TW201918556A - Methods and compositions for cellular reprogramming - Google Patents

Abstract

Disclosed herein are methods and pharmaceutical compositions for the treatment of retinitis pigmentosa, macular degeneration and other retinal conditions by interfering with expression of genes, such as those encoding photoreceptor cell-specific nuclear receptor and neural retina-specific leucine zipper protein, in cells of the eye. These methods and compositions employ nucleic acid based therapies.

Description

Method and composition for cell reprogramming

Gene therapy (delivering nucleic acids to cells of patients to treat conditions) has been expected and tested for decades and has achieved varying degrees of success. The conditions to be treated are usually advanced diseases (such as cancer, leukemia) and extremely debilitating diseases (such as severe combined immunodeficiency).

Disclosed herein are methods of reprogramming a cell from a first cell type to a second cell type comprising contacting the cell with a first guide RNA that hybridizes to a target site of the gene, wherein the gene encodes a cell that facilitates the cell a cell type-specific functional protein; and a Cas nuclease that cleaves a strand of the gene at a target site, wherein the expression of the cleavage chain-modified gene allows the cell to no longer perform cell type-specific functions, thereby reprogramming the cell to Second cell type. The gene may comprise a mutation. The first cell type can be sensitive to mutations, and wherein the second cell type is an anti-mutated cell type. Mutations can only have an adverse effect in the first cell type. Adverse effects can be selected from senescence, apoptosis, lack of differentiation, and abnormal cell proliferation. The gene encodes a transcription factor. The first cell type and the second cell type may be closely related terminally differentiated mature cell types. Reprogramming can occur in vivo. Reprogramming can occur in vitro or ex vivo. The cells can be cells of the pancreas, heart, brain, eyes, intestines, colon, muscles, nervous system, prostate or breast. The cell can be a cell after mitosis. The cells can be cells in the eye. The cells can be retinal cells. The retinal cells can be rod cells. Cell type-specific functions can be night vision or color vision. The gene may be selected from the group consisting of NRL, NR2E3, GNAT1, ROR beta, OTX2, CRX and THRB. The gene may be selected from the group consisting of NRL and NR2E3. The first cell type can be a rod cell and the second cell type can be a cone cell. Cones can have individual light vision. The first cell type can be a rod cell and the second cell type can be a pluripotent cell. The first cell type can be a rod cell, and the second cell type can be a pluripotent retinal progenitor cell. The cells can be cancer cells. The function may be selected from abnormal cell proliferation, cancer metastasis, and tumor angiogenesis. The first cell type can be a colon cancer cell, and the second cell type can be a benign intestinal cell or a colon cell. The gene may be selected from the group consisting of APC, MYH1, MYH2, MYH3, MLH1, MSH2, MSH6, PMS2, EPCAM, POLE1, POLD1, NTHL1, BMPR1A, SMAD4, PTEN and STK11. The first cell type can be a malignant B cell, and the second cell type can be a benign macrophage. The gene may be selected from the group consisting of C-MYC, CCND1, BCL2, BCL6, TP53, CDKN2A, and CD19. The cells can be neurons. The cells can be interneurons. The interneurons can be horizontal cells. The first cell type can produce at least one protein selected from the group consisting of amyloid beta, tau protein, and combinations thereof, and the second cell type can produce no protein or produce less protein than the first cell type. The first cell type can be a neuron, and the second cell type can be a gel cell. The gene can be selected from APP and MAPT. The first cell type produces alpha synuclein. The first cell type can be a gel cell, and the second cell type can be a dopamine that produces neurons. The gene may be selected from the group consisting of SNCA, LRRK2, PARK2, PARK7 and PINK1. The gene can be alpha synuclein (SNCA). The second cell type can be selected from the group consisting of dopamine-exciting neurons and dopamine-exciting progenitor cells. The first cell type can be a non-dopamine-exciting neuron or a gelatinous cell. Further disclosed herein is the use of reprogrammed cells to treat a condition in a subject in need thereof, wherein the reprogrammed cells are produced by contacting the cells with: a first guide RNA that hybridizes to a target site of the gene, wherein the gene encoding contributes to the cell a cell type-specific function protein; and a Cas nuclease that cleaves a gene strand at a target site, wherein the cleavage chain-modified gene is expressed such that the cell can no longer perform cell type-specific functions, thereby reprogramming the cell For the second cell type. Reprogrammed cells can be autologous to an individual. The condition may include retinal degeneration. The condition may be selected from the group consisting of macular degeneration, retinitis pigmentosa, and glaucoma. The condition may be retinitis pigmentosa. The condition can be cancer. The cancer can be colon cancer or breast cancer. The condition can be a neurodegenerative condition. The condition may be selected from Parkinson's Disease and Alzheimer's Disease. Disclosed herein are methods of treating a condition comprising administering to a subject in need thereof: a first guide RNA that hybridizes to a target site of a gene in a cell of a first type, wherein the gene encodes a cell that facilitates the first type of cell a functional protein; and a Cas nuclease that cleaves a strand of the gene at a target site, wherein the cleavage chain-modified gene is such that the first type of cell is converted from the first type of cell to the second type of cell, wherein The resulting production of two types of cells presents or increases the improved condition. Characterizing the modified gene can comprise reducing gene expression of the first type of cell by at least about 90%. Characterizing the modified gene can include editing the gene, wherein the editing results in a protein not being produced from the gene or a non-functional protein being produced from the gene. The condition may be an ocular condition, and the first type of cells may be the first type of ocular cells and the second type of cells are the second type of ocular cells. Function can be performed in the first type of eye cells rather than the second type of eye cells. The second type of ocular cells can perform a second function, wherein the second function can be performed by the first type of ocular cells. The first type of ocular cells can be rod cells, and the second type of ocular cells can be cone cells. The ocular condition can be retinal degeneration, retinitis pigmentosa or macular degeneration. The gene may be selected from the group consisting of NR2E3 and NRL. Methods can include reprogramming rod cells into cone cells or reprogramming rod cells into pluripotent retinal progenitor cells. The ocular condition can be glaucoma, and the second type of ocular cells can be retinal ganglion cells. The first cell type can be a Mueller gelatin cell. The gene can be ATOH7. The gene may be the POU4F gene (POU4F1, POU4F2 or POU4F3) encoding the BRN-3 protein (BRN3A, BRN3B, BRN3C, respectively). The gene can be Islet1, also known as ISL1. The gene may be CDKN2A encoding p16. The gene can be Six6. The method can comprise administering to a vehicle selected from the group consisting of a vector, a liposome, and a ribonucleoprotein, at least one polynucleotide encoding a Cas nuclease and a guide RNA. The method can comprise contacting the cell with a second guide RNA. The method can comprise administering a second guide RNA. The method can comprise introducing a novel splice site in the gene. Introduction of novel splice sites can result in the removal of exons or portions thereof from the gene coding sequence. An exon can contain a genetic mutation. Mutations can only have an adverse effect in the first cell type. Adverse effects can be selected from senescence, apoptosis, lack of differentiation, and abnormal cell proliferation. The gene encodes a transcription factor. Cells of the first type are sensitive to mutations and cells of the second type are resistant to mutations. The method can comprise introducing a novel exon into the gene. The method can comprise introducing at least one nucleotide to the gene. The method can comprise introducing a novel exon into the gene. Further disclosed herein is a system comprising a Cas nuclease or a polynucleotide encoding a Cas nuclease, a first guide RNA, and a second guide RNA, wherein the first guide RNA is 5' of the first site of at least the first region of the gene The Cas9 cleavage is targeted, and the second guide RNA targets the Cas9 cleavage of the second site 3' of the first region of the gene, thereby excising the region of the gene. The first guide RNA can cleave at least the first site 5' of Cas9 of the first exon, and the second guide RNA targets the Cas9 cleavage of at least the second site 3' of the first exon, This excises at least the first exon. The system can comprise a donor polynucleotide, wherein the donor polynucleotide can be inserted between the first site and the second site. The donor polynucleotide can be an in vitro exon that contains a splice site at the 5' and 3' ends of the in vitro exon. The donor polynucleotide can comprise a wild type sequence. The gene may be selected from the group consisting of NRL and NR2E3. The first guide RNA and/or the second guide RNA can target the Cas9 protein to a sequence comprising any of SEQ ID NO.: 1-4. Disclosed herein is a kit comprising a Cas nuclease or a polynucleotide encoding a Cas nuclease, a first guide RNA, and a second guide RNA, wherein the first guide RNA is 5' of the first site of at least the first region of the gene The Cas9 cleavage is targeted, and the second guide RNA targets the Cas9 cleavage of the second site 3' of the first region of the gene, thereby excising the region of the gene. The first guide RNA can be targeted to at least the first site 5' of Cas9 of the first exon, and the second guide RNA can be targeted by at least the second site 3' of Cas9 of the first exon, This excises at least the first exon. The kit can comprise a donor polynucleotide, wherein the donor nucleic acid can be inserted between the first site and the second site. The donor polynucleotide can be an in vitro exon that contains a splice site at the 5' and 3' ends of the in vitro exon. The donor polynucleotide can comprise a wild type sequence. The gene may be selected from the group consisting of NRL and NR2E3. The first guide RNA and/or the second guide RNA can target the Cas9 protein to a sequence comprising any of SEQ ID NO.: 1-4. Further disclosed herein are pharmaceutical compositions for treating an ocular condition in an individual comprising: a Cas nuclease or a polynucleotide encoding a Cas nuclease; and at least a portion complementary to a portion of a gene selected from the NRL gene and the NR2E3 gene A guide RNA. The polynucleotide may encode a Cas protein and at least one guide RNA is present in at least one viral vector. A polynucleotide encoding a Cas protein or at least one guide RNA is present in the liposome. At least one guide RNA can target the Cas protein to a sequence comprising any of SEQ ID NO.: 1-4. The pharmaceutical composition can be formulated as a liquid to be administered using an eye dropper. The pharmaceutical composition can be formulated as a liquid for intravitreal administration. Disclosed herein is a method of editing a gene in a cell, the method comprising: contacting the cell with: a first guide RNA that hybridizes to a target site of the gene; a Cas nuclease that cleaves the strand of the gene at the target site; Body nucleic acid. The donor nucleic acid can be inserted into the gene via a non-homologous end joining. The cell can be a cell after mitosis. The gene can be the Mertk gene. The cell can be a cell in the retina of the individual's eye. Further disclosed herein is a method of treating retinal degeneration in an individual comprising contacting the retina of the individual with: a first guide RNA that hybridizes to a target site of the gene; a Cas nuclease that cleaves the strand of the gene at the target site; And a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. Retinal degeneration can be retinitis pigmentosa. The gene can be the Mertk gene. Disclosed herein is a method of treating beta thalassemia in an individual comprising contacting an individual's hematopoietic stem/progenitor cells with: a first guide RNA that hybridizes to a target site of a hemoglobin gene; and a strand of the hemoglobin gene at a target site a cleavage Cas nuclease; and a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The donor nucleic acid can replace a portion of the hemoglobin gene comprising the CD41/42 mutation. Disclosed herein are methods of treating cancer in an individual comprising contacting an individual's T cells with a first guide RNA that hybridizes to a target site of a gene encoding an immunological checkpoint inhibitor; and causing the gene to be at a target site The cleavage Cas nuclease. The method can comprise contacting a T cell with a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The gene may be PDCD1 encoding the planned cell death protein 1 (PD-1). The cancer can be a metastatic cancer. The cancer can be metastatic ovarian cancer, metastatic melanoma, metastatic non-small cell lung cancer or metastatic renal cell carcinoma. Further disclosed herein are methods of treating cancer in an individual comprising contacting a cancer cell of the individual with a first guide RNA that hybridizes to a target site of a gene encoding an immunological checkpoint inhibitor ligand; A Cas nuclease that cleaves at a target site. The gene may be CD274, also known as PDCD1LG1, which encodes a programmed death ligand 1 (PD-L1). The gene can be PDCD1LG2 or a planned death ligand 2 (PD-L2). The method can comprise contacting a tumor cell with a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The cancer can be a metastatic cancer. The cancer can be metastatic ovarian cancer, metastatic melanoma, metastatic non-small cell lung cancer or metastatic renal cell carcinoma.

Sequence table This application contains a Sequence Listing which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy created on October 31, 2017 is named 49697-713-SEQ.txt and is 4.31 KB in size. Gene therapy displays have great promise for treating many human diseases. However, one of the major drawbacks of current technology is that it can only target a specific mutation or a single gene at most, which makes gene therapy difficult to apply to a larger patient population. Similarly, repair and regeneration of tissues using endogenous or autologous stem cells represents an important goal of regenerative medicine. However, this method is hindered by the requirement that the starting cells have normal gene composition and function, and in many cases it is not practicable because the autologous cells have genetic mutations that the gene therapy intends to overcome. Provided herein are methods for overcoming the above-described challenges of cell reprogramming, which convert a cell type susceptible to mutation into a functionally related cell type that is resistant to the same mutation, thereby protecting tissue and function. This method is based on the assumption that 1) mutations usually only have an adverse effect on specific cell types; 2) the combination of transcription factors enables determination of cell fate, and 3) the presence of mature cell types (such as pancreas) that allow differentiation at closely related terminals Developmental plasticity between direct conversion in vivo, between myocardium and nerve cells. In addition, distantly related cells can also be directly transformed in vivo by appropriate combinations of developmentally related transcription factors. A method based on clustering regular interval palindrome-Cas9 (CRISPR-Cas9) using a homology-independent targeted integration (HITI) strategy is provided herein. These methods provide efficient targeted gene insertion of both split and non-dividing cells. These methods can be performed in vitro and in vivo. These methods provide targeted transgene insertions in post-mitotic cells (eg, the brain) of postpartum mammals. Retinitis pigmentosa is one of the most common degenerative diseases of the eye, affecting more than one million patients worldwide. It can be caused by many mutations in more than 200 genes. RP is characterized by the death and degeneration of primary rod-shaped photoreceptors followed by secondary cone death. Rod cell determinant A large number of gene knockouts of NRL reprogram adult rod cells into cone cells, which counteract the effects of mutations in RP-specific genes on rod-shaped photoreceptors, and thus prevent secondary cone deletions . NRL acts as the dominant switch gene between rod cells and cone cells and activates the major downstream transcription factor NR2E3. NRL and NR2E3 are used together to activate rod-specific gene transcription networks and control rod cell differentiation and fate. Loss of function of NRL or NR2E2 reprograms rod cells into cone fate. This system provides an opportunity to demonstrate the concept that therapy can be developed, in which cells are reprogrammed from cells that are sensitive to mutations to their anti-mutation cells. Provided herein are methods for treating a condition comprising targeted inactivation of a gene comprising a mutation in a cell type that is susceptible to mutation (eg, abnormal or toxic to an individual having the cell). Examples of such methods are provided herein, including for the treatment of RP using in vivo rod-to-cone reprogramming by targeting NRL or NR2E3 in a non-targeted activated retina by using CRISPR/Cas9 adeno-associated virus (AAV). And other methods of retinal conditions (see, for example, Example 12). The example demonstrates that rod-to-cone-specific cell fate can be reprogrammed by the inactivation of the rod-shaped photoreceptor cell fate with consequent retinal photoreceptor reservation and visual function first aid. These results point to novel therapeutic approaches that are independent of genes and mutations and can have broad implications for genetic disease therapies.Therapeutic platform Provided herein are methods of treating a hereditary condition in an individual comprising administering to a cell of a first cell type of the subject a therapeutic agent that exhibits the expression of a modified gene disclosed herein in a first cell, wherein the gene encoding has a specific A protein of the function of the first cell type. The performance of the modified gene can result in reprogramming the cell from the first cell type to the second cell type. By way of non-limiting example, the hereditary condition may be retinitis pigmentosa, the gene may be selected from the group consisting of NRL and NR2E3, and the therapeutic agent may be a virus encoding a Cas nuclease of a targeted gene and a guide RNA. The method can comprise administering a therapeutic agent to a retinal cell, such as a rod-shaped photoreceptor cell, also referred to herein as a "rod cell." The method can result in reprogramming rods into cones, saving retinal degeneration and restoring retinal function. Thus, the first cell type can be a rod cell and the second cell type is a cone cell (see, eg, Example 13). Although rod-to-cone reprogramming can result in loss of rod count and possible subsequent night blindness, individuals may be willing to endure night blindness. Provided herein are methods of reprogramming a cell from a first cell type to a second cell type comprising contacting the cell with a guide RNA that hybridizes to a target site of the gene, wherein the gene encodes a cell type that contributes to the cell a protein that specifically functions; and a Cas nuclease that cleaves a strand of the gene at a target site, wherein the expression of the cleavage chain-modified gene allows the cell to no longer perform cell type-specific functions, thereby reprogramming the cell to a second Cell type. The term "reprogramming" as used herein refers to at least one gene in a genetically altered cell to convert the cell from a first cell type to a second cell type. The first cell type can be a more differentiated form of the second cell type or vice versa. The first cell type can be functionally related to the second cell type. For example, the first cell type and the second cell type can provide visually related functions. Also by way of non-limiting example, the first cell type and the second cell type may provide for brain activity, neuronal activity, muscle activity, immune activity, sensory activity, cardiovascular activity, cell proliferation, cellular senescence, and cellular cell death. Death related features. Genetically altering the gene can include silencing the gene, thereby inhibiting the production of the protein encoded by the gene. Silencing a gene can involve introducing a nonsense mutation into the gene to produce a non-functional protein. Insignificant mutations can be introduced by using gene editing to establish artificial splice variants, wherein the artificial splice variant lacks at least one exon or portion thereof. The term "cell type-specific function" as used herein refers to a function specific to a cell type. In some cases, this function is only specific for a single cell type. For example, the cell type specific function can be light vision, and the single cell type is a cone photoreceptor cell. In some cases, the function is specific to a subset of cells. For example, cell type-specific functions can be generally visual, and a subset of cells can be photoreceptor cells, such as rods, cones, and photosensitive retinal ganglion cells. The terms "first cell type" and "second cell type" are used herein only to distinguish one cell type from another in the context in which it is used. The methods or compositions disclosed herein are in no way limited to the order of the one part of the present application in another part of the present application. The first cell type disclosed herein can be sensitive to mutations. "Sensitive to mutation" means that a mutation in a gene in one cell will have a functional effect on the other cell. The second cell type disclosed herein is resistant to mutation. "Anti-mutation" means that a mutation in a gene in the cell will not exert any functional effect on the cell, or that a mutation in the gene in the cell will produce an acceptable functional effect, and is non-toxic to the individual in which the cell is present, or There is little or no functional effect on the individual in which the cell is present. For example, the anti-mutated cell type can be a cell type of a gene that does not exhibit a gene or exhibits a negligible amount. The anti-mutation cell type can be a cell type that expresses a gene, but the functional role of the gene in the cell type is not affected by the mutation. Cell type-specific functions are performed on cell types that are sensitive to mutations, wherein cell type-specific functions are regulated or controlled by the expression of genes that can have mutations. When a mutation occurs in a gene, cell type-specific function is lost or altered. The methods disclosed herein comprise editing a gene such that the first cell type (sensitive to mutation) is reprogrammed to a second cell type (anti-mutation). Methods of treating retinal degeneration are provided herein. Retinal degeneration involves a variety of diseases such as retinitis pigmentosa, macular degeneration and glaucoma. The method can comprise reprogramming retinal cells from a rod-shaped photoreceptor cell type to a cone-shaped photoreceptor cell type, comprising contacting the retinal cell with a guide RNA that hybridizes to a target site of a gene disclosed herein, wherein the gene A protein encoding a protein that contributes to the nighttime or color vision function of the cell; and a Cas nuclease that cleaves the strand of the gene at the target site, wherein the expression of the cleavage chain-modified gene allows the retinal cell to no longer perform nighttime or color vision functions, This reprograms retinal cells into conical photoreceptor cell types. Cone photoreceptor cell types may be capable of providing light vision to an individual. The gene may be selected from the group consisting of NRL, NR2E3, GNAT1, ROR beta, OTX2, CRX and THRB. The gene can be an NRL. The gene can be NR2E3. Methods of treating retinal degeneration are provided herein. Retinal degeneration involves a variety of diseases such as retinitis pigmentosa, macular degeneration and glaucoma. The method can comprise reprogramming retinal cells from a first cell type to a second cell type. The first cell type can be a rod cell. The first cell type can be a cell other than a rod cell or a cone cell. The first cell type can be a neuron. The first cell type can be an interneuron. The first cell type may be a neuronal stem cell or a neuronal precursor cell (a pluripotent or pluripotent cell having the ability to differentiate into a neuronal cell). The advantage of using cells such as interneurons or cells other than rod cells can be used to provide a line of sight to patients with terminal RP who have completely lost both rod and cone receptors. The second cell type can be a cone cell. The second cell type can be an intermediate cell. The intermediate cell can be a cell that has been reprogrammed as described herein (eg, treated with Cas nuclease and guide RNA or RNAi). The intermediate cell can be a rod cell in which the rod cell gene expression has been downregulated. Down-regulation of rod cell gene expression reduces the effect of rod-specific mutations. As used herein, "rod-specific mutation" generally refers to a mutation in a gene that affects the function and phenotype of a rod. In other words, rod cells can be sensitive to rod cell mutations. Such cells can provide a tissue structure carrier to maintain normal architecture and function. These cells also secrete nutrient factors that are critical for maintaining the growth and survival of endogenous cone cells. The method can comprise reprogramming retinal cells from a rod-shaped photoreceptor cell type to a pluripotent cell type comprising contacting the retinal cell with a guide RNA that hybridizes to a target site of a gene disclosed herein, wherein the gene is encoded a protein that contributes to the nighttime or color vision function of the cell; and a Cas nuclease that cleaves the strand of the gene at the target site, wherein the expression of the cleavage chain-modified gene allows the retinal cell to no longer perform nighttime or color vision functions, thereby Retinal cells are reprogrammed into pluripotent cell types. The pluripotent cell type may be a pluripotent retinal progenitor cell, meaning cells that may develop into rods or cones when placed in the retina and/or subjected to environmental stimulation of the retina. The pluripotent cell type can be a cell type intermediate between cone cells and rod cells. The cell type between the cone cells and the rod cells may be a retinal ganglion pluripotent cell. During normal retinal development, retinal ganglion pluripotent cells will differentiate into cones or rods. The gene may be selected from the group consisting of NRL, NR2E3, GNAT1, ROR beta, OTX2, CRX and THRB. The gene can be an NRL. The gene can be NR2E3. Methods of treating cancer are provided herein. By way of non-limiting example, the cancer can comprise colon cancer, B cell lymphoma, glioblastoma, retinoblastoma, and breast cancer. The method can comprise reprogramming a cancer cell from a malignant cell type to a benign cell type comprising contacting the cancer cell with a guide RNA that hybridizes to a target site of a gene disclosed herein, wherein the gene encoding contributes to the cell a proliferating protein; and a Cas nuclease that cleaves a strand of the gene at a target site, wherein cleavage of the strand-modified gene allows the cancer cell to no longer abruptly augment, thereby reprogramming the cancer cell into a benign cell type. By way of non-limiting example, the first cell type may be a colon cancer cell, the second cell type may be a benign intestinal cell or a benign colon cell, and the gene may be selected from the group consisting of APC, MYH1, MYH2, MYH3, MLH1, MSH2, MSH6, PMS2, EPCAM, POLE1, POLD1, NTHL1, BMPR1A, SMAD4, PTEN