TW201536918A - Generation of neural stem cells from human trophoblast stem cells - Google Patents

Abstract

Provided herein are isolated neural stem cells. Also provided are methods for treatment of neurodegenerative diseases using suitable preparations comprising the isolated neural stem cells.

Description

Generation of neural stem cells from human trophoblast stem cells

This application claims the benefit of U.S. Provisional Application No. 61/413,892, filed on November 15, 2010, and U.S. Provisional Application No. 61/434,790, filed on Jan. 20, 2011. This is incorporated herein by reference.

Human trophoblast stem (hTS) cells are capable of infinite proliferation in vitro in an undifferentiated state. hTS cells maintain potential multilineage differentiation capabilities. The hTS cell preparation can be induced to differentiate into cells of the trophoblast lineage either in vitro or in vivo . Further, hTS cells can be induced to differentiate into neurons, such as dopaminergic neurons. hTS cells can be used to treat a functional abnormality or deletion of dopamine neurons in the nigrostriatal pathway, such as neurodegenerative disorders in humans.

Summary of invention

Neurodegenerative disorders have deep socio-economic effects in the human race. Current drugs are only provided by alleviating specific symptoms of neurodegenerative disorders such as Parkinson's disease, Alzheimer's disease, Huntington's disease or the like. Limited benefits. Parkinson's disease (PD) is caused by dysfunction or loss of dopamine neurons in the nigrostriatal pathway and is a common neurodegenerative disorder in humans. Provided here for use in neurodegenerative disorders [including Parkinson's disease, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple system atrophy (multiple) System atrophy), Lewy body dementia, peripheral sensory neuropathies, or alternative cell-based on spinal cord injuries in mammals Isolated neural stem cells of cell-based therapy.

In one aspect, provided herein are isolated neural stem cells, wherein the isolated neural stem cells are derived from a trophoblast tissue. In some embodiments, the trophoblast tissue is a human trophoblast tissue.

In one embodiment, an isolated neural stem cell described herein is expressed against one or more caudal type homeobox 2 (Cdx2), Nanog homeobox, nestin (nestin). ), octamer-binding transcription factor 4 (Oct-4), neurofilament, neuron-3 (NgN3), Neo-D, microtubule-associativity protein -2 (microtubule-associated protein-2 , MAP-2), CD133, retinoic acid receptor β (retinoic acid receptor beta, RAR β), retinoid X receptor α (retinoid X receptor alpha, RXR α) , retinoid X receptor β (retinoid X receptor beta, RXR β), cellular retinoic acid binding protein 2 (cellular retinoic acid binding protein 2 , CRABP-2), cellular retinol binding protein 1 (cellular retinol binding protein 1, CRBP-1), retinaldehyde dehydrogenase 2 (RALDH-2) or retinaldehyde dehydrogenase 3 (RALDH-3) transcript.

In one embodiment, the isolated neural stem cell is a human neural stem cell. In one embodiment, the cell has a normal karyotype. In another embodiment, the isolated neural stem cells have one or more immune-privileged characteristics. In another embodiment, the one or more immune-exempt properties comprise a lack of performance of CD33 and/or a manifestation of CD133.

Further provided herein is a method of differentiating the isolated neural stem cells into neurons, the method comprising: administering the isolated neural stem cells to a mammalian brain, wherein the isolated Neural stem cells differentiate into a neuron. In another embodiment, the neuron is a dopamine neuron, a glutaminergic neuron, a serotonergic neuron or a GABAergic ( gamma -aminobutyric acid) neuron.

In one embodiment, the administered (eg, transplanted) isolated neural stem cells are pre-induced to an induction drug prior to administration. In another embodiment, the isolated neural stem cells are not pre-induced to induce a drug prior to administration.

In one embodiment, the mammalian brain is damaged or has suffered neuronal loss prior to administration. In another embodiment, the damage is directed to a dopamine neuron, a glutamate neuron, a serum-based neuron, or a GABAergic ( gamma -aminobutyric acid) neuron. In another embodiment, the neuronal deletion is directed to a dopamine neuron.

In one embodiment, the cell is transfected with an expression vector.

In another embodiment, the isolated neural stem cell, after being administered to the brain of the individual, is transferred to the substantia nigra pars compacta (SNC) region of the individual's brain. In another embodiment, the administration enhances the sensorimotor function in the mammal. In another embodiment, the administration results in a decrease in rigidity, akinesia, or balance impairment of the mammal.

Provided herein are methods for differentiating isolated neural stem cells into dopamine neurons, the methods comprising: administering the isolated neural stem cells to a mammalian brain, wherein the isolated nerves Stem cells are expressed against one or more of Cdx2, Nanog, Nestin, Oct-4, neurofilament, NgN3, Neo-D, MAP-2, CD133, RAR β , RXR α , RXR β , CRABP-2, CRBP-1 A transcript of RALDH-2 or RALDH-3, wherein the mammalian brain is damaged or has suffered neuronal loss, wherein one or more of the isolated neural stem cells differentiate into dopamine neurons.

Provided herein is a method of differentiating isolated neural stem cells into dopamine neurons, the method comprising: administering the isolated neural stem cells to a mammalian brain, wherein the isolated neural stem cells are Derived from trophoblast tissue in which the brain of the mammal is damaged or has been deficient in neurons, wherein one or more of the isolated neural stem cells differentiate into dopamine neurons.

In one embodiment of the method described above, the administration enhances sensorimotor function in the mammal. In another embodiment of the method described above, the administration results in a decrease in stiffness, movement disability, or balance disorder in the mammal.

Provided herein is a method for differentiating an isolated human trophoblast stem cell into a neural stem cell comprising: regulating a Cdx2, Nanog, nestin, Oct4, neurofilament, NgN3, Neo- Activity of D, MAP-2, CD133, RAR β , RXR α , RXR β , CRABP-2, CRBP-1, RALDH-2 or RALDH-3 genes.

Provided herein is a method for differentiating an isolated human trophoblast stem cell into a neural stem cell comprising: regulating a Cdx2, Nanog, nestin, Oct4, neurofilament, NgN3, Neo-D, MAP-2, CD133 , the level of RAR β , RXR α , RXR β , CRABP-2, CRBP-1, RALDH-2 or RALDH-3 transcripts.

Provided herein is a method for differentiating an isolated human trophoblast stem cell into a neural stem cell comprising: modulating a Cdx2, Nanog, nestin, Oct4, neurofilament, NgN3, Neo-D, MAP-2, CD133 , the level or activity of RAR β , RXR α , RXR β , CRABP-2, CRBP-1, RALDH-2 or RALDH-3 proteins.

Provided herein is a method of screening a compound for use in treating or preventing a disease comprising: contacting an isolated human trophoblast stem cell with the compound; and detecting at least one gene in the human trophoblast stem cell, A change in the activity of a transcript or protein. In a specific embodiment of the method described above, at least one gene, transcript or protein in the human trophoblast stem cell is compared to a comparable isolated human trophoblast stem cell that is not contacted with the compound Reduced activity. In another embodiment of the method described above, at least one gene, transcript or protein in the human trophoblast stem cell when compared to a comparable isolated human trophoblast stem cell not in contact with the compound The activity increases. In another embodiment of the method described above, the disease is a neurodegenerative disorder. In another embodiment of the method described above, the disease is Parkinson's disease, Alzheimer's disease, schizophrenia or systolic lateral sclerosis.

Provided herein is a method of screening a compound for use in treating or preventing a disease comprising: contacting an isolated human trophoblast stem cell with the compound; and detecting the human trophoblast stem cell A change in the level of at least one transcript or protein. In one embodiment of the method described above, at least one transcript or protein level is reduced in the human trophoblast stem cells when compared to a human trophoblast stem cell that is not contacted with the compound. In another embodiment of the method described above, at least one transcript or protein position in the human trophoblast stem cell when compared to a comparable isolated human trophoblast stem cell that is not contacted with the compound Increase in quasi. In another embodiment of the method described above, the disease is a neurodegenerative disorder. In another specific embodiment of the method described above, the disease is Parkinson's disease, Alzheimer's disease, schizophrenia or systolic lateral sclerosis.

Provided herein is a method of screening for a compound capable of inducing alteration in a cell comprising: contacting an isolated human trophoblast stem cell with the compound; and detecting an induced differentiation of the human trophoblast stem cell.

Provided herein is a method of screening for a compound capable of inducing alteration in a cell comprising: contacting an isolated neural stem cell with the compound; and detecting an induced differentiation of the neural stem cell.

Provided herein is a method of screening a compound for use in treating or preventing a disease comprising: contacting an isolated neural stem cell with the compound; and detecting at least one gene, transcript or protein in the neural stem cell A change in activity. In one embodiment of the method described above, at least one gene, transcript or protein activity is reduced in the neural stem cell when compared to a comparable isolated neural stem cell that is not contacted with the compound. Another method of the method described above In one embodiment, the activity of at least one gene, transcript or protein is increased in the neural stem cell when compared to a comparable isolated neural stem cell that is not contacted with the compound. In another embodiment of the method described above, the disease is a neurodegenerative disorder. In a specific embodiment, the disease is Parkinson's disease, Alzheimer's disease, schizophrenia or systolic lateral sclerosis.

Provided herein is a method of screening a compound for use in treating or preventing a disease comprising: contacting an isolated neural stem cell with the compound; and detecting at least one transcript or protein in the neural stem cell A change on the standard. In one embodiment of the method described above, at least one transcript or protein level is reduced in the neural stem cell when compared to a comparable isolated neural stem cell that is not contacted with the compound. In another embodiment of the method described above, at least one transcript or protein level is increased in the neural stem cell when compared to a comparable isolated neural stem cell that is not contacted with the compound. In another embodiment of the method described above, the disease is a neurodegenerative disorder. In another specific embodiment of the method described above, the disease is Parkinson's disease, Alzheimer's disease, schizophrenia or systolic lateral sclerosis.

A specific example provided herein describes a method of treating a neurological disorder in a mammal in need thereof, comprising: administering at least one neural stem cell to the mammal, wherein the cell is Immune exempt. In another embodiment, the mammal is a mouse, rat, pig, dog, monkey, orangutan or human ape. In another embodiment, the mammal is a human.

In one embodiment, the mammal in need thereof has one or more symptoms associated with a neurological disorder. In another embodiment, the one or more symptoms are selected from the group consisting of: stiffness, motion disability, balance disorder, tremor, gait disorder, adverse steps Maldispositional gait, dementia, excessive swelling [edema], muscle weakness, atrophy in the lower extremity, movement disorder [dance disease] (chorea)], muscle rigidity, slowing of physical movement [bradykinesia], lack of physical movement (exercise disability), forgetfulness, cognitive (smart) damage [cognitive( Intellectual)impairment], loss of recognition [agnosia], impaired function (such as decision making and planning), hemifacial paralysis, sensory deficits, Numbness, tingling, painful paresthesias in the extremities, weakness, cranial nerve palsies, speech disorder Ty with speech), eye movements, visual field defects, blindness, hemorrhage, exudates, proximal muscle wasting, dyskinesia (dyskinesia), abnormality of tonus in limb muscles, decrease in myotony, incoordination, finger-finger test or finger-nose test Indication of error in trial, dysmetria, Holmes-Stewart phenomenon, incomplete or complete systemic paralysis, optic neuritis, Multiple vision, ocular motor disturbance [such as nystagmus], spastic paralysis, painful tonic seizure, Lhermitte's syndrome ( Lhermitte syndrome, ataxia, mogilalia, vesicorectal disturbance, orthostatic hypotension, decrease in motor function, bed wetting, Poor verbalization, poor sleep patterns, sleep disturbance, appetite disturbance, change in weight, psychomotor agitation or hysteresis (psychomotor) Agitation or retardation), reduced energy, feelingless or excessive Inappropriate guilt, difficulty in thinking or concentration, repeated intentions of death or suicidal thoughts or attempts, fearfulness, anxiety, irritability, contemplative or obsessive rumination ), excessive concern with physical health, panic attacks, and phobias. In another embodiment, the neurological disorder is Parkinson's disease, Alzheimer's disease, Huntington's disease, systolic lateral sclerosis, Friedreich's ataxia, and Louis's body. Lewy body disease, spinal muscular atrophy (spinal muscular atrophy), multiple system atrophy, dementia, schizophrenia, paralysis, multiple sclerosis, spinal cord injury, brain injuries (eg, stroke), cranial nerves Cranial nerve disorders, peripheral sensory neuropathy, epilepsy, prion disorders, Creutzfeldt-Jakob disease, Alper's disease, cerebellum/spinal Cerebellar/spinocerebellar degeneration, Batten disease, corticobasal degeneration, Bell's palsy, Guillain-Barre Syndrome, Pico Pick's disease and autism.

In a specific embodiment, also provided herein is a method of treating a neurological disorder in a mammal in need thereof, comprising: administering at least one neural stem cell to the mammal, wherein the cell is Immune-exempted and derived from trophoblast tissue. In another embodiment, the immune-immunized cells have a low level of CD33 expression. In another embodiment, the immune-immunized cells have a low level of CD133 expression. In another embodiment, the neuronal progenitor stem cell does not elicit an immune response. In another embodiment, the neuronal progenitor stem cells do not form a tumor. In another embodiment, the neural stem cell is expressed against one or more of Cdx2, Nanog, Nestin, Oct-4, Neurofilament, NgN3, Neo-D, MAP-2, CD133, RAR β , RXR α , RXR Transcripts of β , CRABP-2, CRBP-1, RALDH-2 or RALDH-3.

In another embodiment, the method further comprises: administering the one or more neural stem cells to the brain of a mammal, wherein the cell differentiates into a neuron. In another embodiment, the administration comprises injection or implantation. In another embodiment, the neuron is a dopamine neuron, a glutamate neuron, a serum-based neuron, or a GABAergic ( gamma -aminobutyric acid) neuron. In another embodiment, the progenitor cell is pre-induced to induce a drug prior to administration.

In one embodiment, also provided herein is a method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties, comprising: (a) contacting the stem cell with an inducing drug; (b) the stem cells to the inducing drugs to adjust one or more proteins, wherein the one or more proteins comprising: Wnt2B, Fzd6, Dvl3, FRAT1 , GSK3 β, HDAC6, β - _{catenin, G α q / 11, G} β , RXR α , RAR β , GLuR1, PI3K, AKt1, AKt2, AKt3, mTOR, elf4EBP, CREB1, TH (tyrosine hydroxylase), PLC- β , PIP ₂ , CaMKII, elf4B, parkin, SNCA, microtubule Protein (tubulin), calcineurin (calcineurin), CRMP-2, NFAT1, importin, LEF1, Pitx2, MEF2A or EP300; and (c) induce or promote differentiation of the stem cell into a neuron Characteristic cells.

In one embodiment, the stem cell is a mammalian trophoblast stem cell. In another embodiment, the stem cell is a mammalian embryonic stem cell. In another specific example, the stem cell is a feeding Mammalian induced pluripotent stem cells. In another embodiment, the stem cell is an endodermal, mesoderm, ectoderm or mesodermal (ectodermal or mesenchymal stem cell). In another embodiment, the stem cells are from a mouse, rat, human, chimpanzee, gorilla, dog, pig, goat, dolphin or cow. In another embodiment, the stem cells are from a human. In another embodiment, the stem cell is a human trophoblast stem cell. In another embodiment, the neuronal cell is a neural stem cell (NSC), a dopamine producing cell, a dopamine neuron, a unipolar neuron, a bipolar neuron (bipolar). Neuron), multipolar neuron, pyramidal cell, Purkinje cell, and anterior horn cell, basket cell, Bayesian cell Betz cell), Renshaw cell, granule cell or medium spiny cell.

In one particular embodiment, the inducing drugs comprising: retinoic acid (retinoic acid), niacinamide (nicotinamide) or a β - mercapto ethanol (beta-mercaptoethanol), vitamin B12 (vitamin B12), heparin (heparin), Putrescine, biotin or Fe ²⁺ , butylated hydroxyanisole, valproic acid, forskolin, 5-aza nucleoside ( 5-azacytidine), indomethacin, isobutylmethylxanthine or insulin. In another embodiment, the adjusting comprises: increasing the activity of at least one of the one or more proteins. In another embodiment, the adjusting comprises: increasing the performance of at least one of the one or more proteins. In another embodiment, increasing performance comprises increasing the amount of mRNA encoding at least one of the one or more proteins, or increasing the amount of translation of at least one of the one or more proteins from an mRNA. In another embodiment, the adjusting comprises reducing the activity of at least one of the one or more proteins. In another embodiment, the adjusting comprises: reducing the performance of at least one of the one or more proteins. In another embodiment, reducing performance comprises reducing the amount of mRNA encoding at least one of the one or more proteins, or reducing the amount of translation of at least one of the one or more proteins from an mRNA.

Also described herein is a method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties, wherein the neuronal characteristic comprises a subunit of the dopamine, glutamate NMDA receptor (subunits of the glutamate NMDA receptor), synapsin I (synapsin I), a calcium channel markers (calcium channel marker), GAP- 43, the voltage - dependent K ⁺ channels ^{(voltage-dependent K + channel)} , a voltage - dependent performance-dependent Na ⁺ channels (voltage-dependent Na ⁺ channel) of - Ca ²⁺ channel (voltage-dependent Ca ²⁺ ehannel) or a voltage.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the one or more The protein is Wnt2B. In another embodiment, Wnt2B is activated. In another embodiment, Wnt2B is deactivated. In another embodiment, Wnt2B is activated and subsequently deactivated. In another embodiment, Wnt2B is deactivated and then activated. In another embodiment, Wnt2B promotes differentiation or proliferation of the stem cells. In another embodiment, Wnt2B promotes or induces dopamine manifestation.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins are GSK3 β . In another embodiment, GSK3 beta is activated. In another embodiment, GSK3 beta is deactivated. In another embodiment, GSK3 beta is activated and subsequently deactivated. In another embodiment, GSK3 beta is deactivated and then activated. In another embodiment, GSK3 beta promotes differentiation or proliferation of the stem cells. In another embodiment, GSK3 beta regulates a microtubule assembly.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins are CREB1. In another embodiment, CREB1 is activated. In another embodiment, CREB1 is deactivated. In another embodiment, CREB1 is activated and subsequently deactivated. In another embodiment, CREB1 is deactivated and then activated. In another embodiment, CREB1 promotes differentiation or proliferation of the stem cells. In another embodiment, CREB1 promotes or induces dopamine manifestation.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins are CaMKII. In another embodiment, CaMKII is activated. In another embodiment, CaMKII is deactivated. In another embodiment, CaMKII is activated and subsequently deactivated. In another embodiment, CaMKII is deactivated and then activated. In another embodiment, CaMKII promotes differentiation or proliferation of the stem cells. In another embodiment, CaMKII modulates the microtubule combination.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having neuronal properties comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins are MAPT. In another embodiment, MAPT is activated. In another embodiment, the MAPT is deactivated. In another embodiment, the MAPT is activated and then deactivated. In another embodiment, the MAPT is deactivated and then activated. In another embodiment, MAPT promotes differentiation or proliferation of the stem cells. In another embodiment, MAPT regulates microtubule combinations.

In one embodiment, provided herein is a method of inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity, comprising: (a) stimulating the stem cell with an inducing drug contacting; (b) the stem cells to the inducing drugs to adjust one or more proteins, wherein the one or more proteins comprising: Wnt2B, Fzd6, Dvl3, FRAT1 , GSK3 β, HDAC6, β - catenin, G α _{q /11} , G β , RXR α , RAR β , GLuR1, PI3K, AKt1, AKt2, AKt3, mTOR, elf4EBP, CREB1, TH (tyrosine hydroxylase), PLC- β , PIP ₂ , CaMKII, elf4B, parkin , SNCA, tubulin, calcineurin, CRMP-2, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300; and (c) inducing or promoting differentiation of the stem cell into a reduced immunogenicity Cell.

In one embodiment, the stem cell is a mammalian trophoblast stem cell. In another embodiment, the stem cell is a mammalian embryonic stem cell. In another embodiment, the stem cell is a mammalian induced pluripotent stem cell. In another embodiment, wherein the stem cell is an endoderm, mesoderm, ectoderm or mesenchymal stem cell. In another embodiment, the stem cells are from a mouse, rat, human, chimpanzee, gorilla, dog, pig, goat, dolphin or cow. In another embodiment, the stem cells are from a human. In another embodiment, the stem cell is a human trophoblast stem cell.

In one embodiment, described herein is a method of inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity, wherein the cell having reduced immunogenicity is a neural stem cell (NSC). , dopamine-producing cells, dopamine neurons, monopolar neurons, bipolar neurons, multipolar neurons, pyramidal cells, primordial cells, and anterior horn cells, basket cells, Bayesian cells, Raytheon cells, granules Cells or medium thorn cells. In another embodiment, the cell having reduced immunogenicity does not induce an immune response or can inhibit an immune response. In another embodiment, the cell having reduced immunogenicity is not tempted An immune response can be induced, or an immune response can be inhibited by a T cell, a B cell, a macrophage, a microglia cell, a mast cell, or an NK cell.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity comprises: contacting the stem cell with an inducing drug, wherein the inducing drug comprises retinoic acid, nicotine Indoleamine or β -indole ethanol, vitamin B12, heparin, putrescine, biotin or Fe ²⁺ , butyl hydroxymethoxybenzene, valproic acid, forskolin, 5-aza nucleoside, 吲哚美洒Octyl, isobutylmethylxanthine or insulin.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the adjusting comprises: Increasing the activity of at least one of the one or more proteins. In another embodiment, the adjusting comprises: increasing the performance of at least one of the one or more proteins. In another embodiment, the increased expression comprises: increasing the amount of mRNA encoding at least one of the one or more proteins, or increasing the amount of translation of at least one of the one or more proteins from an mRNA. . In another embodiment, the adjusting comprises reducing the activity of at least one of the one or more proteins. In another embodiment, the adjusting comprises: reducing the performance of at least one of the one or more proteins. In another embodiment, the reducing expression comprises: reducing the amount of mRNA encoding at least one of the one or more proteins, or reducing the amount of translation of at least one of the one or more proteins from an mRNA. .

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity further comprises: inducing or promoting differentiation of the stem cell into a cell having neuronal properties, wherein the neuronal characteristic Subunit containing dopamine, glutamate NMDA receptor, synapsin I, a calcium channel label, GAP-43, voltage-dependent K ⁺ channel, a voltage-dependent Ca ²⁺ channel, or a voltage - Dependence on the performance of Na ⁺ channels.

In one embodiment, the method of inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity comprises: modulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins It is NFAT. In another embodiment, the NFAT is activated. In another embodiment, the NFAT is deactivated. In another embodiment, the NFAT is activated and subsequently deactivated. In another embodiment, the NFAT is deactivated and then activated. In another embodiment, NFAT promotes differentiation or proliferation of the stem cells. In another embodiment, the NFAT modulates the microtubule combination.

