown in FIG. 69 is for a storage string having a net (or total or average) negative charge, such as a load-electropolymer, such as DNA, or another load-electropolymer. If the storage string has a net positive charge, the value shown here will be inverted. Based on electronic circuit components or other factors, other values can be used for the storage string (or DNA or polymer) pilot voltages shown herein, as long as the relative voltage difference is sufficient to achieve the desired result, if desired. In addition, the pilot voltage does not necessarily have a positive and negative value. It is only necessary that the relative voltage differences created by the pilot voltages cause them to create the necessary electric field forces to move the storage strings through the nanopores 6528 to the desired chamber.

Please refer to Fig. 70, which shows a series of time diagrams 7000, with a write cycle diagram 7002 and a corresponding set of bit time diagrams 7004-7012, showing how 5-bit words are filled for the corresponding five different bit patterns. In particular, the write (or add) cycle diagram shows a square wave 7002, which indicates the Add "0" cycle, the Add "1" cycle, the Add "0" cycle, and the alternate repeating write cycle in analogy. Time diagram 7004-7012 shows an example of five 5-bit binary data words 7020 (11100, 00011, 01010, 1111, 0000) on the left, and the corresponding time diagram 7004-7012 shows the use of an alternate write cycle 7002 (Add "1", Add "0") When to write each bit of 5-bit metadata word 7020 in a single cell. A cell with an "X" indicates that no data was written during the portion of the write cycle 7002. The figure also shows when each data word 7020 is fully written into the cell, as shown by arrow 7014. For data 11100, it is written in 9 cycles, data 00011 is written in 8 cycles, data 01010 is written in 5 cycles, 1111 is written in 10 cycles, and data 0000 is written in 9 cycles. Therefore, if each word is written to a given unit, the number of write cycles (or time) to write the same number of bits can be changed based on the pattern of 1 or 0 in the word. In this example, the number of write cycles varies from 5 cycles to 10 cycles (that is, from the number of bits to twice the number of bits).

However, if the cells are written (or added) in parallel, that is, each bit is assigned to a different cell and written at the same time, the maximum number of write cycles will be 2 and the minimum number will be 1, independent of the bits Arbitrary or bit pattern. Therefore, if the writing speed is important and a specific embodiment with alternating write cycles is used, it may be advantageous to format the data to be written in parallel cells instead of serially writing data words to a single cell. Therefore, for some specific embodiments, there may be a compromise between write cycle management and data storage unit format.

Please refer to FIG. 70A, which shows a flowchart 7030 of a write / V _st control logic 6804 for a read / write memory controller 6802 (FIG. 68) for writing bits according to a specific embodiment of the present disclosure. Flow / logic 7030 begins at block 7032, which checks whether the write cycle is an Add "0" cycle. If not, the flow proceeds to block 7034, which checks whether the write cycle is an Add "0" cycle. If not, the process exits. If the result of block 7034 is YES, block 7036 sets the pilot voltage V _ST to the value shown in FIG. 69, for example, V _ST1 = GND; V _ST0 = Neg (negative). Block 7038 then checks if the next bit data to be written is "1". If not, the process exits. If so, block 7040 sets V _STDB = Neg (negative) to release the storage string (or DNA or polymer) into the Add "1" chamber for a duration t = T1 + W1, as shown in Figure 69. Then, after this time has elapsed, the logic sets V _STDB = Pos (positive) to pull the storage string out of the Add room into the deprotection room, and the process exits.

If the result of block 7032 is YES, the write cycle is in an Add "0" loop, and block 7042 sets V _ST to the value shown in Figure 69, for example, V _ST1 = Neg; V _ST0 = GND. Next, block 7044 checks whether the next bit data to be written is "0". If No, the process exits. If Yes, block 7046 sets V _STDB = Neg to release the storage string (or DNA or polymer) into the Add "0" chamber for a duration t = T3 + W0, as shown in Figure 69. Then, after this time has elapsed, the logic sets V _STDB = Pos to pull the storage string out of the Add room into the deprotection room, and the process exits. The process 7030 repeats itself to find the next write cycle and responds accordingly.

Referring to FIG. 70B, a table showing the steps of writing “1” and “0” for the nanohole memory device unit configuration shown in FIG. 66. In particular, the unit has a common on the bottom of the deprotection chamber. The electrode and the addition chamber at the top have individually controllable electrodes. There are four steps in column 7082 for each type of write and corresponding controller actions are shown in column 7084 for the write controller, and corresponding results are shown in column 7076 to explain what is happening inside the wafer for a particular step.

Please refer to Figure 71. The format of the stored data can be changed based on various factors and design standards. In particular, the storage string (or DNA or polymer) 6550 can be displayed as a line 7102, on which is a series of ellipses, marking individual "bits" written (or added) to the storage string 6550 in a given memory cell . In some embodiments, bits 7104 can be written one after the other to construct a "storage word." The first example data format 7110 shows three components of the stored word 7112: an address segment 7106, a data segment 7108, and an error check segment 7110. The address segment 7106 is a mark or pointer used by the memory system to locate the required data. Unlike traditional semiconductor memory storage, where hardware address lines on computer memory buses address unique memory locations, the memory chips and systems of this disclosure require addresses (or tags) as part of the stored data and indicate the desired Where the retrieved data is located. In the example shown in Figure 71, the address and data and error checking data (such as parity, checksum, error correction code (ECC), cyclic redundancy check (CRC), or any other form of error checking And / or security information, including encrypted information) is adjacent or contiguous. In the storage word 7112, each component: the address 7106, the data 7108, and the error check 7110 are connected to each other in the storage string. Since each component has a known length (number of bits), such as address = 32 bits, data = 16 bits, error checking = 8 bits, each stored word 7112 and its components can be calculated by counting the number of bits determine.

Another example data format 7120 shows the same three components: an address segment 7106, a data segment 7108, and an error checking segment 7110. However, there are "special bits or sequences" segments S1, S2, and S3 between the segments, which are shown as the component symbols 7122, 7124, and 7126, respectively. These special bits S1, S2, and S3 can be a predetermined series of bits or codes, which indicate why the next segment, for example, 1001001001 can indicate the next address, while 10101010 can indicate the next data, and 1100110011 can indicate The next step is the error checking segment. In some embodiments, the special bit can be a different molecular bit or bit structure attached to the string, such as dumbbells, flowers, or other "large" molecular structures, which can be easily discerned as it passes through the nanopore. Instead, it may have other molecular properties to provide unique changes in capacitance or resonance other than 1-bit and 0-bit, as described above.

Another example data format 7130 only displays a data portion 7140 without an address portion, and an error checking portion 7110. In this structure, the string holds only the "data" part and no address part, and the address part can be stored in other strings, as described below. In this example, there are also special bits S1, S2, and S3, which are displayed as element symbols 7132, 7134, and 7136, respectively. Similar to Example 7120, these special bits S1, S2, and S3 can be a predetermined series of bits or codes, which indicate the separation between data segments and indicate when the error checking segment is next, or they can be different attached to the string Molecular position or structure, which can be easily identified when passing through the nanopore, as described above.

Referring to FIG. 72, a single-line memory cell 7202-7208 is shown, each having a sample storage string 7210-7216 associated with each cell. The memory system of the present disclosure is significantly different from the conventional semiconductor memory, because each memory cell of the present disclosure can store a large amount of data, rather than each unit of memory storing unit information (1 or 0). Therefore, if the conventional semiconductor memory is regarded as a two-dimensional array, the current memory system is a three-dimensional array, wherein each memory cell position in the array has a significant storage depth. This provides a wide range of options for how to store and retrieve data.

For the example shown in Figure 72, each unit can store a linear self-contained message string (storage word), similar to that described in Example 7110 in Figure 71. In this case, each stored word is stored back to back on top of the other stored words. And each unit in the row 7202-7208 duplicates this structure and repeats for multiple rows (not shown).

Referring to FIG. 73, in some specific embodiments, some units may store only address information, and some units may store only data information. In this case, each row may have a cell such as cell 1 7310, which has an address or pointer storage string 7302, and the rest of the row, such as cell 2-cell N, 7310-7316, respectively, has a corresponding data string 7304-7308. In this case, the address or pointer will have values that indicate where the data is stored on the memory chip, such as row, column, and entry, such as row 3, column 8, entry data 50 means that the data corresponding to this address resides in the 50th data block in row 3 and column 8. This effectively decouples address physical proximity data, which provides storage flexibility. In addition, each string may have one or more error checking or security sections to verify the information stored on the string. This can be repeated for each row in the array.

Referring to FIG. 74, instead of storing information contiguously (or serially) on a given storage string, data can be stored in a memory cell array in parallel. For example, when storing a storage word, it can be stored faster in a single storage action and stored on an array, similar to the way a traditional semiconductor memory array works, but because of its three-dimensional depth, it is allowed to be repeated over and over again. Each time "push" (save) another stored word onto the string. Such formats also support fast, parallel retrieval of a given stored word (once positioned). In this case, a specific unit 7402 may be allocated to store addresses / pointers, a specific unit 7204 may be allocated to store parallel data, and a specific unit 7406 may be allocated to store error checking and safety data. For example, the storage word 7210 (serial storage on a string) shown in Figure 72 can be stored as storage word 7410 as shown, which has Address 1, Data 1, and Error Check ( Error check) 1 and store it in parallel on multiple cells (1-N, N + 1 to M, and M + 1 to P). Similarly, for storage word 7412, it is stacked in parallel with storage word 7410 on the same string (underneath or on top, depending on the direction of storage on the string). In some specific embodiments, data can be stored in parallel in a two-dimensional manner, thereby creating a layered two-dimensional array that stores information. For example, multiple layers of two-dimensional image acquisition data can be stored. The dimension snapshot is stacked on top of the previous snapshot.

Bits can be binary bits, however, they are not limited to any base numbering system, as this disclosure allows a memory stick to write (or add) more than two different values, as described herein. In this case, the unit design can be adjusted accordingly. For example, for a base-4 system (eg, GCAT, for a DNA-based system), there will be 4 addition chambers and a single deprotection chamber, as described herein. This extension can be used for any base number system greater than 2, such as 3, 4, 5, 6, 7, 8, 9, 10 (decimal), or more, up to N. There are N addition rooms and 1 deprotection room. The only limitation will be that the chamber is oriented so that the storage string (or DNA or polymer) can reach all addition chambers.

The term "data" as used herein includes all forms of data, including data that can be stored in memory to represent addresses (or tags or pointers, including physical or virtual), any type of machine code (including but not Limited to object code, executable code, etc.), error checking, encryption, libraries, databases, stacks, etc. In certain examples, such as in Figures 71 to 74 (or elsewhere as the context implies), the term "data" may be displayed and illustrated as being independent of "address" or "error checking." In these cases, these terms can be used to show different forms of data for illustrative purposes only.

Wafer fluid instrument and control: Please refer to Figure 75. The nano-hole wafer 6700 (Figure 67) can interact with the read / write memory controller 6802. As described above with reference to Figure 68, the read / write memory controller The voltage (AC and DC) can be controlled to control the memory string to add bits or read bits on the memory string, which are collectively displayed by line 7504. The memory chip can also be interfaced to an instrument 7502 via a line 7506, which can provide fluid to the memory chip, such as filling the wafer with buffers, enzymes and / or polymers or DNA (or other storage strings), as described herein As described. The instrument 7502 and the memory controller 6802 can control or receive instructions from the computer system 6870. For example, as shown and shown in Figure 68A, the computer system can interact with the user 6878 and can have a display 6880. The computer system 6870 can interact with the read / write memory controller 6802 and the instrument 7502 through a computer bus 6872 (Fig. 68). Instrument 7502 has the necessary electronics, computer processing power, interfaces, memory, hardware, software, firmware, logic / state machine, database, microprocessor, communication link, display or other audio-visual user interface, printing device, and any other Input / output interfaces, including ample fluid and / or pneumatic control, supply, and measurement functions to provide functionality or achieve results described in this article.

In particular, the instrument can perform the following fluidic actions on the memory chip: by capillary action and / or micropumping, the wafer is initially filled with the necessary fluid, enzymes, reagents, DNA or the like. For the specific embodiment where Add1 and Add0 have flow channels and deprotection as isolation chambers, the deprotection chambers can be filled together first (by capillary action), and then sealed—water and buffer will travel into the addition chamber. The chambers can then be filled with their enzymes / buffers or deprotected. The chambers can be individually filled and dried and sealed with targeted additions such as inkjet. In this case, the Add chamber can be filled under vacuum to ensure that there are no air bubbles trapped in the deprotection chamber, or the deprotection chamber can be sealed with a material that allows gas but does not allow water to pass through (eg PDMS). In addition, the deprotection chamber can be filled by opening the bottom of the unit during assembly, and the bottom of the unit can be placed in the desired fluid, and the fluid will enter the deprotection chamber by capillary action.

There are various fluid designs to achieve the desired fluid filling and flushing results. For example, you can connect the Add “0” channel and the Add “1” channel to each other in a continuous serpentine (front-to-back) mode (similar to the channels together), and supply fluid through the vias from the layer above the channel. The via can be connected to the instrument via a standard fluid interface sufficient to supply the required fluid to the channel. In some specific embodiments, the Add channel may be supplied through separate vias for the common reservoir for the Add “0” channel and the common reservoir for the Add “1” channel on the layer above the channel, respectively. Any other fluid design can be used if desired. The sample size for the Add channel is: about 100 nanometers to about 10 micrometers in width, about 1 micrometer to about 50 micrometers in height, and about 100 mm (1 cm or 1 cm) in length from one side of the wafer to the other. 1000 microns). Depending on the number of channels connected in series, the serpentine channels will be multiples of this.

If required, the instrument 7502 can also be used during initialization and unit testing. For example, cell test quality control (QC) for cell initialization and nanopore quality to ensure that the expected current is observed (the current is proportional to the hole size). In addition, quality control for the presence of DNA: ensuring that the expected current (or capacitance or impedance, or the amplitude or phase shift of the resonance, as described herein) changes the properties of the DNA (or polymer, etc.) moving through the nanopore ( For example, the expected reduction in current, or the amplitude or phase shift of the resonance, as described herein). In addition, it can be used for quality control of circuit formation, similar to the quality control performed for nanopore quality.

The instrument 7502 can also be used for DNA addition, as previously described, in which DNA with origami is introduced by one of the addition chambers (or channels), and a current can be applied to the unit until an insertion is detected in the deprotection chamber. The modified DNA ends diffuse and then attach to the surface, and restriction enzymes are introduced into the addition chamber to cut the origami, which is then removed by a buffer flow.

In another specific embodiment, the present invention provides a single-stranded or double-stranded DNA molecule as described above, wherein the single-stranded or the coding sequence consists essentially of non-hybrid bases, such as adenine and cytosine (A and C), which are sequentially arranged to correspond to binary codes, for example, in a method for data storage. For example, the present invention provides DNA (DNA 1), wherein the DNA is single- or double-stranded, at least 1000 nucleotides in length, for example, 1000-1000000 nucleotides, or, for example, 5000 to 20,000 nucleosides Acid length, where the nucleotide sequence corresponds to a binary code; for example

1.1 DNA1, wherein the DNA is single-stranded.

1.2 DNA1, wherein the DNA is double-stranded.

1.3 Any of the above DNAs, wherein the nucleotide in a single strand or in a coding strand is selected from adenine, thymine and cytosine nucleotides, for example, selected from adenine and cytosine nucleotides or thymine and Cytosine nucleotides.

1.4 Any of the above-mentioned DNA, which is mainly composed of non-hybrid nucleotides, so that when it is in a single-stranded form, it does not form a significant secondary structure.

1.5 Any of the above DNAs, wherein the nucleotide is at least 95%, such as 99%, such as 100% adenine and cytosine nucleotides.

1.6 Any of the above DNA, including nucleotides or nucleotide sequences, is added to separate or interrupt the nucleotides including the binary code from time to time, such as separating the 1 and 0 or 1 and 0 groups to make it easier Read consecutive 1s or 0s.

1.7 Any of the above DNAs, wherein (a) each bit in the binary code corresponds to a single nucleotide, for example, 1 and 0 respectively correspond to A or C; or (b) each bit in the binary code corresponds to a series of more than One nucleotide, such as 2, 3, or 4 nucleotides, such as AAA or CCC.

1.8 Any of the above DNAs is crystallized.

1.9 Any of the above DNAs, with one or more buffer salts (e.g., borate buffers), antioxidants, humectants such as polyols, and chelating agents as needed, such as described in US 8283165B2 (which is incorporated herein by reference ) Together in a dry form; and / or form a matrix between the nucleic acid and the polymer, such as poly (ethylene glycol) -poly (1-lysine) (PEG-PLL) AB block copolymer; and / or complementary The nucleic acid strand or protein that binds the DNA is provided together.

1.10 Any of the above DNAs, including a recognition sequence.

1.11 Any of the above DNAs, including PCR amplified sequences.

1.12 Any of the above DNAs, including one or more correction sequences, for example, known nucleotide sequences, which can be used to correct a nanopore-based sequencing device, for example, to measure the speed or factor of the DNA passing through the nanopore. The relative influence of different nucleotides passing through the nanopore on capacitance or current.

1.13 Any of the above DNAs, including: a terminal linking group that enables it to be fixed to a surface near the nanopore in a nanopore-based device such as nanowafer 1 and the like; a spacer sequence that is long enough for the When the DNA strand is immobilized on the surface, the DNA strand is allowed to reach the nanopore; the data storage sequence, where the sequence encodes data, codons or other information; and the sequence is restricted as needed so that the DNA can be cut and placed in Retrieved after synthesis.

1.14 Any of the above-mentioned DNAs is prepared by any one of the methods 1 and the like or the method 2 and the like and the method A and the like.

In yet another embodiment, the present invention provides the use of any DNA 1 or the like in a method of storing information.

In another specific embodiment, the present invention provides the use of single-stranded DNA in a method of storing information, for example, wherein the sequence is substantially non-self-hybrid.

Nano wafers can be manufactured, for example, as shown in Figures 23 to 29. For example, in one format, each polymer chain is associated with two or four addition chamber formats, where the two addition chamber formats can be used to encode a binary code in the polymer, and the four addition chamber formats are particularly useful for Make custom DNA sequences. Each addition chamber contains independently controllable electrodes. The addition chamber contains reagents to add monomer to the polymer in the buffer. The addition chamber is separated from the retention chamber by a membrane including one or more nanopores. The retention chamber may be common to the plurality of addition chambers, and it contains a deprotection reagent and a buffering agent to prevent the addition chamber. Protective monomers or oligomers added in the deprotection. The nanowafer includes multiple sets of addition chambers to allow parallel synthesis of numerous polymers.

For example, in some embodiments, the nanohole-based memory device of the present disclosure can be fabricated on a polished single crystal silicon wafer, for example, about 200 to 400 microns thick. A silicon nitride layer having a thickness of about 200 nanometers is deposited on both sides of the silicon wafer by, for example, low pressure chemical vapor deposition (LPCVD) or other similar techniques. Next, a silicon dioxide layer, for example, about 1-5 microns thick is deposited on the top side of the single crystal silicon wafer, and then polished. Next, a thin silicon nitride layer (eg, about 5-20 nanometers) is deposited on top of the silicon dioxide layer. Next, a silicon dioxide layer (eg, about 5 microns) is deposited. A fluid “Add” channel is then created by etching through the silicon dioxide to expose the thin silicon nitride layer at the bottom of the channel. These channels will become "Add 1" and "Add 0" channels. Next, the silicon wafer is etched from the bottom to the silicon nitride. After that, a separate deprotection chamber is etched through the silicon dioxide to expose the thin silicon nitride layer. Next, by using an electron beam or other suitable technique, nanopores are created at appropriate locations in the thin silicon nitride layer. A glass wafer (approximately 300 micrometers thick) with vias filled with conductive metal to serve as lines is aligned with the initial silicon wafer and the wafers are bonded together. An extra glass wafer (approximately 300 microns thick) with vias filled with conductive metal to serve as lines is aligned and bonded to the bottom of the bond wafer. The top layer of the device is etched or drilled until the fluid channel introduces fluid inlets and outlets. Connections to the electrodes embedded inside the device (internally connected to the fluid channel and the deprotection chamber) are accessible on the top and bottom surfaces of the device. If desired, other thicknesses can be used for the upper layers as long as they provide the functions and properties described herein.