and STK11. Also, by way of non-limiting example, the first cell type can be a malignant B cell, the second cell type can be a benign macrophage, and the gene can be PU.1, CD19, CD20, CD34, CD38, CD45 or CD78. The first cell type may be a malignant B cell, the second cell type may be a benign macrophage, and the gene may be C-MYC, CCND1, BCL2, BCL6, TP53, CDKN2A, CREBBP or EP300. The second cell type can exhibit a higher RNA/protein content of CD68, CD11b, F480, Cd11c or Ly6g than the first cell type. Also by way of non-limiting example, the first cell type may be an estrogen receptor positive and/or Her2 positive breast cancer cell, and the second cell type may be an estrogen receptor negative and/or estrogen receptor negative breast cancer cell, and The gene may be selected from the group consisting of an estrogen receptor gene, a Her2 gene, and combinations thereof. The method of treating cancer disclosed herein can comprise modifying the gene such that the cancer cell loses its ability to metastasize. The method can comprise modifying the gene such that the cancer cell loses its ability to promote tumor angiogenesis.RNA interference ( RNAi ) Provided herein are methods of administering an antisense oligonucleotide capable of inhibiting the expression of a gene in a cell via RNA interference. Inhibition of this gene can result in the conversion of cells from a first cell type to a second cell type. The first cell type or cell type can be any of the cell types disclosed herein. In some embodiments, an antisense oligonucleotide comprises a modification that provides resistance to decomposition or degradation by a naturally occurring DNase. In some embodiments, the modification is to modify the phosphodiester backbone of the antisense oligonucleotide during its synthesis using a solid phase amino phosphate method. This will effectively visualize the least efficient DNase form of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide comprises a delivery system that most effectively promotes or enhances uptake of an antisense oligonucleotide in both methods. In some embodiments, the delivery system comprises a liposome or lipid container that is readily absorbed by human cells. In some embodiments, the delivery system isTat A protein-mediated system that allows the transfer of macromolecules resembling oligonucleotides via cell membranes. In some embodiments, the antisense oligonucleotide is a short hairpin RNA (shRNA). These RNA strands silence the gene by targeting the mRNA produced by the relevant gene. In some embodiments, shRNAs can be custom designed via computer software and manufactured commercially using design templates. In some embodiments, the shRNA is delivered using a bacterial plastid, a circular strand of bacterial DNA, or a virus carrying a viral vector. In some embodiments, the antisense oligonucleotide targets the RNA encoded by the NR2E3 gene. In some embodiments, the antisense oligonucleotide targets an RNA encoded by the NRL gene. In some embodiments, the antisense oligonucleotide targets an RNA encoded by a gene encoding a puroferrin. In some embodiments, the antisense oligonucleotide targets an RNA encoded by a rhodopsin gene. In some embodiments, the siRNA is between about 18 nucleotides and about 30 nucleotides in length. In some embodiments, the siRNA is 18 nucleotides in length. In some embodiments, the siRNA is 19 nucleotides in length. In some embodiments, the siRNA is 20 nucleotides in length. In some embodiments, the siRNA is 21 nucleotides in length. In some embodiments, the siRNA is 22 nucleotides in length. In some embodiments, the siRNA is 23 nucleotides in length. In some embodiments, the siRNA is 24 nucleotides in length. In some embodiments, the siRNA is 25 nucleotides in length.Gene editing Provided herein are methods for genetically editing genes in a cell, wherein gene editing results in the conversion of cells from a first cell type to a second cell type. By way of non-limiting example, the method can be used to treat retinal conditions. Further provided herein are cells wherein the genes in the cells are modified by the methods disclosed herein. By way of non-limiting example, the cells are cells of the retina, also known as retinal cells. In some embodiments, the methods and cells disclosed herein utilize genomic editing to modify a target gene in a cell for use in treating a retinal condition. In some embodiments, the methods and cells disclosed herein utilize a nuclease or nuclease system. In some embodiments, the nuclease system comprises a site-directed nuclease. Suitable nucleases include, but are not limited to, CRISPR-associated (Cas) proteins or Cas nucleases, including type I CRISPR-associated (Cas) polypeptides, type II CRISPR-associated (Cas) polypeptides, and type III CRISPR-associated (Cas) a polypeptide, a Type IV CRISPR-associated (Cas) polypeptide, a Type V CRISPR-associated (Cas) polypeptide, and a Type VI CRISPR-associated (Cas) polypeptide; a zinc finger nuclease (ZFN); a transcriptional activator-like effector nuclease ( Transcription activator-like effector nucleases, TALEN); meganuclease; RNA-binding protein (RBP); CRISPR-associated RNA-binding protein; recombinase; turnover enzyme; transposase; Argonaute protein; Any variant thereof; and any fragment thereof. In some embodiments, the site-directed nucleases disclosed herein can be modified to produce a catalytic nuclease capable of site-specific binding to a target sequence without cleavage, thereby blocking transcription and reducing target gene expression. . In some embodiments, the methods and cells disclosed herein utilize a nucleic acid-guided nuclease system. In some embodiments, the methods and cells disclosed herein will cluster a regularly spaced short palindromic repeat (CRISPR), CRISPR associated (Cas) protein system for modifying nucleic acid molecules. In some embodiments, the CRISPR/Cas system disclosed herein comprises a Cas nuclease and a guide RNA. In some embodiments, the CRISPR/Cas system disclosed herein comprises a Cas nuclease, a guide RNA, and a repair template. The guide RNA directs the Cas nuclease to a target sequence in which the Cas nuclease cleaves or strands the target sequence, thereby generating a cleavage site. In some embodiments, the Cas nuclease produces a double strand break (DSB) repaired via a non-homologous end joining (NHEJ). However, in some embodiments, non-mediated or non-directed NHEJ-mediated DSB repair results in a disruption of the open reading frame that produces undesirable consequences. In order to circumvent these problems, in some embodiments, the methods disclosed herein comprise the use of a prosthetic template to be inserted at a cleavage site, taking into account a control of the final edited gene sequence. This use of the repair template can be referred to as homology directed repair (HDR). In some embodiments, the methods and cells disclosed herein utilize homologous independent targeted integration (HITI). HITI may allow for efficient local targeting of gene insertion in both dividing and non-dividing cells and, more importantly, allowing in vivo insertion of a target transgene into post-mitotic cells (eg, the brain) of a postpartum mammal. In some embodiments, the repair template comprises a wild type sequence corresponding to the target gene. In some embodiments, the repair template comprises the desired sequence to be delivered to the cleavage site. In some embodiments, the desired sequence is not a wild type sequence. In some embodiments, the desired sequence is equivalent to a target sequence other than one or more edited nucleotides to correct or alter the performance/activity of the target gene. For example, the desired sequence may comprise a single nucleotide difference compared to a target sequence comprising a single nucleotide polymorphism, wherein the single nucleotide difference is for restoring wild-type performance/activity or altered performance/activity Substitution of nucleotides to single nucleotide polymorphisms of the target gene. Any suitable CRISPR/Cas system can be used in the methods and compositions disclosed herein. The CRISPR/Cas system can be referred to as using a variety of named systems. An exemplary naming system is provided by Makarova, KS et al., "An updated evolutionary classification of CRISPR-Cas systems", Nat Rev Microbiol (2015) 13:722 to 736, and Shmakov, S. et al., "Discovery and Functional Characterization of Diverse Class". 2 CRISPR-Cas Systems" Mol Cell (2015) 60:1 to 13. The CRISPR/Cas system can be a Type I, Type II, Type III, Type IV, Type V, Type VI system or any other suitable CRISPR/Cas system. The CRISPR/Cas system as used herein may be a Class 1, Class 2 or any other suitable classification of the CRISPR/Cas system. Class 1 CRISPR/Cas systems can use multiple complexes of Cas proteins to effect modulation. Class 1 CRISPR/Cas systems may include, for example, Type I (eg, I, IA, IB, IC, ID, IE, IF, IU), Type III (eg, III, IIIA, IIIB, IIIC, IIID) and Type IV ( For example, IV, IVA, IVB) CRISPR/Cas type. The Class 2 CRISPR/Cas system can use a single large Cas protein to affect regulation. Class 2 CRISPR/Cas systems can include, for example, Type II (eg, II, IIA, IIB) and Type V CRISPR/Cas. The CRISPR systems can complement each other and/or can provide functional units in reverse to facilitate CRISPR locus targeting. The Cas protein may be a Type I, Type II, Type III, Type IV, Form V or Type VI Cas protein. A Cas protein can comprise one or more domains. Non-limiting examples of domains include a guide nucleic acid recognition and/or binding domain, a nuclease domain (eg, DNase or RNase domain, RuvC, HNH), a DNA binding domain, an RNA binding domain, a helicase Domains, protein-protein interaction domains, and dimeric domains. The guide nucleic acid recognition and/or binding domain can interact with the guide nucleic acid. The nuclease domain can comprise catalytic activity for nucleic acid cleavage. The nuclease domain may have no catalytic activity to prevent nucleic acid cleavage. The Cas protein can be a chimeric Cas protein fused to other proteins or polypeptides. The Cas protein can be a chimera of various Cas proteins, for example, comprising domains from different Cas proteins. Non-limiting examples of Cas proteins include c2c1, C2c2, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csxl2), Cas10, Cas10d, Cas10, CaslOd, CasF, CasG, CasH, Cpf1, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CASE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4 and Cul966, and homologs or modified forms thereof. The Cas protein can be from any suitable organism. Non-limiting examples include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus, Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces streptomyces, Streptomyces lividans, Streptomyces lividans , Streptomyces faecalis, Streptomyces faecalis, Thermophilic acidophilus, Pseudomonas aeruginosa, Bacillus arsenic, Microbacterium siberia, Lactobacillus brevis, Lactobacillus salivarius, Marine microscopy, Bo Klebst's bacteria, resistance to degradation of Pseudomonas, monosporium, marine nitrogen-fixing cyanobacteria, cyanobacteria, microcystis, Pseudomonas aeruginosa, cyanobacteria, Arabidopsis Thermobacteria, Agrobacterium strain, gold ore, Clostridium botulinum, Clostridium difficile, Daphnegold, thermophilic saline-base anaerobic bacteria, propionic acid-degrading bacteria, Thiobacillus acidophilus, eosinophilic Thiobacillus, Alternaria, Lactobacillus, Nitrosococcus, Nitrosomonas, Tetrodotoxin, Alternaria, Vibrio cholerae, Yves Methane, and Rhododendron Bubble nodules, Nostoc, great festival Algae, Anopheles sinensis, Rhizoctonia solani, Cercospora, Prototheca sphaeroides, Vibrio, Acinetobacter, Alcalibur, Marine cyanobacteria, C. serrata and new murderer Francis bacteria. In some aspects, the organism is S. pyogenes. In some aspects, the organism is S. aureus. In some aspects, the organism is S. thermophilus. Cas protein can be derived from a variety of bacterial species, including but not limited to: atypical vannamei, Fusobacterium nucleatum, gingival line bacteria, resistance to bad breath pathogenic bacteria, faecal faecal bacteria, Treponema pallidum, Durden E.coli, G. glabrata, Streptococcus mutans, Escherichia coli, Pseudo-Streptococcus, Enteric acid genus, Escherichia coli, Bacillus subtilis, Bifidobacterium bifidum, rhamnose Lactobacillus, Lactobacillus gargle, Daphnegold, Micrococcus, Mycoplasma gallisepticum, Mycoplasma pneumoniae, Canine mold, Candida albicans, Proteus urtica, addiction Streptococcus thermophilus, Lactobacillus sphaeroides, Lactobacillus bulgaricus subsp., multi-nutrition bacillus, white rumen cocci, Akemasa femazina, fibrinolytic acid, B. rhizogenes, Bifidobacterium Corynebacterium diphtheriae, Micro-Eulimococcus, Nitrobacter oxysporum, Spirulina, Subspecies of Mycobacterium succinogenes, Bacteroides fragilis, Chloasophila genus, Rhodopseudomonas, Rainbow Prevobacter, rumen prion, columnar yellow rod , less cytobacteria, Rhodospirillum rubrum, marine candidate bacillus, Aphis sinensis, A. serrata, R. serrata, A. serrata, Nitrogen faecalis, slow-growing Rhizobium, amber Phytophthora, Campylobacter jejuni, Vibrio cholerae, Bacillus cereus, Isolates, Clostridium perfringens, food cleaner, Corynebacterium sinensis, Neisseria meningitidis, subfamily of Pasteurella multocida, Wald'sactate, Proteus, Legionella vulgaris, human feces Passat, succinic acid-producing genus and new murderer Francis . In this context, the term "derived" is defined as a modification from a variety of naturally occurring bacterial species to maintain a substantial portion or substantial homology of the various bacterial species naturally produced. A substantial portion may be at least 10 contiguous nucleotides, at least 20 contiguous nucleotides, at least 30 contiguous nucleotides, at least 40 contiguous nucleotides, at least 50 contiguous nucleotides, at least 60 contiguous nucleuses Glycosidic acid, at least 70 contiguous nucleotides, at least 80 contiguous nucleotides, at least 90 contiguous nucleotides or at least 100 contiguous nucleotides. A substantial homology can be at least 50% homology, at least 60% homology, at least 70% homology, at least 80% homology, at least 90% homology, or at least 95% homology. The derivative species can be modified while retaining the activity of the naturally occurring variant. In some embodiments, the CRISPR/Cas system utilized by the methods and cells described herein is a Type II CRISPR system. In some embodiments, a Type II CRISPR system comprises a repair template to modify a nucleic acid molecule. The Type II CRISPR system has been described in S. pyogenes, in which Cas9 and two non-coding small RNAs (pre-crRNA and tracrRNA (anti-activated CRISPR RNA)) are used together to target and reduce related nucleic acid molecules in a sequence-specific manner. (See Jinke et al., "A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity", Science 337 (6096): 816 to 821 (August 2012, electronic version June 28, 2012)). In some embodiments, two non-coding small RNAs are ligated to create a single nucleic acid molecule, referred to as a guide RNA. In some embodiments, the methods and cell use guide nucleic acids disclosed herein. A guide nucleic acid refers to a nucleic acid that can hybridize to another nucleic acid. The guide nucleic acid can be RNA. The guide nucleic acid can be DNA. The guide nucleic acid for DNA can be more stable than the guide RNA. The guide nucleic acid can be programmed to bind to a sequence of particular nucleic acid sites. The nucleic acid or target nucleic acid to be targeted may comprise nucleotides. The guide nucleic acid can comprise nucleotides. A portion of the target nucleic acid can be partially complementary to one of the guide nucleic acids. The guide nucleic acid can comprise a polynucleotide chain and can be referred to as a "single guide nucleic acid" (ie, "single guide nucleic acid"). The guide nucleic acid can comprise two polynucleotide strands and can be referred to as a "dual-guided nucleic acid" (ie, a "dual-guided nucleic acid"). Unless otherwise indicated, the term "guide nucleic acid" is inclusive and refers to a single guide nucleic acid and a dual guide nucleic acid. The wizard nucleic acid can contain fragments that can be referred to as "wizard fragments" or "wizard sequences." The guide nucleic acid can comprise a fragment that can be referred to as a "protein binding fragment" or a "protein binding sequence." The guide nucleic acid can comprise one or more modifications (eg, base modifications, backbone modifications) to provide nucleic acids with new or enhanced characteristics (eg, improved stability). The guide nucleic acid can comprise a nucleic acid affinity tag. The guide nucleic acid can comprise a nucleoside. The nucleoside can be a base-sugar combination. The base portion of the nucleoside may be a heterocyclic base. The two most common classes of such heterocyclic bases are purines and pyrimidines. The nucleotide may be a nucleoside further comprising a phosphate group covalently linked to the sugar moiety of the nucleoside. For nucleosides including furanosylose, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. In forming a guide nucleic acid, a phosphate group can covalently link adjacent nucleosides to each other to form a linear polymeric compound. Thereafter, the corresponding ends of the linear polymeric compound can be further bonded to form a cyclic compound; however, linear compounds are generally suitable. Additionally, linear compounds can have internal nucleotide base complementarity and can thus be folded in such a way as to completely or partially produce a double-stranded compound. Within a guide nucleic acid, a phosphate group is often referred to as an internucleoside backbone that forms a guide nucleic acid. The bond or backbone of the guide nucleic acid can be a 3' to 5' phosphodiester bond. The guide nucleic acid can comprise a modified backbone and/or a modified internucleoside linkage. The modified backbone may comprise those backbones that will retain the phosphorus atoms in the backbone and those backbones that do not have a phosphorus atom in the backbone. Suitable modified guide nucleic acid backbones containing a phosphorus atom may include, for example, phosphorothioate, palmitic phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl phosphate, A Phosphonates and other alkylphosphonates such as 3'-alkylphenylphosphonates, 5'-alkylphenylphosphonates, palmitic phosphonates, phosphonites, including 3'-amines Amino phosphates of amino phosphates and aminoalkylamino phosphates, diamino phosphates, thiocarbonylamino phosphates, thiocarbonylalkylphosphonates, thiocarbonylalkyl phosphates, selenophosphates a salt and a borane phosphate having a normal 3'-5' bond, a 2'-5' bond analog, and a phosphate having a reverse polarity, wherein one or more internucleotide linkages are 3' to 3', 5' to 5' or 2' to 2' bond. A suitable guide nucleic acid having a reverse polarity can comprise a single 3' to 3' bond at the 3'-maximum internucleotide linkage (ie, a single reverse nucleoside with a nucleobase deletion or a hydroxyl group at its proper position) the remains). Various salts (for example, potassium chloride or sodium chloride), mixed salts, and free acid forms may also be included. The guide nucleic acid may comprise one or more phosphorothioate and/or heteroatonucleotide linkages, in particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- (ie, sub- Methyl (methylimido) or MMI backbone), -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -ON(CH3)-CH2- CH2- (wherein the primary phosphodiester internucleotide linkage is represented by -OP(=O)(OH)-O-CH2-). The guide nucleic acid can comprise a morpholino backbone structure. For example, the guide nucleic acid can comprise a 6 member morpholino ring instead of a ribose ring. In some of these embodiments, a diamine phosphate or other non-phosphodiester internucleoside linkage is substituted for the phosphodiester linkage. The guide nucleic acid may comprise a short chain alkyl or cycloalkyl internucleoside linkage, a mixed heteroatom and an alkyl or cycloalkyl internucleoside linkage or one or more short chain heteroatoms or heterocyclic internucleoside linkages. Polynucleotide backbone. Such backbones may include (N-morpholinyl) linkages (partially formed by nucleoside sugar moieties); oxirane backbones; thio, anthracene and oxime backbones; formazan and thioformamidine Base chain; methylene methyl thiol and thiomethanyl backbone; core thiol backbone; backbone containing olefin; amine sulfonate backbone; methylene imino group and methylene a thiol backbone; a sulfonate and a sulfonamide backbone; a guanamine backbone; and a backbone having a mixture of N, O, S and CH2 moieties. The guide nucleic acid can comprise a nucleic acid mimetic. The term "mimetic" is intended to include a polynucleotide in which only the furanose ring or the furanose ring and the internucleotide bond are replaced by a non-furanose group, and the substitute of only the furanose ring may also be referred to as a sugar. substitution. The heterocyclic base moiety or modified heterocyclic base moiety can be maintained for hybridization to a suitable target nucleic acid. One such nucleic acid can be a peptide nucleic acid (PNA). In PNA, the sugar backbone of the polynucleotide can be replaced by a backbone containing a guanamine, specifically an aminoethylglycine backbone. Nucleotides may retain and bind directly or indirectly to the aza nitrogen atom of the guanamine moiety of the backbone. The backbone of the PNA compound can comprise two or more than two linked amine ethylglycine units that produce a guanamine containing backbone for the PNA. The heterocyclic base moiety may be bonded directly or indirectly to the aza nitrogen atom of the guanamine moiety of the backbone. The guide nucleic acid can comprise a linked morpholino unit (ie, a morpholinyl nucleic acid) having a heterocyclic base attached to a morpholinyl ring. The linking group c can bond a morpholino monomer unit in the morpholino nucleic acid. Nonionic morpholino oligomeric compounds can interact less with cellular proteins. The morpholinyl-like polynucleotide can be a non-ionic mimetic of a guide nucleic acid. A wide variety of compounds within the morpholinyl group can be attached using different linking groups. Another type of polynucleotide mimetic can be referred to as cyclohexenyl nucleic acid (CeNA). The furanose ring normally present in the nucleic acid molecule can be replaced by a cyclohexenyl ring. CeNA DMT protected amino phosphate monomers can be prepared and synthesized for use in oligomeric compounds using amino phosphate chemistry. The incorporation of CeNA monomers into the nucleic acid strand increases the stability of the DNA/RNA hybrid. CeNA oligoadenylate forms a complex with a nucleic acid complement that is similar in stability to the native complex. Another modification may include a locked nucleic acid (LNA) in which a 2'-hydroxyl bond is bonded to the 4' carbon atom of the sugar ring thereby forming a 2'-C, 4'-C-formaldehyde bond thereby forming a bicyclic sugar moiety. The bond may be a group bridging a 2' oxygen atom and a methylene group (-CH2-) of a 4' carbon atom, wherein n is 1 or 2. LNA and LNA analogs can exhibit very high duplex thermostability with complementary nucleic acids (Tm = +3 to +10 °C) with stability towards 3'-exonuclease breakdown and good solubility characteristics. The guide nucleic acid can comprise one or more substituted sugar moieties. Suitable polynucleotides may comprise a sugar substituent selected from the group consisting of OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N- Or alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly suitable are O((CH2)nO) mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 and O(CH2)nON((CH2)nCH3)2, Wherein n and m are from 1 to about 10. The sugar substituent may be selected from a C1 to C10 lower alkyl group, a substituted lower alkyl group, an alkenyl group, an alkynyl group, an alkylaryl group, an aralkyl group, an O-alkylaryl group or an O-aralkyl group. SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkylaryl, aminoalkylamine, polyalkylamine a substituted decyl group, an RNA cleavage group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a guide nucleic acid, or a group for improving the pharmacodynamic properties of a guide nucleic acid, and the like Other substituents of the property. Suitable modifications may include 2'-methoxyethoxy (2'-O-CH2 CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE, ie alkoxy Alkoxy group). Other suitable modifications may include 2'-dimethylaminooxyethoxy, (i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE), and 2'-dimethyl Alkyl ethoxyethoxy (also known as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), ie, 2'-O-CH2-O- CH2-N(CH3)2. Other suitable sugar substituents may include methoxy (-O-CH3), amine propoxy (--OCH2CH2CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (--O--CH2-CH=CH2) and a fluorine group (F). The 2'-saccharide substituent can be in the arabin (upper) position or the ribose (lower) position. A suitable 2'-arabinose is modified to 2'-F. Similar modifications can be made at other positions on the oligomeric compound, specifically, the 3' position of the 3' terminal nucleoside or the 2'-5' linkage nucleotide and the 5' terminal nucleotide 5 'position. The oligomeric compound may also have a sugar mimetic (such as a cyclobutyl moiety) rather than a pentose saccharide. The guide nucleic acid can also include nucleobase (often referred to simply as "base") modifications or substituents. As used herein, "unmodified" or "natural" nucleobases may include purine bases (eg, adenine (A) and guanine (G)), and pyrimidine bases (eg, thoracic (adenosine) pyrimidine (T). ), cytosine (C) and uracil (U)). Modified nucleobases may include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-amino 6-methyl and other alkyl derivatives of adenine, adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymidine and 2 -thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and other alkynyl derivatives of cytosine and pyrimidine bases, 6-azouracil , cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and others 8-substituted adenine and guanine, 5-halo (specifically, 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine), 7-methylguanine and 7 - methyl adenine, 2-F-adenine, 2-amino adenine, 8-azaguanine and 8-azadenine, 7-azepineguanine and 7-deazadenine and 3- Denitrifying guanine and 3-deaza adenine. Modified nucleobases may include tricyclic pyrimidines, such as phenoxazine cytidine (1H-pyrimido(5,4-b)(1,4)benzoxazine-2(3H)-one), brown Thiazinium cytidine (1H-pyrimido(5,4-b)(1,4)benzothiazin-2(3H)-one); G-clip, such as substituted pyridoxine cytidine (eg 9-(2-aminoethoxy)-H-pyrimido(5,4-(b)(1,4)benzoxazine-2(3H)-one), azaindole nucleus Glycosides (2H-pyrimido(4,5-b)indol-2-one), pyridopyrene nucleosides (hydrogen (3',2':4,5)pyrrolo(2,3-d Pyrimidine-2-one). The heterocyclic base moiety may include such a base in which the purine or pyrimidine base is replaced by another heterocycle, for example, 7-deaza-adenine, 7-deazaguanosine, 2 -Aminopyridine and 2-pyridone. Nucleobases can be used to increase the binding affinity of polynucleotide compounds. These nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N- 6 and O-6 substituted oximes, including 2-aminopropyl adenine, 5-propynyl uracil and 5-propynyl cytosine. 