Also described herein is a method of inducing or promoting differentiation of a human trophoblast stem cell into a tNSC [trophoblast neural stem cell] having reduced immunogenicity or capable of inhibiting an immune response. The method comprises the following steps: (a) contacting the human trophoblast stem cells with an inducing drug; and (b) modulating the one or more proteins with the inducing drug in the stem cells, wherein the one or more proteins comprise: Wnt2B, Fzd6, Dvl3 , FRAT1, GSK3 β , HDAC6, β -catenin, G α _q/11 , G β , RXR α , RAR β , GLuR1, PI3K, AKt1, AKt2, AKt3, mTOR, elf4EBP, CREB1, TH (tyramine hydroxylate) Chemical enzyme), PLC- β , PIP ₂ , CaMKII, elf4B, parkin, SNCA, tubulin, calcineurin, CRMP-2, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300; Inducing or promoting differentiation of the human trophoblast stem cells into a tNSC.

In one embodiment, the method of inducing or promoting differentiation of a human trophoblast stem cell into a tNSC (trophoblastic neural stem cell) having reduced immunogenicity or inhibiting an immune response comprises: cultivating the human trophoblast stem cell Contact with an inducing drug, wherein the inducing drug comprises retinoic acid, nicotinamide or β-巯 ethanol, vitamin B12, heparin, putrescine, biotin or Fe ²⁺ , butyl hydroxy methoxybenzene, propyl Acid, forskolin, 5-aza nucleoside, indomethacin, isobutylmethylxanthine or insulin. In another embodiment, the tNSC does not induce an immune response, or an immune response can be inhibited by an immune cell. In another embodiment, the immune cell is a T cell, a B cell, a macrophage, a microglial cell, a mast cell, or an NK cell.

All publications, patents, and patent applications referred to in this specification are hereby incorporated by reference to the same extent, as the individual disclosures, patents, or patent applications are specifically and individually indicated It was incorporated as a reference.

Simple illustration

The novel features of the present invention are described in detail within the scope of the appended claims. The features and advantages described herein will be better understood by reference to the detailed description of the specific examples illustrated in the <RTIgt; Figure 1 shows the characteristics of pluripotence and renewing in hTS cells. (1a) Measured by RT-PCR analysis, hTS cells express specific genes of both inner cell mass (ICM) and trophectoderm. (1b) illustrates specific stage embryonic antigens-1, -3, and -4 [specific stage embryonic antigen (SSEA)-1, -3, and -4] as seen by immunocytochemical staining. Performance and intracellular localization (darkened spots). In hTS cells (upper region), SSEA-1 is mostly expressed in the cytoplasm (upper left region), SSEA-3 is expressed in the nucleus (middle superior region), and SSEA-4 is expressed in both cytoplasm and membrane. In the middle (upper right area). These SSEA-expressing cells are histologically similar to ectopic villous cytotrophoblasts (lower region). (1c) Unmodified telomere of hTS cell cultures at passages 3 and 7 as measured by Terminal Restriction Fragment (TRF) Southern blot analysis Length (upper and lower areas). (1d) Venn diagram illustrating microarray analysis of gene expression in hTS (859 gene) and trophoblast-associated placenta-derived mesenchymal stem cells (PDMS cells) (2449 gene) Microarray analysis). A total of 2,140 and 3,730 genes were expressed in hTS cells as well as in trophoblast-associated PDMS cells (fold change >2-fold). (1e) Description from different concentrations of leukemia inhibitory factor (LIF) [ie 500, 250, 125 U/ml; U: units/ml, actin (Actin): beta -actin as The results of the reverse transcription polymerase chain reaction (RT-PCR) analysis of the transcription factor expressed by the control sample. Removal of LIF inhibits Oct4 and Sox2 in hTS cells, but overexpresses Nanog and Cdx2. (1f) LIF (125 U/ml) Flow cytometric analysis (left panel) that promotes the expression of Nanog, Cdx2, Sox2, and Oct4 in hTS cells. The histograms show a negative dose-dependent manner (left zone) in Nanog and Cdx2 and a positive dose-dependent manner (right zone) in Oct4 and Sox2. (1g) a pattern of physiological distribution of LIF levels in different segments of fallopian tubes in women, particularly in the fallopian tube from the ampulla to the isthmus LIF level Physiology is reduced. The relative proportions of Oct4, Nanog, and Sox2 relative to Cdx2 each showed a dose-dependency in three different segments of the fallopian tube. (1h) The utility of different siRNAs for specific transcripts Nanog and Cdx2 in hTS cells was analyzed by RT-PCR (left) and flow cytometry analysis (right), illustrating a pluripotency in hTS cells. The maintenance of the interaction between Nanog and Cdx2. Data represent mean ± SD for 3 analyses. (1i) Histogram of gene intensity shows a homogenous form in hTS cells and a biphasic pattern in PDMS cells.

Figure 2 illustrates that retinoic acid (RA) induces differentiation of hTS cells into neural stem cells of various phenotypes. (2a) Distribution of various neural progenitor subtypes, including glial restricted precursors (GRP), neuron restricted precursors (NRP), pluripotency Multipotent neural stem (MNS) cells, astrocytes (AST), and undefined trophoblast giant cells (TGC). The frequency of hTS cell-derived neural progenitor cell subsets distributed at a consistent ratio during RA induction over time (ie 1, 3, 5, and 7 days), as shown in columns 1 through 4, respectively of. n: indicates the total number of cells counted. (2b) RT-PCR analysis of the expression of neural stem cell-associated genes of hTS cells before and after 1-day RA (10 μM) induction, including nestin produced from RA (10 μM)-induced hTS cells, Oct-4, neurofilament, NgN3, Neo-D, MAP-2 and CD133. (2c) Neural stem cell genes, including neurofilament proteins, nestin, and GFAP, which are immunoreactive with 3- and 5-day RA-induced hTS cells, as observed by flow cytometry analysis, They maintain a similar ratio in distribution. (2d) Immunocytochemical analysis of nestin, tyrosine hydroxylase-2 (TH-2) and serotonin of the immune response expressed by the trophoblastic neural stem cells (tNSCs) ( Immunocytochemical analysis). (2e) Comparative expression of immune-related genes in hTS cells, tNSCs, and human embryonic stem (hES) cells by flow cytometry analysis: HLA-ABC (MHC type I) in hTS cells (99.4) %) and tNSCs are highly expressed but lower in hES cells. HLA-DR (MHC class II) does not manifest in these cells. (2f) Comparative performance of immune-related genes in hTS cells, tNSCs, and hES cells by flow cytometry analysis: No differences in the expression of CD14 and CD44 were observed in these cells. Proliferative factor CD73 is highly expressed in hTS cells and tNSCs, but negatively in hES cells. (2g) Comparative analysis of immune-related genes in hTS cells, tNSCs, and hES cells by flow cytometry analysis: Transmembrane receptor CD33 is expressed in hTS and hES cells But not in tNSCs. CD45 does not be expressed in these cells. (2h) Comparative expression of immune-related genes in hTS cells, tNSCs, and hES cells by flow cytometry analysis: no expression of mesenchymal stem cell marker CD105 in hTS cells, tNSCs, and hES Differences in intensity were found, however, compared to hTS cells (93.6%) and hES cells (98.8%), fewer cancer stem cell markers CD133 (11.8%) were expressed in tNSCs.

Figure 3 illustrates RA-induced gene expression. (3a) illustrates the utility of RA (10 μM) on the c-Src/Stat3/Nanog pathway in activating tNSCs. RA (n=3) determined by RT-PCR analysis, RA induced a significant performance of c-Src, peaks at the 15th minute and then maintained at a lower level. (3b) Western blot analysis showed that RA stimulated RXR α , c-Src, and RAR β expression at 30 minutes, 1 hour, 2 hours, and 4 hours, respectively. RA induction promoted the expression of both G α _q/11 and G β within 30 minutes, suggesting involvement of G proteins signaling. (3c) Immunoprecipitation (IP) analysis demonstrated direct RA-induced binding between RXR alpha and RAR beta ; however, this interaction was blocked by the c-Src inhibitor PP1 analog, showing c -Src involves the binding of RXR alpha and RAR beta to form a scaffolding protein complex. (3d) IP assay analysis showed that RXR α has an independent binding interaction with G α _q/11 and RAR β has an independent binding interaction with G β . (3e) Describes the early generation of RA-induced c-Src in hTS, the apparent phosphorylation of Stat3 at the Tyr705 site, and the Western blot analysis of Nanog activation at the 1st hour; β -actin was Used in the control sample. (3f) The rapid generation of this c-Src protein by Western blot analysis then induced phosphorylation of Stat3 at the Tyr705 site and overexpression of Nanog. The c-Src inhibitor PP1 analog (4 μM) inhibited RA-induced phosphorylation of Stat3 on Tyr 705 and the performance of Nanog by Western blot analysis. (3g) Chromatin immunoprecipitation (ChIP) assay analysis demonstrating that RA stimulates the binding interaction of Stat3 with the Nanog promoter. Input: lysate, C: control group.

Figure 4 illustrates the results of an immunogold fluorescence transmission electron microscopy (IEM) analysis. The RA-induced binding interaction between the small gold particle-labeled RXR α (6 μM) and the large gold particle-labeled G α _q/11 (20 μM) was shown at the cell membrane. The immunostained RXR α and G α _q/11 mainly exhibited a homogeneous feature in the cytoplasm or nucleus by dynamic confocal immunofluorescence microscopy (Fig. 4, upper region). By treating with RA for 5 minutes, the RXR alpha intensity of the cytosol increased in the nuclear-perimeter region and the nuclear intensity decreased (line 1), indicating a cytosolic translocation after stimulation. The RXR alpha intensity of the nucleus becomes significant at the 15th minute, while the intensity of the cytosol decreases. These phenomena show that an increase in activity in one nucleus maintains a steady state in one cell. An apparent cytosolic translocation was again observed within 30 minutes. The change in the expression of G α _q/11 , on the other hand, is similar to that of RXR α (line 2).

5 illustrates the tNSCs GFP- flag (3 × 10 ⁶⁾ transplantation to Parkinson's disease (PD) analysis of rat. (5a) analyzed by apomorphine (apomorphine) induced rotation test (rotation test) of the; group A (dark - shaded circle, n = 4), which relates PD rats receiving tNSCs transplantation, the display Significant reduction in contralateral rotation from week 3 to week 12 after implantation; group b (light-shaded circle, n=4), which is relevant for 5-day RA-treated hTS cells PD rats showed an initial significant improvement at week 6 after implantation, but this improvement gradually decreased over the 12th week; and group c (triangles, n=4), it was relevant Untreated PD rats in the control group showed no improvement. Statistical analysis by repeated measures ANOVA: p- value = 0.001 and LSD post hoc comparisons between the two groups after repeated measures ANOVA: p = 0.037 at week 6 (a vs Group .c) and p = 0.008 (b vs. c group); p=0.019 at week 9 (a vs. c group); p = 0.005 at week 12 (group a vs. c) and p = 0.018 (group a vs. b). * indicates p < 0.05. (5b) described TH- positive staining time after implantation of 18 weeks in the striatum (lesioned striatum) by a group of the injury in immunohistochemistry (upper zone); immunofluorescent microscopy analysis: Immunization Fluorescent GFP-tagged tNSCs still have a spot at the site of the injection that remains in the injured striatum (lower region). (5c) described at 18 weeks after the injury by implantation of a group of substantia nigra (substantia nigra compacta, SNC) as reproduced TH- positive neurons (upper zone); is an enlarged end region Display (lower left area), scale bar: 100 μM; immunofluorescence microscopy analysis showed that immunofluorescent GFP-tagged tNSCs were retained in a scattered distribution (lower right region, arrow indicating GFP-labeled tNSCs). (5d) Describe the immunohistochemical staining of group b at week 18 after implantation: no TH-positive cells in the injured striatum (str, upper region) or subthalamic nucleus (left) Found in stn, lower area). (5e) Describe the immunohistochemical staining of group c at week 18 after implantation: cells without TH-staining in the injured striatum (str, upper zone) or injured SNC (lower zone) ) was found; the arrow indicates the needle trajectory.

By striatal damage; FIG. 6 illustrates a graft derived from an injection at the address tNSCs (1.5 × 10 ⁶⁾ to "aged (aged)" PD rats (body weight, 630-490gm n = 16) The result in . Behavioral assessments were analyzed every 3 weeks after implantation. The results showed a significant improvement in behavioral impairments assessed from week 3 to week 12 after implantation. Student's t test: * p < 0.05 as statistic significance. ** p <0.01 and *** p <0.001. (6a) Analysis of the dehydrated morphine-induced spin test: TNSCs were accepted as compared to untreated "aged" PD rats as control (group i; n=8, unfilled circles) Implanted aged PD rats (group ii, n=8, filled circles) significantly improved the number of rotations from week 3 to week 12. (6b) Describe the behavioral assessment results for exercise disability (seconds). (6c) Describe the behavioral evaluation results regarding the step length (mm). (6d) Describe the behavioral evaluation results for the stride length (mm). (6e) Describe the behavior evaluation results regarding the walking speed (cm/sec). (6f) Explain the results of the behavioral assessment of the basis (mm) of the support. (6g) Explain the gait analyzed for behavioral assessment: A is associated with normal rats, B is associated with hemiparkinsonian rats prior to cell transplantation, and C is associated with albino after cell transplantation. Sensitive rats are associated.

Figure 7 illustrates that after appropriate induction, hTS cells exhibit components of all three primary germ layers, including ectoderm, mesoderm, and endoderm; the left line of each region It is about gene expression before induction; the right line of each area is about gene expression after induction.

Figure 8 illustrates the results of flow cytometry analysis showing that hTS cells exhibit mesenchymal stem cell markers [CD90, CD44, CK7, Vimentin, and neurofilament] and are related to hematopoietic stem cell markers [CD34, CD45] , α 6- integrins (α 6-integrin), E- cadherin (E-cadherin) and L- selectin (L-selectin)] is negative.

Figure 9 shows that under appropriate induction, hTS cells are differentiated into a variety of specific cell phenotypes.

Figure 10 illustrates the subcutaneous transplantation of hTS cells to severe combined immune deficiency (SCID). Histological analysis of the minor chimeric reaction with myxoid-like bizarre cells in mice at 6-8 weeks after implantation (histological analysis) (filled, black arrows indicate singular cells; unfilled arrows indicate muscle fibers; "NT" indicates needle trajectories).

Figure 11 shows that the hTS cells do not change the karyotype (46, XY). To examine cell life in the generation, no significant shortening in telomere length between the 3rd and 7th generation cultures was observed by Southern blot analysis (Fig. 1c).

Figure 12 illustrates a specific medium used for cell differentiation.

Figure 13 illustrates a PCR primer used for RT-PCR.

Figure 14 illustrates the analysis of AhR as a signal molecule at the cell membrane, including the activity of pGFP-C1-AhR transfected at the cell membrane by introduction of BBP in Huh-7 cells (1 μM). The image shown by (14a) is the expression of the relative intensity of the GFP-marker AhR measured by TIRF microscopy. Circles and arrows indicate areas measured over time: before stimulation (Zone 1), at peaks (Zone 2), and at rest (Zone 3). The graph (Zone 4) shows that a peak value was found at about the 2nd minute, and the time when the BBP was added was indicated by an arrow. (14b) Quantitative RT-PCR analysis of the memAhR for the reaction of BBP showed a rapid rise at the 5th minute reaching the peak at the 15th minute followed by a gradual decrease to a lower at the 2nd hour The flat line area is accurate. Error bars indicate standard deviation. *, p < 0.05, t-test (n=3). (14c) Analysis of Western blot analysis showed that BBP promoted AhR rise at the 15th minute followed by a slight decrease at the 30th minute and repeated-rising at the 60th minute. (14d) Analysis of Western blot analysis showed that BBP induced the production of both G α _q/11 and G β at the 30th minute. (14e) Immunoprecipitation (IP) analysis of the interaction between AhR and G α _{q / 11,} the letter C for control groups after stimulation BBP. (14f) As measured by Western blot analysis, the knockdown of AhR by siRNA demonstrated that BBP inhibited the expression of both AhR and G α _q/11 in Huh-7 cells, and the letter S represents the negative control group. Scrambled siRNA.

Figure 15 illustrates the results of dynamic immunofluorescence imaging. (15a) described immunostaining control cells untreated; of AhR and G α _{q / 11} showed predominantly nuclear Huh-7 cells and weakly observed in the cytosol; strip dimensions (bar scale ): 50 μM. (15b) is treated to BBP (1μM) over 15 minutes and 5 each show a cell from the nucleus to the cytosolic compartment (cytosolic compartment) of the AhR and G α _{q / 11} This translocation of both. The immunostained G α _q/11 specifically accumulates at the cell membrane at the 15th minute. (15c) Cells transfected with AhR siRNA strongly reduced the AhR intensity (upper region) in both the cytosol and the nucleus compartment, whereas transfection with scrambled siRNA did not alter the immunostaining intensity (lower region). (15d) BBP reverts to the intensity of both AhR and G[ alpha] _q/11 in cells after 15 minutes of use of pre-transfected AhR siRNA.

Figure 16 illustrates the results of double immunogold transmission electron microscopic analysis. (16a) Immunogold-stained G α _q/11 (white arrow) There is a single or double or triple entity at the cell membrane in Huh-7 cells as a control group. (16b) At the 20th minute, BBP (1 μM)-treated cells showed an immunogold-labeled AhR particle (in the size of 6 nm, black arrow) and immunogold-labeled G α _q/11 particles (in The interaction of 20 nm size, white arrow) forms a complex where different entities appear at the cell membrane: monomeric (not shown), dimeric (not shown), three Polymeric (left) and polymeric (right) entities. (16c) A trimeric complex of AhR and G α _q/11 present at the cell membrane. CM: cell membrane, N: core, and band scale: 500 nm.

Figure 17 illustrates the "pull and push" mechanism and the biochemical process. (17a) Measurement of G[ alpha] _q/11 signaling cascades of BBP treatment responses in Huh-7 cells. Western blot analysis showed that BBP (1 μM) triggered the generation of both G α _q/11 and G β at the 30th minute. Activated Gα _q/11 results in a decrease in PIP ₂ , resulting in an increased IP3R level. (17b) Analysis of the reactivity of immunofluorescent Fluo-4-labled calcium in Huh-7 cells. Unlabeled cells (upper left area) and Fluo-4-labeled calcium (green, lower left area) are shown. Also shown is the change in relative calcium level in the BSS medium (middle upper zone) and the calcium-free medium (middle zone) after BBP (1 μM) stimulation (arrow). Cells cultured in calcium-free medium with pre-treated IP3R inhibitor 2-APB (100 μM, 1 hour) (upper right area) showed a decrease in calcium density (upper right area), which was present in one dose - Reaction-response manner (y=-0.4x +2.5, R ² =0.94) (lower right zone). The error bars represent the standard deviation of the mean (n=5). (17c) Results of Western blot analysis indicated that BBP-induced COX-2 expression was inhibited by pre-treatment with 2-APB (30 μM, 1 hour), and letter C indicates a control group. (17d) illustrates the results of western blot analysis showing that BBP (1 μM) induces excessive expression of COX-2 via the AhR/Ca ²⁺ /ERK/COX-2 pathway. ERK1/2 was phosphorylated at the 15th minute after BBP treatment and dephosphorylated at the 30th minute. (17e) illustrates the results of Western blot analysis showing that BBP-induced COX-2 expression was inhibited by pretreatment with the chemical PD98059 (20 μM, 1 hour, Calciochem), and the letter C indicates the control group. (17f) shows that the ARNT level is significantly suppressed (measured overnight) by treatment with BBP (1 μM). Data represent mean ± SD, n = 3 and *: Stutton's t-test, p < 0.01. (17g) illustrates a pathway representation of the "pull and push" mechanism that underlies the basis of the ligand-induced nongenomic AhR signaling pathway via GPCRs-G protein signaling.

Figure 18 illustrates the utility of LIF in Nanog performance. (18a) Explain that LIF promotes the performance of Nanog. Left panel description: Nanog performance was significantly inhibited in a negative dose-dependent manner by flow cytometric analysis in hTS cells. Data represent mean ± SD for 3 analyses. * p <0.01 (Stutton's t test, n=3). The right panel illustrates the relative Nanog performance of LIF at 1-day intervals when hTS cells were pre-incubated with RA (10 [mu]M) overnight and at different levels (i.e., 125, 250, and 500 U/mL each). (18b) Description RA induction (1 day incubation, 10 μM) in hTS cells stimulates the performance of Nanog and Oct4 by flow cytometric analysis, instead of Cdx2 and Sox2.

Figure 19 illustrates the assessment of behavioral improvement in aged PD rats. (19a) shows that immunohistochemistry of TH+ neurons on a series of brain sections (30 μM) at week 12 after implantation shows that a large number of re-regenerated TH-positive neurons appear In the damaged nigrostriatal pathway (left part). In the SNC region, TH-positive neurons exhibit a feature that has multiple outgrowths protruding from the cell body to form neuronal circuitries with the host tissue. The number of regenerated dopamine neurons in one rat accounted for 28.2% (n=5) of the opposite normal side. (19b) The number of dopamine neurons in the injured SNC of one rat was regenerated to 28.2% compared to the normal side.

Figure 20: (20a) illustrates the expression of specific genes for both ICM and trophectoderm (TE) by RT-PCR; (20b) shows that hTS cells are transfected with a DNA of F1B-GFP plastid construct DNA mixture of F1B-GFP plasmid construct to produce a success rate of over 95%; (20c) illustrates the time course of RA-induced eIF4B production; (20d) illustrates activation of c-Src by using eIF- 4B is inhibited; (20e) indicates that IP analysis shows that active c-Src binds directly to Stat3 [transcriptional signal transducer and activator]; (20f) indicates that c-Src siRNA inhibits Stat3 (20g) indicates that Nanog expression is inhibited by Stat3 siRNA; and (20h) illustrates a pathway for RA-induced c-Src/Stat3/Nanog pathway via subcellular c-Src mRNA localization in hTS cells .

Figure 21 illustrates the activation of G α _{q / 11} signaling pathway: (21a) described by western blot, the RA processing α _{q / 11} pathway after G (10μM) - associated with the presentation time of the component; ( 21b) A real-time live cell in a hTS cell cultured in calcium-free medium and pre-filled with Fluo4 (1 μM) in BSS buffer 20 minutes prior to RA treatment. Imaging microscopy) (Cell-R system, Olympus, Tokyo). (a) RA-induced intracellular calcium consumption was recovered by adding CaCl ₂ (2 mM) in a SOCE type. (b) RA-induced intracellular calcium levels were inhibited by 2-APB (10 min) in a significant dose-dependent manner (R ² = 0.8984). (c) After consumption of ER calcium, KCl (60 mM) was able to deactivate L-type calcium channels. (d) After ER calcium depletion, the KCl-dependent L-type calcium channel was blocked by the inhibitor nifedipine (5 μM). n: total cells counted; (21c) indicates that CaMKII interacts directly with CREB1 and eIF4B; (21d) indicates that eIF4B siRNA inhibits CaMKII, calcineurin and eIF4B by Western blot; (21e) It is indicated that KN93 (1μM, 2 hours) inhibits eIF4B expression by Western blotting method; (21f) indicates that parkin interacts directly with CaMKII and MAPT; (21g) indicates that SNCA interacts directly with MAPT; (21h) indicates that MAPT and GSK3 β and α -tubulin interactions; (21i) demonstrates that 2-APB inhibits the expression of calcium-regulated dephosphatase, NFAT1, and MEF2A by Western blotting; (21j) illustrates endogenous protein and Direct interaction between NFAT1; (21k) illustrates that RA stimulates NFAT1 nuclear translocation by fractional assay. Lamin A / C: nuclear marker and α - tubulin: cytoplasmic marker; (21L) Description Akt2 interaction directly with GSK3 β; (21m) illustrate different antibodies used in the dynamic change is shown in Flow analysis of GSK3 β expression in cells with RA for 4 hours (blank column) and 24 hours (black column) was processed. Data show mean ± SD, n = 3; (21n) indicates that flow cytometric analysis showed that Akt2 siRNA inhibited RA-induced GSK3 beta expression.

