TW201916883A - Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to SCNA - Google Patents

Abstract

The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Sodium channel, voltage-gated, alpha subunit (SCNA), in particular, by targeting natural antisense polynucleotides of Sodium channel, voltage-gated, alpha subunit (SCNA). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of SCNA.

Description

Treatment of SCNA-related diseases by inhibiting the natural antisense transcript of voltage-gated sodium channel alpha subunit (SCNA)

Embodiments of the invention encompass oligonucleotide-regulated expression and/or function of SCNAs and related molecules. The present application claims priority to U.S. Provisional Patent Application Serial No. 61/357, file, filed on Jun.

DNA-RNA and RNA-RNA hybridization are important for many aspects of nucleic acid function, including DNA replication, transcription, and translation. Hybridization is also important for a variety of techniques for detecting specific nucleic acids or altering their performance. Antisense nucleotides disrupt gene expression, for example, by hybridizing to a target RNA, thereby interfering with RNA splicing, transcription, translation, and replication. Antisense DNA has the additional feature that the DNA-RNA hybrid acts as a substrate for ribonuclease H digestion (an activity present in most cell types). As in the case of oligodeoxynucleotides (ODN), an antisense molecule can be delivered into a cell, or it can be expressed as an RNA molecule from an endogenous gene. The FDA recently approved an antisense drug, VITRAVENETM (for the treatment of giant viral retinitis), reflecting the therapeutic utility of antisense.

The Summary of the Invention is provided to present an overview of the invention in which the nature and substance of the invention are described. It should be presented with the understanding that it should not be used to interpret or limit the scope or meaning of the scope of the patent application. In one embodiment, the invention provides a method of inhibiting the action of a natural antisense transcript by using any region that targets a natural antisense transcript, thereby causing upregulation of an antisense oligonucleotide of the corresponding sense gene, wherein The sense gene is selected from at least one member of the SCNA gene family and variants thereof. Also contemplated herein is a natural antisense transcript that can be inhibited by siRNA, ribonuclease, and small molecules that are considered to be within the scope of the invention. An embodiment provides a method of modulating the function and/or expression of a SCNA polynucleotide in a cell or tissue of a patient in vivo or ex vivo, comprising affixing the cell or tissue to a length of 5 to 30 nucleotides Antisense oligonucleotide contact, wherein the oligonucleotide has at least 50% sequence identity to a reverse complement comprising a polynucleotide of 5 to 30 contiguous nucleotides in the following nucleotide: SEQ ID NO: 12 to 1123 and SEQ ID NO: 13 to 1 to 2352, SEQ ID NO: 14 to 1 to 267, SEQ ID NO: 1 to 1 to 1080, SEQ ID NO: 1 to 1 to 173, SEQ ID NO: 17 to 1 618, 1 to 871 of SEQ ID NO: 18, 1 to 304 of SEQ ID NO: 19, 1 to 293 of SEQ ID NO: 20, 1 to 892 of SEQ ID NO: 21, SEQ ID NO: 22 to 1 to 260, 1 to 982 of SEQ ID NO: 23, 1 to 906 of SEQ ID NO: 24, 1 to 476 of SEQ ID NO: 25, 1 to 185 of SEQ ID NO: 26, SEQ ID NO: 27 to 1 162 and SEQ ID NO: 28 to 1 to 94; thereby regulating the function and/or expression of SCNA polynucleotides in a patient's cells or tissues in vivo or in vitro. In one embodiment, the oligonucleotide targets a natural antisense sequence of a SCNA polynucleotide (eg, the nucleotides set forth in SEQ ID NOs: 12-28) and any variants thereof, dual genes, homologs thereof , mutants, derivatives, fragments and complementary sequences. Examples of antisense oligonucleotides are set forth in SEQ ID NOs: 29-94. Another embodiment provides a method of modulating the function and/or expression of a SCNA polynucleotide in a cell or tissue of a patient in vivo or ex vivo, comprising affixing the cell or tissue to a length of 5 to 30 nucleotides The antisense oligonucleotide is contacted, wherein the oligonucleotide has at least 50% sequence identity to the antisense reverse complement of the SCNA polynucleotide; thereby modulating the patient's cells or tissues in vivo or in vitro The function and/or performance of the SCNA polynucleotide. Another embodiment provides a method of modulating the function and/or expression of a SCNA polynucleotide in a cell or tissue of a patient in vivo or ex vivo, comprising affixing the cell or tissue to a length of 5 to 30 nucleotides Antisense oligonucleotide contact, wherein the oligonucleotide has at least 50% sequence complementarity to the SCNA native antisense transcript; thereby modulating SCNA polynucleotides in a patient's cells or tissues in vivo or in vitro Function and / or performance. In one embodiment, the composition comprises one or more antisense oligonucleotides that bind to a sense and/or antisense SCNA polynucleotide, wherein the polynucleotides are selected from SCNA to SCN12A and variants thereof a group of body composition. In a preferred embodiment, the polynucleotide of interest is selected from the group consisting of SCNA. In one embodiment, the oligonucleotide comprises one or more modified or substituted nucleotides. In one embodiment, the oligonucleotide comprises one or more modified linkages. In another embodiment, the modified nucleotide comprises a phosphorothioate, a methylphosphonate, a peptide nucleic acid, a 2'-O-methyl, a fluoro- or carbon, a methylene group or other locked nucleic acid ( Locked nucleic acid, LNA) A modified base of a molecule. Preferably, the modified nucleotide is a locked nucleic acid molecule, including alpha-L-LNA. In one embodiment, the oligonucleotide is administered subcutaneously, intramuscularly, intravenously or intraperitoneally to the patient. In one embodiment, the oligonucleotide is administered as a pharmaceutical composition. The treatment regimen comprises administering to the patient an antisense compound at least once; however, the treatment can be modified to include multiple doses over a period of time. Treatment can be combined with one or more other types of therapies. In one embodiment, the oligonucleotide is encapsulated in a liposome or linked to a carrier molecule (eg, cholesterol, TAT peptide). Other aspects are described below.

Several aspects of the invention are described below with reference to illustrative applications for illustration. It should be appreciated that numerous specific details, relationships, and methods are described in order to fully understand the invention. However, one of ordinary skill in the art will readily recognize that the invention can be practiced without one or more specific details. The present invention is not limited by the order of acts or events, as some acts may occur in a different order and/or in parallel with other acts or events. In addition, not all illustrated acts or events may be required to practice a method of the invention. All of the genes, gene names, and gene products disclosed herein are intended to correspond to homologs of any species from which the compositions and methods disclosed herein are applicable. Thus, terms include, but are not limited to, genes and gene products from humans and mice. It is to be understood that the disclosure of the present invention is intended to be illustrative only and not to be construed as limiting. Thus, for example, for the genes disclosed herein associated with mammalian nucleic acid and amino acid sequences in some embodiments, it is intended to encompass other animals (including but not limited to other mammals, fish, amphibians, Homologous and/or orthologous genes and gene products of reptiles and birds. In one embodiment, the gene or nucleic acid sequence is a human gene or nucleic acid sequence.definition The terminology used herein is for the purpose of describing particular embodiments and is not intended to limit the invention. As used herein, the singular forms "" In addition, the terms "including", "having" or variations thereof are used in the context of the [embodiments] and/or claims, and such terms are intended to be inclusive in a manner similar to the term "comprising." The term "about" means that within the acceptable error range of a particular value as determined by one of ordinary skill, the error range will depend in part on how the value is measured or measured, i.e., the limits of the measurement system. For example, "about" can mean within one or more standard deviations according to the practice in the art. Alternatively, "about" may mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and still more preferably up to 1% of the established value. Alternatively, particularly with respect to biological systems or methods, the term may mean within a certain order of magnitude of a value, preferably within 5 times, and more preferably within 2 times. When a particular value is recited in the present application and the scope of the claims, the term "about" is intended to be within the range of acceptable tolerances of the particular value. As used herein, the term "mRNA" means a currently known mRNA transcript of a targeted gene and any other transcript that can be elucidated. In the case of "antisense oligonucleotide" or "antisense compound", it means an RNA or DNA molecule that binds to another RNA or DNA (target RNA, DNA). For example, if it is an RNA oligonucleotide, it binds to another RNA target by means of an RNA-RNA interaction and alters the activity of the target RNA. Antisense oligonucleotides can upregulate or downregulate the performance and/or function of a particular polynucleotide. The definition is intended to include any foreign RNA or DNA molecule that appears to be therapeutic, diagnostic or otherwise. Such molecules include, for example, antisense RNA or DNA molecules, interfering RNA (RNAi), microRNAs, decoy RNA molecules, siRNA, enzymatic RNA, therapeutically editable RNA and agonist and antagonist RNA, antisense oligomeric compounds, Antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternative splicers, primers, probes, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. Thus, such compounds can be introduced as single, double, partially single, or cyclic oligomeric compounds. In the context of the present invention, the term "oligonucleotide" refers to an oligo or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or a mimetic thereof. The term "oligonucleotide" also includes natural and/or modified monomers or bonds (including deoxyribonucleosides, nucleosides, substituted and alpha-directed forms, peptide nucleic acids (PNA), locked nucleic acids ( Linear or cyclic oligomers of LNA), phosphorothioates, methylphosphonates and the like). Oligonucleotides can interact with monomers by regular patterning (such as Watson-Crick type base pairing, Hoögsteen or reverse Hugues) Base pairing of the D-type, or a similar interaction thereof) to specifically bind to the polynucleotide of interest. Oligonucleotides can be "chimeric", that is, composed of different regions. In the context of the present invention, a "chimeric" compound is an oligonucleotide comprising two or more chemical regions, such as a DNA region, an RNA region, a PNA region, and the like. Each chemical region consists of at least one monomeric unit, i.e., a nucleotide in the case of an oligonucleotide compound. Such oligonucleotides typically comprise at least one region in which the oligonucleotide has been modified to exhibit one or more desired properties. Desirable properties of the oligonucleotide include, but are not limited to, increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity to the target nucleic acid. Thus, different regions of the oligonucleotide can have different properties. The chimeric oligonucleotide of the present invention can be formed into a mixed structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide analogs as described above. . Oligonucleotides can be constructed by "registered" linkages (i.e., when monomers are contiguously joined as in native DNA) or by regions joined by spacers. The spacers are intended to form a covalent "bridge" between the regions and, preferably, have a length of no more than about 100 carbon atoms. Spacers can have different functionalities, such as having a positive or negative charge, with specific nucleic acid binding properties (intercalators, groove binders, toxins, fluorophores, etc.), lipophilic, induction specific Secondary structure, such as, for example, an alanine-containing peptide that induces an alpha-helix. As used herein, "SCN1A" includes all family members, mutants, dual genes, fragments, materials, coding and non-coding sequences, sense and antisense polynucleotide strands, and the like. Similarly, SCN2A-SCN12A includes all mutants, dual genes, fragments, and the like. As used herein, the phrase "voltage-gated sodium ion channel type I alpha subunit", SCN1A, FEB3, FEB3A, GEFSP2, HBSCI, NAC1, Nav1.1, SCN1, SMEI, sodium ion channel protein brain I subunit The sodium ion channel protein type 1 subunit α, the sodium ion channel protein type I subunit α, and the voltage-gated sodium ion channel subunit α Nav1.1 are considered identical in the literature and are used interchangeably in this application. As used herein, the term "oligonucleotide specific for" or "an oligonucleotide that targets" refers to having (i) capable of forming a stable complex with a portion of a targeted gene, or (ii) capable of An oligonucleotide that forms a stable duplex sequence with a portion of the mRNA transcript of the targeted gene. The stability of the complex and the double helix can be determined by theoretical calculations and/or in vitro assays. Exemplary assays for determining the stability of hybridization complexes and duplexes are described in the Examples below. As used herein, the term "target nucleic acid" encompasses DNA, RNA transcribed from such DNA (including pre-mRNA (premRNA) and mRNA), and cDNA derived from the RNA, coding sequence, non-coding sequence, sense or antisense polymerization. Nucleotide. The specific hybridization of an oligomeric compound to its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of the function of the target nucleic acid by a compound that specifically hybridizes to the target nucleic acid is commonly referred to as "antisense." DNA functions that will be disturbed include, for example, replication and transcription. RNA functions that will be interfered with include all life functions, such as translocation of RNA to protein translation sites, translation of proteins from RNA, splicing of RNA to produce one or more mRNA species, and catalytic activity in which RNA can participate or promote. The overall effect of this interference with the function of the target nucleic acid is to modulate the performance of the encoded product or oligonucleotide. RNA interference "RNAi" is mediated by a double-stranded RNA (dsRNA) molecule with sequence-specific homology to a "target" nucleic acid sequence. In certain embodiments of the invention, the mediator is a "small interference" RNA duplex (siRNA) containing 5-25 nucleotides. siRNA is produced by processing dsRNA with an RNase called Dicer. The siRNA duplex product is recruited into a polyprotein siRNA complex called RISC (RNA-induced resting complex). Without wishing to be bound by any particular theory, the RISC is then directed to a target nucleic acid (suitable for mRNA), where the siRNA duplexes interact in a sequence-specific manner to catalyze cleavage in a catalytic manner. Small interfering RNAs that can be used in accordance with the present invention can be synthesized and used according to procedures well known in the art and which will be familiar to those of ordinary skill. The small interfering RNA used in the methods of the invention suitably comprises between about 1 and about 50 nucleotides (nt). In an example of a non-limiting embodiment, the siRNA can comprise from about 5 to about 40 nt, from about 5 to about 30 nt, from about 10 to about 30 nt, from about 15 to about 25 nt, or from about 20-25 Nucleotides. Selection of appropriate oligonucleotides is facilitated by the use of computer programs that automatically align nucleic acid sequences and indicate regions of homology or homology. Such programs are used to compare the resulting nucleic acid sequences, for example, by searching a library such as GenBank or by sequencing the PCR products. Comparison of nucleic acid sequences from a range of species allows selection of nucleic acid sequences that exhibit the appropriate degree of identity between species. Southern blots are performed in the absence of sequenced genes to allow for the determination of the degree of identity between genes in the target species and genes in other species. As is well known in the art, it is possible to obtain an approximate measure of consistency by performing Southern blot analysis at varying degrees of stringency. Such procedures allow for the selection of nucleic acid sequences that have a high degree of complementarity with a target nucleic acid sequence in an individual to be controlled and that have a lower degree of complementarity with corresponding nucleic acid sequences in other species. Those skilled in the art will recognize that there is a great deal of freedom in selecting the appropriate region for the genes used in the present invention. In the case of "enzymatic RNA", it means an enzymatically active RNA molecule (Cech, (1988)J. American. Med. Assoc 260, 3030-3035). An enzymatic nucleic acid (ribonuclease) functions by binding to a target RNA. This binding occurs via a target binding moiety of the enzymatic nucleic acid that remains in close proximity to the enzymatic portion of the molecule that functions to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes the target RNA and then binds to the target RNA via base pairing, and once bound to the correct site, acts enzymatically to cleave the target RNA. By "bait RNA" it is meant an RNA molecule that mimics the natural binding domain of a ligand. Thus, the decoy RNA competes with the natural binding target for binding to a particular ligand. For example, an over-expressed HIV trans-activation response (TAR) RNA has been shown to act as a "bait" and efficiently binds to the HIV tat protein, thereby preventing its binding to the TAR sequence encoded in HIV RNA. This is intended to be a specific example. Those skilled in the art will recognize that this is merely an example, and that other embodiments are readily produced using techniques generally known in the art. As used herein, the term "monomer" generally indicates that it is linked via a phosphodiester bond or an analog thereof to form a size in a number of monomer units (eg, from about 3-4 monomer units) to about several hundred monomer units. Monomers of oligonucleotides within the range. Analogs of phosphodiester bonds include: phosphorothioates, dithiophosphates, methylphosphonates, selenophosphates, aminophosphates, and the like, as described more fully below. The term "nucleotide" encompasses naturally occurring nucleotides as well as non-naturally occurring nucleotides. Those skilled in the art should be aware that the various nucleotides previously considered "non-naturally occurring" have subsequently been discovered in nature. Thus, "nucleotide" includes not only molecules known to contain purine and pyrimidine heterocycles, but also heterocyclic analogs and tautomers thereof. Illustrative examples of other types of nucleotides are molecules containing adenine, guanine, thymine, cytosine, uracil, guanidine, xanthine, diamine guanidine, 8-sided oxy-N6-A Adenine, 7-deazapurine, 7-deazaguanine, N4, N4-ethanocytosin, N6, N6-bridged ethylene-2,6-di Aminoguanidine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisomeromide, 2-hydroxy-5-methyl-4- Triazolopyridine, isocytosine, isoguanine, inosine, and "non-naturally occurring" nucleotides described in U.S. Patent No. 5,432,272, to Benner et al. The term "nucleotide" is intended to cover every and every such instance as well as analogs and tautomers thereof. Particularly interesting nucleotides are nucleotides containing adenine, guanine, thymine, cytosine, and uracil, which are considered to be naturally occurring nucleotides associated with therapeutic and diagnostic applications in humans. Nucleotides include, for example, natural 2'-deoxy and 2'-hydroxy sugars as described in Kornberg and Baker, DNA Replication, 2nd Edition (Freeman, San Francisco, 1992) and analogs thereof. "Analogs" with respect to nucleotides include portions having modified bases and/or modified sugar moieties (see, for example, commonly, Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier and Altmann, (1997)).Nucl. Acid. Res ., 25(22), 4429-4443; Toulmé, J.J., (2001)Nature Biotechnology 19:17-18; Manoharan M., (1999)Biochemica et Biophysica Acta 1489: 117-139; Freier S. M., (1997)Nucleic Acid Research , 25:4429-4443; Uhlman, E., (2000)Drug Discovery & Development , 3: 203-213; Herdewin P., (2000)Antisense & Nucleic Acid Drug Dev. , 10:297-310) synthetic nucleotide; 2'-O, 3'-C linked [3.2.0] bicyclic glucosinolate. Such analogs include synthetic nucleotides designed to enhance binding properties, such as duplex or triple helix stability, specificity, or the like. As used herein, "hybridization" means the pairing of substantially complementary strands of an oligomeric compound. A pairing mechanism involves hydrogen bonding between complementary nucleosides or nucleotide bases (nucleotides) of a strand of an oligomeric compound, which may be a Watson-Crick, Huguestin, or Reversed Hu Gastin hydrogen bonding. For example, adenine and thymine are complementary nucleotides paired by the formation of hydrogen bonds. Hybridization can occur in different situations. When the binding of the antisense compound to the target nucleic acid interferes with the normal function of the target nucleic acid, resulting in modulation of function and/or activity, and there is a sufficient degree of complementarity to avoid specific binding of the antisense compound to the non-target nucleic acid sequence. Antisense compound under conditions (ie, under in vivo conditions or in the case of therapeutic treatment, under physiological conditions, and in the case of in vitro assays, under conditions of assay) It is "specifically hybridizable". As used herein, the phrase "stringent hybridization conditions" or "stringent conditions" refers to conditions under which a compound of the invention will hybridize to its target sequence but to a minimum number of other sequences. Stringent conditions are sequence dependent and will vary from case to case, and in the context of the present invention, the "stringent conditions" at which an oligomeric compound hybridizes to a target sequence are determined by the nature and composition of the oligomeric compound and its investigation. Decide. In general, stringent hybridization conditions include low concentrations (<0.15 M) of salts with inorganic cations (such as Na++ or K++) (ie, low ionic strength), below the Tm of the oligomeric compound: target sequence complex. The presence of a denaturant such as formamide, dimethylformamide, dimethylhydrazine or detergent sodium dodecyl sulfate (SDS) at a temperature of °C-25 °C. For example, for every 1% metformin, the hybridization rate is reduced by 1.1%. An example of a high stringency hybridization condition is 0.1 x sodium chloride-sodium citrate buffer (SSC) / 0.1% (w/v) SDS at 60 ° C for 30 minutes. As used herein, "complementary" refers to the ability to precisely pair between two nucleotides on one or two oligomeric strands. For example, if the nucleobase at a position of the antisense compound is capable of interacting with a nucleobase at a position of the target nucleic acid (the target nucleic acid is a DNA, RNA or oligonucleotide molecule) Hydrogen bonding, the position of the hydrogen bond between the oligonucleotide and the target nucleic acid is considered to be a complementary position. When a sufficient number of complementary positions in each molecule are occupied by nucleotides that are hydrogen-bondable to each other, the oligomeric compound and other DNA, RNA or oligonucleotide molecules are complementary to each other. Thus, "specifically hybridizable" and "complementary" are terms used to indicate a sufficient degree of precise matching or complementarity of a sufficient number of nucleotides for stable and specific binding between an oligomeric compound and a target nucleic acid. It is understood in the art that a sequence that achieves specific hybridization without the need for an oligomeric compound is 100% complementary to its target nucleic acid. Furthermore, one or more segments of the oligonucleotide can hybridize such that the intervening or adjacent segments are not involved in a hybridization event (eg, a loop structure, a mismatch, or a hairpin structure). The oligomeric compound of the invention comprises at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least of the target region within the target nucleic acid sequence to which it is targeted. About 95%, or at least about 99%, of sequence complementarity. For example, 18 of the 20 nucleotides of the antisense compound are complementary to the region of interest and thus the antisense compound that specifically hybridizes will represent 90% complementarity. In this example, the remaining non-complementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous with each other or contiguous with complementary nucleotides. Thus, an antisense compound of 18 nucleotides in length and having 4 (four) non-complementary nucleotides flanked by two regions that are fully complementary to the target nucleic acid will have 77.8% overall complementarity with the target nucleic acid and thus It will fall within the scope of the invention. The percent complementarity of the antisense compound having the region of the target nucleic acid can be determined in a conventional manner using the BLAST program (basic local alignment search tool) and the PowerBLAST program known in the art. Percent homology, sequence identity or complementarity can be achieved, for example, by using the Smith and Waterman algorithms (Adv. Appl. Math . (1981) 2, 482-489) Gap program (Wisconsin Sequence Analysis Package, 8th Edition for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using presets Settings are determined. As used herein, the term "thermal melting point (Tm)" refers to the temperature at which 50% of the oligonucleotide complementary to the target sequence hybridizes to the target sequence in equilibrium at a defined ionic strength, pH, and nucleic acid concentration. Generally, stringent conditions will be those having a salt concentration of at least about 0.01 to 1.0 M Na ion concentration (or other salt) at pH 7.0 to 8.3 and for short oligonucleotides (eg, 10 to 50 nucleotides) The temperature is at least about 30 °C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. As used herein, "modulate" means increased (stimulated) or reduced (inhibited) gene expression. When used in the context of a polynucleotide sequence, the term "variant" can encompass a polynucleotide sequence associated with a wild-type gene. This definition may also include, for example, "dual genes", "splicing", "species" or "polymorphic" variants. Splice variants may have significant identity to a reference molecule, but will typically have a larger or smaller number of polynucleotides due to alternative splicing of exons during mRNA processing. The corresponding polypeptide may have other functional domains or no functional domains. A species variant is a sequence of nucleotides that varies from one species to another. In the present invention, variants of the wild type gene product have a specific utility. A variant may be produced by at least one mutation in a nucleic acid sequence and may produce a polypeptide whose altered mRNA or structure or function may or may not be altered. Any given natural or recombinant gene may not have a dual gene form or have one or many dual gene forms. Common mutational changes that produce variants are often attributed to natural deletions, additions or substitutions of nucleotides. Each such type of change can occur one or more times in a given sequence, either alone or in combination with other variations. The resulting polypeptides will typically have significant amino acid identity relative to each other. A polymorphic variant is a change in the nucleotide sequence of a particular gene between individuals of a given species. Polymorphic variants may also encompass single-base mutations in which a single nucleotide polymorphism (SNP) or a polynucleotide sequence has one base change. The presence of a SNP may indicate, for example, that a population has a predisposition to disease status, i.e., sensitivity to resistance. Derivatized polynucleotides include nucleic acids that undergo chemical modification (e.g., replacement of hydrogen with an alkyl, sulfhydryl or amine group). For example, derivatives of the derivatized oligonucleotide may comprise non-naturally occurring moieties such as altered sugar moieties or intersaccharide linkages. Illustrative of these are phosphorothioates and other sulfur-containing materials known in the art. Derivatized nucleic acids can also contain labels, including radionucleotides, enzymes, fluorescers, chemiluminescent agents, chromogenic agents, receptors, cofactors, inhibitors, magnetic particles, and the like. A "derived" polypeptide or peptide is, for example, a polypeptide modified by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, deuteration, chemical coupling, or moderate formalin treatment or Peptide. Derivatives may also be modified, directly or indirectly, to contain detectable labels including, but not limited to, radioisotopes, fluorescent labels, and enzyme labels. As used herein, the term "animal" or "patient" is intended to include, for example, humans, sheep, donkeys, deer, mule deer, baboons, mammals, monkeys, horses, cows, pigs, goats, dogs, cats, Rats, mice, birds, chickens, reptiles, fish, insects and arachnids. "Mammal" encompasses warm-blooded mammals (such as humans and domesticated animals) that are usually under medical care. Examples include felines, canines, equines, bovines, and humans, as well as humans only. "Treatment" encompasses the treatment of a disease state in a mammal and includes: (a) preventing the disease state from occurring in a mammal, in particular, when the mammal is susceptible to the disease state but has not yet been diagnosed as having it; b) inhibiting the disease state, for example, arresting its development; and/or (c) mitigating the disease state, for example, causing the disease state to subside until the desired end point is reached. Treatment also includes amelioration of the symptoms of the disease (eg, alleviating pain or discomfort), where the improvement may or may not directly affect the disease (eg, etiology, transmission, performance, etc.). As used herein, "neurological disease or condition" refers to any disease or condition of the nervous system and/or the visual system. "Nervous diseases or conditions" include diseases involving the central nervous system (brain, brainstem, and cerebellum), the peripheral nervous system (including the cranial nerves), and the autonomic nervous system (which is partially located in both the central nervous system and the peripheral nervous system) or Illness. Neurological diseases or conditions include, but are not limited to, acquired epileptiform aphasia; acute disseminated encephalomyelitis; adrenoleukodystrophy; age-related macular degeneration ( Age-related macular degeneration); adenesis of the corpus callosum; agnosia; Aicardi syndrome; Alexander disease; Alpers' disease Alternating hemiplegia; Alzheimer's disease; Vascular dementia; amyotrophic lateral sclerosis; anencephaly; Angieman syndrome (Angelman syndrome); angiomatosis; anoxia; aphasia; apraxia; arachnoid cysts; arachnoiditis; -Anronl-Chiari malformation; arteriovenous malformation; Asperger syndrome; ataxia telegiectasia; attention deficit hyperactivity disorder; autism; autonomic dysfunction; back pain; Batten disease; Behcet's disease; Bell's palsy; benign essential blepharospasm; benign focal; amyotrophy; Benign intracranial hypertension; Binswanger's disease; blepharospasm; Bloch Sulzberger syndrome; brachial plexus injury; brain abscess Brain damage; brain tumors (including glioblastoma multiforme); spinal tumors; Brown-Sequard syndrome; Canavan disease; carpal tunnel syndrome (carpal tunnel syndrome); causalgia (causalgia); central pain syndrome; central pontine myelinolysis; Cerebral aneurysm; cerebral arteriosclerosis; cerebral atrophy; cerebral gigantism; cerebral palsy; Charcoal-Mari-Tus Charcot-Marie-Tooth disease; chemotherapy-induced neuropathy and neuralgia; Chiari malformation; chorea; chronic inflammatory demyelinating polyneuropathy; chronic pain Chronic regional pain syndrome; Coffin Lowry syndrome; coma (coma), including persistent growth; congenital facial diplegia; corticobasal degeneration; Cranial arteritis; craniosynostosis; Creutzfeldt-Jakob disease; cumulative injury disorder; Cushing's syndrome; cytomegalic inclusion body disease ; cell giant virus infection; dance eye - dance eyes syndrome (dancing eyes- Dancing feet syndrome);DandyWalker syndrome; Dawson disease; De Morsier's syndrome; Dejerine-Klumke palsy; Dementia; dermatomyositis; diabetic neuropathy; diffuse sclerosis; Dravet's dysautonomia; dysgraphia; dyslexia; Dystonias; early infantile epileptic encephalopathy; empty sella syndrome; encephalitis; encephaloceles; encephalotrigeminal angiomatosis; Epilepsy; Erb's palsy; essential tremor; Fabry's disease; Fahr's syndrome; fainting; familial