5-methylcytosine substituents can doublet the nucleic acid The stability is increased by 0.6-1.2 ° C and may be a suitable base substituent (for example, when with 2'- When the O-methoxyethyl sugar is modified to bind.) The modification of the guide nucleic acid can comprise chemically bonding the guide nucleic acid to one or more portions or conjugates that enhance the activity, cell distribution or cellular uptake of the guide nucleic acid. The moiety or conjugate may comprise a conjugated group covalently bonded to a functional group such as a first hydroxyl group or a second hydroxyl group. The conjugate group may include, but is not limited to, an intercalating agent, a reporter molecule, a polyamine, a polyfluorene. Amine, polyethylene glycol, polyether, a group that enhances the pharmacodynamic properties of the oligomer, and a group that enhances the pharmacokinetic properties of the oligomer. Conjugation groups can include, but are not limited to, cholesterol, lipids , phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, luciferin, rhodamine, coumarin, and dyes. Groups that enhance the mechanical properties of the drug include improved uptake and enhanced resistance to decomposition. And/or a group that enhances sequence-specific hybridization using a target nucleic acid. Groups that enhance pharmacokinetic properties include groups that improve the uptake, distribution, metabolism, or secretion of nucleic acids. Conjugated moieties can include, but are not limited to, a lipid moiety, such as a cholesterol moiety, Cholic acid, thioether (eg hexyl-S-trityl mercaptan), thiocholesterol, aliphatic chain (eg dodecanediol or undecyl residue), phospholipid (eg di-hexadecyl) - racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-propanetriethoxy-3-H-phosphate), polyamine or polyethylene glycol chain or diamond An alkanoic acid; a soft lipid moiety; or an octadecylamine or a hexylamino-carbonyl-hydroxycholesterol moiety. Modifications may include a "protein transduction domain" or a PTD (ie, a cell penetrating peptide (CPP)). PTD may refer to Generation of polypeptides, polynucleotides, carbohydrates or organic or inorganic compounds that promote through lipid bilayers, micelles, cell membranes, organelle membranes or vesicle membranes. The PTD can be attached to another molecule that can range from a small polar molecule to a larger macromolecule and/or nanoparticle, and can help the molecule to pass through the membrane, for example, from the extracellular space into the intracellular space, Or cytosol to the organelle. The PTD can be covalently linked to the amine end of the polypeptide. PTD can be covalently linked to the carboxy terminus of the polypeptide. The PTD can be covalently linked to the nucleic acid. An exemplary PTD can include, but is not limited to, a minimal peptide protein transduction domain; comprising a plurality of arginine sufficient to direct access to the cell (eg, 3, 4, 5, 6, 7, 8, 9, 10, or 10 to 50 The arginine sequence of arginine, the VP22 domain, the Drosophila antennal mutated protein transduction domain, the truncated human calcitonin peptide, the polylysine and the transport protein, from the three arginine residues A arginine homopolymer of 50 arginine residues. The PTD can be an activatable CPP (ACPP). ACPP may comprise a polycationic CPP (eg, Arg9 or "R9") attached to a matching polyanion (eg, Glu9 or "E9") via a cleavable linker, which reduces the net charge to near zero and thereby inhibits adhesion And in the cells. Upon cleavage of the linker, the polyanion can be released, partially exposing the polyarginine and its inherent adhesion, thereby "activating" the ACPP to pass through the membrane. The invention provides a guide nucleic acid that directs the activity of an associated polypeptide (eg, a site-directed polypeptide) to a particular target sequence within a target nucleic acid. The guide nucleic acid can comprise nucleotides. The guide nucleic acid can be RNA. The guide nucleic acid can be DNA. The guide nucleic acid can comprise a single guide nucleic acid. The guide nucleic acid can comprise a gap extension and/or a tracrRNA extension. The spacer extension and/or tracrRNA extension can comprise elements that contribute to the additional functionality (eg, stability) of the guide nucleic acid. In some embodiments, the spacer extension and tracrRNA extension are selected as appropriate. The guide nucleic acid can comprise a spacer sequence. The spacer sequence can comprise a sequence that hybridizes to the target nucleic acid sequence. The spacer sequence can be a variable portion of the guide nucleic acid. The sequence of the spacer sequence can be genetically engineered to hybridize to the target nucleic acid sequence. A CRISPR repeat (also referred to as a minimal CRISPR repeat in this exemplary embodiment) can comprise a nucleotide that can hybridize to a tracrRNA sequence (ie, referred to as a minimal tracrRNA sequence in this exemplary embodiment). The minimal CRISPR repeat and the minimal tracrRNA sequence are interactive, and the interacting molecule comprises a base pair double stranded structure. In summary, minimal CRISPR repeats and minimal tracrRNA sequences can facilitate binding to site-directed polypeptides. The minimal CRISPR repeat and minimal tracrRNA sequences can be linked together to form a hairpin structure through a single guide linker. The 3' tracrRNA sequence can comprise a protospacer adjacent major structure recognition sequence. The 3' tracrRNA sequence may be identical or similar to one of the tracrRNA sequences. In some embodiments, the 3' tracrRNA sequence can comprise one or more hairpins. In some embodiments, the guide nucleic acid can comprise a single guide nucleic acid. The guide nucleic acid can comprise a spacer sequence. The spacer sequence can comprise a sequence that can hybridize to the target nucleic acid sequence. The spacer sequence can be a variable portion of the guide nucleic acid. The spacer sequence can be 5' of the first duplex. The first duplex can comprise a region of hybridization between the smallest CRISPR repeat and the minimal tracrRNA sequence. The first double chain may have a convex portion interposed therebetween. The bulging portion may comprise unpaired nucleotides. The bulging portion can aid in the addition of the site-directed polypeptide to the guide nucleic acid. The bulging portion can be followed by the first stem cell. The first stem cell can comprise a linker sequence that joins a minimal CRISPR repeat and a minimal tracrRNA sequence. The last pair of nucleotides at the 3' end of the first duplex can be ligated to the second linker sequence. The second linker can comprise a P domain. The second linker can bond the first double strand to the middle tracrRNA. In some embodiments, the medium tracrRNA can comprise one or more hairpin regions. For example, the medium tracrRNA can comprise a second stem cell and a third stem cell. In some embodiments, the guide nucleic acid can comprise a dual guide nucleic acid structure. Similar to a single guide nucleic acid construct, the dual guide nucleic acid construct can comprise a spacer extension, a spacer, a minimal CRISPR repeat, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and a tracrRNA extension. However, the dual guide nucleic acid may not contain a single guide linker. In fact, the minimal CRISPR repeat can comprise a 3' CRISPR repeat that can be similar or identical to a portion of the CRISPR repeat. Similarly, the minimal tracrRNA sequence can comprise a 5' tracrRNA sequence that can be similar or identical to a portion of a tracrRNA. The bi-guided RNA can be hybridized together via minimal CRISPR repeats and minimal tracrRNA sequences. In some embodiments, the first segment (ie, the guide segment) can include a spacer extension and a spacer. The guide nucleic acid can direct the binding polypeptide to a particular nucleotide sequence within the target nucleic acid via a guide fragment as mentioned above. In some embodiments, the second fragment (ie, the protein-binding fragment) can comprise a minimal CRISPR repeat, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and/or a tracrRNA extension sequence. The protein binding fragment of the guide nucleic acid can interact with the site-directed polypeptide. The protein-binding fragment of the guide nucleic acid can comprise two extensions of nucleotides that can hybridize to each other. The nucleotides of the protein-binding fragment can hybridize to form a double-stranded nucleic acid duplex. The double stranded nucleic acid duplex can be RNA. The double stranded nucleic acid duplex can be DNA. In some cases, the guide nucleic acid can comprise a spacer extension, a spacer, a minimal CRISPR repeat, a single guide linker, a minimal tracrRNA, a 3' tracrRNA sequence, and a tracrRNA extension in the order 5' to 3'. In some cases, the guide nucleic acid can comprise a tracrRNA extension, a 3' tracrRNA sequence, a minimal tracrRNA, a single guide linker, a minimal CRISPR repeat, a spacer, and a spacer extension in any order. The guide nucleic acid and the site-directed polypeptide can form a complex. The guide nucleic acid can provide a target specificity to the complex by a nucleotide sequence comprising a sequence that hybridizes to the target nucleic acid. In other words, a site-directed polypeptide can be directed to a nucleic acid sequence by virtue of its association with at least a protein-binding fragment of a guide nucleic acid. The guide nucleic acid can direct the activity of the Cas9 protein. The guide nucleic acid can direct the activity of the Cas9 protein to which the enzyme is not functioning. The methods of the invention can provide genetically modified cells. The genetically modified cell can comprise an exogenous guide nucleic acid and/or an exogenous nucleic acid comprising a nucleotide sequence encoding a guide nucleic acid.Spacer extension sequence The spacer extension sequence can provide stability and/or provide a location for modification of the guide nucleic acid. The spacer extension sequence can have a length of from about 1 nucleotide to about 400 nucleotides. The spacer extension sequence can have more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220 , 240, 260, 280, 300, 320, 340, 360, 380, 40, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides in length. The spacer extension sequence can have less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220 The length of 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides. The spacer extension sequence can be less than 10 nucleotides in length. The spacer extension sequence can be between 10 and 30 nucleotides in length. The spacer extension sequence can be between 30 and 70 nucleotides in length. The spacer extension sequence can comprise a portion (eg, a stability control sequence, an endonuclease binding sequence, a ribonuclease). Part of it can affect the stability of RNA targeted by nucleic acids. A portion may be a transcription terminator fragment (i.e., a transcription termination sequence). The portion of the guide nucleic acid can have from about 10 nucleotides to about 100 nucleotides, from about 10 nucleotides (nt) to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, From about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, about 15 nucleotides (nt) to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt or about 15 nt to about 25 nt in total length. Some may be part that can function in eukaryotic cells. In some cases, a portion may be a moiety that can function in prokaryotic cells. Some may be part that can function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties can include: a 5' cap (eg, a 7-methylguanylic acid cap (m7G)), a riboswitch sequence (eg, to allow stability through regulation of protein and protein complexes and/or Or the feasibility of regulation), the formation of a sequence of dsRNA duplexes (ie, hairpins), targeting of RNA to subcellular locations (eg, nucleus, mitochondria, chloroplasts, and the like), providing traced modifications or sequences (eg, direct conjugation to fluorescent molecules, conjugation to portions that facilitate fluorescence detection, sequences that allow for fluorescent detection, etc.), for proteins (eg, proteins that act on DNA, including transcriptional activators, transcription) Modifications or sequences of binding sites for inhibitors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like, providing increase, decrease, and/or Alternatively, the modification or sequence of stability, or any combination thereof, can be controlled. The spacer extension sequence can comprise a primer binding site, a molecular index (eg, a barcode sequence). The spacer extension sequence can comprise a nucleic acid affinity tag.Spacer The guide fragment of the guide nucleic acid can comprise a nucleotide sequence (e.g., a spacer) that can hybridize to a sequence in the target nucleic acid. The spacers of the guide nucleic acid can interact with the target nucleic acid via hybridization (i.e., base pairing) in a sequence-specific manner. Thus, the nucleotide sequence of the spacer can be varied and the position at which the guide nucleic acid within the target nucleic acid interacts with the target nucleic acid can be determined. The spacer sequence can hybridize to a target nucleic acid located 5' to the adjacent major structure (PAM) of the spacer. Different organisms can contain different PAM sequences. For example, in S. pyogenes, the PAM can be a sequence in a target nucleic acid comprising the sequence 5'-XRR-3', wherein R can be A or G, wherein X is any nucleotide and X is 3' of the target nucleic acid sequence targeted by the spacer sequence. The target nucleic acid sequence can be 20 nucleotides. The target nucleic acid can be less than 20 nucleotides. The target nucleic acid can be at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid can be up to 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid sequence can be 20 bases and is followed by 5' of the first nucleotide of the PAM. For example, in a sequence comprising 5'-NNNNNNNNNNNNNNNNNNNNXRR-3', the target nucleic acid can be a sequence corresponding to N', wherein N is any nucleotide. The guide sequence of the spacer that can hybridize to the target nucleic acid can have a length of at least about 6 nt. For example, a spacer sequence that can hybridize to a target nucleic acid can have at least about 6 nt, at least about 10 nt, at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least About 30 nt, at least about 35 nt or at least about 40 nt, about 6 nt to about 80 nt, about 6 nt to about 50 nt, about 6 nt to about 45 nt, about 6 nt to about 40 nt, about 6 nt to About 35 nt, about 6 nt to about 30 nt, about 6 nt to about 25 nt, about 6 nt to about 20 nt, about 6 nt to about 19 nt, about 10 nt to about 50 nt, about 10 nt to about 45 Nt, from about 10 nt to about 40 nt, from about 10 nt to about 35 nt, from about 10 nt to about 30 nt, from about 10 nt to about 25 nt, from about 10 nt to about 20 nt, from about 10 nt to about 19 nt, From about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, about 19 Nt to about 60 nt, about 20 nt to about 25 nt, about 20 nt to about 30 nt, about 20 nt to about 35 nt, about 20 nt to about 40 nt, about 20 nt to about 45 nt, about 20 nt to A length of about 50 nt, or about 20 nt to about 60 nt. In some cases, the spacer sequence that can hybridize to the target nucleic acid can be 20 nucleotides in length. The spacer of the hybridizable target nucleic acid can be 19 nucleotides in length. The percentage complementarity between the spacer sequence and the target nucleic acid can be at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least About 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. The percentage complementarity between the spacer sequence and the target nucleic acid can be up to about 30%, up to about 40%, up to about 50%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 80%, up to about 85%, up to about 90%, up to about 95%, up to about 97%, up to about 98%, up to about 99% or 100%. In some cases, the percent complementarity between the spacer sequence and the target nucleic acid can be 100% beyond the six adjacent 5'-maximum nucleotides of the target sequence of the complementary strand of the target nucleic acid. In some cases, the percent complementarity between the spacer sequence and the target nucleic acid can exceed at least 60% beyond about 20 contiguous nucleotides. In some cases, the percent complementarity between the spacer sequence and the target nucleic acid can be 100% over the fourteen adjacent 5'-maximum nucleotides of the target sequence of the complementary strand of the target nucleic acid, and as low as 0% over The rest. In this case, the length of the spacer sequence can be considered to be 14 nucleotides. In some cases, the percent complementarity between the spacer sequence and the target nucleic acid can be 100% beyond the six adjacent 5'-maximum nucleotides of the target sequence of the complementary strand of the target nucleic acid and as low as 0% beyond the remainder . In this case, the length of the spacer sequence can be considered to be 6 nucleotides. The target nucleic acid can be more than about 50%, 60%, 70%, 80%, 90% or 100% complementary to the provenance region of the crRNA. The target nucleic acid can be less than about 50%, 60%, 70%, 80%, 90%, or 100% complementary to the source region of the crRNA. The spacer fragment of the guide nucleic acid can be modified (eg, by genetic engineering) to hybridize to any desired sequence within the target nucleic acid. For example, a spacer can be genetically engineered (eg, designed to be programmed) to be included in cancer, cell growth, DNA replication, DNA repair, HLA genes, cell surface proteins, T cell receptors, immunoglobulin genes Sequence hybridization in a target nucleic acid in a tumor suppressor gene, a microRNA gene, a long non-coding RNA gene, a transcription factor, a globin, a viral protein, a mitochondrial gene, and the like. The spacer sequence can be identified using a computer program such as a machine readable code. Computer programs such as predictive melting temperature, secondary structural rock formation and predicted annealing temperature, sequence identity, genomic context, chromosome accessibility, % GC, frequency of genomic occurrence, methylation status, presence of SNPs, and the like Variables.Minimum CRISPR Repeat sequence The minimal CRISPR repeat may be at least about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, with reference to a CRISPR repeat (eg, a crRNA from S. pyogenes), Sequence of 90%, 95% or 100% sequence identity and/or sequence homology. The minimal CRISPR repeat may be up to about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85% with reference to a CRISPR repeat (eg, a crRNA from S. pyogenes). a sequence of 90%, 95% or 100% sequence identity and/or sequence homology. The minimal CRISPR repeat can comprise a nucleotide that can hybridize to the minimal tracrRNA sequence. The minimal CRISPR repeat and the minimal tracrRNA sequence can be formed into a base pair double stranded structure. In summary, minimal CRISPR repeats and minimal tracrRNA sequences can facilitate binding to site-directed polypeptides. Portions of the minimal CRISPR repeat can hybridize to the minimal tracrRNA sequence. Portions of the minimal CRISPR repeat may be at least about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to the minimal tracrRNA sequence. A portion of the minimal CRISPR repeat can be up to about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the minimal tracrRNA sequence . The minimal CRISPR repeat can have a length of from about 6 nucleotides to about 100 nucleotides. For example, a minimal CRISPR repeat can have from about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, about 6 Nt to about 20 nt, about 6 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt or about 8 nt to Approximately 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt or about 15 nt to about 25 The length of nt. In some embodiments, the minimum CRISPR repeat is about 12 nucleotides in length. The minimal CRISPR repeat may span at least about 60% of a segment of at least 6, 7, or 8 contiguous nucleotides identical to a reference minimal CRISPR repeat (eg, wild-type crRNA from S. pyogenes). The minimal CRISPR repeat may span at least about 60% of a segment of at least 6, 7, or 8 contiguous nucleotides identical to a reference minimal CRISPR repeat (eg, wild-type crRNA from S. pyogenes). For example, a minimal CRISPR repeat can span at least about 65% of a reference minimum CRISPR repeat, spanning at least about 6, 7 or 8 contiguous nucleotides, at least about 70% identical, at least about 75% identical, at least about 80 % identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100% identical.Minimum tracrRNA sequence The minimal tracrRNA sequence can be at least about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85% with a reference tracrRNA sequence (eg, wild type tracrRNA from S. pyogenes). , 90%, 95% or 100% sequence identity and/or sequence homology. The minimal tracrRNA sequence can be up to about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85% with a reference tracrRNA sequence (eg, wild-type tracrRNA from S. pyogenes). , 90%, 95% or 100% sequence identity and/or sequence homology. The minimal tracrRNA sequence can comprise nucleotides that hybridize to the smallest CRISPR repeat. The minimal tracrRNA sequence and the minimal CRISPR repeat can form a base pair double stranded structure. In summary, minimal tracrRNA sequences and minimal CRISPR repeats can aid in binding to site-directed polypeptides. Portions of the minimal tracrRNA sequence can hybridize to the minimal CRISPR repeat. A portion of the minimal tracrRNA sequence can be about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the minimal CRISPR repeat. The minimal tracrRNA sequence can have a length of from about 6 nucleotides to about 100 nucleotides. For example, a minimal tracrRNA sequence can have from about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, about 6 nt to about 20 nt, about 6 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt or about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt or about 15 nt to about 25 nt in length. In some embodiments, the minimal tracrRNA sequence is about 14 nucleotides in length. The minimal tracrRNA sequence can be at least about 60% identical to a reference minimal tracrRNA (eg, a wild-type tracrRNA from S. pyogenes) sequence spanning at least one of six, seven or eight contiguous nucleotides. The minimal tracrRNA sequence can be at least about 60% identical to a reference minimal tracrRNA (eg, a wild-type tracrRNA from S. pyogenes) sequence spanning at least one of six, seven or eight contiguous nucleotides. For example, a minimal tracrRNA sequence can span at least about 65% of a reference minimum tracrRNA sequence, at least about 70% identical, at least about 75% identical, at least about 80% identical across at least 6, 7, or 8 contiguous nucleotides. At least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical. The double strand between the minimal CRISPR RNA and the minimal tracrRNA may comprise a double helix. The first base of the first strand of the double strand can be guanine. The first base of the first strand of the double strand can be adenine. The double strand between the minimal CRISPR RNA and the minimal tracrRNA can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The double strand between the minimal CRISPR RNA and the minimal tracrRNA can comprise up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. Double strands can contain mismatches. The double strand can comprise at least about 1, 2, 3, 4 or 5 or a mismatch. The double strand can comprise up to about 1, 2, 3, 4 or 5 or a mismatch. In some cases, the double strand contains no more than 2 mismatches.Protruding part A bulge can refer to an unpaired region of a nucleotide consisting of a minimal CRISPR repeat and a minimal tracrRNA sequence within a double strand. The bulging moiety can be important in binding to a site-directed polypeptide. The bulging moiety may comprise an unpaired 5'-XXXY-3' on one side of the double strand and an unpaired nucleotide region on the other side of the double strand, wherein X is any 嘌呤 and Y may be A nucleotide that forms a wobble pair with a nucleotide on the opposite strand. For example, the bulging portion may comprise an unpaired 嘌呤 (eg, adenine) on the smallest CRISPR repeating strand of the bulging portion. In some embodiments, the bulging portion can comprise an unpaired 5'-AAGY-3' of the minimal tracrRNA sequence strand of the bulge, wherein Y can be a nucleus that can form a oscillating pair with the nucleotides on the minimal CRISPR repeat strand Glycosylate. The bulging portion on the first side of the double strand (eg, the smallest CRISPR repeating side) can comprise at least 1, 2, 3, 4, or 5 or more unpaired nucleotides. The bulging portion on the first side of the double strand (eg, the smallest CRISPR repeating side) can comprise up to 1, 2, 3, 4, or 5 or more unpaired nucleotides. The bulging portion on the first side of the double strand (e.g., the smallest CRISPR repeating side) can comprise one unpaired nucleotide. The bulging portion on the second side of the double strand (eg, the smallest tracrRNA sequence side of the double strand) may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nuclei Glycosylate. The bulge on the second side of the double strand (eg, the smallest tracrRNA sequence side of the double strand) may comprise up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleosides acid. The bulge on the second side of the double strand (eg, the smallest tracrRNA sequence side of the double strand) can comprise 4 unpaired nucleotides. The regions of different numbers of unpaired nucleotides on each strand of the double strand can be paired together. For example, the bulging portion can comprise 5 unpaired nucleotides from the first strand and 1 unpaired nucleotide from the second strand. The bulging portion may comprise 4 unpaired nucleotides from the first strand and 1 unpaired nucleotide from the second strand. The bulging portion may comprise 3 unpaired nucleotides from the first strand and 1 unpaired nucleotide from the second strand. The bulging portion may comprise 2 unpaired nucleotides from the first strand and 1 unpaired nucleotide from the second strand. The bulging portion may comprise one unpaired nucleotide from the first strand and one unpaired nucleotide from the second strand. The bulging portion may comprise one unpaired nucleotide from the first strand and two unpaired nucleotides from the second strand. The bulging portion may comprise one unpaired nucleotide from the first strand and three unpaired nucleotides from the second strand. The bulging portion may comprise one unpaired nucleotide from the first strand and four unpaired nucleotides from the second strand. The bulging portion may comprise one unpaired nucleotide from the first strand and five unpaired nucleotides from the second strand. In some cases, the raised portion can include at least one wobble pair. In some cases, the raised portion can include at most one swing pair. The bulging portion sequence can comprise at least one purine nucleotide. The bulging portion sequence can comprise at least 3 purine nucleotides. The bulging portion sequence can comprise at least 5 purine nucleotides. The bulging portion sequence can comprise at least one guanine nucleotide. The bulging portion sequence can comprise at least one adenine nucleotide.P - Domain ( P - DOMAIN ) A P-domain can refer to a region of a guide nucleic acid that recognizes a protospacer adjacent major structure (PAM) in a target nucleic acid. The P-domain can hybridize to the PAM in the target nucleic acid. Thus, the P-domain can comprise a sequence that is complementary to the PAM. The P-domain can be located from the 3' to the smallest tracrRNA sequence. The P-domain can be localized within the 3' tracrRNA sequence (ie, the middle tracrRNA sequence). p starts at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more of the smallest pair of nucleotides in the smallest CRISPR repeat and the smallest tracrRNA sequence duplex Nucleotides 3'. The P-domain can initiate at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more of the smallest CRISPR repeat and the last pair of nucleotides in the smallest tracrRNA sequence duplex Nucleotides 3'. The P-domain may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more contiguous nucleotides. The P-domain may comprise up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more contiguous nucleotides. In some cases, the P-domain can comprise a CC dinucleotide (ie, two consecutive cytosine nucleotides). The CC dinucleotide can interact with the GG dinucleotide of the PAM, wherein the PAM comprises a 5'-XGG-3' sequence. The P-domain can be a nucleotide sequence located in a 3' tracrRNA sequence (ie, a middle tracrRNA sequence). The P-domain may comprise double-stranded nucleotides (eg, nucleotides in a hairpin hybridization type together). For example, the P-domain can comprise a CC dinucleotide that hybridizes to a GG dinucleotide in a hairpin duplex of a 3' tracrRNA sequence (ie, a middle tracrRNA sequence). The activity of the P-domain (e.g., the ability of the guide nucleic acid to target the target nucleic acid) can be modulated by the hybridization state of P-DOMAIN. For example, if the P-domain is crossed, the guide nucleic acid may not recognize its target. If the P-domain is crossed, the guide nucleic acid can recognize its target. The P-domain interacts with the P-domain interaction region within the site-directed polypeptide. The P-domain interacts with a arginine-rich alkaline patch in a site-directed polypeptide. The P-domain interaction region can interact