Figure 22 illustrates the formation of a transcriptional complex: (22a) illustrates the interaction between β -catenin and LEF1 (above) and between LEF1 and Pitx2; (22b) illustrates treatment by RA (4 hours) , LEF1 transcript gene Pitx2 instead of gene Pitx3 ; (22c) shows that MEF2A interacts directly with NFAT1, MEF2A, Pitx2, SNCA and EP300 by Western blotting method; (22d) shows that RA induces MEF2A by Western blot method , EP300 and Pitx2 are generated over time; (22e) indicates that NFAT1 siRNA inhibits the expression of MEF2A by Western blotting; (22f) indicates that CREB1 targets at the promoter of MEF2A gene; (22g) indicates that MEF2A transcript SNCA (top), TH (middle), and MEF2A itself (below); (22h) demonstrates that MEF2A siRNA inhibits the performance of EP300, Pitx2, and MEF2A by Western blotting; (22i) states that EP300 targets are at HDAC6 (top) And the promoter of the TH (below) gene; (22j) illustrates the identification of various molecular activities at the 4th hour and the 24th hour by the Western blot method. Abbreviations, IP: immunoprecipitation analysis; ChIP: chromatin immunoprecipitation analysis.

Figure 23 illustrates RA-induced neurogenesis in hTS cells The regulation network (upper zone) of the route of the (neurogenesis). Two tools for mRNA translation: cap-dependent (bottom left) and cap-independent (bottom right). Red lines: spatiotemporal signaling pathways; black lines: transcription pathways; double-directional arrows: molecules linked to other pathways.

Figure 24 illustrates that RA signaling promotes the Wnt2B/Fzd6/ β -catenin pathway: (24a) illustrates that flow cytometric analysis showed that RA (10 μM) was significantly induced by overnight inhibition of pretreated Wnt2B siRNA Wnt2B, Dvl3 and FRAT1 suppressed but the activation of GSK3 β. Data show mean ± SD; n = 3; (24b) illustrates increased Fzd6 mRNA expression by RA RT-PCR. Data show mean ± SD; n = 3, *: by the Historic Test p <0.05; (24c) illustrates the induction of beta -catenin and HDAC6 over time by Western blotting (24d) illustrates IP analysis showing: physical interaction between HDAC6 and β -catenin by RA overnight; (24e) illustrating fractionation assay after overnight incubation RA induces nuclear/cytoplasmic translocation of β -catenin. Laminin and α -tubulin act as nuclear and cytoplasmic markers, respectively; (24f) Description Confocal immunofluorescence microscopy shows that RA-induced β -catenin and dynamic changes in HDAC6 show β -catenin At the 30th minute, the nuclear translocation was inhibited by HDAC6 siRNA; (24g) indicated that the fine β -catenin appeared in the synaptic region at the 5th minute of RA treatment (arrow).

Figure 25 illustrates confocal immunofluorescence microscopy analysis. The nuclear localization of β -catenin is blocked in the presence of siRNA against HDAC6.

Figure 26 illustrates molecular events at the cell membrane: (26a) illustrates the induction of G α _q/11 , G β , RXR α, and RAR β over time by Western blotting. β - actin as a control group; (26b) described confocal immunofluorescent microscopy instant analysis, display of 0,4.5 and 13 minutes from the perinuclear region toward the RXR α after stimulation in a representative flag RA GFP- The movement of the cell membrane (arrow). No RXR α is visible in the nucleus. Normal phase contrast (top left) and fluorescent image (top right). Bar (Bar) represents 30 μM; (26c) illustrates a dynamic shift and change in the intensity of a relatively quantitative GFP-marked RXR α from the core (N) to the cell membrane (M) over time. Normal phase contrast and fluorescence imaging are shown on the upper right; (26d) shows that a representative image shows the co-expression of RXR α and G α _q/11 at the cell membrane by RA at the 5th minute. (26e) illustrates the double immunogold-labeled RXR α (6 μM: black arrow) and G α _q/11 (20 μM; white arrow) observed at the cell membrane after 20 minutes of RA treatment. N: nuclear; (26f) indicates that RXR α siRNA inhibits RA-induced interaction of G α _q/11 with RXR α (24 hours); (26 g) indicates that RAR β siRNA inhibits RA-induced G β and RAR β Interaction and interaction of Gβ with PI3K (24 hours). IP: immunoprecipitation analysis; IgG: negative control group; C: positive control group; (26h) indicates that IP assay analysis showed that a selective c-Src inhibitor PP1 analog can prevent RXR α -RAR β heterodimer ( of a heterodimer) formation; (26i) described by double immunogold gold particles penetrate RA- induced electron microscope we observed - sign RXR α endoplasmic reticulum (anchoring (anchorage) ER) in.

Figure 27 illustrates that RA stimulates the canonical Wnt2B pathway by RT-PCR; after overnight treatment (10 μM) in hTS cells, RA induces the performance of components of the Wnt2B signaling pathway, showing a statistically significant result; After treatment, Wnt2B siRNA inhibited the components of the RA-induced Wnt2B pathway.

Figure 28 illustrates the local synthesis of RXR alpha and RAR β : (28a) illustrates that RA (10 μM) rapidly induced a transient rise in both RXR α mRNA and RAR β mRNA at 15 minutes by RT-PCR. Data show mean ± SD, n = 3, t test *: p <0.05; (28b) demonstrates that RA induces PI3K and Akt isoforms over time by Western blotting; (28c) This demonstrates that by flow cytometry, the PI3K inhibitor 124005 inhibits the RA-induced Akt isoform (24 hours). The data shows the mean ± SD, n = 3; (28d) shows that Akt3 interacts with mTOR by Western blotting, but is inhibited by Akt3 siRNA; (28e) shows that RA is induced by Western blotting Temporal expression of mTOR; (28f) indicates that Akt3 siRNA inhibits RA-induced phosphorylation of mTOR; (28g) indicates that mTOR interacts directly with 4EBP1 (4 hours); (28h) indicates with or without mTOR siRNA or 4EBP1 siRNA The pre-incubated hTS cells treated with RA (4 hours) were analyzed by Western blotting for mTOR, 4EBP1, eIF4E, and eIF4B; (28i) illustrates eIF4E siRNA by Western blotting Inhibition of RA-induced (4 hours) interaction between RXR α and G α _q/11 (above) and between RAR β and G β (below).

Figure 29: (29a) illustrates inhibition of RA-induced Akt isoforms, Akt1, 2 and 3 expression by RT-PCR after overnight treatment of h3K inhibitors in hTS cells; (29b) by RT-PCR, Akt2 inhibitors inhibit the expression of β -catenin mRNA; (29c) Akt3 siRNA inhibits mTOR expression by flow cytometry.

Figure 30 illustrates that CREB1 promotes TH transcription: (30a) illustrates that CREB1 interacts directly with Aktl and β -catenin by Western blotting: (30b) illustrates that Aktl siRNA inhibits the expression of CREB1. Β -actin: control group; (30c) indicates that the CREB1 target is at the promoter of the TH gene; (30d) indicates that CREB1 siRNA inhibits the expression of TH by Western blotting; (30e) illustrates immunofluorescent organization Analysis showed that tNSCs were TH-FITC (blue) and TH-Cy-3 (red) in DA neurons (white arrows) in the treated SNC side at week 12 after implantation in the brain of PD rats. Common-performance (right area). Amplified DA neurons in the normal side (upper left) and in the treatment side (lower left). Positive CERB1 staining was found in the nucleus; (30f) indicates that the histogram shows the relative mean of TH and CREB1 expressed in DA neurons on normal (left; n=86) and treatment side (right; n=114) strength. Error bars: mean ± SD; n: total cells counted; p < 0.05: statistically significant.

Figure 31 illustrates immunohistofluorescence analysis: TH(+) and NeuN(+) motor neurons (arrows) in the SNC of the control group (top left). Reduced TH(+) (arrow) at the 1st week after 6-OHDA injury (top right). At the 6th week after injury, with the disturbance of TH-positive nerve endings, there is a significant decrease in TH(+) neurons (green particles), and various The degenerate cavity is formed (red explosive circle) (bottom left). After transplantation, the TH(+) neurons (arrows) at the wall of the degenerative cavity (red explosive circle; insert) with TH(+) nerve endings protruding into the cavity (bottom right) green).

Figure 32 illustrates in vivo regeneration of TH(+) and GFAP(+) cells with less immune response: (32a) illustrates TH(+) cells at weeks 1 and 6 after injury The number was reduced to 48% and 13% in the injured SNC (red) and 78% and 4% in the injured striatum (light blue), respectively. After transplantation, TH(+) cells were re-growth to 67% and 73% (right) in injured SNC and striatum, respectively. Data was analyzed by Tissuequest 2.0 software (TissueGnostics Gmbh, Vienna, Austria); (32b) indicated in the damaged SNC (lower zone) and enlarged (top left, insert a) and non-invasive side (upper right, insert) b) Regeneration of comparable dopamine neurons; (32c) indicates that transplantation of tNSCs at week 12 produced 78.4 ± on TH-positive neurons (arrows) in injured SNC compared to the non-lesion side Recovery rate of 8.3% (mean ± SEM; n = 4); (32d) indicates TH-FITC (+) and GFAP-Cy-3 in the injured striatum at week 6 after injury +) Degradation of Wilson's pencils (blank arrows) (left row). At the 12th week after implantation (right row), several GFAP(+) cells (arrows) appear in the fine fibers of the re-established Wilson bundle (blank arrow): (32e) Immunohistochemical fluorescence imaging analysis of cells in the gate (left scatter plot) determined by the position of the cell size (diameter of 8-10 μm) and the intensity of its corresponding GFAP-Cy-3 count. Gate (red scatter plot): counted glial cells; black scatter plot: exclude cells of abnormal size; blue scatter plot: cells with abnormal GFAP strength. In the striatum, GFAP(+) cells in the injured side were 65.5% before treatment and 93.9% after treatment (right region) compared to the non-lesion side; (32f) illustrates hTS cells Implantation into SCID mice caused only a mild immune response and no tumorigenesis was observed. Class-mucus-like singular cells (black arrows), muscle fibers (blank arrows), and needle trajectories (NT).

Figure 33 illustrates the determination of the coefficient of determination between TH-FITC and NeuN-Cy-3 using the coefficient of determination between TH-FITC and NeuN-Cy-3 in the SNC before and after cell therapy as measured by immunohistochemical scatter plots in chronic PD rats. Identification of TH(+) cells. (33 upper left ) indicates normal SNC: R ² = 0.72; (33 upper right ) indicates SNC (1-week) caused by 6-OHDA damage: R ² = 0.77; (33 bottom left ) illustrates 6-OHDA SNC (6-week) caused by injury: R ² = 0.25; (33 lower right ) SNC (12-week) after tNSCs transplantation: R ² = 0.66. The results shown represent the average of 2 rats.

Detailed description of the invention

Neural tissue-derived stem cells, phenotype-specified progenitor cells derived from pluripotent embryo stem cells (ESC), and derived from a variety of different Transdifferentiated non-neural stem cells have been explored in preclinical studies for their ability to generate neurons and glia, and neural stem cells are in clinical trials. The purpose of this has been described. Although embryonic stem (ES) cells have been shown to be potential for cell therapeutics (Bjorklund, LM, et al. Proc. Nat . Acad. Sci. 2002, 99, 2234-49), the use of such treatments It is limited and associated with ethical concerns.

Stem cells have the ability to self-renewal and to generate committed progenitors, including neural stem cells (Reubinoff BE et al. , Nat. Biotech. 2001, 19, 1134-1140).

Provided herein are isolated neural stem cells derived from trophoblast tissue. Further provided herein are isolated neural stem cells (tNSCs) that are robust in cell culture and that survive for generations and also have pluripotency and immune privilege characteristics. In one specific example described herein, a method for inducing dopamine neurons from tNSCs derived from human trophoblastic stem (hTS) cells is described. Further provided herein are methods that allow transplanted tNSCs to survive and grow into dopamine neurons, as well as to assess recovery of damaged behavior to achieve reduced variability compared to current therapeutic regimens. Methods.

Also provided herein are isolated neural stem cells derived from hTS cells that are cultured without the use of mouse embryonic feeder cells to prevent suspected contamination. Provided herein is a method for efficiently and reproducibly generating hTS cell-derived tNSCs, which results in a uniform mixing A subset of the population can be distinguished from other methods used to induce dopamine neurons from cells of other sources. Provided herein is a method for transplanting dopamine tNSCs into the brain in a cell suspension, thereby preventing uneven growth associated with tissue grafts.

Provided herein is a method of inducing a drug to modulate the differentiation of a stem cell into a cell having neuronal properties. In one embodiment, the inducing drug modulates the expression or activity of one or more proteins in the stem cell. In one embodiment, one of the one or more proteins is Wnt2B, Fzd6, Dvl3, FRAT1, GSK3 β , HDAC6, β -catenin, G α _q/11 , G β , RXR α , RAR β , GLuR1 PI3K, AKt1, AKt2, AKt3, mTOR, elf4EBP, CREB1, TH (tyrosine hydroxylase), PLC- β , PIP ₂ , CaMKII, elf4B, parkin, SNCA, tubulin, calcium dephosphatase, CRMP - 2, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300. In one embodiment, the stem cell can be a trophoblast, embryonic or induced progenitor stem cell. In one embodiment, the neuronal cell is an NSC, dopamine producing cell, dopamine neuron, monopolar neuron, bipolar neuron, multipolar neuron, pyramidal cell, puffer cell, and pre- Keratinocytes, basket cells, Bayesian cells, Raytheon cells, granulosa cells or medium spur cells.

Also provided herein is a method of inducing a drug to modulate the differentiation of a stem cell into a cell having reduced immunogenicity. In one embodiment, the inducing drug modulates the expression or activity of one or more proteins in the stem cell. In one embodiment, one of the one or more proteins is Wnt2B, Fzd6, Dvl3, FRAT1, GSK3 β , HDAC6, β -catenin, G α _q/11 , G β , RXR α , RAR β , GLuR1 PI3K, AKt1, AKt2, AKt3, mTOR, elf4EBP, CREB1, TH (tyrosine hydroxylase), PLC- β , PIP ₂ , CaMKII, elf4B, parkin, SNCA, tubulin, calcium dephosphatase, CRMP - 2, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300. In one embodiment, the stem cell can be a trophoblast, embryonic or induced progenitor stem cell. In one embodiment, the cell having reduced immunogenicity does not induce an immune response, or can be inhibited by a T cell, B cell, macrophage, microglia, mast cell or NK cell. An immune response.

Human trophoblastic stem cells (hTS cells)

Human fallopian tubes are the site of fertilization in women and common sites of ectopic pregnancies, where several biological events occur, such as the difference between the inner cell mass (ICM) and the nourishing ectoderm, and have a major appearance. The transformation of epigenetic changes from totipotency to pluripotency. These observations provide support for the fallopian tube at the stage prior to implantation as a niche reservoir for obtaining blastocyst-associated stem cells. In industrialized countries, ectopic pregnancy accounts for 1 to 2% of all pregnancies and is much higher in developing countries. In the absence of availability of human embryonic stem cells (hES cells) and fetal brain tissue, human trophoblast cells (hTS cells) derived from ectopic pregnancy are described here as being almost unusable. Substitution of hES cells for use in generating progenitor cells.

In a specific example, such humans derived from ectopic pregnancy Trophoblast cells do not involve the destruction of a human embryo. In another embodiment, the human trophoblast cells derived from ectopic pregnancy do not involve the destruction of a viable human embryo. In another embodiment, the human trophoblast cells are derived from a trophoblast tissue associated with a non-viable ectopic pregnancy. In another embodiment, the ectopic pregnancy cannot be saved. In another embodiment, the ectopic pregnancy will not result in a viable human embryo. In another embodiment, the ectopic pregnancy threatens the mother's life. In another embodiment, the ectopic pregnancy is tubal, abdominal, ovarian or cervical.

During blastocyst development, ICM itself contacts or its derived diffusible "inducer" causes a high rate of cell proliferation in polar nourishing ectoderm, resulting in the entire capsule The embryonic phase moves toward the cells of the mural region and continues even after the distinction between ICM and nourishing ectoderm. The wall-nourished ectodermal cells covering ICM retain a "cell memory" of ICM. Typically, at the initial stage of implantation, the parietal cells opposite the ICM stop dividing due to mechanical constraints from the uterine endometrium. However, no such limitation exists in the fallopian tubes, which results in the continued division of polar trophectoderm cells and the formation of extraembryonic ectoderm (ExE) in stagnant blastocysts of an ectopic pregnancy. In one embodiment, the ExE-derived trophoblastic stem (TS) cells are present in a proliferative state for a period of at least one 4-day depending on the interaction of the ICM-secreted FGF4 with its receptor Fgfr2. effect. In another embodiment, the ExE-derived TS cells are in a proliferative state and exist for at least one of 1-days. At least one is 2-day, at least one is 3-day, at least one is 4-day, at least one is 5-day, at least one is 6-day, at least one is 7-day, at least one is 8-day, At least one is 9-days, at least one is 10-days, at least one is 11-days, at least one is 12-days, at least one is 13-days, at least one is 14-days, at least one is 15-days, at least one is 15-days, at least one One is 16-days, at least one is 17-days, at least one is 18-days, at least one is 19-days, and at least one is 20-days. Until clinical intervention occurs, these cellular processes produce an infinite number of hTS cells in the preimplantation embryos that retain cellular memory from ICM, which is reflected by the expression of ICM-related genes.

One aspect described herein is hTS cells prior to implantation of the uterus and chorionic cytotrophoblasts of the chorion. In one embodiment, the hTS cell has a specific gene of the inner cell mass (ICM) ( Oc4 , Nanog , Sox2, FGF4) and the nourishing ectoderm ( Cdx2 , Fgfr-2 , Eomes , BMP4 ) (Fig. 1a) and The components of all three primary germ layers are represented (Fig. 7). In another embodiment, the hTS cells exhibit hES cell-associated surface markers [such as specific stage embryonic antigens (SSEA)-1, -3, and -4] (Fig. 1b) and mesenchymal stem cell-associated markers. (CD44, CD90, CK7, and intermediate filament proteins), while hematopoietic stem cell markers (CD34, CD45, α6 -integrin, E-cadherin, and L-selectin) were not expressed (Fig. 8). In one embodiment, hTS cells can be differentiated into various specific cell phenotypes of the three primary germ layers depending on the induction (Fig. 9). Subcutaneous transplantation of hTS cells into male severe combined immunodeficiency (SCID) mice resulted in only a histologically mild chimeric response 6-8 weeks after implantation (Figure 10). In one specific example, chromosomal analysis revealed that hTS cells did not change the karyotype (46, XY) (Figure 11). In another specific example, cell life was not significantly shortened in the telomere length between the 3rd and 7th passages (Fig. 1c).

One aspect provided herein is the use of Affymetrix ^TM platform to inquire about a GeneChip Human Genome hTS global gene between cells and compare cells PDMS U133 plus 2.0 GeneChip, described inter hTS placenta-derived cells and mesenchymal stem (PDMS) cells The difference between [placenta derived mesenchymal stem (PDMS) cell]. In one embodiment, the hTS cells exhibit about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40% less gene performance than in PDMS cells. , about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or about 75% of the gene's performance. In another embodiment, the hTS cells exhibit a total of 2,140 genes (fold change > 2 fold) which is about 40% less (3,730 genes) than in PDMS cells (Fig. 1d). In one embodiment, the gene intensity distribution of hTS cells exhibits a homogenous pattern that is distinct from those found in PDMS cells. In another embodiment, the hTS cells represent a special group of lining inner layers at a pre-implantation stage such that they have molecular portraits of inner cell mass (ICM) and/or trophectoderm ( Molecular portraits). In another embodiment, the hTS cells exhibit pluripotency and self-renewal characteristics similar to those of hES cells.

Removal of LIF in hTS cells regulates overexpression of Nanog

In humans, the inner layer of the nucleus is a fusion cell trophoblast A pioneer of (syncytiotrophoblasts) (Benirschke, K., Kaufmann, P. in Pathology of the human placenta, 39-51 Spring-Verlag New York Inc., 1990). When the embryo is a morula, a specialized region of trophoblast is established, which reflects a specific combination of transcription factors in the cells of the region and various environmental cues and growth factors that affect them. .

There is much evidence that the early ectodermal and true ES cells have naive pluripotency depending on the role of three transcriptional organizers (Oct4, Sox2, and Nanog) (Chambers I., et al. , Oncogene) , 23:7150-7160 (2004); Niwa H. Development , 134: 635-646 (2007)). ES cells maintain pluripotency via a complex interaction with different signaling pathways as well as transcription factors [including leukemia inhibitory factor (LIF), Nanog, Sox2, and Oct3/4]. The transcription factor Nanog plays a key role in maintaining the pluripotency of mouse and human ES cells, while LIF acts in concert with Oct4 and Nanog to support pluripotency and self-renewal (Cavaleri, F. et al . Cell 113, 551-552 (2003)).

LIF [an interleukin-6 class cytokine] affects cell growth and differentiation. LIF binds to LIFR- α [it forms a heterodimeric receptor complex with the GP130 co-receptor]. Binding of LIF results in activation of the JAK/STAT signaling pathway as well as the MAPK pathway. LIE is usually expressed in the nourishing ectoderm of developing embryos. LIF is thought to play a role in maintaining an undifferentiated state. Removal of LIF from a stem cell culture typically results in differentiation of cultured stem cells. LIF also affects the performance of Nanog, a gene known to play an important role in stem cell maintenance.

A pleiotropic cytokine leukemia inhibitory factor (LIF) is usually expressed in a concentration in the fallopian tube that is higher than in the endometrium, which shows an isthmic segment from the ampulla to the isthmic segment. The gradient is reduced (Fig. 1g). Although in the ectopic pregnancy, the LIF level is increased by 2 to 4 times in the fallopian tubes (Wånggren, K., et al. , Mol. Hum. Reprod. 2007, 13, 391-397). LIF is functionally integrated with other signals to activate pluripotency transcription factors (eg, Oct4 and Nanog) to maintain pluripotency and self-renewal in mouse embryonic stem (mES) cells. When withdrawal of LIF, but a continued proliferation type homeobox transcription factor Cdx2 (caudal -related homeobox transcription factor Cdx2 ) is activated, causing the trophectoderm differentiation in embryonic stem (ES) cells.