spasticity Familial spastic paralysis; febrile seizures; Fisher syndrome; Friedrich's syndrome (Friedreich's ataxia); fronto-temporal dementia and other "tauopathies"; Gaucher's disease; Gerstmann's syndrome; giant cells Giant cell arteritis; giant cell inclusion disease; globular cell leukodystrophy; Guillain-Barre syndrome; HTLV-1 Related skeletal disease (HTLV-1-associated myelopathy); Hallervorden-Spatz disease; head injury; headache; hemifacial spasm; hereditary spastic paraplegia (hereditary Spastic paraplegia; heredopathia atactic a polyneuritiformis; herpes zoster oticus; herpes zoster; Hirayama syndrome; HIV-related dementia And neuropathy (also a neurological manifestation of AIDS); holoprosencephaly; Huntington's disease and other polyglutamic acid Repeated disease; hydranencephaly in the brain; hydrocephalus; hypercortisolism; hypoxia; immune-mediated encephalomyelitis; inclusion body myositis; incontinentia pigmenti Infantile phytanic acid storage disease; infantile refsum disease; infantile spasms; inflammatory myopathy; intracranial cyst; intracranial hypertension; Joubert syndrome; Keams-Sayre syndrome; Kennedy disease Kinsboume syndrome; Klippel Feil syndrome; Krabbe disease; Kugelberg-Welander disease; Kuru; Lafora disease; Lambert-Eaton myasthenia gravis syndrome (Lambert) -Eaton myasthenic syndrome); Landau-Kleffner syndrome; lateral medullary (Wallenberg) syndrome; learning difficulties (learnin g disabilities); Leigh's disease; Lennox-Gustaut syndrome; Lesch-Nyhan syndrome; leukodystrophy; Lewy body dementia; Lissencephaly; locked-in syndrome; Lou Gehrig's disease (also known as motor neuron disease or muscular atrophy) Lateral cord sclerosis; lumbar disc disease; lyme disease - neurological sequelae; Machado-Joseph disease; macrocephalon malformation; megalencephaly; Melkersson-Rosenthal syndrome; Menieres disease; meningitis; Menkes disease; metachromatic leukodystrophy; small Head deformity (microcephaly); migraine; Miller Fisher syndrome; mini-strokes; mitochondrial myopathies; Mobius syndrome; Muscular atrophy Motor neuron disease; Moyamoya disease; mucopolysaccharidoses; milti-infarct dementia; multifocal motor neuropathy; multiple sclerosis and others Demyelinating disorder; multiple system atrophy with postural hypotension; muscular dystrophy; myasthenia gravis; myelinoclastic diffuse sclerosis; infant myoblast Myoclonic encephalopathy of infants; myoclonus; myopathy; myotonia congenital; narcolepsy; neurofibromatosis; psychiatric inhibitor malignant syndrome ( Neuroleptic malignant syndrome); neurological manifestations of AIDS; neurological sequelae of lupus; neuromytonia; neuronal ceroid lipofuscinosis; neuronal migration Disorder); Niemann-Pick disease; Osali - O'Sullivan-McLeod syndrome; occipital neuralgia; occult spinal dysraphism sequence; Ohtahara syndrome; olive pons cerebellum Atrophy (olivopontocerebellar atrophy); strabismus myoclonus; optic neuritis; orthostatic hypotension; overuse syndrome; paresthesia; neurodegenerative diseases or Conditions (Parkinson's disease, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), dementia, multiple sclerosis and associated with neuronal cell death Other diseases and conditions); paramyotonia congenital; paraneoplastic diseases; paroxysmal seizures; Parry Romberg syndrome; chronic childhood sclerosis (Pelizaeus- Merzbacher disease); periodic paralyses; peripheral neuropathy Hy); painful neuropathy and neuralgia; persistent growth state; pervasive developmental disorders; photic sneeze reflex; phytanic acid storage disease; Pick's disease; Nerve contusion; pituitary tumor; polymyositis; pore penetrating (porencephaly); post-polio syndrome; postherpetic neuralgia; postinfectious encephalomyelitis; Orthostatic hypotension; Prader-Willi syndrome; primary lateral sclerosis; prion diseases; progressive hemifacial atrophy; Progressive multifocalleukoencephalopathy; progressive sclerosing poliodystrophy; progressive supranuclear palsy; pseudotumor cerebri; Ramsey-Heng Special syndrome (type I and type 11); Rasmussen encephalitis (Rasmussen 's encephalitis); reflex sympathetic dystrophy syndrome; Lefsum disease; repetitive motion disorders; repetitive stress impairment; restless legs syndrome; retrovirus Related myelopathy; Rett syndrome; Reye's syndrome; Saint Vitus dance; Sandhoff disease; Schilder's disease ); schizencephaly; septo-optic dysplasia; shaken baby syndrome; shingles; shy-Drager syndrome; Sjogren's syndrome; sleep apnea; Soto's syndrome; spasticity; spina bifida; spinal cord injury; spinal cord tumor; spinal muscular atrophy; -Person syndrome); stroke; Sturge-Weber syndrome; subacute sclerosing panenceph Alitis); subcortical arteriosclerotic encephalopathy; Sydenham chorea; syncope; syringomyelia; tardive dyskinesia; Tay-Sachs disease; temporal arteritis; tethered spinal cord syndrome; Thomsen disease; thoracic outlet syndrome; trigeminal neuralgia (Tic Douloureux); Todd's paralysis; Tourette syndrome; transient ischemic attack; transmissible spongiform encephalopathies; transverse myelitis; traumatic Brain injury; tremor; trigeminal neuralgia; tropical spastic paraparesis; tuberous sclerosis; vascular dementia (multiple infarct dementia); vasculitis, including sputum Arteritis; Von Hippel-Lindau disease; Wallenberg's syndrome (Wallenberg) 's syndrome); Werdnig-Hoffman disease; West syndrome; whiplash; Williams syndrome; Wilton's disease Disease); and Zellweger syndrome and other neurological disorders described herein. Cardiovascular diseases or conditions include those that result in ischemia or reperfusion from the heart. Examples include, but are not limited to, atherosclerosis, coronary artery disease, granulomatous myocarditis, chronic myocarditis (non-granulomatous), primary hypertrophic cardiomyopathy, peripheral arterial disease (PAD), peripheral vascular disease, venous thromboembolism, pulmonary embolism, stroke, angina pectoris, myocardial infarction, cardiovascular tissue damage caused by cardiac arrest, bypass by the heart ( Cardiac bypass caused by cardiovascular bypass, cardiogenic shock, and dysfunction or tissue damage known to the general practitioner or involving cardiac or vascular structures, particularly but not limited to tissue damage associated with SCNA activation Related conditions. CVS diseases include, but are not limited to, atherosclerosis, granulomatous myocarditis, myocardial infarction, myocardial fibrosis secondary to valvular heart disease, myocardial fibrosis without infarction, primary hypertrophic cardiomyopathy, and Chronic myocarditis (non-granulomatous). Examples of diseases or conditions associated with sodium ion channel dysfunction include, but are not limited to, malignant hyperthermia, myasthenia gravis, intermittent ataxia, neuropathic and inflammatory pain, Alzheimer's disease, Parkinson's disease , schizophrenia, hyperekplexia, myotonia (such as hypokalemia and hyperkalemia periodic paralysis, paramyotonia congenita and potassium-induced muscle rigidity) and arrhythmia (cardiac arrhythmias) (such as long QT syndrome).Polynucleotide and oligonucleotide compositions and molecules aims: In one embodiment, the target comprises a nucleic acid sequence of a voltage-gated sodium ion channel alpha subunit (SCNA), including, without limitation, a sense and/or antisense non-coding and/or coding sequence associated with SCNA. Voltage-sensitive ion channels are a class of transmembrane proteins that provide the basis for cell excitability and the ability to transmit information via membrane potential generated by ions. In response to changes in membrane potential, these molecules mediate the rapid flow of ions across selective channels in the cell membrane. If the channel density is sufficiently high, a regenerative depolarization called an action potential is produced. In most electrically excitable cells, including neurons, heart cells, and muscles, voltage-gated sodium ion channels are responsible for generating and transmitting action potentials. Electroactivity is triggered by depolarization of the membrane, which opens a channel that is highly selective to sodium ions across the membrane. The ions are then driven through the open channel within the cell by an electrochemical gradient. Although the action potentials based on sodium ions in different tissues are similar, electrophysiological studies have demonstrated the existence of a variety of sodium ion channels with different structures and functions, and have cloned numerous genes encoding sodium ion channels. The SCNA gene belongs to the gene family of voltage-gated sodium ion channels. The voltage-gated sodium ion channel can be named according to the standardized nomenclature outlined in Goldin et al. (2000) Neuron 28:365-368. According to the system, voltage-gated sodium ion channels are grouped into one family, and nine mammalian isoforms from the family have been identified and expressed. These 9 isoforms are given the names Navl.l to Navl.9. In addition, the splice variants of various isoforms are distinguished by using lowercase letters (eg, "Navl.la") after the numbers. Voltage-gated sodium ion channels play an important role in the generation of action potentials in nerve cells and muscle. The alpha subunit (SCNA) is the major component of the channel and will be sufficient to produce efficient channels when expressed in vitro in cells. In turn, the alpha-1 and second order units require alpha subunits to create an effective channel. The role of these secondary units will be to improve the dynamic properties of the channels primarily by rapidly inactivating the sodium ion stream. Compared to normal SCNB1, mutations found in the SCN1B gene in GEFS syndrome were shown to reduce rapid inactivation of sodium ion channels when co-expressed with alpha subunits. In one embodiment, an antisense oligonucleotide is used to prevent or treat a disease or condition associated with a member of the SCNA family. Exemplary voltage-gated sodium channel alpha subunit (SCNA) mediated diseases and conditions that can be treated with cells/tissues of stem cell regeneration obtained using antisense compounds include: diseases associated with abnormal function and/or performance of SCNA Or a condition, a neurological disease or condition, convulsions, pain (including chronic pain), impaired electrical excitability involving sodium ion channel dysfunction, a disease or condition associated with sodium ion channel dysfunction, and voltage-gated sodium ion channel alpha Diseases or conditions associated with mis-regulation of subunit activity (eg paralysis, hyperkalemia, periodic paralysis, congenital myocardium, potassium tonic muscle rigidity, long QT syndrome 3, motor endplate disease) , ataxia, etc.), gastrointestinal diseases (such as colitis, ileitis, inflammatory bowel syndrome, etc.), cardiovascular diseases or conditions (such as hypertension, congestive heart failure, etc.) attributed to dysfunction of the enteric nervous system a disease or condition involving the genitourinary and parasympathetic nerve distribution of the genitourinary tract (eg, benign prostatic hyperplasia, impotence); and the neuromuscular system a disease or condition (eg, muscular dystrophy, multiple sclerosis, epilepsy, autism, migraine (eg, sporadic and familial hemiplegic migraine), severe episodic epilepsy in infants (SMEI or German) Laweit's syndrome), systemic epilepsy (GEFS+) with thermal seizures, and SCNA-related seizures. The invention further relates to a pharmaceutical composition comprising at least one oligonucleotide that targets at least one or more natural antisense transcripts selected from the group consisting of: SCN1A to SCN12A genes or Its mRNA or isoform or variant. The invention further relates to a method of treating a neurological disease or disorder comprising administering an oligonucleotide that targets at least one or more natural antisense transcripts selected from the group consisting of: mRNA SCN1A, SCN2A, SCN3A, SCN4A, SCN5A, SCN6A, SCN7A, SCN8A, SCN9A, SCN10A, SCN11A and SCN12A or variants thereof. In a preferred embodiment, the oligomer is selected to upregulate the performance of the fully functional performance product of the SCNA family. In a preferred embodiment, the oligomers of the invention upregulate transcription and/or translation of any of the mRNAs of the SCNXA gene family to provide a fully functional sodium ion channel in a patient in need of treatment. In a patient having a disease or condition associated with a mutated form of a voltage-gated sodium ion channel, in a preferred embodiment, a natural one comprising a targeted voltage-gated sodium ion channel alpha gene or mRNA of the gene is used. Administration or treatment of a pharmaceutical composition of an oligonucleotide of an antisense transcript will upregulate a fully functional performance product at a greater rate than the upregulation of the performance product produced by the mutated form of the gene. In another embodiment, the invention relates to an oligonucleotide combination that targets at least one natural antisense transcript of at least two members of the SCNXA family, wherein the X is selected from 1-12. For example, in the treatment of Dravid's syndrome, a combination of oligonucleotides can be used to upregulate performance products such as SCN1A and SCN9A. In another embodiment, at least one oligonucleotide can be selected to target a natural antisense transcript of at least two genes selected from any one of SCN1A to SCN12A. Preferred oligonucleotides of the invention are between about 5 and about 30 nucleotides in length and at least 50% complementary to a segment of 5 to about 30 nucleotides of NAT. A preferred NAT for any of the SCNA gene or its transcript is a NAT that interferes with and modulates the expression of mRNA and/or translation products of the mRNA when targeted by the oligonucleotides of the invention. In a preferred embodiment, the oligonucleotide upregulates the performance of the target's functional protein to treat or ameliorate SCNA-related diseases. In a preferred embodiment, this "upregulation" is not associated with the etiology or promotion of a disease, such as cancer. Alterations in the SCNA gene may include or encompass many or all forms of genetic mutations in the coding and/or non-coding regions of the gene, including insertions, deletions, rearrangements, and/or point mutations. A deletion can be a deletion of a whole gene or part of a gene. Point mutations can result in amino acid substitutions, frame shifts or stop codons. Point mutations can also occur in regulatory regions of the SCNA gene, such as in promoters, resulting in loss or reduction in the performance of mRNA, or can result in improper processing of this mRNA, resulting in reduced stability or reduced translation efficiency. Such changes in humans can lead to various forms of disease and there are numerous publications describing the association of changes in the SCNA gene with, for example, epilepsy or SMEI. Such changes may be "de novo" or heritable. The invention is not limited to the treatment of diseases associated with alterations in the SCNA gene and also includes treating SCNA-associated diseases or conditions in which the patient does not have or does not have an alteration or mutation in the SCNA gene. Any modulation or up-regulation of the performance of a functional voltage-gated sodium ion channel will result in a reduction or treatment of the relevant SCNA disease or condition in the patient in need of treatment. This alleviation may also include at least one measurable indicator of clinical improvement, including fewer episodes, less frequent episodes, less severe episodes, less seizure types, neurodevelopmental improvements, or any other therapeutic benefit. In one embodiment, administration of one or more antisense oligonucleotides to a patient in need thereof modulates SCNA to prevent or treat any disease associated with abnormal SCNA performance, function, activity compared to a normal control or Illness. In one embodiment, the oligonucleotide is specific for a polynucleotide comprising, without limitation, a non-coding region of SCNA. SCNA targets include variants of SCNA; mutants of SCNA, including SNPs; non-coding sequences of SCNA; dual genes, fragments and analogs thereof. Preferably, the oligonucleotide is an antisense RNA molecule. According to an embodiment of the invention, the target nucleic acid molecule is not limited to the SCNA polynucleotide but extends to any of the isoforms, receptors, homologs, non-coding regions and analogs of the SCNA. In one embodiment, the oligonucleotide targets a natural antisense sequence of the SCNA target (natural antisense of the coding and non-coding regions), including, without limitation, variants thereof, dual genes, homologs, mutants, Derivatives, fragments and complementary sequences. Preferably, the oligonucleotide is an antisense RNA or DNA molecule. In one embodiment, the oligomeric compounds of the invention also include variants in which different bases are present at one or more nucleotide positions in the compound. For example, if the initial nucleotide is adenine, a variant containing thymidine, guanosine, cytidine or other natural or non-natural nucleotides at this position can be produced. This can be done at any position of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to inhibit the performance of the target nucleic acid. In some embodiments, the homology, sequence identity, or complementarity between the antisense compound and the target is from about 50% to about 60%. In some embodiments, the homology, sequence identity, or complementarity is from about 60% to about 70%. In some embodiments, the homology, sequence identity, or complementarity is from about 70% to about 80%. In some embodiments, the homology, sequence identity, or complementarity is from about 80% to about 90%. In some embodiments, the homology, sequence identity, or complementarity is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. When the binding of the antisense compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause loss of activity, and there is a sufficient degree of complementarity to avoid non-specificity of the antisense compound and the non-target nucleic acid sequence under the conditions required for specific binding. When combined, the antisense compound is specifically hybridizable. Such conditions include physiological conditions in the case of in vivo assays or therapeutic treatments, and conditions for assays in the case of in vitro assays. When an antisense compound (whether DNA, RNA, chimeric, substituted antisense compound, etc.) binds to a target DNA or RNA molecule, it interferes with the normal function of the target DNA or RNA for loss of utility, and there is a sufficient degree of complementarity. To avoid the specific binding of the antisense compound to the non-target sequence (ie, in the case of in vivo assay or therapeutic treatment, under physiological conditions, and in the case of in vitro assays, the assay is performed) The antisense compound is specifically hybridizable when subjected to non-specific binding. In one embodiment, targeting SCNA includes, without limitation, antisense sequences identified and amplified using, for example, PCR, hybridization, etc.; one or more of the sequences set forth in SEQ ID NOs: 12 to 28 and analogs thereof are modulated The performance or function of SCNA. In one embodiment, the performance or function is up-regulated compared to the control. In one embodiment, the performance or function is down-regulated compared to the control. In one embodiment, the oligonucleotide comprises the nucleic acid sequences set forth in SEQ ID NOs: 29-94, including antisense sequences identified and amplified using, for example, PCR, hybridization, and the like. Such oligonucleotides may comprise one or more modified nucleotides, shorter or longer fragments, modified linkages, and the like. Examples of modified linkages or internucleotide linkages include phosphorothioates, dithiophosphates, or the like. In one embodiment, the nucleotide comprises a phosphorus derivative. Phosphorus derivatives (or modified phosphate groups) which may be attached to a sugar or sugar analog moiety in a modified oligonucleotide of the invention may be monophosphate, diphosphate, triphosphate, alkyl phosphate Esters, alkyl phosphates, phosphorothioates and the like. The preparation of the above indicated phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides are also known per se and need not be described herein. The specificity and sensitivity of antisense are also utilized by those skilled in the art to achieve therapeutic use. Antisense oligonucleotides have been used as therapeutic moieties in the treatment of disease states in animals and humans. Antisense oligonucleotides have been safely and efficiently administered to humans and numerous clinical trials are currently underway. Thus, it is determined that the oligonucleotide can be a therapeutic modality that can be configured to be useful in the treatment of cells, tissues, and animals, particularly humans. In an embodiment of the invention, an oligomeric antisense compound, in particular an oligonucleotide, binds to a target nucleic acid molecule and modulates the expression and/or function of the molecule encoded by the gene of interest. DNA functions that will be interfered with include, for example, replication and transcription. The RNA function that will be interfered with contains all life functions, such as translocation of RNA to protein translation sites, translation of proteins from RNA, splicing of RNA to produce one or more mRNA species, and catalytic activity in which RNA can participate or promote . Depending on the function you want, the function can be up or down. Antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, external leader sequence (EGS) oligonucleotides, alternative splicers, primers, probes, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. . Thus, such compounds can be introduced as single, double, partially single, or cyclic oligomeric compounds. In the context of the present invention, targeting an antisense compound to a particular nucleic acid molecule can be a multi-step process. This process typically begins with the identification of a target nucleic acid whose function is to be modulated. The target nucleic acid can be, for example, a nucleic acid molecule that exhibits a cellular gene (or mRNA transcribed from a gene) associated with a particular disorder or disease state, or from an infectious agent. In the present invention, the target nucleic acid encodes a voltage-gated sodium ion channel alpha subunit (SCNA). The targeting process also typically includes determining at least one target region, segment or site within the target nucleic acid for the antisense interaction to occur to produce the desired effect (e.g., to modulate the expression). In the context of the present invention, the term "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function or feature. The segment is within the region of the target nucleic acid. A "segment" is defined as a smaller portion or sub-portion of a region within a target nucleic acid. A "site" as used in the present invention is defined as a position within a target nucleic acid. In one embodiment, the antisense oligonucleotide binds to the natural antisense sequence of a voltage-gated sodium channel alpha subunit (SCNA) and regulates the performance and/or function of SCNA (SEQ ID NOS: 1 to 11). Examples of natural antisense sequences include SEQ ID NOS: 12 to 28. Examples of antisense oligonucleotides include SEQ ID NOs: 29 to 94. In one embodiment, the antisense oligonucleotide binds to one or more segments of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide and modulates the performance and/or function of the SCNA. The segment comprises at least 5 contiguous nucleotides of a SCNA sense or antisense polynucleotide. In one embodiment, the antisense oligonucleotide is specific for the natural antisense sequence of SCNA, wherein binding of the oligonucleotide to the natural antisense sequence of SCNA modulates the performance and/or function of the SCNA. In one embodiment, the oligonucleotide compound comprises the sequences set forth in SEQ ID NOs: 29-94, including antisense sequences identified and amplified using, for example, PCR, hybridization, and the like. Such oligonucleotides may comprise one or more modified nucleotides, shorter or longer fragments, modified linkages, and the like. Examples of modified linkages or internucleotide linkages include phosphorothioates, dithiophosphates, or the like. In one embodiment, the nucleotide comprises a phosphorus derivative. Phosphorus derivatives (or modified phosphate groups) which may be attached to a sugar or sugar analog moiety in a modified oligonucleotide of the invention may be monophosphate, diphosphate, triphosphate, alkyl phosphate Esters, alkyl phosphates, phosphorothioates and the like. The preparation of the above indicated phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides are also known per se and need not be described herein. As is known in the art, since the translation initiation codon is typically 5'-AUG (in the transcribed mRNA molecule; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as "AUG". Codon, Start Codon or AUG Start Codon. A few genes have a translation initiation codon with an RNA sequence of 5'-GUG, 5'-UUG or 5'-CUG; and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass a number of codon sequences, even if the starting amino acid in each case is usually methionine (in eukaryotes) or Methionine (in prokaryotes). Eukaryotic and prokaryotic genes can have two or more alternative initiation codons, either of which can be preferentially used to initiate translation in a particular cell type or tissue or under a particular set of conditions. In the context of the present invention, "start codon" and "translation initiation codon" refer to mRNA transcribed in vivo for the initiation of a gene encoding a voltage-gated sodium ion channel alpha subunit (SCNA). The translated codon, regardless of the sequence of such codons. The gene translation stop codon (or "stop codon") can have one of three sequences: 5'-UAA, 5'-UAG, and 5'-UGA (the corresponding DNA sequence is 5'-TAA, respectively). 5'-TAG and 5'-TGA). The terms "start codon region" and "translation initiation codon region" refer to about 25 to about 50 contiguous nucleosides covering either the start of the translation start codon in either direction (ie, 5' or 3'). A portion of the mRNA or gene of the acid. Similarly, the terms "stop codon region" and "translatation stop codon region" refer to about 25 to about 50 contiguous nucleosides covering either the start of the translation stop codon in either direction (ie, 5' or 3'). A portion of the mRNA or gene of the acid. Therefore, the "start codon region" (or "transition initiation codon region") and the "stop codon region" (or "transition termination codon region") are all effectively targeted by the antisense compounds of the present invention. region. An open reading frame (ORF) or "coding region", which is known in the art to refer to the region between the translation initiation codon and the translation stop codon, is also an area that can be effectively targeted. In the context of the present invention, the targeting region is an intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Another target region includes a portion of the mRNA known in the art that refers to the start of the translation start codon in the 5' direction, and thus includes the 5' cap site of the mRNA and the translation initiation password. The 5' untranslated region (5' UTR) of the nucleotide (or corresponding nucleotide on the gene) between the children. Another region of interest includes a portion of the mRNA known in the art that refers to the start of the translation stop codon in the 3' direction, and thus includes the nucleotide between the translation stop codon of the mRNA and the 3' end (or 3' untranslated region (3' UTR) of the corresponding nucleotide on the gene. The 5' capping site of the mRNA comprises an N7-methylated guanosine residue joined to the most 5' end of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of the mRNA is considered to comprise the 5' cap structure itself and 50 nucleotides adjacent to the cap site. Another target area for use in the present invention is the 5' cap region. Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions called "introns" that are excised from the transcript prior to translation. The remaining (and thus translated) regions are referred to as "exons" and are spliced together to form a continuous mRNA sequence. In one embodiment, targeting a splice site, ie, an intron-exon junction or an exon-intron junction, is particularly useful in diseases involving abnormal splicing or disease involving a particular splicing product. In the case of production. Another embodiment of the target site is due to an abnormal fusion junction due to rearrangement or deletion. mRNA transcripts produced via a splicing process from two (or more) mRNAs of different gene sources are referred to as "fusion transcripts." Introns can be efficiently targeted using antisense compounds that target, for example, DNA or pre-mRNA. In one embodiment, the antisense oligonucleotide binds to the coding and/or non-coding region of the polynucleotide of interest and modulates the expression and/or function of the target molecule. In one embodiment, the antisense oligonucleotide binds to a natural antisense polynucleotide and modulates the expression and/or function of the target molecule. In one embodiment, the antisense oligonucleotide binds to a sense polynucleotide and modulates the expression and/or function of the target molecule. Alternative RNA transcripts can be produced from the same genomic region of DNA. Such alternative transcripts are often referred to as "variants." More specifically, a "pre-mRNA variant" is a transcript produced from the same genomic DNA, unlike other transcripts produced from the same genomic DNA in its initiation or termination position and containing introns and Both of the sequence of the show. Pre-mRNA variants produce smaller "mRNA variants" when one or more exons or intron regions or portions thereof are excised during splicing. Thus, mRNA variants are mRNA variants prior to processing and each unique pre-mRNA variant must always produce unique mRNA variants due to splicing. These mRNA variants are also referred to as "alternative splice variants". If the splicing of the pre-mRNA variant does not occur, the pre-mRNA variant is identical to the mRNA variant. Variants can be generated by using alternative signals to initiate or terminate transcription. The pre-mRNA and mRNA may have more than one start codon or stop codon. Variants derived from pre-mRNA or mRNA using alternative start codons are referred to as "alternative start variants" of the pre-mRNA or mRNA. Their transcripts using alternative stop codons are referred to as "alternative termination variants" of the pre-mRNA or mRNA. A particular type of alternative termination variant is a "polyA variant" in which multiple transcripts are produced by an alternative selection of a "polyA termination signal" by a transcriptional machinery, thereby generating a unique polyA site. Terminated transcripts are produced. In the context of the present invention, the variant types described herein are also examples of target nucleic acids. The position on the target nucleic acid that hybridizes to the antisense compound is defined as the portion of the target region that is targeted by the active antisense compound and that is at least 5 nucleotides in length. Although specific sequences of certain exemplary target segments are set forth herein, those skilled in the art will recognize that such sequences are used to illustrate and describe particular embodiments within the scope of the invention. Other target segments are readily identified by one of ordinary skill in the art in view of the present invention. A target segment of 5 to 100 nucleotides in length comprising an extension of at least five (5) contiguous nucleotides selected from the illustrative preferred target segments is considered to be also suitable for targeting. The target segment can comprise a DNA or RNA sequence comprising at least 5 contiguous nucleotides from the 5' end of an illustrative preferred target segment (the remaining nucleotides are consecutive extensions of the same DNA or RNA, which are immediately followed by the target The upstream of the 5' end of the segment begins and continues until the DNA or RNA contains from about 5 to about 100 nucleotides). A similar preferred target segment is represented by a DNA or RNA sequence comprising at least 5 contiguous nucleotides from the 3' end of an illustrative preferred target segment (the remaining nucleotides are consecutive extensions of the same DNA or RNA, Beginning immediately downstream of the 3' end of the target segment and continuing until the DNA or RNA contains from about 5 to about 100 nucleotides). Those skilled in the art having the subject areas described herein will be able to identify other preferred target segments without performing an experiment. Once one or more of the target regions, segments or sites have been identified, an antisense compound that is sufficiently complementary to the target (ie, sufficiently good to hybridize) and of sufficient specificity is selected to produce the desired effect. In an embodiment of the invention, the oligonucleotide is associated with an antisense strand of a particular target. Oligonucleotides are at least 5 nucleotides in length and can be synthesized such that each oligonucleotide targets an overlapping sequence such that the oligonucleotide is synthesized to encompass the entire length of the polynucleotide of interest. Targets also include coding and