with the PAM sequence. The P-domain can comprise a stem cell loop. The P-domain can comprise a bulge. The 3' tracrRNA sequence 3' tracrRNA sequence can be at least about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80% with a reference tracrRNA sequence (eg, tracrRNA from S. pyogenes). , 85%, 90%, 95% or 100% sequence identity and/or sequence homology. The 3' tracrRNA sequence can be up to about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85 with a reference tracrRNA sequence (eg, wild-type tracrRNA from S. pyogenes). %, 90%, 95% or 100% sequence identity and/or sequence homology. The 3' tracrRNA sequence can have a length of from about 6 nucleotides to about 100 nucleotides. For example, a 3' tracrRNA sequence can have from about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, about 6 nt to About 25 nt, about 6 nt to about 20 nt, about 6 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to About 25 nt, about 8 nt to about 20 nt or about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to About 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt or about 15 nt to about 25 nt in length. In some embodiments, the 3' tracrRNA sequence is about 14 nucleotides in length. The 3' tracrRNA sequence can be at least about 60% identical to a reference 3' tracrRNA (eg, a wild type 3' tracrRNA from S. pyogenes) sequence spanning at least one of six, seven or eight contiguous nucleotides. For example, a 3' tracrRNA sequence can span at least about 60% of a reference 3' tracrRNA sequence (eg, a wild type 3' tracrRNA sequence from S. pyogenes) across at least 6, 7 or 8 contiguous nucleotides, At least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100% identical. The 3' tracrRNA sequence can comprise more than one double-stranded region (eg, a hairpin hybridization region). The 3' tracrRNA sequence can comprise two double stranded regions. The 3' tracrRNA sequence can also be referred to as a middle tracrRNA. The medium tracrRNA sequence can comprise a stem cell loop structure. In other words, the medium tracrRNA sequence can comprise a hair clip that is different from the second stem cell or the third stem cell. The stem cell loop structure in the middle tracrRNA (i.e., 3' tracrRNA) can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides. The stem cell loop structure in the middle tracrRNA (i.e., 3' tracrRNA) can comprise up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The stem cell loop structure can comprise a functional moiety. For example, a stem cell loop structure can comprise an aptamer, a ribonuclease, a protein interaction hairpin, a CRISPR array, an intron, and an exon. The stem cell loop structure can comprise at least about 1, 2, 3, 4 or 5 or more functional moieties. The stem cell loop structure can comprise up to about 1, 2, 3, 4 or 5 or more functional moieties. The hairpin in the middle tracrRNA sequence may comprise a P-domain. The P-domain can comprise a double-stranded region in the hairpin.tracrRNA Extended sequence The tracrRNA extension sequence provides stability and/or provides a location for modification of the guide nucleic acid. The tracrRNA extension sequence can have a length of from about 1 nucleotide to about 400 nucleotides. The tracrRNA extension sequence can have more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 or more nucleotides in length. The tracrRNA extension sequence can have a length of from about 20 to about 5,000 or more nucleotides. The tracrRNA extension sequence can have a length of more than 1000 nucleotides. The tracrRNA extension sequence can have less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 nucleotides in length. The tracrRNA extension sequence can have a length of less than 1000 nucleotides. The tracrRNA extension sequence can be less than 10 nucleotides in length. The tracrRNA extension sequence can be between 10 and 30 nucleotides in length. The tracrRNA extension sequence can be between 30 and 70 nucleotides in length. The tracrRNA extension sequence may comprise a portion (eg, a stability control sequence ribonuclease, an endoribonuclease binding sequence). Part of it can affect the stability of nucleic acid targeting RNA. A portion may be a transcription terminator fragment (i.e., a transcription termination sequence). The portion of the guide nucleic acid can have from about 10 nucleotides to about 100 nucleotides, from about 10 nucleotides (nt) to about 20 nt, from about 20 nt to about 30 nt, about 30 nt to About 40 nt, about 40 nt to about 50 nt, about 50 nt to about 60 nt, about 60 nt to about 70 nt, about 70 nt to about 80 nt, about 80 nt to About 90 nt, or about 90 nt to about 100 nt, about 15 nucleotides (nt) to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt A total length of from about 15 nt to about 30 nt or from about 15 nt to about 25 nt. Some may be part that can function in eukaryotic cells. In some cases, a portion may be a moiety that can function in prokaryotic cells. Some may be part that can function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable tracrRNA extensions include: 3' polyadenosine tails, ribose switching sequences (eg, to allow for stability and/or regulation of regulation by protein and protein complexes), formation of dsRNA pairs a sequence of strands (ie, hairpins), sequences that target RNA to subcellular locations (eg, nucleus, mitochondria, chloroplasts, and the like), provide tracking modifications or sequences (eg, direct conjugation to fluorescent molecules) , to conjugates that promote fluorescence detection, sequences that allow fluorescence detection, etc.), for proteins (eg, proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA) Modifications or sequences of binding sites for demethylase, histone acetyltransferase, histone deacetylase, and the like, providing modifications, or sequences that increase, decrease, and/or control stability, Or any combination thereof. A tracrRNA extension sequence can comprise a primer binding site, a molecular index (eg, a barcode sequence). In some embodiments of the invention, the tracrRNA extension sequence may comprise one or more affinity markers.Single guide nucleic acid The guide nucleic acid can be a single guide nucleic acid. A single guide nucleic acid can be RNA. A single guide nucleic acid can comprise a linker between a minimal CRISPR repeat and a minimal tracrRNA sequence that can be referred to as a single guide linker sequence. A single guide linker of a single guide nucleic acid can have a length of from about 3 nucleotides to about 100 nucleotides. For example, a linker can have from about 3 nucleotides (nt) to about 90 nt, from about 3 nt to about 80 nt, from about 3 nt to about 70 nt, from about 3 nt to about 60. Nt, about 3 nt to about 50 nt, about 3 nt to about 40 nt, about 3 nt to about 30 nt, about 3 nt to about 20 nt or about 3 nt to about 10 The length of nt. For example, a linker can have from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, about 20 From nt to about 25 nt, about 25 nt to about 30 nt, about 30 nt to about 35 nt, about 35 nt to about 40 nt, about 40 nt to about 50 nt, about 50 From nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt in length . In some embodiments, the linker of a single guide nucleic acid is between 4 and 40 nucleotides. The linker can have a length of at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500 or 7000 or more nucleotides. The linker can have a length of up to about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500 or 7000 or more nucleotides. A linker sequence can include a functional moiety. For example, a linker sequence can comprise an aptamer, a ribonuclease, a protein interaction hairpin, a CRISPR array, an intron, and an exon. The linker sequence can comprise at least about 1, 2, 3, 4 or 5 or more functional moieties. The linker sequence can comprise up to about 1, 2, 3, 4 or 5 or more functional moieties. In some embodiments, a single guide connector can link the 3' end of the minimal CRISPR repeat to the 5' end of the minimal tracrRNA sequence. Alternatively, a single guide connector can link the 3' end of the tracrRNA sequence to the 5' end of the minimal CRISPR repeat. That is, a single guide nucleic acid can comprise a 5' DNA-binding fragment linked to a 3' protein-binding fragment. A single guide nucleic acid can comprise a 5' protein-binding fragment linked to a 3' DNA-binding fragment. The guide nucleic acid may comprise a spacer extension sequence of from 10 to 5000 nucleotides in length; a spacer sequence of from 12 to 30 nucleotides in length, wherein at least 50% of the spacer is complementary to the target nucleic acid; the minimum CRISPR repeat comprises a span of 6 , 7 or 8 contiguous nucleotides are at least 60% identical to a crRNA from a prokaryote (eg, S. pyogenes) or phage and wherein the smallest CRISPR repeat is 5 to 30 nucleotides in length; the smallest tracrRNA sequence comprises 6 , 7 or 8 contiguous nucleotides are at least 60% identical to tracrRNA from bacteria (eg, S. pyogenes) and wherein the smallest tracrRNA sequence is 5 to 30 nucleotides in length; ligated minimal CRISPR repeats with minimal tracrRNA and a linker sequence of from 3 to 5000 nucleotides in length; comprising a 3' tracrRNA that is at least 60% identical to a tracrRNA from a prokaryote (eg, S. pyogenes) or phage across 6, 7, or 8 contiguous nucleotides And wherein the 3' tracrRNA comprises a length from 10 to 20 nucleotides and comprises a double stranded region; and/or comprises a tracrRNA extension of 10 to 5000 nucleotides in length, or any combination thereof. This guide nucleic acid can be referred to as a single guide nucleic acid. The guide nucleic acid may comprise a spacer extension sequence from 10 to 5000 nucleotides in length; a spacer sequence of 12 to 30 nucleotides in length, wherein at least 50% of the spacer is complementary to the target nucleic acid; the double strand comprises 1) 6 consecutive nucleotides are at least 60% identical to the smallest CRISPR repeat from a prokaryotic (eg, S. pyogenes) or phage crRNA and wherein the smallest CRISPR repeat is 5 to 30 nucleotides in length, 2) contains a span of 6 a contiguous nucleotide having a minimum tracrRNA sequence that is at least 60% identical to a tracrRNA from a bacterium (eg, S. pyogenes) and wherein the smallest tracrRNA sequence is 5 to 30 nucleotides in length, and 3) a bulge, wherein The bulging portion comprises at least 3 unpaired nucleotides on the smallest CRISPR repeating strand of the double strand and at least 1 unpaired nucleotide in the minimal tracrRNA sequence strand of the double strand; the linker connecting the minimal CRISPR repeat with the smallest tracrRNA a sequence comprising from 3 to 5000 nucleotides in length; comprising a 3' tracrRNA that is at least 60% identical to a tracrRNA from a prokaryote (eg, S. pyogenes) or a phage across 6 contiguous nucleotides, wherein the 3' tracrRNA Containing a length from 10 to 20 nucleotides and comprising a double-stranded region; the P-domain from 1 to 5 nucleotides downstream of the double strand comprising the smallest CRISPR repeat and the smallest tracrRNA comprises 1 to 10 nucleotides , comprising a sequence that hybridizes to a proximal host adjacent to the protospacer in the target nucleic acid, can form a hairpin, and is positioned in the 3' tracrRNA region; and/or comprises a tracrRNA extension of 10 to 5000 nucleotides in length, Or any combination thereof.Double-guided nucleic acid The guide nucleic acid can be a dual guide nucleic acid. The dual guide nucleic acid can be RNA. A dual guide nucleic acid can comprise two separate nucleic acid molecules (ie, a polynucleotide). Each of the two nucleic acid molecules of the dual-guide nucleic acid can comprise a double-stranded duplex that can hybridize to one of the nucleotides of the nucleic acid such that the complementary nucleotides of the two nucleic acid molecules hybridize to form a protein-binding fragment. If not listed, reference is made to both single molecule guided nucleic acids and molecularly guided nucleic acids, and the term "guide nucleic acid" can be inclusive. A bi-guided nucleic acid can comprise 1) a spacer extension sequence comprising from 10 to 5000 nucleotides in length; a spacer sequence of 12 to 30 nucleotides in length, wherein at least 50% of the spacer is complementary to the target nucleic acid; 6 consecutive nucleotides are at least 60% identical to the smallest CRISPR repeat from a prokaryotic (eg, Streptococcus pyogenes) or phage crRNA and wherein the minimum CRISPR repeat is 5 to 30 nucleotides in length; and 2) double guide The second nucleic acid molecule of the nucleic acid can comprise a minimal tracrRNA sequence comprising at least 60% identical to the tracrRNA from a prokaryote (eg, S. pyogenes) or phage spanning 6 consecutive nucleotides and wherein the length of the smallest tracrRNA sequence is 5 to 30 nucleotides; comprising a 3' tracrRNA that is at least 60% identical to a tracrRNA from a bacterium (eg, S. pyogenes) spanning 6 consecutive nucleotides and wherein the 3' tracrRNA comprises from 10 to 20 nucleuses The length of the nucleotide, and comprising a double-stranded region; and/or a tracrRNA extension comprising a length of 10 to 5000 nucleotides, or any combination thereof. In some cases, the dual guide nucleic acid can comprise 1) a first nucleic acid molecule comprising a spacer extension of 10 to 5000 nucleotides in length; a spacer sequence of 12 to 30 nucleotides in length, wherein the spacer is at least 50 % is complementary to the target nucleic acid; comprises a minimum CRISPR repeat that is at least 60% identical to a nucleic acid of a prokaryote (eg, S. pyogenes) or phage spanning 6 consecutive nucleotides and wherein the smallest CRISPR repeat is 5 to 30 nucleosides in length Acid, and at least 3 unpaired nucleotides of the bulge; and 2) the second nucleic acid molecule of the double-guided nucleic acid can comprise a minimal tracrRNA sequence comprising spanning 6 contiguous nucleotides and from a prokaryote ( For example, Streptococcus pyogenes or phage tracrRNA is at least 60% identical and wherein the smallest tracrRNA sequence is 5 to 30 nucleotides in length and at least one unpaired nucleotide of the bulge, wherein one of the bulges Unpaired nucleotides are located in the same bulge as the three unpaired nucleotides of the smallest CRISPR repeat; contain tracrR spanning 6 contiguous nucleotides from prokaryotes (eg, S. pyogenes) or phage NA is at least 60% identical to the 3' tracrRNA and wherein the 3' tracrRNA comprises a length of 10 to 20 nucleotides and comprises a double-stranded region; from 1 to 5 nucleotides downstream of the double strand comprising the smallest CRISPR repeat and the smallest tracrRNA The initial P-domain comprises from 1 to 10 nucleotides, comprising a sequence that hybridizes to a proximal host adjacent to the protospacer in the target nucleic acid, can form a hairpin, and is positioned in the 3' tracrRNA region; and/or A tracrRNA extension comprising 10 to 5000 nucleotides in length, or any combination thereof.Guided nucleic acid and complex of peptides The guide nucleic acid can interact with a site-directed polypeptide (eg, a nucleic acid-guided nuclease, Cas9), thereby forming a complex. The guide nucleic acid can direct the targeted polypeptide to a target nucleic acid. In some embodiments, the guide nucleic acid can be genetically engineered such that the complex (eg, comprising a site-directed polypeptide and a guide nucleic acid) can bind outside of the cleavage site of the site-directed polypeptide. In this case, the target nucleic acid may not interact with the complex and the target nucleic acid may be excised (eg, without the complex). In some embodiments, the guide nucleic acid can be genetically engineered such that the complex can bind within the cleavage site of the site-directed polypeptide. In this case, the target nucleic acid can interact with the complex and can bind to the target nucleic acid (eg, to the complex). Any of the guide nucleic acids of the present invention, the site-directed polypeptides of the present invention, effector proteins, multiplexed genetic targeting agents, donor polynucleotides, tandem fusion proteins, reporter elements, related genetic elements, must be executed The components of the cleavage system and/or any nucleic acid or protein molecule of embodiments of the methods of the invention may be recombined, purified, and/or isolated. In some embodiments, the methods comprise modifying a mutation of a nucleic acid molecule using a CRISPR/Cas system. In some embodiments, the mutation is a substitution, insertion or deletion. In some embodiments, the mutation is a single nucleotide polymorphism. In some cases, the target sequence is between 10 and 30 nucleotides in length. In some cases, the target sequence is between 15 and 30 nucleotides in length. In some cases, the length of the target sequence is about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. Nucleotides. In some cases, the target sequence is about 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides in length. In some cases, the CRISPR/Cas system utilizes the Cas9 enzyme or a variant thereof. In some embodiments, the methods and cells disclosed herein utilize a polynucleotide encoding a Cas9 enzyme or a variant thereof. In some embodiments, Cas9 is a double-stranded nuclease having two active cleavage sites, one for each strand of the double helix. In some cases, the Cas9 enzyme or variant thereof produces a double-strand break. In some embodiments, the Cas9 enzyme is a wild type Cas9 enzyme. In some embodiments, the Cas9 enzyme is a naturally occurring variant or a mutant wild-type Cas9 enzyme or a Streptococcus pyogenes Cas9 enzyme. The variant may be an enzyme that is partially homologous to the wild-type Cas9 enzyme while maintaining Cas9 nuclease activity. The variant may be an enzyme comprising only a portion of the wild-type Cas9 enzyme while maintaining Cas9 nuclease activity. In some embodiments, the wild type Cas9 enzyme is a Streptococcus pyogenes (S. pyogenes) Cas9 enzyme. In some embodiments, the wild type Cas9 enzyme is represented by the amino acid sequence given GenBank ID AKP81606.1. In some embodiments, the variant is at least about 95% homologous to the amino acid sequence given GenBank ID AKP81606.1. In some embodiments, the variant is at least about 90% homologous to the amino acid sequence given GenBank ID AKP81606.1. In some embodiments, the variant is at least about 80% homologous to the amino acid sequence given GenBank ID AKP81606.1. In some embodiments, the variant is at least about 70% homologous to the amino acid sequence given GenBank ID AKP81606.1. In some cases, the Cas9 enzyme is a wild type Cas9 enzyme modification that optimizes the Cas9 enzyme from the best performance and/or activity used in the cells described herein. In some embodiments, the Cas9 enzyme is a modified Cas9 enzyme, wherein the modified Cas9 enzyme comprises a Cas9 enzyme or variant thereof and an additional amino acid sequence as described herein. As a non-limiting example, the additional amino acid sequence can provide additional activity, stability or recognition tag/barcode to the Cas9 enzyme or variant thereof. The naturally occurring S. pyogenes Cas9 enzyme cleaves the DNA to create a double-strand break. In some embodiments, the Cas9 enzyme disclosed herein acts as a Cas9 nickase, wherein the Cas9 nickase is a Cas9 enzyme that has been modified to cleave the target sequence to produce a single strand break. In some embodiments, the methods disclosed herein comprise the use of a Cas9 nickase having more than one guide RNA targeting the target sequence to decompose each DNA strand in the staggered pattern at the target sequence. In some embodiments, the use of two guide RNAs with a Cas9 nickase can increase the target specificity of the CRISPR/Cas system disclosed herein. In some embodiments, the use of two or more than two guide RNAs can result in the generation of a genome deletion. In some embodiments, the genome deletion is a deletion of from about 5 nucleotides to about 50,000 nucleotides. In some embodiments, the genome deletion is a deletion of from about 5 nucleotides to about 1,000 nucleotides. In some embodiments, the methods disclosed herein comprise the use of a plurality of guide RNAs. In some embodiments, the plurality of guide RNAs target a single gene. In some embodiments, the plurality of guide RNAs target a plurality of genes. In some cases, the specificity of the guide RNA for the target sequence is about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or higher. In some cases, the guide RNA has a target binding rate of less than about 20%, 15%, 10%, 5%, 3%, 1%, or less. In some embodiments, the specificity of the guide RNA that hybridizes to the target sequence has about 95%, 98%, 99%, 99.5%, or 100% sequence complementarity to the target sequence. In some cases, the hybridization is a highly stringent hybridization condition. In some embodiments, the guide RNA targets a nuclease to a gene encoding a neuroretinogenic leucine zipper (NRL) protein. In some embodiments, the guide RNA comprises a sequence that hybridizes to a target sequence of an NRL-encoding gene. In some embodiments, the target sequence is selected from the group consisting of SEQ ID NOS: 1-2. In some embodiments, the target sequence is at least 90% homologous to a sequence selected from the group consisting of SEQ ID NOS: 1-2. In some embodiments, the target sequence is at least about 80% homologous to a sequence selected from the group consisting of SEQ ID NOS: 1-2. In some embodiments, the target sequence is at least about 85% homologous to a sequence selected from the group consisting of SEQ ID NOS: 1-2. In some embodiments, the target sequence is at least about 90% homologous to a sequence selected from the group consisting of SEQ ID NOS: 1-2. In some embodiments, the target sequence is at least about 95% homologous to a sequence selected from the group consisting of SEQ ID NOS: 1-2. In some embodiments, the guide RNA targets a nuclease to a gene encoding a nuclear receptor subfamily 2 group E member 3 (NR2E3) protein. In some embodiments, the guide RNA comprises a sequence that hybridizes to a target sequence of the NR2E3 encoding gene. In some embodiments, the target sequence is selected from the group consisting of SEQ ID NOS: 3-4. In some embodiments, the target sequence is at least 90% homologous to a sequence selected from the group consisting of SEQ ID NOS: 3-4. In some embodiments, the target sequence is at least about 80% homologous to a sequence selected from the group consisting of SEQ ID NOS: 3-4. In some embodiments, the target sequence is at least about 85% homologous to a sequence selected from the group consisting of SEQ ID NOS: 3-4. In some embodiments, the target sequence is at least about 90% homologous to a sequence selected from the group consisting of SEQ ID NOS: 3-4. In some embodiments, the target sequence is at least about 95% homologous to a sequence selected from the group consisting of SEQ ID NOS: 3-4.DNA Guide Nuclease In some embodiments, the methods and cells disclosed herein utilize a nucleic acid-guided nuclease system. In some embodiments, the methods and cells disclosed herein use a DNA-guided nuclease system. In some embodiments, the methods and cells disclosed herein use an Argonaute system. The Argu protein can be a polypeptide that can be linked to a target nucleic acid. The Argu protein can be a nuclease. The Argu protein can be a eukaryotic, prokaryotic or archaeal Algu protein. The Argu protein can be a prokaryotic alpha protein (pArgonaute). pArgonaute can be derived from archaea. pArgonaute can be derived from bacteria. The bacteria may be selected from thermophilic bacteria and mesophilic bacteria. Bacteria or archaea can be selectedAeolian liquid bacteria, apatite green microalgae, Clostridium, Microbacterium, organic solvent tolerant bacteria, salt genus, genus Rhizobacter, Azotobacter, Thermophilic genus, Synechococcus , Synechococcus and Thermophilic Blue-green Or any combination thereof. The bacteria can be thermophilic bacteria. Bacteria can beWind-producing bacteria . Thermophilic bacteria can beThermophilic bacterium (T . Thermophilic ) (Tt Algu). Alcoco comes fromThermophilic bacteria. Alcoco comes fromSynechococcus . P-argu can be a wild-type p-argu-one variant p-argu. In some embodiments, the Arguin of the invention is a type I prokaryotic alpha (pAgo). In some embodiments, the progenitor nuclear type I ancient alpha carries a DNA nucleic acid targeting nucleic acid. In some embodiments, the DNA nucleic acid targeting nucleic acid targets a strand of double stranded DNA (dsDNA) to produce strand breaks or breaks in dsDNA. In some embodiments, strand disruption or cleavage triggers host DNA repair. In some embodiments, the host DNA repair is non-homologous end joining (NHEJ) or homologous guided recombination (HDR). In some embodiments, the dsDNA is selected from the group consisting of a genome, a chromosome, and a plastid. In some embodiments, the progenitor nuclear type I ancient is a long type I prokaryotic Algu. In some embodiments, the long type I prokaryotic alpha has an N-PAZ-MID-PIWI domain architecture. In some embodiments, the long Form I prokaryotic Algu has a catalytically active PIWI domain. In some embodiments, the long Form I prokaryotic Algu has a catalytic tetramer encoded by aspartate-glutamic acid-aspartate-aspartate/histamine (DEDX). In some embodiments, the catalyst tetrazygous combines one or more Mg+ ions. In some embodiments, the catalyst tetrazygote does not bind to Mg+ ions. In some embodiments, the catalyst tetrazygote combines one or more Mn+ ions. In some embodiments, the catalytically active PIWI domain is most active at moderate temperatures. In some embodiments, the moderate temperature is from about 25 °C to about 45 °C. In some embodiments, the moderate temperature is about 37 °C. In some embodiments, the type I prokaryotic Algu anchors the 5' phosphate end of the DNA guide. In some embodiments, the DNA guide has deoxycytosine at its 5' end. In some embodiments, the progenitor nuclear type I ancient is A. thermophilus Ago (TtAgo). In some embodiments, the progenitor genus of the type I is Alcohol Ago (SeAgo). In some embodiments, the prokaryotic Alguy is type II pAgo. In some embodiments, the Type II prokaryotic Alguq carries an RNA nucleic acid targeting nucleic acid. In some embodiments, the RNA nucleic acid targeting nucleic acid targets a strand of double stranded DNA (dsDNA) to produce strand breaks or breaks in dsDNA. In some embodiments, strand disruption or cleavage triggers host DNA repair. In some embodiments, the host DNA repair is non-homologous end joining (NHEJ) or homologous guided recombination (HDR). In some embodiments, the dsDNA is selected from the group consisting of a genome, a chromosome, and a plastid. In some embodiments, the progenitor nuclear alpha system is selected from the group consisting of a pro-nuclear pro-nucleus Algu and a short-type pro-nuclear algu. In some embodiments, the long Form II prokaryotic Algu has an N-PAZ-MID-PIWI domain architecture. In some embodiments, the long Form II prokaryotic Alguchi does not have an N-PAZ-MID-PIWI domain architecture. In some embodiments, the short type II prokaryotic Algu has a MID and a PIWI domain, but does not have a PAZ domain. In some embodiments, the short type II pAgo has an analogy of the PAZ domain. In some embodiments, the Type II pAgo does not have a catalytically active PIWI domain. In some embodiments, the Type II pAgo does not have a catalytic tetramer encoded by aspartate-glutamic acid-aspartate-aspartate/histamine (DEDX). In some embodiments, the gene encoding a type II prokaryotic Algu and one or more gene clusters encoding a nuclease, a helicase, or a combination thereof. The nuclease or helicase can be a natural design or a domain thereof. In some embodiments, the nuclease is selected from the group consisting of Sir2, RE1, and TIR. In some embodiments, the type II pAgo anchors the 5' phosphate end of the RNA guide. In some embodiments, the RNA guide has uracil at its 5' end. In some embodiments, the progenitor of the type II progenitor is Arcobacteria, R. ago. In some embodiments, the pAgos pair can carry RNA and/or DNA nucleic acid targeting nucleic acids. Type I pAgo can carry RNA nucleic acid targeting nucleic acids, each capable of targeting one strand of double stranded DNA to create double strand breaks in double stranded DNA. In some embodiments, the pAgo pair comprises two type I pAgos. In some embodiments, the pAgo pair comprises two Type II pAgos. In some embodiments, the pAgo pair comprises