In one embodiment, a method is described to determine how hTS cells maintain pluripotency and self-renewal characteristics. In one embodiment, LIF and pluripotency transcription factors [eg, in Smith, AG, et al. , Nature 336, 688-690 (1998); Williams, RL, et al. , Nature 336, 684-687, (1998); Cavaleri , F. et al. , Cell 113, 551-552 (2003); Chambers I., et al. , Cell , 2003; 113:643-655; Boiani, LA et al. , Nature Rev. Mol. Cell Biol. 6,872- The association of the factors described in 884 (2005) was detected in hTS cells.

hTS cells are obtained from women who have been infected with ectopic pregnancy of the fallopian tube at the 5th-8th week of pregnancy and are considered to be a special group of primordial germ layers, with ICM-derived human embryonic stem (hES) Cells and specific genetic markers that nourish the ectoderm (for example, the markers described in Adjaye, J., et al. , Stem Cells , 2005, 23, 1514-1525) (Fig. 1a).

In one embodiment, provided herein is a method of affecting the differentiation of hTS cells by modulating exposure of the cells to LIF. For example, hTS cells are divided into 3 groups and exposed to different concentrations of LIF. In one embodiment, the concentration of LIF is about 1000, about 750, about 600, about 550, about 525, about 500, about 450, about 400, about 350, about 300, about 250, about 200, about 150, about 125, about 100, about 75, about 50, or about 25 units/mL. In another embodiment, the concentration of LIF is 500, 250, and 125 units/mL. In one embodiment, the concentration of LIF is 500 units/mL. In another specific example, the concentration of LIF is 250 units/mL. In another specific example, the concentration of LIF is 125 units/mL.

In one embodiment, the hTS cells are exposed to different concentrations of LIF for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 days. In another embodiment, the hTS cells are exposed to different concentrations of LIF for 3, 6, 12, 18, 24, 30, 36, 48, 60, 72, 84, 96, 108, 120, 132, 144. , 156, 168, 180, 192, 204, 216, 228, 240 or 252 hours. In another embodiment, the hTS cells are exposed to different concentrations of LIF for about 1 to 30, about 1 to 28, about 1 to 26, about 1 to 24, about 1 to 22, about 1 to 20, about 1 to 18, approximately 1 to 15. about 1 to 13, about 1 to 10, about 1 to 9, about 1 to 8, about 1 to 9, about 1 to 8, about 1 to 7, about 1 to 6, about 1 to 5, about 1 to 4 or about 1 to 2 days. In another embodiment, the hTS cells are exposed to different concentrations of LIF for 3 days.

One aspect described herein is that lower concentrations of LIF alter the performance of a particular gene, including, but not limited to, Oct4, Sox2, Cdx2, and Nanog). Another specific example demonstrates by RT-PCR that removal of LIF and/or lower concentrations of LIF inhibits Oct4 and Sox2 expression and, conversely, promotes Cdx2 and Nanog (Fig. 1e). In one embodiment, these phenomena were further confirmed by flow cytometric analysis showing that inhibition of Oct4 and Sox2 is in a dose-dependent manner (Fig. 1f).

In another embodiment, the relative expression ratio of Oct4/Cdx2 suggests a cell fate in early embryonic differentiation. In another embodiment, the removal and/or reduction of LIF exposure results in a decrease in Oct4 performance. In another embodiment, the withdrawal and/or reduction of LIF exposure promotes the performance of Cdx2, Nanog, and Sox2 transcription factors in a dose-dependent manner, which is consistent with quantitative PCR (qPCR) analysis.

Another aspect described herein is that the high Oct4/Cdx2 ratio in the ampulla of hTS cells is reduced by a gradient towards the isthmus segment (Fig. 1g) and is compatible with the trend of LIF levels in the fallopian tubes. This suggests that a cell fate selection tends to hES cells. In one embodiment, the relative upregulation (2x) of the relative Nanog/Cdx2 ratio further performs pluripotency in the cell. In a specific example, the relative increase in the ratio of Nanog/Cdx2 Section (2x) maintains pluripotency in hTS cells. In another embodiment, the proportion of Sox2/Cdx2 expression in hTS cells does not change to maintain pluripotency. In another embodiment, Cdx2 overexpression is a phenotype that favors hTS cells to maintain a trophoblast.

One specific example described herein is a method for detecting the relationship between Nanog and Cdx2 in hTS cells. In another specific example, knockout studies of both Nanog and Cdx2 by siRNA promoted Cdx2 and Nanog expression, respectively (Fig. 1h), which supports a similar relationship between Nanog and Cdx2 in hTS cells. Oct4 and Cdx2 are selected for cell fate in ES cells (Niwa, H., et al. , Cell 123, 917-929). In another embodiment, the overexpression of Nanog combines with the elevated Nanog/Cdx2 ratio to compensate for the reduced Oct4/Cdx2 ratio and is sufficient to maintain pluripotency and/or renewal in determining the fate of cell differentiation in hTS cells.

One aspect described herein shows that the overexpression of Nanog at the time of LIE withdrawal is at least one factor that plays a role in maintaining the pluripotency of hTS cells.

Retinoic acid (RA) and related pathways

Retinoic acid (RA), a derivative of vitamin A, plays a role in the differentiation of ES cells and embryoogenesis. In ES cells, RA acts by binding to its nuclear receptor and inducing transcription of a particular target gene to produce several different cell types. In one embodiment, induction with RA enables one hTS cell-derived tNSCs to maintain a stable, undifferentiated state with a specific pattern.

In one embodiment, treating hTS cells with all-trans-retinoic acid (RA) produces neural stem cells suitable for implantation into a rat disease model (eg, a Parkinson's disease model). In another embodiment, the removal and/or a decrease in LIF exposure in hTS cells modulates the overexpression of Nanog , which is responsible for the pluripotency of hTS cells and maintenance of self-renewal. Also described herein are specific molecular pathways that allow RA-induced differentiation of hTS cells into neural stem cells, including in epithelial-mesenchymal transition (EMT), bone morphogenetic protein (bone morphogenetic protein). , BMP) interacts with the Wnt signaling pathway (cross-talk) and triggers the target gene Pitx2 to play a role in neural stem cell formation. Thus, one specific example describes the use of modulators of RA-related pathways for the production of neural stem cells from hTS cells.

RA induces a consensus complex of an NSC subtype

In one embodiment, hTS cells are induced to generate neural stem cells. In one embodiment, the hTS cells are exposed to or treated with an inducer. In one embodiment, an inducer includes, but is not limited to, retinoic acid, a nerve growth factor, a basic fibroblast growth factor, a neurotrophin (eg, , neurotrophic factor 3), and/or combinations thereof. Additional exemplary inducers include, but are not limited to, erythropoietin (EPO), brain derived neurotrophic factor (BDNF), Wnt protein (eg, Wnt3a), transforming growth factor alpha ( Transforming growth factor alpha, TGF α ), transforming growth factor beta (TGF β ), bone formation protein (BMPs), thyroid hormone (TH) (including both T3 and T4) , thyroid stimulating hormone (TSH), thyroid releasing hormone (TRH), hedgehog proteins (eg, sonic hedgehog), platelet derived growth Factor, PDGF), cyclic AMP, pituitary adenylate cyclase activating polypeptide (PACAP), follicle-stimulating hormone (FSH), growth hormone (growth hormone) , GH), insulin-like growth factors (IGFs) (eg, IGF-1), ghrelin (growth h) Ormone releasing hormone, GHRH), prolactin (PRL), prolactin releasing peptide (PRP), fibroblast growth factor (FGF), estrogen (estrogen), serotonin ( Serotonin), epidermal growth factor (EGF), gonadotropin releasing hormone (GnRH), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), granule ball community stimulation Granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), vascular endothelial growth factor (VEGF), lutein (luteinizing hormone, LH), human chorionic gonadotropin (hCG), pheromones {eg, 2-second-butyl-4,5-dihydrothiazole (2-sec-butyl) -4,5-dihydrothiazole), 2,3- dehydro - West Bark beetle set information (2,3-dehydro-exo-brevicomin ) factors, α and β bacteriochlorin ene (alpha and beta farnesenes), 6- hydroxyalkyl -6-hydroxy-6-methyl-3-heptanone, 2-heptanone, trans-5-hepten-2-one (trans-5-hepten) -2-one), trans-4-hepten-2-one, n-pentyl acetate, cis-2-penten-1-yl- Acetate (cis-2-penten-1-yl-acetate), 2,5-dimethylpyrrolide (2,5-dimethylpyrazine), dodecyl propionate, and (Z)-7-dodecen-1-yl acetate [(Z)-7-dodecen-1-yl acetate]} , and / or a combination thereof. In another embodiment, the inducer is an analog or variant having the activity of a natural inducer.

As a non-limiting example, retinoic acid is used to chemically induce hTS cells. The pleiotropic factor, all-trans retinoic acid (RA), functions in vivo through multiple pathways in neural differentiation, patterning, and motor axon outgrowth. Such multiple pathways include, but are not limited to, RA/RARs/RXRs signaling, Wnt signaling, and ERK pathways in ES cells (Maden, M. Nat . Rev. Neuroscience 8, 755-765 (2007), Lu J, et Al. , BMC Cell Biol. 2009, 10:57, Wichterle H, et al. , Cell . 2002; 110:385-397). In mES cells (Wichterle H, et al. , Cell. 2002; 110:385-397), hES cells (Li, L. et al . Stem Cells 22, 448-456 (2004)) and in adult neurogenesis (Jacobs S) , et al. , Proc Natl Acad Sci 2006, 103(10): 3902-7), RA induces the expression of tyrosine hydroxylase (TH) [a characteristic enzyme of dopamine neurons] and neurite formation ).

In one embodiment, a method is described to determine the fate of hTS cells treated with RA. In another embodiment, the hTS cells are treated with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, 30, 35, 40, 45, 50, 55, 60 or 65 μM RA. In another embodiment, the hTS cells are treated at about 0.5-75, about 1-65, about 1-60, about 1-50, about 1-55, about 1-50, about 1-40, about RA of 1-35, about 1-30, about 1-25, about 1-20, about 1-15, about 1-13, about 1-10, about 2-10, about 5-10, or about 8-10 μM . In another embodiment, the hTS cells are treated with 10 [mu]M RA.

In one embodiment, the hTS cells are exposed to RA for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20, 25, 30, 35 or 40 days. In another embodiment, the hTS cells are exposed to RA for 3, 6, 12, 18, 24, 30, 36, 48, 60, 72, 84, 96, 108, 120, 132, 144, 156, 168, 180, 192, 204, 216, 228, 240 or 252 hours. In another embodiment, the hTS cells are exposed to RA for about 1 to 20, about 1 to 18, about 1 to 15, about 1 to 13, about 1 to 10, about 1 to 9, and about 1 to 8 , about 1 to 7, big About 1 to 6, about 1 to 5, about 1 to 4, or about 1 to 2 days. In another embodiment, the hTS cells are each exposed to RA for the following different periods: 1, 2, 3, 4, 5, 6, 7, or 8 days. In another embodiment, the hTS cells are exposed to RA for 1 day. In another embodiment, the hTS cells are exposed to RA for 2 days. In another embodiment, the hTS cells are exposed to RA for 3 days. In another embodiment, the hTS cells are exposed to RA for 4 days. In another embodiment, the hTS cells are exposed to RA for 5 days. In another embodiment, the hTS cells are exposed to RA for 6 days. In another embodiment, the hTS cells are exposed to RA for 7 days. In another embodiment, the hTS cells are exposed to RA for 8 days.

In one embodiment, RA induces differentiation of hTS cells into neural cells of various phenotypes including, but not limited to, glial-restricted precursor cells (GRP), neuron-restricted precursor cells (NRP), pluripotency Neural stem (MNS) cells, stellate cells (AST), and undefined trophoblastic giant cells (TGC) (Fig. 2a), which immunocytochemically express neural stem cell marker nestin (Fig. 2b). In another embodiment, the RA-induction period, which lasts from 1 to 5 days, is produced in a similar ratio on the distribution of mixed RA-induced neural progenitor cells. In another specific example, the treatment of RA for 7 days resulted in cell differentiation becoming undefined trophoblast giant cells.

Thus, in one embodiment, provided herein are RA-induced neural stem cells derived from hTS cells. In another embodiment, the RA induction period is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35 or 40 days. In another embodiment, the RA induction period is 3, 6, 12, 18, 24, 30, 36, 48, 60, 72, 84, 96, 108, 120, 132, 144, 156, 168, 180, 192, 204, 216, 228, 240 or 252 hours. In another embodiment, the RA induction period is about 1 to 20, about 1 to 18, about 1 to 15, about 1 to 13, about 1 to 10, about 1 to 9, about 1 to 8, and about 1 to 7. About 1 to 6, about 1 to 5, about 1 to 4, or about 1 to 2 days. In one embodiment, the RA induction period is from about 1 day to about 7 days. In another embodiment, the RA induction period is 1 day. In another embodiment, the RA induction period is 2 days. In another embodiment, the RA induction period is 3 days. In another embodiment, the RA induction period is 4 days. In one embodiment, the RA induction period is 5 days. In one embodiment, the RA induction period is 6 days. In another embodiment, the RA induction period is 7 days. In another embodiment, the RA induction period is 24 hours. In one embodiment, the RA induction period is 12 hours. In another embodiment, the RA induction period is from 1 hour to 24 hours.

In one embodiment, described herein is a tNSC that exhibits at least one neural stem cell gene as well as a marker. In another embodiment, the tNSC exhibits at least 2, at least 3, at least 4, or at least 5 neural stem cell genes. In another embodiment, the tNSC exhibits at least 2, at least 3, at least 4, or at least 5 neural stem cell markers. Non-limiting examples of neural stem cell genes and markers include: nestin, neurofilament, NgN3, MAP-2, Neo-D, CD133, and Oct4 (Fig. 2b). In one embodiment, the tNSCs also exhibit RA receptor genes (including, but not limited to, RAR β , RXR α, and RXR β ), cellular retinoic acid binding protein (CRABP)-2, and cellular retinol binding protein. (CRBP)-1 and, in particular, RA-synthase RALDH-2 and RALDH-3, which were found not to be present in ES cells.

Thus, a specific example describes the expressed neural stem cell genes and markers [including nestin, neurofilament, NgN3, MAP-2, Neo-D, CD133 and Oct4, RA receptor genes (such as RAR β , RXR α, and RXR β). Use of CRABP-2, CRBP-1, RA-synthase RALDH-2 and RALDH-3 or the like, and/or their modulators to promote the differentiation ability of tNSCs. In one specific example, both 3-day and 5-day RA-induced hTS cells maintained neural stem cell markers in a similar ratio, including nestin, GFAP, and neurofilament protein (Fig. 2c). In another embodiment, these tNSCs immunocytochemically express tyrosine hydroxylase-2 (TH-2) and serotonin (Fig. 2d), suggesting that they are to be differentiated into dopamine neurons and serum basal nerves. The ability of the yuan. Another specific example described herein is the differentiation of tNSCs into dopamine neurons and serum-based neurons.

Further provided herein are tNSCs consisting of uniformly mixed neuroepithelial progenitor cells [maintaining a steady-state in gene and phenotype during cell culture]. This consistency in product is a desirable property for any treatment regimen containing stem cell-based therapies.

The relationship between LIF and RA in terms of Nanog performance

In early embryonic development, tNSCs typically express RALDH-2. One specific example described herein is a method for assessing how LIF affects RA-induced neuronal production in hTS cells. In mouse ES (mES) cells, LIF has the ability to inhibit RA-induced neuronal differentiation and make transplantation more difficult (Martín-Ibá Ez R, et al. , J. Neuron. Res. 85, 2686-2710 (2007); Bain G, et al. , Dev Biol 168:342-357). Other reports claim that LIF is a positive role in the differentiation of ES cells into neurons (Tropepe V, Neuron 2001, 30: 65-78).

In one embodiment, a method is described to assess the association between LIF and RA in terms of Nanog performance in hTS cells. In another specific example, tNSCs were treated with LIF and were measured by Nanog performance by flow cytometry (Fig. 18a). In one embodiment, the tNSCs are processed at about 1000, about 750, about 600, about 550, about 525, about 500, about 450, about 400, about 350, about 300, about 250, about 200, about 150. , about 125, about 100, about 75, about 50, or about 25 units/mL of LIF. In another embodiment, the tNSCs are processed at 1-1000, 1-500, 1-450, 1-400, 1-350, 1-300, 1-250, 1-200, 1-150, 1 -125, 1-100, 1-75 or 1-50 units/mL of LIF. In another embodiment, the tNSCs are treated with a LIF of 500, 250, and/or 125 units/mL.

In one embodiment, the hTS cells are exposed to LIF for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In another specific In this example, the hTS cells were exposed to LIF overnight. In another embodiment, the hTS cells are exposed to LIF for 3, 6, 12, 15, 18, 22, 24, 30, 36, 48, 60, 72, 84, 96, 108, 120, 132, 144, 156, 168, 180, 192, 204, 216, 228, 240 or 252 hours. In another embodiment, the hTS cells are exposed to LIF for about 1 to 20, about 1 to 18, about 1 to 15, about 1 to 13, about 1 to 10, about 1 to 9, and about 1 to 8 , about 1 to 7, about 1 to 6, about 1 to 5, about 1 to 4, or about 1 to 2 days.

In one embodiment, treating hTS cells with RA induces Nanog overexpression. In another embodiment, LIF inhibits RA-induced Nanog in a dose-dependent manner. In another embodiment, LIF exerts an inhibitory effect on tNSC development.

One aspect described herein is in the interaction of LIF with RA on the neural differentiation of ES cells. In one embodiment, LIF affects the utility of RA in pluripotency in hTS cells. The results showed that in hTS cells, RA induced excessive expression of Nanog and Oct4 but not Cdx2 and Sox2 (Fig. 18b). In the isthmus region of the brain, Nanog was observed to be 62.5% in LIF-induced cells (Fig. 1f, left and right regions), but only 26.9% in RA-induced cells (Fig. 18b). It was also observed that a higher level of LIF generally inhibited RA-induced Nanog and the removal of LIF significantly enhanced RA-induced Nanog performance (Fig. 18a). These results suggest that the hTS cells move toward the isthmus. In one embodiment, RA maintains cellular pluripotency by Nanog performance.

In a specific example, in a RA-enriched microenvironment (RA-enriched microenviroment) implantation of tNSCs promotes continuous proliferation of stem cells in vivo. In another embodiment, the tNSCs are implanted into the brain. In another embodiment, the tNSCs are implanted or injected into hippocampus, cerebral cortex, striatum, septum, diencephalon, mesencephalon , hindbrain or spinal cord basal ganglia. In another embodiment, the tNSCs are implanted into the striatum of the brain. In another embodiment, the tNSCs are implanted or injected into any part of the central nervous system. In another embodiment, the tNSCs are implanted or injected into a nerve ending region of a cell that is degraded in a particular neurodegenerative disorder. In another embodiment, the tNSCs are implanted or injected into the substantia nigra pars compacta in the midbrain. In another embodiment, the tNSCs are implanted or injected into a nerve ending region in the forebrain. In another embodiment, the tNSCs are implanted or injected into the ventricular system. In another embodiment, the tNSCs are implanted or injected into a lateral ventricle.

G protein signaling on maintaining multipotency in tNSCs

Another aspect described herein is a method to study how tNSCs maintain their pluripotency state. In one embodiment, RA induces c-Src mRNA expression peaks at about the 15th minute (Fig. 3a). Another specific embodiment described herein is based on the stimulation of RA RXR α, c-Src, and the RAR β expression by Western blot analysis to assess GPCR signaling pathways (FIG. 3b). In one embodiment, RA promotes both Gα _q/11 and G β in 30 minutes. In another specific example, analysis by immunoprecipitation (IP) assay demonstrated that RA induces direct binding between RXR alpha and RAR beta ; however, this interaction is blocked by the c-Src inhibitor PP1 analog Broken, this indicates that c-Src involves the formation of a scaffold protein complex between RXR α and RAR β (Fig. 3c).

By Immunoprecipitation (IP) analysis (FIG. 3d), we observed RXR α independently exhibit binding interaction with the G α _{q / 11,} and displays RAR β G β binding interaction. These results are compatible with the "pull and push" model of GPCR-G protein signaling (Tsai et al. , "The ubiquitin ligase gp78 promotes sarcoma metastasis by targeting KAI1 for degradation. Nat. Med. 13 , 1504-1509, (2007)).

In one embodiment, the RARs and the heterodimeric pair of RXRs act as ligand-activated transcription factors and endogenous cell surface signals in the nucleus. The role of molecules). Constitutively activated by RXR α receptor conformation and destroy the c-Src to raise and phase association G α _{q / 11} interaction and / or activation is associated with G α _{q / 11.} In one example, this non-gene RA message transmission assists in the interpretation of retinoic acid-response element (RARE)-regulated gene expression (Maden, M., Nat . Rev. Neuroscience 8, 755 -765 (2007)).

Therefore, what is provided here is to prevent the transplant here. Provide strategies for cell overgrowth before and after neural stem cells. One specific example describes the use of agents that modulate RA-related pathways thereby preventing and/or reducing and/or alleviating overgrowth and/or graft rejection.

Src and Nanog

c-Src maintains ES cells in an undifferentiated state (Annerén C. et al. , J Biol Chem. 279, 590-598 (2004)). Nanog and Stat3 synergistically bind to activate the Stat3-dependent promoter (Torres J., et al. , Nat Cell Biol. 10, 194-201 (2008)). In a specific example, c-Src induces phosphorylation of Stat3 at the Tyr705 site, and this effect is blocked by the c-Src inhibitor PP1 analog, thereby linking the c-Src and Stat3 molecules. The correlation between them (Fig. 3f). In another embodiment, Stat3 acts directly on the Nanog promoter (Fig. 3g). In another specific example, Stat3 does not act directly on the Nanog promoter. In another embodiment, RXR alpha acts directly on the Nanog promoter. In another embodiment, RXR alpha does not act directly on the Nanog promoter. In another embodiment, RAR beta acts directly on the Nanog promoter. In another embodiment, RAR beta does not act directly on the Nanog promoter. In another embodiment, RA induces overexpression of c-Src, pStat3 (Fig. 3e), and Nanog (Fig. Ie) in hTS cells. In another embodiment, the reaction of both RXR alpha and RAR beta to RA plays a delivery role via GPCR-G protein signaling.

In one embodiment, described herein is a method for maintaining pluripotency in tNSCs comprising activating the c-Src/Stat3/Nanog transcriptional pathway. In another embodiment, the interaction of c-Src with G[ alpha] _q/11 activates the c-Src/Stat3/Nanog pathway. In order to further confirm the direct interaction between RXR α and G α _q/11 by imaging studies, a double immunogold fluorescent transmission electron microscope (IEM) was used. RA induced a binding interaction between the small gold particle-labeled RXR α (6 μM) and the large gold particle-labeled G α _q/11 (20 μM) at the plasma membrane ( FIG. 4 ). By dynamic confocal immunofluorescence microscopy, immunostained RXR α and G α _q/11 are predominantly homogeneous in the cytoplasm or nucleus (Fig. 4). By treating with RA for 5 minutes, the RXR α intensity of the cytosol increased at the nuclear-peripheral region and the nuclear RXR α intensity decreased (Fig. 4, line 1), indicating a cytosolic translocation after stimulation. . At the 15th minute, the RXR α intensity of the nucleus became significant, while the cytosolic RXR α intensity decreased (Fig. 3a).