High-bandwidth and low-noise nanopore sensors and detection electronics are important to achieve single DNA base resolution. In some specific embodiments, the nano wafer is electrically linked to a Complementary Metal-Oxide Semiconductor (CMOS) wafer. Solid-state nanopores can be integrated in a CMOS platform, next to bias electrodes and custom-designed amplifier electronics, such as "Integration of solid-state nanopores in a 0.5 μm cmos foundry process" by Uddin et al., Nanotechnology (2013) 24 (15): 155501, the contents of which are incorporated herein by reference.

In another embodiment, the present disclosure provides a nanochip (Nanochip 1) for synthesizing and / or sequencing a charged polymer (eg, DNA) including at least two different monomers, the nanochip comprising At least first and second reaction chambers separated by a membrane of one or more nanopores, wherein each reaction chamber includes one or more electrodes to draw the charged polymer into the chamber, and further includes an electrolyte Media and, if necessary, reagents for adding monomers to the polymer, for example,

1.1 Nano wafer 1, wherein the nano hole has a diameter of 2 to 20 nanometers, such as 2-10 nanometers, such as 2-5 nanometers.

1.2 Any of the above nano wafers, wherein some or all of the walls of the reaction chamber of the nano wafer include a silicon material, such as silicon, silicon dioxide, silicon nitride, or a combination thereof, such as silicon nitride.

1.3 Any of the above nano wafers, wherein some or all of the walls of the reaction chamber of the nano wafer include a silicon material, such as silicon, silicon dioxide, silicon nitride, or a combination thereof, such as silicon nitride, and the Some or all of the nanopores are made by ion bombardment.

1.4 Any of the above nano wafers, wherein some or all of the nanopores are composed of a pore forming protein α-hemolysin located in a membrane such as a lipid bilayer.

1.5 Any of the above nano wafers, wherein some or all of the walls of the reaction chamber are coated to minimize interaction with the reagent, for example, coated with a polymer such as polyethylene glycol, or with a protein such as bovine serum white Protein coated.

1.6 Any of the above nano wafers, including electrolyte media.

1.7 Any of the above nano wafers, including an electrolyte medium, the electrolyte medium including a buffering agent, such as a buffering agent at pH 7-8.5, such as about pH 8, including, for example, trismethylaminomethane (Tris), a suitable acid, and optionally Chelating agents (such as ethylenediaminetetraacetic acid (EDTA)), such as TAE buffer containing a mixture of Tris base, acetic acid, and EDTA, or TBE buffer including a mixture of Tris base, boric acid, and EDTA; Includes 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCL, or, for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9@25°C.

1.8 Any of the above nano wafers, including reagents for adding monomer to the polymer.

1.9 Any of the above nano wafers can be synthesized ("written", e.g. by adding monomers or groups of monomers to the polymer in sequence) and sequenced ("read", e.g. by measuring that monomer passes through the nano Changes in current and / or inductance when the hole is present) the polymer.

1.10 Any of the above nano wafers, wherein the film including one or more nano holes includes metal surfaces on both sides, the metal surfaces separated by an insulator such as a silicon nitride film, for example, configured by photolithography The metal surface is provided with electrodes at both ends of each nanopore, for example, so that a current flowing through the nanopore can be established through the nanopore through an electrolyte medium, for example, so that the current can pull the polymer through Through the nanopore and when the polymer passes through the nanopore, the potential change on the nanopore can be measured and used to identify the monomer sequence in the polymer.

1.11 Any of the above nano wafers, including a charged polymer, which is DNA.

1.12 Any of the above nano wafers, including a charged polymer, which is single-stranded DNA (ssDNA).

1.13 Any of the above nano wafers, including a charged polymer, which is DNA including a predetermined restriction site.

1.14 Any of the above nano wafers, including a charged polymer, which is DNA, wherein the DNA is any one of the DNAs of the above DNA 1 and the like.

1.15 Any of the above nano wafers, including a charged polymer, which is DNA, wherein the DNA includes at least 95%, such as 99%, such as 100% adenine and cytosine.

1.16 Any of the above nano wafers, including a charged polymer, which is DNA, wherein the DNA includes only adenine and cytosine.

1.17 Any of the nanochips described above, including one or more ports to allow the introduction and flushing of buffers and reagents.

1.18 Any of the nano wafers described above, including a buffer solution, for example, a solution including a buffering agent at pH 7-8.5, for example, about pH 8, including, for example, trismethylaminomethane (Tris), a suitable acid, and a chelating agent as needed (Such as ethylenediaminetetraacetic acid (EDTA)), such as TAE buffer containing a mixture of Tris base, acetic acid, and EDTA, or TBE buffer including a mixture of Tris base, boric acid, and EDTA; for example, the solution includes 10mM Tris pH 8, 1 mM EDTA, 150 mM KCL, or for example 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9@25°C.

1.19 Any of the nanochips described above, which is or is capable of being lyophilized for storage and then rehydrated, for example, wherein the structure of the nanochip includes a hydratable or water-permeable polymer.

1.20 Any of the above nano wafers, which are synthesized in a dry form, for example, wherein the structure of the nano wafers includes a hydratable or permeable polymer, which is then hydrated before use, as needed, and then, once the writing process is completed, Perform lyophilization for long-term storage.

1.21 Any of the above nano wafers, wherein the charged polymer (for example, DNA) is stabilized with histone.

1.22 Any of the above nano wafers, wherein the inner surface is positively charged.

1.23 Any of the above nano chips, wherein the electrode is operatively connected to a capacitor circuit capable of providing a radio frequency pulsating DC current on the nano hole, such as a frequency of 1 MHz to 1 GHz, such as 50-200 MHz, such as About 100MHz, wherein the pulsating DC current can pull the charged polymer through the nanopore, and determine the unit by measuring the change in capacitance on the nanopore when the charged polymer passes through the nanopore. Body sequence.

1.24 Any of the above nano wafers, including a retention or deprotection chamber, which contains a reagent to deprotect the polymer, and then a monomer or oligomer is added to one of the addition chambers.

1.25 Any of the above nano wafers, including multiple pairs of addition chambers.

1.26 Any of the above nanometer wafers includes an electrical control layer, a fluid layer, and an electrical ground layer combined by wafer bonding, for example, as shown in FIG. 24.

1.27 Any of the above nano wafers, wherein the nano hole is made by drilling with FIB, TEM, wet or dry etching.

1.28 Any of the above nanometer wafers, wherein the film including the nanopore is from 1 atomic layer to 30 nanometers thick.

1.29 Any of the above nano wafers, wherein the film including the nano holes is made of SiN, BN, SiOx, graphene, a transition metal disulfide such as WS ₂ or MoS ₂ .

1.30 Any of the above nanochips, including wiring made of metal or polycrystalline silicon.

1.31 Any of the nano wafers described above, wherein the line density is increased by three-dimensional stacking, and electrical isolation is provided by dielectric deposition (for example, by PECVD, sputtering, ALD, etc.).

1.32 Any of the above nano wafers, wherein the contact to the electrode in the addition chamber is made by Deep Reactive Ion Etch (DRIE) using Through Silicon Via (TSV), for example, using cryo Or BOSCH process, or by wet silicon etching.

1.33 Any of the above nano wafers, wherein the separate voltage control for the electrodes in each addition chamber allows the electrodes in each addition chamber to be individually controlled and monitored.

1.34 Any of the nano wafers described above, wherein each polymer is associated with a first addition chamber, a second addition chamber, and a deprotection chamber.

1.35 Any of the above nano wafers, wherein one or more of the chambers have a fluid flow.

1.36. Any of the nanochips described above, wherein one or more of the chambers are fluidically isolated.

1.37 Any of the above nano wafers, wherein the deprotection chamber has a fluid flow.

1.38 Any of the above nano wafers, wherein the addition chambers have a common fluid flow.

1.39 Any of the above nanometer wafers, where the wiring between the chambers is common between chambers of a similar type (e.g., between the first addition chamber, between the second addition chamber, and between deprotection chambers) of.

1.40 Any of the above nano wafers, wherein the addition chamber has a separate voltage control and the deprotection chamber has a common electrical ground.

1.41 Any of the above nano wafers, wherein the deprotection chamber has separate voltage control, the first addition chamber has a common electrical ground and the second addition chamber has a common electrical ground.

1.42 Any of the above nano wafers, wherein the nano wafers are manufactured by wafer bonding and the chambers are pre-filled with the required reagents before bonding.

1.43. Any of the nanochips described above, wherein one or more internal surfaces are silanized.

1.44 Any of the above nano wafers, having one or more ports for introducing or removing fluid.

1.45 Any of the above nano wafers, wherein the electrode in the chamber is restricted from directly contacting the charged polymer, for example, where the electrode is located away from the nano hole so that the electrode bonded to the surface adjacent to the nano hole The charged polymer cannot be reached, or the electrode is protected by a material that will allow water or monoatomic ions (such as Na +, K +, and Cl- ions) to pass, but the polymer or Monomer or oligomer reagents cannot pass.

1.46 Any of the above nano wafers is electrically linked to a complementary metal oxide semiconductor (CMOS) wafer.

1.47 Any of the above nano wafers, operatively linked to a wafer controller, as previously described.

For example, in a specific embodiment, the present invention provides a nanowafer, such as any of the wafers based on nanowafer 1 and the like, to sequence a charged polymer (eg, DNA) including at least two different monomers, the Nano wafers include at least first and second reaction chambers that include an electrolyte medium and are separated by a membrane including one or more nanopores, wherein each reaction chamber includes at least one disposed on opposite sides of the membrane. A counter electrode, wherein the electrode is operatively connected to a capacitor circuit capable of providing a radio frequency pulsating DC current on the nanopore, for example, at a frequency of 1 MHz to 1 GHz, for example, 50-200 MHz, for example, about 100 MHz For example, wherein the pulsating DC current can pull the charged polymer through the nanopore, and the capacitance can be determined by measuring the change in capacitance on the nanopore when the charged polymer passes through the nanopore. Monomer sequence.

In another specific embodiment, the present invention provides a method for reading a monomer sequence of a charged polymer (eg, DNA) molecule including at least two different types of monomers, including applying a RF pulsed DC current to a nanopore. For example, at a frequency of 1 MHz to 1 GHz, such as 50-200 MHz, such as about 100 MHz, wherein the pulsating DC current draws the charged polymer through the nanopore, and by passing the charged polymer through the nanopore The capacitance change on the nanopore is measured at times to read the monomer sequence. For example, the circuit is a resonant circuit and the capacitance change is detected by detecting a change in the resonance frequency.

For example, in a specific embodiment, the present invention provides a device 1 (device 1) based on nanopores, such as a nanochip, for example, any one of the chips based on the nanochip 1 and the like, which can be read on The data stored in the polymer, the device includes: a. A resonator having an inductor and a unit having a nano hole and a polymer that can pass through the nano hole, the resonator having AC at the probe frequency Output voltage frequency response in response to an AC input voltage at the probe frequency; b. An AC input voltage source configured to provide an AC input voltage at least the probe frequency; and c. A monitoring device configured to monitor at least the The AC output voltage at the probe frequency, and the AC output voltage at the probe frequency indicates the data stored in the polymer during monitoring.

For example, in some specific embodiments of the device 1, the polymer includes at least two monomers having different properties, thereby causing different resonance frequency responses at the probe frequency, and the responses indicate at least two different Data bits, for example, two different DNA nucleotides or oligonucleotides; and / or the inductor is connected in series with an effective capacitor to create the resonator, the combination of the inductor and the effective capacitor is in the probe This resonant frequency response of the frequency is correlated.

For example, in a specific embodiment, the present invention provides a method for reading data stored in a polymer (Method 3), for example, in combination with Method 1 and the like, Method A and the like, or Method 2 and the like Any of the methods, for example, using a device according to any one of the nano holes 1 and the like or the device 1 and the like, the method includes: a. Providing a resonator having an inductor and a unit having the nano hole and A polymer that can pass through the nanopore, the resonator has an AC output voltage frequency response at the probe frequency and responds to the AC input voltage at the probe frequency; b. Provides the AC input voltage with at least the probe frequency ; And c. Monitoring the AC output voltage at least at the probe frequency, the AC output voltage at the probe frequency indicating the data stored in the polymer at the time of monitoring; for example,

3.1 Method 3, wherein the polymer includes at least two different types of monomers or oligomers, which have different properties, thereby causing different resonance frequency responses.

3.2 Method 3.1, wherein the at least two types of monomers or oligomers include: at least a first monomer or oligomer having a first property, such that the first monomer or oligomer is in the nanometer Causing a first resonance frequency response when in a hole; and a second monomer or oligomer having a second property, so that the second monomer or oligomer causes a second resonance frequency response when in the nanopore .

3.3 Method 3.2, wherein the characteristic of the first frequency response at the probe frequency is different from the same characteristic of the second frequency response at the probe frequency.

3.4 Method 3.3, wherein the characteristics of the first and second frequency responses include at least one of an amplitude and a phase response.

3.5 Method 3.4, wherein the first attribute and the second attribute of the monomer include a dielectric attribute.

3.6 Any of the above methods, wherein the first and second monomers or oligomers respectively include a plurality of monomers or oligomers.

3.7 Any of the above methods, wherein the unit includes at least a top and a bottom electrode, the nanopore is disposed between the electrodes, and the unit has a fluid therein, and wherein the electrode, the nanopore, and the fluid have The effective cell capacitance that changes as the polymer passes through the nanopore.

3.8 Any of the above methods, wherein the inductor is connected in series with the effective capacitance to create the resonator, and the combination of the inductor and the effective capacitance is related to the resonance frequency response.

3.9 Any of the above methods, wherein the polymer is passed through the nanopore by a DC pilot voltage applied to the electrode.

3.10 Any of the above methods, wherein the unit has at least three chambers, at least two nanopores, and at least three electrodes to pass the polymer through the nanopores.

3.11 Any of the above methods, wherein at least two of the monomers indicate at least two different data bits.

3.12 Any of the above methods, wherein multiple cells indicate one bit of data.

3.13 Any of the above methods, wherein the polymer includes DNA, and wherein the DNA includes bases, and at least two of the bases provide a unique frequency response at the probe frequency.

3.14 Any of the above methods, wherein the probe frequency is about 1 MHz to about 1 GHz.

3.15 Any of the above methods, wherein at least two of the monomers have dielectric properties that affect the frequency response of the resonator to produce at least two different frequency responses at the probe frequency.

3.16 Any of the above methods, wherein the polymer comprises DNA and the sequence encodes a protein or biologically functional RNA, such as mRNA.

3.17 Any of the above methods, wherein the sequence encodes computer-readable data, for example, in a binary, ternary or quaternary code.

3.18 Any of the above methods, which is a method of reading or confirming the sequence of a polymer ordered according to any of the methods 1 and the like, the method A and the like or the method 2 and the like.

In another specific embodiment, the present invention provides a method for storing and reading data on a polymer in situ in a nanopore-based wafer, including: a. Providing a unit having at least three chambers, including An Add "1" chamber configured to add "1" bits to the polymer, and an Add "0" chamber configured to add "0" bits to the polymer, and a "deprotection" chamber, configured to Enabling the polymer to receive the "1" bit and the "0" bit when the polymer enters the Add "1" or Add "0" chamber respectively; b. Then guiding the polymer from the "1" and "0" positions based on a predetermined digital data pattern The "deprotection" chamber passes through the nanopore to the Add "1" or the Add "0" chamber to create the digital data pattern on the polymer; and c. Utilizes nanopores on the wafer-polymerization The resonance frequency of an object resonator (NPR) is responsive to reading the digital data stored on the polymer as the polymer passes through the nanopore, for example, using a method according to Method 3 and the like.

In another specific embodiment, the present invention provides a method and device for data storage method. A nano-chip such as a nano-chip 1 or the like is used to fabricate a charged polymer including at least two different monomers or oligomers. (E.g., DNA), wherein the monomers or oligomers are sequentially arranged to correspond to the binary code, for example, according to any of the methods 1 and / or 2 described above.

For example, in a specific embodiment, the nanowafer including the polymer so synthesized provides a data storage device because the nanowafer can be activated and the sequence of the polymer can be passed through the nanopore Detection. In other embodiments, the polymer is removed from the nanowafer, or the polymer is amplified and the amplified polymer is removed from the nanowafer, stored until needed, and then by using conventional Read by a sequencer such as a traditional nanopore sequencing device.

In another specific embodiment, the present invention provides a method for storing information, including synthesizing any of the DNA1 and the like, for example, according to any of the methods 1 and 2 or the method 2 and the like.

In another specific embodiment, the present invention provides a method for reading any of the DNAs encoded in DNA1 and the like by using a nanopore sequencer, for example, by using a nanochip 1 and the like as described herein. Binary code method.

In another specific embodiment, the present invention provides any of the above methods, wherein the nanochip is erased with an enzyme that dissolves the charged polymer, such as DNA-deoxyribonuclease (DNase).

Refer to Figures 48A and 58. As described in this article, by applying a DC pilot voltage (Vin or Vst) on the top and bottom electrodes 4818, 4820 (the DC pilot voltage creates an electric field on the nanopore 4808 and drives the negative The charged DNA 4810 leaves the negative charge and faces the positive charge), and the DNA molecule 4810 can move (or travel or shift) in the chamber fluid through the nanopore 4808 from the upper chamber 4802 to the lower chamber 4804. In particular, as described herein, when the top electrode 4818 has a positive voltage relative to the bottom electrode 4820 (shown here as ground or 0 volts), the DNA 4810 will pass through the nanopore 4808 (if it is in the lower chamber 4804) to the top electrode. 4818 moves into the upper chamber 4802. Conversely, when the top electrode 4818 has a negative voltage relative to the bottom electrode 4820, the DNA 4810 will move through the nanopore 4808 toward the bottom electrode 4818 and enter the lower chamber 4804.

Please refer to Figures 77A and 58 for a graph 7700 showing the relationship between Vin and time, where Vin is a number of DC values (for example, -V1, 0, + V1) for Vin over several time periods 7702-7710, After the “T-bias” connection described in this article with reference to Figures 58 to 61, the AC signal (or AC component or RF input) 7712 on line 5812 is “AC In / Out” (Figure 58) and DC The combination of the bias (or pilot) voltage 7714 "DC In" on line 5810, as seen at electrode 4818 (Figure 58). Vin's AC component can be a single frequency, time-varying frequency, or broadband frequency signal, as described herein with reference to Figures 55A and 55B, or a signal with any desired shape (e.g., sine, square, triangle, etc.) Any other frequency band signal to provide the desired result. When Vin's DC value is -V1 (during time period 7702 and 7710), DNA 4810 will be located in the bottom chamber 4804, and when Vin's DC value is + V1 (during time period 7706), DNA 4810 will be located Top chamber 4802. When Vin's DC value is 0V (ground) (during periods 7704, 7708), no voltage is applied to the nanopore 4808, so DNA 4810 is not driven in any particular direction, that is, the DNA will be closest to it "Float" in the liquid / fluid being driven into the chamber. In this case, DNA 4810 can move or float around the chamber based on Brownian motion, stray electricity or magnetic force, fluid force, thermodynamic force, or other forces acting locally on the DNA 4810 chain.

In addition, the time (or speed) of DNA passing through the nanopore 4808 can be adjusted or stopped at any time without affecting the AC resonance measurement or sensitivity of the present disclosure. In particular, the speed at which DNA molecules 4810 (picture 48A), 6550 (picture 65) move (or travel or cross or shift) through the nanopores 4808 (picture 48A, 58), 6528 (picture 65) The amplitude of the electric field (or voltage) that can be applied to the nanopore 4808 by the top and bottom electrodes 4818, 4820 (Figure 48A), respectively (i.e., the DC value of Vin (or the DC component or DC offset or DC) Enter)).

It is known that by controlling the DC voltage, the speed of DNA transfer through the nanopore can be slowed or stopped. For example, in Figure 77A, if the DC component of Vin is reduced from +/- V1 to a lower amplitude value of +/- V2, as shown by the dashed line 7716, the DNA will pass through the nanopore 4808 more slowly while maintaining Vin's AC component 7712 is the same as before (not shown on 7716). Such a change in the DC component voltage from V1 (7714) to V2 (7716) does not affect the resonance measurement because it is based only on the AC component 7712 of the input voltage Vin. Therefore, the speed of the DNA 4810 can be adjusted without affecting the AC resonance frequency shift measurement.