a type I pAgo and a type II pAgo. The Argu protein can be targeted to the target nucleic acid sequence by a guide nucleic acid. The guide nucleic acid can be single stranded or double stranded. The guide nucleic acid can be a DNA, RNA or DNA/RNA hybrid. The guide nucleic acid can comprise a chemically modified nucleotide. The guide nucleic acid can hybridize to the sense strand or the antisense strand of the polynucleotide of interest. The guide nucleic acid can have a 5' modification. The 5' modification can be phosphorylation, methylation, methylolation, acetylation, ubiquitination or ubiquitination. The 5' modification can be phosphorylated. The length of the guide nucleic acid can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides or base pairs. In some examples, the guide nucleic acid can be less than 10 nucleotides or base pairs in length. In some examples, the guide nucleic acid can be more than 50 nucleotides or base pairs in length. The guide nucleic acid can be a guide DNA (gDNA). The gDNA can have a 5' phosphorylated end. The gDNA can be single stranded or double stranded. The length of the gDNA can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides or base pairs. In some examples, the length of the gDNA can be less than 10 nucleotides. In some examples, the length of the gDNA can exceed 50 nucleotides.Multiplex Methods, compositions, systems, and/or kits for multiplexed genome engineering are disclosed herein. In some embodiments of the invention, the site-directed polypeptide may comprise a guide nucleic acid, thereby forming a complex. The complex can be contacted with a target nucleic acid. The target nucleic acid can be cleaved and/or modified by the complex. The methods, compositions, systems, and/or kits of the invention can be used to rapidly, efficiently, and/or simultaneously modify a plurality of target nucleic acids. The method can be performed using any of a site-directed polypeptide (e.g., Cas9), a guide nucleic acid, and a complex of a site-directed polypeptide and a guide nucleic acid as described herein. The site-directed nucleases of the invention may be combined in any combination. For example, multiple CRISPR/Cas nucleases can be used to target different target sequences or different fragments of the same target. In another example, Cas9 and Alcoa can be used in combination to target different targets or different portions of the same target. In some embodiments, a site-directed nuclease can be used with a plurality of different guide nucleic acids to simultaneously target multiple different sequences. A nucleic acid (eg, a guide nucleic acid) can be fused to a non-native sequence (eg, a partial, endonuclease-binding sequence, ribonuclease), thereby forming a nucleic acid module. Nucleic acid modules (eg, comprising nucleic acids fused to a non-native sequence) can be conjugated in tandem form, thereby forming a multiplexed genetic targeting agent (eg, a poly-module, such as an array). The multiplexed genetic targeting agent can comprise RNA. The multiplexed genetic targeting agent can be contacted with one or more endoribonucleases. Endoribonucleases can be ligated to non-native sequences. The endonuclease ribonuclease can cleave the nucleic acid module of the multiplexed genetic targeting agent at a defined position defined by the non-native sequence. Lysis can treat (eg, release) individual nucleic acid modules. In some embodiments, the processed nucleic acid module can comprise all, some, or none of the non-native sequences of the non-native sequences. The processed nucleic acid module can be combined with a site-directed polypeptide to form a complex. The complex can be targeted to a target nucleic acid. The target nucleic acid can be cleaved and/or modified by the complex. A multiplexed genetic targeting agent can be used to simultaneously modify multiple target nucleic acids, and/or to be stoichiometrically counted. The multiplexed genetic targeting agent can be any nucleic acid targeting nucleic acid as described herein in tandem. A multiplexed genetic targeting agent can refer to a contiguous nucleic acid molecule comprising one or more nucleic acid modules. Nucleic acid modules can comprise nucleic acids and non-native sequences (eg, partial, endoribonuclease binding sequences, ribonucleases). The nucleic acid can be a non-coding RNA such as a microRNA (miRNA), a short interfering RNA (siRNA), a long non-coding RNA (lncRNA or lincRNA), an endogenous siRNA (internal-siRNA), a piwi interactive RNA (piRNA), trans Short interfering RNA (tasiRNA), repetitive associated small interfering RNA (rasiRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA) or any combination. The nucleic acid can be an encoding RNA (eg, an mRNA). The nucleic acid can be any type of RNA. In some embodiments, the nucleic acid can be a nucleic acid targeting nucleic acid. The non-native sequence can be located at the 3' end of the nucleic acid module. The non-native sequence can be located at the 5' end of the nucleic acid module. The non-native sequence can be located at both the 3' end and the 5' end of the nucleic acid module. The non-native sequence can comprise a sequence that binds to an endoribonuclease (eg, an endoribonuclease binding sequence). The non-native sequence may be specifically an endo-ribonuclease (for example, ribonuclease T1 cleaves an unpaired G base, ribonuclease T2 cleaves the 3' end of As, and ribonuclease U2 cleaves an unpaired A base 3 The sequence of the sequence identified by the 'end'. The non-native sequence can be a sequence structurally recognized by an endoribonuclease (eg, a hairpin structure, a single-stranded double-stranded junction (eg, Drosha) recognizes a single-stranded-double-link junction within a hairpin). The non-native sequence may comprise a sequence that binds to a CRISPR system endoribonuclease (eg, Csy4, Cas5 and/or Cas6 protein). In some embodiments, wherein the non-native sequence comprises an endoribonuclease binding sequence, the nucleic acid module can bind to the same endoribonuclease. The nucleic acid module may not comprise the same endoribonuclease binding sequence. The nucleic acid module can comprise different endoribonuclease binding sequences. Different endoribonuclease binding sequences can bind to the same endoribonuclease. In some embodiments, the nucleic acid module can bind to a different endonuclease. A portion may comprise a ribonuclease. Ribonuclease cleaves itself, thereby releasing the modules of the multiplexed genetic targeting agent. Suitable ribozymes may include peptidyl transfer 23S rRNA, RnaseP, Group I intron, Group II intron, GIR1 divergent ribonuclease, lead enzyme, hairpin ribozyme, hammerhead ribozyme, HDV nucleus Enzyme, CPEB3 ribozyme, VS ribozyme, glmS ribonuclease, CoTC ribonuclease, synthetic ribozyme. The nucleic acid of the nucleic acid module of the multiplexed genetic targeting agent can be the same. The nucleic acid modules can differ by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides. For example, different nucleic acid modules can be different in the spacer region of the nucleic acid module, thereby targeting the nucleic acid module to different target nucleic acids. In some cases, different nucleic acid modules may differ in the spacer region of the nucleic acid module, but still target the same target nucleic acid. The nucleic acid module can target the same target nucleic acid. The nucleic acid module can target one or more target nucleic acids. The nucleic acid module can comprise regulatory sequences that permit suitable translation or amplification of the nucleic acid module. For example, a nucleic acid module can comprise a promoter, a TATA box, an enhancer element, a transcriptional end element, a ribosome binding site, a 3' untranslated region, a 5' untranslated region, a 5' cap sequence, a 3' polyadenosine Deuterated sequences, RNA stability elements and the like.a nucleic acid encoding a design guide nucleic acid and / Nucleic acid guide nuclease The invention provides a nucleic acid encoding the invention, a nucleic acid guide nuclease of the invention, an effector protein, a donor polynucleotide, a multiplexed genetic targeting agent, a tandem fusion polypeptide, a reporter element, and a correlation A genetic element, a nucleic acid of a nucleotide sequence of a component of a cleavage system and/or any nucleic acid or protein molecule necessary to carry out an embodiment of the method of the invention. In some embodiments, a guide nucleic acid encoding the invention, a nucleic acid guide nuclease of the invention, an effector protein, a donor polynucleotide, a multiplexed genetic targeting agent, a tandem fusion polypeptide, a reporter element The nucleic acid of a relevant gene element, a cleavage system and/or a component of any nucleic acid or protein molecule necessary for carrying out an embodiment of the method of the invention may be a vector (eg, a recombinant expression vector). In some embodiments, the recombinant expression vector can be a viral construct (eg, a recombinant adeno-associated virus construct), a recombinant adenoviral construct, a recombinant lentiviral construct, a recombinant retroviral construct, and the like. Suitable expression vectors can include, but are not limited to, viral vectors (eg, viral vectors based on acne virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vector) (eg murine leukemia virus, spleen necrosis virus, and from sources such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and breast Vectors for retroviruses of tumor viruses), plant vectors (eg T-DNA vectors) and the like. The following vectors can be provided by way of example for eukaryotic host cells: pXT1, pSG5, pSVK3, pBPV, pMSG and pSVLSV40 (Pharmacia). Other vectors may be used as long as the other vectors are compatible with the host cell. In some cases, the vector may be a linearized vector. The linearized vector may comprise a nuclease (eg Cas9 or Algu) and/or The guide nucleic acid. The linearized vector may not be a circular plastid. The linearized vector may comprise a double-strand break. The linearized vector may comprise a coded fluorescent light. A sequence of a protein (eg, orange fluorescent protein (OFP). The linearized vector may comprise a sequence encoding an antigen (eg, CD4). The linearized vector may be in a region encoding a vector of a portion of the designed nucleic acid targeting nucleic acid. Linearization (eg, cleavage). For example, a linearized vector can be linearized (eg, cleaved) in the 5' region of a designed nucleic acid targeting nucleic acid. The linearized vector can be designed to target nucleic acids in a nucleic acid. Linearization (eg, cleavage) in the 3' region. In some cases, the linearized vector or the closed supercoiled vector comprises a sequence encoding a nuclease (eg, Cas9 or Algu), driving the expression of the sequence encoding the nuclease Promoter (eg, CMV promoter), a sequence encoding a marker, a sequence encoding an affinity tag, a sequence encoding a portion of a guide nucleic acid, a promoter that drives expression of a sequence encoding a portion of a guide nucleic acid, and a coding selectable marker (eg, Ambi Sequence of any of ampicillin or any combination thereof. The vector may contain transcriptional and/or translational control elements. Depending on the host/vector system utilized, multiple suitable transcriptions and translations Any of the elements (including constitutive and inducible promoters, transcription enhancing elements, transcriptional terminators, etc.) can be used in the expression vector. In some embodiments, the guide nucleic acid encoding the invention, the nuclease of the invention , an effector protein, a donor polynucleotide, a multiplexed genetic targeting agent, a tandem fusion polypeptide, a reporter element, a related gene element, a split system necessary to carry out an embodiment of the method of the invention and/or Or the nucleotide sequence of a component of any nucleic acid or protein molecule can be operably linked to a control element (eg, a transcriptional control element), such as a promoter. The transcriptional control element can be in a eukaryotic cell (eg, a mammalian cell) and/or a prokaryotic Functional in a cell, such as a bacterial or archaeal cell. In some embodiments, a design-guided nucleic acid encoding the invention, a nucleic acid-guided nuclease of the invention (eg, Cas9 or Algu), an effector protein, a donor Polynucleotides, multiplexed genetic targeting agents, tandem fusion polypeptides, reporter elements, related gene elements, and embodiments necessary to perform the methods of the invention Cracking system and / or any nucleotide sequence or a nucleic acid molecule of the protein components can be operatively connected to a plurality of control elements. An operable bond to a plurality of control elements may allow for the encoding of a guide nucleic acid of the present invention, a nucleic acid guide nuclease of the present invention, an effector protein, a donor polynucleotide, a reporter element, and a related gene element in a prokaryotic or eukaryotic cell. The performance of the nucleotide sequence of the components of the cleavage system and/or any nucleic acid or protein molecule necessary to carry out the embodiments of the methods of the invention. Non-limiting examples of suitable eukaryotic promoters (i.e., promoters that are functional in eukaryotic cells) can include those from the following: early cytomegalovirus (CMV), herpes simplex virus (HSV) thymidine Kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, human elongation factor-1 promoter (EF1), cytomegalovirus (CMV) enhancer containing fusion to chicken β-promoter (CAG) The mixed construct, the murine stem cell virus promoter (MSCV), the phosphoglycerate kinase-1 locus promoter (PGK), and the mouse metallothionein-I. The promoter can be a fungal promoter. The promoter can be a plant promoter. A database of plant promoters can be found (for example, PlantProm). The expression vector may also contain a ribosome binding site for translation initiation and transcription termination. The performance vector can also include sequences suitable for amplifying the performance. The expression vector can also include a nucleotide sequence that encodes a non-natural marker fused to Argo (eg, a 6xHis tag (SEQ ID NO: 5), a hemagglutinin tag, a green fluorescent protein, etc.) thereby producing a fusion protein. In some embodiments, a nucleotide sequence or a guide nucleic acid encoding the same, a nucleic acid guide nuclease of the invention (eg, Cas9 or Algu), an effector protein, a donor polynucleotide, a multiplexed genetic target Sequences of components, fractional fusion polypeptides, reporter elements, related gene elements, cleavage systems necessary for performing embodiments of the methods of the invention, and/or components of any nucleic acid or protein molecule can be operably linked to inducible Promoters (eg, heat shock promoters, tetracycline-regulated promoters, steroid-regulated promoters, metal-regulated promoters, estrogen receptor-regulated promoters, etc.). In some embodiments, a guide nucleic acid encoding the invention, a nucleic acid guide nuclease of the invention, an effector protein, a donor polynucleotide, a multiplexed genetic targeting agent, a tandem fusion polypeptide, a reporter element The nucleotide sequence of the relevant gene element, the cleavage system necessary for carrying out the embodiment of the method of the invention and/or the components of any nucleic acid or protein molecule can be operably linked to a constitutive promoter (eg CMV promoter, UBC) Promoter). In some embodiments, the nucleotide sequence can be operably linked to a space-constrained and/or time-limited promoter (eg, a tissue-specific promoter, a cell type-specific promoter, etc.). In some embodiments, a nucleotide sequence or a guide nucleic acid encoding the same, a nucleic acid guide nuclease of the invention (eg, Cas9 or Algu), an effector protein, a donor polynucleotide, a multiplexed genetic target Sequences of components, fractional fusion polypeptides, reporter elements, related gene elements, cleavage systems necessary for performing embodiments of the methods of the invention, and/or components of any nucleic acid or protein molecule may be packaged for delivery to In the biological compartment of the cell or on its surface. Biological compartments can include, but are not limited to, viruses (lentiviruses, adenoviruses), nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. Introduction of the complexes, polypeptides and nucleic acids of the present invention into cells can occur by viral or phage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethylene. Imine (PEI)-mediated transfection, DEAE-polydextrose-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery Similar.a - optimization The polynucleotides encoding the nucleic acid-guided nucleases (e.g., Cas9 or Algu) disclosed herein can be codon-optimized. This type of optimization may necessarily be accompanied by a foreignly derived mutant (e.g., recombinant) DNA to mimic the codon preferences of a given host organism or cell when encoding the same protein. Thus, the codon can be altered, but the encoded protein remains unchanged. For example, if the intended target cell is a human cell, the human codon-optimized polynucleotide Cas9 can be used to generate a suitable Cas9. As another non-limiting example, if the established host cell is a mouse cell, the codon-optimized polynucleotide encoding the Cas9 mouse can be a suitable Cas9. A polynucleotide encoding a CRISPR/Cas protein can be a codon optimized for a number of related host cells. The polynucleotide encoding alpha is a codon optimized for many relevant host cells. The host cell may be a cell selected from any organism (eg, bacterial cells, archaeal cells, cells of single-cell eukaryotes, plant cells, algae cells (eg, brown grape algae, C. reinhardtii, marine oil-rich microspheres) Algae, Chlorella pyrenoidosa, S. cerevisiae and its analogues), fungal cells (eg yeast cells), animal cells, cells from invertebrates (eg flies, cnidaria, echinoderms, nematodes, etc.) Cells from vertebrate animals (eg, fish, amphibians, reptiles, birds, mammals), from mammals (eg, pigs, cows, goats, sheep, rodents, rats, mice, non-human primates) Codon optimization, etc. Codon optimization may not be desirable. Codon optimization may be preferred in some cases.transfer The site-directed nucleases of the invention can be expressed endogenously or recombinantly in a cell. The site-directed nuclease can be encoded on a chromosome, extrachromosomally, or on a plastid, synthetic chromosome or artificial chromosome. Alternatively or additionally, the site-directed nuclease can be provided or delivered to the cell as a polypeptide or mRNA encoding the polypeptide. In such instances, the polypeptide or mRNA can be delivered by standard mechanisms known in the art, such as by the use of cell-penetrating peptides, nanoparticles, virions, viral delivery systems, or other non-viral delivery systems. Alternatively or additionally, the guide nucleic acids disclosed herein can be provided by genetic or episomal DNA within the cell. The guide nucleic acid can be reverse transcribed from RNA or mRNA within the cell. The guide nucleic acid can be provided or delivered to a cell that exhibits a corresponding site-directed nuclease. Alternatively or additionally, the guide nucleic acid can be provided or delivered simultaneously or sequentially with the site-directed nuclease. The guide nucleic acid can be chemically synthesized, assembled, or otherwise produced using standard DNA or RNA production techniques known in the art. Alternatively or additionally, the guide nucleic acid can be cleaved, released or otherwise derived from genomic DNA, episomal DNA molecules, isolated nucleic acid molecules, or any other source of nucleic acid molecules.Small molecule inhibitor In some embodiments, the therapeutic agent is a small molecule inhibitor. Small molecule inhibitors may be free of polynucleotides. Small molecule inhibitors may be free of peptides. In some embodiments, the small molecule inhibitor binds directly to a protein or structure that is disrupted by the function of pl6a. In general, small molecule inhibitors readily cross the cell membrane and may not require additional modification to aid in their cellular uptake.Gene target Methods for editing the genes disclosed herein using the CRISPR/Cas system are provided herein. The invention further provides methods of contacting RNA expressed by a gene disclosed herein with a counter-oligonucleotide, thereby altering the production of a protein encoded by the gene. The invention further provides methods of editing the genes disclosed herein or modifying the expression of the genes disclosed herein. In some embodiments, editing the gene or modifying the expression of the gene comprises reducing the performance of the gene, reducing the performance of the product of the gene (eg, an RNA protein), reducing the activity of the product of the gene, or a combination thereof. In some embodiments, the gene encodes a nuclear receptor. In some embodiments, the gene encodes a leucine zipper protein. In some embodiments, the gene encodes a flaviprotein. In some embodiments, the gene encodes a G-coupled protein receptor. In some embodiments, the gene is a tumor suppressor gene. In some embodiments, the gene encodes a protein that promotes cellular senescence. In some embodiments, the gene encodes a protein that promotes apoptosis. In some embodiments, the gene encodes a protein that promotes cell differentiation. In some embodiments, the gene encodes a protein that inhibits cell proliferation. In some embodiments, the gene encodes a protein that inhibits cell survival. In some embodiments, the gene is characterized by a sequence having the sequence identifier (SEQ ID NO) provided herein. In some embodiments, the gene is characterized by having a sequence homologous to the sequence identifier (SEQ ID NO) provided herein to a sequence homologous thereto. When the terms "homologous", "homology" or "percent homology" are used herein to describe amino acid sequences or nucleic acid sequences relative to a reference sequence, Karlin and Altschul (Proc. Natl. Acad) can be used. .Sci. USA 87: 2264-2268, 1990, modified to Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993). Such a formula is incorporated into the Base Local Alignment Search Tool (BLAST) program of Altschul et al. (J. Mol. Biol. 215: 403-410, 1990). As of the filing date of this application, the nearest form of BLAST can be used to determine the percent homology of the sequence. Any of the genes disclosed herein can be a human gene. A gene encodes a protein expressed by a blood cell. The gene encodes hemoglobin. A gene encodes a protein that is expressed on cells of the eye of a human individual. By way of non-limiting example, a gene can encode a G protein coupled receptor (GPCR). The GPCR can be selected from genes encoding a flaviprotein (eg, rhodopsin) or transduction (eg, GNAT1). Also by way of non-limiting example, the gene may encode a leucine zipper protein. The gene may be a neuroretin-specific leucine zipper gene (Nrl) gene. The gene encodes the Nrl protein. The gene may comprise at least 10 contiguous nucleotides of SEQ ID NO.: 1 or SEQ ID NO.: 2. Also, by way of non-limiting example, a gene can encode a nuclear receptor. The gene may be a photoreceptor cell-specific nuclear receptor (PNR) gene. The gene encodes a PNR protein. PNR is also known as NR2E3 (nuclear receptor subfamily 2, E, member 3). The gene may comprise at least 10 contiguous nucleotides of SEQ ID NO.: 3 or SEQ ID NO.: 4. The gene can be the Mertk gene. The gene may be other ocular genes including the retinoblastoma gene, the athonal7 gene, and the Pax6 gene. Provided herein are methods comprising modifying a gene disclosed herein in a cell disclosed herein. The gene can be a non-ocular gene and the cell can be a non-ocular cell. By way of non-limiting example, the genes may be UMOD, TMEM174, SLC22A8, SLC12A1, SLC34A1, SLC22A12, SLC22A2, MCCD1, AQP2, SLC7A13, KCNJ1, SLC22A6 Pax3 Pax3, and the cells may be kidney cells. By way of non-limiting example, the gene may be PNLIPRP1, SYCN, PRSS1, CTRB2, CELA2A, CTRB1, CELA3A, CELA3B, CTRC, CPA1, PNLIP or CPB1, and the cells may be pancreatic cells. By way of non-limiting example, the gene may be GFAP, OPALIN, OLIG2, GRIN1, OMG, SLC17A7, C1orf61, CREG2, NEUROD6, ZDHHC22, VSTM2B or PMP2, and the cells may be brain cells. By way of non-limiting example, the gene may encode an immune checkpoint inhibitor and the cell may be a T cell. By way of non-limiting example, the gene may encode PD-1 and the cell may be a T cell. The gene may encode PD-L1 or PD-L2, and the cell may be a tumor cell.cell Methods of modifying nucleic acid molecules that are expressed by the cells disclosed herein are provided herein. The invention further provides methods of modifying the expression and/or activity of a nucleic acid molecule expressed by the cells disclosed herein. In some embodiments, the methods comprise modifying a nucleic acid molecule or its expression/activity, wherein the nucleic acid molecule is present in a cell in vivo. In some embodiments, the methods comprise modifying a nucleic acid molecule or its expression/activity, wherein the nucleic acid molecule is present in a living cell. In some embodiments, the methods comprise modifying a nucleic acid molecule or its expression/activity, wherein the nucleic acid molecule is present in a living cell. In some embodiments, a method comprises modifying a nucleic acid molecule or its expression/activity, wherein the nucleic acid molecule is present in an in situ cell. In some embodiments, the cell is a retinal cell. In some embodiments, the cells are photoreceptor cells. In some embodiments, the photoreceptor cells are rod cells. In some embodiments, the photoreceptor cells are cone cells. In some embodiments, the photoreceptor cells are photosensitive retinal ganglion cells. In some embodiments, the cell is an optic nerve cell. In some embodiments, the cell is a ganglion cell. In some embodiments, the cell is an axonal nerve cell. In some embodiments, the cell is a retinal ganglion cell. In some embodiments, the cells have been isolated from the treatment. In some embodiments, the cells are stem cells. In some embodiments, the cell is a cord blood stem cell. In some embodiments, the cells are blood cells. In some embodiments, the cells are hematopoietic stem cells. In some embodiments, the cell is a hematopoietic pluripotent cell. In some embodiments, the cells are cancer cells. In some embodiments, the cells are epithelial cells. In some embodiments, the cells are intestinal cells. In some embodiments, the cell is a pluripotent cell. In some embodiments, the cell is a pluripotent cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC). In some embodiments, the iPSC is derived from a neural cell. In some embodiments, the iPSC is derived from an ocular cell. In some embodiments, the cell is an iPSC that differentiates into retinal ganglion cells or pluripotent progenitor cells thereof.Pharmaceutical composition and mode of administration Disclosed herein are pharmaceutical compositions for treating conditions of retinal degeneration comprising a therapeutic agent for inhibiting gene expression and protein activity as described herein. In some embodiments, the pharmaceutical composition is a formulation for administration to the eye. In some embodiments, the formulation for administration to the eye comprises a thickening agent, a surfactant, a humectant, a base component, a carrier, an excipient, or a salt suitable for administration to the eye. In some embodiments, the formulation for administration to the eye has a pH, salt or osmotic properties that renders it suitable for administration to the eye. This aspect of the formulation for administration to the eye is described herein. In some embodiments, the pharmaceutical composition is an ophthalmic formulation. The pharmaceutical compositions may contain a thickening agent to extend the contact time of the pharmaceutical composition with the eye. In some embodiments, the thickening agent is selected from the group consisting of polyvinyl alcohol, polyethylene glycol, methyl cellulose, carboxymethyl cellulose, and combinations thereof. In some embodiments, the thickening agent is filtered and sterilized. The pharmaceutical compositions disclosed herein may comprise a pharmaceutically acceptable carrier for the eye, a pharmaceutically acceptable excipient or a pharmaceutically acceptable salt. Non-limiting examples of pharmaceutically