non-coding areas. In one embodiment, the specific nucleic acid is preferably targeted with an antisense oligonucleotide. Targeting an antisense compound to a particular nucleic acid molecule is a multi-step process. This process typically begins with the identification of the nucleic acid sequence whose function is to be modulated. This can be, for example, a cellular gene (or mRNA transcribed from a gene), or a non-coding polynucleotide, such as a non-coding RNA (ncRNA), that is associated with a particular disorder or disease state. RNA can be classified into (1) messenger RNA (mRNA), which is translated into protein, and (2) RNA that does not encode protein (ncRNA). ncRNAs contain microRNAs, antisense transcripts and other transcription units (TUs) that contain high-density stop codons and lack any extended "open reading frame". Many ncRNAs appear to start from the start site in the 3' untranslated region (3' UTR) of the locus of the encoded protein. ncRNAs are usually sparse and at least half of the ncRNAs that have been sequenced by the FANTOM Association do not appear to be polyadenylated. Most researchers have focused on polyadenylation mRNA that is processed and excreted into the cytoplasm for obvious reasons. Recently, the collection of non-polyadenylated nuclear RNAs has been shown to be extremely large, and many of these transcripts are produced by so-called intergenic regions. The mechanism by which ncRNAs can regulate gene expression is based on base pairing with a target transcript. RNA acting by base pairing can be grouped into (1) cis-encoding RNA, which is encoded at the same genetic position but on the opposite strand of the RNA to which it acts and thus exhibits complete complementarity with its target, and (2 Trans-encoding RNA, which encodes at a chromosomal location different from the RNA it acts on and typically does not exhibit full base pairing potential with its target. Without wishing to be bound by theory, the perturbation of the antisense oligonucleotides described herein by antisense oligonucleotides can alter the performance of the corresponding sense messenger RNA. However, this regulation may be inconsistent (antisense blocking gene expression results in elevated messenger RNA) or consensus (antisense blocking gene expression results in concomitant messenger RNA reduction). In such cases, the antisense oligonucleotide can be targeted to overlapping or non-overlapping portions of the antisense transcript, thereby causing it to block gene expression or sequestration. Both coding and non-coding antisense can be targeted in the same manner and any of the species can modulate the corresponding sense transcript in a consistent or inconsistent manner. The strategy for identifying novel oligonucleotides for use against a target can be based on blocking the gene expression of the antisense RNA transcript by antisense oligonucleotides or any other means of modulating the desired target.Strategy 1 : In the case of inconsistent regulation, blocking the expression of the antisense transcript gene will increase the performance of the conventional (sense) gene. If a known gene encodes a known or putative drug target, it is conceivable that the gene expression that blocks its antisense counterpart mimics the effect of a receptor agonist or enzyme stimulant.Strategy 2 : In the case of consistent regulation, gene expression of both antisense and sense transcripts can be blocked and thereby synergistically reduce conventional (sense) gene expression. If, for example, an antisense oligonucleotide is used to block gene expression, this strategy can be used to administer an antisense oligonucleotide that targets a sense transcript and another antisense oligo that targets the corresponding antisense transcript. Glycosidic acid, or a single energy symmetric antisense oligonucleotide that simultaneously targets overlapping sense and antisense transcripts. According to the invention, antisense compounds include antisense oligonucleotides, ribonucleases, external leader sequence (EGS) oligonucleotides, siRNA compounds, single or double stranded RNA interference (RNAi) compounds (such as siRNA compounds), And other oligomeric compounds that hybridize to at least a portion of the target nucleic acid and modulate their function. Thus, it can be DNA, RNA, DNA-like, RNA-like or a mixture thereof, or a mimetic of one or more of these. Such compounds may be single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal protrusions, mismatches or rings. The antisense compounds are prepared in a conventional manner in a linear form but may be linked or otherwise prepared to form a ring and/or a branch. An antisense compound can include a construct, such as a single strand that hybridizes to form a fully or partially double-stranded compound or has sufficient self-complementarity to allow hybridization and formation of a fully or partially double-stranded compound. The two strands may be internally connected to leave a free 3' or 5' end; or may be joined to form a continuous hairpin structure or loop. The hairpin structure may have protrusions on the 5' or 3' end to create an extension having a single strand characteristic. The double-stranded compound may optionally include protrusions on the ends. Other modifications may include a binding group attached to one end, a selected nucleotide position, a sugar position, or an internucleoside linkage. Alternatively, the two strands may be linked via a non-nucleic acid moiety or a linking group. When formed from only one strand, the dsRNA can take the form of a self-complementary hairpin-type molecule that folds in itself to form a double helix. Thus, the dsRNA can be fully or partially double stranded. Gene expression can be specifically regulated by stably expressing dsRNA hairpins in a transgenic cell line, however, in some embodiments, gene expression or function is upregulated. When formed from two strands, or a single strand in the form of a self-complementary hairpin type molecule that is folded in half to form a double helix, the two strands (or single stranded double helix forming regions) are taken in Waldorf-Kerry Complementary RNA strands that base pairing in gram mode. Once introduced into the system, the compounds of the invention may elicit one or more enzymes or structural proteins to effect cleavage or other modification of the target nucleic acid or may function via an occupancy-based mechanism. In general, nucleic acids (including oligonucleotides) can be described as "DNA-like" (ie, typically having one or more 2'-deoxy sugars and usually having a T base rather than a U base) or "RNA-like" (ie, typically having one or more 2'-hydroxy or 2'-modified sugars and typically having a U base rather than a T base). Nucleic acid helices can employ more than one type of structure, most commonly A and B. In general, an oligonucleotide having a B-like structure is "DNA-like" and an oligonucleotide having an A-like structure is "RNA-like". In some (chimeric) embodiments, an antisense compound can contain both an A-form region and a B-form region. In one embodiment, the desired oligonucleotide or antisense compound comprises at least one of: an antisense RNA, an antisense DNA, a chimeric antisense oligonucleotide, an antisense oligonucleotide comprising a modified bond , interfering RNA (RNAi), short interfering RNA (siRNA); micro interfering RNA (miRNA); small temporal RNA (small, temporal RNA) (stRNA); or short hairpin RNA (shRNA); small RNA-induced gene activation ( RNAa); small activating RNA (saRNA) or a combination thereof. dsRNA also activates gene expression, a mechanism known as "small RNA-induced gene activation" or RNAa. The dsRNA targeting the gene promoter induces strong transcriptional activation of related genes. RNAa is demonstrated in human cells using synthetic dsRNA called "small activating RNA" (saRNA). It is currently unknown whether RNAa is conserved in other organisms. Small double-stranded RNA (dsRNA) such as small interfering RNA (siRNA) and microRNA (miRNA) has been found to be a trigger for an evolutionarily conserved mechanism called RNA interference (RNAi). RNAi always results in gene quiescence by remodeling chromatin to thereby inhibit transcription, degrade complementary mRNA, or block protein translation. However, as detailed in the Examples section that follows, oligonucleotides are shown to increase the performance and/or function of voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotides and their encoded products. dsRNA can also act as a small activating RNA (saRNA). Without wishing to be bound by theory, by targeting a sequence in a gene promoter, the saRNA will induce expression of the target gene, a phenomenon known as dsRNA-induced transcriptional activation (RNAa). In another embodiment, the "better target segment" identified herein can be used in the screening of other compounds that modulate the performance of voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotides. A "modulator" is one that reduces or increases the performance of a nucleic acid molecule encoding a SCNA and comprises a compound that is complementary to at least a 5 nucleotide portion of the preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding a sense or natural antisense polynucleotide of SCNA with one or more candidate modulators, and selecting one or more reducing or increasing encoding of the SCNA poly Candidate modulators of the expression of nucleic acid molecules of nucleotides, such as SEQ ID NOS: 29-94. Once the candidate modulator is shown to be capable of modulating (eg, reducing or increasing) the expression of the nucleic acid molecule encoding the SCNA polynucleotide, the modulator can then be used in other exploratory studies of the function of the SCNA polynucleotide, or as The research agent, diagnostic agent or therapeutic agent of the invention. Targeting the natural antisense sequence preferably modulates the function of the target gene. For example, SCNA genes (eg, accession numbers NM_001165963, NM_021007, NM_006922, NM_000334, NM_198056, NM_002976, NM_014191, NM_002977, NM_006514, NM_014139, AF109737). In one embodiment, the target is an antisense polynucleotide of the SCNA gene. In one embodiment, the antisense oligonucleotides are targeted to SCNA polynucleotides (eg, accession numbers NM_001165963, NM_021007, NM_006922, NM_000334, NM_198056, NM_002976, NM_014191, NM_002977, NM_006514, NM_014139, AF109737) and/or Or a natural antisense sequence, variants thereof, dual genes, isoforms, homologs, mutants, derivatives, fragments and complementary sequences. Preferably, the oligonucleotide is an antisense molecule and the target comprises an encoding and non-coding region of an antisense and/or sense SCNA polynucleotide. Preferred target segments of the invention may also be combined with the respective complementary antisense compounds of the invention to form stabilized double stranded (double helix) oligonucleotides. In the art, these double-stranded oligonucleotide moieties have been shown to modulate target expression via antisense mechanisms and regulate translation and RNA processing. In addition, the double-stranded portion can undergo chemical modification. For example, such double-stranded portions have been shown to undergo classical cross-linking with the target by the antisense strand of the double helix, thereby triggering enzymatic degradation of the target to inhibit the target. In one embodiment, the antisense oligonucleotide targets a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide (eg, accession numbers NM_001165963, NM_021007, NM_006922, NM_000334, NM_198056, NM_002976, NM_014191, NM_002977, NM_006514, NM_014139, AF109737), variants thereof, dual genes, isoforms, homologs, mutants, derivatives, fragments and complementary sequences. Preferably, the oligonucleotide is an antisense molecule. According to an embodiment of the invention, the target nucleic acid molecule is not limited to SCNA but extends to any of the isoforms, receptors, homologs and analogs thereof of the SCNA molecule. In one embodiment, the oligonucleotide targets a natural antisense sequence of a SCNA polynucleotide (eg, the polynucleotides set forth in SEQ ID NOs: 12 to 28) and any variants thereof, dual genes, homologs , mutants, derivatives, fragments and complementary sequences. Examples of antisense oligonucleotides are set forth in SEQ ID NOs: 29-94. In one embodiment, the oligonucleotide is complementary to or binds to a nucleic acid sequence of SCNA antisense, including, without limitation, non-coding sense and/or antisense sequences associated with a SCNA polynucleotide, and modulating the performance of the SCNA molecule And / or function. In one embodiment, the oligonucleotide is complementary to or binds to the nucleic acid sequence of the SCNA natural antisense as set forth in SEQ ID NOs: 12 to 28, and modulates the expression and/or function of the SCNA molecule. In one embodiment, the oligonucleotide comprises a sequence of at least 5 contiguous nucleotides of SEQ ID NOs: 29 to 94 and modulates the expression and/or function of the SCNA molecule. Polynucleotide targets include SCNAs, including family members, variants of SCNA; mutants of SCNA, including SNPs; non-coding sequences of SCNA; dual genes of SCNA; species variants, fragments and analogs thereof. Preferably, the oligonucleotide is an antisense molecule. In one embodiment, the oligonucleotide that targets the SCNA polynucleotide comprises: antisense RNA, interfering RNA (RNAi), short interfering RNA (siRNA); micro interfering RNA (miRNA); small temporal RNA (stRNA) Or short hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); or small activating RNA (saRNA). In one embodiment, targeting voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotides, such as SEQ ID NOS: 1 to 11, modulate the performance or function of such targets. In one embodiment, the performance or function is up-regulated compared to the control. In one embodiment, the performance or function is down-regulated compared to the control. In another embodiment, targeting a natural antisense transcript (eg, SEQ ID NOs: 12 to 28) and any other target NAT of such target polynucleotides results in upregulation of the target mRNA and corresponding protein. In one embodiment, the antisense compound comprises the sequences set forth in SEQ ID NOs: 29-94. Such oligonucleotides may comprise one or more modified nucleotides, shorter or longer fragments, modified linkages, and the like. In one embodiment, SEQ ID NOs: 29 to 94 comprise one or more LNA nucleotides. Table 1 shows exemplary antisense oligonucleotides suitable for use in the methods of the invention. table 1 : * indicates a phosphorothioate linkage, + indicates LNA, "r" indicates RNA and "m" indicates a methyl group on the 2' oxygen atom on the designated sugar moiety of the oligonucleotide. To avoid ambiguity, this LNA has the following formula:Wherein B is a specific designated base. table 2 : Relative expression of SCN1A mRNA in cells treated with antisense oligonucleotides targeting SCN1A-specific natural antisense transcripts. The mean fold difference in the performance of SCN1A compared to the control transfected with Avg-; the Std-standard deviation, the P-treated sample is no different from the probability of simulating the control. The total number of N-parallel measurements. table 2 : The desired target nucleic acid can be modulated in a number of ways known in the art. For example, antisense oligonucleotides, siRNA, and the like. Enzymatic nucleic acid molecules (e.g., ribonucleases) are those capable of catalyzing one or more of a variety of reactions, including nucleic acid molecules capable of repeatedly cleaving other individual nucleic acid molecules in a nucleotide base sequence specific manner. Such enzymatic nucleic acid molecules can be used, for example, to target virtually any RNA transcript. Trans-lytic enzymatic nucleic acid molecules are promising as therapeutic agents for human diseases due to their sequence specificity. Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the context of cellular RNA. This cleavage event renders the mRNA non-functional and abolishes the expression of the protein from the other RNA. In this way, the synthesis of proteins associated with disease states can be selectively inhibited. In general, an enzymatic nucleic acid having an RNA cleavage activity functions by first binding to a target RNA. This binding occurs via a target binding moiety of the enzymatic nucleic acid that remains in close proximity to the enzymatic portion of the molecule that functions to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes the target RNA and then binds to the target RNA via complementary base pairing, and once bound to the correct site, acts enzymatically to cleave the target RNA. The key cleavage of this target RNA will destroy its ability to direct synthesis of the encoded protein. After the enzymatic nucleic acid has bound and cleaves its RNA target, it is released from the other RNA to search for another target and can repeatedly bind and cleave the new target. Several methods such as the In Vitro Selection (Evolution) Strategy (Orgel, (1979) Proc. R. Soc. London, B 205, 435) have been used to develop a variety of reactions, such as cleavage and linkage of phosphodiester bonds and guanamines. A novel nucleic acid catalyst for the bond. The development of a catalytically active ribonuclease will significantly contribute to the use of RNA cleavage ribonuclease to achieve any strategy for the regulation of gene expression. The hammerhead ribonuclease acts, for example, at a catalytic rate (kcat) of about 1 min-1 in the presence of a saturated (10 mM) concentration of Mg2+ cofactor. Artificial "RNA ligase" ribonucleases have been shown to catalyze the corresponding self-modification reactions at a rate of about 100 min-1. Furthermore, it is known that certain modified hammerhead ribonucleases having a binding arm composed of DNA catalyze RNA cleavage at multiple conversion rates of approximately 100 min-1. Finally, replacement of a particular residue within the catalytic core of the hammerhead with certain nucleotide analogs results in a modified ribonuclease that exhibits up to a 10-fold improvement in catalytic rate. These findings demonstrate that ribonuclease can significantly promote chemical conversion at a catalytic rate that is significantly greater than the catalytic rate exhibited by most native self-cleaving ribonucleases in vitro. It is then possible that the structure of certain self-cleaving ribonucleases can be optimized to produce maximum catalytic activity, or completely novel RNA motifs that exhibit significantly faster RNA phosphodiester cleavage rates can be prepared. The intermolecular cleavage of RNA catalysts for RNA conformation was first shown in 1987 (Uhlenbeck, O. C. (1987) Nature, 328: 596-600). The RNA catalyst is recovered and reacted with a plurality of RNA molecules to prove that it does catalyze. Catalytic RNA designed based on the "hammerhead" motif has been used to cleave specific target sequences by making appropriate base changes in the catalytic RNA to maintain the necessary base pairing with the target sequence. This has allowed the use of catalytic RNA to cleave specific target sequences and indicates that catalytic RNA designed according to the "hammerhead" model may cleave specific receptor RNA in vivo. RNA interference (RNAi) has become a powerful tool for regulating gene expression in mammalian and mammalian cells. This method requires the transmission of small interfering RNA (siRNA) in the form of self RNA or in the form of DNA using a coding sequence that expresses a plastid or virus and a small hairpin RNA that is processed into siRNA. This system is capable of efficiently transporting pre-siRNA to the cytoplasm where the pro-siRNA is active and allows the use of a regulated and tissue-specific promoter to achieve gene expression. In one embodiment, the oligonucleotide or antisense compound comprises an oligo or polymer of ribonucleic acid (RNA) and/or deoxyribonucleic acid (DNA), or a mimetic, chimera, analog or the like Source. The term includes oligonucleotides consisting of naturally occurring nucleotides, sugars, and covalent internucleoside (backbone) linkages, as well as oligonucleotides having portions that are not naturally occurring and functioning in a similar manner. Such modified or substituted oligonucleotides are often required to exceed the native form due to desirable properties such as enhanced cellular uptake, increased affinity for the target nucleic acid, and increased stability in the presence of nucleases. According to the invention, an oligonucleotide or "antisense compound" includes an antisense oligonucleotide (eg, an RNA, DNA, mimetic, chimera, analog or homolog thereof), a ribonuclease, an external leader sequence ( EGS) Oligonucleotides, siRNA compounds, single or double stranded RNA interference (RNAi) compounds (such as siRNA compounds), saRNA, aRNA, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid and modulate its function. Thus, it can be DNA, RNA, DNA-like, RNA-like or a mixture thereof, or a mimetic of one or more of these. Such compounds may be single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal protrusions, mismatches or rings. The antisense compounds are prepared in a conventional manner in a linear form but may be linked or otherwise prepared to form a ring and/or a branch. An antisense compound can include a construct, such as a single strand that hybridizes to form a fully or partially double-stranded compound or has sufficient self-complementarity to allow hybridization and formation of a fully or partially double-stranded compound. The two strands may be internally connected to leave a free 3' or 5' end; or may be joined to form a continuous hairpin structure or loop. The hairpin structure may have protrusions on the 5' or 3' end to create an extension having a single strand characteristic. The double-stranded compound may optionally include protrusions on the ends. Other modifications may include a binding group attached to one end, a selected nucleotide position, a sugar position, or an internucleoside linkage. Alternatively, the two strands may be linked via a non-nucleic acid moiety or a linking group. When formed from only one strand, the dsRNA can take the form of a self-complementary hairpin-type molecule that folds in itself to form a double helix. Thus, dsRNAs can be fully or partially double stranded. Gene expression can be specifically regulated by stably expressing dsRNA hairpins in transgenic cell lines. When formed from two strands, or a single strand in the form of self-complementary hairpin-type molecules that are folded in half to form a double helix, the two strands (or single-stranded double helix forming regions) are in the form of Waldorf-German Complementary RNA strands for base pairing in Rick mode. Once introduced into the system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect cleavage or other modification of the target nucleic acid or may act via a mechanism based on occupancy. In general, nucleic acids (including oligonucleotides) can be described as "DNA-like" (ie, typically having one or more 2'-deoxy sugars and usually having a T base rather than a U base) or "RNA-like" (ie, typically having one or more 2'-hydroxy or 2'-modified sugars and typically having a U base rather than a T base). Nucleic acid helices can be used in more than one type of structure, most commonly in the A form and the B form. In general, an oligonucleotide having a B-like structure is "DNA-like" and an oligonucleotide having an A-like structure is "RNA-like". In some (chimeric) embodiments, an antisense compound can contain both an A-form region and a B-form region. Antisense compounds of the invention may comprise an antisense portion of from about 5 to about 80 nucleotides in length (i.e., from about 5 to about 80 linked nucleosides). This refers to the length of the antisense strand or portion of the antisense compound. In other words, the single antisense compound of the invention comprises from 5 to about 80 nucleotides, and the double antisense compound of the invention (such as dsRNA) comprises sense and antisense of from 5 to about 80 nucleotides in length. Share or part. One of ordinary skill will appreciate that this includes lengths of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 76, 77, 78, 79 or 80 nucleotides or any range of antisense portions therebetween. In one embodiment, an antisense compound of the invention has an antisense portion of 10 to 50 nucleotides in length. The average technician should understand that this includes the antisense portion lengths of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides or any Range of oligonucleotides. In some embodiments, the oligonucleotide is 15 nucleotides in length. In one embodiment, an antisense or oligonucleotide compound of the invention has an antisense portion of 12 or 13 to 30 nucleotides in length. One of ordinary skill will appreciate that this includes antisense portions of length 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 Nucleotide or any range of antisense compounds therebetween. In one embodiment, the oligomeric compounds of the invention also include variants in which different bases are present at one or more nucleotide positions in the compound. For example, if the initial nucleotide is adenosine, a variant containing thymidine, guanosine or cytidine at this position can be produced. This can be done at any position of the antisense or dsRNA compound. These compounds are then tested using the methods described herein to determine their ability to inhibit the performance of the target nucleic acid. In some embodiments, the homology, sequence identity, or complementarity between the antisense compound and the target is from about 40% to about 60%. In some embodiments, the homology, sequence identity, or complementarity is from about 60% to about 70%. In some embodiments, the homology, sequence identity, or complementarity is from about 70% to about 80%. In some embodiments, the homology, sequence identity, or complementarity is from about 80% to about 90%. In some embodiments, the homology, sequence identity, or complementarity is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. In one embodiment, antisense oligonucleotides such as the nucleic acid molecules set forth in SEQ ID NOs: 29-94 comprise one or more substitutions or modifications. In one embodiment, the nucleotide is substituted with a locked nucleic acid (LNA). In one embodiment, the oligonucleotide targets one or more of the sequence of the nucleic acid molecule encoding and/or non-coding sequence associated with the SCNA, and/or antisense, and the sequences set forth in SEQ ID NOs: 1 to 28. region. Oligonucleotides are also targeted to the overlapping regions of SEQ ID NOS: 1 to 28. Certain preferred oligonucleotides of the invention are chimeric oligonucleotides. In the context of the present invention, a "chimeric oligonucleotide" or "chimera" is an oligonucleotide comprising two or more chemically distinct regions each consisting of at least one nucleotide. Such oligonucleotides typically contain at least one region of the modified nucleotide that confers one or more beneficial properties, such as increased resistance to nucleases, increased uptake into cells, increased binding affinity to the target, and as capable of cleavage. RNA: A region of the DNA or RNA: RNA hybrid that is responsible for the enzyme. For example, RNase H is a cellular endonuclease that cleaves RNA strands of RNA:DNA duplexes. Thus, activation of RNase H results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense regulation of gene expression. Thus, similar results obtained with shorter oligonucleotides are typically obtained when chimeric oligonucleotides are used as compared to hybridization of phosphorothioate deoxyoligonucleotides to the same target region. Cleavage of the RNA target can be detected in a conventional manner by gel electrophoresis and, if desired, related nucleic acid hybridization techniques known in the art. In one embodiment, the chimeric oligonucleotide comprises at least one region modified to increase the binding affinity of the target and a region that normally acts as a substrate for RNAse H. The affinity of an oligonucleotide for its target (in this case, the nucleic acid encoding ras) is determined in a conventional manner by measuring the Tm of the oligonucleotide/target pair, and Tm is the temperature at which the oligonucleotide dissociates from the target. Dissociation is detected by spectrophotometry. The higher the Tm, the greater the affinity of the oligonucleotide for the target. The chimeric antisense compounds of the invention can be formed into a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds are also referred to in the art as hybrids or gapmers. Representative US patents for the preparation of such hybrid structures include, but are not limited to, U.S. Patent Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350 , 5, 652, 355; 5, 652, 355; 5, 652, 356; and 5,700, 922, each incorporated herein by reference. In one embodiment, the region of the modified oligonucleotide comprises at least one nucleotide modified at the 2' position of the sugar, most preferably 2'-O alkyl, 2'-O-alkyl-O - an alkyl or 2'-fluoro-modified nucleotide. In another embodiment, the RNA modification comprises a 2'-fluoro, 2'-amino and 2' O-methyl modification on the ribose of the pyrimidine, an abasic residue or an inverted base at the 3' end of the RNA. Such modifications are incorporated into the oligonucleotides in a conventional manner, and such oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than the 2'-deoxyoligonucleotide for a given target. The effect of this increased affinity is to greatly enhance RNAi oligonucleotide inhibition gene expression. RNAse H is a cellular endonuclease that cleaves RNA:DNA double helix RNA strands; therefore, this enzyme activation results in cleavage of the RNA target and thus greatly enhances the efficiency of RNAi inhibition. Cleavage of the RNA target can be demonstrated by gel electrophoresis in a conventional manner. In one embodiment, the chimeric oligonucleotide is also modified to enhance nuclease resistance. The cell contains a plurality of exonuclease and endonuclease which degrade the nucleic acid. Many nucleotide and nucleoside modifications have been shown to make the incorporated oligonucleotides more resistant to nuclease digestion than natural oligodeoxynucleotides. Nuclease resistance is measured in a conventional manner by culturing the oligonucleotide with a cell extract or an isolated nuclease solution and measuring the extent to which the intact oligonucleotide remains over time, typically by gel electrophoresis. Oligonucleotides that have been modified to enhance their nuclease resistance are more fully present than unmodified oligonucleotides. A variety of oligonucleotide modifications have been shown to enhance or confer nuclease resistance. Oligonucleotides currently containing at least one phosphorothioate modification are preferred. In some cases, oligonucleotide modifications that enhance target binding affinity are also independently capable of enhancing nuclease resistance. Specific examples of some preferred oligonucleotides contemplated by the present invention include such modified backbones, such as phosphorothioates, phosphotriesters, methylphosphonates, short chain alkyl or cycloalkyl sugar linkages. A bond between a short or a short chain hetero atom or a heterocyclic sugar. Preferably, it is an oligonucleotide having a phosphorothioate skeleton, and has a hetero atom skeleton, particularly CH2--NH--O--CH2, CH, -N(CH3)--O--CH2 [called Is a methylene (methylimido) or MMI skeleton], CH2--O--N(CH3)--CH2, CH2-N(CH3)--N(CH3)--CH2 and O--N (CH3)--CH2--CH2 skeleton in which the natural phosphodiester skeleton is represented by O--P--O--CH. De Mesmaeker et al. (1995) Acc. Chem. Res. 28: 366-374 discloses that the indoleamine backbone is also preferred. Oligonucleotides having a morpholino skeleton structure (Summerton and Weller, U.S. Patent No. 5,034,506) are also preferred. In another embodiment, a peptide nucleic acid (PNA) backbone, such as an oligonucleotide, and a phosphodiester backbone are replaced by a polyamine backbone, wherein the nucleotide is bonded directly or indirectly to the aza nitrogen atom of the polyamine backbone. The oligonucleotide may also comprise one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2 or O(CH2)n CH3 Wherein n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O--, S-- or N-alkyl; O--, S-- or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkylaryl; Aminoalkylamino; polyalkylamino; substituted decyl; RNA cleavage group; reporter group; intercalator; group for improving the pharmacokinetic properties of the oligonucleotide; or modified oligonucleotide Groups of pharmacodynamic properties and other substituents of similar nature. Preferred modifications include 2'-methoxyethoxy [2'-O-CH2 CH2 OCH3, also known as 2'-O-(2-methoxyethyl)]. Other preferred modifications include 2'-methoxy (2'-O--CH3), 2'-propoxy (2'-OCH2 CH2CH3) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, at the 3' position of the sugar at the 3' end nucleotide and at the 5' position of the 5' end nucleotide. Oligonucleotides may also have a sugar mimetic, such as a cyclobutyl group in place of a pentofuranosyl group. Oligonucleotides may also or alternatively include modifications or substitutions of nucleobases (often referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleotides include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleotides include nucleotides that are only occasionally or transiently found in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Mepyrimidine, specifically 5-methylcytosine (also known as 5-methylcytosine) 