If desired, other techniques for adjusting the rate of DNA translocation through the nanopore can be used in conjunction with the measurement techniques of this disclosure, such as described by U.S. Patent Publication 2014/0099726 to Heller or U.S. Patent No. 8,961,763 to Dunbar et al., They are each incorporated herein by reference in order to understand the present disclosure.

Please refer to FIG. 78A. More specifically, it shows a top block diagram and a side view of a two-hole device or unit 7800 with a corresponding voltage source. In particular, there may be three chambers, such as an upper chamber 7802, a middle chamber 7804, and a lower chamber 7806, respectively, filled with a fluid (similar to those described herein); three corresponding electrodes, such as the upper electrode 7808, the middle electrode 7810, and the lower The electrode 7812, and the two nano-holes 7814, 7816 passing through the respective membranes 7815, 7817, are fluidly connected to three chambers 7802-7806. The middle electrode 7810 may be attached to the side of the middle chamber 7804, or may penetrate into the fluid of the middle chamber 7804 (for example, a "wet" or "bath" electrode), shown as an electrode 7809 connected by a lead 7811, and the electrode 7809 may be It is disposed adjacent to the nano holes 7814, 7816, and may come from one or more sides of the middle chamber 7804, and may partially or completely surround the diameter of the nano holes 7814, 7816.

A first DC voltage V1dc 7816 is applied to the nano hole 7814 between the chambers 7802 and 7804, and a second DC voltage V2dc 7818 is applied to the nano hole 7816 between the chambers 7806 and 7804. The DC voltages V1dc (7816) and V2dc (7818) have opposite polarities and therefore exert opposing forces on the DNA 7820, as shown by arrows 7822, 7824. The net force (and resulting velocity) is determined by the difference between V1dc and V2dc. It can be set very precisely to allow very precise control of the DNA 7820, as described in the aforementioned patent applications and patents. In addition, the input voltage can also have one or two corresponding AC components V1ac (7826), V2ac (7828), and the AC and DC components can be combined at corresponding “T-bias” connections 7830, 7832 to The corresponding electrodes 7808, 7810 provide DC-biased AC input signals. The T-type biaser connections 7830 and 7832 can also include inductors L1 and L2, respectively, which can set (or adjust) the resonant frequency of the corresponding resonator together with the total capacitance of the corresponding resonator, as described herein. In particular, there may be two resonators (or nano-hole resonators or NPRs), one NPR is associated with the upper chamber 7802, and one NPR is associated with the lower chamber 7804. In this case, two AC voltages V1ax, V2ac will be used As shown in Figures 78A and 78B. These NPRs can be set (or adjusted) to the same resonance frequency, or they can be set to different resonance frequencies, depending on the required functions and performance requirements. Alternatively, the resonators NPR1, NPR2 can be operated at different times to reduce the risk of electrical crosstalk or interference between adjacent resonators operating on the same device or unit (or electrochemical multi-chamber structure) 7800.

In some embodiments, only one nano-hole resonator (NPR) may be used, corresponding to one of the pair of chambers 7802, 7804, or 7806, 7804. In this case, the corresponding one of the AC voltages V1ac, V2ac will be used One of them and the "T-type biaser" are connected to the corresponding one of 7830 and 7832. The use of a single resonator can minimize the risk of electrical (or electromagnetic) crosstalk or interference between adjacent resonators in the same device 7800, which may be enhanced when the charged DNA string 7820 passes through the two holes 7814, 7816 Crosstalk. This type of crosstalk can be minimized or filtered out by filtering or signal processing, or it can be a common mode effect that does not affect the resonant frequency shift caused when DNA bases pass through the electrodes in the nanopore and as described herein Corresponding measurements of such offsets as described in.

Referring to FIG. 78B, an AC equivalent circuit 7850 for the AC portion of a two-hole (or two-hole) device 7800 (FIG. 78A) with two resonators is shown. In particular, the upper and middle chambers 7802, 7804 of the device 7800 (FIG. 78A) form a first nano-hole resonator NPR1 (7852), which has a coupling capacitor Ccp11, an inductor L1, and a unit or chamber variable capacitor C1 and The resistor R1, the variable capacitor C1 and the resistor R1 change as the DNA 7820 passes through the first nano hole 7814, as described above. In addition, the lower and middle chambers 7806, 7804 of the device 7800 (FIG. 78A) form a second nano-hole resonator NPR2 (7854), which has a coupling capacitance Ccpl2, an inductor L2, and a unit or room variable capacitance C2 and The resistor R2, the variable capacitor C2, and the resistor R2 change as the DNA 7820 passes through the second nano hole 7816, as described above with reference to other specific NPR embodiments. If the two resonators NPR1 and NPR2 are set to the same frequency, the values of the two inductors L1 and L2 will be set to the same value. In the case where a single resonator is used for each device or unit 7800, there will be only one of the NPR resonators 7852, 7854 in the equivalent circuit of the device.

Other dual-hole devices (or units) 7800 (via a common set of input / output lines) can be electrically connected in parallel and (by using a frequency division multiplexer) at the same time to query the frequency response, such as the dotted line 7856- As shown at 7860, similar to that described with reference to Figure 53, this operation can be performed on a single or dual resonator device or unit 7800.

Since each of these resonators operates independently, they can be adjusted to different frequencies to provide specific required measurement performance. For example, when nanopores 7814, 7816 are measuring the same DNA string 7820, the first resonator NPR1 can be adjusted to optimize the detection sensitivity of one type of DNA base (e.g., larger purines G and A) (e.g., The output amplitude or phase change is maximized for a given resonant frequency shift), and the second resonator NPR2 can be adjusted to optimize the detection sensitivity of another type of DNA base (eg, smaller pyrimidines C and T). These maximum output signal changes can be seen where the slope of the frequency response curve is the highest (closest to vertical), such as the frequency response curve for a given DNA base and a given probe measurement frequency shown in Figure 50 About halfway between the minimum and maximum values of.

In some embodiments, the resonators can be adjusted to the same resonance frequency and monitored at the same or different probe frequencies, and the second resonator is used as a second delay of the same data or its predictable variable Secondary measurements, for example for quality control or redundancy purposes or for other purposes. In particular, when the probe frequency is the same for the two resonators, the output signal data should be the same, and when the probe frequency is different, the output signal data will change (or differ) in a predictable manner, known from the first resonator The output data determines the measured second probe frequency and expected DNA base.

In some embodiments, the resonators can be tuned to the same resonant frequency and measured at different probe frequencies that are selected to optimize the detection sensitivity of a given DNA base type (e.g., maximum Output amplitude or phase change of a given resonant frequency shift). For example, the probe / measurement frequency of the first resonator NPR1 can be adjusted to optimize the detection sensitivity of one type of DNA base (eg, larger purines G and A), and the probe / measurement frequency of the second resonator NPR2 It can be adjusted to optimize the detection sensitivity of another type of DNA base (eg, smaller pyrimidines C and T). In this case, G and A may be detected using the first resonator, and C and T may be detected using the second resonator.

In the case where a single resonator is used for each device or unit 7800, only one resonance frequency is set by using the associated inductor of the unit. In this case, each DNA base can be interrogated (or monitored or measured) at multiple probe frequencies, depending on the speed of the output signal frequency detection and the speed of DNA transfer through the nanopore, and / or re-run, re-interrogate , Or "ping-pong" ability to pass DNA back and forth through the nanopore. In this limit, the full frequency response distribution of each DNA base in the string can be determined from multiple samples (for example, as shown in Figure 50).

Please refer to FIG. 79A. In some embodiments, the effective capacitance (or effective impedance) change that causes resonance shift can be measured laterally on the diameter of the nanopore, as shown by the dual-chamber lateral measurement unit 7900. In particular, the unit 7900 has upper (top) and lower (bottom) fluid chambers 7902, 7904 similar to the upper and lower chambers of the unit 4800 (Figure 48A); and a membrane 7906 separating the two chambers 7902, 7904. Membrane 7906 is made of the materials described herein and has nanopores 7908 (or nano-sized holes) that pass through the membrane 7906. The nanopores 7908 have shapes and dimensions such as those described herein to allow the chamber 7902 7904 fluid communication. Inside the unit 7900 is a polymer molecule in solution, such as a single-stranded DNA molecule 7910 (or ssDNA), such as described herein. If desired, any other molecule or polymer may be used as long as they provide properties and / or functions similar to those described herein.

The cells 7902, 7904 of the unit 7900 may be filled with a fluid, such as described herein, to allow the DNA 7910 to float and move between the cells 7902, 7904. The unit 7900 also has an upper (or top) electrode 7918 connected to a DC input voltage source V1dc 7922, and a lower (or bottom) electrode 7920 connected to the other side of the DC voltage source 7922, which in this embodiment is connected to the DC Ground connection (or GND or 0 volts).

Cell 7900 also has "transverse" electrodes 7902 (left), 7904 (right) located inside the membrane 7906, which extend along the membrane from the outer edge of the cell 7900 to the edge of the nanopore 7908, as described in detail below. The lateral electrodes 7912, 7914 may be embedded in a film 7906 having a nano hole 7908. In some embodiments, the lateral electrodes 7912, 7914 may be attached to, etched on, or otherwise disposed on the upper or lower surface of the film 7906. The electrodes 7912, 7914 may be disposed adjacent to the nano hole 7908, and may come from multiple sides or angles surrounding the nano hole 7908. In some embodiments, the electrodes 7912, 7914 may be separated from the membrane 7906, and may penetrate into the chamber fluid between the two chambers 7902, 7904 as "wet" or "bath" electrodes (not shown), and close to The nano hole inlet or outlet is set to measure the capacitance on the nano hole 7908.

The lateral electrodes 7912 and 7914 are connected to an AC input voltage source V1ac 7924. In addition, a DC voltage V1dc is applied to the top and bottom electrodes 7918, 7920 to drive or guide the movement of the DNA 7910 in the unit 7900, as described herein.

Referring to Figure 79B, the lateral measurement unit 4900 (or nanopore and DNA system) can be electrically simulated on the lateral electrodes 7912 and 7914 in the lateral direction as an equivalent circuit diagram 8000, which shows a parallel capacitor Ct connected in parallel And the lateral resistor Rt is similar to the model used to measure the electrical model vertically or longitudinally as shown in Figures 48A to 48C. In particular, the left lateral electrode 7912 sees the lateral capacitance C1 and the lateral resistance R1 to the ground set by the local environment, where the lateral capacitor Ct represents the lateral capacitance of the cell 7900, and is attributed to the properties of the two lateral electrodes 7912 and 7914 (that is, The properties of the capacitor "plate") and the dielectric material between them are determined at least by the fluid within the cell 7900 and the membrane 7906 with nanopores 7908. The resistor Rt represents the DC lateral resistance associated with the cell 7900 and is defined at least by the losses associated with the dielectric material of the above cell, which is shown as a DC leakage current between the two electrodes.

When DNA 7910 passes through nanopore 7908, the lateral capacitance and lateral resistance (or total lateral cell impedance Zt cell) of the cell change. Different DNA bases have different sizes, and therefore have different effects on the lateral capacitance Ct and the lateral resistance Rt, resulting in different lateral equivalent circuit models for each DNA base, similar to that described with reference to Figures 48A to 48C, Among them, the values of C1, R1, C2, R2, and C3, R3 will be replaced by Ct1, Rt1, Ct2, Rt2, and Ct3, Rt3, but they are equivalent in other respects, resulting in three different impedance values (Zt unit 1, Zt Unit 2, Zt unit 3).

Please refer to Figure 79C. Similar to Figures 49A and 49B, the lateral capacitance Ct and lateral resistance Rt of unit 7900 (nanopore and DNA system) can be combined with the inductor Lt to create a circuit as shown in Figure 7970 (and 49A (Similar to the figure) horizontal "inductor-cell" or "cell-inductor" RLC (or LC) resonant circuit or resonator or filter (or band stop filter, or notch filter, or band stop filter) It has a lateral resonator impedance Ztres including a lateral cell impedance Zt unit, and has an amplitude frequency response shown by a graph 4952 (FIG. 49B) and a phase frequency response shown by a graph 4954 (FIG. 49B). The center or resonant frequency fres of the lateral resonance circuit 7970 is shown in Equations 1 and 2. As described above, the values of L, C, and R are replaced by Lt, Ct, and Rt.

In some embodiments, the lateral inductor (or inductance) Lt of the lateral resonator may be a spiral inductor or other inductance configuration described herein, which provides the required resonator characteristics (other than the effective impedance of the resonator Part together) and can be located inside or on the membrane 7906, similar to that shown and described in Figures 58 and 59, or can be elsewhere in the unit or can have other configurations, such as the effectiveness of a split ring resonator The impedance part is described in detail below.

The amplitude and phase frequency response of the lateral resonance equivalent circuit 7970 (for a given value of Ct and Rt, or a given value of the Zt unit) are substantially the same as those shown in graphs 4952, 4954 in FIG. 49B and previously described. Similarly, in response to DNA (or other polymers or molecules with varying sizes along its length) passing through the nanopore and changing the measured capacitance (or impedance) to ground (for example, 0 volts), the first A set of resonance frequency response amplitude curves 5002 and phase curves 5003 of the resonance circuit (or filter) shown in Fig. 50 are also basically the same. The lateral resonance circuit configurations shown in Figures 79A to 79C are also referred to herein as lateral nanohole resonators (or lateral NPR or TNPR).

In addition, the transverse nano-hole resonator (TNPR) can also be multiplexed (or frequency division multiplexed), similar to that shown in Figure 53, where each TNPR (TNPR1-TNPR3) resonator can be connected in parallel Connected (similar to the NPR1-NPR3 resonators in Figure 53) and supplied (or connected) by a common AC voltage source. In some specific embodiments, since the AC and DC voltage sources are not combined on a common electrode and there is no “T-bias” connection, the AC input (or RF input) signal can be directly applied to the inductor. Coupling capacitor CCPL for each multiplexing resonator TNPR1-TNPR3. Accordingly, there is no lateral DC voltage (or pilot voltage) that needs to be blocked by the coupling capacitor CCPL. However, a specific resonator design embodiment may still require an equivalent coupling capacitor CCPL (even if no DC pilot voltage is blocked), as described below, for example for a specific split-loop resonator (SRR) design or an equivalent circuit may be required Other designs of equivalent coupling capacitor CCPL with resonators in series in the model.

The lateral nano-hole resonator TNPR has the longitudinal (or vertical or " Along the hole length ") nano hole resonator NPR (or vertical NPR or LNPR) is configured with the same frequency response and frequency division multiplexing (FDM) properties. In addition, any of the specific embodiments and cell designs disclosed herein can be used in the lateral resonator design (TNPR) described herein to measure or read molecular structures or data. For example, the specific embodiments shown in Figures 65 and 66 may be modified to add a lateral electrode 6590 around one or more of the nanopores 6528. In addition, the hardware and software logic, control logic, and specific embodiments shown in this article can also be used for TNPR configuration.

The longitudinal (or vertical or "length along the hole") nanohole resonator (LNPR) configuration described with reference to Figures 48A-48C and related drawings and the horizontal (referred to in Figures 79A-79C and related drawings) (Or horizontal or "through-aperture") One potential difference between nanopore resonator (TNPR) configurations is that the effective total (or average) cell capacitance value for a given cell design may be larger, at least in part, in a longitudinally configured LNPR. Because of the potentially larger surface area of the electrodes (or capacitor "plates") and / or the potentially larger spacing between the electrodes that may exist in some specific embodiments of the LNPR configuration. However, even if the average effective capacitance value is large in one configuration, when the measured molecule (for example, each NDA base or other molecular structure) passes through the nanopore, the amount of capacitance change (or impedance change) and the corresponding resonance frequency shift (Amplitude and / or phase) is basically similar between LNPR and TNPR configurations.

One advantage of using a TNPR configuration is that it separates (or decouples) the DC pilot voltage from the AC sense or measurement voltage. Therefore, there is no need for a “T-bias” connection, as there is no need to combine AC and DC voltage sources to drive the common electrode.

Please refer to FIG. 80. In some specific embodiments, the present disclosure can use two configurations of LNPR and TNPR in the same unit. More specifically, a top block diagram and a side view of a dual resonator device or unit 8000 with corresponding voltage sources are shown. In particular, the unit 7900 shown in Figure 79A can be modified as shown in Figure 80 to create a lateral resonator TNPR shown in Figures 79A to 79C and the vertical directions shown in Figures 48A to 61 The dual resonator unit 8000 of the resonator LNPR is configured.

As described in FIG. 79A herein, a lateral AC voltage V2ac 7924 is applied to the lateral electrodes 7912 and 7914. In addition, a DC pilot voltage V1dc is applied to the electrodes 7918 and 7920 to guide DNA between the two chambers 7902 and 7904, as described with reference to FIG. 79A. In addition, the input voltage may have a corresponding AC component V1ac (8002), and the "T-type biaser" connection 8004 is used to combine the AC and DC components (for example, refer to Figures 58 to 61) to provide the electrode 7918. Combined DC-biased AC input signals. The "T-type biaser" connection 8004 may also include an inductor Lv that sets (or adjusts) the resonant frequency of the vertical resonator VNPR together with the total capacitance of the vertical resonator, as described herein.

Please refer to FIG. 80A. In some embodiments, the two resonators LNPR and TNPR can be operated (or excited by the corresponding AC sources V1ac and V2ac) at different times (time multiplexing) to reduce the operating time. Risk of electrical crosstalk or interference between adjacent resonators on the same device or unit (or electrochemical multi-chamber structure) 8000, or for other reasons. In addition, the two resonators LNPR, TNPR in each unit can be set (or adjusted) to the same resonance frequency (for example, each using the same resonator inductor L) or they can be set to different resonance frequencies ( For example, each uses a different resonator inductor L value), and / or for two resonator output signals, the probe measurement frequency can be the same or different, depending on the required function and performance requirements, for example, refer to Figure 78B It is described when using two resonators. For the specific embodiment shown in Figure 80A, the output voltages from the two resonators LNTP and TNPR associated with the AC input sources V1ac and V2ac are V1out and V2out, respectively "and can be executed as shown in Figure 80A Independent online.

Referring to FIG. 80B, in some embodiments, two resonators LNPR can be operated (or driven or excited) at a single common AC source V2ac by driving all required resonators in the cell array using the same line , TNPR. In this case, the two resonators LNPR, TNPR in each unit can be set (or adjusted) to different resonance frequency bands (e.g., using different resonator inductor L values for each resonator) to avoid coming from the two Overlap and interference between the resonator frequency output signals of each resonator, because the output signals may be on the same return line V2out (as shown in Figure 80B). In addition, for similar reasons, the probe measurement frequencies for the two resonators LNPR, TNPR may also measure the two resonator output signals at different frequencies.

When two resonators LNPR, TNPR are used in a given unit, it can be obtained (or obtained or sampled) at the same time as the DNA molecule 7910 (for example, a given DNA base or monomer) passes through the nanopore 7908 Output measurement of the frequency shift or frequency response of two resonators. These two outputs can then be used as a redundancy or quality check to verify the results. In some embodiments, the two simultaneous measurement results may be combined, averaged, filtered, correlated, cross-correlated, or otherwise signal-processed to more accurately identify the monomers passing through the electrodes 7912, 7914 at a given time. type. Such correlations or processing can help remove common-mode effects or anomalous data between measurements.

In this case, read logic such as the read control logic 6850 (Figure 68) will control when the reads occur to ensure that they target the same sample window at the same time. Referring to Figure 68, for a two-chamber device or unit, as described herein, the write / Vst control logic 6804 may have only one or two DC output pilot voltage lines to control the DNA between the upper and lower chambers (rather than all Show three lines 6710-6714: Add0, Add1, deprotection). In addition, the read control logic 6856 may have multiple AC source voltage Vin lines to drive the unit (eg, V1ac, V2ac, Figure 80A), and multiple AC response measurement lines to read / measure frequency response AC from the unit The output voltage (eg, V1out, V2out, FIG. 80A) and / or various other adjustments known to those skilled in the art to adapt to the design or specific embodiments described herein. Similarly, in Figure 75, a read / write memory controller 6802 can be used to move or guide or drive DNA between chambers to read DNA (or molecules of interest or samples), and nanopore memory chips (Nano wafers) can be two-chamber wafers described herein, which can be used to read DNA (or molecules or samples), and an instrument 7502 can be used to hold samples and provide their fluids to the units described herein or Device to read DNA (or molecules of interest or samples), and those skilled in the art can make various other adjustments to Figures 68 and 75 and Figure 67 (showing an array of three-compartment units) to accommodate the Various different unit designs or specific embodiments.