In one embodiment, an increase in activity in a nucleus maintains a steady state in a cell. An apparent cytosolic translocation was again observed within 30 minutes. On the other hand, the variation in the expression of G α _q/11 is similar to that of RXR α (Fig. 4, line 2). In a specific example, a significant accumulation of G α _q/11 was observed at the cell membrane at the 30th minute after the stimulation. In another embodiment, RA is capable of promoting constitutive synthesis and translocation of both RXR[ alpha] and G[ alpha] _q/11 in hTS cells.

Thus, what is provided herein is the use of RA at the cell membrane to act on hTS cells via GPCR-G protein signaling (which is distinguishable from the RA/RXRs/RARs pathway of the gene) for the production of tNSCs. As shown here, RA differentiates hTS cells into tNSCs via Nanog and Oct4, but not Cdx2 and Sox2 pathways. Also provided herein is RA-induced Nanog activation for use in maintaining pluripotency and self-renewal in tNSCs. Provided herein is a RA-activated G protein-coupled receptor (GPCR)-G protein signaling, along with activation of the RXR α /G α _q/11 /c-Src/Stat3/Nanog pathway. Use for maintaining pluripotency in tNSCs. Provided herein are the use of RXR alpha and RAR beta heterodimers at the cell membrane to act as signal molecules for maintaining the pluripotency in tNSCs. Also provided herein is the use of RA to induce differentiation of hTS cells into neural stem cells (NSCs) for maintenance of pluripotency and regeneration by overexpression of Nanog.

The tNSCs described herein will exhibit retinol aldehyde dehydrogenase (RALDH)-2 and RALDH-3 that help neurogenesis. The presence of RALDHs in tNSCs and the absence of CD33 as described herein suggest that tNSCs are superior to hES cells in differentiation into sensorimotor neurons. Accordingly, what is provided herein is the use of the tNSCs described herein for neurogenesis and/or regenerative medicine.

On the developmental striatum and hippocampus, once the increased Src kinase activity is consistent with neuronal differentiation and the peak period of growth. However, RA can inhibit the phosphorylation of ribosomal S6 kinase and its downstream eukaryotic Initiation factor 4B (eIF4B) by 24-hour incubation, resulting in the growth of many cell types. Growth arrest. RA induces hTS at the 15th minute One of the cells showed rapid and transient c-Src mRNA peaks (Fig. 3a), which in turn produced c-Src protein at 1 hour (Fig. 3e). In one embodiment, the c-Src mRNA contains an internal ribosome entry site. In another specific example, RA transiently produced an eIF4B peak at 4 hours but resolved at 24 hours (Fig. 20c). This effect was inhibited by the use of eIF4B siRNA (Fig. 20d). The involvement of mTOR/eIF4EBP1 signaling [the mechanism of rapamycin/eukaryotic Initiation factor 4E binding protein 1] was excluded (Fig. 20b). In another embodiment, RA activates eIF4B for secondary cell mRNA localization to generate c-Src.

The active c-Src binds directly to Stat3 (transcribed message transmitter and activator) by phosphorylation at the Tyr705 site (Fig. 20e) to generate a protein (Fig. 3e). In one embodiment, this effect is inhibited by the use of c-Src siRNA (Fig. 20f). In another embodiment, this effect is inhibited by a selective c-Src inhibitor PP1 analog (Fig. 3f). In another specific example, a direct effect of Stat3 on the Nanog gene promoter was observed by chromatin immunoprecipitation (ChIP) analysis (Fig. 3g). In another embodiment, Nanog is generated within 4 hours (Figures 3f and 20f), which can be blocked by using the PP1 analog (Figure 3f) and Stat3 siRNA (Figure 20g).

In one embodiment, described herein is a method for maintaining pluripotency of tNSCs comprising exposing cells to an inducer to modulate non-genetic eIF4B/c-Src/Stat3/Nanog signaling pathways Regulated c-Src subcellular mRNA localization (Fig. 20h). In another embodiment, the inducer is RA.

RA and Wnt signaling

Also provided herein is a method for inducing hTS cells to become neural stem cells. In one embodiment, the method comprises modulating a Wnt2B/[ beta] -catenin signaling pathway. In another embodiment, the method comprises modulating a RARs-Akt signaling pathway. In another embodiment, the method comprises modulating Wnt2B/[ beta] -catenin and a RARs/Akt signaling pathway. In another embodiment, the hTS cells are induced by treatment with retinoic acid (RA). In another embodiment, the method for inducing hTS cells to become neural stem cells further comprises an activated transcription factor Pitx2. In another embodiment, the method for inducing hTS cells to become neural stem cells further comprises an activated transcription factor NTN. In another embodiment, the method for inducing hTS cells to become neural stem cells further comprises an activated transcription factor Pitx2 and NTN. In another embodiment, RAR and RXR are present as a heterodimer, which is bound to RARE DR-5 via its DNA-binding domain (DBD). In another embodiment, the corepressors bind to the RAR and recruit HDACs to cause transcriptional repression. In another embodiment, RA is added to hTS cells and transcription is activated by binding of RA to RAR. In another embodiment, RAR binding to RA followed by recruitment of coactivators and HAT.

The RA-regulated Wnt signaling pathway is an important contributor during adult neurogenic and survival in vivo. Wnt proteins present in the neural stem cell microenvironment are key regulators of cellular behavior in early embryogenesis and maintain neural stem cell potential. In adult neurogenesis, Wnt proteins bind to their receptor Frizzled (eg, Fzd6) to deliver a number of signaling cascades, such as by activating specific beta -catenins against specific target genes. LEF signal transmission.

Wnt signaling involves cell cycle control and morphogenesis during neurodevelopment. Among them, Wnt2B inhibits the differentiation of retinal neurons and has been implicated as a stem cell factor for NSCs using comparative bioinformatics data analysis and management integromics analysis. In one embodiment, Wnt2B regulates the performance of Fzd6. In another specific example, Wnt2B induces the expression of Fzd6. In another specific example, Fzd6 is overexpressed in the presence of Wnt2B. In one embodiment, RA modulates a typical Wnt2B/Fzd6/ β -catenin signaling pathway for dopamine differentiation in hTS cells. In one embodiment, RA induces a typical Wnt2B/Fzd6/ β -catenin signaling pathway for dopamine differentiation in hTS cells.

One specific example provided herein describes a canonical Wnt pathway as an inducer of inhibitory GSK3 beta , resulting in stabilization of beta -catenin for nuclear translocation in cells. In another embodiment, RA rapidly induces phosphorylation of the GSK3[ beta] position at the Tyr216 site [downstream effector of Akt2]. In another specific embodiment, the RA rapidly induced GSK3 β address bits of the Tyr216 phosphorylation, whereas beta] in the initial hours of causes - catenin phosphorylation and play for a typical subsequent The "priming" effect of the Wnt pathway. In another embodiment, these activated Fzd6 and Dvl3 are capable of promoting JNK interaction with the cytoskeleton or increasing intracellular Ca ²⁺ levels, followed by a non-typical Wnt/Ca ²⁺ signaling pathway Activate CaMKII for synaptic function. Over time, a transition from a non-typical to a typical Wnt pathway occurs due to phosphorylation of the GSK3 beta position at the Ser9/21 site. In one embodiment, the G protein regulates the conduction of non-typical Wnt2B signaling at the beginning. In another embodiment, a typical Wnt2B signaling occurs in a later stage of early developmental neuronal differentiation.

HDAC6

Also provided herein is a method for inducing hTS cells to become neural stem cells, the method comprising a tissue protein deacetylase 6, HDAC6. Tissue protein deacetylase 6 (HDAC6), an enzyme mainly located in the cytoplasm, regulates many biological processes, including cell migration, immune synapse formation, and viral infection (viral). Infection) and degradation of misfolded proteins. For example, HDAC6 deacetylates tubulin, Hsp90, and cortactin and forms complexes with other partner proteins.

HDAC6 is capable of transporting beta -catenin for nuclear localization. In one embodiment, by cell separation analysis, HDAC6 interacts with β -catenin to result in nuclear translocation of β -catenin. In another embodiment, RA induces a novel, typical Wnt2B/Fzd6/ β -catenin signaling pathway that allows for nuclear translocation of β -catenin in hTS cells. Within the nucleus, beta -catenin is involved in the regulation of key gene expression programs, or as a docking platform for various transcriptional co-activators to stimulate transcription.

HDAC4

HDAC4 is an important epigenetic regulator of functional hTS cell-induced neural stem cells. HDAC4 inhibits cell-cycle progression and protects neurons from cell death. Transcriptional regulation by RARs involves the modification of chromatin by HDACs [they are recruited to the RA-target by nuclear co-repressors), which determines the differential response to RA.

LEF/TCF/Pitx2

Lef-1 and Pitx2 act in the Wnt signaling pathway by recruiting and interacting with β -catenin to activate the target gene. Pitx2 interacts with two addresses within the Lef-1 protein. In addition, β -catenin interacts with the Pitx2 homeodomain, while Lef-1 interacts with the tail of the C-terminus of Pitx2. Lef-1 and β -catenin interact simultaneously and independently with Pitx2 via two different sites to regulate Pitx2 transcriptional activity. These data support a role for Pitx2 in cell proliferation, migration, and cell division via differential Lef-1 isoforms and interactions with Lef-1 and β -catenin.

NTN1

The molecular mechanism of NTN1 is thought to be mainly related to axonal guidance. (axonal guidance) and control of neuronal cell movement.

Activation of the Wnt/PS1/PI3K/Akt pathway and inhibition of GSK3-β by RA

Due to the increased number of proliferative progenitor cells and a corresponding decrease in differentiated neurons, increased Wnt signaling dilates the stem cell pool and enhances the performance of a stable beta -catenin resulting in a large Brain (Chenn, A. et al. , Science 297, 365-369, (2002)). Β -catenin has a dual role as a junctional protein, and in typical Wnt signaling, phenotype may be due to increased Wnt signaling (which is linked to NSC self-renewal) or increased Junctional stability.

PI3K/Akt signal transmission

In one embodiment, described herein is a method for maintaining pluripotency of tNSCs, the method comprising modulating a PI3K/Akt signaling pathway. The G-protein β /γ heterodimer also activates phosphoinositide-3-kinase, regulatory subunit 5 [PI3K regclass IB (p101)], resulting in phosphoinositide- 3-kinase-catalyzed gamma polypeptide (Phosphoinositide-3-kinase,catalytic,gammapolypeptide)[PI3K cat class IB(p110-γ)]-regulated phospholipidinositol 4,5-biphosphate Conversion of PtdIns(4,5)P2] to phospholipid inositol 3,4,5-triphosphate [phosphatidylinositol 3,4,5-triphosphate, PtdIns(3,4,5)P3] [3]. PtdIns(3,4,5)P3 is a direct binding to 3-phosphoinositide dependent protein kinase-1 [PDK(PDPK1)] and V-akt mouse thymoma Secondary messenger of V-akt murine thymoma viral oncogene homolog 1 [AKT (PKB)]. PDK (PDPK1) phosphorylates AKT (PKB) and activates AKT signaling [4].

PI3K/Akt signaling regulates self-renewal and differentiation in the stem cell system below. From primordial germ cells (primordial germ cells, PGC) of pluripotent embryonic germ (embryonic germ, EG) cells derived in PGC- specific Pten - mice (PGC-specific Pten -deficient mice) is enhanced in the absence of ( Kimura T, et al. , Development 130 : 1691-1700, (2003)).

Shown in one specific example is that using the conditional activation of Akt signaling, PI3K/Akt signaling plays a role in the activation of dormant stem cells. In another embodiment, PI3K/Akt signaling plays a role in the proliferation of progenitor cells in the adult epidermis.

In one embodiment, PI3K/Akt signaling promotes self-renewal of stem cells in these culture-adapted stem cells, rather than the generation of committed progenitor cells. In one embodiment, RA modulates activation of Akt3/mTOR signaling in hTS cells, and causes translation of subcellular mRNAs to encode proteins RXR alpha and RAR beta . In one embodiment, RA induces activation of Akt3/mTOR signaling in hTS cells, resulting in translation of subcellular mRNAs to encode proteins RXR alpha and RAR beta . In another embodiment, an inducer inhibits activation of Akt3/mTOR signaling. In another embodiment, the selective movement and interaction of the RXR α /G α _q/11 and RAR β /G β signaling pathways are initiated independently.

In another embodiment, RA regulates gene program transcriptional activity related to cellular function depending on a pleiotropic and cellular context-dependent manner; that is, output phenotype It is a combination of AP-1 and/or β -catenin-LEF/TCF inhibition and the utility of RARE activation.

GSK3 β regulation microtubule combination

hTS cells include major GSK3 beta functions, whereas on neurodevelopmental initiation of GSK3 beta promotes neuronal differentiation and subsequent inactivation promotes progenitor cell proliferation. In dormant cells, the basal activity of GSK3 is usually relatively high, and exposure of cells to a pilot signal reduces its specific activity to between 30-70% within 10 minutes. GSK3 beta has a strong preference for its already phosphorylated host, and thus the previously elicited beta -catenin in a typical Wnt2B signaling becomes a suitable candidate for subsequent inhibitory GSK3 beta .

In one embodiment, rapid spatiotemporal activity of GSK3 beta phosphorylation is localized to MAPT in the axon growth core, resulting in tubulin-like, neuronal polarity, and axonal exogenous tubulin-type II Activation of the polymer (Figures 21a and 21b), which is consistent with the concept of activation of GSK3 beta involving axon microtubule combinations. In addition, GSK3 beta also regulates phosphorylation of CRMP-2 to promote microtubule assembly, whereby CRMP-2 preferentially binds to tubulin heterodimers, which is clearly distinguishable from those of MAPT. A mutant of CRMP-2 inhibits axonal growth and branching in a predominantly-negative manner.

In one embodiment, provided herein is a mechanism to help explain the regulation of neural progenitor cells in a developing brain by helping to explain that GSK-3 signaling is an important mediator of homeostatic control in vivo. In another embodiment, the initial local activation of the PI3K/Akt pathway induces activation of the GSK3[ beta] position in the hTS cells at Tyr216. In one particular embodiment, the initial local activation of PI3K / Akt pathway and by Ser9 / 21 phosphorylation isolated from embryonic rat E18 hippocampal neurons (hippocampal neurons) in the induction of GSK3 β is not activated different. In one embodiment, phosphorylation at different sites in GSK3 beta results in different cell fates, depending on time factors. Phosphorylation by GSK3 β promoting nuclear export by preventing dephosphorylation of calcineurin enzyme - DNA binding induced NFAT1. NFAT plays a central role in promoting gene transcription, including cytokine genes in T-cells during immune responses. These facts explain, at least in part, why both hTS cells and tNSCs have an immunopotency that promotes intracranial transplantation in PD rats.

G protein and neuronal plasticity

High autonomy in NSCs allows rapid local response to the leader signal by selectively localizing and translating a subset of mRNAs during neurogenesis, where mTOR is typically translated via phosphorylated mRNA and ribosome synthesis in NSCs The key regulators to rise regulate protein synthesis. In hTS cells, active Akt3/mTOR signaling triggers mRNA translation to independently synthesize RXR alpha and RAR beta proteins (which activate G α _q/11 and G β signaling pathways, respectively), where local CREB1 is activated and plays A role that transiently targets the expression of inducible genes transcribed by the TH gene, to produce neurotransmitter dopamine. It has been shown that RA promotes RAR alpha expression in dendritic RNA particles and activates local glutamate receptor 1 (GluR1) synthesis, which means a constant homeostatic synaptic plasticity . Thus, activation of the dopamine D1/D5 receptor (upstream enhancer of CREB) induces GluR1 insertion at the synaptic site in neurons.

In one embodiment, provided herein is a molecular model for studying RA signal-related plasticity.

Transcription factor for dopaminergic neurogenesis

In one embodiment, the interaction of β -catenin with CREB1 in the nucleus represents a mainstream in TH transcription. In one embodiment, the active β -catenin binds to lymphoid enhancer factor 1/T cell factor 1 (LEF1), which results in the conversion of LEF1 from a transcriptional repressor to activation. child. LEF1 then recruits and interacts with Pitx2, a member of the superfamily of a bicoid -related factor. In one embodiment, LEF1 promotes transcription of the Pitx2 gene. In another embodiment, LEF1 promotes transcription of the Pitx3 gene. In another embodiment, LEF1 promotes transcription of both Pitx3 and Pitx2 genes. In one embodiment, β -catenin, Pitx2, and LEF1 synergistically interact to modulate the LEF-1 promoter.

In addition, transient nuclear activity of NFAT1 acts as a transcription factor to generate cytokines and TNF- α for use in immune responses. However, because of phosphorylated GSK3 β it is possible to suppress to calcineurin phosphatase - induced NFAT1 DNA incorporated in the core and to facilitate nuclear export, this effect is unlikely to occur in this case. Therefore, since this effect is inhibited by NFAT1 siRNA (Fig. 22e), the active cytoplasmic NFAT1 will interact and activate the cytoplasmic transcription factor myocyte enhancer factor 2A (MEF2A) (Fig. 22c and 22d). Specifically, the rapidly inducible CREB1 enters the nucleus and is transcribed to generate the MEF2A gene of the MEF2A protein (Fig. 22f). MEF2A may act in a variety of ways on gene transcription (Fig. 22g), including autoregulation of autoregulation to generate more MEF2A, transcription of the TH gene for dopaminergic specification, transcription of the SNCA gene for SNCA/ MAPT/parkin complex formation, and interaction with EP300 and Pitx2 (which was inhibited by MEF2A siRNA) (Fig. 22h).

In one embodiment, the active EP300 targets the HDAC6 gene as well as the TH gene. In one embodiment, the active EP300 targets the HDAC6 gene. In another embodiment, the active EP300 targets the TH gene. In one embodiment, the active EP300 promotes transcription of the HDAC6 gene as well as the TH gene. In another embodiment, the active EP300 inhibits transcription of the HDAC6 gene as well as the TH gene. In another embodiment, HDAC6 transports beta -catenin for nuclear translocation.

In one embodiment, provided herein is a feature of performing a transcriptional complex that is formed and designated for transcription of the TH gene. For example, CREB1, EP300, and MEF2A are capable of targeting the promoter of the TH gene, while β -catenin, LEF1, and Pitx2 perform co-activators as enhancers during the transcription process. In one specific example, provided herein is a method for understanding how these genes manipulate the balance between differentiation and proliferation in dopamine NSCs, which has implications for assessing disease mechanisms (eg, PD).

Various aspects of CaMKII

On developing NSCs, local calcium influx via voltage-gated calcium channels or neurotransmitter receptors leads to CaMKII activation, while forward transmission Kind of message. In one embodiment, for excitability-transcription coupling, spatiotemporal CaMKII triggers c-Src mRNA localization via activated eIF4B in hTS cells to synthesize c-Src protein, resulting in activation of Nanog for self - Update and hyperplasia. In another embodiment, CaMKII triggers activation of local CREB1, resulting in a retrograde trafficking into the nucleus to transcribe the target gene MEF2A . MEF2A regulates cell function not only in neuronal differentiation and proliferation, but also in skeletal and cardiac muscle development. In one embodiment, CaMKII activates MAPT to regulate parkin proteins and, in turn, MAPT activates tubulin heterodimers for use in microtubule combinations (Figures 22a and 22j). These results suggest that CaMKII signaling in early spacetime is responsible for the activation of tubulin to promote microtubule assembly, neuronal movement, and neuronal polarization in early developmental NSCs, which ensures striate with the brain. Appropriate connectivity of the striatal targets.

L-type calcium ion channels otherwise regulate intracellular calcium for constant, which involves excitability-neurogenesis in adult NSCs. An elevated potassium chloride (KCl) level causes membrane depolarization, which results in an influx of calcium via the L-type potential-sensitive calcium channel, which is sufficient to pass ER and granules in the neuron Interaction between bodies to induce mitochondrial dysfunction. In one embodiment, RA modulates intracellular ER calcium associated with L-type calcium ion channels.

CaMKII {CaM-dependent protein kinase II] (a downstream effector of L-type Ca ²⁺ channels) in response to transient low-amplitude calcium ions The response of the transient low-amplitude calcium spikes exhibits a lower affinity for Ca ²⁺ /calcin-producing proteins. In one embodiment, RA modulates a time-space activation of CaMKII. In another embodiment, RA induces a spatiotemporal activation of CaMKII. In another embodiment, RA inhibits a spatiotemporal activation of CaMKII.

By IP analysis, CaMKII directly phosphorylates and activates CREB1 (Fig. 21c), which is a previous study of CaMKII's localization of L-type calcium channel activity to CREB signaling to the nucleus on excitatory-transcriptional coupling. Tolerance. Because axons contain a variety of different localized mRNAs encoding specific protein synthesis, including CaMKII, calcineurin and CREB1 in developing neurons, this shows that foreign RA-triggered mRNA translation machinery occurs on them, Because they can be inhibited by eukaryotic initiation factor 4B (elf4B) siRNA (Fig. 21d). Therefore, this partial CREB1 A specific transcriptional process that can be transported back for responsibility for signaling a terminal axon in the nucleus. These results show a rapid inducible gene transcription for extracellular signals.

These results are the first to explore: G α _q/11 signal-derived CaMKII excitation involves the maintenance of self-renewal of tNSCs. At the same time, these results show the importance of axonal behaviors in early neurogenesis. SNCA interacts with phospholipid membranes and plays an important role in the pathogenesis of neurodegenerative disorders, including PD and Alzheimer's disease.

Calcium-regulated phosphatase/NFAT1 signaling

In one embodiment, RA modulates calcium to produce dephosphatase production. In one embodiment, RA induces the production of calcium phosphatase. In another embodiment, ER calcium is linked to calcium dephosphatase/NFAT1 signaling, which is consistent with previous studies. In another embodiment, by cell separation analysis, RA induces a transient interaction of NFAT1 and an endogenous protein [a cytoplasmic plasmonic transporter], resulting in nuclear translocation of NFAT1. This short-lived utility of NFAT1 is thought to be a mechanism by which cells can distinguish between persistent and transient calcium signals. In one embodiment, RA-induced calcium dephosphatase/NFAT1 signaling involves early neurogenesis.

Cellular Remodeling at the time of initial neurogenesis

In one embodiment, provided herein is a method for inducing a molecular process during the transition of hTS cells to tNSCs. in In one embodiment, the molecular processes are induced by RA. In one specific example, molecular cascades were detected at 2 time points: 4 hours (early) and 24 hours (late). In one specific example, molecular events occur in two periods. In a particular embodiment, a period includes a spatiotemporal response to tissue differentiation (eg, Figure 23, early, red line). In another specific embodiment, a period includes gene transcription on cell differentiation and proliferation (eg, Figure 23, late, black line).