5-methyl-2'deoxycytosine and is often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentobiosyl HMC And synthetic nucleotides such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino) adenine or other miscellaneous Substituted alkyl adenine, 2-thiouracil, 2-thiothymidine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6- Aminohexyl) adenine and 2,6-diaminopurine. "General" bases known in the art, such as inosine, can be included. The 5-Me-C substitution has been shown to increase the stability of the nucleic acid duplex by 0.6-1.2 ° C and is currently a preferred base substitution. Another modification of the oligonucleotides of the invention involves chemically linking one or more portions or conjugates of the enhanced oligonucleotide to the oligonucleotide. Such moieties include, but are not limited to, lipid moieties (such as cholesterol moieties, cholesteryl moieties), aliphatic chains (such as dodecanediol or eleven base residues), polyamines or polyethylene glycol chains, or diamonds Adamantane acetic acid. Oligonucleotides comprising a lipophilic moiety and methods of preparing such oligonucleotides are known in the art, for example, in U.S. Patent Nos. 5,138,045, 5,218,105, and 5,459,255. Not all positions in a given oligonucleotide must be uniformly modified, and indeed more than one of the above mentioned modifications can be incorporated into a single oligonucleotide or even within a single nucleoside within an oligonucleotide. The invention also includes oligonucleotides that are chimeric oligonucleotides as defined above. In another embodiment, a nucleic acid molecule of the invention is conjugated to another moiety, including but not limited to, abasic nucleotides, polyethers, polyamines, polyamines, peptides, carbohydrates, lipids or Polyhydrocarbon compound. Those skilled in the art will recognize that such molecules can be linked to one or more of any of the nucleotides comprising the nucleic acid molecule at several positions on the sugar, base or phosphate group. Oligonucleotides for use in accordance with the present invention can be conveniently and routinely prepared via well known solid phase synthesis techniques. The equipment used for this synthesis is sold by several suppliers including Applied Biosystems. Any other means for this synthesis can also be employed; the actual synthesis of the oligonucleotides is well within the skill of the average skilled artisan. It is also well known to use similar techniques to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives. It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products, such as biotin, luciferin, acridine or psoralen. (psoralen) modified amino acid esters and/or CPG (available from Glen Research, Sterling VA) to synthesize fluorescently labeled oligonucleotides, biotinylated oligonucleotides or other modified oligos Nucleotides, such as cholesterol-modified oligonucleotides. In accordance with the present invention, modifications such as the use of LNA monomers to enhance the potency, specificity and duration of action and broaden the route of administration of oligonucleotides comprising current chemical compositions (such as MOE, ANA, FANA, PS, etc.) are used. This can be achieved by replacing some of the monomers in the current oligonucleotide with LNA monomers. The LNA modified oligonucleotide may have a size similar to the parent compound or may be larger or preferably smaller. Preferably, such LNA-modified oligonucleotides contain less than about 70%, more preferably less than about 60%, optimally less than about 50% of the LNA monomer and are between about 5 and 25 nucleotides in size. More preferably, between about 12 and 20 nucleotides. Preferred modified oligonucleotide backbones include, but are not limited to, phosphorothioates, palmitic phosphorothioates, dithiophosphates, phosphotriesters, aminoalkyl phosphates, methylphosphines Acid esters and other alkyl phosphonates (including 3' phosphonic acid alkyl esters and palmitic phosphonates), phosphonites, amino phosphates (including 3'-amino amino phosphates and amine groups) Alkylamino phosphate), thiocarbonylamino phosphate, thiocarbonylalkylphosphonate, thiocarbonylalkylphosphoric acid triester, and boranophosphate having a normal 3'-5' bond, a 2'-5' linked analog of borane phosphate, and a borane phosphate having a reverse polarity, wherein the adjacent nucleoside unit pair is 3'-5' to 5'-3' or 2'-5' Connect to 5'-2'. Also included are various salts, mixed salts and free acid forms. Representative US patents for the preparation of the above phosphorus-containing bonds include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019 , No. 5, 286, No. 5, No. 5, 286, No. 5, No. 5, 351, No. 5, 563, 253; Preferred modified oligonucleotide backbones which do not include a phosphorus atom have a short chain alkyl or cycloalkyl internucleoside linkage, a mixed heteroatom and an alkyl or cycloalkyl internucleoside linkage, or one or more A skeleton formed by a short chain hetero atom or a heterocyclic nucleoside bond. Such oligonucleotide backbones comprise an oligonucleotide backbone having the following: a morpholino linkage (partially formed from a sugar moiety of a nucleoside); a oxoxane skeleton; a sulfide, an anthracene and an anthracene skeleton; Formacetyl and thioformacetyl skeleton; methylene methyl ethyl and methylene thiomethyl sulfonyl skeleton; olefin-containing skeleton; amino sulfonate skeleton; methylene imino group And a methylene fluorenyl skeleton; a sulfonate and a sulfonamide skeleton; a guanamine skeleton; and other skeletons having a mixture of N, O, S and CH2 components. Representative US patents for the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564 , 5, 405, 938; 5, 434, 257; 5, 466, 677; 5, 470, 967; 5, 489, 677; 5, 541, 307; 5, 561, 225; 5, 596, 086; 5, 602, 240; 5, 610, 289; 5, 602, 240; 5, 608, 046; U.S. Patent Nos. 5,610, 399; 5, 618, 704; 5, 623, 070; 5, 663, 312; 5, 633, 360; 5, 677, 437; and 5, 677, 439 each incorporated herein by reference. In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e., the backbone) of the nucleotide unit are replaced by a novel group. Base units are retained for hybridization to the appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as peptide nucleic acid (PNA). In the PNA compound, the sugar-backbone of the oligonucleotide is replaced by a guanamine-containing backbone, specifically an amine ethylglycine skeleton. The nucleobase is retained and directly or indirectly bound to the aza nitrogen atom of the backbone guanamine moiety. Representative US patents for the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262 each incorporated herein by reference. Other teachings of PNA compounds can be found in Nielsen et al. (1991) Science 254, 1497-1500. In one embodiment of the invention, the oligonucleotide has a phosphorothioate backbone and the oligonucleoside has a heteroatom backbone, and in particular CH2-NH-O-CH2-; referred to as methylene (methyl Amino) or MMI backbone -CH2-N(CH3)-O-CH2-;-CH2-ON(CH3)-CH2-;-CH2N(CH3)-N(CH3)CH2- and -ON(CH3)- CH2-CH2-, wherein the natural phosphodiester backbone is represented by the above-mentioned U.S. Patent No. 5,489,677 -OPO-CH2-; and the above-cited U.S. Patent No. 5,602,240. Oligonucleotides having the morpholino skeleton structure of U.S. Patent No. 5,034,506, which is incorporated by reference above, are also preferred. The modified oligonucleotide may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N- Alkynyl; or Oalkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted C to CO alkyl or C2 to CO alkenyl and alkynyl. Particularly preferred are O(CH2)n OmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 and O(CH2nON(CH2)nCH3)2, wherein n and m can be from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: C to CO, lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkylaryl or O- Aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkylaryl, aminoalkylamine, poly An alkylamino group, a substituted alkylene group, an RNA cleavage group, a reporter group, an intercalator, a group that modifies the pharmacokinetic properties of the oligonucleotide, or a group that improves the pharmacodynamic properties of the oligonucleotide And other substituents having similar properties. A preferred modification comprises 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE), ie alkoxy Alkoxy group. Another preferred modification comprises a 2'-dimethylaminooxyethoxy group, that is, an O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the Examples herein below; 2'-Dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), ie 2'-O- CH2-O-CH2-N (CH2)2. Other preferred modifications include 2'-methoxy (2'-O CH3), 2'-aminopropoxy (2'-O CH2CH2CH2NH2) and 2'-fluoro (2'-F). It can also be located at other positions on the oligonucleotide, specifically at the 3' end nucleotide or in the 2'-5' linked oligonucleotide, at the 3' position of the sugar and at the 5' end nucleotide 5 Similar modifications were made at the location. The oligonucleotide may also have a sugar mimetic, such as a cyclobutyl moiety in place of the pentofuranosyl sugar. Representative US patents for the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; Nos. 5, 514, 785; 5, 519, 134; 5, 567, 811; 5, 576, 427; 5, 591, 722; 5, 597, 909; 5, 610, 300; 5, 627, 053; 5, 639, 873; 5, 646, 265; 5, 658, 873; 5, 670, 633; No. 5,700,920, each of which is incorporated herein by reference. Oligonucleotides may also contain modifications or substitutions of nucleobases (often referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil. (U). The modified nucleotide comprises other synthetic and natural nucleotides, such as 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoglycan嘌呤; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil; 2-thiothymidine and 2- Thiocytosine; 5-halouracil and 5-halocytosine; 5-propynyl uracil and 5-propynyl cytosine; 6-azouracil, 6-azocytosine and 6-azo Thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and birds嘌呤; 5-halo (specifically 5-bromine), 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylquanine and 7-methyladenine; 8-Azaguanine and 8-azadenine; 7-deazaguanine and 7-deaza adenine, 3-deazaguanine and 3-deaza adenine. In addition, the nucleotides include the nucleotides disclosed in U.S. Patent No. 3,687,808, "The Concise Encyclopedia of Polymer Science And Engineering", pp. 858-859, Kroschwitz, JI, John Wiley & Sons, 1990, Englisch, et al. People, "Angewandle Chemie, International Edition", 1991, 30, p. 613, and Sanghvi, YS, Chapter 15, "Antisense Research and Applications", pp. 289-302, Crooke, ST and Lebleu, B. CRC Press, 1993. Certain of these nucleotides are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted indole, including 2-aminopropyl adenine, 5-propynyl uracil and 5-propynyl Pyrimidine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ° C (Sanghvi, YS, Crooke, ST and Lebleu, B. ed., "Antisense Research and Applications", CRC Press, Boca Raton, 1993 , pp. 276-278) and presently preferred base substitutions, even more particularly preferred when combined with 2'-O methoxyethyl sugar modifications. Representative US patents that teach the preparation of the above-described modified nucleotides and other modified nucleotides include, but are not limited to, U.S. Patent Nos. 3,687,808 and 4,845,205; 5,130,302; 5,134,066; 5,175,273 No. 5, 367, 266; 5, 432, 272; 5, 457, 187; 5, 459, 255; 5, 484, 908; 5, 502, 177; 5, 525, 711, 5, 552, 540; 5, 587, 469; 5, 596, 091; 5, 614, 617; 5, 750, 692; No. 5,681,941, each of which is incorporated herein by reference. Another modification of the oligonucleotides of the invention involves chemically linking one or more portions or conjugates of the enhanced oligonucleotide, cell distribution or cellular uptake to the oligonucleotide. Such moieties include, but are not limited to, lipid moieties (such as cholesterol moieties), cholic acid, thioethers (such as hexyl-S-trityl mercaptan), thiocholesterol, aliphatic chains (eg, dodecanediol) Or eleven base residues), phospholipids (eg, di-hexadecyl-racemic-glycerol or 1,2-di-O-hexadecyl-racemic-glyceryl-3-H-phosphonic acid triethyl) Alkyl ammonium), polyamine or polyethylene glycol chain, or adamantane acetic acid, palmityl moiety, or octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety. Representative US patents for the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538 [5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4, 605, 044; 4, 605, 735; 4, 667, 025; 4, 762, 779; 4, 789, 737; 4, 824, 941; 4, 835, 263; 4, 876, 335; 4, 904, 582; 4, 958, 013; 5, 082, 830; 5, 112, 963; 5, 214, 136 , 5, 082, 830; 5, 112, 963; 5, 214, 136; 5, 245, 022; 5, 254, 469; 5, 258, 506; 5, 262, 536; 5, 272, 250; 5, 292, 873; 5, 317, 098; 5, 371, 241; 5, 391, 723; 5, 416, 203; 5, 451, 463; 5, 510, 475; 5, 512, 667; 5, 514, 785; 5, 565, 552; 567,810; 5, 574, 142; 5, 585, 481; 5, 587, 371; 5, 595, 726; 5, 597, 696; 5, 599, 923; 5, 599, 928 and 5, 688, 941, each of which is incorporated herein by reference.Drug discovery: The compounds of the invention are also useful in the field of drug discovery and target validation. The present invention includes efforts to clarify the relationship between voltage-gated sodium channel alpha subunit (SCNA) polynucleotides and disease states, phenotypes or conditions using the compounds identified herein and preferred target segments. The drug. Such methods comprise detecting or modulating a SCNA polynucleotide comprising contacting a sample, tissue, cell or organism with a compound of the invention, and measuring the nucleic acid or protein content and/or correlation of the SCNA polynucleotide at a time after treatment. Phenotype or chemical endpoint, and compare measurements to untreated samples or samples treated with another compound of the invention, as appropriate. Such methods can also be performed in parallel or in combination with other assays to determine the function of an unknown gene for a target validation method or to determine the effectiveness of a particular gene product as a target for treating or preventing a particular disease, condition or phenotype.Assess gene expression up-regulation or inhibition: The transfer of an exogenous nucleic acid into a host cell or organism can be assessed by directly detecting the presence of the nucleic acid in the cell or organism. This detection can be achieved by several methods well known in the art. For example, the presence of an exogenous nucleic acid can be detected by Southern blot analysis or by polymerase chain reaction (PCR) techniques using primers that specifically amplify nucleic acid-related nucleotide sequences. The performance of exogenous nucleic acids can also be measured using conventional methods including gene expression analysis. For example, mRNA produced by exogenous nucleic acids can be detected and quantified using Northern blot analysis and reverse transcription PCR (RT-PCR). The RNA expressed by the exogenous nucleic acid can also be detected by measuring the activity of the enzyme or reporting the activity of the protein. For example, antisense modulating activity can be indirectly measured as a decrease or increase in the performance of a target nucleic acid, which indicates that the exogenous nucleic acid is producing an effector RNA. Based on sequence conservation, primers can be designed and used to amplify coding regions of a target gene. Initially, the most highly expressed coding region for each gene can be used to construct a model control gene, but any coding or non-coding region can be used. Each control gene is assembled by inserting each coding region between the reporter region and its poly (A) signal. These plastids will produce mRNA with a reporter gene in the upstream portion of the gene and a potential RNAi target in the 3' non-coding region. The utility of individual antisense oligonucleotides will be assayed by modulation of the reporter gene. Reporter genes suitable for use in the methods of the invention include acetamyl hydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), and chloramphenicol Chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), horseradish Horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS) and its derivatives. A variety of anesthetic (ampicillin), bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin Selectable markers for resistance to methotrexate, phosphinothricin, puromycin, and tetracycline are available. Methods for determining modulation of a reporter gene are well known in the art and include, but are not limited to, fluorescence assays (e.g., fluorescence spectrometry, fluorescence activated cell sorting (FACS), fluorescent microscopy). (Technology), antibiotic resistance is determined. Target nucleic acid segments can also be detected in cell-based assays. Experiments were performed to detect Scn1a natural antisense BG724147 in HepG2, primary human fibroblasts with Dravet syndrome-related mutations, and human testis. For HepG2 and primary human fibroblasts with Dravid syndrome-associated mutations, cells are grown and RNA is extracted. For human testicles, RNA is isolated and purchased using polyA. This experiment was called RACE (rapid amplification of the cDNA ends) and specific primers for the BG724147 RNA transcript were used. A very similar PCR product was detected in RNA isolated from polyA isolated from HepG2 and polyA isolated from primary human fibroblasts with Dravid syndrome-related mutations but this product was not isolated from polyA from human testis Detected in RNA. Furthermore, the PCR product was not detected (or at a very low level) in total RNA from HepG2 cells and total RNA from primary human fibroblasts with Dravid syndrome-associated mutations. The results indicate that the natural antisense of Scn1a, designated BG724147, is present in HepG2 cells and primary human fibroblasts with mutations associated with Dravid syndrome but not in human testis. SCNA protein and mRNA expression can be assayed using methods known to those skilled in the art and described elsewhere herein. For example, an immunoassay such as ELISA can be used to measure protein content. The SCNA ELISA assay kit is commercially available, for example, from R&D Systems (Minneapolis, MN). In an embodiment, SCNA expression (eg, mRNA or protein) in a sample (eg, an in vivo or ex vivo cell or tissue) treated with an antisense oligonucleotide of the invention is performed by SCNA expression in a control sample. Compare to evaluate. For example, the performance of a protein or nucleic acid can be compared to the performance of a protein or nucleic acid in a simulated or untreated sample using methods known to those skilled in the art. Alternatively, it may be compared to a sample treated with a control antisense oligonucleotide (eg, an antisense oligonucleotide having altered or different sequences) depending on the desired information. In another embodiment, the difference in performance of the SCNA protein or nucleic acid in the treated sample relative to the untreated sample may be relative to the untreated sample, different nucleic acids in the treated sample (including any deemed appropriate by the researcher) Differences in performance of standards, such as housekeeping genes, were compared. The observed differences can be expressed as needed, for example in the form of ratios or fractions, for comparison with controls. In an embodiment, the amount of SCNA mRNA or protein in the sample treated with the antisense oligonucleotide of the invention is increased or decreased from about 1.25 fold to about 10 fold or 10 relative to the untreated sample or the control nucleic acid treated sample. More than double. In embodiments, the amount of SCNA mRNA or protein is increased or decreased by at least about 1.25 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 1.6 fold, at least about 1.7 fold, at least about 1.8 fold, at least About 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 4.5 times, at least about 5 times, at least about 5.5 times, at least about 6 times, at least about 6.5 times, at least About 7 times, at least about 7.5 times, at least about 8 times, at least about 8.5 times, at least about 9 times, at least about 9.5 times, or at least about 10 times or more.Kits, research reagents, diagnostics, and therapeutics The compounds of the invention are useful in the diagnosis, treatment, and prevention, and can be used as components of research reagents and kits. Furthermore, antisense oligonucleotides capable of inhibiting gene expression with strong specificity are often used by the general practitioner to elucidate the function of a particular gene or to distinguish the function of each member of the biological pathway. For use in kits and diagnostics and various biological systems, the compounds of the invention, alone or in combination with other compounds or therapeutic agents, are useful as tools in differential analysis and/or combinatorial analysis to elucidate expression in cells and tissues. The expression pattern of one part of the gene or the entire complementary sequence. As used herein, the term "biological system" or "system" is defined to mean any organism, cell, cell culture or tissue that exhibits or enables the ability to express a voltage-gated sodium ion channel alpha subunit (SCNA) gene product. These include, but are not limited to, humans, transgenic animals, cells, cell cultures, tissues, xenografts, grafts, and combinations thereof. As a non-limiting example, a pattern of expression in a cell or tissue treated with one or more antisense compounds is compared to a control cell or tissue that has not been treated with an antisense compound and the resulting pattern is analyzed to obtain a difference in gene expression, Because it relates to, for example, the disease correlation, signal transduction pathway, cellular localization, amount of expression, size, structure or function of the gene being examined. Such analysis can be performed on stimulated or unstimulated cells in the presence or absence of other compounds that affect the performance profile. Examples of gene expression analysis methods known in the art include DNA arrays or microarrays, serial analysis of gene expression (SAGE), and restriction enzyme amplification of digested cDNAs (restriction enzyme amplification of digested cDNAs). ;READS), total gene expression analysis (TOGA), protein array and proteomic research, expressed sequence tag (EST) sequencing, subtractive RNA fingerprinting (SuRF), Differential display, differential display (DD), comparative genomic hybridization, fluorescence in situ hybridization (FISH) and mass spectrometry. The compounds of the invention are useful in research and diagnostics because such compounds hybridize to nucleic acids encoding voltage-gated sodium ion channel alpha subunits (SCNA). For example, oligonucleotides that hybridize as effective SCNA modulators under such conditions as disclosed herein are effective primers or probes, respectively, under conditions conducive to gene amplification or detection. Such primers and probes are useful in methods that require specific detection of nucleic acid molecules encoding SCNA and in other studies for amplifying such nucleic acid molecules to detect SCNA or for SCNA. Hybridization of an antisense oligonucleotide of the invention, in particular a primer and probe, to a nucleic acid encoding SCNA can be detected by means known in the art. Such means may include binding the enzyme to the oligonucleotide, radiolabeling the oligonucleotide or any other suitable means of detection. Kits using such detection means for detecting the amount of SCNA in a sample can also be prepared. The specificity and sensitivity of antisense are also utilized by those skilled in the art to achieve therapeutic use. Antisense compounds have been used as therapeutic moieties in the treatment of disease states including animals in humans. Antisense oligonucleotide drugs have been safely and effectively administered to humans and numerous clinical trials are currently underway. It is thus determined that the antisense compound can be a suitable therapeutic modality that can be configured to be useful in the treatment of cells, tissues, and animals, particularly humans. For treatment, an animal suspected of having a disease or condition treatable by modulating the performance of a SCNA polynucleotide is preferred for administration by administering an antisense compound of the invention. For example, in one non-limiting embodiment, the method comprises the step of administering to a subject in need of treatment a therapeutically effective amount of a SCNA modulator. The SCNA modulators of the invention are effective in modulating the activity of SCNA or modulating the performance of SCNA proteins. In one embodiment, the activity or performance of SCNA in an animal is inhibited by about 10% compared to a control. Preferably, the activity or performance of SCNA in an animal is inhibited by about 30%. More preferably, SCNA inhibits activity or performance in animals by 50% or more. Thus, the oligomeric compound modulates the performance of the voltage-gated sodium ion channel alpha subunit (SCNA) mRNA by at least 10%, at least 50%, at least 25%, at least 30%, at least 40%, at least 50%, compared to the control, At least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100%. In one embodiment, the activity or performance of a voltage-gated sodium ion channel alpha subunit (SCNA) in an animal is increased by about 10% compared to a control. Preferably, the activity or performance of SCNA in an animal is increased by about 30%. More preferably, the activity or performance of SCNA in animals is increased by 50% or more. Thus, the oligomeric compound modulates the performance of SCNA mRNA by at least 10%, at least 50%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75% compared to the control. At least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100%. For example, a decrease in the performance of a voltage-gated sodium ion channel alpha subunit (SCNA) in serum, blood, adipose tissue, liver, or any other body fluid, tissue, or organ of an animal can be measured. Preferably, the cells contained in the fluid, tissue or organ analyzed comprise a nucleic acid molecule encoding the SCNA peptide and/or the SCNA protein itself. The compounds of the present invention can be utilized in pharmaceutical compositions by the addition of an effective amount of the compound to a pharmaceutically acceptable diluent or carrier. The use of the compounds and methods of the invention may also be applied prophylactically.Conjugate Another modification of the oligonucleotides of the invention involves chemically linking one or more portions or conjugates of the enhanced oligonucleotide, cell distribution or cellular uptake to the oligonucleotide. Such moieties or combinations may include a binding group covalently bonded to a functional group such as a primary or secondary hydroxyl group. The binding groups of the present invention include intercalating agents, reporter molecules, polyamines, polyamines, polyethylene glycols, polyethers, groups which enhance the pharmacodynamic properties of oligomers and enhance the pharmacokinetic properties of oligomers. The group. Typical binding groups include cholesterol, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, luciferin, rhodamine, coumarin, and dyes. In the context of the present invention, groups that enhance pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or enhance sequence-specific hybridization to a target nucleic acid. In the context of the present invention, groups which enhance the pharmacokinetic properties include groups which improve the uptake, distribution, metabolism or excretion of the compounds of the invention. A representative binding group is disclosed in International Patent Application No. PCT/US92/09196, filed on Oct. 23, 1992, and U.S. Pat. Binding moieties include, but are not limited to, lipid moieties (such as cholesterol moieties), cholic acid, thioethers (such as hexyl-5-trityl mercaptan), thiocholesterol, aliphatic chains (such as dodecanediol or Eleven base residues), phospholipids (eg, di-hexadecyl-racemic-glycerol or 1,2-di-O-hexadecyl-racemic-glyceryl-3-Hphosphonic acid triethylammonium) a polyamine or polyethylene glycol chain, or adamantane acetic acid, a palmitoyl moiety, or an octadecylamine or hexylamino-carbonyl-hydroxycholesterol moiety. The oligonucleotide of the present invention may also be combined with an active drug substance such as aspirin, warfarin, phenylbutazone, ibuprofen, Suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl sarcosine ( Dansylsarcosine), 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine (diazepine), indomethicin, barbiturate, cephalosporin, sulfa drugs, antidiabetic agents, antibacterial agents or antibiotics. Representative US patents for the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538 [5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4, 605, 044; 4, 605, 735; 4, 667, 025; 4, 762, 779; 4, 789, 737; 4, 824, 941; 4, 835, 263; 4, 876, 335; 4, 904, 582; 4, 958, 013; 5, 082, 830; 5, 112, 963; 5, 214, 136 , No. 5, 082, 830; 5, 317, 098; 5, 371, 241; 5, 391, 723; 5, 416, 203; 5, 451, 463; 5, 510, 475; Nos. 5, 514, 785; 5, 565, 552; 5, 574, 142; 5, 585, 481; 5, 587, 371;Formulation The compounds of the invention may also be incorporated, encapsulated, with other molecules, molecular structures or mixtures of compounds, such as liposomes, receptor targeting molecules, oral formulations, rectal formulations, topical formulations or other formulations. Binding or otherwise association to aid ingestion, distribution, and/or absorption. Representative US patents for the preparation of such formulations which facilitate ingestion, distribution and/or absorption include, but are not limited to, U.S. Patent Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; No. 5, 543, pp; Nos. 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each patent The manner of reference is incorporated herein. Although antisense oligonucleotides need not be administered in the context of a vector to modulate target expression and/or function, embodiments of the invention pertain to expression vector constructs for use in expressing antisense oligonucleotides, including The promoter, hybridization initiation gene sequence and has strong constitutive promoter activity or promoter activity that can be induced if desired. In one embodiment, the practice of the invention involves administering at least one of the foregoing antisense oligonucleotides in a suitable nucleic acid delivery system. In one embodiment, the system includes a non-viral vector operably linked to a polynucleotide. Examples of such non-viral vectors include oligonucleotides alone (e.g., any one or more of SEQ ID NOS: 29-94) or oligonucleotides in combination with suitable protein, polysaccharide or lipid formulations. Further suitable nucleic acid delivery systems include viral vectors, the sequences of which are typically derived from adenovirus, adeno-associated virus (AAV), helper virus-dependent adenovirus, retrovirus or hemagglutinatin virus of Japan-liposome (hemagglutinatin virus of Japan-liposome, At least one of the HVJ) complexes. Preferably, the viral vector comprises a strong eukaryotic promoter, such as a cytomegalovirus (CMV) promoter operably linked to a polynucleotide. Further preferred vectors include viral vectors, fusion proteins, and chemical conjugates. Retroviral vectors include Moloney murine leukemia viruses and HIV-based viruses. A preferred HIV-based viral vector comprises at least two vectors, wherein the gag and pol genes are derived from the HIV genome and the env gene is derived from another virus. A DNA viral vector is preferred. Such vectors include vaccinia vectors, such as acne or avian pox vectors; herpesvirus vectors, such as herpes simplex I virus (HSV) vectors; adenoviral vectors and adeno-associated viral vectors. The antisense compound of the present invention encompasses any pharmaceutically acceptable salt, ester or salt of such an ester, or is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof when administered to an animal including humans. Any other compound. The term "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound of the invention: that is, a salt which retains the desired biological activity of the parent compound and which does not impart an undesirable toxicological effect. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their use are further described in U.S. Patent No. 6,287,860, incorporated herein by reference. The invention also includes pharmaceutical compositions and formulations comprising the antisense compounds of the invention. The pharmaceutical compositions of the present invention can be administered in a number of ways, depending on the local or systemic treatment desired and the area to be treated. Administration may be topical (including ophthalmic and mucosal administration, including vaginal and rectal delivery); pulmonary administration (eg, by inhalation or insufflation of a powder or aerosol, including the use of a nebulizer; intratracheal administration; intranasal administration; Transdermal administration and transdermal administration); oral administration or parenteral administration. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, such as intrathecal or intraventricular administration. For the treatment of tissues in the central nervous system, administration can be carried out by, for example, injection or infusion into the cerebrospinal fluid. The administration of antisense RNA to the cerebrospinal fluid is described, for example, in U.S. Patent Application Publication No. 2007/0117772, the entire disclosure of which is incorporated herein by reference. When the antisense oligonucleotide of the present invention is intended to be administered to cells in the central nervous system, it can be administered with one or more agents capable of promoting the penetration of the target antisense oligonucleotide across the blood-brain barrier. Injection can be performed, for example, in an entorhinal cortex or hippocampus. The delivery of a neurotrophic factor by administering an adenoviral vector to a motor neuron in muscle tissue is described in, for example, U.S. Patent No. 6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons", which is incorporated by reference. Incorporated herein. Direct delivery to the brain, such as the striatum, thalamus, hippocampus or substantia nigra, is known in the art and is described, for example, in U.S. Patent No. 6,756,523, "Adenovirus vectors For the transfer of foreign genes into cells of the central nervous system particularly in brain, the patent is incorporated herein by reference. When administered by injection, the administration can be rapid, or when the formulation is slowly infused or administered by slow infusion, the administration can take a period of time. The subject antisense oligonucleotide can also be linked or associated with an agent that will provide the desired pharmaceutical or pharmacodynamic properties. For example, an antisense oligonucleotide can be coupled to any substance known in the art to facilitate penetration or transport across the blood-brain barrier, such as an antibody to a transferrin receptor, and by intravenous The injection is administered. An antisense compound can be linked to, for example, a viral vector that renders the antisense compound more effective and/or increases the transport of the antisense compound across the blood-brain barrier. Infiltration of blood-brain barriers can also be accomplished by, for example, infusion of sugars including, but not limited to, meso erythritol, xylitol, D(+) galactose, D(+) lactose. , D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose ( D(+) arabinose), D(-)arabinose, cellobiose, D(+) maltose, D(+) raffinose (D(+) raffinose), L(+) rhamnose (L(+) ) rhamnose), D(+) melibiose (D(+) melibiose), D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+ ) trehalose (D(+) fucose), L(-) trehalose, D(-) to threose (D(-) lyxose), L(+) to threose and L(-) to threose; or Amino acids including, but not limited to, glutamic acid, lysine, arginine, aspartame, aspartic acid, cysteine, glutamic acid, glycine, histidine, It is achieved by leucine, methionine, phenylalanine, valine, serine, threonine, tyrosine, proline and taurine. Methods and materials for enhancing blood-brain barrier penetration are described in, for example, U.S. Patent No. 4,866,042, "Method for the delivery of genetic material across the blood brain barrier", No. 6,294,520, "Material for passage through the blood-brain barrier", And U.S. Patent No. 6,936, 589, the entire disclosure of each of which is incorporated herein by reference. The subject antisense compound can be incorporated, encapsulated, with other molecules, molecular structures or mixtures of compounds, such as liposomes, receptor targeting molecules, oral formulations, rectal formulations, topical formulations or other formulations. Binding or otherwise association to aid ingestion, distribution, and/or absorption. For example, cationic lipids can be included in the formulation to facilitate oligonucleotide uptake. One such composition which is shown to promote uptake is LIPOFECTIN (available from GIBCO-BRL, Bethesda, MD). Oligonucleotides having at least one 2'-O-methoxyethyl modification are particularly suitable for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous bases, powder bases or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be suitable. The pharmaceutical formulations of the present invention, which are preferably provided in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing the active ingredient into association with a pharmaceutical carrier or excipient. In general, formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and, if necessary, shaping the product. The compositions of the present invention may be formulated into any of a wide variety of possible dosage forms such as, but not limited to, lozenges, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. The aqueous suspensions may additionally contain materials which increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. Pharmaceutical compositions of the invention include, but are not limited to, solutions, emulsions, foams, and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients. The emulsion is typically a heterogeneous system in the form of droplets of a liquid diameter typically exceeding 0.1 μm dispersed in another liquid. The emulsion may contain other components in addition to the dispersed phase and the solution which may be present in the aqueous phase, the oil phase, or the active drug itself present in the separate phase. Microemulsions are included as an embodiment of the invention. Emulsions and their use are well known in the art and are further described in U.S. Patent No. 6,287,860. Formulations of the invention include liposome formulations. As used in the present invention, the term "liposome" means a vesicle composed of two pherophilic lipids arranged in a spherical bilayer. Liposomes are single or multi-layered vesicles having a film formed from a lipophilic material and an aqueous interior containing the composition to be delivered. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form stable complexes. Salt-sensitive or negatively charged liposomes enticle DNA rather than complex with it. Both cationic liposomes and non-cationic liposomes have been used to deliver DNA to cells. Liposomes also include "sterically stabilized" liposomes, as the term is used herein to refer to liposomes comprising one or more specialized lipids. When incorporated into liposomes, such specialized lipids produce liposomes with increased cycle life relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are liposomes: a portion of the liposome-forming lipid portion of the liposome comprising one or more glycolipids or partially derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) . Liposomes and their use are further described in U.S. Patent No. 6,287,860. The pharmaceutical formulations and compositions of the present invention may also include a surfactant. The use of surfactants in pharmaceuticals, formulations and emulsions is well known in the art. Surfactants and their use are further described in U.S. Patent No. 6,287,860, incorporated herein by reference. In one embodiment, the invention employs various permeation enhancers to efficiently deliver nucleic acids, in particular oligonucleotides. In addition to helping non-lipophilic drugs to diffuse across the cell membrane, the penetration enhancer also enhances the permeability of the lipophilic drug. Penetration enhancers can be classified into one of five categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Permeation enhancers and their use are further described in U.S. Patent No. 6,287,860, the disclosure of which is incorporated herein by reference. Those skilled in the art will recognize that the formulation is designed in a conventional manner in accordance with its intended use, i.e., the route of administration. Preferred formulations for topical administration include formulations in which the oligonucleotides of the invention are admixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Preferred lipids and liposomes include neutral (eg, dioleoyl-phospholipid oxime ethanolamine DOPE, dimyristoyl phosphatidylcholine DMPC, distearyl phosphatidylcholine), negatively charged (e.g., dimyristylphospholipid glycerol DMPG) and cationic (e.g., dinonyltetramethylammonium propyl DOTAP and dioleyl-phosphothioguanylethanolamine DOTMA). For topical or other administration, the oligonucleotides of the invention may be encapsulated within a liposome or may form a complex with a liposome, in particular with a cationic liposome. Alternatively, the oligonucleotide may be complexed with a lipid, in particular with a cationic lipid. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their use are further described in U.S. Patent No. 6,287,860. Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous medium, capsules, gel capsules, sachets, lozenges Or a small lozenge. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are formulations of the oligonucleotides of the invention administered with one or more penetration enhancers, surfactants, and chelating agents. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their use are further described in U.S. Patent No. 6,287,860, incorporated herein by reference. Combinations of penetration enhancers, such as fatty acid/salts and bile acids/salts, are also preferred. A particularly preferred combination is the sodium salt of lauric acid, citric acid and UDCA. Other penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-hexadecyl ether. The oligonucleotides of the invention may be delivered orally in particulate form (including spray dried particles) or by complex formation of microparticles or nanoparticles. Oligonucleotide complexes and their use are further described in U.S. Patent No. 6,287,860, incorporated herein by reference. Compositions and formulations for parenteral, intrathecal or intrapharmaceutical administration may also include buffers, diluents, and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds, and other pharmaceutically acceptable agents. A sterile aqueous solution of the carrier or excipient is accepted. Certain embodiments of the invention provide pharmaceutical compositions comprising one or more oligomeric compounds and one or more other chemotherapeutic agents that act by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, cranberry (doxorubicin), Epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, arsenic Cytosine arabinoside, bischloroethyl-nitrosurea, busulfan sulfate, mitomycin C, actinomycin D, light god Mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethyl Hexamethylmelamine, pentamethyl melamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexyl nitrosourea, nitrogen mustard, beauty Melphalan, cyclophosphamide, 6-mercaptopurine, 6-thio bird呤, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxyguanamine, 5-fluorouracil (5-FU), 5- Fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-) 16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES) . When used with a compound of the invention, such chemotherapeutic agents can be used individually (eg, 5-FU and oligonucleotides), sequentially (eg, 5-FU and oligonucleotides for a period of time, followed by MTX and oligos) Nucleotides) or in combination with one or more other such chemotherapeutic agents (eg, 5-FU, MTX and oligonucleotides, or 5-FU, radiation therapy, and oligonucleotides). Anti-inflammatory drugs may also be combined in the compositions of the present invention, including but not limited to non-steroidal anti-inflammatory drugs and corticosteroids; and antiviral drugs including, but not limited to, ribivirin, vidarabine, Acyclovir and ganciclovir. Combinations of antisense compounds with other non-antisense drugs are also within the scope of the invention. Compounds of two or more combinations may be used together or sequentially. In another related embodiment, the compositions of the invention may contain one or more antisense compounds that target the first nucleic acid, in particular, oligonucleotides; and one or more other antisense compounds that target the second nucleic acid target . For example, the first target can be a specific antisense sequence of a voltage-gated sodium ion channel alpha subunit (SCNA), and the second target can be a region from another nucleotide sequence. Alternatively, the compositions of the invention may contain two or more antisense compounds that target different regions of the same voltage-gated sodium ion channel alpha subunit (SCNA) nucleic acid target. Numerous examples of antisense compounds are described herein and other examples can be selected from suitable compounds known in the art. Compounds of two or more combinations may be used together or sequentially.Dosing: The formulation of the Xianxin therapeutic composition and its subsequent administration (administration) are within the skill of the relevant personnel in the art. Administration depends on the severity and responsiveness of the condition being treated, wherein the course of treatment lasts from several days to several months, or until the condition is cured or attenuated. The optimal dosing schedule can be calculated from the cumulative measurement of the drug in the patient. The average dosage, method of administration, and repetition rate can be readily determined by one of ordinary skill. The optimal dose will vary depending on the relative potency of the individual oligonucleotides and can generally be estimated based on the EC50 considered to be effective in both in vitro and in vivo animal models. Generally, the dosage is from 0.01 μg to 100 mg per kilogram of body weight and may be administered once or more daily, weekly, monthly or yearly, or even every 2 to 20 years. One of ordinary skill can readily estimate the repetition rate for administration based on measuring the residence time and concentration of the drug in body fluids or tissues. After successful treatment, it may be necessary to subject the patient to maintenance therapy to prevent recurrence of the disease state, with a maintenance dose ranging from 0.01 μg to 100 mg per kilogram of body weight, once or more once a day to once every 20 years. Nucleotide. In an embodiment, the patient is treated with a dose of at least about 1 mg, at least about 2 mg, at least about 3 mg, at least about 4 mg, at least about 5 mg, at least about 6 mg, at least about 7 mg per kilogram of body weight, At least about 8 mg, at least about 9 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, At least about 50 mg, at least about 60 mg, at least about 70 mg, at least about 80 mg, at least about 90 mg, or at least about 100 mg. Some of the injectable doses of the antisense oligonucleotides are described, for example, in U.S. Patent No. 7,563,884, the disclosure of which is incorporated herein by reference. While the various embodiments of the invention have been described, Numerous variations of the disclosed embodiments can be made without departing from the spirit and scope of the invention. Therefore, the breadth and scope of the invention should not be limited by any of the embodiments described above. All documents mentioned herein are hereby incorporated by reference. All publications and patent documents cited in this application are hereby incorporated by reference in their entirety in their entirety in the extent of the disclosures in To the extent that the various references are cited in this document, the Applicant does not recognize that any particular reference is the "pre-technical" of the invention. Examples of the compositions and methods of the present invention are illustrated in the following examples.Instance The following non-limiting examples are illustrative of selected embodiments of the invention. It is to be understood that the changes in the proportions and the alternatives to the elements of the invention are obvious to those skilled in the art and are within the scope of the embodiments of the invention.Instance 1 : Designed for voltage-gated sodium ion channels α Subunit (SCNA) Antisense nucleic acid molecule and / or SCNA The sense strand of the polynucleotide has a specific antisense oligonucleotide As indicated above, the term "oligonucleotide specific for" or "oligonucleotide targeting" refers to having (i) capable of forming a stable complex with a portion of the targeted gene, or (ii) capable of An oligonucleotide that forms a stable duplex sequence with a portion of the mRNA transcript of the targeted gene. Promote the selection of appropriate oligonucleotides by using a computer program (eg IDT AntiSense Design, IDT OligoAnalyzer) that automatically identifies the desired sequence with the desired melting temperature (usually 50-60 ° C) and the target nucleus The nucleotide sequence forms a hybrid and will not form a 19-25 nucleotide subsequence of the self-dimer or other complex secondary structure. The selection of appropriate oligonucleotides is further facilitated by the use of computer programs that automatically align nucleic acid sequences and indicate regions of homology or homology. Such programs are used to compare the resulting nucleic acid sequences, for example, by searching a library such as GenBank or by sequencing the PCR products. Comparing nucleic acid sequences from a range of genes and intergenic regions of a given genome allows selection of nucleic acid sequences that exhibit an appropriate degree of specificity for the relevant genes. Such procedures allow for the selection of oligonucleotides that exhibit a high degree of complementarity to a target nucleic acid sequence and a lower degree of complementarity to other nucleic acid sequences in a given genome. Those skilled in the art will recognize that there is a great deal of freedom in selecting the appropriate region for the genes used in the present invention. When the antisense compound binds to the target nucleic acid, it interferes with the normal function of the target nucleic acid to regulate the function and/or activity, and there is a sufficient degree of complementarity to avoid the specific binding of the antisense compound to the non-target nucleic acid sequence. The antisense compound is administered under conditions (ie, in the case of in vivo assay or therapeutic treatment, under physiological conditions, and in the case of in vitro assays, under conditions of assay), the antisense compound is "Specially hybridizable." The hybridization properties of the oligonucleotides described herein can be determined by one or more in vitro assays known in the art. For example, the properties of the oligonucleotides described herein can be obtained by measuring the binding strength between a target natural antisense and a potential drug molecule using a melting curve assay. The strength of binding between the target natural antisense and the potential drug molecule (molecule) can be estimated using any established method of measuring the strength of the intermolecular interaction, such as a melting curve assay. The melting curve assay determines the temperature at which a natural antisense/molecular complex rapidly transitions from a double-strand configuration to a single-strand configuration. This temperature is widely accepted as a reliable measure of the strength of the interaction between two molecules. The melting curve assay can be performed using a cDNA copy of the actual native antisense RNA molecule or a synthetic DNA or RNA nucleotide corresponding to the binding site of the molecule. Multiple kits are available that contain all the reagents necessary to perform this assay (eg, Applied Biosystems Inc. MeltDoctor kit). Such kits include suitable buffer solutions containing a double-stranded DNA (dsDNA) binding dye such as ABI HRM dye, SYBR Green, SYTO, and the like. The nature of the dsDNA dye is that it emits almost no fluorescence in free form, but is highly fluorescent when bound to dsDNA. For the assay, the cDNA or corresponding oligonucleotide is mixed with the molecule at a concentration determined by a particular manufacturer's protocol. The mixture was heated to 95 ° C to dissociate all preformed dsDNA complexes, then slowly cooled to room temperature or other lower temperatures as determined by the kit manufacturer to allow DNA molecules to adhere. The newly formed composite was then slowly heated to 95 ° C while continuously collecting data on the amount of fluorescence generated by the reaction. The intensity of the fluorescence is inversely proportional to the amount of dsDNA present in the reaction. Data can be collected using a real-time PCR instrument compatible with the kit (eg, ABI's StepOne Plus Instant PCR System or lightTyper instrument, Roche Diagnostics, Lewes, UK). Construct by using a suitable software (such as lightTyper (Roche) or SDS Dissociation Curve, ABI) to plot the negative derivative of fluorescence relative to temperature (on the y-axis (descent) / dT) relative to temperature (x-axis) Melting peak. The data was analyzed to identify the temperature at which the dsDNA complex rapidly transitions to a single molecule. This temperature is called Tm and is proportional to the strength of the interaction between the two molecules. Typically, the Tm will exceed 40 °C.Instance 2 : adjustment SCNA Polynucleotide Treatment with antisense oligonucleotides HepG2 cell At 37 ° C and 5% CO₂ Next, make HepG2 cells from ATCC (catalog number HB-8065) in growth medium (MEM/EBSS (Hyclone catalog number SH30024, or Mediatech catalog number MT-10-010-CV) + 10% FBS (Mediatech catalog number MT35- 011-CV) + penicillin/streptomycin (Mediatech catalog number MT30-002-CI)) was grown. One day before the experiment, the cells were 1.5×10⁵ The density of /ml was re-inoculated in a 6-well plate at 37 ° C and 5% CO₂ Under cultivation. On the day of the experiment, the medium in the 6-well plate was changed to fresh growth medium. All antisense oligonucleotides were diluted to a concentration of 20 μM. 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and HepG2 cells were applied to each well of a 6-well plate. . A similar mixture comprising 2 μl of water instead of oligonucleotide solution was used to simulate the transfection control. At 37 ° C and 5% CO₂ After 3-18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and the Promega SV Total RNA Isolation System (Cat. No. Z3105) or the RNeasy Total RNA Isolation Kit from Qiagen (Cat. No. 74181) was followed from the cells according to the manufacturer's instructions. Extract RNA. 600 ng of RNA was added to the reverse transcription reaction using the Thermo Scientific cDNA kit (Cat. No. AB1453B) or the high capacity cDNA reverse transcription kit (Cat. No. 4368813) as described in the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by using ABI Taqman Gene Expression Mixture (Cat. No. 4369510) and primers/probes designed by ABI for real-time PCR (according to Applied Biosystems Inc., Foster City CA Applied) Biosystems Taqman Gene Performance Assay: Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCNA). The following PCR cycles were used: 50 °C for 2 minutes; 95 °C for 10 minutes; 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using a StepOne Plus real-time PCR machine (Applied Biosystems). The fold change in gene expression after treatment with the antisense oligonucleotide was calculated based on the difference in the 18S corrected dCt value between the treated sample and the mock transfected sample.result: The real-time PCR results showed that the content of SCN1A mRNA in HepG2 cells was significantly increased 48 hours after treatment with SCN1A antisense BG724147 antisense oligonucleotide (Fig. 1, 4). Other oligonucleotides designed for SCN1A antisense BG724147 and Hs.662210 did not increase SCN1A content (Figures 2, 3).Instance 3 : by targeting SCNA Antisense oligonucleotide treatment of specific natural antisense transcripts to upregulate different cell lines SCNA mRNA In Example 3, antisense oligonucleotides of different chemical compositions targeting SCN1A-specific natural antisense transcripts were screened at a final concentration of 20 nM in a panel of various cell lines. The cell lines used are derived from different organs and different animal species. The following data demonstrate that up-regulation of SCN1A mRNA/protein via a function of modulating the SCN1A-specific natural antisense transcript is not limited to a single oligonucleotide, tissue or species and thus represents a general phenomenon.Materials and methods Primary human fibroblasts with mutations associated with Dravid syndrome. At 37 ° C and 5% CO₂ Next, primary human skin fibroblasts with Dravid syndrome-associated mutation E1099X introduced into culture by Dr. N. Kenyon (University of Miami) were obtained from MEM (Gibco, catalog number: 12561-056) + 10 % FBS (Mediatech, catalog number: 35-015 CV) was grown in growth medium consisting of +1% antifungal antibiotic (Gibco, catalog number: 15240-062). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in growth medium at approximately 2 x 10 days prior to the experiment.⁵ /The density of the wells was re-inoculated in a 6-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 6-well plate was changed to fresh growth medium (1.5 ml/well) and the cells were administered with antisense oligonucleotides. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of all oligonucleotides are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. For administration to 1 well, 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and One well of the 6-well plate of the cells was applied dropwise. A similar mixture comprising 2 μl of water instead of oligonucleotide solution was used to simulate the transfection control. In addition, the inactive oligonucleotide CUR-1462 at the same concentration was used as a control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and RNA was extracted from the cells using Promega's SV Total RNA Isolation System (catalog number Z3105) following the manufacturer's instructions. 600 ng of purified total RNA was added to the reverse transcription reaction using Invitrogen's SuperScript VILO cDNA Synthesis Kit (catalog number 11754-250) as described in the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by using ABI Taqman gene expression mixture (catalog number 4369510) and primers/probes designed by ABI for real-time PCR (for Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCN1A) . The results obtained using all 3 tests are very similar. The following PCR cycles were used: 50 °C for 2 minutes; 95 °C for 10 minutes; 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using the StepOne Plus Real-Time PCR System (Applied Biosystems). The 18S test is manufactured by ABI (catalog number 4319413E). The fold change in gene expression after treatment with the antisense oligonucleotide was calculated based on the difference in the 18S corrected dCt value between the treated sample and the mock transfected sample. For the alternative same day method, all procedures were performed similarly, but cells were dosed with antisense oligonucleotides on the first day after they were dispensed into 6-well plates.SK-N-AS Cell line . At 37 ° C and 5% CO₂ Next, make SK-N-AS human neuroblastoma cells from ATCC (Catalog No. CRL-2137) in growth medium (DMEM (Mediatech catalog number 10-013-CV) + 10% FBS (Mediatech catalog number MT35-011) -CV) + Penicillin/Streptomycin (Mediatech Cat. No. MT30-002-CI) + Non-essential Amino Acid (NEAA) (HyClone SH30238.01)). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in growth medium at approximately 3 x 10 days prior to the experiment.⁵ /The density of the wells was re-inoculated in a 6-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 6-well plate was changed to fresh growth medium (1.5 ml/well) and the cells were administered with antisense oligonucleotides. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of all oligonucleotides are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. For administration to 1 well, 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and One well of the 6-well plate of the cells was applied dropwise. A similar mixture comprising 2 μl of water instead of oligonucleotide solution was used to simulate the transfection control. In addition, the inactive oligonucleotide CUR-1462 at the same concentration was used as a control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and RNA was extracted from the cells using Promega's SV Total RNA Isolation System (catalog number Z3105) following the manufacturer's instructions. 600 ng of purified total RNA was added to the reverse transcription reaction using Invitrogen's SuperScript VILO cDNA Synthesis Kit (catalog number 11754-250) as described in the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by using ABI Taqman gene expression mixture (catalog number 4369510) and primers/probes designed by ABI for real-time PCR (for Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCN1A) . The results obtained using all 3 tests are very similar. The following PCR cycles were used: 50 °C for 2 minutes; 95 °C for 10 minutes; 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using the StepOne Plus Real-Time PCR System (Applied Biosystems). The 18S test is manufactured by ABI (catalog number 4319413E). The fold change in gene expression after treatment with the antisense oligonucleotide was calculated based on the difference in the 18S corrected dCt value between the treated sample and the mock transfected sample. For the alternative same day method, all procedures were performed similarly, but cells were dosed with antisense oligonucleotides on the first day after they were dispensed into 6-well plates.CHP-212 Cell line. At 37 ° C and 5% CO₂ Next, make CHP-212 human neuroblastoma cells from ATCC (Catalog No. CRL-2273) in growth medium (1: MEM and F12 (ATCC catalog number 30-2003 and Mediatech catalog number 10-080-CV, respectively) The mixture was grown in +10% FBS (Mediatech catalog number MT35-011-CV) + penicillin/streptomycin (Mediatech catalog number MT30-002-CI)). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in growth medium at approximately 2 x 10 days prior to the experiment.⁵ /The density of the wells was re-inoculated in a 6-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 6-well plate was changed to fresh growth medium (1.5 ml/well) and the cells were administered with antisense oligonucleotides. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of all oligonucleotides are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. For administration to 1 well, 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and One well of the 6-well plate of the cells was applied dropwise. A similar mixture comprising 2 μl of water instead of oligonucleotide solution was used to simulate the transfection control. In addition, the inactive oligonucleotide CUR-1462 at the same concentration was used as a control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and RNA was extracted from the cells using Promega's SV Total RNA Isolation System (catalog number Z3105) following the manufacturer's instructions. 600 ng of purified total RNA was added to the reverse transcription reaction using Invitrogen's SuperScript VILO cDNA Synthesis Kit (catalog number 11754-250) as described in the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by using ABI Taqman gene expression mixture (catalog number 4369510) and primers/probes designed by ABI for real-time PCR (for Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCN1A) . The results obtained using all 3 tests are very similar. The following PCR cycles were used: 50 °C for 2 minutes; 95 °C for 10 minutes; 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using the StepOne Plus Real-Time PCR System (Applied Biosystems). The 18S test is manufactured by ABI (catalog number 4319413E). The fold change in gene expression after treatment with the antisense oligonucleotide was calculated based on the difference in the 18S corrected dCt value between the treated sample and the mock transfected sample. For the alternative same day method, all procedures were performed similarly, but cells were dosed with antisense oligonucleotides on the first day after they were dispensed into 6-well plates.Vero76 Cell line. At 37 ° C and 5% CO₂ Next, make Vero76 African green monkey embryo kidney cells from ATCC (Catalog No. CRL-1587) in growth medium (Dulbecco's Modified Eagle's Medium (Cellgrow 10-013-CV) + 5 % FBS (Mediatech catalog number MT35-011-CV) + penicillin/streptomycin (Mediatech catalog number MT30-002-CI)) was grown. Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in the growth medium at approximately 1 day prior to the experiment.⁵ /The density of the wells was re-inoculated in a 6-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 6-well plate was changed to fresh growth medium (1.5 ml/well) and the cells were administered with antisense oligonucleotides. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of all oligonucleotides are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. For administration to 1 well, 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and One well of the 6-well plate of the cells was applied dropwise. A similar mixture comprising 2 μl of water instead of oligonucleotide solution was used to simulate the transfection control. In addition, the inactive oligonucleotide CUR-1462 at the same concentration was used as a control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and RNA was extracted from the cells using Promega's SV Total RNA Isolation System (catalog number Z3105) following the manufacturer's instructions. 600 ng of purified total RNA was added to the reverse transcription reaction using Invitrogen's SuperScript VILO cDNA Synthesis Kit (catalog number 11754-250) as described in the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by using ABI Taqman gene expression mixture (catalog number 4369510) and primers/probes designed by ABI for real-time PCR (for Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCN1A) . The following PCR cycles were used: 50 °C for 2 minutes; 95 °C for 10 minutes; 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using the StepOne Plus Real-Time PCR System (Applied Biosystems). The 18S test is manufactured by ABI (catalog number 4319413E). The fold change in gene expression after treatment with the antisense oligonucleotide was calculated based on the difference in the 18S corrected dCt value between the treated sample and the mock transfected sample. For the alternative same day method, all procedures were performed similarly, but cells were dosed with antisense oligonucleotides on the first day after they were dispensed into 6-well plates.3T3 Cell line. At 37 ° C and 5% CO₂ Next, let 3T3 mouse embryonic fibroblasts from ATCC (Catalog No. CRL-1658) in growth medium (Dellbeck modified Eagle's medium (Cellgrow 10-013-CV) + 10% fetal bovine serum (Cellgrow) Growth in 35-22-CV) + penicillin/streptomycin (Mediatech catalog number MT30-002-CI)). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in the growth medium at approximately 1 day prior to the experiment.⁵ /The density of the wells was re-inoculated in a 6-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 6-well plate was changed to fresh growth medium (1.5 ml/well) and the cells were administered with antisense oligonucleotides. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of all oligonucleotides are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. For administration to 1 well, 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and One well of the 6-well plate of the cells was applied dropwise. A similar mixture comprising 2 μl of water instead of oligonucleotide solution was used to simulate the transfection control. In addition, the inactive oligonucleotide CUR-1462 at the same concentration was used as a control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and RNA was extracted from the cells using Promega's SV Total RNA Isolation System (catalog number Z3105) following the manufacturer's instructions. 600 ng of purified total RNA was added to the reverse transcription reaction using Invitrogen's SuperScript VILO cDNA Synthesis Kit (catalog number 11754-250) as described in the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by using ABI Taqman gene expression mixture (catalog number 4369510) and primers/probes designed by ABI for real-time PCR (for Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCN1A) . The results obtained using all 3 tests are very similar. The following PCR cycles were used: 50 °C for 2 minutes; 95 °C for 10 minutes; 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using the StepOne Plus Real-Time PCR System (Applied Biosystems). The 18S test is manufactured by ABI (catalog number 4319413E). The fold change in gene expression after treatment with the antisense oligonucleotide was calculated based on the difference in the 18S corrected dCt value between the treated sample and the mock transfected sample. For the alternative same day method, all procedures were performed similarly, but cells were dosed with antisense oligonucleotides on the first day after they were dispensed into 6-well plates.HepG2 Cell line. HepG2 human hepatocellular carcinoma cells from ATCC (catalog number HB-8065) in growth medium (MEM/EBSS (Hyclone catalog number SH30024, or Mediatech catalog number MT-10-010-CV) + 10% FBS (Mediatech catalog number MT35) -011-CV) + penicillin/streptomycin (Mediatech catalog number MT30-002-CI)) at 37 ° C and 5% CO₂ Growing. Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in growth medium at approximately 3 x 10 days prior to the experiment.⁵ Density of holes/wells inoculated in 6-well plates at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 6-well plate was changed to fresh growth medium (1.5 ml/well) and the cell antisense oligonucleotide was administered. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of all oligonucleotides are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. For 1 well, 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco Cat. No. 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen Cat. No. 11668019) for 20 minutes at room temperature and to 6 wells with cells. One hole of the disk was applied dropwise. A similar mixture including 2 μl of water replacement oligonucleotide solution was used to simulate the transfection control. In addition, the same concentration of the inactive oligonucleotide CUR-1462 was used as a control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and RNA was extracted from the cells using Promega's SV Total RNA Isolation System (catalog number Z3105) following the manufacturer's instructions. 600 ng of purified total RNA was added to the reverse transcription reaction using Invitrogen's SuperScript VILO cDNA Synthesis Kit (Cat. No. 11754-250) as described in the manufacturer's protocol. The gene expression (Hs00374696_m1, Hs00897350_m1 or Hs00897341_m1 for human SCN1A) was monitored by real-time PCR using the ABI Taqman gene expression mixture (catalog number 4369510) and the ABI-designed primer/probe using cDNA from this reverse transcription reaction. The results obtained using all three assays are very similar. The following PCR cycles were used: 50 °C for 2 minutes, 95 °C for 10 minutes, 40 cycles (95 °C for 15 seconds, 60 °C for 1 minute) using the StepOne Plus Real-Time PCR System (Applied Biosystems). The 18S test is manufactured by ABI (catalog number 4319413E). The fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S corrected dCt values between the treated samples and the mock transfected samples. For the alternative same day method, all procedures were performed similarly, but the antisense oligonucleotides were administered immediately after the cells were dispensed to the 6-well plate on the first day.result. The amount of SCN1A mRNA in different cell lines after treatment with 20 nM antisense oligonucleotides is shown in Table 2 compared to mock-transfected controls. As can be seen from the literature, some oligonucleotides are highly active in up-regulating SCN1A mRNA levels when applied at 20 nM and are derived from several species (human, African green monkeys and mice), from different organs/cell types Cell lines of (liver, kidney, brain, embryonic fibroblasts) and primary skin fibroblasts with SCN1A mutations consistently showed up-regulation. Up-regulation of the SCN1A protein in cells with a Dewitt mutation supports the suitability of a method for treating a disease associated with a mutation in the SCN1A gene. Some oligonucleotides designed for natural antisense sequences do not affect or only slightly affect the SCN1A mRNA content in all or some of the test cell lines. These differences are consistent with the literature indicating that the binding of the oligonucleotides may depend on the secondary and tertiary structure of the target sequence of the oligonucleotide. It is noteworthy that the SCN1A content in cells treated with an oligonucleotide that is not homologous to the SCN1A natural antisense sequence but has a similar chemical composition (CUR-1462) is not significantly different from the mock-transfected control, which confirms targeting The effect of oligonucleotides does not depend on the non-specific toxicity of such molecules.Instance 4 : by targeting SCNA Antisense oligonucleotide treatment of specific natural antisense transcripts to upregulate different cell lines SCNA mRNA Dose dependence In Example 4, antisense oligonucleotides of different chemical compositions targeting SCNA-specific natural antisense transcripts were screened at a final concentration ranging from 5 to 80 nM in a panel of various cell lines. The cell lines used are derived from different organs and different animal species. The following data demonstrate that the degree of up-regulation of SCNA mRNA by modulating the function of SCNA-specific natural antisense transcripts can be altered by applying different amounts of active oligonucleotides.Materials and methods. SK-N-AS, Vero 76 and primary human fibroblasts with a Dravid mutation were treated with antisense oligonucleotides as described in Example 2 with the exception of oligonucleosides for treatment of each well. Acid and Lipofectamine 2000 concentrations are different. Adjust the concentration of oligonucleotide and Lipofectamine 2000 to ensure a final oligonucleotide concentration of 5, 10, 20, 40 and 80 nM and a 2:1 (v:v) Lipofectamine 2000 and 20 μM oligonucleotide stock solution ratio.result. Results of Dose Response Experiments Antisense oligonucleotides targeting SCN1A-specific natural antisense RNA have been shown to induce dose-dependent up-regulation of SCN1A mRNA (Figures 1-3). In some cases, at higher doses, this up-regulation is extremely strong (up to 60 times) (Figure 1-3). The degree of up-regulation induced by the same nucleotide in different cell lines appears to be different, for example 10-40 fold in primary fibroblasts at 40 nM, and by the same oligonucleotide at the same concentration The overshoot was achieved in Vero 76 cells by 2-6 fold (Figure 1 vs. Figure 3). These differences can be attributed to different transfection efficiencies of different cell lines and/or various feedback pathways manifested by them. The effect of most oligonucleotides reached a plateau at approximately 40 nM, with the exception of CUR-1764 and CUR-1770 in SCN1A fibroblasts and all oligonucleotides tested in Vero 76 cells, in the above case The plateau was not reached at the highest test concentration (Figure 1-3).Instance 5 : by targeting SCNA Up-regulation of antisense oligonucleotides specific for natural antisense transcripts SCNA mRNA Sequence specificity In Example 5, the targeted SCN1A-specific natural antisense transcript was tested in an assay designed to demonstrate that SCN1A up-regulation by oligonucleotides is independent of non-specific toxicity associated with the chemical composition of the oligonucleotide used. Antisense oligonucleotides. The following data demonstrate that the extent to which SCN1A mRNA is up-regulated by modulating the function of the SCN1A-specific natural antisense transcript depends only on the amount of active oligonucleotide, rather than the total amount of molecules of similar chemical composition.Materials and methods : Vero 76 and primary human fibroblasts with a Dravid mutation were treated with antisense oligonucleotides as described in Example 2 with the exception of different concentrations of oligonucleotides used to treat each well. The active oligonucleotide is co-administered with an inactive oligonucleotide (CUR-1462) that is similar in chemical composition but has no known target in the human genome and has no effect on the performance of the multiple genes tested (data not shown). The total amount of oligonucleotides and the amount of Lipofectamine 2000 remained constant while changing the ratio of active oligonucleotides in the mixture. Oligonucleotide concentrations were adjusted to ensure a final active oligonucleotide concentration of 5, 10, 20 and 40 nM and a total oligonucleotide concentration of 40 nM (active + inactive). As seen from the data (Figure 7), the dose-dependent effects of oligonucleotides targeting SCN1A natural antisense are not produced by non-specific toxicity potentially associated with such molecules. The SCN1A mRNA content is dependent on the dose of active oligonucleotide used to treat it (Figure 7).Instance 6 : by targeting SCNA Up-regulation of antisense oligonucleotides specific for natural antisense transcripts SCNA mRNA Target specificity In Example 6, antisense oligonucleotides that target the SCN1A-specific natural antisense transcript were tested in experiments designed to confirm the specificity of their target (ie, SCN1A). The following data demonstrate that up-regulation of SCN1A mRNA is restricted to SCN1A mRNA by modulating the function of the SCN1A-specific natural antisense transcript and does not affect the relevant sodium channels SCN9A, SCN8A, SCN7A, SCN3A, and SCN2A.Materials and methods. Vero 76 and primary human fibroblasts with a Dravid mutation were treated with antisense oligonucleotides as described in Example 3. After treatment, the isolated RNA was analyzed as described in Example 2 with the exception of using Taqman gene expression assay to detect mRNA of SCN9A, SCN8A, SCN7A, SCN3A and SCN2A channels by real-time PCR. The assays for the alpha subunits of the human SCN9A, SCN8A, SCN7A, SCN3A and SCN2A channels were obtained from ABI Inc. (catalog numbers Hs00161567_m1, Hs00274075_m1, Hs00161546_m1, Hs00366902_m1 and Hs00221379_m1, respectively).result . As shown in Figure 8, treatment with oligonucleotides CUR-1916 and CUR-1770 did not significantly affect the performance of SCN8A and SCN9A channels in human fibroblasts with a de lavert mutation. The performance of the SCN7A, SCN3A and SCN2A channels was not detectable in these cells before or after treatment (data not shown). The data demonstrates the specificity of gene expression regulation using oligonucleotides directed against the natural antisense RNA of a given gene.Instance 7 :Targeting SCNA Stability of antisense oligonucleotides specific for natural antisense transcripts In Example 7, two batches of antisense oligonucleotides targeting SCN1A-specific natural antisense transcripts were tested in an assay designed to check their stability after storage in diluted (1 mM) aqueous solution at 4 °C. Test it. The following data shows that oligonucleotides can be stable for at least 6 months in these conditions without significant loss of activity.Materials and methods. Vero 76 cells were treated with two different sets of antisense oligonucleotides as described in Example 2. The batches were synthesized in August 2010 and March 2011. The oligonucleotide synthesized in August 2010 was stored as a 1 mM aqueous solution at 4 °C. Oligonucleotides synthesized in March 2011 were shipped in lyophilized form within 3 days after synthesis and tested as soon as they arrived.result: As shown in Figure 9, there was no significant loss of biological activity after the oligonucleotide was stored in aqueous solution for 6 months at 4 °C.Instance 8 : targeting SCNA Specific antisense oligos specific for natural antisense transcripts in primary human fibroblasts with Dravid syndrome-associated mutations SCNA Protein upregulation The aim of this experiment was to classify the SCNA protein by its ability to up-regulate the performance of the SCNA protein in fibroblasts with Dravid syndrome-associated mutations based on antisense oligonucleotides CUR-1740, CUR-1770 and CUR-1916.Materials and methods. At 37 ° C and 5% CO₂ Next, fibroblasts with Dravid syndrome-associated mutations introduced into culture by Dr. N. Kenyon (University of Miami) were used in MEM (Gibco, catalog number: 12561-056) + 10% FBS (Mediatech , Catalog No.: 35-015 CV) Growth in a growth medium consisting of +1% antifungal antibiotic (Gibco, catalog number: 15240-062). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in growth medium at approximately 4 x 10 days prior to the experiment.⁴ /The density of the wells was re-inoculated in a 24-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 24-well plate was changed to fresh growth medium (1 ml/well) and the cells were administered with antisense oligonucleotides CUR-1740, CUR-1770 and CUR-1916. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of oligonucleotides CUR-1740, CUR-1770 and CUR-1916 are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. To administer 1 well at a final concentration of 20 nM, 1 μl of 20 μM oligonucleotide stock solution and 200 μl Opti-MEM medium (Gibco Cat. No. 31985-070) and 2 μl Lipofectamine 2000 (at room temperature) Invitrogen catalog number 11668019) was incubated for 20 minutes and applied dropwise to one well of a 24-well plate with cells. To achieve final concentrations of 5, 10, 40 and 80 nM, the volume of the 20 μM oligonucleotide stock solution used was adjusted accordingly. The ratio of 20 μM oligonucleotide stock solution to Lipofectamine 2000 was 1:2 (v:v). A similar mixture of 8 μl of water replacement oligonucleotide solution and corresponding volume of Lipofectamine 2000 was used to simulate the transfection control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and the cells were washed 3 times with calcium and magnesium-free Dulbecco's phosphate buffered saline (PBS) (Mediatech Cat. No. 21-031-CV). The PBS was then discarded and the cells were fixed in a 24-well plate for 15 minutes at -20 °C using 300 μl of 100% methanol. After removing methanol and washing with PBS, the cells were incubated with 3% hydrogen peroxide (Fisher Chemical Cat. No. H325-100) for 5 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each, followed by incubation with 300 μl of PBS containing 0.1% bovine serum albumin (BSA) (Sigma Cat. No. A-9647) for 30 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each, followed by incubation with 300 μl of avidin solution (Vector Laboratories Cat. No. SP-2001) for 30 minutes at 21 °C. The cells were briefly washed 3 times with PBS, followed by incubation with biotin solution (Vector Laboratories Cat. No. SP-2001) for 30 minutes at 21 °C. The cells were washed 3 times with PBS and then incubated overnight at 4 °C with 300 μl of rabbit antibody (Abcam catalog number ab24820) against human SCN1A diluted 250-fold in PBS/0.1% BSA overnight. After equilibrating the plate for 5 minutes at 21 ° C, the cells were washed 3 times with PBS for 5 minutes each, followed by incubation with goat anti-rabbit antibody diluted 200-fold in PBS/0.1% BSA for 30 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each and then incubated with 300 μl of Vectastain Elite ABC Reagent A+B solution (Vector Laboratories Cat. No. PK-6101) for 30 minutes; Vectastain Elite ABC Reagent A+B solution at 21 °C Prepare 30 minutes before incubation with the cells by sequentially adding and mixing 2 drops of Reagent A and 2 drops of Reagent B to 5 ml of PBS. The cells were washed 3 times with PBS for 5 minutes at 21 ° C, and then incubated with diaminobenzidine (DAB) peroxidase substrate (Vector Laboratories catalog number SK-4105) until cell staining; DAB over The oxidase substrate was reconstituted by mixing 1 ml of ImmPACTTM DAB dilution with 30 μl of ImmPACTTM DAB chromogen concentrate prior to addition to the cells. At this time, the cells were briefly washed 3 times with PBS and 300 μl of PBS was left in each well. Cell staining was analyzed directly on the inside of each well of a 24-well plate using a reverse Nikon Eclipse TS100 microscope equipped with a Nikon DS-Ri1 camera coupled to a Nikon digital observation device on a Dell Latitude D630 laptop screen. The photographs of the individual holes were taken using a software NIS-Elements D 3.0 with a Nikon camera.result. All tested antisense oligonucleotides up-regulated SCN1A protein efficiently, with CUR-1770 and CUR-1916 being the two best antisense oligonucleotides (Figure 10).Instance 9 : targeting SCNA Antisense oligonucleotide treatment of specific natural antisense transcripts SK-N-AS In the cell SCNA Protein upregulation The purpose of this experiment was to classify antisense oligonucleotides CUR-1740, CUR-1764, CUR-1770 and CUR-1916 by upregulating the ability of the SCN1A protein to be expressed in SK-N-AS cells. SK-N-AS is a human neuroblastoma cell line.Materials and methods : at 37 ° C and 5% CO₂ SK-N-AS human neuroblastoma cells from ATCC (Catalog No. CRL-2137) were grown in growth medium (DMEM (Mediatech catalog number 10-013-CV) + 10% FBS (Mediatech catalog number MT35-011- CV) + penicillin/streptomycin (Mediatech Cat. No. MT30-002-CI) + non-essential amino acid (NEAA) (HyClone SH30238.01)). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in the growth medium at approximately 5 x 10 days prior to the experiment.⁴ /The density of the wells was re-inoculated in a 24-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 24-well plate was changed to fresh growth medium (1 ml/well) and the cells were administered with antisense oligonucleotides CUR-1740, CUR-1764, CUR-1770 and CUR-1916. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of oligonucleotides CUR-1740, CUR-1764, CUR-1770 and CUR-1916 are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. To administer 1 well at a final concentration of 20 nM, 1 μl of 20 μM oligonucleotide stock solution and 200 μl Opti-MEM medium (Gibco Cat. No. 31985-070) and 2 μl Lipofectamine 2000 (at room temperature) Invitrogen catalog number 11668019) was incubated for 20 minutes and applied dropwise to one well of a 24-well plate with cells. To achieve final concentrations of 5, 10, 40 and 80 nM, the volume of the 20 μM oligonucleotide stock solution used was adjusted accordingly. The ratio of 20 μM oligonucleotide stock solution to Lipofectamine 2000 was 1:2 (v:v). A similar mixture of 8 μl of water replacement oligonucleotide solution and corresponding volume of Lipofectamine 2000 was used to simulate the transfection control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and the cells were washed 3 times with calcium and magnesium-free Dulbecco's phosphate buffered saline (PBS) (Mediatech Cat. No. 21-031-CV). The PBS was then discarded and the cells were fixed in a 24-well plate for 15 minutes at -20 °C using 300 μl of 100% methanol. After removing methanol and washing with PBS, the cells were incubated with 3% hydrogen peroxide (Fisher Chemical Cat. No. H325-100) for 5 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each, followed by incubation with 300 μl of PBS containing 0.1% bovine serum albumin (BSA) (Sigma Cat. No. A-9647) for 30 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each, followed by incubation with 300 μl of antibiotic solution (Vector Laboratories Cat. No. SP-2001) for 30 minutes at 21 °C. The cells were briefly washed 3 times with PBS, followed by incubation with biotin solution (Vector Laboratories Cat. No. SP-2001) for 30 minutes at 21 °C. The cells were washed 3 times with PBS and then incubated overnight at 4 °C with 300 μl of rabbit antibody (Abcam catalog number ab24820) against human SCN1A diluted 250-fold in PBS/0.1% BSA overnight. After equilibrating the plate for 5 minutes at 21 ° C, the cells were washed 3 times with PBS for 5 minutes each, followed by incubation with goat anti-rabbit antibody diluted 200-fold in PBS/0.1% BSA for 30 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each and then incubated with 300 μl of Vectastain Elite ABC Reagent A+B solution (Vector Laboratories Cat. No. PK-6101) for 30 minutes; Vectastain Elite ABC Reagent A+B solution at 21 °C Prepare 30 minutes before incubation with the cells by sequentially adding and mixing 2 drops of Reagent A and 2 drops of Reagent B to 5 ml of PBS. The cells were washed 3 times with PBS for 5 minutes at 21 ° C, and then incubated with diaminobenzidine (DAB) peroxidase substrate (Vector Laboratories catalog number SK-4105) until cell staining; DAB peroxidation The enzyme substrate was reconstituted by mixing 1 ml of ImmPACTTM DAB dilution with 30 μl of ImmPACTTM DAB chromogen concentrate prior to addition to the cells. At this time, the cells were briefly washed 3 times with PBS and 300 μl of PBS was left in each well. Cell staining was analyzed directly on the inside of each well of a 24-well plate using a reverse Nikon Eclipse TS100 microscope equipped with a Nikon DS-Ri1 camera coupled to a Nikon digital observation device on a Dell Latitude D630 laptop screen. The photographs of the individual holes were taken using a software NIS-Elements D 3.0 with a Nikon camera.result: All tested antisense oligonucleotides up-regulated the SCN1A protein, with CUR-1764 and CUR-1770 being the two best antisense oligonucleotides (Figure 11).Instance 10 : targeting SCNA Antisense oligonucleotide treatment of specific natural antisense transcripts Vero 76 In the cell SCNA Protein upregulation The purpose of this experiment was to classify antisense oligonucleotides CUR-1740, CUR-1770, CUR-1916, CUR-1924 and CUR-1945 by upregulating the ability of the SCN1A protein to behave in Vero 76 cells. Vero76 is a prairie monkey (Cercopithecus aethiops (Green vervet or African green monkey) kidney cell line.Materials and methods: At 37 ° C and 5% CO₂ Next, make Vero76 African green monkey embryo kidney cells from ATCC (Catalog No. CRL-1587) in growth medium (Dellbeck modified Eagle's medium (Cellgrow 10-013-CV) + 5% FBS (Mediatech catalog number) Growth in MT35-011-CV) + penicillin/streptomycin (Mediatech catalog number MT30-002-CI)). Cells were treated with antisense oligonucleotides using one of the following methods. For the next day method, cells were grown in growth medium at approximately 4 x 10 days prior to the experiment.⁴ /The density of the wells was re-inoculated in a 24-well plate at 37 ° C and 5% CO₂ Cultivate overnight. The next day, the medium in the 24-well plate was changed to fresh growth medium (1 ml/well) and the cells were administered with antisense oligonucleotides CUR-1740, CUR-1770 and CUR-1916. All antisense oligonucleotides were manufactured by IDT Inc. (Coralville, IA) or Exiqon (Vedbaek, Denmark). The sequences of oligonucleotides CUR-1740, CUR-1770, CUR-1916, CUR-1924 and CUR-1945 are listed in Table 1. The stock solution of the oligonucleotide was diluted to a concentration of 20 μM in sterile water without DNAse/RNAse. To administer 1 well at a final concentration of 20 nM, 1 μl of 20 μM oligonucleotide solution and 200 μl Opti-MEM medium (Gibco Cat. No. 31985-070) and 2 μl Lipofectamine 2000 (Invitrogen) at room temperature Catalog No. 11668019) was incubated for 20 minutes and applied dropwise to one well of a 24-well plate with cells. To achieve final concentrations of 5, 10, 40 and 80 nM, the volume of the 20 μM oligonucleotide stock solution used was adjusted accordingly. The ratio of 20 μM oligonucleotide stock solution to Lipofectamine 2000 was 1:2 (v:v). A similar mixture of 8 μl of water replacement oligonucleotide solution and corresponding volume of Lipofectamine 2000 was used to simulate the transfection control. At 37 ° C and 5% CO₂ After about 18 hours of incubation, the medium was changed to fresh growth medium. 48 hours after the addition of the antisense oligonucleotide, the medium was removed and the cells were washed 3 times with calcium and magnesium-free Dulbecco's phosphate buffered saline (PBS) (Mediatech Cat. No. 21-031-CV). PBS was discarded and Vero 76 cells were fixed in a 24-well plate for 15 minutes at -20 °C using 300 μl of 100% methanol. After removing the methanol and washing the cells with PBS, the cells were incubated with 3% hydrogen peroxide (Fisher Chemical Cat. No. H325-100) for 5 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each, followed by incubation with 300 μl of PBS containing 0.1% bovine serum albumin (BSA) (Sigma Cat. No. A-9647) for 30 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each, followed by incubation with 300 μl of antibiotic solution (Vector Laboratories Cat. No. SP-2001) for 30 minutes at 21 °C. The cells were briefly washed 3 times with PBS, followed by incubation with biotin solution (Vector Laboratories Cat. No. SP-2001) for 30 minutes at 21 °C. The cells were washed 3 times with PBS and then incubated overnight at 4 °C with 300 μl of rabbit antibody (Abcam catalog number ab24820) against human SCN1A diluted 250-fold in PBS/0.1% BSA overnight. After equilibrating the plate for 5 minutes at 21 ° C, the cells were washed 3 times with PBS for 5 minutes each, followed by incubation with goat anti-rabbit antibody diluted 200-fold in PBS/0.1% BSA for 30 minutes at 21 °C. The cells were washed 3 times with PBS for 5 minutes each and then incubated with 300 μl of Vectastain Elite ABC Reagent A+B solution (Vector Laboratories Cat. No. PK-6101) for 30 minutes; Vectastain Elite ABC Reagent A+B solution at 21 °C Prepare 30 minutes before incubation with the cells by sequentially adding and mixing 2 drops of Reagent A and 2 drops of Reagent B to 5 ml of PBS. The cells were washed 3 times with PBS for 5 minutes at 21 ° C, and then incubated with diaminobenzidine (DAB) peroxidase substrate (Vector Laboratories catalog number SK-4105) until cell staining; DAB peroxidation The enzyme substrate was reconstituted by mixing 1 ml of ImmPACTTM DAB dilution with 30 μl of ImmPACTTM DAB chromogen concentrate prior to addition to the cells. At this time, the cells were briefly washed 3 times with PBS and 300 μl of PBS was left in each well. Cell staining was analyzed directly on the inside of each well of a 24-well plate using a reverse Nikon Eclipse TS100 microscope equipped with a Nikon DS-Ri1 camera coupled to a Nikon digital observation device on a Dell Latitude D630 laptop screen. The photographs of the individual holes were taken using a software NIS-Elements D 3.0 with a Nikon camera.result. All tested antisense oligonucleotides up-regulated the SCN1A protein, with CUR-1764 and CUR-1770 producing the highest upregulation (Figure 12).Instance 11 : Powerful up SCNA mRNA Targeting SCNA Oligonucleotides specific for natural antisense transcripts are not upregulated Vero76 Actin in cells (actin) mRNA The purpose of this experiment was to examine whether antisense oligonucleotides (CUR-1924, CUR-1740, CUR-1838) targeting SCN1A-specific natural antisense transcripts that upregulate SCN1A mRNA and protein can regulate Vero76 African green mRNA of other non-related genes (such as actin) in monkey embryonic kidney cells.Materials and methods. The Vero76 African green monkey embryo kidney cell line (Catalog No. CRL-1587) from ATCC was administered under the same conditions as described in Example 2. Actin mRNA was quantified by real-time PCR as described in Example 2 with the exception that the ABI-designed primer/probe was specific for actin (catalog number Hs99999903_m1). The data is presented in Figure 13.result. As shown in Figure 13, oligonucleotides (CUR-1924, CUR-1740, which target SCN1A-specific natural antisense transcripts that up-regulate SCN1A mRNA and protein in Vero76 cells are shown in Examples 3 and 10. CUR-1838) Effect on actin mRNA expression in Vero 76 cells. The data in Figure 13 demonstrates that oligonucleotides targeting SCN1A-specific natural antisense transcripts do not upregulate non-related genes, such as actin. Thus, such oligonucleotides are specific for up-regulating SCN1A.Instance 12 : Display will be raised SCNA mRNA And protein targeting SCNA Oligonucleotides specific for the natural antisense transcript do not upregulate actin in primary fibroblasts with Dravid-related mutations mRNA The purpose of this experiment was to examine whether antisense oligonucleotides (CUR-1916, CUR-1945), which display SCN1A-specific mRNA and protein-targeting SCN1A-specific natural antisense transcripts, can be regulated with Dravid syndrome Related mRNA of other non-related genes (such as actin) in primary human skin fibroblasts of mutant E1099X.Materials and methods. Primary human skin fibroblasts bearing the Delavid syndrome-associated mutation E1099X introduced into the culture by Dr. N. Kenyon (University of Miami) were administered under the same conditions as described in Example 3. Actin mRNA was quantified by real-time PCR as described in Example 3 with the exception that the primer/probe designed by ABI was specific for actin (catalog number Hs99999903_m1). The data is presented in Figure 14.result : As shown in Figure 14, oligonucleotides that target the SCN1A-specific natural antisense transcript do not upregulate non-related genes, such as actin. Thus, such oligonucleotides are specific for up-regulating SCN1A.Instance 13 : Display will be raised SCNA mRNA And protein targeting SCNA Oligonucleotides specific for natural antisense transcripts are not upregulated SK-N-AS Actin in cells mRNA The purpose of this experiment was to examine antisense oligonucleotides (CUR-1740, CUR-1764, CUR-1770, CUR-1838, CUR-) that display SCN1A-specific natural antisense transcripts that up-regulate SCN1A mRNA and protein. 