Those skilled in the art should understand that the specific embodiments described herein for the lateral resonator TNPR and the dual resonators LNPR, TNPR, and the two-chamber device or unit or unit array can also be easily applied to the Three-compartment devices (eg, Add0, Add1, Deblock) and four-compartment or more-compartment devices, cells, or arrays of cells, such as shown in FIG. 65, which are shown as transverse electrodes 6590 in a three-compartment based array device.

Referring to Figures 81A and 81B, a plurality of lateral nano-hole resonators TNPR can be provided in the common unit 8100. The unit 8100 is similar to the TNPR unit 7900 described previously (Figure 79A). There are multiple lateral electrode pairs 8102-8110 on the opposite side of Mikong 8112-8120. The electrode pairs 8102-8110 can be embedded or provided on a membrane having nanopores 8112-8120, as described above in Figure 79A. The DNA molecules (or other molecules of interest) 8122 in cell 8100 can be driven (or guided) through each nanopore 8112-8120 and measured by each lateral resonator TNPR. In addition, the spacing De between the transverse electrode pairs (and corresponding ring resonators, if used) can be set sufficiently large to minimize the influence of electromagnetic interference between adjacent electrode pairs. In addition, there is a common AC input voltage Vac 8124 connected in parallel to each lateral electrode pair 8102-8110. The AC output voltage signal Vout can be processed by an amplifier A 8216, which is similar to the amplifier A 5320 described earlier with reference to Figures 53 and 67. If desired, a common AC input voltage Vac can also be provided to other cells in the array, as shown by line 8128, as previously described. In addition, there may be a DC input (or guide or drive) voltage Vdc 8134 applied to the electrodes 8130, 8132 on the top and bottom of the unit 8100, respectively, which can be used to drive DNA 8122 (or other molecules of interest) through the nanopore 8112. , 8120. If desired, a DC pilot voltage Vdc can also be provided to other cells in the array, as shown by the dashed line 8136. In some embodiments, it may be desirable to control each of the pilot voltages of each unit individually. In this case, each cell 8100 in the array has an independent Vdc pilot voltage. When the common AC input voltage Vac 8124 is used as an AC source to drive the lateral resonator TNPR in the unit 8100, each TNPR should be adjusted to a different resonance frequency band to avoid overlapping output signals, as previously described.

Referring to FIG. 81B, in some specific embodiments, the unit 8100 of FIG. 81A may be connected to have independent AC input voltages V1ac-VNac connected to each lateral electrode pair 8102-8110 of each TNPR. In this case, there may be independent AC output voltage signals Vout1-VoutN8150, which can be processed by their respective amplifiers A 8252, which are similar to the amplifier A 5320 described earlier with reference to Figures 53 and 67. If needed, independent AC input voltages V1ac-VNac can also be provided to the resonators of other units in the array, as shown by line 8154. For example, the first AC input voltage V1ac is provided to the first TNPR in each cell in the array, and they will share a common output voltage.

In addition, a DC input (or guide or drive) voltage Vdc 8134 may be applied to the top and bottom electrodes 8130, 8132 of the unit 8100, respectively, to drive the DNA 8122 (or other molecules of interest) through the nanopores 8112, 8120. If required, the DC pilot voltage Vdc can also be provided to other cells in the array, as shown by the dashed line 8156. In some embodiments, it may be desirable to control each of the pilot control voltages of each unit individually. In this case, each cell 8100 in the array will have an independent Vdc pilot voltage. When different AC input voltages Vac1-VacN 8148 are used as the AC source to drive each of the lateral resonators TNPR in the unit 8100 and have independent output signals, if necessary, each TNPR can be adjusted to the same (or overlapping frequency band) resonance Frequency (or overlapping frequency band or bandwidth). Alternatively, if desired, each TNPR can be adjusted to a different resonant frequency.

Multiple TNPRs in series as shown in Figures 81A and 81B allow multiple sequential measurements to read the same DNA or molecule, which can be used for quality control and / or redundancy if needed. In some specific embodiments, the resonance frequency of each TNPR resonator can be adjusted to a frequency that provides maximum sensitivity to the frequency shift (amplitude and / or phase) to optimize the accuracy of the measurement, while there is no overlapping frequency band (depending on the configuration when If necessary), as described previously. For example, for a DNA string, the first TNPR 8102 can be adjusted to DNA base G, TNPR 8104 can be adjusted to DNA base C, TNPR 8106 can be adjusted to DNA base A, and TNPR 8108 can be adjusted to DNA base T. As mentioned above, each resonator may be in a different frequency band that does not overlap with other TNPRs in cell 8100 and / or in other cells in the array (if connected in a cell array), depending on the configuration used (e.g., 81A and 81B).

Referring to FIG. 82A, in some specific embodiments, there are shown multiple lateral electrodes 8202-8210 (and corresponding lateral resonators TNPR) that interact with a fluid nanochannel (or nanotube) 8201 (or nanofluidic channel). ) Unit 8200. Unit 8200 is similar to unit 8100 in Figures 81A and 81B, with a DC voltage Vdc 8134 and an AC voltage Vac 8124, but the unit is modified to have fluid nano-sized channels or ducts 8201 instead of nano in the membrane. A well, DNA 8222 (or other molecule or unit) travels along the channel or pipe or flows between the upper chamber 8252 and the lower chamber 8254. In this case, the lateral electrode pairs 8202-8210 may be disposed along opposite sides of the wall of the nano-channel 8201. Please refer to FIGS. 82B and 82C, which show perspective views of specific embodiments of the nano channel 8201 having a square (or rectangular) section (FIG. 82B) and a circular (or elliptical) section (FIG. 82C), respectively. The nanochannel 8201 may have a length Lc that is longer than the length of a typical nanopore, such as a length exceeding about 50 to 100 nanometers (or greater), and a width (between sidewalls) of about 10 to 1000 nanometers. , And a height (or depth) Hc (from the top to the bottom of the side wall of the nanometer channel) of about 10 to 1000 nanometers. If desired, other sizes may be used as long as they provide the functionality and performance described herein. The width Wc of the channel can be set to at least partially linearize or elongate the DNA so that the DNA does not entangle or knot or fold itself in the fluid nano channel 8201, etc., to allow the DNA along the fluid nano. The channels flow essentially linearly, so that only one monomer at a time occupies a section of the nanochannel, such as an entropy constraint. For example, for double-stranded DNA, the width Wc of the nanochannel 8201 may be about 40 nanometers, and for single-stranded DNA, the width Wc may be about 20 nanometers. Other widths can be used if required. In some embodiments, the width Wc and the height Hc may be approximately the same size to help provide a substantially linear flow of DNA. There may be an upper fluid chamber 8252 that holds DNA (or other molecules) 8222. When a voltage Vdc is applied to the upper and lower electrodes 8240, 8242 (for example, the opposite electrode 8242 is a negative voltage at the electrode 8240) (as described above for DNA movement), one end of the DNA 8222 is pulled into the top of the nano channel 8201, It flows through each pair of electrodes 8202-8210 (here, it is read by each lateral resonator TNPR), then exits the bottom of the nano channel 8201, where it is held in the lower fluid chamber 8254.

The nanochannel 8201 may be similar to the nanochannels described in Cao et al. U.S. Patent No. 8,722,327 and Austin et al. 9,725,315, which are incorporated herein by reference for the purpose of understanding the present invention. The nanochannel 8201 can be formed by any technique that provides the functional and performance requirements described herein. In some embodiments, the nanochannels 8201 may be patterned or etched in a matrix 8250, such as fused silica or other materials that provide the functions and properties described herein. In addition, the spacing Dc between the electrodes can be set sufficiently large to avoid unacceptable electromagnetic interference between adjacent rows of the electrodes 8202-8210. In addition, electrodes 8202-8210 (and corresponding split ring resonators or lateral resonators TNPR) can be applied or photolithographically fabricated on the matrix material layer 8250. In addition, the matrix material 8250 between the rows of electrodes 8202-8210 may be made of an insulating material (or doped with a suitable dopant added to it) to radiate electromagnetic between adjacent rows of electrodes 8202-8210 Limit interference to acceptable levels or minimize such interference. In some specific embodiments, the nano channel 8201 may be one of a plurality of nano channels. Each channel 8201 has its own set of measurement electrodes 8202-8210, which are arranged in an array in the matrix 8250, for example, multiple parallel channels. aisle. In some specific embodiments, if desired, there may be an array or network of nanochannels to maintain or guide or transfer the DNA (or other molecules) measured by this disclosure. In some embodiments, the nano-channel may be a nano-sized tube having an outer diameter and an inner diameter of 8260, and DNA flows therein. In some embodiments, the channels 8201 may be a series of short nano-channels or nano-pipes arranged in series and may be separated by a predetermined interval. The channel 8201 may have any cross-sectional shape, such as a square, a rectangle, a circle, an oval, a polygon, or other shapes or any combination thereof. When used in a nano-channel, an NPR or nano-hole resonator may be referred to as a nano-channel resonator, or more commonly referred to as a "nano-path" resonator (NPR), which may be suitable for use herein Nano-holes or nano-channels or other nano-sized openings. In addition, if necessary, the unit 8200 having a nano channel 8201 can be electrically connected as shown in FIG. 81B to have independent AC input voltages V1ac-VNac and independent output voltages Vout1-VoutN.

Please refer to FIGS. 83-85. In some embodiments, a type of LC resonator design that can be used for a lateral nano-hole resonator TNPR is a split-ring resonator (or SPR) that is configured to have a Nanoholes in the gap of the split ring portion. In particular, Fig. 83 shows a partial top view of a split ring resonator 8300 layer with an AC supply line 8306 which receives the AC input voltage AC IN (or Vin, as described herein) provided by the input port 8302 and An AC output voltage is provided at output port 8304. The AC input voltage on the supply line 8306 is AC-coupled with a split ring 8308 portion or structure (also referred to herein as a "resonator" portion) of the SRR 8300 having a square shape. The AC supply line 8306 sets a predetermined coupling distance Dcpl 8316 for a predetermined coupling length Lcpl along one side of the split ring 8308 to form an AC coupling capacitor of the split ring 8308. There is a gap "g" (or opening) 8310 in the split ring, and a nano hole 8312 is located therein. When DNA (or other molecules) passes through the nanopore, it changes the capacitance on the gap g 8310 in the split ring 8306, thereby changing the resonant frequency of the split ring resonator LC circuit. The size of the split ring 8308 can be set to provide the required resonance frequency and the required electric field strength in the gap "g" 8310, as described in detail herein. In addition, the coupling length Lcpl and the coupling distance Dcpl along one side of the split ring 8308 are set to provide an appropriate amount of energy transfer between the supply line 8306 and the resonator (open ring) 8308. This can be referred to as a geometric capacitor, which will be determined by the standard parallel plate capacitor formula. In some embodiments, the supply line 8306 may couple AC voltage along more than one side of the resonator 8308, for example to ensure that sufficient AC voltage is coupled to the resonator 8308, as shown by the dotted line 8305. In this case, the output voltage AC OUT will be on port 8307.

Please refer to FIG. 84, which shows a partial top view of an alternative embodiment of the split ring resonator 8300 of FIG. 83 with a split ring (or resonator) portion 8308 having a circular shape. If desired, other shapes can be used as long as it provides the required functionality and performance.

Please refer to FIG. 85, which shows a partial front cross-sectional view taken along line 8314 of FIGS. 83 and 84, and has a split ring 8308 provided on top of the film 8324, and a nano hole 8312 is located in the film. Membrane 8324 separates the upper and lower chambers 8326 and 8328 of the fluid-filled dual-chamber unit 8330, similar to other dual-chamber units described herein, which has a unit that can be used to guide or drive DNA between the two chambers 8326, 8328 (Or other interested person) the upper electrode 8320 and the lower electrode 8322 of 8332.

Please refer to FIGS. 86 and 87. In some embodiments, the supply line 8306 may be located on a vertical plane different from the portion of the split ring 8308. In this case, the supply line 8306 may be provided above or below the split ring portion 8308 of the SRR. In particular, Fig. 86 shows the SRR of Fig. 83 with a supply line 8306 displaced above the split ring 8308. Figure 87 shows a partial front cross-sectional view along line 8602 of Figure 86, showing the vertical displacement of the supply line 8306 above the split ring 8308, which are separated by a vertical AC coupling distance Dvcpl 8604, similar to that shown in Figure 83 Lateral AC coupling distance Dcpl 8316.

Please refer to Figures 88, 89, 90, 91, and 91A. The split ring resonator SRR disclosed in this disclosure can be a square / rectangular split ring 8308 shown in Figure 88 and a modified square shown in Figure 90. / An array configuration of rectangular split ring 8308 is connected. In Figures 88 and 90, the supply line 8306 receives the AC input voltage VAC from the input port 8302, and AC couples the AC voltage along the supply line 8306 to each split ring 8308 in the array, and provides the output voltage at the output port 304 VAC. The nano hole 8312 is located in the gap g as described above. Referring to FIGS. 89 and 90, the length Lg of the gap g of the split ring 8306 can be made long enough to allow the nano-hole 8312 to be located in the gap g along the straight lines 8802 (FIG. 88) and 9002 (FIG. 90).

By forming a split ring with different geometries, the resonator 8308 can be frequency division multiplexed along a common supply line 8306, as shown in FIGS. 88 and 90, for example. In particular, different area loops shown by resonator 8308 create different resonance frequencies, similarly using different values of inductor L or capacitor C to set the resonance, as previously described. In the top row 9004 of FIG. 90, the shape varies depending on the aspect ratio, in the middle row 9006, the shape varies depending on the width (having a common height), and in the bottom row 9008, the shape varies depending on the length (having a common width). If needed, other variations can be used.

The various sizes h, w, s, g, L (and materials) of the split ring (or resonator) 8308 shown in Figures 91 and 91A can be set to provide the required resonance frequency in the gap "g" 8310 and Required electric field strength, where E is the electric field, H is the magnetic field, and k is the wave vector of the incident field, shown in the x, y, and z coordinate systems, such as "Giant Electric Field Enhancement in Split Ring Resonators Featuring Nanometer-sized" Gap ", Scientific Reports, 5: 8051, DOI: 10.1038 / srep. 08051, which is incorporated herein by reference. The resonance frequency of a split ring resonator can be determined by the size and geometry of the split ring (resonator) 8306 and the materials used, such as "Resonant Frequencies of a Split-Ring Resonator: Analytical Solutions and Numerical Simulations", Microwave and Opt by Shamonin .Tech. Letters. Vol. 44, pp. 133-136, 2005, which is incorporated herein by reference. In addition, in order to maximize the sensitivity of the resonant frequency change of the split-ring resonator caused by DNA (or other molecules) passing through the nanopore 8312 in the gap g, it is desirable to maximize the gap g 8310 in which the nanopore 8312 is located. The value of the electric field (or E-field) intensity is displayed as regions 8902 (Figure 89) and 9102 (Figure 91). The gap electric field strength can be maximized by forming the gap g as small as possible, such as 100 nanometers, as described in Bagiante, where the matrix is made of high-resistance silicon and the associated size of the gold structure is L = 20 microns, = 10 microns, s = 20 microns, and h = 60 nanometers, where significant THz electric field enhancement (eg, about 14,000) is observed at the lowest order resonances, such as at about 50 GHz. If necessary, other values can be used for the gap g as long as it provides sufficient electric field strength on the gap where the nanopore (or nanochannel) is located to provide a sufficient offset of the resonance frequency to measure through the nanopore Or nanochannel molecules.

If desired, other LC resonators can be used for this disclosure, such as microstrip, coplanar waveguide, pseudo-luminous element LC (where inductors and capacitors are made geometrically using the geometry of the chip itself, rather than using lumped Component wafer assemblies) as long as they provide the functions and performance described herein.

Please refer to Figures 92A, 92B, 92C, 92D, 92E, and 92F to show the various possible top-view geometries of the electrode near the nano-hole 8312. Referring to Figure 92G, a side view of a membrane having a nanopore 8312 is shown. In particular, FIG. 92A shows that the electrodes 9202 and 9204 are wider than the diameter of the nano-hole 8312 and the electrodes have vertical (or right-angled) sides. Figure 92B shows that the width of the electrodes 9202 and 9204 is the same as the diameter of the nano-hole 8312. Fig. 92C shows that the electrodes 9202 and 9204 are descended to the size of the nano-hole stepwise near the nano-hole and have right-angled sides. Fig. 92D shows that the electrodes 9202 and 9204 gradually decrease to the size of the nanopore near the nanopore and have right-angled sides. Figure 92E shows that the electrodes 9202 and 9204 have ends that are designed according to the nano-hole geometry rounding or the shape of the nano-holes. In Fig. 92F, the diameter of the nano-hole is reduced to the diameter of the nano-hole in a step near the nano-hole. Both the nano-hole and the electrode have right-angled sides.

Refer to Figure 92G, showing a side view of the electrodes 9202, 9204 in a film with a nano hole 8312, showing the nano hole 8312 that starts wide and narrows down to the desired nano hole diameter size described in this article Section (for example, an "X" shape or two cones that intersect at a common apex) and show the electrode near the center (the nanopore 8312 has the smallest diameter here). In some embodiments, the edges of the nanopore section can also be rounded, instead of being straight, and can follow similar outer diameters and center diameters as shown by dashed line 9212. In addition, in some embodiments, the electrode may stop before reaching the edge of the nanopore, as shown by the dashed line 9210 (Figures 92A-92G).

Please refer to FIG. 93, which shows an example of a manufacturing process for creating a wafer to implement the portions of this disclosure. In particular, in step 1, a SiN layer 9306 is formed on top of a silicon-based 9302 and a resonator layer 9304 having a thickness of Au of about 50 nm is formed by using LPCVD (low-pressure chemical vapor deposition) low-stress silicon nitride (if necessary) , Other thicknesses can be used). Next, in step 2, the 9308 resonator layer 9304 is etched to define the resonator (or split ring) geometry by using photolithography, such as wet etching of Au (gold) with KI (potassium iodide). Next, in step 3, a TEOS silicon oxide (about 150 nm) heterostructure 9312 is grown, followed by a LPCVD low-stress silicon nitride layer 9310 of about 20 nm. Next, in step 4, the backside of the opening is etched in the silicon 9302 to form a backside (or bottom) opening (or chamber) 9314 by using a standard etching technique. Next, in step 5, the front side (or top side) is etched to form a second opening (or chamber) 9316 and a nano hole 9318 is defined. Next, in step 6, a supply line contact 9320 is added to connect (or couple) the resonator to a supply line (not shown, see supply line 8306 in FIG. 83), which is located in the CMOS chip 9324 to complete the fluid The main part of the wafer / layer 9322 (top / bottom electrodes can be added later, as described below). From this point on, the supply line contact 9320 may couple the supply line with more than one portion (or side) of the resonator.

Next, in step 7, the fluid wafer / layer 9322 is flipped upside down and the wafer is bonded to the CMOS read layer wafer 9324, and then by using known standard integrated circuit manufacturing, connection, and assembly techniques with a field programmable gate array (FPGA) Printed Circuit Board (PCB) layer 9326 package. In particular, a multi-chamber fluid wafer portion 9322 is used for DNA control, and a resonator structure for impedance measurement (by resonance offset) is integrated into the fluid wafer 9322. The output of the resonator is read by a wafer bonded to the fluid wafer 9322 CMOS wafer 9324 containing an amplifier and impedance matching circuit, and then the fluid / CMOS wafer stack 9322, 9324 and FPGA read the PCB 9326 package, where: The FPGA controls signal generation and processes the data read from the resonator. The bottom electrode (not shown) may be a portion facing the CMOS wafer 9324 of the chamber 9316, and a top electrode (not shown) may be added by a top layer (not shown) bonded to the top of the silicon layer 9302 (and the fluid wafer 9222).

As described herein, the lateral electrodes of the lateral resonator TNPR described herein can have a variety of different geometries, depending on the required performance and sensitivity, and the materials and resonator design used. When used in a split ring resonator described herein, the electrode may define a portion of the split ring (resonator) 8306 near the gap g.