In one embodiment, the mechanism of differentiation in early neuronal tissue is characterized. Once stem cells sense an extraneous guiding signal, various specific subcellular mRNA localizations are rapidly initiated, and as a reaction, local production of specific proteins (later than the distant transcriptional process in the nucleus). Through protein-protein interactions and "sensory experience", these local proteins accumulate at the subcellular regions to initiate growth cone formation in early developing NSCs. Asymmetric division begins with gene transcription. For example, the presence of beta -catenin is visible at the synaptic membrane after 5 minutes of RA treatment (Figure 25, box insert) and local activated CREB1 moves back into the nucleus Transcription of the target gene MEF2A .

In one embodiment, a series of molecular processes occur synergistically to regulate mitochondrial function, lipid metabolism of membrane, axonal growth, neuronal movement and plasticity ( Neuronal migration and plasticity) and microtubule combinations, including but not limited to: RXRα, RARβ, β -catenin, Akt, CREB1, mTOR, CaMKII, calcineurin, c-Src, GSK3 β , SNCA And MAPT. In another specific example, transcription on the TH gene by MEF2A, EP300, and CREB1 represents an inducible gene expression that induces chromatin looping from the chromosomal region and facilitates subsequent gene transcription. In another embodiment, the component of the RA-induced G protein signaling plays a key role in neuronal tissue differentiation and also acts as an integral part of the activation transcription at the TH gene.

Described herein is a balance between differentiation and proliferation to maintain a steady state of tNSCs in vitro. In one embodiment, neural differentiation is controlled by modulating RA-signaling. Prior to the further application of regenerative drugs or drug discovery, manipulation of hTS cells can be more efficiently energized in vitro through the understanding of these regulatory mechanisms.

tNSCs have an immune exemption

One specific example provided herein describes a method of treating a neurological disorder using at least one tNSC, wherein the cells are immunologically exempt. In another embodiment, the tNSC does not elicit an immune response. In another embodiment, the tNSC does not elicit an immune response from a T cell, B cell, macrophage, microglia, NK cell or mast cell. In another embodiment, the tNSC inhibits an immune response. In another embodiment, the tNSC has reduced immunogenicity. In another embodiment, the tNSC does not result in tumor formation. In another embodiment, the tNSC is designed to be immune exempt. In another specific example provided herein, a population of tNSC cells is used to treat A method of treating a neurological disorder in which the cells are immune exempt. In another embodiment, the use of stem cells or their derivatives as cell therapy benefits from understanding their immunogenicity to help determine the application of immunosuppression agents after implantation.

Another aspect described herein is a method for detecting and comparing the expression of immune-associated genes and markers in hTS cells, tNSCs, and hES cells. In one embodiment, the performance is detected by flow cytometric analysis.

Examples of immuno-related genes and markers in hTS cells, tNSCs, and hES cells include, but are not limited to, HLA-ABC, HLA-DR, CD14, CD44, CD73, CD33, CD34, CD45, CD105, and CD133. In another embodiment, the expression of HLA-ABC in hTS cells and tNSCs is higher in tNSCs than in hES cells. In one specific example, the negative expression of HLA-DR was observed in all three stem cells (Fig. 2e). In another specific example, HLA-ABC was higher in hTS cells (99.4%) and tNSCs (99.7%) than in hES cells (12.9%), and was higher in tNSCs (Fig. 2e). In another specific example, no difference in CD14 and CD44 expression was seen among hTS cells, tNSCs, and hES cells. In another embodiment, high levels of CD73 are expressed in hTS cells as well as in tNSCs compared to negative expression levels in hES cells (Fig. 2f). In one embodiment, the tNSCs have the property of mesenchymal stem cells, which facilitates the proliferation of glial cells.

In another specific example, CD33 (which is in the extracellular portion) The immunoglobulin structure and a transmembrane receptor were expressed in hTS and hES cells but not in tNSCs (Fig. 2g). In another embodiment, the absence of CD33 in tNSCs facilitates cell therapy because of its association with immune defense. Thus, provided herein are tNSCs having a low level of CD33 expression and thus low immunogenicity.

In one specific example, no difference in the expression of mesenchymal stem cell marker CD105 was found among them. In another specific example, the low level of cancer stem cell marker CD133 is found in tNSCs compared to hTS cells and hES cells. In another specific example, the low level of cancer stem cell marker CD133 (11.8%) was found in tNSCs compared to hTS cells (93.6%) and hES cells (98.8%) (Fig. 2h). Accordingly, provided herein are tNSCs having a low level of CD133 expression and thus low tumorigenicity.

Further provided herein are selective populations of CD133+tNSCs that are beneficial for transplantation as well as tissue regeneration for stem cell therapy. Also provided herein are tNSCs with an immune-exempt status that are viable candidates for cell-based therapy.

In one embodiment, RA induces a change in the expression of an immune-related marker, for example, a decrease in cells with CD34(+) but a decrease in CD133(+). In another embodiment, RA induces differentiation of CD34(+) hES cells into smooth muscle progenitors (smooth muscle progenitor) Cells). In another embodiment, grafts selected from CD34(+) immunologous transplantation tNSCs are feasible in children with high-risk neuroblastoma.

Differentiation and hyperplasia after implantation

In neurogenesis, the association between RA and retinoic acid-reactive elements (RARE) is known (Maden, M. et al. , Nat. Rev. Neuroscience . 8, 755-765, (2007)), but not The existence of the -RARE effect is under-understood. In one embodiment, RA induces activation of the RXR α /RAR β /c-Src complex via a “pull and push” mechanism of G protein-coupled receptor (GPCRs) signaling. In another embodiment, RXR alpha is first activated by interaction with G α _q/11 within 2 hours, followed by c-Src and subsequent activation of RAR β to form a complex (Figures 3a and 3b). ). Among them, c-Src subsequently induced Nanog overexpression via Stat3 to maintain the pluripotency and self-renewal of those hTS cell-derived NSCs.

This signaling pathway suggests that RA does not necessarily enter the cell to trigger the typical RA/RXR/RAR/RARE pathway. Alternatively, RA activates the G protein G α _q/11 via GPCR signaling, which is related to signal transduction. The concept is compatible. Thus, in one embodiment, provided herein are methods for controlling the pluripotency and self-renewal of RA-regulated NSCs, as well as methods of manipulating hTS cells and/or neural stem cells before and after transplantation. In another embodiment, Wnt and RA affect Cdx1 in a proximal promoter via an atypical RARE and a Lef/Tcf-reaction element (LRE), respectively.

In one embodiment, RA induces differentiation of hTS cells into dopamine NSCs via a typical RA/RARE signaling pathway to maintain stem cell properties. In another embodiment, a non-RARE signaling pathway generates functional dopamine NSCs via activation of a Wnt/[ beta] -catenin message cascade. In another embodiment, the impairment of non-RARE signaling causes a malfunction or absence of dopamine production, resulting in a progressive degenerative change in dopamine neurons. Thus, in another embodiment, provided herein is a neural stem cell that differentiates into dopamine neurons via activation of a non-RARE signaling pathway.

RA activates the PKC pathway at 6 hours prior to induction of RAR-beta expression. RA causes a 1.3-fold transient increase in intracellular acid glycerides (diacylglycerol, DG), and within 5 minutes of isozymes of PKC gamma] (gamma isozyme) (PKC- γ) at 2 minutes One transposition (Kurie JM et al. , Biochim Biophys Acta. 1993, 1179(2): 203-7). These findings indicate that PKC pathway activation is an early step in RA-regulated human TC differentiation, and that PKC- γ enhances the utility of RA in RAR transcriptional activation. Thus, provided herein are methods for controlling the differentiation of hTS cells. In one embodiment, modulation of the PKC signaling pathway controls hTS cell differentiation.

BMP4 works with LIF to support the expansion of undifferentiated mES cells. BMP4 induces trophoblast differentiation of hES cells (Qi X, et al. , Proc Natl Acad Sci US A. 2004; 101: 6027-6032). BMP-induced Id proteins cooperate with STAT3 to inhibit differentiation and maintain embryonic stem cell self-renewal (Ying, QL, et al. , Cell. 2003; 115:281-292). Bone-formed proteins (BMPs) bind to LIF to maintain self-renewal and maintain multivariate differentiation, chimera colonization, and germline transmission properties (Xu RH, et al. , Nat) Biotechnol. 2002; 20: 1261-1264). Thus, in one embodiment, provided herein is a method of inducing dopamine differentiation of the tNSCs described herein by modulating PKC and/or BMP.

Treatment of disease

Provided herein is a method for treating a disorder, wherein the method comprises transplanting a pure population of neurons or a complex of a particular neural stem cell population to a patient, wherein the patient has the need of. In one embodiment, the patient is diagnosed with a neurological disorder. In another embodiment, the patient is diagnosed with a neuropsychiatric disorder. In another embodiment, the patient is diagnosed with a neurodegenerative disorder. In another embodiment, the pure population of neurons comprises dopamine neurons.

Any of the methods described herein can be used to treat a disease or disorder. In one embodiment, the disease is a neurological disease. In another embodiment, the disease is a neurodegenerative disease or disorder. Non-limiting examples of neurological diseases include: Parkinson's disease, Alzheimer's disease, Huntington's disease, systolic lateral sclerosis, Fleet's movement disorder, Lewis' body disease, spinal muscular muscle Atrophy, multiple system atrophy, dementia, schizophrenia, paralysis, multiple sclerosis, spinal cord injury, brain injury (eg stroke), cranial nerve disorder, peripheral sensory neuropathy, epilepsy , pathogenic protein particle disorders, CJD, Albé's disease, cerebellum/spinal cerebellar degeneration, Baden's disease, cortical basal ganglia degeneration, Burr's sputum, Geb's syndrome, Pick's disease, and self Autism.

Thus, the tNSCs described herein are suitable for use in the treatment of neurodegenerative disorders including, but not limited to, Parkinson's disease, Alzheimer's disease, Huntington's disease, spinal cord injury, glaucoma, or the like.

In addition, tNSCs also express neurotransmitter serotonin. Thus, a specific example describes the use of tNSCs in the treatment of neuropsychiatric disorders. Non-limiting examples of neuropsychiatric disorders include: depression, schizophrenia, dementia, autism, attention deficit hyperactivity disorder, and bipolar disorder.

Any of the methods described herein can be used to ameliorate or improve a symptom of a neurological disease or disorder. Non-limiting examples of symptoms associated with a neurological disease or disorder include: tremor, gait, poor gait, dementia, excessive swelling (edema), muscle weakness, lower extremity atrophy, dyskinesia (chore), muscle Stiffness, slowing of physical movement (slow movement), loss of physical movement (exercise disability), forgetfulness, cognitive (smart) damage, lack of identification (missing), impaired function (such as decision making) Painting), half face numbness, loss of feeling, numbness, tingling, painful sensation of limbs, weakness, cranial nerve palsy, speech disorder, eye movement, visual field disorder, blindness, bleeding, secretions, proximal muscle loss , dyskinesia, abnormal muscle tone in the limbs, decreased muscle rigidity, movement disorders, false indications in finger-finger tests or finger-nose tests, poor positioning, Hosner's phenomenon, Incomplete or complete systemic paralysis, optic neuritis, visual hyperactivity, ocular dyskinesia (such as nystagmus), spastic paralysis, painful tonic attack, Lhermitte's syndrome, disorders, language difficulties, bladder rectum Obstacle, standing hypotension, decreased motor function, bedwetting, poor speech expression, inadequate sleep patterns, sleep disorders, appetite disorders, weight changes, psychomotor agitation or retardation, reduced vitality, worthless feelings Or excessive or inappropriate guilt, difficulty in thinking or concentration, repeated intentions of death or suicidal thoughts or attempts, fear, anxiety, excitement, meditation or compulsive meditation, excessive fear of physical health, panic attacks, and phobia .

Described herein are tNSCs having the following specific desired properties: First, the tNSCs are composed of heterogeneous subtypes with consistent phenotype, stable gene expression, and pluripotency characteristics. Mixed cell populations; second, they contain glia progenitor cells and stellate cells that substantially enhance dopaminergic neurogenesis; and third, they have a dopamine neuron that is used to "save" dysfunction The intrinsic ability and the nature of the immune-exemption; and finally, the neurotrophic effects of different neural precursors secreted from the host tissue will promote structural repair.

In some embodiments, provided herein are tNSCs having the following specific desired characteristics to allow for proper manipulation of the transplant treatment: 1) the unique tNSCs are based on consistency in quality and sufficient Cell-derived RA is simply and efficiently induced; 2) these are shifted The transplanted tNSCs functionally generate neonatal dopamine neurons in the injured nigrostriatal pathway, which can survive for at least 18 weeks after implantation; 3) sensorimotor impairments are The third week after implantation was significantly improved as early as possible; 4) these tNSCs have an immune exemption to promote stem cell therapy; 5) the molecular mechanism of manipulation on cell proliferation as described herein allows for development for use after transplantation Strategies for preventing tumor formation; 6) the tNSCs are capable of growing in culture through several cell passages; and 7) the tNSCs can be cultured in a medium without mouse embryonic feeder cells.

In one embodiment, provided herein is a method for treating acute and chronic diseases, wherein the method comprises implanting hTS cell-derived tNSCs. In one embodiment, the tNSCs are implanted into the brain of a patient suffering from a neurological disorder. In another embodiment, the tNSCs are implanted into the striatum of a patient suffering from a neurological disorder.

One aspect described herein is a method for treating a neurological disorder, wherein the method comprises site-specific integration of tNSCs. In one embodiment, the tNSCs are derived from hTS cells. In another embodiment, the likelihood of tumor formation is lower when compared to hES cells.

Treatment of neurodegenerative diseases by regeneration of dopamine neurons

Provided herein are methods for inducing dopamine neurons in a mammal, wherein the neuronal progenitor cells described herein are transplanted as a cell suspension, thereby producing a graft comparable to a tissue slab. Produce a more homogeneous neural reinnervation. In one embodiment, the induction of dopamine neurons as described herein reduces the risk of dyskinesias and increases the likelihood of clinically beneficial utility. In one embodiment, the mammal is a human. In another embodiment, the mammal is a rat, mouse, pig, dog, monkey, orangutan or human ape.

Transplantation of tNSCs induces newly formed dopamine neurons in the nigrostriatal pathway and substantially improves behavioral disorders in rats with Parkinson's disease. These results provide evidence that hTS cells are human pluripotent stem cells suitable for use in clinical applications to treat neurodegenerative diseases.

A first experiment was performed to detect: 1) whether the tNSCs treated with RA for different durations would affect the efficacy of improvement in behavioral deficits in PD rats; and 2) the transplants How long does the incoming tNSCs survive in the brain? Transplantation of GFP-tagged tNSCs (1.5×10 ⁶ ) into the two sites of the injured striatum significantly improved behavior from week 3 to week 12 by dehydration morphine-induced rotation analysis. Defect (Figure 5a). PD rats receiving 5-day RA-induced tNSCs showed a significant improvement at the beginning of 6-week post-implantation, however, this effect subsequently disappeared at week 12 and was similar to that of the control group. This reason can be explained by the fact that most of the neurogenic fate-limited GRP (Götz) after induction for more than 5 days is placed at a ridge on the differentiation into undefined trophoblast giant cells. Given the improved behavior, rats were sacrificed at week 18 to detect the viability of those GFP-tagged tNSCs. Brain sections immunohistochemically showed that a large number of newly generated dopaminergic neurons in the nigrostriatal pathway with multiple exogenous dopamine neurons protruding from the cell body reinforce the surrounding brain regions (Fig. 5b). However, none of these phenomena were observed in rats receiving 5-day RA-induced tNSCs (Fig. 5c) and control PD group (Fig. 5d). At week 18, immunofluorescence microscopy demonstrated that GFP-tagged tNSCs were still present in the injured area and were distributed or spotted at the injection site. No teratoma formation was found and no immunosuppressive agents were used.

In order to avoid the inverse effects of dopamine overgrowth and uneven and disproportionate nerve re-domination, a second experiment attempted to transplant fewer tNSCs (1 × 10 ⁶ ) by injection into a single site to "aged""Injured striatum of PD rats (n=16; body weight 630-490 gm). Behavioral assessments were analyzed every 3 weeks after implantation. The results showed that in the dehydrated morphine-induced rotation test, there was a significant improvement in the rotation of the pair from the 3rd week to the 12th week after implantation (Fig. 6a). To assess the utility of cell therapy in postural imbalances and gait lesions (PIGD) characterized by motor disability, stiffness, and pace and balance disorders, several tests (such as walking speed, pace length, cross) The step length and the basis of the support are executed. The gripping time of the affected forelimbs on the bar was significantly shortened by up to 3 weeks and continued to improve at the end of the 12th week in the "bar test" (Fig. 6b), suggesting a forelimb Grab the power to improve very quickly. Measurements of stride length (Fig. 6c), stride length (Fig. 6d), walking speed (Fig. 6e), and support base (Fig. 6f) showed that transplantation of tNSCs significantly improved sensorimotor function from early 3rd week to 12th week. obstacle. In one embodiment, the tNSCs are suitable candidates for regenerative medicine for stem cell-based treatment in patients with neurodegenerative diseases (eg, Parkinson's disease). At the end of the 12th week, the rats were sacrificed and brain sections were subjected to immunostaining with tyrosine hydroxylase (TH). These experiments show that regeneration of new dopamine neurons occurs in the nigrostriatal pathway (Figure 19). The newly generated dopamine neurons were evaluated by using densitometry, which showed a recovery of 28.2%. In one embodiment, the tNSCs are an alternative to both hES cells and fetal mesencephalic tissue in the treatment of patients with neurodegenerative diseases.

In one embodiment, provided herein is an hTS cell which is a human pluripotent stem cell other than a hES cell, but which has pluripotency and self-renewal similar properties in early embryogenesis. In vivo, transplanted tNSCs functionally generate neonatal dopamine neurons in the injured nigrostriatal pathway, which survive in PD rats for at least 18 weeks after implantation. The sensory dyskinesia was significantly improved as early as the third week after implantation by a behavioral assessment in both young and aged PD rats. Transplantation of hTS cell-derived NSCs into the brain neurotoxin-denervated striatum enables regeneration of the missing dopamine neurons and amelioration of major behavioral defects in PD-bearing rats.

In one embodiment, DA neurons in the nigrostriatal pathway are regenerated. In another embodiment, the implanted tNSCs increase glial cells in the striatum. In another embodiment, RA induces the expression of GRAP and GFAP-positive progenitor cells, which produces nerves throughout the CNS And oligodendrocytes.

Treatment of Alzheimer's disease

Provided herein is a method for treating Alzheimer's disease, wherein the method comprises transplanting a neuronal progenitor cell into the brain of a mammal. In one embodiment, the mammal is a human. In another embodiment, the human is at risk of being diagnosed with Alzheimer's disease or developing Alzheimer's disease (eg, a family history with the disease or he has been identified as having A disease in a person with a risk factor). In another embodiment, the mammal is a pig, dog, monkey, orangutan or human ape. In another embodiment, the mammal is a mouse. In another embodiment, the mammal is a rat. In another embodiment, the rat or mouse exhibits symptoms of Alzheimer's disease. In one embodiment, the neuronal progenitor cells are transplanted into a non-human animal model for the disease [eg, a mouse model in which AD7c-NTP is overexpressed), an Alzheimer's disease rat model. , a mouse model of gene transfer, etc.].

In one embodiment, the hTS cells are treated with an inducer to provide a population of neuronal cells having a biomarker characteristic. In a specific embodiment, the inducer is RA. In one embodiment, the molecular mechanism or signaling pathway is modulated to maintain pluripotency. In another embodiment, the molecular mechanism or signaling pathway is modulated to prevent tumor formation following transplantation.

In another embodiment, the tNSCs are transplanted or embedded in the brain of a mammal. In one embodiment, the neuronal progenitor cells are transplanted as a cell suspension, thereby producing a more homogeneous nerve. Dominate again. In another embodiment, the neuronal progenitor cells are injected into the brain of the mammal. In another embodiment, the tNSCs derived from hTS cells are embedded in the subventricular zone of the brain. In one embodiment, the mammal is a human.

In one embodiment, induction of neurons as described herein reduces the risk of tumor formation and increases the likelihood of clinically beneficial utility. In another embodiment, the recipient of tNSCs shows an improvement in symptoms associated with Alzheimer's disease. In another embodiment, the connections between neurons in the brain are increased and strengthened.

Treatment of schizophrenia

Provided herein is a method for treating schizophrenia, wherein the method comprises transplanting a neuronal progenitor cell into the brain of a mammal. In one embodiment, the mammal is a human. In another embodiment, the human is at risk of being diagnosed with schizophrenia or at developing schizophrenia (eg, a family history with the disease or he has been identified as having a risk for the disease) The patient in the factor). In another embodiment, the mammal is a mouse. In another embodiment, the mammal is a rat. In another embodiment, the mammal is a pig, dog, monkey, orangutan or human ape. In another embodiment, the rat or mouse exhibits symptoms of schizophrenia.

In one embodiment, the neuronal progenitor cells are transplanted into a non-human animal model for the disease (eg, a schizophrenia rat model, a gene-transferred mouse model, etc.). In one embodiment, the model mouse has a normal physiological regulation that is altered by one of the neuronal systems. In another embodiment, the model animal or tissue can be utilized to screen for potential therapeutic agents and/or therapeutic regimens that act on the intracellular level.

In one embodiment, the hTS cells are treated with an inducer to provide a population of neuronal cells having a biomarker signature. In a specific embodiment, the inducer is RA. In one embodiment, the molecular mechanism or signaling pathway is modulated to maintain pluripotency. In another embodiment, the molecular mechanism or signaling pathway is modulated to prevent tumor formation following transplantation.

In another embodiment, the tNSCs are transplanted or embedded in the brain of a mammal. In one embodiment, the neuronal progenitor cells are transplanted as a cell suspension, thereby producing a more homogeneous neural re-innervation. In another embodiment, the neuronal progenitor cells are injected into the brain of the mammal.

In one embodiment, induction of neurons as described herein reduces the risk of tumor formation and increases the likelihood of clinically beneficial utility. In another embodiment, the recipient of tNSCs shows an improvement in symptoms associated with schizophrenia.

Dosing and Administration

Modes of administration of an isolated neural stem cell preparation described herein include, but are not limited to, systemic intravenous injection and direct injection to the intended active site. The formulation can be administered by any convenient route [e.g., by infusion or bolus injection] and can be administered with other biologically active agents. In one In the system, the administration is systemic localized administration.

In one embodiment, a neural stem cell preparation or composition is formulated as a pharmaceutical composition suitable for intravenous administration to mammals, including humans. In some embodiments, the composition for intravenous administration is a solution in a sterile isotonic aqueous buffer. When necessary, the composition also includes a local anesthetic to improve any pain at the site of the injection. When the composition is to be administered by instillation, it can be dispensed using an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is to be administered by injection, an ampoule of sterile water or saline for injection may be provided such that the ingredients are mixed prior to administration.

In one embodiment, a suitable pharmaceutical composition comprises a therapeutically effective amount of progenitor stem cells and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, and combinations thereof.