1916) Whether it is capable of regulating mRNA of other non-related genes (such as actin) in SK-N-AS human neuroblastoma cells.Materials and methods. SK-N-AS human neuroblastoma cells (Catalog No. CRL-2137) from ATCC were administered under the same conditions as described in Example 2. Actin mRNA was quantified by real-time PCR as described in Example 2 with the exception that the ABI-designed primer/probe was specific for actin (catalog number Hs99999903_m1). The data is presented in Figure 15.result. As shown in Figure 15, oligonucleotides that target the SCN1A-specific natural antisense transcript do not upregulate non-related genes, such as actin. Thus, such oligonucleotides are specific for up-regulating SCN1A.Instance 14 : Actin is targeted SCNA Antisense oligonucleotide treatment of specific natural antisense transcripts SK-N-AS Not upregulated in cells The purpose of this experiment was to determine whether oligonucleotides (CUR-1740, CUR-1764, CUR-1770, and CUR-1916) that target the SCN1A-specific natural antisense transcript and are capable of upregulating the SCN1A protein can also regulate SK-N. - The expression of non-related proteins (such as actin) in AS cells. SK-N-AS is a human neuroblastoma cell line.Materials and methods: SK-N-AS human neuroblastoma cells (Catalog No. CRL-2137) from ATCC were grown in the same conditions as described in Example 9. The cells were precisely fixed and stained under the same conditions as described in Example 8, except that the first antibody was rabbit anti-actin (Abcam catalog number ab1801) diluted 500-fold. The staining of the cells was directly analyzed inside each well of a 24-well plate using the same method as described in Example 9.result: As shown in Figure 16, none of the antisense oligonucleotides tested up-regulated actin. Thus, such oligonucleotides are specific for up-regulating the SCN1A protein.Instance 15 : Actin is targeted SCNA Antisense oligonucleotide treatment of specific natural antisense transcripts Vero 76 Not upregulated in cells The purpose of this experiment was to identify specific antisense oligonucleotides that target the SCN1A-specific natural antisense transcript and are capable of up-regulating the SCN1A protein (CUR-1740, CUR-1770, CUR-1916, CUR-1924, and CUR-1945). Whether it is also capable of regulating the expression of proteins (such as actin) of non-related genes in Vero76 cells. Vero76 is a rhesus monkey (green monkey or African green monkey) kidney cell line.Materials and methods. The Vero76 African green monkey embryo kidney cell line (catalog number CRL-1587) from ATCC was grown in the same conditions as described in Example 10. The cells were precisely fixed and stained under the same conditions as described in Example 10 except that the first antibody was rabbit anti-actin (Abcam catalog number ab1801) diluted 500-fold. The staining of the cells was directly analyzed inside each well of a 24-well plate using the same method as described in Example 10.result. As shown in Figure 17, none of the antisense oligonucleotides tested up-regulated actin. Thus, such oligonucleotides are specific for up-regulating the SCN1A protein.Instance 16 : Actin is targeted SCNA Anti-sense oligonucleotides specific for natural antisense transcripts are not upregulated in primary human fibroblasts with Dravid syndrome-associated mutations The purpose of this experiment was to determine whether oligonucleotides (CUR-1740, CUR-1764, CUR-1770, CUR-1838, and CUR-1916) that target the SCN1A-specific natural antisense transcript and are capable of upregulating the SCNA protein are also capable of Proteins (such as actin) that regulate non-related genes in primary human fibroblasts with Dravid syndrome-associated mutations.Materials and methods. Fibroblasts with a Dehwat syndrome-associated mutation introduced into the culture by Dr. N. Kenyon (University of Miami) were grown under the same conditions as described in Example 8. The cells were precisely fixed and stained under the same conditions as described in Example 8, except that the first antibody was rabbit anti-actin (Abcam catalog number ab1801) diluted 500-fold. The staining of the cells was directly analyzed inside each well of a 24-well plate using the same method as described in Example 8.result: As shown in Figure 18, none of the antisense oligonucleotides tested up-regulated actin. Thus, such oligonucleotides are specific for up-regulating the SCN1A protein.Instance 17 :use ELISA Targeting SCNA Oligonucleotide-specific natural antisense transcripts in primary human fibroblasts with Dravid syndrome-associated mutations SCNA Protein quantification The purpose of this experiment was to quantify the affluent with Dravid syndrome due to treatment with oligonucleotides targeting SCN1A-specific natural antisense transcripts (CUR-1740, CUR-1770, and CUR-1916) using ELISA. The degree of up-regulation of SCN1A protein in primary human fibroblasts with related mutations.Materials and methods: Fibroblasts with Dravid syndrome-associated mutations introduced into culture by Dr. N. Kenyon (University of Miami) were grown under the same conditions as described in Example 8, but only at concentrations of 0 and 80 nM Oligonucleotides are used for administration. Cells were then counted and re-seeded in 96 well plates. After 24 hours, the cells were precisely fixed in the same conditions as described in Examples 8 and 16, with the exception that all 300 μl volumes were reduced to 100 μl. Parallel assay wells were stained with actin and SCN1A antibodies as described in Example 8, with the exception that all reactions were performed in a volume of 100 μl. The anti-actin antibody dilution was 1:500, the anti-SCN1A dilution was 1:250 and the anti-mouse dilution was 1:250. Further, in place of the diaminobenzidine (DAB) peroxidase receptor solution, a tetramethylbenzidine (TMB) peroxidase receptor solution (Thermo Scientific catalog No. N301) was used. After the supernatant turned blue, it was transferred to a new 96-well plate (Greiner bio one catalog number 65121) and 1 M sulfuric acid was added. Absorbance was read at 450 nm using a Multiskan Spectrum spectrophotometer (Thermo Scientific). Background signals were subtracted from all SCN1A and actin readings (read in wells used as anti-mouse stains for primary antibodies). The SCN1A signal for each condition is then corrected relative to the actin signal.result: Figure 19 shows that all of the tested antisense oligonucleotides (CUR-1740, CUR-1770 and CUR-1916) up-regulated SCN1A protein by up to 40%.Instance 18 :use ELISA Targeting SCNA Oligonucleotide treatment of specific natural antisense transcripts Vero76 In the cell SCNA Protein quantification The purpose of this experiment was to quantify the use of ELISA to quantify the oligonucleotides (CUR-1740, CUR-1770, CUR-1916, CUR-1924, CUR-1945) that target the SCN1A-specific natural antisense transcript. The extent of SCN1A protein up-regulation in primary human fibroblasts with Dravid syndrome-associated mutations.Materials and methods: Vero76 African green monkey embryo kidney cells were grown in the same conditions as described in Example 10, but only oligonucleotides at concentrations of 0 and 80 nM were used for administration. Cells were then counted and re-seeded in 96 well plates. After 24 hours, the cells were precisely fixed in the same conditions as described in Example 8, with the exception that all 300 μl volumes were reduced to 100 μl. Parallel assay wells were stained with actin and SCN1A antibodies as described in Examples 10 and 15, with the exception that all reactions were performed at 100 μl, the anti-actin antibody dilution was 1:500, and the anti-SCN1A dilution was 1:250 and the anti-mouse dilution was 1:250. Further, instead of using a diaminobenzidine (DAB) peroxidase receptor solution, a tetramethylbenzidine (TMB) peroxidase receptor solution (Thermo Scientific catalog No. N301) was used. After the supernatant turned blue, it was transferred to a new 96-well plate (Greiner bio one catalog number 651201) and 1 M sulfuric acid was added. Absorbance was read at 450 nm using a Multiskan Spectrum spectrophotometer (Thermo Scientific). Background signals were subtracted from all SCN1A and actin readings (read in wells used as anti-mouse stains for primary antibodies). The SCN1A signal for each condition is then corrected relative to the actin signal.result: Figure 20 shows that all of the tested antisense oligonucleotides (CUR-1740, CUR-1770, CUR-1916, CUR-1924, CUR-1945) efficiently upregulated the SCN1A protein by up to 300%.Instance 19 :use ELISA Targeting SCNA Oligonucleotide treatment of specific natural antisense transcripts SK-N-AS In the cell SCNA Protein quantification The purpose of this experiment was to quantify SK-N-AS due to treatment with oligonucleotides (CUR-1740, CUR-1770, CUR-1924 and CUR-1945) that target the SCN1A-specific natural antisense transcript. The degree of up-regulation of SCN1A protein in cells.Materials and methods: SK-N-AS human neuroblastoma cells from ATCC (Catalog No. CRL-2137) were grown under the same conditions as described in Example 10, but only oligonucleotides at concentrations of 0 and 20 nM were used to give medicine. Cells were then counted and re-seeded in 96 well plates. After 24 hours, the cells were precisely fixed in the same conditions as described in Example 9, with the exception that all 300 μl volumes were reduced to 100 μl. Parallel assay wells were stained with actin and SCN1A antibodies as described in Examples 9 and 13, with the exception that all reactions were performed at 100 μl, the anti-actin antibody dilution was 1:500, and the anti-SCN1A dilution was 1:250 and the anti-mouse dilution was 1:250. Further, in place of the diaminobenzidine (DAB) peroxidase receptor solution, a tetramethylbenzidine (TMB) peroxidase receptor solution (Thermo Scientific catalog No. N301) was used. After the supernatant turned blue, it was transferred to a new 96-well plate (Greiner bio one catalog number 651201) and 1 M sulfuric acid was added. Absorbance was read at 450 nm using a Multiskan Spectrum (Thermo Scientific). Background signals were subtracted from all SCN1A and actin readings (read in wells used as anti-mouse stains for primary antibodies). The SCN1A signal for each condition is then corrected relative to the actin signal.result: Figure 21 shows that all of the tested antisense oligonucleotides (CUR-1740, CUR-1770, CUR-1924, and CUR-1945) efficiently up-regulated SCN1A protein in SK-N-AS cells by up to 500%.Instance 20 :Detection HepG2 Natural antisense in cells and primary human fibroblasts with mutations related to Dravid syndrome BG724147 . The purpose of this experiment was to determine whether natural antisense BG724147 is present in human hepatocellular carcinoma HepG2 cell lines and primary human fibroblasts with mutations associated with Dravid syndrome. To achieve this, two different RNAs (poly A RNA and total RNA) isolated from each cell type were used. The PCR product was obtained after two consecutive rounds of PCR using two cell types, which were analyzed on a gel. Amplification of a similarly sized band obtained using the BG724147-specific primer confirmed the presence of BG724147 in both cell types.Materials and methods Separation total RNA . At 75 cm² The 80% confluent HepG2 cells grown in the culture flask or the primary human fibroblasts with the Dravid syndrome-associated mutation were washed twice with PBS AccuGENE 1× (Lonza Rockeland Inc., Rockeland, ME). After discarding the PBS, 5 ml of RLT buffer containing b-mercaptoethanol (QIAGEN Inc.-USA, Valencia, CA) was added to the cells and the cell lysate was stored in a 1 ml aliquot at -80 °C. The total RNA was isolated in a microcentrifuge tube. Total RNA was isolated from these cells using the RNeasy Medium Kit (QIAGEN Inc. - USA, Valencia, CA) following the manufacturer's protocol. Briefly, cell lysates were centrifuged at 3000 xg for 5 minutes to clarify the lysate and discard any centrifugation. The clarified cell lysate was centrifuged through a QIAshredder column (inside a 2 ml microcentrifuge tube) at 14800 xg and the resulting homogenized lysate was mixed with an equal volume of 70% ethanol. The cell lysate mixed with ethanol was applied to an RNeasy medium column (inside a 15 ml conical tube) and centrifuged at 3000 x g for 5 minutes. The column was washed once with 4 ml of RW1 buffer and then subjected to DNase digestion on a column with 140 μl of RDD buffer containing RNase-free DNase for 15 minutes. The DNase digestion was terminated by the addition of 4 ml RW1 buffer and the column was centrifuged at 3000 xg. The column was washed twice with RPE buffer and the total RNA bound to the filter was dissolved in 150 μl of water without DNase and RNAse. Total RNA was stored at -80 °C until the next step.from HepG2 Total cell RNA Separation poly-A RNA . Separation of total RNA from HepG2 cells and primary human fibroblasts with Dravid syndrome-associated mutations using the kit for separation of poly-A from Ambion (Applied Biosystems/ Ambion, Austin, TX) following the manufacturer's protocol Poly A RNA. Basically, 100 μg of total RNA was resuspended so that the final concentration in water without DNase/RNAse was 600 μg/ml and an equal volume of 2× binding solution was added. During this time, 10 μl of Oligo (dT) magnetic beads were placed in a microcentrifuge tube, which was captured by placing the tube on a magnetic stand and discarding the storage buffer. 50 μl of Wash Solution 1 was added to the beads and the tube was removed from the magnetic bench and the wash solution was discarded. At this time, 1× binding buffer containing total RNA from HepG2 cells was mixed with magnetic beads and heated at 70 ° C for 5 minutes, followed by incubation at room temperature for 60 minutes with gentle agitation. The poly A RNA combined with the magnetic beads was captured by using a magnetic stand for 5 minutes. Discard the supernatant. The Oligo (dT) magnetic beads were washed twice with Wash Solution 1 and once with Wash Solution 2 to remove non-specifically bound RNA. The magnetic beads were captured with a magnetic stand and 200 μl of warm RNA storage solution (preheated at 70 ° C for 5 minutes) was added to the beads. The magnetic beads are captured by a magnetic gantry and the supernatant (the first solution of poly A RNA) is stored. A second 200 μl of warm RNA storage solution (preheated at 70 ° C for 5 minutes) was then added to the beads. A second eluate of polyA RNA is added to the first eluate. At this time, the eluted RNA was precipitated overnight at -20 ° C using 5 M ammonium acetate, glycogen and 100% ethanol. The poly RNA was centrifuged at 14800 x g for 30 minutes at 4 °C. The supernatant was discarded and the RNA pellet was washed 3 times with 1 ml of 70% ethanol, and the RNA pellet was recovered each time by centrifugation at 4 ° C for 10 minutes. Finally, the poly A RNA pellet was resuspended in an RNA storage solution heated to 70 ° C to dissolve the RNA. Poly A RNA was stored at -80 °C. Adenosine was added to the 3' end of the RNA transcript. Total RNA (40 μg) from HepG2 cells or primary human fibroblasts with Dravid syndrome-associated mutations was mixed with 2 units of RNA Poly (A) polymerase to a final reaction volume of 100 μl (Ambion, Applied Biosystems, St. Austin TX). The ATP used in the polyadenylation reaction was from Invitrogen. After polyadenylation, RNA was purified using phenol/chloroform techniques followed by hepatic glucose/sodium acetate precipitation. This RNA was resuspended in 40 μl of DNAse/RNAse-free water and used in the 3' RACE reaction (from the FirstChoice RLM-RACE kit from Ambion, Applied Biosystems, St. Austin TX). 3' extension of BCN724147 natural antisense transcript of SCN1A. The 3' rapid amplification (RACE) reaction of the two different cDNA ends was performed using the FirstChoice RLM-RACE kit from Ambion, Applied Biosystems (St. Austin, TX). One group used poly A RNA and the other group used total RNA supplemented with 1 adenosine, and the poly A RNA and total RNA were derived from HepG2 cells or primary human fibroblasts with mutations associated with Dravid syndrome. Two consecutive rounds of PCR were performed. The first PCR was performed using the 3' external primer supplied in the kit and the 5' primer (5' GATTCTCCTACA GCAATTGGTA 3') specific for BG724147 designed by OPKO CURNA. The second round of PCR was performed using the 3' external primer supplied in the kit and the different 5' primer (5' GACATGTAATCACTTTCATCAA 3') specific for BG724147 designed by OPKO CURNA. The product of the second PCR reaction was run on a 1% agarose-1 x TAE gel.result : Figure 22 shows the use of poly A RNA from HepG2 cells and total RNA supplemented with adenosine and poly A RNA from primary human fibroblasts with Dravid syndrome-associated mutations and total RNA supplemented with adenosine The product of the second round of PCR reaction of the 3' RACE experiment was performed. One identical bright band was observed in poly A RNA from HepG2 cells and primary human fibroblasts with Dravid syndrome-associated mutations.in conclusion: PCR amplification using a primer specific for the BG724147 natural antisense transcript of SCN1A produces a common PCR bright in two different cells (HepG2 cells and primary human fibroblasts with mutations associated with Dravid syndrome) band. Furthermore, antisense oligonucleotides targeting SCN1A natural antisense BG724147 have been shown to upregulate SCN1A mRNA and protein in such cells as shown in Examples 2, 7 and 16. This data indicates that BG724147 is actually present in both cells (HepG2 cells and primary human fibroblasts with mutations associated with Dravid syndrome).Instance twenty one : SCNA Natural antisense sequence BG724147 Extension The purpose of this experiment was to extend its known sequence by sequencing all sequences of SCN1A natural antisense BG724147. The original BG724147 RNA transcript was obtained from the human test pellet obtained by Miklos Palkovits. A cDNA library prepared in pBluescriptR vector by Michael J. Brownstein (at NHGRI), Shiraki Toshiyuki, and Piero Carninci (at RIKEN). The cDNA libraries were arranged by the I.M.A.G.E. Association (or LLNL) and purely sequenced by Incyte Genomics, Inc. in May 2001. BG724147 pure line is available from Open Biosystems (Open Biosystems Products, Huntsville, AL). In 2001, the cDNA inserted into the BG724147 pure line was not completely sequenced. OPKO-CURNA obtained the BG724147 pure line and sequenced all inserts. To achieve this, a bacterial strain containing a plastid having the BG724147 insert was obtained from Open Biosystems and plated in a Luria Bertani (LB) agar plate containing ampicillin to isolate individual colonies. The colonies were then expanded in 5 ml of LB medium. The plastid containing the BG724147 insert was then isolated from the bacteria and delivered to Davis Sequencing (Davis, CA) for sequencing. materialAnd method: Separation and sequencing SCNA Natural antisense BG724147 It cDNA The plastid. A suspension of frozen bacteria containing BG724147 plastids (Open Biosystems Products, Cat. No. 4829512) was purchased from Open Biosystems, diluted 10, 100, 1000, 10,000, 100000 times, followed by inoculation with 100 μg/ml ampicillin (Calbiochem, catalogue) No. 171254) Luria Bertani (LB) (BD, Cat. No. 244520) agar plate (Falcon, Cat. No. 351055). After 15 hours, 20 individual bacterial colonies were isolated from the 100,000-fold dilution plate and individually grown in 5 ml LB medium (Fisher Scientific, Cat. No. BP1426-2) for 15 hours to 24 hours. At this point, the bacteria were pooled and the plastids (cDNA containing the BG724147 RNA transcript) were isolated using Promega's PureYieldTM plastid small scale purification system kit (Promega, Cat. No. A1222) following the manufacturer's protocol. The isolated DNA was diluted to 200 ng/ml and 12 μl of plastids from each community were delivered to Davis sequencing (Davis, CA) for sequencing.result: The sequence obtained from Davis sequencing provides an extended BG724147 (SEQ ID NO: 12).in conclusion: The BG724147 sequence is known to successfully extend 403 nucleotides to serve as the basis for designing antisense oligonucleotides against the SCN1A natural antisense transcript BG724147. While the invention has been illustrated and described with reference to the embodiments In addition, although a particular feature of the invention may have been disclosed in connection with only one of several embodiments, this feature can be combined with one of the other embodiments as may be required for any given or specific application and for any given or particular application. Or a combination of multiple other features. The Abstract of the Invention will allow the reader to quickly ascertain the nature of the technical disclosure. It should be understood that it does not apply to the scope or meaning of the following claims.

Figure 1 is a graph of real-time PCR results showing fold change + standard deviation of SCN1A mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000 compared to controls. The real-time PCR results showed that the content of SCN1A mRNA in HepG2 cells was significantly increased 48 hours after treatment with one antisense oligonucleotide of SCN1A antisense BG724147. The bars indicated by CUR-1624 to CUR-1627 correspond to the samples treated with SEQ ID NOS: 30 to 33, respectively. Figure 2 is a graph of real-time PCR results showing fold change + standard deviation of SCN1A mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000 compared to controls. The bars indicated by CUR-1628 to CUR-1631 correspond to the samples treated with SEQ ID NOS: 34 to 37, respectively. Figure 3 is a graph of real-time PCR results showing fold change + standard deviation of SCN1A mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000 compared to controls. The bars indicated by CUR-1632 to CUR-1636 correspond to the samples treated with SEQ ID NOS: 38 to 42, respectively. Figure 4 shows dose-dependent up-regulation of SCN1A mRNA in primary human skin fibroblasts with Dravid syndrome-associated mutations. CUR-1916, CUR-1740, CUR-1764 and CUR-1770 correspond to the samples treated with SEQ ID NOS: 70, 45, 52 and 57, respectively. Figure 5 shows a dose-dependent up-regulation of SCN1A mRNA in SK-N-AS cells. CUR-1916, CUR-1740, CUR-1764 and CUR-1770 correspond to the samples treated with SEQ ID NOS: 70, 45, 52 and 57, respectively. Figure 6 shows a dose-dependent up-regulation of SCN1A mRNA in Vero76 cells. CUR-1916, CUR-1740, CUR-1764 and CUR-1770 correspond to the samples treated with SEQ ID NOS: 70, 45, 52 and 57, respectively. Figure 7 shows that SCN1A mRNA upregulation is not caused by non-specific toxicity of antisense oligonucleotides. A- is caused by CUR-1916; B- is caused by CUR-1770. CUR-1462 is an inactive control oligonucleotide of similar chemical composition. Figure 8 shows that the expression of SCN8A and SCN9A channels in human fibroblasts with Dravid-related mutations was not significantly affected by treatment with antisense oligonucleotides targeting the SCN1A natural antisense transcript. A-treated with CUR-1770; B- treated with CUR-1916. Figure 9 shows the stability of antisense oligonucleotides that target SCN1A-specific natural antisense transcripts. Vero 76 cells were treated with two different batches of CUR-1916 synthesized in August 2010 and March 2011 as described in Example 2. The oligonucleotide synthesized in August 2010 was stored as a 1 mM aqueous solution at 4 °C. Oligonucleotides synthesized in March 2011 were shipped in lyophilized form and tested as soon as they arrived. Figure 10 shows the up-regulation of SCN1A protein in fibroblasts with Dravid syndrome mutations treated with antisense oligonucleotides complementary to SCN1A natural antisense. Fibroblasts were grown in 24-well plates and treated with antisense oligonucleotides complementary to SCN1A natural antisense at 20 nM (panel c: CUR-1740; d: CUR-1770; e: CUR-1916) and 0 nM (b) deal with it. Cell lines were treated with anti-SCN1A antibody (Abeam catalog number ab24820) and anti-protein/biotin method (Vector Laboratories catalog number SP-2001; Vector Laboratories catalog number PK-6101; Vector Laboratories catalog number SK-4105). Staining/amplification, staining for SCN1A (be) by indirect immunohistochemistry; Figure a - Negative control, rabbit anti-mouse antibody was used as primary antibody, followed by the same staining procedure as in Figure be. Figure 11 shows up-regulation of SCN1A protein in SK-N-AS cells treated with antisense oligonucleotides complementary to SCN1A natural antisense. SK-N-AS cells were grown in 24-well plates and oligonucleotides were used at 20 nM (c: CUR-1740; d: CUR-1764; e: CUR-1770; f: CUR-1916) and (b :0 nM) to be processed. The SK-N-AS cell line used anti-SCN1A antibody (Abeam catalog number ab24820) and the antibiotic/biotin method (Vector Laboratories catalog number SP-2001; Vector Laboratories catalog number PK-6101; Vector Laboratories catalog number SK-4105) Secondary antibody staining/amplification was performed, and SCN1A (bf) was stained by indirect immunohistochemistry; as a negative control, a rabbit anti-mouse antibody was used as a primary antibody, followed by the same staining procedure as in Figure bf (Fig. a). Figure 12 shows up-regulation of SCN1A protein in Vero 76 cells treated with antisense oligonucleotides complementary to SCN1A natural antisense. Vero 76 cells were grown in 24-well plates and treated with antisense oligonucleotides complementary to SCN1A natural antisense at 20 nM (c: CUR-1740; d: CUR-1945; e: CUR-1770; f: CUR- 1916; g: CUR-1924) and 0 nM (b) are processed. The Vero 76 cell line was treated with anti-SCN1A antibody (Abeam catalog number ab24820) and antibiotic/biotin method (Vector Laboratories catalog number SP-2001; Vector Laboratories catalog number PK-6101; Vector Laboratories catalog number SK-4105). Sub-body staining/amplification, staining for SCN1A (bf) by indirect immunohistochemistry; Figure a - As a negative control, a rabbit anti-mouse antibody was used as a primary antibody, followed by the same staining procedure as in Figure bg. Figure 13 shows that oligonucleotides that target SCN1A mRNA targeting SCN1A-specific natural antisense transcripts do not upregulate actin in Vero76 cells. The same antisense oligonucleotides (CUR-1740, CUR-1838, CUR-1924) targeting SCN1A-specific natural antisense transcripts that up-regulate SCN1A mRNA and protein were shown in Examples 5 and 12 for Vero 76 cells. The effect of β-actin mRNA expression. The data demonstrate that oligonucleotides that target the SCN1A-specific natural antisense transcript do not upregulate non-related genes, such as actin. The bars indicated by CUR-1740, CUR-1838 and CUR-1924 correspond to the samples treated with SEQ ID NOS: 45, 62 and 78, respectively. Figure 14 shows that oligonucleotides targeting SCN1A-specific natural antisense transcripts that up-regulate SCN1A mRNA and protein do not upregulate actin in fibroblasts with Dravid-related mutations. The oligonucleotides (CUR-1916, CUR-1945) targeting SCN1A-specific natural antisense transcripts that up-regulate SCN1A mRNA and protein are shown in Examples 2 and 7 for fibers with Dravid-related mutations. The effect of actin mRNA expression in mother cells. The following data demonstrate that oligonucleotides targeting SCN1A-specific natural antisense transcripts do not upregulate non-related genes, such as actin. The bars indicated by CUR-1916 and CUR-1945 correspond to the samples treated with SEQ ID NOS: 70 and 93, respectively. Figure 15 shows that oligonucleotides targeting SCN1A-specific natural antisense transcripts that up-regulate SCN1A mRNA and protein do not upregulate actin in SK-N-AS cells. The test showed in the examples that the same antisense oligonucleotides (CUR-1740, CUR-1770, CUR-1916, CUR-1764, CUR-1838) that upregulate SCN1A mRNA and protein are involved in the muscles of SK-N-AS cells. The effect of kinesin mRNA expression. The data demonstrate that oligonucleotides that target the SCN1A-specific natural antisense transcript do not upregulate non-related genes, such as actin. The bars indicated by CUR-1740, CUR-1770, CUR-1916, CUR-1764, CUR-1838 correspond to the samples treated with SEQ ID NOS: 45, 57, 70, 52 and 62, respectively. Figure 16 shows the staining of actin in SK-N-AS cells treated with antisense oligonucleotides complementary to SCN1A natural antisense. SK-N-AS cells were grown in 24-well plates with oligonucleotides at 20 nM (b: CUR-1740; c: CUR-1764; d: CUR-1770; e: CUR-1916) and 0 nM (a) deal with it. SK-N-AS cell line uses anti-actin antibody (Abeam catalog number ab1801) and antibiotic/biotin method (Vector Laboratories catalog number SP-2001; Vector Laboratories catalog number PK-6101; Vector Laboratories catalog number SK- 4105) Secondary antibody staining/amplification performed by indirect immunohistochemistry for actin (ae) staining. Figure 17 shows staining of actin in Vero 76 cells treated with antisense oligonucleotides complementary to SCN1A natural antisense. Vero 76 cells were grown in 24-well dishes and treated with antisense oligonucleotides complementary to SCN1A natural antisense at 20 nM (b: CUR-1740; c: CUR-1770; d: CUR-1916; e: CUR- 1924; f: CUR-1945) and 0 nM (a) are processed. The Vero 76 cell line was performed using an anti-actin antibody (Abeam catalog number ab1801) and using the antibiotic/biotin method (Vector Laboratories Cat. No. SP-2001; Vector Laboratories Cat. No. PK-6101; Vector Laboratories Cat. No. SK-4105). Secondary antibody staining/amplification, staining for actin (bf) by indirect immunohistochemistry; Figure a - negative control, rabbit anti-mouse antibody used as primary antibody, followed by staining as in Figure bg program. Figure 18 shows actin upregulation in fibroblasts with Dravid syndrome mutations treated with antisense oligonucleotides complementary to SCN1A natural antisense. Fibroblasts were grown in 24-well plates and treated with antisense oligonucleotides complementary to SCN1A natural antisense at 20 nM (panel b: CUR-1740; c: CUR-1764; d: CUR-1770; e: CUR -1838 and f:CUR-1916) and 0 nM(a) are processed. Cell lines were performed using anti-actin antibody (Abeam catalog number ab1801) and anti-protein/biotin method (Vector Laboratories catalog number SP-2001; Vector Laboratories catalog number PK-6101; Vector Laboratories catalog number SK-4105) Sub-body staining/amplification, staining for actin (af) by indirect immunohistochemistry. Figure 19 shows up-regulation of SCN1A protein in fibroblasts with Dravid syndrome mutations treated with antisense oligonucleotides complementary to SCN1A natural antisense, quantified using ELISA. Fibroblasts were treated with oligonucleotides complementary to the natural antisense of SCN1A at 0 or 80 nM. After 48 hours, the cells were transferred to 96-well plates for 24 hours, then fixed and used for SCN1A and actin ELISA. The OD reading of the SCN1A signal was corrected relative to the actin signal of the same experimental conditions. The corrected SCN1A signal in cells dosed with 0 nM oligonucleotide was used as the baseline (100%). The bars indicated by CUR-1740, CUR-1770 and CUR-1916 correspond to the samples treated with SEQ ID NOS: 45, 57 and 70, respectively. Figure 20 shows up-regulation of SCN1A protein in Vero76 cells treated with antisense oligonucleotides complementary to SCN1A natural antisense, quantified using ELISA. Vero76 cells were treated with antisense oligonucleotides complementary to SCN1A natural antisense at 0 or 80 nM. After 48 hours, the cells were transferred to 96-well plates for 24 hours, then fixed and used for SCN1A and actin ELISA. The OD reading of the SCN1A signal was corrected relative to the actin signal of the same experimental conditions. The corrected SCN1A signal in cells dosed with 0 nM oligonucleotide was used as the baseline (100%). The bars indicated by CUR-1740, CUR-1770, CUR-1916, CUR-1924, CUR-1945 correspond to the samples treated with SEQ ID NOS: 45, 57, 70, 78 and 93, respectively. Figure 21 shows up-regulation of SCN1A protein in SK-N-AS cells treated with oligonucleotides complementary to SCN1A natural antisense, quantified using ELISA. SK-N-AS cells were treated with antisense oligonucleotides complementary to SCN1A natural antisense at 0 or 20 nM. After 48 hours, the cells were transferred to 96-well plates for 24 hours, then fixed and used for SCN1A and actin ELISA. The OD reading of the SCN1A signal was corrected relative to the actin signal of the same experimental conditions. The corrected SCN1A signal in cells dosed with 0 nM oligonucleotide was used as the baseline (100%). The bars indicated by CUR-1740, CUR-1770, CUR-1924, CUR-1945 correspond to the samples treated with SEQ ID NOS: 45, 57, 78 and 93, respectively. Figure 22 shows the product of the second round of PCR of 3' RACE of SCN1A natural antisense transcript BG724147. 3' RACE for: a) total RNA with adenosine from HepG2 cells; b-poly A RNA isolated from HepG2 cells; c-primary human fibroblasts with mutations associated with Dravid syndrome Total RNA with adenosine added; d-poly A RNA isolated from primary human fibroblasts with Dravid syndrome-associated mutations. A 1% agarose gel/1 x TAE negative stained with GelRed (GenScript, catalog number M00120) is shown. The arrows show a bright band shared by HepG2 cells and primary human fibroblasts with Dravid syndrome-associated mutations, demonstrating the presence of BG724147 natural antisense transcripts in these cells. Sequence Listing - SEQ ID NO: 1: Homo sapiens voltage-gated sodium channel type I alpha subunit (SCN1A), transcript variant 1, mRNA (NCBI accession number: NM_001165963); SEQ ID NO: 2: Homo sapiens Voltage-gated sodium channel type II alpha subunit (SCN2A), transcript variant 1, mRNA (NCBI accession number: NM_021007); SEQ ID NO: 3: Homo sapiens voltage-gated sodium ion channel type III alpha subunit (SCN3A), transcript variant 1, mRNA (NCBI accession number: NM_006922); SEQ ID NO: 4: Homo sapiens voltage-gated sodium channel type IV subunit (SCN4A), mRNA (NCBI accession number: NM_000334) SEQ ID NO: 5: Homo sapiens voltage-gated sodium channel V-alpha subunit (SCN5A), transcript variant 1, mRNA (NCBI accession number: NM_198056); SEQ ID NO: 6: Homo sapiens voltage gating Sodium channel type VII alpha (SCN7A), mRNA (NCBI accession number: NM_002976); SEQ ID NO: 7: Homo sapiens voltage-gated sodium channel VIII type alpha subunit (SCN8A), transcript variant 1, mRNA (NCBI accession number: NM_014191); SEQ ID NO: 8: Homo sapiens voltage-gated sodium ion channel type IX alpha subunit (SCN9A), mRNA (NCBI registry No.: NM_002977); SEQ ID NO: 9: Homo sapiens voltage-gated sodium channel X-type alpha subunit (SCN10A), mRNA (NCBI accession number: NM_006514); SEQ ID NO: 10: Homo sapiens voltage-gated sodium Ion channel type XI alpha subunit (SCN11A), mRNA (NCBI accession number: NM_014139); SEQ ID NO: 11: Homo sapiens voltage-gated sodium channel alpha subunit SCN12A (SCN12A) mRNA, complete cds (NCBI registration number :AF109737); SEQ ID NO: 12: native SCN1A antisense sequence (extended BG724147); SEQ ID NO: 13: native SCN1A antisense sequence (Hs. 662210); SEQ ID NO: 14: native SCN1A antisense sequence ( AA383040); SEQ ID NO: 15: native SCN1A antisense sequence (BC029452); SEQ ID NO: 16: native SCN1A antisense sequence (AA630035); SEQ ID NO: 17: native SCN1A antisense sequence (BE566126); SEQ ID NO: 18: native SCN1A antisense sequence (BF673100); SEQ ID NO: 19: native SCN1A antisense sequence (BG181807); SEQ ID NO: 20: native SCN1A antisense sequence (BG183871); SEQ ID NO: 21: natural SCN1A antisense sequence (BG215777); SEQ ID NO: 22: natural SCN1A antisense sequence (BG227970); SEQ ID NO: 23: natural SCN1A antisense sequence (BM90552 7); SEQ ID NO: 24: native SCN1A antisense sequence (BU180772); SEQ ID NO: 25: mouse native SCN1A antisense sequence (BG724147 ExtMouse); SEQ ID NO: 26: mouse native SCN1A antisense sequence ( Hs.662210 mouse AS1); SEQ ID NO: 27: mouse native SCN1A antisense sequence (Hs.662210 mouse AS2); SEQ ID NO: 28: mouse native SCN1A antisense sequence (Hs.662210 mouse AS3) SEQ ID NOs: 29 to 94: Antisense oligonucleotides. SEQ ID NOS: 95 and 96 are the reverse complement of the antisense oligonucleotides SEQ ID NOS: 58 and 59, respectively. * indicates a phosphorothioate linkage, + indicates LNA, "r" indicates RNA and "m" indicates a methyl group on the 2' oxygen atom on the designated sugar moiety of the oligonucleotide.