Please refer to Figures 94 and 95. The three rooms described in this article with Add 0 and Add 1 upper chambers 9402, 9404, and a common lower (or deprotected) chamber 9406 (for example, shown in Figures 62, 65, and 66) There may be a nano-sized fluid channel or nanochannel 9408 in the lower chamber 9406, which has a width "Wc" of about 40 nanometers to help prevent DNA tangles or knots, similar to previously referred to sections 82A, 82B And the nanochannel shown in Figure 82C. In particular, the nanochannel 9408 may have a length Lc (longer than the length of the nanopore) of at least about 10 nanometers, and a width (between the side walls) Wc of about 10 nanometers to 1000 nanometers, and about 10 nanometers to The height (or depth) Hc of 1000 nanometers from the top of the sidewall to the bottom of the nanochannel (Figure 95). If desired, other sizes may be used as long as they provide the functionality and performance described herein. The width Wc of the channel 9408 can be set to at least partially linearize or stretch the DNA so that the DNA does not entangle or knot or fold itself in the fluid nano channel 9408, etc., to allow the DNA to follow the fluid nano The channels flow linearly so that only one monomer at a time occupies a section of the nanochannel, such as an entropy constraint. For example, for double-stranded DNA, the width Wc of the nanochannel 8201 may be about 40 nm, and for single-stranded DNA, the width Wc may be about 20 nm. Other widths can be used if required. In some embodiments, the width Wc and the height Hc may be approximately the same size to help provide a substantially linear flow of DNA along the nanochannel 9408. The nanochannel 9408 may be similar to the nanochannels described in Cao et al., U.S. Patent No. 8,722,327 and Austin et al., 9,725,315, which are incorporated herein by reference in order to understand the present invention. In some specific embodiments, if desired, there may be an array or network of nanochannels to maintain or guide or transfer the DNA (or other molecules) measured by this disclosure. The nanochannel 9408 can be formed by any technique that provides the functional and performance requirements described herein, such as described with reference to Figures 82A-82C. In some embodiments, the nano-channel 9408 may be a nano-sized tube having an outer diameter and an inner diameter, and DNA flows therein. The channel 9408 may have any cross-sectional shape, such as a square, rectangle, circle, oval, polygon, or other shape or any combination thereof. DNA (or other polymer or molecule) 9408 may have beads or DNA origami or other particles or molecules attached to one end (e.g., bead 6554 shown in Figure 65) so that the portion of DNA remains underneath for common deprotection The chamber 9406 does not pass through the nano holes 9410, 9412. In some embodiments, the bead can be magnetic or charged, attracting it to the bottom electrode 9416 to ensure that DNA is pulled into the nanochannel. In Fig. 94, the vertical channel 9408 has a length Lc and a width Wc. In Figure 95, the nanochannel 9408 extends into the page and the DNA will lie flat along the bottom of the lower channel 9406. In some embodiments, the nano channel 9408 can be oriented from left to right along the bottom of the lower chamber 9406, similar to the bottom electrode 6514 shown in FIG. 65.

Any other technique can be used instead of using FFT (Fast Fourier Transform) logic 5328 (Figure 53) to measure (or monitor or determine or calculate) the frequency component of the output voltage signal, such as being set or adjusted to a suitable monitoring or probe frequency Or one or more fixed or adjustable digital or analog bandpass filters of the band of interest. Any other technique can be used to measure the desired frequency content of the frequency division multiplexed output voltage signal.

In addition, as described herein, the resonant frequency shifts (see Figures 50 to 52) of the various nanohole or nanochannel (or nanopath) resonators (NPR) described herein can be measured in a number of different ways And multiplexing, and optimizing the measurement sensitivity, each way can be applied to any of the specific embodiments and resonator and unit configurations described herein. In some specific embodiments, the probe or monitoring or measurement frequency can be set at a fixed value or dynamically adjusted or changed to have the highest slope at the probe frequency (wherein the frequency response (amplitude and / or phase)) ( That is, it has the greatest change in signal strength when the resonance frequency is shifted)) monitoring to optimize the measurement sensitivity of reading one or more DNA bases (or other molecules of interest). In addition, in some embodiments, the frequency response (or portion thereof) of a given DNA base (or monomer) can be “mapped” outward by obtaining multiple probe sample points at different frequencies, thereby targeting a given Fixed cells form a frequency response curve or frequency response "signature." To this end, multiple independent readings of the DNA molecule (i.e., re-interrogation) can be performed by the same resonator and the probe measurement frequency can be shifted for each measurement to optimize the sensitivity of the required detection monomer, or Different probe frequencies are used to measure multiple resonators in series, or multiple probe frequencies are measured simultaneously from a single resonator at a given time when a molecule passes.

In addition, this disclosure can be used in combination with nano holes, nano pipes, nano gaps, nano channels, or any other nano-sized openings (collectively referred to as "nano paths") between the two chambers, and can have any Desired side or top view geometry, such as circle, oval, square, rectangle, polygon, polygon with rounded corners, triangle, parallelogram, rhombus, star, any combination of these, or any other desired shape As long as it provides the functionality or performance described in this article, any of them can be referred to as a "nanopore" or "nanopath."

In particular, in some embodiments, the nanopore 4808 (FIG. 58) in the two-chamber device 5880 of FIG. 58 can be made by using vertical nanochannels in the film (where the film 4806 can be made thicker than typical The length of the nanopore (e.g., greater than about 50 nanometers), such as about 100-1000 nanometers (or greater), and the material etched into the film 4806 (e.g., fused silica or other materials, which provides Functions and performances, such as those described above, are created with nano-channels that provide nano-sized fluid paths (or nano-paths) between chambers 4802 and 4804. They can also be used in the three-chamber installations in Figures 62 and 63, respectively. 6200, 6300 nano holes 6203, 6205. In this case, DNA can be detected by using one or more lateral electrodes along the nanochannel as described previously with reference to Figures 82A and 82B. In some embodiments, nanopores 4808 (Figure 58) can be created by a combination of nanopores and nanochannels, for example, in the bottom of one of the horizontal nanochannels etched in film 4806 or in one of the walls. Drilling, creating, or setting nano holes depends on the orientation of the nano channel.

This disclosure can use frequencies up to or above 100 GHz, as long as the liquid or material causing the unit is not heated or damaged or damages the specific frequency or energy of the molecule being measured. In particular, it has been shown that, as previously described, e.g., in the aforementioned Laborde article, charged molecules such as DNA carrying negative charges pass through or are present in ionized solutions (e.g., fluids that can be used in the chambers described herein). The detrimental effect of the ion shielding caused by the electric field is reduced at high frequencies. Accordingly, the present disclosure can operate at frequencies as high as frequencies supported by integrated circuit technology.

In some specific embodiments, the present disclosure can be implemented by using a nano-capacitor array CMOS wafer made by NXP Semiconductors, such as the wafer described in the above-mentioned Laborde article, where the electrode pads of the NXP wafer become ( Or interface) The ground electrode of the fluidic wafer or cell 5800, for example as shown in Figure 58.

This disclosure does not require that cells be individually addressable to read data in each cell. In addition, the present disclosure allows the use of frequency division multiplexing to read data stored on the polymer located in each unit through a single source input line and a single output line.

Those skilled in the art will understand that the unit configurations and specific embodiments described herein can be applied to DNA, protein, polymer, or other molecules residing in a fluid sample presented or provided to the units described herein. Or partly for interrogation, evaluation, reading or sequencing. In this case, there may be a fluid interface that fluidly connects one or more input sample chambers or cells to the unit, thereby providing a sample to the unit fluid for interrogation, measurement, or evaluation.

All dimensions described herein are shown for the example embodiments of this disclosure, and other dimensions, geometries, layouts, and orientations can be used if desired, as long as they provide the functionality described herein.

In addition, this disclosure is not limited to being used for DNA-based data storage, and may be used for any type of molecular data storage, such as any polymer or other material having the necessary properties to achieve the functions or properties described herein.

Any automatic or semi-automatic device or component herein can be a computer control device, which has the necessary electronics, computer processing capabilities, interfaces, memory, hardware, software, firmware, logic / state machine, database, microprocessor, communication chain Circuits, displays or other audiovisual user interfaces, printing devices, and any other input / output interface, including ample fluid and pneumatic control, supply, and measurement functions to provide functionality or achieve the results described in this article. The processes or method steps described herein may be implemented in a software module (or computer program) executed on one or more general-purpose computers, unless explicitly or implicitly stated otherwise herein. Alternatively, specific operations can be performed using specially designed hardware. In addition, a computer or computer-based device described herein may include any number of computer devices capable of performing the functions described herein, including, but not limited to, a tablet computer, a notebook computer, a desktop computer, and the like.

Although illustrated herein uses example techniques, algorithms, or processes to implement the disclosure, those skilled in the art should understand that other techniques, algorithms, and processes, or other combinations of the techniques, algorithms, and processes described in this document, and Sequences to achieve the same functions and results described herein, and they are included within the scope of this disclosure.

Any process descriptions, steps, or blocks in the flowcharts provided herein indicate a possible implementation, and alternative implementations are included within the scope of the preferred embodiments of the systems and methods described herein, where the art Skilled artisans will understand that a function or step may be removed from that shown or described or performed in a different order, depending on the function in question.

It should be understood that any feature, characteristic, substitution, or modification described with respect to a particular specific embodiment herein may also be applied, used, or included in any other specific embodiment described herein unless explicitly or implicitly stated herein. . In addition, the drawings herein are not drawn to scale unless otherwise indicated.

[Example]

Example 1-One end of the fixed DNA is next to the nanopore and the regulated reciprocating movement of the DNA through the current

The experimental process was developed to show that the DNA system reciprocates between two chambers separated by nanopores under the condition that the related protein does not move between the chambers through an electric current.

A nano wafer containing two chambers is manufactured from silicon nitride. <4nm (for dsDNA or ssDNA) and 2nm as described in Briggs K, et al. Automated fabrication of 2-nm solid-state nanopores for nucleic acid analysis, Small (2014) 10 (10): 2077-86 (Only for ssDNA) Nanopores. The two chambers are referred to as the "near" chamber and the "far" chamber, and the far chamber is the 3 'end junction of the DNA.

It shows ssDNA (2nm pore) and ssDNA + dsDNA (4nm pore) instead of protein through the nanopore. The nanopore is detected by the current interruption.

Binding DNA to the surface of the pores : 5 'amine modified DNA was attached to carboxyl-coated polystyrene beads (Fluoresbrite® BB Carboxylate Microspheres 0.05 μm, available from Polysciences, Inc.) via carbodiimide-mediated attachment. 3 'of DNA is labeled with biotin. DNA is a pre-specified length.

Streptavidin junction : The junction is performed on the "distant" side of the silicon nitride nanopore, and the streptavidin is bonded to the surface, as disclosed in Arafat, A. Covalent Biofunctionalization of Silicon Nitride Surfaces. Langmuir (2007) 23 ( 11): 6233-6244.

Immobilization of DNA close to nanopores : Polystyrene beads in the buffer are added to the "near" chamber and the buffer is added to the "far" chamber (standard buffer: 10mM Tris pH 8, 1mM EDTA , 150 mM KCl). Apply voltage (~ 100mV) until current interruption is observed (using Axon Nanopatch200B patch-clamp amplifier). 50nm beads cannot pass through the nanopore, so when the DNA strand resists the nanopore end by being pressurized, the current is highly interrupted. The current was maintained for 1 to 2 minutes until DNA binding and biotin binding to telemetry irreversibly bound to the immobilized streptavidin. To confirm that the DNA has been fixed, the current is retained. Observe the different currents, whether the DNA is in or out of the well. If it shows that the DNA is unfixed, repeat the process.

Releasing beads via endonuclease: Restriction enzymes . Restriction enzymes in the middle lobe are added to the DNA-attached chamber. In a specific example, the DNA is single-stranded and contains a restriction site that can cleave an enzyme that cleaves the single-stranded DNA. See, for example, Nishigaki, K., Type II restriction endonucleases cleave single-stranded DNAs in general. Nucleic Acids Res. (1985) 13 (16): 5747-5760. In an alternative embodiment, a complementary oligonucleotide is attached to a DNA-attached chamber and allowed to hybridize for 30 minutes to produce dsDNA, and then a restriction enzyme is added. Once the beads are released, they are washed out. The current is switched between forward and reverse to confirm that DNA enters / vias and leaves the well.

Demonstrate controlled back and forth movement: Using standard buffer, apply current in the forward direction until a signal interruption is observed and then reverse to "normal" after DNA passes. Reverse current was applied until a signal interruption was observed. It was observed that when the DNA stayed in the well, the signal did not return to normal. The application of the current in the forward and reverse directions was repeated several cycles to confirm that the DNA reciprocated through the nanopore.

Example 1a: Fixing DNA strands on a silicon dioxide wafer immediately adjacent to the nanopore

The inner wall of the nano chip is made of silicon dioxide. Both sides are silylated, but the oligonucleotide attaches to only one side of the chip wall and then makes nanopores.

Silanization: The surface of the wafer wall is cooled at 30 ° C with a piranha solution (commercially available, usually containing a mixture of sulfuric acid (H ₂ SO ₄ ) and hydrogen peroxide (H ₂ O ₂ ), which is removed from the surface Organic residues) and double filtered water. (3-Aminopropyl) triethoxysilane (APTES) was prepared, and a stock solution with 50% methanol (MeOH), 47.5% APTES, 2.5% nano-pure H2O was aged at 4 ° C for> 1 hour. The APTES stock solution was then diluted 1: 500 in methanol and applied to the wafer walls and incubated at room temperature. The wafer walls were then rinsed with MeOH and incubated with the wafer walls at room temperature. The wafer walls were then rinsed with MeOH and dried at 110 ° C for 30 minutes.

Bonding: The wafer wall was then incubated at room temperature in 1,4-phenylene diisothiocyanate (PDC) in a 0.5% w / v solution of dimethylsulfinium (DMSO) for 5 hours. Wash briefly with DMSO twice and then wash twice with double filtered water. The wafer wall was then cultured overnight at 37 ° C in double filtered water (pH 8) with 100 nM amine-modified single-stranded DNA oligomers (approximately 50 monomer units (mer)). The wafer wall was then washed twice with 28% ammonia water to deactivate any unreacted materials, and washed twice with double filtered water. One or more nanopores are then made in the wall.

Once the preparation of the nanopore was completed, the inner wall was covered with a DNA oligomer having a length of about 50 base pairs (bp). This allows a single strand of DNA with a terminal-end sequence complementary to the surface to which DNA is bound to be attached to a nanopore by attaching the ssDNA to a relatively large volume structure (e.g., a bead, a protein, or having a diameter that is too large) (Suitable for the DNAS origami structure through the nanopore), wherein the sequence complementary to the surface-bound DNA is far away from the large-volume structure, and a charged polymer is drawn through the nanopore using an electric current to bind the ssDNA to The surface of the nanopore-bound DNA oligomer is immediately adjacent to the nano-pore, and the large-volume structure is cleaved.

Example 2: DNA Synthesis-Single Nucleotide Addition

DNA is moved to the "retention" chamber by applying a suitable current and DNA movement is detected.

Terminal transferase enzymes (TdT, New England Biolabs) in suitable buffers (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25 ° C), plus reversibly blocked -dATP * system Add to Add chamber. Buffer is also added to the "retention" chamber.

DNTPs with a reverse blocking at 3'-OH were used to add nucleotide to DNA. When added to the DNA strand, the next dNTP cannot be added until the blocked dNTP is unblocked.

Deprotection can be chemical or enzymatic. Take advantage of different scenarios:

a. 3 'O-allyl: Removal of allyl is in aqueous buffer solution by Pd-catalyzed deallylation, as disclosed in Ju J, Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators. Proc Natl Acad Sci USA. (2006); 103 (52): 19635-40; or by using iodine (10 mole%) in polyethylene glycol-400, as disclosed in Shankaraiah G., et al., Rapid and selective deallylation of allyl ethers and esters using iodine in polyethylene glycol-400. Green Chem. (2011) 13: 2354-2358.

NaNO ₂ removal amine in buffered, as disclosed in U.S. Patent No. 8034923: b.3 'O-NH2.

c. 3'-phosphate. Phosphate is hydrolyzed with nuclease IV (New England Biolabs). Other possible 3 &apos; modifications that can be removed using endonuclease IV include phosphoethanolaldehyde and deoxyribose-5-phosphate.

d. 3'-O-Ac: Acetate is removed by enzymatic hydrolysis, as disclosed in Ud-Dean, A theoretical model for template- free synthesis of long DNA sequence. Syst Synth Biol (2008) 2: 67- 73.

The DNA is then moved to the "far" chamber by applying a suitable current and the DNA movement is detected. DNA is deprotected by switching buffers and deprotection buffers / solutions are added as described in a to d above.

The procedure is repeated as desired to make a sequence of interest.

Example 3: DNA synthesis: wind resistance oligonucleotide addition

The 3 &apos; end of the double-stranded DNA was attached to a nanopore with a 4mm opening. The 5 'end of this DNA has a CG overhang (read from 5' to 3 ').

The oligo cassettes A and B are manufactured as follows: (SEQ ID NO 1) 5 ’CGAAGGG <Code A or B> GTCGACNNNNN 3’ GCTTCCC <Complementary> CAGCTGNNNNN

Code A and code B each represent an information sequence. N refers to any nucleotide. The 5 'sequence contains a topoisomerase recognition site and the 3' sequence contains an Acc1 restriction site. The oligomer is exposed to a topoisomerase and the topoisomerase binds to 3 'thymine: 5' CGAAGGG <code A or B> GTCGACNNNNN 3 '* TTCCC <complementary> Conformation enzyme)

The DNA is moved to the "near" chamber by applying a suitable current and the DNA movement is detected. Topoisomerase-loaded "coding A" oligomerization services are provided in the "addition" chamber. DNA is moved to the addition chamber by applying a suitable current and DNA movement is detected, where the encoded A oligomer is bound to the DNA. Acc1 is added to the "retention" chamber where it is cleaved at a restriction site to provide a topoisomerase attachment site.

Repeat the process until the desired sequence is reached, adding "Code A" or "Code B". Note that it is not necessary to continuously add new Acc1 to the "reserved" chamber; it is only necessary to flush the code A or code B oligomer into the "add" chamber when switching code or code B.

In order to sequence wells that only allow ssDNA to pass through, certain modifications to the above scheme are needed. It is known that when dsDNA hits the small hole (2nm), only ssDNA will pass and complement will be "stripped". Therefore, if this synthesis with a 2nm pore is performed, it is necessary to ensure that the appropriate dsDNA can be "reassembled" on the other side. To do this, "CGAAGGG <Code A or B> GTCGACNNNNN" (SEQ ID NO 1) will be added to the near chamber (to ensure that restriction sites are made) and "CGAAGGG <Code A or B> GT" (SEQ ID NO 3) To the distant chamber (to ensure that a topology compatible site is made).

Explain the aforementioned method, here show the sequential "addition" of the encoded DNA information to the growing DNA strand has 2 Add sequentially (representing 2-bit data), each of which includes "add" and "deprotect" steps. Initial experiments for concept optimization and validation were performed in microtubules.

In the scheme described in this example, one bit of information is encoded in a list of nucleotides. DNA bits are "added" to the short dsDNA sequence complexed to vaccinia topoisomerase I (topo). In the presence of appropriate "deprotected" and "receptor" DNA, the topo-loaded DNA "bit" is a receptor that is topologically and covalently linked ("added") topoisomerase. It becomes removed from DNA during the process. Restriction enzymes can then cleave the added bit to "deprotect" it and make a suitable "receptor" sequence for adding the next bit.

Topo load: The general load scheme is as follows, illustrated schematically in Figure 22 and below, where N refers to any nucleotide and A, T, G, and C respectively represent adenine, thymine, guanine, and cytosine Pyrimidine nucleotides. N on top of each other is complementary. Although this example uses the restriction enzyme HpyCH4III, this basic scheme can work with other restriction enzymes, for example, as shown in Example 4.