acceptable carriers, pharmaceutically acceptable excipients, and pharmaceutically acceptable salts for use in the eye include hyaluronic acid, boric acid, calcium chloride, sodium perborate, phosphonic acid, Potassium chloride, magnesium chloride, sodium borate, sodium phosphate and sodium chloride. The pharmaceutical compositions disclosed herein should be isotonic with lacrimal secretions. In some embodiments, the pharmaceutical composition has a permeability from 0.5% to 2% NaCl. In some embodiments, the pharmaceutical composition comprises an isotonic vehicle. By way of non-limiting example, the isotonic vehicle can comprise boric acid or monobasic sodium phosphate. In some embodiments, the pharmaceutical composition has a pH of from about 3 to about 8. In some embodiments, the pharmaceutical composition has a pH of from about 3 to about 7. In some embodiments, the pharmaceutical composition has a pH of from about 4 to about 7. Pharmaceutical compositions outside this pH range can irritate the eye or form granules in the eye when administered. In some embodiments, the pharmaceutical compositions disclosed herein comprise a surfactant or a humectant. Non-limiting examples of surfactants employed in the pharmaceutical compositions disclosed herein are resveratrol chloride, polysorbate 20, polysorbate 80, and sodium dioctyl succinate. In some embodiments, the pharmaceutical compositions disclosed herein comprise a preservative that prevents microbial contamination after the container holding the pharmaceutical composition has been opened. In some embodiments, the preservative is selected from the group consisting of benzalkonium chloride, chlorobutanol, phenylmercuric acetate, chlorhexidine acetate, and phenylmercury nitrate. In some embodiments, a pharmaceutical composition (eg, an emulsion or ointment) comprises a base component. The base component can be selected from the group consisting of sodium chloride, acidic sodium carbonate, boric acid, borax, zinc sulfate, paraffins, and waxes or fatty materials. In some embodiments, the pharmaceutical composition is an emulsion. In some embodiments, the emulsion is provided to the individual (or the individual administering the emulsion) in the form of a powder or lyophilized product (i.e., reconstituted immediately prior to use). Direct administration of the pharmaceutical composition to the eye avoids any undesirable deviation of the therapeutic agent from the target at locations other than the eye. For example, intravenous or systemic administration of a pharmaceutical composition can result in inhibition of gene expression in cells other than the cells of the eye, wherein inhibition of the gene can have adverse effects. In some embodiments, a pharmaceutical composition comprises a polynucleotide vector encoding any of the nucleic acid molecules disclosed herein (eg, shRNA, guide RNA, nuclease encoding a polynucleotide). In some embodiments, the polynucleotide vector is an expression vector. In some embodiments, the polynucleotide vector is a viral vector. In some embodiments, a pharmaceutical composition comprises a virus, wherein the virus delivers the vector and/or nucleic acid molecule to a cell of the individual. In some embodiments, the virus is a retrovirus. In some embodiments, the virus is a lentivirus. In some embodiments, the virus is an adeno-associated virus (AAV). In some embodiments, the AAV line is selected from the group consisting of serotypes 1, 2, 5, 7, 8, and 9. In some embodiments, the AAV is AAV serotype 2. In some embodiments, the AAV is AAV serotype 8. AAV is particularly useful in the methods disclosed herein due to the minimal stimulation of the immune system and its ability to provide performance in undivided retinal cells for many years. AAV can be capable of transducing multiple cell types within the retina. In some embodiments, the method comprises intravitreal administration of AAV (eg, injection into the vitreous humor of the eye). In some embodiments, the method comprises subretinal administration of AAV (eg, injection into the lower portion of the retina). In some embodiments, the methods and compositions disclosed herein comprise an exogenously regulatable promoter system in an AAV vector. By way of non-limiting example, the exogenously regulatable promoter system can be a tetracycline-inducible expression system. The pharmaceutical compositions disclosed herein may further comprise one or more pharmaceutically acceptable salts, excipients or vehicles. The pharmaceutically acceptable salts, excipients or vehicles used in the pharmaceutical compositions of the present invention include carriers, excipients, diluents, antioxidants, preservatives, coloring agents, flavoring and diluents, emulsifiers, Suspending agents, solvents, fillers, accumulating agents, buffers, vehicles, tonicity agents, cosolvents, wetting agents, complexing agents, buffers, antimicrobial agents, and surfactants. Neutral buffered saline or physiological saline mixed with serum albumin may be an exemplary suitable vehicle. Pharmaceutical compositions may include antioxidants such as ascorbic acid, low molecular weight polypeptides, proteins such as serum albumin, gelatin or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, such as glycine, glutamic acid , aspartame, arginine or lysine amino acids, monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrin, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol For example, sodium salt counterions, and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG). Also by way of example, suitable osmotic enhancers include alkali metal halides (preferably sodium or potassium chloride), mannitol, sorbitol, and the like. Suitable preservatives include benzalkonium chloride, thimerosal, phenethylethanol, methyl paraben, propyl paraben, chlorhexidine, sorbic acid, and the like. Hydrogen peroxide can also be used as a preservative. Suitable cosolvents include glycerol, propylene glycol, and PEG. Suitable complexing agents include caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxy-propyl-beta-cyclodextrin. Suitable surfactants or wetting agents include sorbitan esters, polysorbates such as polysorbate 80, tromethamine, lecithin, cholesterol, tyloxapol and the like. The buffer may be a conventional buffer such as acetic acid, borate, citric acid, phosphoric acid, bicarbonate or HCl. The acetate buffer can be from about pH 4 to pH 5.5, and the reference buffer can be from about pH 7 to pH 8.5. Additional agents are described in Remington's Pharmaceutical Sciences, 18th Ed., A.R. Gennaro, ed., Mack Publishing Company, 1990. The composition may be in liquid form or in lyophilized or lyophilized form and may include one or more lyoprotectants, excipients, surfactants, high molecular weight structural additives, and/or accumulators (see, for example, U.S. Patent No. 6,685,940 6,566,329 and 6,372,716). In one embodiment, a lyoprotectant is included, the lyoprotectant being a non-reducing sugar such as sucrose, lactose or trehalose. The lyophilized protective dose is typically included such that after reconstitution, although the resulting formulation will be isotonic, a hypertonic or slightly hypotonic formulation may also be suitable. Additionally, the amount of lyoprotectant should be sufficient to prevent decomposition and/or aggregation of unacceptable amounts of protein after lyophilization. An exemplary lyoprotectant concentration of sugar (e.g., sucrose, lactose, trehalose) in the lyophilized formulation is from about 10 mM to about 400 mM. In another embodiment, a surfactant such as a nonionic surfactant and an ionic surfactant such as a polysorbate (eg, polysorbate 20, polysorbate 80); a poloxamer (eg, Poloxamer 188); poly(ethylene glycol) phenyl ether (such as Triton); sodium dodecyl sulfate (SDS); sodium lauryl sulfate; octyl sodium glycoside; Myristyl-, linoleo- or octadecane-sulfobetaine; dodecyl-, myristyl-, linoleyl- or octadecyl-creatinine; linoleic acid , myristyl- or cetyl-betaine; lauryl propyl-, cocoamidopropyl-, linoleylpropyl-, myristylpropyl-, palmitosine-propyl Base- or isostearyl propylamino-betaine (eg, lauric acid propyl); myristylpropyl-, palmitosylpropyl- or isostearylamine-dimethylamine; Methyl sodium cocoyl- or methyl disodium-taurate; MONAQUATTM series (Mona Industries, Inc., Paterson, NJ), polyethylene glycol, polypropylene glycol, and ethylene glycol and propylene glycol Copolymer (eg Pluroni) Cs), PF68, etc.). Exemplary interfacial surfactants that may be present in the pre-lyophilized formulation are from about 0.001% to about 0.5%. High molecular weight structural additives (eg, fillers, binders) may include, for example, gum arabic, albumin, alginic acid, calcium phosphate (two bases), cellulose, carboxymethyl cellulose, sodium carboxymethyl cellulose. , hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, microcrystalline cellulose, polydextrose, dextrin, glucose binder, sucrose, methyl cellulose, pregelatinized starch, sulfuric acid Calcium, amylose, glycine, bentonite, maltose, sorbitol, ethyl cellulose, disodium hydrogen phosphate, disodium phosphate, disodium pyrosulfite, polyvinyl alcohol, gelatin, glucose, guar gum, Liquid glucose, compressible sugar, magnesium aluminum silicate, maltodextrin, polyethylene oxide, polymethacrylate, povidone, sodium alginate, xanthine microcrystalline cellulose, starch and zein. An exemplary concentration of the high molecular weight structural additive is from 0.1 wt% to 10 wt%. In other embodiments, an accumulating agent (eg, mannitol, glycine) may be included. The composition may be suitable for parenteral administration. Exemplary compositions are suitable for injection or infusion into an animal by any route available to those skilled in the art, such as intra-articular, subcutaneous, intravenous, intramuscular, intraperitoneal, intracerebral (intracerebral parenchyma), ventricles. Internal, intramuscular, intraocular, intraarterial or intralesional routes. Parenteral formulations are typically sterile, pyrogen-free isotonic aqueous solutions, optionally containing a pharmaceutically acceptable preservative. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including physiological saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as antimicrobials, antioxidants, chelating agents, inert gases, and the like. See generally, Remington's Pharmaceutical Science, 16th Edition, Mack, ed., 1980. The compositions described herein can be formulated for control or maintenance delivery in a manner that provides a localized concentration of product (e.g., bolus, reservoir effect) and/or increased stability or half-life in a particular local environment. The composition may comprise a formulation of a polypeptide, nucleic acid or carrier disclosed herein with a particle formulation of a polymeric compound such as polylactic acid, polyglycolic acid, and the like, and agents such as biodegradable matrices, injectable microspheres, Microcapsule particles, microcapsules, bioerodible particle beads, liposomes, and implantable delivery devices that provide controlled or sustained release of the active agent, which can then be delivered by reservoir injection. Techniques for formulating such devices for sustained or controlled delivery are known, and a variety of polymers have been developed and used for controlled release and delivery of drugs. Such polymers are generally biodegradable and biocompatible. Due to the mild and aqueous conditions contained in the bioactive protein capture agent, including their polymer hydrogels formed by the mismatch of enantiomeric polymers or polypeptide fragments and water condensation with temperature or pH sensitive properties Gum may be desirable to provide a drug storage effect. See, for example, the description of controlled release porous polymeric microparticles for delivery of pharmaceutical compositions in WO 93/15722. Suitable materials for this purpose may include polylactide (see, for example, U.S. Patent No. 3,773,919), poly-(a-hydroxycarboxylic acid), such as poly-D-(-)-3-hydroxybutyric acid (EP). 133,988A), a copolymer of L-glutamic acid and γ-ethyl-L glutamic acid (Sidman et al., Biopolymers, 22: 547 to 556 (1983)), poly(2-hydroxyethyl-methyl) Acrylate) (Langer et al, J. Biomed. Mater. Res., 15: 167 to 277 (1981), and Langer, Chem. Tech, 12: 98 to 105 (1982)), ethylene vinyl acetate or poly- D(-)-3-hydroxybutyric acid. Other biodegradable polymers include poly(lactone), poly(acetal), poly(orthoester), and poly(orthocarbonate). Sustained-release compositions can also include liposomes that can be prepared by any of a number of methods known in the art (see, for example, Eppstein et al, Proc. Natl. Acad. Sci., USA, 82:3688) 92 (1985)). The carrier itself or its decomposition products should be non-toxic in the target tissue and should not further aggravate the condition. This can be determined by routine screening in animal models of the target disorder, or by routine screening in normal animals when such models are not available. Formulations suitable for intramuscular, subcutaneous, or intratumoral injection may include physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions and solutions for reconstitution into sterile injectable solutions or dispersions Sterile powder. Examples of suitable aqueous and non-aqueous vehicles, diluents, solvents or vehicles include water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, cetyl polyoxyethylene ether and the like), suitable mixtures thereof , vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Formulations suitable for subcutaneous injection may also contain, if desired, additives such as preservatives, wetting agents, emulsifying agents and dispersing agents. For intravenous injection, the active agent may optionally be formulated in an aqueous solution, preferably in a physiologically compatible buffer (such as Hank's solution, Ringer's solution, or physiological saline buffer). Formulated in liquid). Parenteral injections include rapid injections or continuous infusions. In some embodiments, the formulation for injection is optionally presented in unit dosage form, such as an ampule or multi-dose container, with a preservative added thereto. The pharmaceutical compositions described herein may be in the form of a sterile suspension, solution or emulsion in an oily or aqueous vehicle suitable for parenteral injection, and contain a formulation such as a suspension, stabilizer and/or dispersion. Agent. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active agents in water soluble form. Alternatively, the suspension is prepared as a suitable oil-containing injection suspension as appropriate. Alternatively or additionally, the composition may be administered topically via implantation into the affected area of a film, sponge or other suitable material on which the therapeutic agents disclosed herein have been absorbed or Encapsulated. When an implant device is used, the device can be implanted into any suitable tissue or organ, and delivery of the therapeutic agent, nucleic acid or vector disclosed herein can be directly via a bolus or via continuous administration or via a catheter using continuous infusion. The device. Certain formulations comprising a therapeutic agent disclosed herein can be administered orally. Formulations for administration in this manner may or may not be formulated with such carriers which are normally used in admixture with solid dosage forms such as tablets and capsules. For example, the capsule can be designed to release the active portion of the formulation somewhere in the gastrointestinal tract, where bioavailability is maximized and degradation to the body is minimized. Additional agents may be included to promote absorption of the selective adhesive. Diluents, flavoring agents, low melting waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents and binders can also be used. Depending on the intended route of administration, the mode of delivery, and the desired dosage, the general knowledge of the present invention and formulation techniques can be considered to determine suitable and/or preferred pharmaceutical formulations. Regardless of the manner in which the drug is administered, the effective dose can be calculated based on the patient's weight, body surface area, or organ size. Further modifications of the operations used to determine suitable dosages for treating each of the formulations described herein are within the skill of the art and are within the scope of routine tasks performed in the art. The appropriate dose can be determined by using appropriate dose response data. "Pharmaceutically acceptable" may mean approved or approved by a federal or state regulatory agency, or listed in the US Pharmacopoeia or other generally recognized pharmacopeia for animals, including humans. "Pharmaceutically acceptable salt" may refer to a salt of a compound that is pharmaceutically acceptable and which possesses the desired pharmacological activity of the parent compound. "Pharmaceutically acceptable excipient, carrier or adjuvant" can mean that it can be administered to an individual with at least one antibody of the invention and does not destroy the agent when administered at a dose sufficient to deliver a therapeutic amount of the compound. A pharmacologically active and non-toxic excipient, carrier or adjuvant. "Pharmaceutically acceptable vehicle" can refer to a diluent, adjuvant, excipient or carrier that is administered with at least one antibody of the invention. In some embodiments, the pharmaceutical composition is formulated for injectable administration. In some embodiments, the method comprises injecting a pharmaceutical composition. In some embodiments, the methods comprise administering a pharmaceutical composition in liquid form via intraocular injection. In some embodiments, the method comprises administering a pharmaceutical composition in liquid form via intraocular injection. In some embodiments, the methods comprise administering a pharmaceutical composition in liquid form via intravitreal injection. Although some of these modes of administration may not be attractive to the individual (eg, intravitreal injection), they may be most effective at the penetrating barrier of the eye and are comparable to providing convenience and low availability. Eye drops, therapeutic agents are the least likely to be washed away by tears or blinks. In some embodiments, the methods comprise systemically administering a pharmaceutical formulation. In some embodiments, the therapeutic agent is a polynucleotide vector, wherein the polynucleotide vector comprises a guide RNA, an anti-strand oligonucleotide, or a Cas coding polynucleotide. A polynucleotide vector can comprise a conditional promoter for the expression of a nucleic acid molecule that drives a vector in a cell-specific manner. By way of a non-limiting example, a conditional promoter can drive the expression of only the retinal ganglion cells or only the expression of a functional effect in retinal ganglion cells. In some embodiments, the pharmaceutical composition is formulated for non-injectable administration. In some embodiments, the pharmaceutical composition is formulated for topical administration. By way of non-limiting example, the nucleic acid molecule can be suspended in a physiological saline solution or buffer suitable for instillation into the eye. In some embodiments, the pharmaceutical compositions can be formulated as eye drops, gels, lotions, ointments, suspensions or emulsions. In some embodiments, the pharmaceutical composition is formulated into a solid formulation such as an ocular implant. For example, an ocular implant can be formed into a shape that is similar to a contact lens that releases a pharmaceutical composition over a period of time, effectively delivering an extended release formulation. Gels or ointments can be applied under the eyelids or inside the eyelids or in the corners of the eyes. In some embodiments, the method can include administering the pharmaceutical composition immediately prior to sleep or immediately before the individual can keep the eye closed for a period of time. In some embodiments, the method comprises instructing the individual to keep their eyes closed or to use an eye patch (eg, bandage, tape, patch) to maintain eye closure for at least 1 minute, at least 5 minutes, at least 10 minutes, at least after administration of the pharmaceutical composition. 15 minutes, at least 20 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 4 hours, or at least 8 hours. The method can comprise instructing the individual to keep their eyes closed for 1 minute to 8 hours after administration of the pharmaceutical composition. The method can comprise instructing the individual to keep their eyes closed for 1 minute to 2 hours after administration of the pharmaceutical composition. The method can comprise instructing the individual to keep their eyes closed for 1 minute to 30 minutes after administration of the pharmaceutical composition. In some embodiments, the method comprises administering to the individual a pharmaceutical composition only when treating glaucoma. In some embodiments, the method comprises administering a pharmaceutical composition for the first treatment of glaucoma and the second treatment of glaucoma. The first and second time can be separated by a period of one hour to twelve hours. The first and second time can be separated by a period of one day to one week. The first and second time can be separated by a period of one week to one month. In some embodiments, the methods comprise administering to the individual a pharmaceutical composition on a daily, weekly, monthly or yearly basis. In some embodiments, the method can include an initial aggressive treatment that gradually becomes a conservative treatment. By way of non-limiting example, the method can comprise injecting a pharmaceutical composition initially, followed by conservative treatment with a pharmaceutical composition administered as an eye drop. Also, by way of non-limiting example, the method can comprise administering an injection of the pharmaceutical composition initially for about 1 week to about 20 weeks, followed by administration of the pharmaceutical combination via injection or topical administration every two months to twelve months. Things. In some embodiments, the therapeutic agent is a small molecule inhibitor and the pharmaceutical composition is formulated for oral administration.Set / system Provided herein are kits and systems comprising a Cas nuclease or a polynucleotide encoding a Cas nuclease, a first guide RNA, and a second guide RNA. The Cas nuclease and the first/second guide RNA can be any of the nucleases and RNAs disclosed herein. The first guide RNA can cleave the Cas9 of the first site 5' of the first region of the gene into the target and the second guide RNA can cleave the Cas9 of the second site 3' of the first region of the gene, thereby excising The region of the gene, hereinafter referred to as the excised region. Regions can contain exons. A region can contain a portion of an exon. The region may comprise from about 1% to about 100% of the exon. The region may comprise from about 2% to about 100% of the exon. The region may comprise from about 5% to about 100% of the exon. The region may comprise from about 5% to about 99% of the exon. The region may comprise from about 1% to about 90% of the exon. The region may comprise from about 5% to about 90% of the exon. The region may comprise from about 10% to about 100% of the exon. The region may comprise from about 10% to about 90% of the exon. The region may comprise from about 15% to about 100% of the exon. The region may comprise from about 15% to about 85% of the exon. The region may comprise from about 20% to about 80% of the exon. The region can consist essentially of exons. A region can contain more than one exon. The region may contain introns or parts thereof. The portion of the exon or intron can be at least about 1 nucleotide. The portion of the exon or intron can be at least about 5 nucleotides. The portion of the exon or intron can be at least about 10 nucleotides. Kits and systems comprising the donor polynucleotides disclosed herein are provided herein. The donor polynucleotide can comprise an end that is compatible with insertion between the first site and the second site. The donor polynucleotide can be an in vitro exon that contains a splice site at the 5' and 3' ends of the in vitro exon. The donor polynucleotide may comprise an in vitro exon comprising a splice site at the 5' end and the 3' end of the in vitro exon. The splice site allows exons to be included in the open reading frame of the gene, and thus the splice site will ensure that the in vitro exon is transcribed in the relevant cell. The donor polynucleotide can comprise a wild type sequence. The donor polynucleotide can be homologous to the excised region. The donor polynucleotide can be at least about 99% homologous to the excised region. The donor polynucleotide can be at least about 95% homologous to the excised region. The donor polynucleotide can be at least about 90% homologous to the excised region. The donor polynucleotide can be at least about 85% homologous to the excised region. The donor polynucleotide can be at least about 80% homologous to the excised region. The donor polynucleotide can be identical to the excised region, except that the donor polynucleotide comprises a wild type sequence, wherein the excised region comprises a mutation. In some cases, the donor polynucleotide is not similar to the excised region. The donor polynucleotide can be less than about 90% homologous to the excised region. The donor polynucleotide can be less than about 80% homologous to the excised region. The donor polynucleotide can be less than about 70% homologous to the excised region. The donor polynucleotide can be less than about 60% homologous to the excised region. The donor polynucleotide can be less than about 50% homologous to the excised region. The donor polynucleotide can be less than about 40% homologous to the excised region. The donor polynucleotide can be less than about 30% homologous to the excised region. The donor polynucleotide can be less than about 20% homologous to the excised region. The donor polynucleotide can be less than about 10% homologous to the excised region. The donor polynucleotide can be less than about 8% homologous to the excised region. The donor polynucleotide can be less than at least about 5% homologous to the excised region. The donor polynucleotide can be less than at least about 2% homologous to the excised region. Provided herein are kits and systems for treating an ocular condition comprising at least one guide RNA that targets a sequence selected from the group consisting of NRL and NR2E3. The first guide RNA and/or the second guide RNA can target the Cas9 protein to a sequence comprising any of SEQ ID NO.: 1-4. The first guide RNA and/or the second guide RNA can target the Cas9 protein to a sequence that is at least 90% homologous to any of SEQ ID NO.: 1-4.Certain terms All technical and scientific terms used herein have the same meaning as commonly understood by the skilled artisan of the claimed subject matter, unless otherwise defined. It is to be understood that the foregoing general description and the claims In the present application, the use of the singular includes the plural unless otherwise specified. It must be noted that the singular forms "a", "an", "the" In this application, the use of "or" means "and/or" unless stated otherwise. In addition, the use of the term "including" and other forms, such as "include", "includes" and "included", is not limiting. As used herein, ranges and quantities may be expressed as "about" a particular value or range. The appointment also includes the exact amount. For example, "about 5 μL" means "about 5 μL" and also "5 μL". In general, the term "about" includes the amount that would be expected to be within experimental error. The term "about" includes values below 10% to 10% of the value provided. For example, "about 50%" means "between 45% and 55%". And, by way of example, "about 30" means "between 27 and 33." Portions of the headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter. As used herein, the terms "individual (s)", "subject (s)", and "patient" mean any mammal. In some embodiments, the mammal is a human. In some embodiments, the mammal is non-human. The term "statistically significant" or "significant" refers to statistical significance and generally means two standard deviations (2 SD) below the normal concentration of the marker or two standard deviations (2 SD) below the marker concentration. The term refers to statistical