In one embodiment, the isolated tNSCs described herein are delivered to a target site (eg, brain, spinal cord, or any) by a delivery system suitable for targeting cells to a particular tissue. Other sites of nerve damage and/or degradation). For example, the cells are encapsulated in a delivery vehicle, allowing the cells to be slowly released at the site of the target. The delivery carrier is modified such that it is specifically targeted To a specific organization. The surface of the targeted delivery system is modified in a variety of different ways. When it is a liposome-targeted delivery system, lipid groups are incorporated into the lipid bilayer of the liposome to maintain the target ligand and the liposomal bilayer. It is a stable association.

In another example, a colloidal dispersion system is used. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems [including oil-in-oil (oil-in-) Water emulsions), micelles, mixed micelles, and liposomes.

The administration of the tNSCs described herein is tailored to one body selectively by (1) increasing or decreasing the number of cells injected; (2) changing the number of injections; (3) changing the number The method of delivery of the cells; or (4) altering the source of the cells, for example by genetically engineered cells or from in vitro cell cultures.

The tNSC formulation is used in an amount effective to promote cell implantation in the recipient. At the discretion of the physician, the administration is adjusted to achieve optimal efficacy and pharmacological administration.

Screening method

Provided herein is a method of screening for a compound for use in treating or preventing a disease. In one embodiment, the method comprises contacting an isolated human trophoblast stem cell with the compound. In another embodiment, the method comprises analysing an isolated neural stem cell Contact with matter. In another embodiment, the method further comprises detecting a change in activity of at least one gene, transcript or protein in the human trophoblast stem cells. In another embodiment, the method further comprises detecting a change in the level of at least one transcript or protein in the human trophoblast stem cells. In another embodiment, the method comprises detecting a change in activity of at least one gene, transcript or protein in the neural stem cell.

One specific example provided herein describes a method of screening for a compound having the ability to induce alterations in a cell. In one embodiment, the method comprises contacting an isolated human trophoblast stem cell with the compound. In another embodiment, the method comprises contacting an isolated neural progenitor stem cell with the compound. In another embodiment, the method further comprises detecting an induction of differentiation of the human trophoblast stem cells. In another embodiment, the method further comprises detecting an induction of differentiation of the neural stem cell.

Also provided herein is a method of screening for a compound having cellular toxicity or modulating cells, the method comprising contacting a differentiated cell of the invention with the compound. In another embodiment, the method further comprises determining any phenotypic or metabolic alterations in the cell resulting from contact with the compound, and associated with cytotoxicity or any other alteration in cellular function or biochemistry change. In another embodiment, screening of differentiated pharmaceuticals, toxins or potential regulators is facilitated. These substances (eg, agents, toxins or potential regulators) can be added to the medium.

One specific example provided herein describes a method of screening for proliferation factors, differentiation factors, and agents. In one embodiment, human trophoblast stem cells or neural stem cells are used to screen for factors affecting the properties of human trophoblast stem cells or neural stem cells in culture [such as small molecule drugs, peptides, polynucleotides ( Polynucleotides and the like (such as culture conditions or operations). In one embodiment, the system has the advantage of being hampered by a secondary effect caused by a disturbance of the feeding cells caused by the test compound. In another embodiment, the growth-affecting substance is tested. In another embodiment, the conditioned medium is removed from the culture and replaced with a simpler medium. In another embodiment, the different wells are then processed with cocktails of different soluble factors (they are candidates for replacing the components of the conditioned medium). If the treated cells are maintained and proliferated in a satisfactory manner (optimally as in conditioned medium), the efficacy of each mixture is determined. Potential differentiation factors or conditions can be tested by treating the cells according to a test protocol, and then determining whether the treated cells develop functional or phenotypic characteristics of the differentiated cells of one particular lineage.

In one embodiment, the human trophoblast stem cells or neural stem cells are used to screen for potential regulators of cell differentiation. In one embodiment, the cell differentiation is neural differentiation. For example, in an assay for screening for regulators of cell differentiation, the human trophoblast stem cells or neural stem cells can be in serum-free, low-density conditions (as the situation requires in the presence of LIF or It is cultured in the absence of, in the presence of a regulator, and in the presence or absence of RA, and the utility of differentiation can be detected. In another embodiment, the screening methods described herein can be used to study conditions associated with cell development and to screen for potential therapeutics or corrected drugs or modulators associated with the condition. For example, in one embodiment, the development of normal human trophoblast stem cells or neural stem cells is compared to the development of cells having this condition.

In one embodiment, the gene and protein expression can be compared between different cell populations derived from human trophoblast stem cells or neural stem cells, and used to identify and distinguish between being upregulated or downregulated during differentiation. Factors, as well as nucleotide copies that produce the affected gene.

In one embodiment, unfed human trophoblast stem cells or neural stem cell cultures can also be used in pharmaceutical research to test pharmaceutical compounds. Evaluation of the activity of a candidate pharmaceutical compound typically involves combining the differentiated cells of the invention with the candidate compound, determining any resulting changes, and then correlating the utility of the compound with the observed changes. In another embodiment, the screening is done, for example, because the compound is designed to have a pharmacological effect on a particular cell type, or because a compound that is designed to be useful elsewhere has an unwanted effect. Side effects. In another embodiment, two or more drugs are tested in combination (by simultaneous or sequential combination with cells) to detect possible drug-drug interaction effects. In another specific example, the compound is the most The primary site was screened for potential toxicity. In another embodiment, cytotoxicity is achieved by DNA synthesis or repair in cell viability, survival, morphology, on the expression or release of a particular marker, receptor or enzyme. The role is determined.

The terms "treating", "treatment" and the like are used herein to mean obtaining a desired pharmacological and/or physiological effect. In some embodiments, a body (eg, an individual suspected of suffering from a neurodegenerative disorder and/or genetically predisposed to a neurodegenerative disorder) is prophylactically treated with a formulation of a tNSCs as described herein. And the prophylactic treatment completely or partially prevents a neurodegenerative disorder or its signs or symptoms. In some embodiments, a body is treated therapeutically (eg, when a subject is suffering from a neurodegenerative disorder), the therapeutic treatment causing a partial or complete cure for a disorder, and/or reversing one The adverse effect attributable to the disorder, and/or stabilization of the disorder, and/or delaying the progression of the disorder, and/or causing regression of the disorder.

Administration (eg, transplantation) of tNSCs to a region in need of treatment is by, for example and without limitation, local instillation during surgery, by injection, by a catheter, or by An implant {the implant is a porous, non-porous or gel-like material, including a membrane [such as silicatic membranes] or fibers} The way is done.

"Transplanting" a composition to a mammal means introducing the composition into the mammal by any method established in the art. The introduced composition is "graft (transplant)", and the mammal is a "recipient." The graft and the recipient may be syngeneic, allogeneic or xenogeneic. The transplant can be an autologous transplant.

An "effective amount" is an amount of a therapeutic agent sufficient to achieve the desired purpose. For example, an effective amount of a factor to increase the number of hTS cells or tNSCs is an amount sufficient to cause an increase in the number of neural stem cells in vivo or in vitro. An effective amount of a composition for treating or ameliorating a neurodegenerative disease or condition is an amount of the composition sufficient to reduce or remove symptoms of a neurodegenerative disease or condition. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal to be treated, and the purpose for which the drug is administered.

In a specific example, further provided herein are genetically engineered tNSCs. Manipulation modifies the various properties of the cell, for example, making it more adaptive or resistant to specific environmental conditions, and/or inducing one or more specific substances produced by the cell, which may, for example, enhance the activity of the cell . Such genetic alterations can be performed to make the cell more suitable for transplantation, for example, to avoid rejection of the cell from the recipient (for a review of the gene therapy procedure, see Anderson, Science, 256: 808; Mulligan, Science, 926; Miller, Nature, 357: 455; Van Brunt, Biotechnology, 6(10): 1149; and Yu et al. , Gene Therapy, 1:13).

A "vector" means a recombinant DNA or RNA construction A construct, such as a plasmid, a phage, a recombinant virus, or other vector, when introduced into a suitable host cell, results in a modification of a progenitor cell described herein. Suitable expression vectors are those well known to those of ordinary skill in the art, and include those that are replicable in eukaryotic and/or prokaryotic cells, as well as those that maintain epigenetic or those incorporated into the genome of the host cell. By.

The construction of the vector is achieved using the techniques described herein, for example, as described in Sambrook et al. , 1989. In one embodiment, the isolated plastid or DNA fragment is cleaved, cut, and rejoined in the form of the desired plastid. If desired, analysis to determine the correct sequence in the constructed plastid is performed using any suitable method. Suitable methods for constructing expression vectors, preparing in vitro transcripts, introducing DNA into host cells, and performing assays for assessing gene expression and function are known. Gene presentation, amplification, and/or performance is measured directly in a sample, for example, by Southern blotting, by Northern blotting, to quantify mRNA transcription, Northern blotting, Dot blotting (DNA or RNA analysis) or in situ hybridization (using a suitably labeled probe based on a sequence provided herein).

As used herein, terms such as "transfection,""transformation," and the like are intended to mean transferring a nucleic acid into a cell or organism in a functional form. Such term includes the various transfer of nucleic acid into a cell, including transfection to CaPO _4, electroporation (electroporation-), virus transduction (viral transduction), lipofection (lipofection), the use of liposomes, and / or other Delivery carrier delivery.

Cells are classified by affinity techniques or by cell sorting [such as fluorescence-activated cell sorting], where they are labeled with a suitable A label, such as a fluorophore conjugated to or partially, such as an antisense nucleic acid molecule or an immunoglobulin, or an intrinsic fluorescent protein (intrinsically fluorescent) Protein) [such as green fluorescent protein (GFP) or its variant]. As used herein, "sorting" means that a first cell type is at least partially physically separated from a second cell type.

As used herein, the term "about" means ± 15%. For example, the term "about 10" includes 8.5 to 11.5.