N-N-N-N-N-N-N-N-N A-G-G-G-N-N-N-N-N-N-N-N-N-N N-N-N-N-N-N-N-N-N-T-T-C-C-C-N-N-N-N-N-N-N-N-N-N + topoisomerase * = N-N-N-N-N-N-N-N-N N-N-N-N-N-N-N-N-N + A-G-G-G-N-N-N-N-N-N-N-N-N-N * -T-T-C-C-C-N-N-N-N-N-N-N-N-N-N (topo- load) (located at the top of each other and N is complementary to)

addition

Ships 'Add' reaction: N-N-N-N-N-N-N-N-N-N-A N-N-N-N-N-N-N-N-N-N .. (acceptor) + A-G-G-G-N-N-N-N-N-N-N-N-N-N * -T-T-C-C-C-N-N-N-N-N-N-N-N-N-N (topo- load) = N-N-N-N-N-N-N-N-N-N-A A-G-G-G-N-N-N-N-N-N-N-N-N-N N-N-N-N-N-N-N-N-N-N-T-T-C-C-C-N-N-N-N-N-N-N-N-N-N + * (free TOPO)

To protect

Usually "deprotection" reactions: ... N-N-A-C-A-G-T-N-N-N-N-N-N-N-N-N-N ... N-N-T-G-T-C-A-N-N-N-N-N-N-N-N-N-N + HpyCH4III (restriction enzyme) = ... N-N-A-C-A ... N-N-T-G .. (deprotection) + ..G-T-N-N-N-N-N-N-N-N-N-N T-C-A-N-N-N-N-N-N-N-N-N-N (byproduct)

The following oligonucleotides were ordered by Integrated DNA Technologies (IDT). The "b" at the end of certain oligonucleotides refers to biotin:

(SEQ ID NO 4) BAB:

(SEQ ID NO 5): B2: ATCTACTTAAGAGATCATACAGCATTGCGAGTACG TA1: b-CACACTCATGCCGCTGTAGTCACTATCGGAAT

(SEQ ID NO 6): TA2: AGGGC GACACGGACAGTTTGAATCATACCG

(SEQ ID NO 7): TA3b:

(SEQ ID NO 8): TB2: AGGGCGCAGCAAACAGTGCCTAGACTATCG

(SEQ ID NO 9): TB3b:

(SEQ ID NO 10): FP1: CACGTACTCGCAATGCT

(SEQ ID NO 11): FP2: CGGTATGATTCAAACTGTCCG

(SEQ ID NO 12): FP3: GCCCTTGTCCGTGTC

Oligonucleotides were dissolved in 100 uM TE buffer and stored at -20 ° C.

A hybrid oligonucleotide is produced by mixing the oligonucleotides as described below, heating to 95 ° C for 5 minutes, and then lowering the temperature by 5 ° C every 3 minutes until the temperature reaches 20 ° C. The hybridized oligonucleotides are stored at 4 ° C or -20 ° C. The combination of oligonucleotides is as follows:

B1 / 2 48uL B1 48uL B2 4uL 5M NaCl

A5 20uL TA1 20uL TA2 5uL TA3b 4uL 5M NaCl 51uL TE

B5 20uL TB1 20uL TB2 5uL TB3b 4uL 5M NaCl 51uL TE

The following buffers and enzymes are used in this example:

TE: 10M Tris pH 8.0, 1mM EDTA, pH 8.0

WB: 1M NaCl, 10mM Tris pH8.0, 1mM EDTA pH8.0

1x Topo: 20mM Tris pH7.5, 100mM NaCl, 2mM DTT, 5mM MgCl ₂

1x RE: 50 mM K-acetate, 20 mM Tris-acetate, 10 mM Mg-acetate, 100 ug / ml BSA pH 7.9 @ 25C.

Vaccinia DNA topoisomerase I (topo) was purchased from Monserate Biotech (10,000U / mL)

HypCH4III was purchased from NEB

Streptavidin-coated magnetic beads (s-MagBeads) were purchased from ThermoFisher.

The receptor system was prepared as follows: 5 uL of s-bead magnetic beads were washed once in 200 uL of WB (binding time 1 minute). 5uL B1 / 2 + 195uL WB was added to the beads and incubated at room temperature for 15 minutes, then washed once with 200uL WB, washed once with 200uL 1x Topo, and suspended in 150uL 1x Topo.

Topo-load A5 (refer to Figure 20) was prepared as follows: 4uL 10x topo buffer + 23uL water + 8uL A5 + 5uL topo system was incubated at 37 ° C for 30 minutes and added to 5uL s-bead magnetic beads (washed with 200uL WB) Once, wash once with 200uL 1x Topo, resuspend in 150uL 1x topo) and allow to bind for 15 minutes at room temperature.

"Add" load A5 to the receptor: s-bead magnetic beads were removed from Topo-load-A5, added to the receptor, and incubated at 37 ° C for 60 minutes. The separation was removed, diluted 1/200 in TE, and stored at -20 ° C.

Deprotection: The material was washed once with 200uL of WB, once with 200uL of 1x RE, and resuspended in 15uL of 10x RE and 120uL of water. Add 15uL HypCH4III. The mixture was incubated at 37 ° C for 60 minutes, and then washed once with 200uL WB and once with 200uL 1x topo to manufacture the product named "Receptor-A5" by the applicant.

Topo load B5 (refer to Figure 21) was prepared as follows: 4uL 10x topo buffer, 23uL water and 8uL B5 + 5uL topo were combined and incubated at 37 ° C for 30 minutes. The product was added to 5uL s-bead magnetic beads (washed once with 200uL WB, once with 200uL 1x Topo, and resuspended in 150uL 1x topo) and allowed to bind for 15 minutes at room temperature.

"Add" load B5 to receptor-A5: s-bead magnetic beads were removed from Topo-load-B5, added to receptor-A5 and incubated at 37 ° C for 60 minutes. Remove the liquid. Dilute 1/200 in TE and store at -20 ° C.

Deprotection: The material was washed once with 200uL of WB, then once with 200uL of 1x RE, and resuspended in 15uL of 10x RE and 120uL of water. 15 uL HypCH4III was added, and the mixture was incubated at 37 ° C for 60 minutes.

Confirm that the above reaction work is obtained from A5 (with A5 added receptor: step iii, "A5 added" in the protocol) and B5 (with B5 added receptor-A5: step vi, "B5 added in the protocol '') For the separated PCR amplification. "No template" was used as a negative control for A5. The A5 line was used as a negative control for B5, and the oligo BAB line was used as a positive control for B5. The expected product size for A5 PCR is 68bp and the expected product size for B5 PCR is 57bp. (B1 / 2 was also run on the gel, the expected size was ~ 47bp, but it can be estimated because it is prominent and its line is biotinylated). The PCR reaction (30 cycles of 95/55/68 (1 minute each)) was performed as follows:

An SDS-PAGE system using 4 to 20% Tris-glycine gel was used to confirm that oligonucleotides of the desired size were produced. The loading was performed as described above, but directly after the loading (37 ° C incubation step), the loading buffer was mixed and the sample was heated to 70 ° C for 2 minutes and allowed to cool before running. The gel was stained with Coomassie. For the negative control, water was added to the reaction instead of topo. Figure 30 illustrates the results, clearly showing the bands corresponding to the desired product size for A5 PCR and B5 PCR.

Addition of DNA bits via a topoisomerase-loaded DNA cassette and deprotection operations via restriction enzymes are therefore feasible. In these proof-of-concept tests, DNA was immobilized via streptavidin-attached magnetic beads and sequentially moved to different reaction mixtures. An electric current moves the DNA to the different reaction chambers.

Ultimately, PCR shows that the desired DNA sequence is made when sequentially adding DNA sequences in response to "bit" information. These reactions have worked as designed, even with minimal optimization.

The DNAs disclosed in Examples 2 and 3 were recovered and sequenced, and a commercial nanoion sequencer (MinION from Oxford Nanopore) was used to confirm that the desired sequence was obtained.

Example 4-DNA Synthesis: Blocking Oligonucleotide Addition Using Different Restriction Enzymes

The following synthesis is performed in a manner similar to Example 3, but using the restriction enzyme MluI, which is cut off at "ACGCGT" to form: ... NNNA CGCGTNNN ...

In this embodiment, TOPO is loaded to form a complex with a complementary sequence, which enables the loaded TOPO to transfer DNA to the DNA cut by MluI: 5'pCACGTCAGGC GTATCC ATCCCTTCGCGTTCACGTACTCGCAATGCTGTAG 3 'GTGCAGTCCGCATAGGTAGGGAGAGTCGCATCGCATGAGCGTTACGAGATCTCAT CTC + ATPO = * (3 'GTGCAGTCCGCATAGGTAGGGAAGCGC (' * 'refers to TOPO binding to 3' phosphate) + CGCGTTCACGTACTCGCAATGCTGTAG AGTGCATGAGCGTTACGAGATCb (b = biotin. This can be removed using streptavidin)

By a process similar to the previous example, and then using a loaded TOPO to add oligomers, the 5 'end of the synthesized strand was misplaced with a complementary acceptor sequence to release the TOPO, and then the strand was deprotected and repeated using MluI This is repeated until the oligomer of the desired sequence is obtained.

Example 5-Single Base Addition Using Topoisomerase Protocol

It has been discovered that a topoisomerase system can also be designed to add a single base to a single strand of DNA (compared to Example 3, which discloses the addition of a "box"). The DNA locus to be added is contained in the short DNA sequence of the overlying and vaccinia topoisomerase I (topo). In the presence of suitable single-stranded "deprotection" and "receptor" DNA, topo-loaded DNA is conjugated ("added") to the receptor via topoisomerase enzymatically and covalently, in the process Medium becomes self-removed. Type IIS restriction enzymes can then cleave all added DNA with the desired single base (the base is "added"). This deprotection-addition process is repeated until other bases (bits) are added.

Topo load: The general load process is as follows, similar to Example 3: ... NNNNNNNNNCCCTTNNNNNNN-NNNNNN ... ... NNNNNNNNNNNNNNNNIIIII NNNNNNN ... Biotin + Topoisomerase (*) = NNNNNNNNNNNNNNN NNNNNNNNN ... Biotin (by-product) + ... NNNNNNNNNCCCTT * ... NNNNNNNNNNNNNNIIIII (topo load)

As in Example 3, N at the top of each other is complementary. I is inosine. Use biotin to remove unreacted products and by-products. The addition of a single base is performed as follows: NNNNNNNNNN ... (receptor sequence nucleotides are referred to as italics) + ... NNNNNNNNNCCCTT * ... NNNNNNNNNNNNNNIIIII (topo load) ... NNNNNNNNNCCCTT- NNNNNNNNNNNN ... .NNNNNNNNNNNNNNIIIII + * (free topo)

Deprotection instructions are as follows, using BciVI restriction enzymes (bold font sites): ... NGTATCCNNCCCTT- NNNNNNNNNN ... ... NNNNNNNNNNNNNNIIIII + BciVI (restriction enzyme) = TNNNNNNNNNN ... (note that "T" has been added 5 ') to acceptor DNA + NNIIIII (dissociation *) + ... NGTATCCNNCCCT ... NNNNNNNNNNNN --------------------------- ------------------------------------- TNNNNNNNNNN ... NNIIIII = TNNNNNNNNNN ... + NNIIIII ( (NNIIIII is dissociated by a single strand with added bases)

Commercially synthesized the following oligonucleotides (B = biotin, P-phosphate, I = inosinic acid):

(SEQ ID NO 13): NAT1:

(SEQ ID NO 31): NAT9cI: P-IIIIIAAGGGATGGATACGCCTGACGTG

(SEQ ID NO 14): NAT9x: P-ATCGCCATACAGCATTGCGAG

(SEQ ID NO 15): NAT9: ACGTGAAGGGATGGATACGCCTGACGTG

(SEQ ID NO 16): Nat9Acc: CACGTAGCAGCAAACAGTGCC TAGACTATCG

(SEQ ID NO 17): Nat1P: CACGTCAGGCGTATCCATCC

(SEQ ID NO 18): FP4: CGATAGTCTAGGCACTGTTTG

The polymer was dissolved in TE buffer to 100 μM and stored at -20 ° C.

Heterozygosity: The following hybrid oligonucleotides are made by mixing the oligonucleotides as disclosed, heated to 95 ° C for 5 minutes, and then lowered by 5 ° C every 3 minutes until the temperature reaches 20 ° C. The hybridized oligonucleotides are stored at 4 ° C or -20 ° C.

NAT1b / NAT9cI / NAT9x 8μL NAT1B 10μL NAT9cI 10μL NAT9x 48μL TE 4μL 5M NaCl

NAT1 / NAT9cI 10μL NAT1 10μL NAT9cI 80uL PBS

NAT1 / NAT9 10μL NAT1 10μL NAT9 80uL PBS

Buffers and enzymes: Use the following buffers:

TE: 10M Tris pH 8.0, 1mM EDTA, pH 8.0

PBS: phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na ₂ HPO ₄ , 1.8 mM KH ₂ PO ₄ ) (pH 7.4)

10x Cutsmart: 500mM KAc, 200mM Tris-Ac, 100mM Mg-Ac, 1mg / mL BSA pH 7.9

BciVI was purchased from NEB and streptavidin-coated magnetic beads (s-MagBeads) was purchased from ThermoFisher

The addition reaction proceeds as follows.

1. Topo load: Reagents are assembled as shown in the table

The reagents were then incubated at 37 ° C for 30 minutes. By-products were removed by binding using streptavidin magnetic beads (5uL) in 1x topo buffer at room temperature for 10 minutes.

2. Reaction: The reagents are combined as shown in the table:

The reagents were then incubated at 37 ° C for 30 minutes. The additional reactions are expected to proceed as follows:

An asterisk (*) indicates a topoisomerase. Note that NAT9cI is phosphorylated, but this is not shown for illustrative purposes.

When a topo is loaded in the presence of a receptor sequence, it undergoes the following reaction:

RCP amplification and measurement of product molecular weight were confirmed on an agarose gel. Referring to Fig. 30, a band of the correct size is drawn on electrophoresis lane 1 (test), and no band is shown on the negative control.

B. Deprotection reaction: The reagents are combined as shown in the table:

The reagent was incubated at 37 ° C for 90 minutes. For deprotection reactions, representative products using commercially available oligonucleotides for additional reactions and decomposition with BciVI restriction enzyme tests:

(SEQ ID NO 13): NAT1

(SEQ ID NO 13): NAT1

It is unknown whether restriction enzymes will cut DNA as expected, providing a series of inosine 3's relative to "regular" bases. As a positive control, make a "suitable" base pair equivalent of NAT1 / NAT9cI (NAT1 / NAT9c):

(SEQ ID NO 13): NAT1 5'CACGTCAGGCGTATCCATCCCTTCACGTACTCGCAATGCTGTATGGCGAT

(SEQ ID NO 19): NAT9c3 'GTGCAGTCCGCATAGGTAGGGAAGTGCA

PCR amplification of the product followed by molecular weight measurement of the agarose gel (Figure 31) showed that the enzyme worked as expected. For the positive control, a larger band (electrophoresis lane 1) was observed when not decomposed, but a smaller band (group) was observed when decomposed. The same pattern is also seen in NAT1 / NAT9cI, showing that the presence of inosine does not cancel or interfere with decomposition. A small amount of undecomposed products seems to remain in NAT1 / NAT9cI. It is recommended that the cracking is not effective, at least under these conditions, as in NAT1 / NAT9c. The lysis efficiency can be improved by changing buffer conditions and / or adding more creatine to the 5 'end of NAT9cI.

The foregoing examples demonstrate the feasibility of using the foregoing example demonstrates that it is feasible to use a Topo / Type IIS restriction enzyme combination to add a single nucleotide system to the 5 'end of a target single-stranded DNA. Using the related topology isomerase of the recognition sequence CCCTG (https://www.ncbi.nlm.nih.gov/pubmed/8661446), SVF, adding "G" instead of "T", using a similar process, thus allowing encoding to Construction of T and G binary information sequences.

As noted above, where dsDNA is generated using the topoisomerase strategy, gaps in the DNA of the opposite strand can be repaired using ligase and ATP. However, when a single nucleotide is added, as shown in the examples, the present invention is to construct a single-stranded DNA, so there is no need to repair and no ligase is required.

Example 6-Single base addition using topoisomerase with 5-phosphate coupling

For another solution of single base addition, the present invention uses a 5 'phosphate as a blocking group to provide a single base pair addition in the 3' to 5 'direction. The load reaction load is a topoisomerase (or G, or other desired nucleotide) with a single T, with a 5 ' phosphate group. When the loaded topoisomerase "sees" free 5 'unblocked (unphosphorylated) single-stranded DNA strands, it will add T to the strand to provide DNA with T added to 5'. This addition is facilitated by the presence of an adapter DNA with the topoisomerase and single-stranded receptor DNA binding. (It should be noted that this adapter DHA is catalytic-it can be reused as a template in repeated reactions). The added nucleotide has a 5 'phosphate, so it will not be a substrate for further additions until it is exposed to phosphatase, which removes the 5' phosphate. Repeat this process to add a single "T" to the 5 'end of the target single-stranded DNA using Topo and a single "G" to the SVF topology isomerase system, thus allowing the construction of a sequence that encodes T and G binary information . This process is illustrated schematically as follows:

-Generality:

Load:

Transfer:

Example 7-Using DNA origami to help attach DNA to the nanopore

DNA with a large origami structure at one end is captured in the nanopore, and is fixed to the surface-junction streptavidin via the terminal biotin portion of the DNA. After the restriction enzyme of the origami structure is cleaved, the fixed DNA can be moved back and forth through the hole, as confirmed by the interruption of the current. Immobilization enables the regulated movement of a single DNA molecule through a pore, in other words it can "read" and "write" information to the DNA.

As shown in Figure 35, a large double-stranded DNA unit is formed that is too large to pass through the nanopore. The unit has a single-stranded region and has two short, anchored DNAs to be added during synthesis. The double strand area connects to most of the show. The single strand region can then be detached and anchored to the surface immediately adjacent to the nanopore, and the origami structure is released. Refer to Figure 33.

Nanopores are formed on a 3mm wafer with 20nm SiO2 and have a window of 50 * 50 μm. The chip was provided by Nanopore Solutions. Nano-box holders and flow cells are provided by Nanopore Solutions. The amplifier was a Tecella Pico 2 amplifier. This is a usb-powered amplifier using a usb-computer interface for control. Tecella provides (Windows) software to regulate the amplifier. The multimeter is FLUKE 17B + Digital Multimeter, which can detect current as low as 0.1uA. For screening of radio frequency noise, the present invention uses a Concentric Technology Solutions TC-5916A shielded box (Faraday Cage) with a USB interface. Oligonucleotides were obtained from IDT.com. "PS" is propargylsilane-O- (propargyl) -N- (triethoxysilylpropyl) carbamate available from http://www.gelest.com/product/o-propargyl -n-triethoxysilylpropylcarbamate-90 /.

The origami structure is based on a single strand of m13 with a "honeycomb" cube-shaped origami structure, which is ~ 20nm on each side. Immediately next to the honeycomb are double-stranded regions, each of which contains a unique restriction site. One of these sites is used to attach the modified DNA to be able to attach to the nanopore, and the other is used to lyse the origami structure after the DNA is attached.

Nanopore formation: Nanopores are formed on the wafer using dielectric destruction, as follows:

1. Carefully load the wafer into the cassette.

2. Humidification: Carefully aspirate 100% ethanol to the wafer. The foam must be removed. However, avoid aspirating the solution directly onto the wafer or the wafer may be cracked (SiO2 is only 20nm).

3. Surface treatment: Remove the pure and freshly prepared piranha solution (75% sulfuric acid, 25% hydrogen peroxide (30%)) to aspirate the liquid onto the wafer. (Let the piranha solution reach room temperature). Hold for 30 minutes.

4. Rinse 4 times with distilled water.

5. Rinse twice with HK buffer (10 mM HEPES pH 8, 1M KCl).

6. Assemble the cassette to the flow cell.

7. Add 700 μL of HK buffer to each chamber of the flow cell.

8. Insert silver battery and attach to the amplifier and close the Faraday cage tightly.

9. Test the resistance at 30mV. No current should be detected. If a current is detected, the chip appears to be cracked and should restart.

10. Connect electricity to 6VDC and test with multimeter. The current should be low and should not change. By increasing the potential by 1.5V and maintaining this potential until the resistance increases. If the resistance does not increase for 5 to 10 minutes, increase another 1.5V potential and try again. Repeat until the resistance increases, at which point the applied potential should be stopped immediately. (With sufficient potential, dielectric breakdown occurs and "holes" are made in the SiO2 film. When the holes made initially are small, the size will increase as the potential is maintained).