Claims (56)

A method for the in vitro regulation of the function and/or expression of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in a biological system comprising: rendering the system with at least one nucleotide of 5 to 30 nucleotides in length An antisense oligonucleotide contact, wherein the at least one oligonucleotide has at least 50% sequence identity to a reverse complement of a natural antisense of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide; Thereby the function and/or performance of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide is modulated. A method of regulating the function and/or performance of a voltage-gated sodium ion channel alpha subunit SCN1A polynucleotide in a biological system according to claim 1, comprising: bringing the biological system to at least one 5 to 30 nucleosides in length An acid antisense oligonucleotide contact, wherein the at least one oligonucleotide has at least a reverse complement sequence comprising a polynucleotide of 5 to 30 contiguous nucleotides within the nucleotide of the natural antisense transcript below 50% sequence identity: SEQ ID NO: 12 to 1123 and SEQ ID NO: 13 to 1 to 2352, SEQ ID NO: 14 to 1 to 267, SEQ ID NO: 15 to 1 to 1080, SEQ ID NO: 16 to 1 173, 1 to 618 of SEQ ID NO: 17, 1 to 871 of SEQ ID NO: 18, 1 to 304 of SEQ ID NO: 19, 1 to 293 of SEQ ID NO: 20, SEQ ID NO: 21 to 1 892, 1 to 260 of SEQ ID NO: 22, 1 to 982 of SEQ ID NO: 23, 1 to 906 of SEQ ID NO: 24, 1 to 476 of SEQ ID NO: 25, SEQ ID NO: 26 to 1 185, SEQ ID NO: 27 to 1 to 162, and SEQ ID NO: 28 to 1 to 94; thereby modulating the voltage-gated sodium ion channel type I alpha subunit (SCN1A) polynucleotide Function and / or performance. A method for the in vitro regulation of the function and/or expression of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in a patient cell or tissue, comprising: bringing the cells or tissues to at least one length 5 to a 30 nucleotide antisense oligonucleotide contact, wherein the oligonucleotide has at least 50% sequence to the antisense oligonucleotide of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide Consistency; thereby modulating the function and/or performance of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in a patient cell or tissue or in vitro. A method of regulating the function and/or expression of a voltage-gated sodium ion channel type I alpha subunit (SCN1A) polynucleotide in a patient cell or tissue of claim 3, comprising: causing the biological system to be at least one An antisense oligonucleotide of 5 to 30 nucleotides in length, wherein the at least one oligonucleotide and a polynucleotide comprising 5 to 30 contiguous nucleotides within the nucleotide of the natural antisense transcript below The reverse complement sequence has at least 50% sequence identity: SEQ ID NO: 12 to 1123 and SEQ ID NO: 13 to 1 to 2352, SEQ ID NO: 14 to 1 to 267, and SEQ ID NO: 15 Up to 1080, SEQ ID NO: 16 to 1 to 173, SEQ ID NO: 17 to 1 to 618, SEQ ID NO: 18 to 1 to 871, SEQ ID NO: 19 to 1 to 304, and SEQ ID NO: 20 To 293, 1 to 892 of SEQ ID NO: 21, 1 to 260 of SEQ ID NO: 22, 1 to 982 of SEQ ID NO: 23, 1 to 906 of SEQ ID NO: 24, 1 of SEQ ID NO: 25 To 476, SEQ ID NO: 26 to 1 to 185, SEQ ID NO: 27 to 1 to 162, and SEQ ID NO: 28 to 1 to 94; thereby modulating the voltage-gated sodium ion channel type I alpha subunit ( SCN1A) The function and/or performance of a polynucleotide. A method for the in vitro regulation of the function and/or performance of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in a biological system, comprising: targeting the system with at least one of the voltage-gated sodium ions Antisense oligonucleotide contact of one of the natural antisense oligonucleotides of the channel alpha subunit (SCNA) polynucleotide; thereby modulating the voltage-gated sodium channel alpha subunit (SCNA) polynucleoside The function and / or performance of acid. The method of claim 5, wherein the function and/or performance of the voltage-gated sodium ion channel alpha subunit (SCNA) is increased in vitro relative to the control. The method of claim 5, wherein the at least one antisense oligonucleotide targets a natural antisense sequence of a voltage-gated sodium ion channel type I alpha unit (SCN1A) polynucleotide. The method of claim 5, wherein the at least one antisense oligonucleotide targets a nucleic acid comprising a voltage-gated sodium ion channel type I alpha subunit (SCN1A) polynucleotide encoding and/or non-coding nucleic acid sequence sequence. The method of claim 5, wherein the at least one antisense oligonucleotide targets an overlapping and/or non-overlapping sequence of a voltage-gated sodium ion channel type I alpha unit (SCN1A) polynucleotide. The method of claim 5, wherein the at least one antisense oligonucleotide comprises one or more modifications selected from the group consisting of at least one modified sugar moiety, at least one modified internucleoside linkage, at least one Modified nucleotides and combinations thereof. The method of claim 10, wherein the one or more modifications comprise at least one modified sugar moiety selected from the group consisting of 2'-O-methoxyethyl modified sugar moieties, 2'-methoxy modification A sugar moiety, a 2'-O-alkyl modified sugar moiety, a bicyclic sugar moiety, and combinations thereof. The method of claim 10, wherein the one or more modifications comprise at least one modified internucleoside linkage selected from the group consisting of phosphorothioate, 2'-Omethoxyethyl (MOE), 2' - fluorine, alkyl phosphonates, dithiophosphates, thioalkyl phosphonates, phosphoramidates, urethanes, carbonates, phosphates, acetates ( Acetami-date), carboxymethyl esters, and combinations thereof. The method of claim 10, wherein the one or more modifications comprise at least one modified nucleotide selected from the group consisting of a peptide nucleic acid (PNA), a locked nucleic acid (LNA), an arabinic acid (FANA), an analog thereof , derivatives and combinations. The method of claim 1, wherein the at least one oligonucleotide comprises at least one oligonucleotide sequence as set forth in SEQ ID NOs: 29-94. A method for the in vitro regulation of the function and/or expression of a voltage-gated sodium channel alpha subunit (SCNA) gene in a mammalian cell or tissue, comprising: cultivating the cell or tissue with at least one length 5 in vitro Up to 30 nucleotide short interfering RNA (siRNA) oligonucleotide contacts, antisense polynucleosides of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide The acid is specific, wherein the at least one siRNA oligonucleotide is at least about 5 contiguous nucleic acids of the antisense and/or sense nucleic acid molecule of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide The complementary sequence has at least 50% sequence identity; and modulates the function and/or expression of a voltage-gated sodium ion channel alpha subunit (SCNA) in a mammalian cell or tissue. The method of claim 15, wherein the oligonucleotide is at least about 5 contiguous nucleic acids complementary to an antisense and/or sense nucleic acid molecule of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide. The sequence has at least 80% sequence identity. A method for the in vitro regulation of the function and/or expression of a voltage-gated sodium ion channel alpha subunit (SCNA) in a mammalian cell or tissue, comprising: subjecting the cell or tissue to at least one length of about 5 in vitro Antisense oligonucleotides specific to a non-coding and/or coding sequence of a 30-nucleotide pair of voltage-gated sodium channel alpha subunit (SCNA) polynucleotides and/or natural antisense strands Glucuronide contact, wherein the at least one antisense oligonucleotide has at least 50% sequence identity to at least one of the nucleic acid sequences set forth in SEQ ID NOS: 1 to 28; and modulating the voltage-gated sodium ion channel alpha subunit ( SCNA) Function and/or performance in mammalian cells or tissues. Use of at least one antisense oligonucleotide of 5 to 30 nucleotides in length for the manufacture of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in a biological system and And/or performance; wherein the at least one oligonucleotide has at least 50% sequence identity to a natural antisense reverse complement of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide. The use of claim 18, wherein the oligonucleotide has at least 50% sequence identity to a reverse complement comprising a polynucleotide of 5 to 30 contiguous nucleotides within the nucleotide of the natural antisense transcript: SEQ ID NO: 12 to 1123 and SEQ ID NO: 13 to 1 to 2352, SEQ ID NO: 14 to 1 to 267, SEQ ID NO: 15 to 1 to 1080, and SEQ ID NO: 16 to 1 to 173 SEQ ID NO: 17 to 1 to 618, SEQ ID NO: 18 to 1 to 871, SEQ ID NO: 19 to 1 to 304, SEQ ID NO: 20 to 1 to 293, and SEQ ID NO: 21 to 1 to 892 1 to 260 of SEQ ID NO: 22, 1 to 982 of SEQ ID NO: 23, 1 to 906 of SEQ ID NO: 24, 1 to 476 of SEQ ID NO: 25, 1 to 185 of SEQ ID NO: 26. SEQ ID NO: 27 to 1 to 162 and SEQ ID NO: 28 to 1 to 94. Use of at least one antisense oligonucleotide of 5 to 30 nucleotides in length for the manufacture of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in a patient cell or tissue The agent and/or agent of the agent, wherein the oligonucleotide has at least 50% sequence identity to the antisense oligonucleotide of the voltage-gated sodium channel alpha subunit (SCNA) polynucleotide. The use of claim 20, wherein the oligonucleotide has at least 50% sequence identity to a reverse complement comprising a polynucleotide of 5 to 30 contiguous nucleotides within the nucleotide of the natural antisense transcript: SEQ ID NO: 12 to 1123 and SEQ ID NO: 13 to 1 to 2352, SEQ ID NO: 14 to 1 to 267, SEQ ID NO: 15 to 1 to 1080, and SEQ ID NO: 16 to 1 to 173 SEQ ID NO: 17 to 1 to 618, SEQ ID NO: 18 to 1 to 871, SEQ ID NO: 19 to 1 to 304, SEQ ID NO: 20 to 1 to 293, and SEQ ID NO: 21 to 1 to 892 1 to 260 of SEQ ID NO: 22, 1 to 982 of SEQ ID NO: 23, 1 to 906 of SEQ ID NO: 24, 1 to 476 of SEQ ID NO: 25, 1 to 185 of SEQ ID NO: 26. SEQ ID NO: 27 to 1 to 162 and SEQ ID NO: 28 to 1 to 94. Use of an antisense oligonucleotide targeting a region of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide in the region of a natural antisense oligonucleotide, which is used in the manufacture of regulated voltage gating An agent that functions and/or expresses a sodium ion channel alpha subunit (SCNA) polynucleotide in a biological system. The use of claim 22, wherein the function and/or performance of the voltage-gated sodium ion channel alpha subunit (SCNA) is increased in vivo relative to a control. The use of claim 22, wherein the antisense oligonucleotide targets a natural antisense sequence of a voltage-gated sodium ion channel type I alpha subunit (SCN1A) polynucleotide. The use of claim 22, wherein the antisense oligonucleotide targets a nucleic acid sequence comprising a voltage-gated sodium ion channel type I alpha subunit (SCN1A) polynucleotide encoding and/or non-coding nucleic acid sequence. The use of claim 22, wherein the at least one antisense oligonucleotide targets an overlapping and/or non-overlapping sequence of a voltage-gated sodium ion channel type I alpha unit (SCN1A) polynucleotide. The use of claim 22, wherein the antisense oligonucleotide comprises one or more modifications selected from the group consisting of at least one modified sugar moiety, at least one modified internucleoside linkage, at least one modified Nucleotides and combinations thereof. The use of claim 27, wherein the one or more modifications comprise at least one modified sugar moiety selected from the group consisting of 2'-O-methoxyethyl modified sugar moieties, 2'-methoxy modification A sugar moiety, a 2'-O-alkyl modified sugar moiety, a bicyclic sugar moiety, and combinations thereof. The use of claim 27, wherein the one or more modifications comprise at least one modified internucleoside linkage selected from the group consisting of phosphorothioate, 2'-Omethoxyethyl (MOE), 2' -Fluorine, alkylphosphonate, dithiophosphate, thioalkylphosphonate, amino phosphate, urethane, carbonate, phosphotriester, acetate, carboxymethyl Esters and combinations thereof. The use of claim 27, wherein the one or more modifications comprise at least one modified nucleotide selected from the group consisting of peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinic acid (FANA), analogs thereof , derivatives and combinations. The use of claim 18, wherein the oligonucleotide comprises at least one oligonucleotide sequence as set forth in SEQ ID NOs: 29-94. Use of at least one short interfering RNA (siRNA) oligonucleotide of 5 to 30 nucleotides in length for the production of a voltage-gated sodium ion channel alpha subunit (SCNA) gene in a mammalian cell or An agent for function and/or performance in a tissue; wherein the at least one siRNA oligonucleotide is specific for an antisense polynucleotide of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide, wherein At least one siRNA oligonucleotide having at least 50% sequence to the antisense of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide and/or the complement of at least about 5 contiguous nucleic acids of the sense nucleic acid molecule consistency. The use of claim 32, wherein the oligonucleotide is at least about 5 contiguous nucleic acids complementary to an antisense and/or sense nucleic acid molecule of the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide. The sequence has at least 80% sequence identity. A non-coding and/or coding sequence of about 5 to 30 nucleotides in length for a sense-activated and/or natural antisense strand of a voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide Use of an antisense oligonucleotide for the manufacture of an agent for regulating the function and/or expression of a voltage-gated sodium ion channel alpha subunit (SCNA) in a mammalian cell or tissue, wherein the antisense oligonucleotide The nucleotide has at least 50% sequence identity to at least one of the nucleic acid sequences set forth in SEQ ID NOS: 1 to 28. A synthetic modified oligonucleotide comprising at least one modification, wherein the at least one modification is selected from the group consisting of: at least one modified sugar moiety; at least one modified internucleotide linkage; at least one modified core And a combination thereof; wherein the oligonucleotide is an antisense compound that hybridizes in vivo or in vitro to a voltage-gated sodium ion channel alpha subunit (SCNA) gene and modulates its function and/or Characterization, and wherein the oligonucleotide and the voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide antisense and/or sense nucleic acid molecule and its dual gene, homologue, isoform Sequences of at least about 5 contiguous nucleic acids that are complementary to isoforms, variants, derivatives, mutants, fragments or combinations have at least 50% sequence identity. The oligonucleotide of claim 35, wherein the oligonucleotide is 5 to 30 nucleotides in length and is inverted from 5-30 contiguous nucleotides within the native antisense transcript of the SCNA gene The complementary sequence has at least 50% sequence identity. The oligonucleotide of claim 36, wherein the at least one modification comprises an internucleotide linkage selected from the group consisting of phosphorothioate, alkyl phosphonate, dithiophosphate, thioalkyl Phosphonates, aminophosphates, urethanes, carbonates, phosphates, acetates, carboxymethyl esters, and combinations thereof. The oligonucleotide of claim 36, wherein the oligonucleotide comprises at least one phosphorothioate internucleotide linkage. The oligonucleotide of claim 36, wherein the oligonucleotide comprises a backbone of phosphorothioate internucleotide linkages. The oligonucleotide of claim 36, wherein the oligonucleotide comprises at least one modified nucleotide selected from the group consisting of: a peptide nucleic acid, a locked nucleic acid (LNA), an analog thereof, and a derivative. Things and combinations. The oligonucleotide of claim 36, wherein the oligonucleotide comprises a plurality of modifications, wherein the modifications comprise modified nucleotides selected from the group consisting of phosphorothioates, alkyl phosphonates, disulfides Phosphate, thioalkylphosphonate, amino phosphate, urethane, carbonate, phosphotriester, acetate, carboxymethyl ester, and combinations thereof. The oligonucleotide of claim 36, wherein the oligonucleotide comprises a plurality of modifications, wherein the modifications comprise modified nucleotides selected from the group consisting of peptide nucleic acids, locked nucleic acids (LNA), analogs thereof, Derivatives and combinations. The oligonucleotide of claim 36, wherein the oligonucleotide comprises at least one modified sugar moiety selected from the group consisting of a 2'-O-methoxyethyl modified sugar moiety, 2'-methoxy Modified sugar moieties, 2'-O-alkyl modified sugar moieties, bicyclic sugar moieties, and combinations thereof. The oligonucleotide of claim 36, wherein the oligonucleotide comprises a plurality of modifications, wherein the modifications comprise a modified sugar moiety selected from the group consisting of 2'-O-methoxyethyl modified sugar moieties 2'-methoxy modified sugar moiety, 2'-O-alkyl modified sugar moiety, bicyclic sugar moiety, and combinations thereof. The oligonucleotide of claim 36, wherein the oligonucleotide has a length of at least about 5 to 30 nucleotides and is associated with a voltage-gated sodium ion channel type I alpha unit (SCN1A) polynucleotide Antisense and/or sense strand hybridization, wherein the oligonucleotide is antisense and/or sense encoded and/or non-insensitive to the voltage-gated sodium channel type I alpha unit (SCN1A) polynucleotide A complementary sequence of at least about 5 contiguous nucleic acids encoding a nucleic acid sequence has at least about 60% sequence identity. An oligonucleotide according to claim 36, wherein the oligonucleotide is antisense and/or sense-coded and/or non-insensitive to the voltage-gated sodium ion channel type I alpha unit (SCN1A) polynucleotide A complementary sequence of at least about 5 contiguous nucleic acids encoding a nucleic acid sequence has at least about 80% sequence identity. An oligonucleotide according to claim 36, wherein the oligonucleotide hybridizes to at least one voltage-gated sodium channel type I alpha unit (SCN1A) polynucleotide in vivo or in vitro compared to a normal control. And adjust its performance and / or function. The oligonucleotide of claim 36, wherein the oligonucleotide comprises the sequence set forth in SEQ ID NOs: 29-94. A pharmaceutical composition comprising one or more oligonucleotides as claimed in claim 35 which are specific for one or more voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotides and pharmaceutically acceptable excipient. The composition of claim 49, wherein the oligonucleotides have at least about 40% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 29-94. The composition of claim 49, wherein the oligonucleotides comprise the nucleotide sequences set forth in SEQ ID NOs: 29-94. The composition of claim 51, wherein the oligonucleotides set forth in SEQ ID NOs: 29 to 94 comprise one or more modifications or substitutions. The composition of claim 52, wherein the one or more modifications are selected from the group consisting of: phosphorothioates, methylphosphonates, peptide nucleic acids, locked nucleic acid (LNA) molecules, and combinations thereof. a method of binding to a natural antisense sequence of at least one voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide and modulating the performance of the at least one voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide Use of an antisense oligonucleotide for the manufacture of a medicament for preventing or treating a disease associated with at least one voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide and/or at least one of its encoded products . The use of claim 54, wherein the disease associated with the at least one voltage-gated sodium ion channel alpha subunit (SCNA) polynucleotide is selected from the group consisting of: a disease or condition associated with abnormal function and/or performance of SCNA, Neurological diseases or conditions, convulsions, pain (including chronic pain), impaired electrical excitability involving sodium ion channel dysfunction, diseases or conditions associated with sodium ion channel dysfunction, and voltage-gated sodium ion channel alpha subunit activity Diseases or conditions associated with misregulation (eg paralysis, hyperkalemia, periodic paralysis, congenital myocardium, muscle weakness of potassium deterioration, long QT syndrome 3, motor endplate disease, mutual aid) Disorders, etc., gastrointestinal diseases (such as colitis, ileitis, inflammatory bowel syndrome, etc.), cardiovascular diseases or conditions (such as hypertension, congestive heart failure, etc.) attributed to dysfunction of the enteric nervous system; Sympathetic and parasympathetic nerve distribution of the genitourinary tract diseases or conditions (eg, prostate hyperplasia, impotence); diseases associated with the neuromuscular system Disease or condition (eg, muscular dystrophy, multiple sclerosis, epilepsy, autism, migraine (eg, sporadic and familial hemiplegic migraine), severe infantile epilepsy (SMEI) , systemic epilepsy ( GEFS+ ), etc. with febrile seizure plus, and SCNA-related seizure disorders. An method for identifying and selecting at least one oligonucleotide that is selective for a selected target polynucleotide of a natural antisense transcript of a SCNA gene for in vivo administration, comprising identifying at least one comprising at least partially complementary to the An oligonucleotide of at least 5 contiguous nucleotides of an antisense polynucleotide of a polynucleotide of interest; measuring the antisense oligonucleotide under the stringent hybridization conditions with the target polynucleotide or the selected The thermal melting point of the hybrid of the polynucleotide of the target polynucleotide antisense; and based on the information obtained, at least one oligonucleotide is selected for in vivo administration.