evidence of the difference. It is defined as the probability of making a decision to reject a null hypothesis when the null hypothesis is actually true. The p value is often used to make a decision. A p value of less than 0.05 was considered to be statistically significant. As used herein, the terms "treating" and "treatment" refer to an individual administering an effective amount of a composition such that at least one symptom of the disease of the individual is reduced or the disease is ameliorated, such as a beneficial or desired clinical outcome. For the purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, one or more symptom relief, reduced disease severity, stable disease state (ie, no deterioration), delayed or slowed progression of disease, improvement or mitigation of disease states, And mitigation (partial or complete), whether detectable or undetectable. Alternatively, if the progression of the disease slows or stops, the treatment is "effective." Those in need of treatment include those who have been diagnosed with the disease or condition, as well as other factors due to genetic sensitivities or diseases or conditions (as non-limiting examples, such as the weight, diet, and health of the individual, which may result in the individual being Those who have diabetes or a disease may develop a disease or condition. Those in need of treatment also include individuals who require medical or surgical attention, care or management. Without further elaboration, it will be apparent to those skilled in the art that the invention may The following examples are illustrative only and are not intended to limit the remainder of the invention in any way.Instance The examples and embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the claims. Various modifications and variations are apparent to those skilled in the art and are included within the scope of the scope of the invention.Instance 1. Use two guides in vitro RNA It CRISPR - Cas9 Targeting To test the CRISPR-CAS9-based cell reprogramming strategy for the treatment of RP and protection of visual function, two AAV vectors were used, one for Cas9 and the other for gRNA targeting NRL or NR2E3 (seeFigure 1A ). To construct a dual gRNA expression vector, pAAV-U6 gRNA-EF1a mCherry was used. Two 20 bp gRNA sequences were separately subcultured into the vector. The CRISPR/Cas9 target sequence used for this study (underlined 20 bp target and 3 bp PAM sequence) is shown below: GAGCCTTCTGAGGGCCGATC for NRL blocking gene expressionTGG (SEQ ID NO. 1) and GTATGGTGTGGAGCCCAACGAGG ( SEQ ID NO. 2), GGCCTGGCACTGATTGCGAT for NR2E3 blocking gene expressionGGG (SEQ ID NO. 3) and AGGCCTGGCACTGATTGCGATGG (SEQ ID NO. 4). The targeting and inactivation efficiencies of simultaneously targeting two sites from two gRNAs in the same gene are assessed relative to the targeting and inactivation efficiencies of a single gRNA. The gene blocking gene expression efficiency in mouse fibroblasts was tested using a T7E1 nuclease assay that cleaves a mismatched double-stranded DNA template. Blocking gene expression efficiency of two gRNA systems has much higher editing efficiency than performance by a single guide RNA system (seeFigure 1B And map 1C ). Therefore, the dual-targeted gene knockout strategy was used for all subsequent in vivo experiments.Instance 2 . Use two guides in vivo RNA It CRISPR - Cas9 Targeting Two guide RNAs encoding AAV of Cas9 and targeting the NRL gene were delivered to WT mice via subretinal injection at P0 (day 7 postpartum). Briefly, the eyes of the anesthetized mice were dilated, and 1 μl of the AAV mixture was passed through a small incision using a glass micropipette (internal diameter 50-75 μm) and a pump microinjector (Picospritzer III; Parker Hannifin) under direct observation using a dissection microscope. Injection into the subretinal space. Successful injections were noted by creating small subretinal fluid bubbles. Any mice showing retinal damage (such as bleeding) were not included in the study. P30 mice were sacrificed for histology. The retina is segmentally frozen and stained for use as a cone marker, including an anti-mouse cone inhibitor protein (mCAR) antibody and an anti-mediated wavelength opsin (M-diapoprotein) antibody. mCherry is also imaged as a marker to label the transduction region and cells by the AAV vector. The results show that AAV8-Cas9+AAV8-NRL gRNA1-mCherry may not induce any phenotype, indicating that a single gRNA1 is not able to efficiently introduce genomic sequence rupture. According to the in vitro T7E1 analysis, it was observed that the fate conversion phenotype has two gRNAs in vivo. In the control retina, the cone nucleus resides on the top of the ONL, while the rod cell nucleus fills the rest of the ONL (seeFigure 3A ). Retinal transduction was observed to have AAV8-Cas9+AAV8-NRL gRNA2+3-mCherry, and multiple mCAR+ cells were present in the lower outer nuclear layer (ONL) (seeFigure 3B ). Additional mCAR+ cells at the lower ONL layer have normal rod extracellular fragments (seeFigure 3B ). No additional mCAR+ cells at the lower ONL layer were observed in the uninjected control retina on the left. Quantitative display of a significant increase in additional mCAR+ cells at the lower ONL layer in the AAV8-Cas9+AAV8-NRL gRNA2+3-mCherry co-injection group (Figure 3D ). Staining with M-diazein antibody also showed that these cells exhibited another cone-specific gene Opn1mw (Figure 3C ), indicating the feasibility of the cone gene expression program.Instance 3 . Coding targeting NRL or NR2E3 It Cas9 / CRISPR Systematic AAV of Retinal pigmentation ( RP ) Subretinal injection of model mice. To test the hypothesis that denaturation of rod cells into cones was sufficient to rescue retinal degeneration and restore retinal function, AAV-gRNA/Cas9 was injected into the subretinal space of RD10 mice at P0. RD10 mice are models of autosomal recessive RP with rapid rod-shaped photoreceptor degeneration in humans. RD10 mice carry spontaneous mutations in the rod-phosphodiesterase (PDE) gene, leading to rapid rod degeneration beginning at around P18. Rod cell degeneration is completed simultaneously with cell degeneration within 60 days postpartum. Since photoreceptor denaturation does not overlap with retinal development, and photoreaction can be recorded for about one month after birth, RD10 mice mimic the typical human RP more closely than other RD models, such as rd1 mutants. The analysis was performed between the 7th and 8th week after delivery. To determine the effect of this AAV-gRNA/Cas9 treatment on the physiological function of the retina, an electroretinogram (ERG) response was tested to measure rod cells (dignified, esoteric ERG but not analyzed) and cones (light) electrical activity. The ERG test was performed at week 6 (P50) after the injection. All eyes treated with AAV-gRNA/Cas9 showed significantly improved bright b-wave values indicating enhanced cone function (seeFigure 5B ). These results show that AAV-gRNA/Cas9 treats the photoreceptor of the first aid and denatures and protects the retinal visual function. DNA analysis reveals the correct blockade of gene expression in injected AAV-gRNA/Cas9 eyes (seeFigure 2C ). In addition, AAV-gRNA/Cas9 injection resulted in significant improvement in ONL thickness compared to uninjected controls (seeFigure 4C ). Unlike untreated eyes in the ONL having only 1 to 2 (or sparsely distributed) photoreceptor nuclei, there are 3 to 5 ONL layers, indicating that AAV-gRNA/Cas9 treatment prevents photoreceptor cell degeneration. Quantitative RT-PCR (qRT-PCR) for measuring the relative amount of rod and cone photoreceptor genes (seeFigure 5C ). These analyses show an increase in the performance of cone-specific genes. Notably, a significant increase in ONL thickness was observed in the treated eye. Of interest, many of the cells in the ONL do not exhibit rod or cone markers, indicating that they can have been reprogrammed to intermediate cell fate. An additional or alternative explanation for the observed first aid effect is that such intermediate cells down-regulate rod-specific genes and thus reproduce their resistance to death/denaturation caused by rod-specific gene mutations. These intermediate cells may have maintained normal tissue structural integrity and secrete trophic factors important for the survival of endogenous cone cells. Thus visual function acquisition may have been partially attributed to the first aid effect in existing cone cells, rather than reprogramming rod cells to cone fate.Instance 4 . With treatment β Thalassemia Cas Targeted homology-guided repair of targeted hemoglobin gene mutations Beta thalassemia is a blood disorder that reduces the production of hemoglobin (Hb). A mutation known as CD41/42 (-TCTT) in the Hb encoding gene is associated with this condition. Repair of this gene can have a therapeutic effect for an individual having this condition. To specifically target both homologous and heterologous CD41/42 mutations in patient-derived hematopoietic stem/progenitor cells (HSPCs), two CRISPR/Cas9 target sequences located at the mutation site were selected. The specificity and efficiency were then tested based on the single-strand annealing principle (SSA) using luciferase assay. SSA is the procedure that begins when a double-stranded bread is completed between two repeating sequences in the same direction. The luciferase expression was activated by specific cleavage by the CRISPR/Cas9 system by placing the wild type and CD41/42 mutant sequences between two partially repeating luciferase expression cassettes. Both gRNA-1 and gRNA-2 show appropriate specificity, and gRNA-2 contains higher efficiency (Figure 6A ). gRNA-2 was selected for further HSPC editing. Next, the editing efficiency of different Cas9 formats and single-stranded oligodeoxynucleotides (ssODN) was tested. HDR-mediated editing was assessed by both HDR-specific PCR and drop-wise digital PCR. Among Cas9 mRNA and two Cas9 RNPs, Cas9 RNP-2 showed the highest HDR efficiency (Figure 6B , left ). Seven asymmetric ssODNs were designed and screened using Cas9 RNP-2, in which ssODN-111/37 achieved the highest HSPC editing efficiency (Figure 6B , Left and figure 6C ).Platinum. To construct a gRNA expression vector, pX330 (Addgene, 42230) was used. Two mutation-specific target sequences were separately sub-selected into the vector as previously described. The CRISPR/Cas9 target sequence used in this study (using the 20 bp target and the 3 bp PAM sequence shown underlined) is shown below as: gRNA-1: GGCTGCTGGTGGTCTACCCTTGG (SEQ ID NO.: 6); gRNA-2: GGTAGACCACCAGCAGCCTAAGG (SEQ ID NO.: 7). Purchase plastids for in vitro transcription of Cas9.Luciferase assay. To select for mutation-specific gRNA, wild-type and CD41/42 mutant sequences were synthesized and separately cloned into pGL4-SSA. pX330-gRNA-Cas9, pGL4-SSA-HBB and pGL4-hRluc were co-transfected into 293T cells. Luciferase assays were performed using a dual luciferase reporter assay system.In vitro transcription. A template for in vitro transcription of gRNA-2 was amplified using primers: gRNA-2-F: TAATACGACTCACTATAGGGACCCAGAGGTTGAGTCCTT (SEQ ID NO.: 8) and gRNA-F: AAAAGCACCGACTCGGTGCC (SEQ ID NO.: 9); plastid MLM 3639 was linear And then used for in vitro transcription of Cas9. gRNA and Cas9 were in vitro transcribed, purified and used for HSPC electroporation.Cas9 RNP It. To use a Cas9 RNP electroporation 20 ml cell suspension (100,000 cells), a 5 ml gRNA solution was prepared by adding 1.2 mol excess gRNA to Cas9 buffer. Another 5 ml solution containing 100 pmol of Cas9 was slowly added to the gRNA solution and incubated at room temperature for > 10 minutes before mixing with the target cells.Patient derived CD34 + HSPC Isolation and cultivation. The cryopreserved motor peripheral blood PBMC from patients with CD41/42 mutations were used for HSPC isolation and culture.Patient derived CD34 + HSPC In the middle HBB edit. To edit patient-derived HSPCs, HSPCs were isolated and cultured two days prior to the use of Cas9 mRNA or Cas9 RNP electroporation as previously described. 100,000 HSPC pellets and resuspended in 20 ml Lonza P3 solution with 10 ml Cas9 RNP and 1 ml 100 M ssODN template or the same molar Cas9 mRNA, gRNA and 1 ml 100 M ssODN template mixing. This mixture is electroporated, genotyped and used for differentiation of erythroid cells.Edited cells for genotyping. HDR-specific forward primer and universal reverse primer HDR-F: CCCAGAGGTTCTTCGAATCC (SEQ ID NO.: 10) universal R: TCATTCGTCTGTTTCCCATTC (SEQ ID NO.: 11) was used. Perform HDR-specific PCR. BstBI (NEB, R0519) constrained digestion was also used to assess HDR-mediated editing: the region for CD41/42 mutation was first amplified and then digested with BstBI for mutation to HDR editing. The HDR-mediated editing of the CD41/42 mutation was also assessed by Droplet Digital PCR (ddPCR, QX200, Bayer Reid Laboratories, Inc.) HBB-F: CTGCCTATTGGTCTATTTTCC (SEQ ID NO.: 12); HBB-R :ACTCAGTGTGGCAAAGGTG (SEQ ID NO.: 13); probe donor: 6-FAM/CCCAGAGGTTCTTCGAATCCTTTG/BHQ1 (SEQ ID NO.: 14); probe mutation: HEX/CTTGGACCC AGAGGTTGAGTCC/BHQ1 (SEQ ID NO.: 15).Flow cytometry. The purity and linearity of HSPC after isolation and electroporation were analyzed for LSR cell analyzer (BD Biosciences).Target deep sequencing. Use the CRISPR design tool to search for the top 12 predicted off-target sites. The target region and possible off-target regions were amplified from HSPC DNA and used for library construction. The primers for amplifying the genomic region are listed as follows: HBB-F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTGCCTATTGGTCTATTTTCC (SEQ ID NO.: 16); HBB-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTCAGTGTGGCAAAGGTG (SEQ ID NO.: 17). A PCR amplicon from the first step was purified using Ampure beads (Beckman Coulter) and then subjected to a second circular PCR to attach a sample specific barcode. The purified PCR products were combined at equal ratios for sequencing with the opposite end of Illumina MiSeq. The original reads are mapped to the mouse reference genome mm9. Analyze high quality reads (score > 30) for insert and delete (insert delete) events and maximum possible estimate (MLE) calculations as previously described. The CRISPR-Cas9 targeting efficiency and activity demonstrated above was underestimated due to the inability to detect larger deletions and insertion events for next generation sequencing analysis of insertion deletions.Instance 5 . Homology independent targeting integration for in vivo retinal degeneration ( HITI ) Gene replacement therapy The Royal Society of Physicians (RCS) rats are widely used animal models of hereditary retinal degeneration called retinitis pigmentosa, a common cause of blindness in humans.Mertk A homozygous mutation in a gene (with a 1.9 kb deletion from intron 1 to exon 2) results in defective phagocytic function of the retinal pigment epithelium (RPE), accompanied by subsequent RPE and photoreceptor Transgender and blindnessFigure 7A ). Retinal degeneration in RCS rats can be assessed by electroretinogram (ERG) by morphological and visual function tests. Morphological changes in photoreceptor in vitro nuclear layer (ONL) degeneration were presented in RCS rats as early as day 16 postpartum (P16). In order to restore the eyesMertk Gene retinal function, can produceMertk A functional copy of exon 2 was inserted into the AAV vector of intron 1 via HITI (AAV-rMertk-HITI). For comparison, an HDR AAV vector is also generated to recover the deleted 1.9 bp region (AAV-rMertk-HDR) (Figure 7B ). AAV was injected into the rat eye at 3 weeks postpartum and analyzed at weeks 7-8 (Figure 7C ). From DNA analysis, detection of correct DNA gene insertion in AAV injected eyes (Figure 7D And map 8 ). HITI-AAV injection resulted in comparison with untreated and HDR-AAV camerasMertk The amount of mRNA expression is significantly increased and the ONL thickness is well maintained (Figure 7E and Figure 7F ). H&E staining confirmed the increased photoreceptor ONL in the injected eye. In contrast, untreated and HDR-AAV treated eyes have only one-two or sparsely distributed photoreceptor cell bodies in the ONL. MERTK protein expression was also observed in HITI-AAV, not in the eyes of HDR-AAV injections (Figure 7G ). To determine the therapeutic effect on the physiological function of the retina, the ERG response was tested at week 4 (P50) after injection to measure the electrical activity (10 Hz scintillation) of rod and cone function. Briefly, 1% surface tropamide was used to dilate the eyes of deeply anesthetized mice. An active lens electrode is placed on each cornea, the ground needle electrode placed subcutaneously is at the tail, and the subcutaneous reference electrode is at the head, approximately between the eyes. Light simulations were carried out in a Ganzfeld tank using a xenon lamp and the results were processed using software from Diagnosys. Bright ERG public execution: at 30 cd/m² The cone reaction was 10 cd/m after 10 minutes of light adaptation under background light.² 34 cds/m of low background light² The flash is triggered and the signal is averaged from 50 sweeps. All eyes treated with HITI-AAV showed a significantly improved ERG b wave response (Figure 7H ). Similarly, the 10 Hz scintillation value of the measured cone response was significantly improved and was more than 4 times higher than the unscrolled eye.Figure 7I ). These results show that AAV-HITI treatment can provide first aid and protect retinal visual function in the RCS rat model.Instance 6 . Having a coded targeting colon cancer cell Cas9 / CRISPR Systematic AAV of Intraperitoneal injection One or more viruses encoding Cas9 and two guide RNAs that target a gene carrying a mutation that drives colon cancer are injected intraperitoneally into an individual with colon cancer. The gene is APC. Alternatively, the genes are MYH1, MYH2, MYH3, MLH1, MSH2, MSH6, PMS2, EPCAM, POLE1, POLD1, NTHL1, BMPR1A, SMAD4, PTEN or STK11. A colon biopsy is obtained after four weeks and compared to or from a colon biopsy of an individual prior to treatment with the virus. The number of colon cancer cells in the biopsy samples obtained after treatment was less and the intestinal cells were more numerous than the number of biopsy samples obtained prior to treatment. It is concluded that colon cancer cells have been reprogrammed into benign small intestinal cells.Instance 7 . Having a targeted lymphoma cell Cas9 / CRISPR Systematic AAV of Intravenous injection One or more viruses encoding Cas9 and two guide RNAs that target a gene carrying a mutation that drives a B cell lymphoma are injected intravenously into an individual with a B cell lymphoma. The gene is C-MYC. Alternatively, the gene is CCND1, BCL2, BCL6, TP53, CDKN2A or CD19. A blood sample is obtained after four weeks and compared to or from a blood sample of an individual prior to treatment with the virus. The number of B cells in the blood sample obtained after treatment is less and there are more macrophages than the number of blood samples obtained before treatment. It is concluded that B cell lymphoma cells have been reprogrammed to benign macrophages.Instance 8 . Coding targeting for immunotherapy T cell It Cas9 / CRISPR Systematic AAV of Intravenous injection Two guide RNAs encoding Cas 9 and targeting PD-1 and/or PD-L1 checkpoint inhibitor encoding genes are injected intravenously into patients with metastatic melanoma. Alternatively, the patient has another cancer such as metastatic ovarian cancer, metastatic renal cell carcinoma or non-small cell lung cancer. T cells are infected with the virus, and the PD-1 encoding gene is not activated, maximizing the number and response of T cells. The patient's PD-L1 cancer cells are also infected, and PD-L1 is also not activated, and PD-L1, which reduces T cell activation and cytokine production, is banned, which usually provides immune escape to cancer cells.Instance 9 . Split Cas9 Delivery platform The CRISPR/Cas9-mediated targeting inactivation affecting NRL in the retina of in vivo rod cells to cone reprogramming is performed below. Adeno-associated virus is selected for gene transfer due to its mild immune response, long-term transgenic gene expression, and favorable safe distribution. To overcome its limited packaging capabilities, a split Cas9 system was used. The S. pyogenes Cas9 (SpCas9) protein is split into two parts using a split intein. Each SpCas9 moiety is fused to its corresponding split intein portion. After total performance, the entire SpCas9 protein was rehydrated. By using two AAV vectors in this way (seeFigure 9 The residual encapsulation capacity of each vector accommodates a wide range of genomic engineering functionality, including multiple targeting via single or dual gRNA delivery and AAV-CRISPR-Cas9-mediated targeting of in vivo genes for in situ therapy. inhibition.Instance 10 . Use one or two gRNA It Dual carrier delivery effectiveness The dual AAV vector method was evaluated for the delivery of Cas9 and gRNA targeting NRL. A construct that targets one or two gRNAs of NRL is designed to determine whether targeting two sites has a higher targeting efficiency than a single gRNA for two gRNAs of the same gene.Figure 10A The underlined PAM sequence is used to display the target sequence. Furthermore, in order to avoid repetitive sequences in AAV, thereby impairing vector stability and virus titration, each gRNA was independently driven using the human U6 promoter and the mouse U6 promoter. Additional non-homologous tracrRNA was employed. Standard T7 Endonuclease 1 was used to quantify the rate of gene editing in mouse embryonic fibroblasts (MEF). MEF was co-transfected with a split Cas9-Nrl vector and genomic DNA was used for T7E1 analysis (Figure 10B ). Arrows indicate lytic DNA produced by the T7E1 enzyme specific for heteroduplex DNA caused by genome editing. The mutation frequency is calculated from the ratio of the slit band intensity to the total band intensity. Gene targeting efficiency is improved in a single gRNA approach using a dual gRNA targeting strategy.Instance 11 . KRAB Transcriptional repressors are included in the dual vector system Transcriptional interference is achieved by the use of KRAB transcriptional repressors. Constructed on the bis-AAV vector system described in Example 10, the KRAB transcriptional repressor was incorporated into the split Cas9 system by fusing the KRAB inhibitor domain to the N-terminus of the Cas9 protein sequence (Figure 11 ). This produces a reversible method of scar-free and possibly gene therapy in which the risk of mutation induction is minimized due to the inactivation of Cas9 nuclease activity.Instance 12 . Wild type and NRL - GFP Reprogramming of rod cells to cones in mice AAV-gRNA/Cas9 or AAV-gRNA/KRAB-dCas9 targeting NRL was injected into the subretinal space of wild-type mice on day 7 postpartum (p7) and sacrificed at P30 for histology (Figure 12A ). Both the AAV2 protein shell and the tyrosine mutant Y444F were evaluated for transduction efficiency. The Y444F mutant vector shows enhanced retinal transduction at the AA2 stage and was used for subsequent studies. The retina is flash frozen, segmented, and stained for use in cone markers, including cone inhibitory protein (mCAR) and vector wavelength opsin (M-diazonin). As shown in the staining section and in the cell analysis (Figure 12B To map 12D The reprogrammed photoreceptor phenotype was found to have Cas9-gRNA. The cones were specifically expressed in ONL compared to the wild type control. Quantitative RT-PCR (qRT-PCR) was used to measure the relative amount of rod and cone genes in reprogrammed retina and controls. There is a down-regulation of the rod-specific gene, and the cone-specific gene is up-regulated (Figure 12E ). Transgenic NRL-GFP mice in which all rod-shaped photoreceptor cells are labeled are injected subretinally with AAV-NRL gRNA/Cas9 as described (Figure 12F ). Significant increase in the number of mCAR positive cells and simultaneous Nrl-GFP⁺ The reduction of the rod-shaped photoreceptor is visible (Figure 12G And map 12H ). Many morphological cone cells are noteworthy in the inner layer of the inner nuclear layer, reminiscent of horizontal cells (HC) in the wild-type retina (Figure 12I ). In addition, it was detected that these cells exhibited both cone-labeled m-CAR and HC-labeled cadherin (Figure 12J ), indicating that the horizontal cells also remain subject to the possibility of cone cell reprogramming. It is concluded that rod cells have been reprogrammed into cone cells.Instance 13 Targeting NRL in rd10 mice, which is a model for autosomal recessive RP. These rd10 mice carry spontaneous mutations in the rod-phosphodiesterase gene and exhibit rapid rod cell degeneration beginning around P18. At P60, the rod cells are no longer visible and the accompanying cone-shaped photoreceptors are denatured. To assess whether rod-to-cone conversion is sufficient to reverse retinal degeneration and first aid visual function, AAV-gRNA/Cas9 or AAV-gRNA/KRAB-dCas9 was injected into rd10 mice at P7. Such therapeutic effects on cone physiological functions and visual acuity were determined by measuring electroretinogram (ERG) response and optical dynamic nystagmus (OKN) to quantify cone photoreceptor activity at week 6 (P60) after injection. (Ming visual response) and vision (Figure 13A ). The OKN is measured by briefly creating four computer monitors surrounding the platform in the virtual reality chamber on which the test animals are placed. After allowing the animal to adapt to the test condition, a virtual cylinder covered with a vertical sinusoidal grating is projected onto the monitor. The virtual bar cylinder is set to the highest contrast (100%, black 0, white 255, 250 cd/m from above)² Lighting), the number of bars starts at 4 per screening (2 black and 2 white). The test was started with a speed 13 starting clockwise for 1 minute followed by a counterclockwise rotation for 1 minute. A video camera positioned above the animal allows the observer to track and record head movements without bias. Data were quantified by cycle/degree (c/d) and expressed as mean ± S.D., using a t-test statistical analysis. A p value <0.05 was considered statistically significant. All eyes treated with AAV-gRNA/Cas9 or KRAB-dCas9 have improved cone function and visual function, as indicated by a significant improvement in brightness b-wavelength and sharpness (Figure 13B to Figure 13 C ). In addition, based on the improvement of visual function, multiple mCAR positive cells and M-fluoresesin positive cells were observed on histological analysis of AAV-NRL gRNA/Cas9 or KRAB-dCAS9 treated rd10 retina (Figure 13D to Figure 13 G ). Although the untreated eye has only a sparsely distributed photoreceptor nuclei in the ONL, the AAV-gRNA/Cas9 or AAV-gRNA/KRAB-dCas9 treated eyes have 3 to 5 ONL layers (Figure 13D ), indicating that the treatment prevents photoreceptor degeneration and retains ONL.Instance 14 Late / Production of cone cells in terminal diseases AAV-gRNA/Cas9 or AAV-gRNA/KRAB-dCas9 in P60 (Figure 14A ) Subretinal injection into rd10 mice in which no viable photoreceptors and non-recordable ERG were present. All eyes treated with AAV-gRNA/Cas9 or AAV-gRNA/KRAB-dCas9 have improved cone function and visual function, such as by b-wave value and vision (Figure 14B to Figure 14C Significant improvement and indication of simultaneous increase in multiple cone cell mCAR positive cells. Cones Opsin was observed in all eyes treated with AAV-gRNA/Cas9 or AAV-gRNA/KRAB-dCas9 in neonates and adult rd10 mice⁺ Colocalized calculin expression in a significant portion of cells (Figure 14D ). It is concluded that interneuron-to-cone reprogramming can be applied to late/end stage RP gene therapy, and rod and cone photoreceptors have been substantially deformed and depleted at late/end stage.Instance 15 . in 3 Within months restore Olf FvB Retinal function in retinal degeneration mice Has a B-order unit for encoding cGMP phosphodiesterase (PDE)Pde6b ^rd1 The homozygous mutant FVB/N mice display hereditary autosomal recessive retinal degeneration characterized by a rapid initial deletion of the rod-shaped photoreceptor at p35 and subsequent deletion of the conical photoreceptor. Such mice are in P60 (figure15A ) AAV-gRNA/KRAB-dCAS9 was injected subretinally. Histological analysis was performed as in the previous examples. AAV-gRNA/KRAB-dCAS9 treated retina shows mCAR with significantly improved brightness b-wave value and vision⁺ The emergence of cells, showing improved visual function (Figure 15B to Figure 15C ). It was concluded that the CRISPR/Cas-9 mediated cell reprogramming described herein is a gene and mutation independent therapy.