11. Test the wells using an amplifier. At 300mV, a small to several nA current should be observed for larger pores.

Figure 34 depicts the basic function of nanopores. In each group, the y-axis is the current (nA) and the x-axis is the time (s). The left group "Screening of RF Noise" illustrates the use of Faraday cages. A wafer without nanopores was placed in a flow cell and 300 mV was applied. Noise reduction is observed when the lid of Faraday cage is closed (first arrow). A small jump occurred when the latch was closed (middle group). Note that the current is ~ 0nA. After the wells were fabricated, the application of 300 mV (arrow) was 3.5 nA. When DNA is applied to the bottom chamber and +300 mV is applied, DNA translocation can be observed by reducing the current (right group). (Note that in the case of using TS buffer: 50 mM Tris, pH 8, 1M NaCl). Lambda DNA was used in this DNA translocation test.

Silver chloride electrode:

1. Silver wire is soldered to insulated copper wire.

2. Ground the copper wire and soak the silver wire in fresh 30% sodium hypochlorite for 30 minutes.

3. The silver wire should get a dark gray coating (silver chloride).

4. The silver wire is rinsed strongly with distilled water and then dried.

5. Available now.

Beads of Silane: silane-based method to SiO ₂ coated magnetic beads (GBioscience) began development / test. The following procedure guidelines apply:

1. Treat the beads in fresh piranha solution for 30 minutes.

2. Wash 3 times with distilled water.

3. Wash twice with methanol.

4. Dilute the APTES stock solution 1: 500 in methanol.

5. Add diluted APTES to the beads and incubate at RT for 45 minutes.

6. Rinse with methanol.

7. Maintain at 100 ° C for 30 minutes.

8. Store in vacuum.

Silylation of silicon wafers

1. Place a wafer with a nano hole into the cassette.

2. Rinse with methanol and carefully remove any foam.

3. Add fresh piranha solution (equilibrated to room temperature) and incubate for 30 minutes.

4. Wash 4 times with distilled water.

5. Wash 3 times with methanol.

6. Dilute the APTES stock solution 1: 500 in methanol and use it for wafer cleaning. Incubate at RT for 45 minutes.

7. Rinse twice with methanol.

8. Dry under airflow.

9. Store in vacuum overnight.

Streptavidin conjugation of beads: Streptavidin conjugation was developed / tested on the silylated beads prepared above.

1. Wash the silylated beads with modified phosphate-buffered saline (MPBS).

2. Make 1.25% glutaraldehyde in fresh MPBS (use 50% glutaraldehyde and store frozen).

3. Add 1.25% glutaraldehyde to the beads and hold for 60 minutes with gentle pipetting up and down every 15 minutes.

4. Wash twice with MPBS.

5. Wash twice with water.

6. Let it dry under vacuum.

7. Add streptavidin (500 μg / mL in MPBS) to the beads and incubate for 60 minutes. (For negative control beads, bovine serum albumin (BSA) (2 mg / mL in MPBS) was used to replace streptavidin).

8. Remove streptavidin and add BSA (2 mg / mL in MPBS). Incubate for 60 minutes.

9. Wash twice with MPBS.

10. Store at 4 ° C.

Streptavidin junction

1. Rinse the silylated wafer twice with ethanol.

2. Rinse the silylated wafer twice with MPBS.

3. Make a fresh solution of 1.25% glutaraldehyde in MPBS (using 50% glutaraldehyde stock solution, frozen storage).

4. Rinse the menstrual tablets twice with 1.25% glutaraldehyde and maintain them for 60 minutes by gently aspirating the liquid up and down every 15 minutes.

5. Wash twice with MPBS.

6. Wash twice with water.

7. Dry in airflow.

8. Add BSA (2 mg / mL in MPBS) to half of the wafers and streptavidin (500 μg / mL in MPBS) to the other half. Incubate for 60 minutes. Making the cassette showed that half of the wafers were modified with streptavidin.

9. Rinse the two halves of the wafer with BSA (2 mg / mL in MPBS). Incubate for 60 minutes.

10. Wash with MPBS.

The buffer systems used herein are as follows:

MPBS: 8g / L NaCl, 0.2g / L KCl, 1.44g / L disodium phosphate, 0.240g / L potassium phosphate, 0.2g / L polysorbate-20 (pH 7.2)

PBS: 8g / L NaCl, 0.2g / L KCl, 1.44g / L disodium phosphate, 0.240g / L potassium phosphate

TS: 50mM Tris pH 8.0, 1M NaCl

HK: 10mM HEPES pH 8.0, 1M KCl

TE: 10mM Tris, 1mM EDTA, pH 8.0

Piranha solution: 75% hydrogen peroxide (30%) + 25% sulfuric acid

APTES stock solution: 50% methanol, 47.5% APTES, 2.5% nano pure water. Cook at 4 ° C for at least 1 hour. Store at 4 ° C.

PDC stock solution: 0.5% w / v 1,4-phenylene diisothiocyanate in DMSO

Oligonucleotides (5 ’TO 3’) are:

(SEQ ID NO 20): o1 CTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATG

(SEQ ID NO 21): o3 GGAAAGCGCAGTCTCTGAATTTAC

(SEQ ID NO 22): N1 CTTACTGGAACGGCTATCGATATCGCAGCAGGACAGABN1 biotin-CTTACTGGAACGGCTATCGATATCGCAGCAGGACAGA

(SEQ ID NO 23): N2 GTCCTGCTGCGATATCGATAGCCGTTCCAGTAAG

Oligonucleotide hybrids proceed as follows:

1. Make a 100 uM stock solution of oligomer in TE buffer

2. Dilute the oligomer to 10 μM in PBS

3. Heat 5 ′ to 85 ° C in a thermal cycler

4. By reducing the heat by 5 ° C until 25 ° C every 3 minutes

5. Store at 4 ℃ or -20 ℃

Streptavidin bonding: The streptavidin bonding system for SiO ₂ is developed and tested using SiO 2 coated magnetic beads, and then this step criterion applies to SiO ₂ wafers. Biotinylated oligomers bind to both streptavidin and BSA conjugated beads. As expected, negligible binding was observed on BSA-conjugated beads, while strong binding was observed on allenavidin-all beads. Refer to Figure 38. The binding ability of the beads in HK buffer was also tested for more convenient ligation in high salt (DNA movement was performed in high salt). The binding system in HK buffer was comparable to that in MPBS buffer (Figure 39).

Make an origami structure and confirm that it is operational as disclosed in Figures 35 to 37 above. The origami structure of the biotinylated system was tested using oligonucleotides. The inventors have known that the "origami" results disclosed in Fig. 37 above show that AlwNI is not active. The following oligonucleotide pairs (o1 / o3) were used to reproduce the exact sequence segments in origami DNA. Illustration of Origami Molecular System Figure 77:

The oligo pair o1 / o3 is CTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATG o1 (SEQ ID NO 20) CATTTAAGTCTCTGACGCGAAAGG o3 (SEQ ID NO 21)

DNA is decomposed by AlwNI in the presence of T4 DNA ligase and is complementary to the 3 'side of the origami sequence (which itself is attached to a long ssDNA sequence that is attached to the other side of the origami) projecting biotinylated oligomer according to the following reaction: CTGGAACGGTAAATT CAGAGACTG CGCTTTCCATTCTGGCTTTAATG o1 (SEQ ID NO 20) CATTTAA GTCTCTGAC GCGAAAG o3 (SEQ ID NO 21) + AlwNI = CTGGAACGGTAAATT CAGAGA CTG CGCTTTCCATTCTGGCTTTAATG (SEQ ID NO 24) CATTTAA GTC TCTGA CGCGAAAGG (SEQ ID NO 25) + B-CTTACTGGAACGGCTATCGATATCGCAGCAGGAC AGA BN1 (SEQ ID NO 22) GAATGACCTTGCCGATAGCTATAGCGTCGTCCTG N2 (SEQ ID NO 23) + ligase = B- CTTACTGGAACGGCTATCGATATCGCAGCAGGAC AGACTG CGCTTTCCATTCTGGCTTTAATG GAATGACCTTGCCGATAGCTATAGCGTCGTCCTG TCTGA C GCGAAAGG

In this protocol, AlwN1 cleaves the target DNA. This DNA may reconnect when ligase is added, but the restriction enzyme will cut it off again. However, if the / dang (o1 / o3) (right) fragment is bound to BN1 / N2, no restriction sites will be made, and therefore, this product will not be cleaved. Confirm specific attachments by testing with and without restriction enzymes:

All reagents except ligase were added and the solution was incubated at 37 ° C for 60 minutes. Ligase was added and the solution was incubated overnight at 16 ° C. 10x ligation buffer means NEB 10x T4 DNA ligase buffer. Ligase to NEB T4 DNA ligase. o1 / o3 and n1 / n2 mean a pair of bound oligomers, as explained above. The unit is microliter. Agarose gel analysis confirmed the formation of a larger product in the presence of AlwNI, corresponding to a biotinylated oligonucleotide attached to a long ssDNA arm attached to an origami structure. Where desired, 3 'biotinylation was performed using a similar protocol.

The above applicants demonstrated the formation and use of nanopores to detect potentials to induce DNA to pass through the pores, making origami molecules with long ss regions attached to their distal ends to biotin, and streptavidin to silica And use it to capture biotinylated DNA. Use these tools to attach and regulate the movement of a single DNA molecule to the nanopore.

The first step is silicon bonding of streptavidin to the surface of the SiO2 nanopore (and BSA bonding to the other side). This is done in accordance with the above step guidelines. The resulting pores tend to have a smaller current than they originally had. After some concise 6v pulses, the current returns to close to its original current. The functional nanopore system at this point is shown in FIG. 40.

Second, insert origami DNA. When the origami DNA is added to the appropriate chamber and the current is activated, the origami will be inserted into the chamber. Its representative is shown in Figure 41. The test result was that when the origami was introduced at a final concentration of 50 pM, it was confirmed that the DNA with the origami was inserted into the hole relatively quickly (usually in a few seconds), which was caused by the decrease in the current across the nanopore caused by the Detectable (for example, in these tests, the current before insertion of the origami is ~ 3nA and after insertion is ~ 2.5nA). If the current is allowed to operate for a longer period of time, the insertion occurs too quickly to be observed.

Binding of the wafer to the inserted DNA. After the origami was inserted into the nano hole, the allowable time for applying the potential again was 15 minutes. The end of the ssDNA region of the origami contains biotin, and streptavidin is joined to the surface of the nanopore. Streptavidin binds to avidin with an affinity constant close to a covalent bond. The DNA was allowed to diffuse for 15 minutes and was used to discover biotin ends and bind to streptavidin. In fact, if the DNA becomes attached to the surface, it should be slightly lower than previously observed when the potential returns to the observed potential. Furthermore, the reciprocating switch potential should be lower than the current observed in the two directions without holes. In the example shown here, no holes show a current of ~ 3nA. Figure 42 shows the representative of the attached DNA, and Figure 43 shows the test results of the current of the origami DNA attached to the switch. Note that the current observed in both directions is ~ +/- 2.5nA, which is lower than the ~ +/- 3nA observed with no holes. If the DNA does not bind to the surface, the original current is restored when the potential is switched (Figure 44).

To remove the origami structure, the buffer in the flow cell chamber containing the origami structure was removed and replaced with 1x Swa1 buffer with 1uL Swa1 / 20 ° L. The buffer in the other flow cell chamber was replaced with 1x Swa1 buffer without Swa1. This line was incubated at room temperature for 60 minutes, washed with HK buffer, and then applied with a potential. The reciprocating movement of DNA shown in FIG. 45 is confirmed by the data in FIG. 46 and shows the regulated movement of the immobilized DNA through the SiO 2 nanopore.

Example 8-Alternative means of attaching a polymer to the surface of a nanopore

The foregoing examples disclose that the DNA is attached to the surface adjacent to the nanopore by biotinylation of the DNA and the attachment surface is covered with streptavidin. Some alternative means of attaching the polymer are illustrated in Figure 47.

a) DNA hybridization: In one method, the DNA extended in the method of the present invention is hybridized to a short oligonucleotide that is attached to the nanopore. Once synthesis is complete, the synthesized DNA can be easily removed without the need for restriction enzymes, or alternatively a double strand formed by binding the oligonucleotide and the synthesized DNA can be provided as a substrate for restriction enzymes. In this example, as described below, short oligomers are attached to the surface using biotin-streptavidin, or 1,4-phenylene diisothiocyanate:

Biotinylated DNA to SiO2:

A. Silanization:

1. Pretreatment: Treat the piranha solution for 30 minutes and wash with double distilled H ₂ O (ddH ₂ O)

2. Preparation of APTES stock solution: 50% MeOH, 47.5% APTES, 2.5% nano-pure H ₂ O: mature at 4 ° C for> 1hr 4 ° C

3. Dilute APTES stock solution 1: 500 in MeOH

4. Incubate wafers at room temperature

5.MeOH rinse

6. dry

7. Heat at 110 ℃ for 30 minutes

Join:

1. Treat the wafer with PDC stock solution for 5h (room temperature) (PDC stock solution: 0.5% w / v 1,4-phenylene diisothiocyanate in DMSO)

2. Wash 2 times in DMSO (shortly!)

3. Wash 2 times in ddH ₂ O (shortly!)

4.100nM amine modified DNA in ddH ₂ O (pH 8) O / N 37 ℃

5.28% ammonia solution (deactivation) cleaning 2 times

6.ddH ₂ O wash 2 times

Single-stranded DNA with complementary to the attached oligonucleotide is introduced as described above and allowed to hybridize with the attached oligonucleotide.

b) Click chemistry : Click chemistry is a general term used for reactions. The reaction is simple and thermodynamically effective. It does not make toxic and highly reactive by-products in water or biocompatible solvents. Medium, and is often used to link substrate options with specific biomolecules. The click junction in this case uses a chemistry similar to that used below) a) Attachment oligonucleotides, here only used to attach polymers extended during the synthesis process in the method of the invention. In this embodiment, the DNA is a polymer, and this chemistry will work to attach to other polymers that are functionalized by adding a biocompatible azide cluster.

Silanization:

1. Pretreatment: piranha solution treatment for 30 minutes, ddH2O cleaning

2. Preparation of PS (propargyl silane) stock solution: 50% MeOH, 47.5% PS, 2.5% nano-pure H2O: matured at 4 ° C for> 1hr

3. Dilute APTES stock solution 1: 500 in MeOH

4. Incubate wafers at room temperature

5.MeOH rinse

6. dry

7. Heat at 110 ℃ for 30 minutes

DNA terminalized at the azide machine will covalently bind to the surface (as shown in Figure 47). The azide-terminated oligomers are sequentially and attached to the longer origami DNA, as described above for adding biotin to the DNA.

Example 9: Optimized Topoisomerase-Mediated DNA Synthesis

An oligonucleotide cassette is composed of three oligonucleotides that are hybridized to form a double-stranded DNA cassette. The cassette is designed to have a vaccinia virus topoisomerase recognition sequence (CCCTT) in the positive strand DNA and then a GCCG sequence in the negative strand. Once the topoisomerase recognizes its target sequence, the topoisomerase cleaves the oligonucleotide and forms a covalent bond with the 5 'segment of the oligonucleotide, causing a "load" of the topoisomerase form. The addition of an unpaired base pair of CCCTT3 'only on the positive strand (CGAA matches the GCCG of the negative strand) resulted in a more efficient topoisomerase load. When streptavidin-coated beads are added to the mixture and bound to the biotin attached to the 3 'end of the forward DNA strand, the cleaved 3' portion of the oligonucleotide cassette (known as a by-product) can be loaded by the loaded extension Naso isomerase was removed. The reaction system is described as follows:

Initial load oligonucleotide:

Italicized oligonucleotides are 5 'phosphorylated.

After topoisomerase loading:

5 'GCGCACGGTCTCCCGGCGTATCCAT CCCTT 3' (SEQ ID NO 26)

3 ’CGCGTGCCAGAGGGCCGCATAGGTAGGGAAGCCG 5’

The topoisomerase system is covalently linked to 3 '(not shown) of the CCCTT recognition sequence.

Byproduct oligonucleotides were removed by biotin binding to streptavidin beads.

5 'CGAATTCACGTACTCGCCAGTCTACAG-Biotin 3 ’bound to S / A coated magnetic beads 3’ AGTGCATGAGCGGTCAGATGTC 5 ’

The loaded topoisomerase has the unique ability to add an oligonucleotide to the 5 'segment of a DNA receptor strand with complementary overhangs:

DNA binds to the loaded Topo (SEQ ID NO26): DNA receptor strand (SEQ ID NO 27):

The DNA receptor strand is extended by a cassette (or bit):

(SEQ ID NO 28):

Topoisomerase is released by reaction. The oligonucleotide cassette, or bit, is then "byproductized" by the decomposition of the restriction enzyme Bsa I, which recognizes the nucleotide GGTCTC. Bsa I is a type IIS type restriction enzyme, which recognizes asymmetric DNA sequences (GGTCTC sequences) and cleaves the outer sides of such recognition sequences. Designing the cassette for lysis with Bsa I will cause CGGC to stand out. This highlight, as seen in the DNA acceptor strand, allows another cassette (or bit) to add another load of topoisomerase.

(SEQ ID NO 28): DNA receptor with one protected cassette (Bsa I restriction site in bold): (SEQ ID NO29): DNA receptor with one cassette after Bsa I decomposition:

Incubation with the topological isomerase of the load results in the addition of another cassette (bit) and extends the DNA strand to encode more information.

DNA binds to the loaded Topo DNA receptor strand plus a cassette (SEQ ID NO 26): (SEQ ID NO 29):

DNA receptor strand (SEQ ID NO 30) extended by two cassettes (bits):

This step can be repeated again and again to extend the "bits" of the DNA strand with encoded data.

Test details:

Topoisomerase load reaction: 40 microliters of streptavidin-coated magnetic immunobeads (Thermo Fisher) were washed 5 times in B & W buffer (10mM Tris, pH 8.0, 1mM EDTA, 2M NaCl) . Biotinylated loaded oligonucleotides at 2.7pmole were added to the beads, and the mixture was incubated at room temperature for 10 minutes with gentle shaking. Supernatant was removed from beads and discarded, leaving only ligated load oligonucleotides. Then beads were placed in 1x Cutsmart buffer (New England Biolabs, NEB) containing vaccinia virus topoisomerase (6ug), 10 units of T4 polynucleotide kinase (3 'phosphatase negative, NEB), 0.1uM ATP ( NEB) and 5 mM DTT, incubated at 37 ° C for 30 minutes to load topoisomerase. After the topoisomerase cleaves the loaded oligonucleotide, the 5 'end of the by-product oligonucleotide formed by phosphorylation of the polynucleotide kinase is prevented, thereby preventing the topoisomerase from returning to the linked oligonucleotide Acid and increase load reaction efficiency. Any unloaded topoisomerase binds to streptavidin-coated immune beads via electrostatic forces. The loaded topoisomerase is freed by streptavidin-coated beads. Polynucleotide kinase (PNK) is neutralized by recombinant shrimp phosphatase, which reverses PNK activity, or preferably the loaded topoisomerase is performed by ion exchange chromatography or via nickel- NTA beads (top isomerase line His-6-tagged) were purified.

Initial binding of receptor DNA to beads: 20 microliters of streptavidin-coated magnetic magnetic immunobeads (Thermo Fisher) were washed 5 times in B & W buffer (10 mM Tris, pH 8.0, 1 mM EDTA, 2M NaCl). A biotinylated DNA receptor oligonucleotide of 0.03pmoles was added to the washed beads and incubated for 10 minutes at room temperature with shaking. The streptavidin-coated bead supernatant was removed and discarded, leaving only the DNA receptor strand bound to the bead.

Addition reaction: To prepare an addition mixture, add E. coli DNA ligase plus 1 mM NAD to the loaded topoisomerase. As needed: add 100uM Coumermycin or 1mM Novobiocin. (Note: When DNA is added to the receptor via a topoisomerase load, E. coli DNA ligase (which requires NAD) will "fix" the remaining gaps. This ensures that if no topoisomerase is loaded, this DNA is encountered It will not lyse the DNA. Furthermore, coumarin and nascent enzymes will inhibit topoisomerase, as well as "load" and no "addition" reaction. So this inhibitor also helps to ensure Any unloaded topoisomerase is formed during the inactivation of the reaction). Fifty microliters of the addition mixture was added to the beads and incubated at 37 ° C for 15 minutes so that the DNA cassette was added to the DNA acceptor molecules. Figure 76 shows a 4% agarose gel, confirming that the cassette was added as expected. In order to release the DNA from the magnetic magnetic beads to prepare this gel, the sample was decomposed with Eco (EcoRI)).

The beads were then placed adjacent to the magnet, the topoisomerase solution was removed and stored on ice. The beads were then washed 3 times with 55 μl of 1x cutsmart buffer (NEB) to remove any residues of the topoisomerase.

Deprotection reaction: The beads were then incubated with 50 microliters of cutsmart buffer (with NAD and coumarin / neomycin as needed) containing 40 units of Bsa I and 1 unit of shrimp alkaline phosphatase. When the restriction enzyme cuts off the DNA, leaving a 5 &apos; phosphate, and this inhibited loaded topoisomerase is freed from the addition of another cassette. The addition of shrimp alkaline phosphatase removes the 5 'phosphate, thereby effectively deprotecting the cassette. For example, the use of phosphatase from shrimp alkaline phosphatase or bovine small intestine phosphatase enhances the reaction efficiency; without this phosphatase, 5 'phosphate has inhibitory effect.

Bsa I and SAP were removed from the beads, and the beads were washed 3 times with cutsmart buffer. It is ready for the addition of another cassette with a loaded topoisomerase.

This is done by cultivating the DNA receptor strand and the loaded topoisomerase (ligase), and then in the order of adding cassettes decomposed by BsaI / rSAP, and repeating the number of cassettes for pre-addition.

Example 10: Unrestricted Enzyme Protocol

The foregoing embodiments provide step-by-step guidelines for the protection, which combine phosphatase and restriction enzymes to drastically increase the efficiency of the system. In some cases, applicants have found that the ability of 5'-phosphate to inhibit "receptor" DNA is sufficient to inhibit the addition of enzymes. The simplification of using only a phosphatase instead of a combination of a phosphatase and a restriction enzyme is advantageous and unexpected. It requires fewer reagents, it speeds up the reaction, and it provides more flexibility in terms of the nucleotide sequences that can be used for "hybrid" regions. This method of unlimited enzymes is shown here:

7F-T 5 'p CGGC AGATCTACCCTT CGAA TTCACGTACTTG [SEQ ID NO: 33] 3' TCTAGATGGGAAGCCGpAGTGCATGAACp

7F-B1 7F-B2 + Topo = 5 'p CGGC AGATCTACCCTT * [SEQ ID NO: 32] 3' TCTAGATGGGAA GCCG p (* = topo)

When this oligonucleotide is introduced into a receptor with pCGGC overhang, the addition reaction does not occur to any suitable degree until the phosphate is removed by SAP, CIP, or other suitable phosphatase. E.g:

The main limitation of this method is that if restriction enzymes are necessary to cut in and destroy the topoisomerase binding site, as described above, it is not suitable for constructing a DNA chain with a single nucleotide.

The selection of a specific method is taken into consideration when the topology isomerase system is "loaded", a mixture of loaded and unloaded products-which is expressed in the balance between the two species, which can be affected to optimize the reaction efficiency. The "outstanding" left by the topoisomerase can be designed in many ways. GC-rich overhangs tend to have faster load reactions but have load balances that tend to produce lower product yields. In some systems, it may be desirable to have a certain mismatch (or use of inosinic acid) instead of the "appropriate" pair, because it can reduce the "reverse" response and improve yield. Furthermore, the reaction is performed in the presence of a polynucleotide kinase (plus ATP), and the yield is improved by phosphorylation of a reaction "by-product" that reduces the reverse reaction rate. This method can be optimized for scale-up, such as by using column purification rather than magnetic beads to isolate the product.

Example 11: Loading Topo with non-common bases

The common recognition sequence for vaccinia topoisomerase is (C / T) CCTT. When a single nucleotide is added to the DNA strand (as described above), the last position of this sequence ("T" in this case) will be added to the DNA strand. In order to encode binary data in DNA with maximum efficiency (that is, one base per bit), there is a topoisomerase that can "load" a sequence having a position other than "T" at the last position. In general, non-common sequences show poor reactivity to topoisomerase. However, the applicant below shows an effective method for "loading" DNA having a sequence other than a common sequence.

Step 1: Glue the oligonucleotide. The composition specified in the following table was introduced into 4 tubes, heated to 94 ° C for 5 minutes, and then allowed to cool to room temperature.

As explained below, this will produce glued DNA. These DNAs are different from each other in bold nucleotides, which is the last (3 ') position of the topo consensus sequence. Furthermore, attention should be paid to mismatches in the sequence (underlined). When topoisomerase binds its recognition sequence and transesterifies, the presence of these mismatches reduces the rate of the reverse reaction and thus promotes the formation of "loaded" topoisomerase.

7-BT:

7F-T 5 'P-CGGCAGATCTACCCT T CG AA TTCACGTACTTG [SEQ ID NO: 33] 7F-B1 TCTAGATGGGA A GCCG AGTGCATGAAC 7F-B2

7-BTC:

7F-TC 5 'P-CGGCAGATCTACCCT C CG AA TTCACGTACTTG [SEQ ID NO: 35] 7F-B1C TCTAGATGGGA G GCCG AGTGCATGAAC 7F-B2

7-BTG:

7F-TG 5'P-CGGCAGATCTACCCT G CG AA TTCACGTACTTG [SEQ ID NO: 36] 7F-B1G TCTAGATGGGA C GCCG AGTGCATGAAC 7F-B2

7-BTA:

7F-TA5 'P-CGGCAGATCTACCCT A CG AA TTCACGTACTTG [SEQ ID NO: 37] 7F-B1A TCTAGATGGGA T GCCG AGTGCATGAAC 7F-B2

Step 2: The topoisomerase then loads the oligonucleotides by combining each of the four oligonucleotides described in the topoisomerase.

Topoisomerase: 60 ng / μl in 50 mM sodium phosphate (pH 7.5), 1 mM DTT, 0.5 mM EDTA, 50 mM NaCl, 50% glycerol.

10x buffer: 200mM Tris (8.0), 1M NaCl, 50mM MgCl2, 20mM DTT

These ingredients were mixed as set out in the table above, incubated at 37 ° C for 30 minutes, and run on an SDS-PAGE gel to confirm that the reaction proceeded as expected. The gel results are shown in Figure 96. The loaded topoisomerase can be purified from unloaded topoisomerase and other reaction components and products. Although the T reaction (corresponding to the common CCCT T sequence) yielded the highest yield of the topological isomerase (indicated), other reactions also produced a significant amount of the topological isomerase loaded, showing the The topoisomerase reaction can be used to add any selected single nucleotide or oligomer to the DNA strand in the 3 'to 5' direction, such as Method A above, or as described below.

<110> American Arriadia

<120> Systems and methods for writing, reading, and controlling data stored in polymers

<130> DNA-01-TW

<160> 38

<170> PatentIn version 3.5

<210> 1

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Donor oligonucleotide (synthetic sequence)

<220>

<221> misc_feature

<222> (8) .. (15)

<223> n (located at base positions 8 to 15) means the information sequence A or B, which can be 3 to 12 nucleotides

<220>

<221> misc_feature

<222> (22) .. (26)

<223> n is a, c, g, or t

<400> 1

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Topological enzyme attachment site (synthetic sequence)

<220>

<221> misc_feature

<222> (8) .. (15)

<223> n (located at base positions 8 to 15) means the information sequence A or B, which can be 3 to 12 nucleotides

<400> 2

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<220>

<221> misc_feature

<222> (8) .. (15)

<223> n (located at base positions 8 to 15) means the information sequence A or B, which can be 3 to 12 nucleotides

<400> 3

<210> 4

<211> 81

<212> DNA

<213> Artificial sequence

<220>

<223> BAB (synthesized sequence)

<400> 4

<210> 5

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> B2 (synthesized sequence)

<400> 5

<210> 6

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> TA2 (synthesized sequence)

<400> 6

<210> 7

<211> 71

<212> DNA

<213> Artificial sequence

<220>

<223> TA3b (synthesized sequence)

<400> 7

<210> 8

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> TB2 (synthesized sequence)

<400> 8

<210> 9

<211> 71

<212> DNA

<213> Artificial sequence

<220>

<223> TB3b (synthesized sequence)

<400> 9

<210> 10

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> FP1 (synthesized sequence)

<400> 10

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> FP2 (synthesized sequence)

<400> 11

<210> 12

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> FP3 (synthesized sequence)

<400> 12

<210> 13

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<223> NAT1 (synthesized sequence)

<400> 13

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> NAT9x (synthesized sequence)

<400> 14

<210> 15

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> NAT9 (synthesized sequence)

<400> 15

<210> 16

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Nat9Acc (synthetic sequence)

<400> 16

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Nat1P (synthetic sequence)

<400> 17

<210> 18

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> FP4 (synthesized sequence)

<400> 18

<210> 19

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> NAT9c (synthesized sequence)

<400> 19

<210> 20

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> o1 (synthesized sequence)

<400> 20

<210> 21

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> o3 (synthetic sequence)

<400> 21

<210> 22

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> N1 (synthesized sequence)

<400> 22

<210> 23

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> N2 (synthesized sequence)

<400> 23

<210> 24

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 24

<210> 25

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 25

<210> 26

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 26

<210> 27

<211> 84

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 27

<210> 28

<211> 74

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 28

<210> 29

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 29

<210> 30

<211> 91

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 30

<210> 31

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> NAT9cI (synthesized sequence)

<400> 31

<210> 32

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 32

<210> 33

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 33

<210> 34

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 34

<210> 35

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 35

<210> 36

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 36

<210> 37

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 37

<210> 38

<211> 11

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide (synthetic sequence)

<400> 38

Claims (45)

    A method for reading data stored in a polymer, comprising: i) providing an LC resonator with an effective impedance; ii) providing a unit having a nanopore or a nanochannel, and the nanometer being accessible by the nano Polymer with holes or nano-channel shifts, these shifts affecting the effective impedance, the resonator has an AC output voltage resonance frequency response at the probe frequency, which is based on the effective impedance, responding to AC at the probe frequency Input voltage; iii) providing the AC input voltage having at least the probe frequency; and iv) monitoring the AC output voltage at least at the probe frequency, the AC output voltage at the probe frequency being marked at the time of monitoring The data stored in the polymer; wherein the LC resonator is a lateral resonator.         The method according to item 1 of the patent application range, wherein the polymer includes at least two types of monomers or oligomers, which have different properties, thereby causing different resonance frequency responses.         The method according to item 2 of the patent application scope, wherein the at least two types of monomers or oligomers include: at least a first monomer or oligomer, which has a first property, so that the first monomer Or an oligomer causes a first resonance frequency response when in the nanopore; and a second monomer or oligomer having a second property such that the second monomer or oligomer is in the nanopore Middle time causes a second resonance frequency response.         The method of claim 3, wherein the characteristic of the first frequency response at the probe frequency is different from the same characteristic of the second frequency response at the probe frequency.         The method of claim 4, wherein the characteristics of the first and second frequency responses include at least one of an amplitude and a phase response.         The method of claim 3, wherein the first attribute and the second attribute of the monomer include a dielectric attribute.         The method of claim 1, wherein the unit includes at least one set of transverse electrodes, the transverse electrodes are arranged across the nanopore or nanochannel, and the unit has a fluid therein, and wherein the unit The lateral electrode, the nanopore or nanochannel, and the fluid have an effective capacitance that changes as the polymer passes through the nanopore or nanochannel.         The method according to item 7 of the patent application scope, wherein the effective impedance includes an inductor connected in series with the effective capacitor to create the resonator, and the combination of the inductor and the effective capacitor is related to the resonance frequency response.         The method of claim 7, wherein the unit includes at least a top electrode and a bottom electrode, and the polymer is passed through the nanopore by a DC pilot voltage applied to the top and bottom electrodes.         The method according to item 7 of the patent application scope, wherein the unit has at least three chambers, at least two nanopores, and at least three electrodes so that the polymer passes through the nanopores.         The method of claim 2, wherein at least a part of the sequence of the at least two types of monomers or oligomers in the polymer stores data in the form of computer-readable codes.         The method of claim 1, wherein the polymer includes DNA, and wherein the DNA includes at least two types of nucleotides, each type of nucleotide providing a unique frequency response at the probe frequency .         The method of claim 1, wherein the probe frequency is about 1 MHz to 100 GHz.         The method of claim 1, wherein the at least two different types of monomers or oligomers have dielectric properties that affect the frequency response of the resonator to generate at least two at the probe frequency. Different frequency response.         The method of claim 1, further comprising providing a second LC resonator having a second effective impedance, wherein the second LC resonator is a longitudinal resonator, and the displacement of the polymer affects the first Two effective impedances, the second resonator has a second AC output voltage resonance frequency response at the second probe frequency, which is based on the second effective impedance and responds to the second AC input voltage at the second probe frequency; The second resonator provides the second AC input voltage having at least the second probe frequency; and monitors the second AC output voltage of the second resonator at least at the second probe frequency, at the second The second AC output voltage of the second resonator of the probe frequency indicates the data stored in the polymer during monitoring.         The method of claim 1, wherein the resonator includes a split ring resonator, and the nano hole or the nano channel is provided in a gap of the split ring resonator.         The method of claim 1, wherein the nanochannel has a size that allows the polymer to flow substantially linearly without folding on its own.         The method according to item 1 of the patent application scope further comprises a plurality of the resonators in the unit, each resonator being driven by a common AC input voltage and monitored from a common AC output voltage.         The method of claim 15, wherein the LC resonator and the second LC resonator are respectively driven by a common AC input voltage and monitored from a common AC output voltage.         The method according to item 15 of the scope of patent application, wherein the frequency response of the LC resonator and the second LC resonator are simultaneously monitored.         The method described in the first patent application range further includes a plurality of units, each unit having the resonator tuned to a different resonance frequency band, the units being driven by a common AC input voltage and measured by a common AC output voltage.         A nanopore-based device for reading data stored in a polymer, comprising: i) an LC resonator having an effective impedance; ii) a unit having a nanopore or a nanochannel and a The nanopore or nanochannel shifted polymer. These shifts affect the effective impedance. The resonator has an AC output voltage resonance frequency response at the probe frequency. Based on the effective impedance, the response is at the probe frequency. AC input voltage; iii) an AC input voltage source configured to provide an AC input voltage having at least the probe frequency; and iv) a monitoring device configured to monitor the AC output voltage at least at the probe frequency, at The AC output voltage of the probe frequency indicates the data stored in the polymer during monitoring; wherein the LC resonator is a lateral resonator.         The device according to item 22 of the patent application scope, wherein the polymer includes at least two monomers or oligomers, which have different properties, thereby causing different resonance frequency responses at the probe frequency, and the response is marked At least two different data bits.         A method for reading data stored by a polymer, comprising: i) providing a resonator having an inductor and a unit, the unit having a nano hole and a polymer that can pass through the nano hole, the resonator being The probe frequency has an AC output voltage frequency response in response to an AC input voltage at the probe frequency; ii) provides the AC input voltage with at least the probe frequency; and iii) monitors the AC output at least at the probe frequency Voltage, the AC output voltage at the probe frequency indicates the data stored in the polymer during monitoring.         The method of claim 24, wherein the polymer includes at least two types of monomers or oligomers, which have different properties, thereby causing different resonance frequency responses.         The method as described in claim 25, wherein the at least two types of monomers or oligomers include: at least a first monomer or oligomer, which has a first property, so that the first monomer Or an oligomer causes a first resonance frequency response when in the nanopore; and a second monomer or oligomer having a second property such that the second monomer or oligomer is in the nanopore Middle time causes a second resonance frequency response.         The method of claim 26, wherein the characteristic of the first frequency response at the probe frequency is different from the same characteristic of the second frequency response at the probe frequency.         The method of claim 27, wherein the characteristics of the first and second frequency responses include at least one of an amplitude and a phase response.         The method of claim 26, wherein the first attribute and the second attribute of the monomer include a dielectric attribute.         The method of claim 24, wherein the unit includes at least top and bottom electrodes, the nanopore is provided between the electrodes, and the unit has a fluid therein, and wherein the electrode, the nano The mesopores and the fluid have effective cell capacitances that change as the polymer passes through the nanopores.         The method of claim 24, wherein the inductor is connected in series with the effective capacitor to create the resonator, and the combination of the inductor and the effective capacitor is related to the resonance frequency response.         The method of claim 24, wherein the polymer is passed through the nanopore by a DC pilot voltage applied to the electrode.         The method of claim 24, wherein the unit has at least three chambers, at least two nanopores, and at least three electrodes to pass the polymer through the nanopores.         The method of claim 24, wherein the polymer includes at least two types of monomers or oligomers, which have different properties, thereby causing different resonance frequency responses, and wherein the polymer At least part of the sequence of the at least two types of monomers or oligomers in the stored data in the form of computer readable code.         The method of claim 24, wherein the polymer includes DNA, and wherein the DNA includes at least two types of nucleotides, each type of nucleotide providing a unique frequency response at the probe frequency .         The method of claim 35, wherein the probe frequency is about 1 MHz to 1 GHz.         The method of claim 24, wherein the polymer includes at least two different types of monomers or oligomers, each type having different dielectric properties that affect the frequency response of the resonator, Generate at least two different frequency responses at this probe frequency.         A nanohole-based device for reading data stored in a polymer, comprising: i) a resonator having an inductor and a unit, the unit having a nanohole and a polymer that can pass through the nanohole The resonator has an AC output voltage frequency response at the probe frequency and responds to the AC input voltage at the probe frequency; ii) an AC input voltage source configured to provide an AC input voltage at least the probe frequency; and iii) The monitoring device is configured to monitor the AC output voltage at least at the probe frequency, and the AC output voltage at the probe frequency indicates the data stored in the polymer at the time of monitoring.         The device according to item 38 of the scope of patent application, wherein the polymer includes at least two monomers or oligomers, which have different properties, thereby causing different resonance frequency responses at the probe frequency, and the response is marked At least two different data bits.         The device of claim 38, wherein the inductor is connected in series with an effective capacitor to create the resonator, and the combination of the inductor and the effective capacitor is related to the resonant frequency response at the probe frequency.         A method for synthesizing a charged polymer comprising at least two different monomers or oligomers in a nanopore-based device, the nanopore-based device comprising one or more addition chambers or channels, containing a buffer solution And reagents for adding one or more monomers or oligomers to the charged polymer in a protected form so that only a single monomer or oligomer can be added in a reaction cycle; and one or more deprotection chambers Or channel containing buffer solution and reagent for removing the protecting group from the charged polymer, wherein the addition chamber or channel is deprotected by one or more membranes including one or more nanopores The chambers or channels are separated, and wherein the charged polymer can pass through the nanopore and at least one of the reagents used to add one or more monomers or oligomers cannot pass through the nanopore, the method includes a ) By electrically attracting the first end of the charged polymer having the first end and the second end into the addition chamber or channel, thereby adding a monomer or oligomer to the first end in a protected form, b) making In protective form The first end of the charged polymer to which the monomer or oligomer is added enters a deprotection chamber or channel to remove the protecting group from the added monomer or oligomer; c) repeat steps a) and b) Wherein the monomers or oligomers added in step a) are the same or different until the desired polymer sequence is obtained; and d) after one or more monomers or oligomers have been added To verify the sequence of the monomers or oligomers in the polymer, wherein the sequence is verified by using the method described in item 24 of the scope of the patent application.         The method according to item 41 of the application, wherein the charged polymer is DNA.         The method of claim 41, wherein the second end of the polymer is bonded to a surface.         The method of claim 41, wherein the device comprises: one or more first addition chambers or channels containing a reagent suitable for adding a first type of monomer or oligomer; and one or more The second addition chamber contains a reagent suitable for adding a second type monomer or oligomer, and wherein, in step a), depending on whether the first type monomer or oligomer or the second type monomer or An oligomer such that the first end of the charged polymer enters the first addition chamber or the second addition chamber.         The method according to item 42 of the patent application scope, wherein the reagent for adding one or more monomers or oligomers to the charged polymer includes a reagent selected from the group consisting of topoisomerase, DNA polymerase, or a combination thereof Reagent.