Various aspects of the invention are set forth in detail in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by the following detailed description of exemplary embodiments of the invention and the accompanying drawings . FIG. 1A shows an adeno-associated virus (AAV) vector, encoding a targeted NRL gene. The top vector of the two guide RNAs, the intermediate vector encoding the two guide RNAs targeting the NR2E3 gene, and the bottom vector encoding Cas9. Figure IB shows that targeting the NRL gene (lane 6 from the left) using two guide RNAs in the T7E1 assay is more efficient than targeting the NRL gene with a single guide RNA (lane 5 from the left). Figure 1C shows that targeting the NR2E3 gene (lane 6 from the left) using two guide RNAs in the T7E1 assay is more efficient than targeting the NRL gene with a single guide RNA (lane 5 from the left). Figure 2 shows a representative schematic representation of administration of Cas9 and guide RNA and analysis of their viral-mediated delivery to treat retinitis pigmentosa (RP). Figure 3A shows the nuclei (DAPI), cones (mCAR) and viral manifestations in the retina of mice treated with a virus that produces Cas9 and Nrl guide RNA (top panel) versus mice treated with a control virus (below) ( mCherry) staining. Figure 3B shows an enlarged view of the staining of cone cells (mCAR) (relative to Figure 3A ). Figure 3C shows an enlarged view of the staining of cone cells (M-Rayoptin) (relative to Figure 3A ). Figure 3D shows quantification of mCAR positive cells in the subretinal outer nuclear layer (ONL) of mice treated with virus producing Cas9 and Nrl guide RNA compared to mice treated with control virus. Figure 3E shows quantification of mCAR positive cells in the retina of mice treated with virus producing Cas9 and Nrl guide RNA compared to mice treated with control virus, considering the inclusion of pre-existing cones plus newly programmed cones All mCAR front cone cells. Figure 4 shows quantification of extranuclear layer (ONL) thickness in wild-type mice, RP-treated mice treated with control virus, and RP-treated mice treated with virus producing Cas 9 and Nrl guide RNA or NR2E3 guide RNA. . Figure 5A shows, via electroretinogram (ERG), improved Vision in mice treated with Cas9/gRNA for RP (top panel) over similar mice treated with control virus (bottom panel). Figure 5B shows quantification of the brightness ERG b wave amplitude in uninjected mice, AAV-gRNA injected mice, and AAV-Cas9 plus AAV-gRNA injected mice. Figure 6A shows luciferase assays for CD41/42 specific gRNA selection. Figure 6B shows a comparison of Cas9 mRNA and Cas9 RNP mediated HBB editing (left) versus screening of ssODN using Cas9 RNP-2 (right). Figure 6C shows a drop-wise digital PCR analysis of HDR-mediated editing using ssODN (111/37). Figure 7A shows a schematic representation of the Mertk gene in both wild-type and RCS rats. Pentagon, Cas9/gRNA targeting sequence, black line inside the pentagon, Cas9 cleavage site. Figure 7B shows a schematic of the Mertk gene-corrected AAV vector. Exon 2, including the intron, is sandwiched by the Cas9/gRNA targeting sequence and integrated into the intron 1 of Mertk by HITI. AAV is encapsulated in serotype 8. The black half arrow indicates the PCR primer pair to verify correct gene insertion. Figure 7C shows a schematic of an experimental design for Mertk gene correction in RCS rats. AAV-Cas9 and AAV-rMertk-HITI or AAV AAV-rMertk-HDR were locally delivered to RCS rats by subretinal injection at week 3 and analyzed at 7 to 8 weeks. Figure 7D demonstrates the correct gene insertion in the eyes of AAV-Cas9 and AAV-rMertk-HITI injections by PCR. Figure 7E shows the relative Merkt mRNA expression in the eyes of AAV injection by RT-PCR. Number of animals in all bar graphs: n=8 for RCS rats, n=8 for normal rats, n=6 for AAV-Cas9+AAV-rMertk-HITI treatment group and AAV-Cas9+AAV-rMertk-HDR treatment n= 3. Figure 7F shows the morphology of the retina showing the photoreceptor first aid in the eyes of AAV injection. Increased preservation of the photoreceptor outer nuclear layer (ONL) was observed compared to untreated and AAV-HDR treated RCS eyes with only very thin ONL (see square brackets). Scale bar, 20 microns. Figure 7G shows a modified rod cell and cone mixing reaction (left, wave form; right, quantified bars) showing improved b-wave values in the eyes of AAV-Cas9 and AAV-rMertk-HITI injections. Number of animals in all bar graphs: RCS rat n=8, normal rat n=8, AAV-Cas9+AAV-rMertk-HITI treatment group n=8 and AAV-Cas9+AAV-rMertk-HDR treatment n= 6. Figure 7H shows a modified 10 Hz scintillation cone reaction in the eyes of AAV-Cas9 and AAV-rMertk-HITI injections. Number of animals in all bar graphs: RCS rat n=8, normal rat n=8, AAV-Cas9+AAV-rMertk-HITI treatment group n=8 and AAV-Cas9+AAV-rMertk-HDR treatment n= 6. *P < 0.05, Stutton's t test. Figure 8 shows a schematic representation of Cas9-mediated restoration of functional exon 2 to Mertk genes. Figure 9 shows a schematic representation of an AAV vector construct for cleavage of the Cas9 Nrl genome. Figure 10A lists target sequences for Nrl blocking gene expression and inhibition. The PAM sequence is underlined. Figure 10B is a T7E1 analysis of Nrl gRNA in mouse embryonic fibroblasts. The schema reveals SEQ ID NOS 1 through 2 and 18 through 19, respectively, in order of appearance. Figure 11 shows a schematic representation of the AAV construct used to cleave the KRAB-dCas9 Nrl gene inhibition. Figure 12A to Figure 12E show CRISPR/Cas9 blocking gene expression or inhibition strategies using immunofluorescence assays for cells in normal mouse retinas treated with AAV-Nrl gRNA/dis division Cas9 or AAV-Nrl gRNA/dis division Cas9 Alignment of rod-to-cone cell reprogramming in wild-type mice. Rhodopsin, green; DAPI, blue. Figure 12A shows an experimental design for editing or inhibiting NRL in wild type mice. Mice were treated at P7 and analyzed at P30. Figure 12B shows an analysis of mCAR ⁺ cells (stained in red). Figure 12C shows an analysis of M-Opsin ⁺ cells (stained in red). Figure 12D shows quantification of total mCAR ⁺ and M-Opsin ⁺ cells. Results are shown as mean ± sem (*p, 0.05, Studen's t-test). Figure 12E shows RT-qPCR analysis of rod- and cone-specific markers in treated wild-type retina. RNA from each group was extracted from the entire retinal tissue. Results are shown as mean ± sem (*p, 0.05, Studen's t-test). Figure 12F to Figure 12H show rod-to-cone in NRL-GFP mice mediated by CRISPR/Cas9 blocking gene expression and inhibition strategy using AAV-Nrl gRNA/split Cas9 or AAV-Nrl gRNA/split Cas9 Cellular cell reprogramming. Figure 12F shows an experimental design for editing or inhibiting NRL in NRL-GFP mice. Mice were treated at P7 and analyzed at P30. Figure 12G shows immunofluorescence analysis of mCAR ⁺ cells from mice treated at P7 and collected at P30. GFP, green; mCAR, red; DAPI, blue. Figure 12H shows quantification of mCAR ⁺ cells. Results are shown as mean ± sem (*p < 0.05, Studen's t-test). Figure 12I shows the anatomical location of mCAR ⁺ cells in wild-type retina treated with Nrl gRNA/disrupted Cas9. Arrows indicate mCAR ⁺ cells that were ectopically located at the ONL and upper INL. Figure 12J shows immunofluorescence analysis of Calbindin ⁺ and mCAR ⁺ cells in wild-type mice treated with AAV-Nrl-gRNA/dividing Cas9 or AAV-Nrl-gRNA/dividing KRAB dCas9. Calbinden, green; mCAAR, red; DAPI, blue. The arrow indicates Calbindin ⁺ /mCAR ⁺ cells. 13A to 13G show the use of AAV-Nrl gRNA / or split Cas9 AAV-Nrl gRNA / split Cas9 saving of retinal degeneration mouse retinal function of CRISPR / Cas9 block gene expression or suppression strategy. Figure 13A shows an experimental design for editing or performance of NRL rd 10 mice. Mice were treated at P7 and analyzed at P60. Degeneration of rod cells begins around P18, and cones degenerate after a few days. P60 did not detect rod cell and minimal cone activity. Figure 13B shows quantification of b-wave amplitude in injected and uninjected rd10 mice (n=3, results are shown as mean ± sem, *p < 0.05, paired Studen's t-test) and injected and not injected Vision of rd10 mice (n=3, results are shown as mean ± sem, *p < 0.05, Studen's t-test). Figure 13C shows representative ERG wave records showing improved cone response in the eyes injected with AAV-Nrl gRNA/split Cas9 or AAV-Nrl gRNA/split Cas9. Figure 13D shows immunofluorescence analysis of mCAR ⁺ cells in treated retina. Rhodopsin, green; mCAR, red; DAPI, blue. Figure 13E shows quantification of mCAR ⁺ cells (mean ± sem, *p < 0.05, Studen's t-test) and ONL thickness (mean ± sem, * p < 0.05) in treated retina. Figure 13F shows immunofluorescence analysis of M-Opsin ⁺ cells in treated retina. Rhodopsin, green; M-diaphorin, red; DAPI, blue. Figure 13G shows quantification of M-Opsin ⁺ cells in treated retina. Results are shown as mean ± sem (*p < 0.05, Studen's t-test). Figures 14A- 14C show CRISPR/CAS9 blocking gene expression and inhibition strategies for reactivation of retinal function in 3 month old retinal degeneration mice using AAV-Nrl gRNA/dis division Cas9 or AAV-Nrl gRNA/dis division Cas9. Mice were treated at P90 and analyzed at P130. No rod or cone activity was detected in the Rh10 mice at P90. Figure 14A shows an experimental design for editing or inhibiting NRL in Rd10 mice. Figure 14B shows immunofluorescence analysis of mCAR ⁺ cells in treated retina. Rhodopsin, green; mCAR, red; DAPI, blue. Figure 14C shows mCAR ⁺ cells in the retina treated with rd10 (*p<0.05, Studen's t-test), ONL thickness (*p<0.05), b-wave amplitude (n=3, *p<0.05, Quantification of Stutton's t test) and visual acuity (n=3, *p<0.05, Stewart's t test). Figure 14D shows immunofluorescence analysis of Calbindin ⁺ and Opsin ⁺ cells in treated adult retinal degeneration mice treated with AAV-Nrl gRNA/dis division Cas9 or AAV-Nrl gRNA/dis division Cas9, indicating that in retinal degeneration mice Horizontal cell to cone cell reprogramming. Rd10 mice were treated at 3 months and collected after 6 weeks (P130). Calpain, red; opsin, green; DAPI, blue. The arrow indicates Calbindin ⁺ /Opsin ⁺ cells. 15A to 15C show the use of AAV-Nrl gRNA / or split Cas9 AAV-Nrl gRNA / restart split Cas9 retinal functions at 3 months of FvB mouse retinal degeneration CRISPR / CAS9 block gene expression and suppression strategies. Mice were treated at P90 and analyzed at P130. Figure 15A shows an experimental design for editing or inhibiting NRL in FvB mice. Figure 15B shows immunofluorescence analysis of mCAR ⁺ cells in treated retina. Rhodopsin, green; mCAR, red; DAPI, blue. Figure 15C shows mCAR ⁺ cells in the retina treated with rd10 (*p<0.05, Studen's t-test), ONL thickness (*p<0.05), b-wave amplitude (n=3, *p<0.05, Quantification of Stutton's t test) and visual acuity (n=3, *p<0.05, Stewart's t test). All results are shown as mean ± sem.

Claims (115)

A method of reprogramming a cell from a first cell type to a second cell type comprising contacting the cell with: a) a first guide RNA that hybridizes to a target site of the gene, wherein the gene encoding facilitates the a cell type-specific functional protein of the cell; and b) a Cas nuclease that cleaves the strand of the gene at the target site, wherein cleavage of the strand modifies the gene such that the cell can no longer perform the cell type specific Sexual function whereby the cell is reprogrammed to the second cell type. The method of claim 1, wherein the gene comprises a mutation. The method of claim 2, wherein the first cell type is sensitive to the mutation, and wherein the second cell type is a cell type that is resistant to the mutation. The method of claim 2, wherein the mutation only has an adverse effect in the first cell type. The method of claim 4, wherein the adverse effect is selected from the group consisting of aging, apoptosis, lack of differentiation, and abnormal cell proliferation. The method of any one of claims 1 to 5, wherein the gene encodes a transcription factor. The method of any one of claims 1 to 5, wherein the first cell type and the second cell type are closely related terminally differentiated mature cell types. The method of any one of claims 1 to 5, wherein the reprogramming occurs in vivo. The method of any one of claims 1 to 5, wherein the reprogramming occurs in vitro or ex vivo. The method of any one of claims 1 to 5, wherein the cell is a cell of the pancreas, heart, brain, eye, intestine, colon, muscle, nervous system, prostate or breast. The method of any one of claims 1 to 5, wherein the cell is a mitotic cell. The method of any one of claims 1 to 5, wherein the cell is a cell in the eye. The method of claim 12, wherein the cell is a retinal cell. The method of claim 13, wherein the retinal cells are rod cells. The method of claim 14, wherein the cell type-specific function is night vision or color vision. The method of claim 12, wherein the gene is selected from the group consisting of NRL, NR2E3, GNAT1, ROR beta, OTX2, CRX, and THRB. The method of claim 12, wherein the gene is selected from the group consisting of NRL and NR2E3. The method of claim 12, wherein the first cell type is a rod cell. The method of claim 12, wherein the first cell type is an interneuron. The method of claim 12, wherein the second cell type is a cone cell. The method of claim 12, wherein the second cell type is an intermediate cell. The method of claim 12, wherein the first cell type is a rod cell and the second cell type is a cone cell. The method of claim 22, wherein the cone has an individual's light vision. The method of claim 12, wherein the first cell type is a rod cell and the second cell type is a pluripotent cell. The method of claim 12, wherein the first cell type is a rod cell and the second cell type is a pluripotent retinal progenitor cell. The method of claim 1, wherein the cell is a cancer cell. The method of claim 26, wherein the function is selected from the group consisting of abnormal cell proliferation, cancer metastasis, and tumor angiogenesis. The method of claim 26, wherein the first cell type is colon cancer cells and the second cell type is benign intestinal cells or colon cells. The method of claim 28, wherein the gene is selected from the group consisting of APC, MYH1, MYH2, MYH3, MLH1, MSH2, MSH6, PMS2, EPCAM, POLE1, POLD1, NTHL1, BMPR1A, SMAD4, PTEN, and STK11. The method of claim 26, wherein the first cell type is a malignant B cell and the second cell type is a benign macrophage. The method of claim 30, wherein the gene is selected from the group consisting of C-MYC, CCND1, BCL2, BCL6, TP53, CDKN2A, and CD19. The method of claim 1, wherein the cell is a neuron. The method of claim 32, wherein the first cell type produces at least one protein selected from the group consisting of amyloid beta, tau protein, and combinations thereof, and the second cell type does not produce the protein or produces more than the first cell type Less of this protein. The method of claim 33, wherein the first cell type is a neuron and the second cell type is a gel cell. The method of claim 33, wherein the gene is selected from the group consisting of APP and MAPT. The method of claim 32, wherein the first cell type produces alpha synuclein. The method of claim 36, wherein the first cell type is a gel cell and the second cell type is a dopamine-producing neuron. The method of claim 36, wherein the gene is selected from the group consisting of SNCA, LRRK2, PARK2, PARK7, and PINK1. The method of claim 36, wherein the gene is alpha synuclein (SNCA). The method of claim 36, wherein the second cell type is selected from the group consisting of dopamine-exciting neurons and dopamine-exciting progenitor cells. The method of claim 35, wherein the first cell type is a non-dopamine-exciting neuron or a gel cell. A method of treating a condition in an individual in need of a reprogrammed cell, wherein the reprogrammed cell is produced by the method of claim 1. The method of claim 42, wherein the reprogrammed cell is autologous to the individual. The method of claim 42, wherein the condition comprises retinal degeneration. The method of claim 44, wherein the condition is selected from the group consisting of macular degeneration, retinitis pigmentosa, and glaucoma. The method of claim 44, wherein the condition is retinitis pigmentosa. The method of claim 42, wherein the condition is cancer. The method of claim 47, wherein the cancer is colon cancer or breast cancer. The method of claim 42, wherein the condition is a neurodegenerative condition. The method of claim 49, wherein the condition is selected from Parkinson's Disease and Alzheimer's Disease. A method of treating a condition comprising administering to an individual in need thereof: a) a first guide RNA that hybridizes to a target site of a gene in a cell of a first type, wherein the gene encoding contributes to the first type a first functional protein of the cell; and b) a Cas nuclease that cleaves the strand of the gene at the target site, wherein cleavage of the strand modifies the gene such that the first type of cell is from the first type of cell Conversion to a second type of cell wherein the resulting presence or increase of cells of the second type improves the condition. The method of claim 51, wherein modifying the gene comprises reducing the performance of the gene in the first type of cell by at least about 90%. The method of claim 51, wherein modifying the gene comprises editing the gene, wherein the editing results in no protein being produced from the gene or a non-functional protein being produced from the gene. The method of any one of claims 51 to 53, wherein the condition is an ocular condition, and the first type of cells are the first type of ocular cells, and the second type of cells are the second type of ocular cells . The method of claim 54, wherein the function is performed in the first type of eye cells rather than the second type of eye cells. The method of claim 54, wherein the second type of ocular cells perform a second function, wherein the second function is not performed by the first type of ocular cells. The method of claim 54, wherein the first type of ocular cells are rod cells, and the second type of ocular cells are cone cells. The method of claim 54, wherein the ocular condition is retinal degeneration, retinitis pigmentosa, or macular degeneration. The method of claim 57, wherein the gene is selected from the group consisting of NR2E3 and NRL. The method of claim 59, which comprises reprogramming rod cells into cone cells or reprogramming rod cells into pluripotent retinal progenitor cells. The method of claim 54, wherein the ocular condition is glaucoma and the second type of ocular cells are retinal ganglion cells. The method of claim 61, wherein the first cell type is a muller gel cell. The method of claim 62, wherein the gene is ATOH7, POU4F gene or Islet1. The method of claim 58, wherein the gene is selected from the group consisting of CDKN2A and Six6. The method of claim 51, which comprises administering to the vehicle selected from the group consisting of a vector, a liposome, and a ribonucleoprotein, at least one polynucleotide encoding the Cas nuclease and the guide RNA. The method of claim 51, comprising contacting the cell with a second guide RNA. The method of claim 51, comprising administering a second guide RNA. The method of claim 66 or 67, which comprises introducing a novel splice site in the gene. The method of 68, wherein the novel splice site results in the removal of the exon or portion thereof from the coding sequence of the gene. The method of claim 69, wherein the exon comprises a mutation in the gene. The method of claim 70, wherein the mutation only adversely affects the first cell type. The method of claim 71, wherein the adverse effect is selected from the group consisting of aging, apoptosis, lack of differentiation, and abnormal cell proliferation. The method of claim 68, wherein the gene encodes a transcription factor. The method of claim 68, wherein the cell of the first type is sensitive to the mutation and the cell of the second type is resistant to the mutation. The method of claim 69, which comprises introducing a novel exon to the gene. The method of any one of claims 51 to 75, which comprises introducing at least one nucleotide to the gene. The method of claim 76, which comprises introducing a novel exon to the gene. A system comprising a Cas nuclease or a polynucleotide encoding the Cas nuclease, a first guide RNA, and a second guide RNA, wherein the first guide RNA is 5' of the first site of at least a first region of the gene Cas9 cleavage is targeted, and the second guide RNA targets the Cas9 cleavage of the second site 3' of the first region of the gene, thereby excising the region of the gene. The system of claim 78, wherein the first guide RNA targets Cas9 cleavage of at least a first site 5' of the first exon, and the second guide RNA is at least a second of the first exon The Cas9 at position 3' is cleaved to target, thereby excising the at least first exon. The system of claim 79, comprising a donor polynucleotide, wherein the donor polynucleotide is insertable between the first site and the second site. The system of claim 80, wherein the donor polynucleotide is an in vitro exon, comprising a splice site at the 5' and 3' ends of the donor exon. The system of claim 80, wherein the donor polynucleotide comprises a wild type sequence. The system of claim 78, wherein the gene is selected from the group consisting of NRL and NR2E3. The system of claim 83, wherein the first guide RNA and/or the second guide RNA targets the Cas9 protein to a sequence comprising any one of SEQ ID NO.: 1-4. A kit comprising a Cas nuclease or a polynucleotide encoding the Cas nuclease, a first guide RNA, and a second guide RNA, wherein the first guide RNA is at a first position 5' of at least a first region of the gene The Cas9 cleavage is targeted, and the second guide RNA targets the Cas9 cleavage of the second site 3' of the first region of the gene, thereby excising the region of the gene. The set of claim 85, wherein the first guide RNA targets Cas9 cleavage of at least a first site 5' of the first exon, and the second guide RNA is at least the first exon The cleavage of Cas9 at the two-site 3' is targeted, thereby excising the at least first exon. A kit of claim 86, comprising a donor polynucleotide, wherein the donor nucleic acid is insertable between the first site and the second site. A kit of claim 87, wherein the donor polynucleotide is an in vitro exon, comprising a splice site at the 5' and 3' ends of the donor exon. A kit of claim 87, wherein the donor polynucleotide comprises a wild type sequence. A kit of claim 85, wherein the gene is selected from the group consisting of NRL and NR2E3. A kit of claim 85, wherein the first guide RNA and/or the second guide RNA targets the Cas9 protein to a sequence comprising any one of SEQ ID NO.: 1-4. A pharmaceutical composition for treating an ocular condition in an individual, comprising: a) a Cas nuclease or a polynucleotide encoding the Cas nuclease; and b) a complement to a portion of a gene selected from the group consisting of an NRL gene and an NR2E3 gene At least one guide RNA. The pharmaceutical composition of claim 92, wherein the polynucleotide encoding the Cas protein and the at least one guide RNA are present in at least one viral vector. The pharmaceutical composition of claim 93, wherein the polynucleotide encoding the Cas protein or the at least one guide RNA is present in the liposome. The pharmaceutical composition of claim 92, wherein the at least one guide RNA targets the Cas protein to a sequence comprising any one of SEQ ID NO.: 1-4. The pharmaceutical composition of claim 92, wherein the pharmaceutical composition is formulated as a liquid for administration using an eye dropper. The pharmaceutical composition of claim 92, wherein the pharmaceutical composition is formulated as a liquid for intravitreal administration. A method of editing a gene in a cell, comprising a first guide RNA that causes the cell to contact a) to hybridize to a target site of the gene; b) a Cas nuclease that cleaves the strand of the gene at the target site c) Donor nucleic acid. The method of claim 98, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The method of claim 98, wherein the cell is a mitotic cell. The method of claim 98, wherein the gene is a Mertk gene. The method of claim 98, wherein the cell is a cell in the retina of the eye of the individual. A method of treating retinal degeneration in an individual comprising contacting an individual's retina with: a) a first guide RNA that hybridizes to a target site of the gene; b) a Cas that cleaves the strand of the gene at the target site Nuclease; and c) a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The method of claim 103, wherein the retinal degeneration is retinitis pigmentosa. The method of claim 103, wherein the gene is a Mertk gene. A method of treating beta thalassemia in an individual comprising contacting an individual's hematopoietic stem/progenitor cells with: a) a first guide RNA that hybridizes to a target site of a hemoglobin gene; b) causing the hemoglobin gene to be a Cas nuclease cleaved at the target site; and c) a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The method of claim 106, wherein the donor nucleic acid replaces a portion of the hemoglobin gene comprising a CD41/42 mutation. A method of treating cancer in an individual comprising contacting an individual's T cells with: a) a first guide RNA that hybridizes to a target site of a gene encoding an immunological checkpoint inhibitor; and b) causing the gene to be The Cas nuclease which is cleaved at the target site. The method of claim 108, comprising contacting the T cell with a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The method of claim 108, wherein the gene encodes PD-1. A method of treating cancer in an individual comprising contacting a cancer cell of the individual with: a) a first guide RNA that hybridizes to a target site of a gene encoding an immunological checkpoint inhibitor ligand; and b) causing the gene The Cas nuclease which is cleaved at the target site. The method of claim 111, wherein the gene encodes PD-L1 or PD-L2. The method of claim 111 or 112, comprising contacting the tumor cell with a donor nucleic acid, wherein the donor nucleic acid is inserted into the gene via a non-homologous end joining. The method of any one of clauses 111 to 113, wherein the cancer is a metastatic cancer. The method of claim 114, wherein the cancer is metastatic ovarian cancer, metastatic melanoma, metastatic non-small cell lung cancer, or metastatic renal cell carcinoma.