Other features and effects of the present invention will be apparent from the following description of the drawings, wherein: Figure 1 shows the characteristics of pluripotence and renewing in hTS cells. (1a) Measured by RT-PCR analysis, hTS cells express specific genes of both inner cell mass (ICM) and trophectoderm. (1b) illustrates specific stage embryonic antigens-1, -3, and -4 [specific stage embryonic antigen (SSEA)-1, -3, and -4] as seen by immunocytochemical staining. Performance and intracellular localization (darkened spots). In hTS cells (upper region), SSEA-1 is mostly expressed in the cytoplasm (upper left region), SSEA-3 is expressed in the nucleus (middle superior region), and SSEA-4 is expressed in both cytoplasm and membrane. In the middle (upper right area). These SSEA-expressing cells are histologically similar to ectopic villous cytotrophoblasts (lower region). (1c) Unmodified telomere of hTS cell cultures at passages 3 and 7 as measured by Terminal Restriction Fragment (TRF) Southern blot analysis Length (upper and lower areas). (1d) Venn diagram illustrating microarray analysis of gene expression in hTS (859 gene) and trophoblast-associated placenta-derived mesenchymal stem cells (PDMS cells) (2449 gene) Microarray analysis). A total of 2,140 and 3,730 genes were expressed in hTS cells as well as in trophoblast-associated PDMS cells (fold change >2-fold). (1e) Description from different concentrations of leukemia inhibitory factor (LIF) [ie 500, 250, 125 U/ml; U: units/ml, actin (Actin): β -actin as The results of the reverse transcription polymerase chain reaction (RT-PCR) analysis of the transcription factor expressed by the control sample. Removal of LIF inhibits Oct4 and Sox2 in hTS cells, but overexpresses Nanog and Cdx2. (1f) LIF (125 U/ml) Flow cytometric analysis (left panel) that promotes the expression of Nanog, Cdx2, Sox2, and Oct4 in hTS cells. The histograms show a negative dose-dependent manner (left zone) in Nanog and Cdx2 and a positive dose-dependent manner (right zone) in Oct4 and Sox2. (1g) a pattern of physiological distribution of LIF levels in different segments of fallopian tubes in women, particularly in the fallopian tube from the ampulla to the isthmus LIF level Physiology is reduced. The relative proportions of Oct4, Nanog, and Sox2 relative to Cdx2 each showed a dose-dependency in three different segments of the fallopian tube. (1h) The utility of different siRNAs for specific transcripts Nanog and Cdx2 in hTS cells was analyzed by RT-PCR (left) and flow cytometry analysis (right), illustrating a pluripotency in hTS cells. The maintenance of the interaction between Nanog and Cdx2. Data represent mean ± SD for 3 analyses. (1i) Histogram of gene intensity shows a homogenous form in hTS cells and a biphasic pattern in PDMS cells; Figure 2 illustrates that retinoic acid (RA) induces hTS cell differentiation into various The phenotype of neural stem cells. (2a) Distribution of various neural progenitor subtypes, including glial restricted precursors (GRP), neuron restricted precursors (NRP), pluripotency Multipotent neural stem (MNS) cells, astrocytes (AST), and undefined trophoblast giant cells (TGC). The frequency of hTS cell-derived neural progenitor cell subsets distributed at a consistent ratio during RA induction over time (ie 1, 3, 5, and 7 days), as shown in columns 1 through 4, respectively of. n: indicates the total number of cells counted. (2b) RT-PCR analysis of the expression of neural stem cell-associated genes of hTS cells before and after 1-day RA (10 μM) induction, including nestin produced from RA (10 μM)-induced hTS cells, Oct-4, neurofilament, NgN3, Neo-D, MAP-2 and CD133. (2c) Neural stem cell genes, including neurofilament proteins, nestin, and GFAP, which are immunoreactive with 3- and 5-day RA-induced hTS cells, as observed by flow cytometry analysis, They maintain a similar ratio in distribution. (2d) Immunocytochemical analysis of nestin, tyrosine hydroxylase-2 (TH-2) and serotonin of the immune response expressed by the trophoblastic neural stem cells (tNSCs) ( Immunocytochemical analysis). (2e) Comparative expression of immune-related genes in hTS cells, tNSCs, and human embryonic stem (hES) cells by flow cytometry analysis: HLA-ABC (MHC type I) in hTS cells (99.4) %) and tNSCs are highly expressed but lower in hES cells. HLA-DR (MHC class II) does not manifest in these cells. (2f) Comparative performance of immune-related genes in hTS cells, tNSCs, and hES cells by flow cytometry analysis: No differences in the expression of CD14 and CD44 were observed in these cells. Proliferative factor CD73 is highly expressed in hTS cells and tNSCs, but negatively in hES cells. (2g) Comparative analysis of immune-related genes in hTS cells, tNSCs, and hES cells by flow cytometry analysis: Transmembrane receptor CD33 is expressed in hTS and hES cells But not in tNSCs. CD45 does not be expressed in these cells. (2h) Comparative expression of immune-related genes in hTS cells, tNSCs, and hES cells by flow cytometry analysis: no expression of mesenchymal stem cell marker CD105 in hTS cells, tNSCs, and hES Differences in intensity were found, however, compared to hTS cells (93.6%) and hES cells (98.8%), fewer cancer stem cell markers CD133 (11.8%) were expressed in tNSCs; Figure 3 illustrates RA-induced Gene expression. (3a) illustrates the utility of RA (10 μM) on the c-Src/Stat3/Nanog pathway in activating tNSCs. RA (n=3) determined by RT-PCR analysis, RA induced a significant performance of c-Src, peaks at the 15th minute and then maintained at a lower level. (3b) Western blot analysis showed that RA stimulated RXR α , c-Src, and RAR β expression at 30 minutes, 1 hour, 2 hours, and 4 hours, respectively. RA induction promoted the expression of both G α _q/11 and G β within 30 minutes, suggesting involvement of G proteins signaling. (3c) Immunoprecipitation (IP) analysis demonstrated direct RA-induced binding between RXR alpha and RAR beta ; however, this interaction was blocked by the c-Src inhibitor PP1 analog, showing c -Src involves the binding of RXR alpha and RAR beta to form a scaffolding protein complex. (3d) IP assay analysis showed that RXR α has an independent binding interaction with G α _q/11 and RAR β has an independent binding interaction with G β . (3e) Describes the early generation of RA-induced c-Src in hTS, the apparent phosphorylation of Stat3 at the Tyr705 site, and the Western blot analysis of Nanog activation at the 1st hour; β -actin was Used in the control sample. (3f) The rapid generation of this c-Src protein by Western blot analysis then induced phosphorylation of Stat3 at the Tyr705 site and overexpression of Nanog. The c-Src inhibitor PP1 analog (4 μM) inhibited RA-induced phosphorylation of Stat3 on Tyr 705 and the performance of Nanog by Western blot analysis. (3g) Chromatin immunoprecipitation (ChIP) assay analysis demonstrating that RA stimulates the binding interaction of Stat3 with the Nanog promoter. Input: lysate, C: control group; Figure 4 illustrates the results of immunogold fluorescence transmission electron microscopy (IEM) analysis. The RA-induced binding interaction between the small gold particle-labeled RXR α (6 μM) and the large gold particle-labeled G α _q/11 (20 μM) was shown at the cell membrane. The immunostained RXR α and G α _q/11 mainly exhibited a homogeneous feature in the cytoplasm or nucleus by dynamic confocal immunofluorescence microscopy (Fig. 4, upper region). By treating with RA for 5 minutes, the RXR alpha intensity of the cytosol increased in the nuclear-perimeter region and the nuclear intensity decreased (line 1), indicating a cytosolic translocation after stimulation. The RXR alpha intensity of the nucleus becomes significant at the 15th minute, while the intensity of the cytosol decreases. These phenomena show that an increase in activity in one nucleus maintains a steady state in one cell. An apparent cytosolic translocation was again observed within 30 minutes. The change in the expression of G α _q/11 , on the other hand, is similar to that of RXR α (line 2); Figure 5 illustrates the transplantation of GFP-tagged tNSCs (3 × 10 ⁶ ) to Parkinson's disease. Analysis in (PD) rats. (5a) analyzed by apomorphine (apomorphine) induced rotation test (rotation test) of the; group A (dark - shaded circle, n = 4), which relates PD rats receiving tNSCs transplantation, the display Significant reduction in contralateral rotation from week 3 to week 12 after implantation; group b (light-shaded circle, n=4), which is relevant for 5-day RA-treated hTS cells PD rats showed an initial significant improvement at week 6 after implantation, but this improvement gradually decreased over the 12th week; and group c (triangles, n=4), it was relevant Untreated PD rats in the control group showed no improvement. Statistical analysis by repeated measures ANOVA: p- value = 0.001 and LSD post hoc comparisons between the two groups after repeated measures ANOVA: p = 0.037 at week 6 (a vs Group .c) and p = 0.008 (b vs. c group); p=0.019 at week 9 (a vs. c group); p = 0.005 at week 12 (group a vs. c) and p = 0.018 (group a vs. b). * indicates p < 0.05. (5b) described TH- positive staining time after implantation of 18 weeks in the striatum (lesioned striatum) by a group of the injury in immunohistochemistry (upper zone); immunofluorescent microscopy analysis: Immunization Fluorescent GFP-tagged tNSCs still have a spot at the site of the injection that remains in the injured striatum (lower region). (5c) described at 18 weeks after the injury by implantation of a group of substantia nigra (substantia nigra compacta, SNC) as reproduced TH- positive neurons (upper zone); is an enlarged end region Display (lower left area), scale bar: 100 μM; immunofluorescence microscopy analysis showed that immunofluorescent GFP-tagged tNSCs were retained in a scattered distribution (lower right region, arrow indicating GFP-labeled tNSCs). (5d) Describe the immunohistochemical staining of group b at week 18 after implantation: no TH-positive cells in the injured striatum (str, upper region) or subthalamic nucleus (left) Found in stn, lower area). (5e) Describe the immunohistochemical staining of group c at week 18 after implantation: cells without TH-staining in the injured striatum (str, upper zone) or injured SNC (lower zone) ) was found; arrows indicate implant needle trajectories; Figure 6 illustrates transplantation of tNSCs (1.5 × 10 ⁶ ) from an injection site to "aged" PD rats (n = 16; body weight) , 630-490 gm) results in the injured striatum. Behavioral assessments were analyzed every 3 weeks after implantation. The results showed a significant improvement in behavioral impairments assessed from week 3 to week 12 after implantation. Student's t test: * p < 0.05 as statistic significance. ** p <0.01 and *** p <0.001. (6a) Analysis of the dehydrated morphine-induced spin test: TNSCs were accepted as compared to untreated "aged" PD rats as control (group i; n=8, unfilled circles) Implanted aged PD rats (group ii, n=8, filled circles) significantly improved the number of rotations from week 3 to week 12. (6b) Describe the behavioral assessment results for exercise disability (seconds). (6c) Describe the behavioral evaluation results regarding the step length (mm). (6d) Describe the behavioral evaluation results for the stride length (mm). (6e) Describe the behavior evaluation results regarding the walking speed (cm/sec). (6f) Explain the results of the behavioral assessment of the basis (mm) of the support. (6g) Explain the gait analyzed for behavioral assessment: A is associated with normal rats, B is associated with hemiparkinsonian rats prior to cell transplantation, and C is associated with albino after cell transplantation. Sensational rat correlation; Figure 7 shows that after appropriate induction, hTS cells represent all three primary germ layer components, including ectoderm, mesoderm, and endoderm (endoderm) The left line of each zone is related to the gene expression before induction; the right row of each zone is related to the gene expression after induction; Figure 8 illustrates the results of flow cytometry analysis showing that hTS cells exhibit mesenchymal stem cell markers [CD90, CD44, CK7, intermediate filament protein (of Vimentin) and neurofilament] and related markers of hematopoietic stem cells (hematopoietic stem cell markers) [CD34 , CD45, α 6- integrins (α 6-integrin), E- cadherin (E-cadherin) and L-selectin are negative; Figure 9 shows that under appropriate induction, hTS cells are differentiated into various specific cell phenotypes; 10 instructions Subcutaneous transplantation of hTS cells into male severe immunodeficiency (SCID) mice resulted in only mucin-like singular cells (myxoid- at 6-8 weeks after implantation). Histological analysis of the minor chimeric reaction (filled, black arrows indicate singular cells; unfilled arrows indicate muscle fibers; "NT" indicates needle trajectories) The chromosome analysis of Figure 11 shows that hTS cells do not change the karyotype (46, XY). In order to examine cell life in the generation, no significant shortening in telomere length between the 3rd and 7th generation cultures was observed by Southern blot analysis (Fig. 1c); Fig. 12 illustrates the use of Specific medium for cell differentiation; Figure 13 illustrates the PCR primer used for RT-PCR; Figure 14 illustrates the analysis of AhR as a signal molecule at the cell membrane, including introduction of BBP in Huh-7 cells (1 μM), The activity of pGFP-C1-AhR transfected at the cell membrane. The image shown by (14a) is the expression of the relative intensity of the GFP-marker AhR measured by TIRF microscopy. Circles and arrows indicate areas measured over time: before stimulation (Zone 1), at peaks (Zone 2), and at rest (Zone 3). The graph (Zone 4) shows that a peak value was found at about the 2nd minute, and the time when the BBP was added was indicated by an arrow. (14b) Quantitative RT-PCR analysis of the memAhR for the reaction of BBP showed a rapid rise at the 5th minute reaching the peak at the 15th minute followed by a gradual decrease to a lower at the 2nd hour The flat line area is accurate. Error bars indicate standard deviation. *, p < 0.05, t-test (n=3). (14c) Analysis of Western blot analysis showed that BBP promoted AhR rise at the 15th minute and then a slight decrease at the 30th minute and repeated-rise at the 60th minute. (14d) Analysis of Western blot analysis showed that BBP induced the production of both G α _q/11 and G β at the 30th minute. (14e) Immunoprecipitation (IP) analysis of the interaction between AhR and G α _{q / 11,} the letter C for control groups after stimulation BBP. (14f) As measured by Western blot analysis, the knockdown of AhR by siRNA demonstrated that BBP inhibited the expression of both AhR and G α _q/11 in Huh-7 cells, and the letter S represents the negative control group. Scrambled siRNA; Figure 15 illustrates the results of dynamic immunofluorescence imaging. (15a) described immunostaining control cells untreated; of AhR and G α _{q / 11} showed predominantly nuclear Huh-7 cells and weakly observed in the cytosol; strip dimensions (bar scale ): 50 μM. (15b) is treated to BBP (1μM) over 15 minutes and 5 each show a cell from the nucleus to the cytosolic compartment (cytosolic compartment) of the AhR and G α _{q / 11} This translocation of both. The immunostained G α _q/11 specifically accumulates at the cell membrane at the 15th minute. (15c) Cells transfected with AhR siRNA strongly reduced the AhR intensity (upper region) in both the cytosol and the nucleus compartment, whereas transfection with scrambled siRNA did not alter the immunostaining intensity (lower region). (15d) BBP reply using pre - AhR siRNA transfected cells after 15 minutes AhR and G α _{q / 11} both strength; FIG. 16 illustrates the penetration double immunogold electron microscopy (double immunogold transmission electron microscopic Analysis) results. (16a) Immunogold-stained G α _q/11 (white arrow) would exist as a single or double or triple entity at the cell membrane in Huh-7 cells as a control group. (16b) At the 20th minute, BBP (1 μM)-treated cells showed an immunogold-labeled AhR particle (in the size of 6 nm, black arrow) and immunogold-labeled G α _q/11 particles (in The interaction of 20 nm size, white arrow) forms a complex where different entities appear at the cell membrane: monomeric (not shown), dimeric (not shown), three Polymeric (left) and polymeric (right) entities. (16c) A trimeric complex of AhR and G α _q/11 present at the cell membrane. CM: cell membrane, N: nucleus, and ribbon scale: 500 nm; Figure 17 illustrates the "pull and push" mechanism and biochemical process. (17a) Measurement of G[ alpha] _q/11 signaling cascades of BBP treatment responses in Huh-7 cells. Western blot analysis showed that BBP (1 μM) triggered the generation of both G α _q/11 and G β at the 30th minute. Activated Gα _q/11 results in a decrease in PIP ₂ , resulting in an increased IP3R level. (17b) Analysis of the reactivity of immunofluorescent Fluo-4-labled calcium in Huh-7 cells. Unlabeled cells (upper left area) and Fluo-4-labeled calcium (green, lower left area) are shown. Also shown is the change in relative calcium level in the BSS medium (middle upper zone) and the calcium-free medium (middle zone) after BBP (1 μM) stimulation (arrow). Cells cultured in calcium-free medium with pre-treated IP3R inhibitor 2-APB (100 μM, 1 hour) (upper right area) showed a decrease in calcium density (upper right area), which was present in one dose - The dose-response manner (y=-0.4x+2.5, R ² =0.94) (lower right zone). The error bars represent the standard deviation of the mean (n=5). (17c) Results of Western blot analysis indicated that BBP-induced COX-2 expression was inhibited by pre-treatment with 2-APB (30 μM, 1 hour), and letter C indicates a control group. (17d) illustrates the results of western blot analysis showing that BBP (1 μM) induces excessive expression of COX-2 via the AhR/Ca ²⁺ /ERK/COX-2 pathway. ERK1/2 was phosphorylated at the 15th minute after BBP treatment and dephosphorylated at the 30th minute. (17e) illustrates the results of Western blot analysis showing that BBP-induced COX-2 expression was inhibited by pretreatment with the chemical PD98059 (20 μM, 1 hour, Calciochem), and the letter C indicates the control group. (17f) shows that the ARNT level is significantly suppressed (measured overnight) by treatment with BBP (1 μM). Data represent mean ± SD, n = 3 and *: Stutton's t-test, p < 0.01. (17g) illustrates a pathway representation of the "pull-and-push" mechanism that forms the basis of the ligand-induced nongenomic AhR signaling pathway via GPCRs-G protein signaling; Figure 18 Explain the utility of LIF in Nanog performance. (18a) Explain that LIF promotes the performance of Nanog. Left panel description: Nanog performance was significantly inhibited in a negative dose-dependent manner by flow cytometric analysis in hTS cells. Data represent mean ± SD for 3 analyses. * p <0.01 (Stutton's t test, n=3). The right panel illustrates the relative Nanog performance of LIF at 1-day intervals when hTS cells were pre-incubated with RA (10 [mu]M) overnight and at different levels (i.e., 125, 250, and 500 U/mL each). (18b) Explain that RA induction (1 day incubation, 10 μM) stimulates the performance of Nanog and Oct4 in hTS cells by flow cytometric analysis, instead of Cdx2 and Sox2; Figure 19 illustrates behavior in aged PD rats Improved assessment. (19a) shows that immunohistochemistry of TH+ neurons on a series of brain sections (30 μM) at week 12 after implantation shows that a large number of re-regenerated TH-positive neurons appear In the damaged nigrostriatal pathway (left part). In the SNC region, TH-positive neurons exhibit a feature that has multiple outgrowths protruding from the cell body to form neuronal circuitries with the host tissue. The number of regenerated dopamine neurons in one rat accounted for 28.2% (n=5) of the opposite normal side. (19b) The number of dopamine neurons in a damaged SNC of a rat was regenerated to 28.2% compared to the normal side; Figure 20: (20a) illustrates ICM and trophectoderm (TE) by RT-PCR expression of specific genes of both; (20b) described hTS cells are transfected with a DNA mixture F1B-GFP construct was plasmid (DNA mixture of F1B-GFP plasmid construct) to generate a success rate of more than 95%; ( 20c) illustrates the time course of RA-induced eIF4B production; (20d) indicates that c-Src activation is inhibited by using eIF-4B; (20e) indicates that IP analysis shows that active c-Src binds directly to Stat3 [transcriptional signal transducer and activator]; (20f) indicating that c-Src siRNA inhibits the expression of Stat3; (20g) indicates that Nanog expression is inhibited by Stat3 siRNA; and (20h) RA- hTS induced in a cell subcellular mRNA localization via c-Src c-Src / Stat3 / Nanog route pathway; FIG. 21 illustrates the activation of G α _{q / 11} signaling pathway: (21a) described by Western blots, G α _{q / 11} pathway after RA treatment (10μM) - associated with the presentation time of the component; (21b) are described in Tissue culture Real-time live cell imaging microscopy in a calcium-free medium and pre-filled for 20 minutes prior to RA treatment with Fluo4 (1 μM) in BSS buffer (Cell- R system, Olympus, Tokyo). (a) RA-induced intracellular calcium consumption was recovered by adding CaCl ₂ (2 mM) in a SOCE type. (b) RA-induced intracellular calcium levels were inhibited by 2-APB (10 min) in a significant dose-dependent manner (R ² = 0.8984). (c) After consumption of ER calcium, KCl (60 mM) was able to deactivate L-type calcium channels. (d) After ER calcium depletion, the KCl-dependent L-type calcium channel was blocked by the inhibitor nifedipine (5 μM). n: total cells counted; (21c) indicates that CaMKII interacts directly with CREB1 and eIF4B; (21d) indicates that eIF4B siRNA inhibits CaMKII, calcineurin and eIF4B by Western blot; (21e) It is indicated that KN93 (1μM, 2 hours) inhibits eIF4B expression by Western blotting method; (21f) indicates that parkin interacts directly with CaMKII and MAPT; (21g) indicates that SNCA interacts directly with MAPT; (21h) indicates that MAPT and GSK3 β and α -tubulin interactions; (21i) demonstrates that 2-APB inhibits the expression of calcium-regulated dephosphatase, NFAT1, and MEF2A by Western blotting; (21j) illustrates endogenous protein and Direct interaction between NFAT1; (21k) illustrates that RA stimulates NFAT1 nuclear translocation by fractional assay. Lamin A / C: nuclear marker and α - tubulin: cytoplasmic marker; (21L) Description Akt2 interaction directly with GSK3 β; (21m) illustrate different antibodies used in the dynamic change is shown in Flow analysis of GSK3 β expression in cells with RA for 4 hours (blank column) and 24 hours (black column) was processed. Data show mean ± SD, n = 3; (21n) indicates that flow cytometric analysis showed that Akt2 siRNA inhibited RA-induced GSK3 β expression; Figure 22 illustrates the formation of a transcriptional complex: (22a) illustrates β - interaction between lectin and LEF1 (above) and between LEF1 and Pitx2; (22b) indicates that by RA (4 hours), the LEF1 transcript Pitx2 is not the gene Pitx3 ; (22c) illustrates the use of Western ink Point method, MEF2A directly interacts with NFAT1, MEF2A, Pitx2, SNCA and EP300; (22d) shows that RA induces the generation of MEF2A, EP300 and Pitx2 over time by Western blot method; (22e) illustrates the use of Western ink point method, NFAT1 siRNA inhibition MEF2A performance; (22f) described at the promoter MEF2A gene CREB1 target in; (22g) Description MEF2A gene transcription the SNCA (above), TH (intermediate) and MEF2A itself (below); (22h The MEF2A siRNA inhibits the expression of EP300, Pitx2, and MEF2A by Western blotting; (22i) states that the EP300 target is at the promoter of HDAC6 (top) and TH (below) genes; (22j) illustrates by the West Ink method, at 4 hours and 24 hours Identification of various molecular activities at time points. Abbreviations, IP: immunoprecipitation analysis; ChIP: chromatin immunoprecipitation analysis; Figure 23 illustrates the regulatory network (upper region) of pathways for RA-induced neurodevelopment in hTS cells. Two tools for mRNA translation: cap-dependent (bottom left) and cap-independent (bottom right). Red line: spatiotemporal signaling pathway; black line: transcriptional pathway; double-directional arrow: molecular attachment to other pathways; Figure 24 illustrates RA signaling promoting Wnt2B/Fzd6/ β -catenin pathway: (24a) illustrating flow Cellular assay analysis showed that RA (10 μM) significantly induced activation of Wnt2B, Dvl3, and FRAT1 but inhibited GSK3 β by overnight inhibition of pretreated Wnt2B siRNA. Data show mean ± SD; n = 3; (24b) illustrates increased Fzd6 mRNA expression by RA RT-PCR. Data show mean ± SD; n = 3, *: by the Historic Test p <0.05; (24c) illustrates the induction of beta -catenin and HDAC6 over time by Western blotting (24d) illustrates IP analysis showing: physical interaction between HDAC6 and β -catenin by RA overnight; (24e) illustrating fractionation assay after overnight incubation RA induces nuclear/cytoplasmic translocation of β -catenin. Laminin and α -tubulin act as nuclear and cytoplasmic markers, respectively; (24f) Description Confocal immunofluorescence microscopy shows that RA-induced β -catenin and dynamic changes in HDAC6 show β -catenin Nuclear translocation at the 30th minute, which was inhibited by HDAC6 siRNA; (24g) indicating that the fine β -catenin appeared in the synaptic region at the 5th minute of RA treatment (arrow); Figure 25 illustrates confocal immunofluorescence microscopy analysis. Nuclear localization of β -catenin is blocked in the presence of siRNA against HDAC6; Figure 26 illustrates molecular events at the cell membrane: (26a) illustrates that RA induces G α _q/11 by Western blotting, G β , RXR α and RAR β are generated over time. β - actin as a control group; (26b) described confocal immunofluorescent microscopy instant analysis, display of 0,4.5 and 13 minutes from the perinuclear region toward the RXR α after stimulation in a representative flag RA GFP- The movement of the cell membrane (arrow). No RXR α is visible in the nucleus. Normal phase contrast (top left) and fluorescent image (top right). Bar (Bar) represents 30 μM; (26c) illustrates a dynamic shift and change in the intensity of a relatively quantitative GFP-marked RXR α from the core (N) to the cell membrane (M) over time. Normal phase contrast and fluorescence imaging are shown on the upper right; (26d) shows that a representative image shows the co-expression of RXR α and G α _q/11 at the cell membrane by RA at the 5th minute. (26e) illustrates the double immunogold-labeled RXR α (6 μM; black arrow) and G α _q/11 (20 μM; white arrow) observed at the cell membrane after 20 minutes of RA treatment. N: nuclear; (26f) indicates that RXR α siRNA inhibits RA-induced interaction of G α _q/11 with RXR α (24 hours); (26 g) indicates that RAR β siRNA inhibits RA-induced G β and RAR β Interaction and interaction of Gβ with PI3K (24 hours). IP: immunoprecipitation analysis; IgG: negative control group; C: positive control group; (26h) indicates that IP assay analysis showed that a selective c-Src inhibitor PP1 analog can prevent RXR α -RAR β heterodimer ( Formation of heterodimer; (26i) illustrates the anchorage of RA-induced gold particle-labeled RXR α in the endoplasmic reticulum (ER) observed by double immunogold electron microscopy; This demonstrates that RA stimulates the canonical Wnt2B pathway by RT-PCR; after overnight treatment (10 μM) in hTS cells, RA induces the performance of components of the Wnt2B signaling pathway, showing a statistically significant result; after overnight treatment Wnt2B siRNA inhibits the components of the RA-induced Wnt2B pathway; Figure 28 illustrates the local synthesis of RXR alpha and RAR beta : (28a) illustrates that RA (10 μM) rapidly induces RXR at 15 minutes by RT-PCR A transient rise in both alpha mRNA and RAR beta mRNA. Data show mean ± SD, n = 3, t test *: p <0.05; (28b) demonstrates that RA induces PI3K and Akt isoforms over time by Western blotting; (28c) This demonstrates that by flow cytometry, the PI3K inhibitor 124005 inhibits the RA-induced Akt isoform (24 hours). The data shows the mean ± SD, n = 3; (28d) shows that Akt3 interacts with mTOR by Western blotting, but is inhibited by Akt3 siRNA; (28e) shows that RA is induced by Western blotting Temporal expression of mTOR; (28f) indicates that Akt3 siRNA inhibits RA-induced phosphorylation of mTOR; (28g) indicates that mTOR interacts directly with 4EBP1 (4 hours); (28h) indicates with or without mTOR siRNA or 4EBP1 siRNA The pre-incubated hTS cells treated with RA (4 hours) were analyzed by Western blotting for mTOR, 4EBP1, eIF4E, and eIF4B; (28i) illustrates eIF4E siRNA by Western blotting Inhibition of RA-induced (4 hours) interaction between RXR α and G α _q/11 (above) and between RAR β and G β (below); Figure 29: (29a) illustrates RT-PCR , PI3K inhibitors inhibited the expression of RA-induced Akt isoforms, Aktl, 2 and 3 after overnight treatment in hTS cells; (29b) Akt2 inhibitors inhibited the expression of β -catenin mRNA by RT-PCR; (29c) by flow cytometry, Akt3 siRNA inhibition of mTOR expression; FIG. 30 illustrates CREB1 promote transcription of the TH: (30a) Description , CREB1 directly from the western blot with Akt1 and β - catenin interaction; (30b) siRNA inhibition of Akt1 described CREB1 performance. Β -actin: control group; (30c) indicates that the CREB1 target is at the promoter of the TH gene; (30d) indicates that CREB1 siRNA inhibits the expression of TH by Western blotting; (30e) illustrates immunofluorescent organization Analysis showed that tNSCs were TH-FITC (blue) and TH-Cy-3 (red) in DA neurons (white arrows) in the treated SNC side at week 12 after implantation in the brain of PD rats. Common-performance (right area). Amplified DA neurons in the normal side (upper left) and in the treatment side (lower left). Positive CERB1 staining was found in the nucleus; (30f) indicates that the histogram shows the relative mean of TH and CREB1 expressed in DA neurons on normal (left; n=86) and treatment side (right; n=114) strength. Error bars: mean ± SD; n: total cells counted; p < 0.05: statistically significant; Figure 31 illustrates immunohistofluorescence analysis: TH(+) and NeuN in SNC of the control group (+) motor neurons (arrows) (top left). Reduced TH(+) (arrow) at the 1st week after 6-OHDA injury (top right). At the 6th week after injury, with the disturbance of TH-positive nerve endings, significant reduction in TH(+) neurons (green particles) and various degenerate cavity formations (red explosive circles) (Bottom left). After transplantation, the TH(+) neurons (arrows) at the wall of the degenerative cavity (red explosive circle; insert) with TH(+) nerve endings protruding into the cavity (bottom right) Green); Figure 32 illustrates in vivo regeneration of TH(+) and GFAP(+) cells with less immune response: (32a) indicates TH (+ ) at weeks 1 and 6 after injury The number of cells was reduced to 48% and 13% in the injured SNC (red) and 78% and 4% in the injured striatum (light blue), respectively. After transplantation, TH(+) cells were re-growth to 67% and 73% (right) in injured SNC and striatum, respectively. Data was analyzed by Tissuequest 2.0 software (TissueGnostics Gmbh, Vienna, Austria); (32b) indicated in the damaged SNC (lower zone) and enlarged (top left, insert a) and non-invasive side (upper right, insert) b) Regeneration of comparable dopamine neurons; (32c) indicates that transplantation of tNSCs at week 12 produced 78.4 ± on TH-positive neurons (arrows) in injured SNC compared to the non-lesion side Recovery rate of 8.3% (mean ± SEM; n = 4); (32d) indicates TH-FITC (+) and GFAP-Cy-3 in the injured striatum at week 6 after injury +) Degradation of Wilson's pencils (blank arrows) (left row). At the 12th week after implantation (right row), several GFAP(+) cells (arrows) appear in the fine fibers of the re-established Wilson bundle (blank arrow); (32e) Immunohistochemical fluorescence imaging analysis of cells in the gate (left scatter plot) determined by the position of the cell size (diameter of 8-10 μm) and the intensity of its corresponding GFAP-Cy-3 count. Gate (red scatter plot): counted glial cells; black scatter plot: exclude cells of abnormal size; blue scatter plot: cells with abnormal GFAP strength. In the striatum, GFAP(+) cells in the injured side were 65.5% before treatment and 93.9% after treatment (right region) compared to the non-lesion side; (32f) illustrates hTS cells Implantation into SCID mice caused only a mild immune response and no tumorigenesis was observed. Class-mucus-like singular cells (black arrows), muscle fibers (blank arrows), and needle trajectories (NT); and Figure 33 illustrates measurements by immunological tissue fluorescence scatter plots in chronic PD rats, utilized in TH - The coefficient of determination between FITC and NeuN-Cy-3. Identification of TH(+) cells in SNC before and after cell treatment. (33 upper left ) indicates normal SNC: R ² = 0.72; (33 upper right ) indicates SNC (1-week) caused by 6-OHDA damage: R ² = 0.77; (33 lower left ) illustrates 6-OHDA SNC (6-week) caused by injury: R ² = 0.25; (33 lower right ) SNC (12-week) after tNSCs transplantation: R ² = 0.66. The results shown represent the average of 2 rats.

Example material

antibody. For immunoblot and immunocytochemistry: primary antibodies : SSEA-1, -2, -3, CD90, and nestin (Chemicon). Neurofilament and GFAP (BioGenex). Nanog, Oct4, Cdx2, and Sox2 (BD Biosciences, San Jose, CA, USA). G α _q/11 (C-19, sc-392), G β (T-20, sc-378), RXR α , RAR β , c-Src, pStat3, Stat3, PP1 analogues and β -actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA), TH (Sigma-Aldrich St. Louis, MO and Temcoula, CA) and serotonin (Sigma-Aldrich St. Louis, MO).

Secondary antibodies :

siRNAs: Nanog siRNA and Cdx2 siRNA (Sigma-Aldrich St. Louis, MO).

Primary antibodies for flow cytometry: HLA-ABC, CD9, CD14, CD34, CD45, CD73, CD90, CK7, intermediate filament protein, 6-integrin, E-cadherin, L-selectin, Nanog , Oct4 Cdx2 and Sox2 were purchased from BD Biosciences, San Jose, CA, USA; HLA-DR, CD33, CD44 and CD105 were from eBioscience, San Diego, CA, USA; CD133 was from Miltenyi Biotec, Germany.

For TH-2 and serotonin immunostaining, cells were incubated in 0.1 M PBS overnight at 4 °C after washing with PBS. After incubation for 1 hour at room temperature with a blocking solution [50 mL of 0.1 M PBS, 0.05 g of sodium azide, 1% horse serum and 10% Triton X-100], the cells were washed again. The cells were incubated with primary antibodies, namely TH-2 (1:200, Sigma-Aldrich, St. Louis, MO) and serotonin (1:100, Sigma-Aldrich, St. Louis, MO) for 2 hours and Wash with PBS. The cells were thoroughly washed with PBS and subjected to immunofluorescence analysis by incubation with anti-mouse IgG (Sigma-Aldrich, St, Louis, MO) with FITC or PE for 1 hour.

Example 1: Isolation, differentiation and cell culture

Embryonic chorionic villous is obtained from the fallopian tubes of early ectopic pregnancy (gestational age: 6-8 weeks) in women undergoing laparoscopic surgery, by human studies and ethics committees. Approved by the Institutional Review Board on Human Subjects Research and Ethics Committees. Tissues were minced in serum-free α- MEM (Sigma-Aldrich, St. Louis, MO) and trypsinized with 0.025% trypsin/EDTA (Sigma-Aldrich, St. Louis, MO) for 15 minutes. This decomposition was terminated by the addition of α- MEM containing 10% FBS. This procedure is repeated several times. After centrifugation, the cells were harvested at 37 [deg.] C and in 5% CO ₂ with 20% FBS containing α -MEM (JRH, Biosciences, San Jose, CA) and 1% penicillin - streptomycin (penicillin-streptomycin) Train it. The hCG performance in the medium measured by a commercial kit (Dako, Carpinteria, CA) became undetectable after 2 passages of culture.

Cell Differentiation : hTS cells were cultured in conditional α- MEM (CytoLab Ltd, Rehovot, Israel) containing 20% FBS, 1% penicillin-streptomycin, and 10 μg/mL bFGF at 37 ° C in 5% CO ₂ . The medium was replaced every 3 days. After 5 generations, differentiation into a variety of specialized phenotypes was initiated by the use of improved published procedures. For cell culture in a Transwell plate (Corning, New York, NY), the upper chamber was coated with 500 μL of a 4:1 ratio of PureCol-containing collagen gel (Inamed Biomaterials, Fremont, CA) and conditional L-DMEM (Gibco, Grand Island, NY) (adjusted to pH 7.4 using 1 M NaHCO3). The cells (4 × 10 ⁵ ) were cultured in the conditional L-DMEM (1 mL) on the upper chamber. The lower chamber contained the conditional H-DMEM (3 mL). Preliminary experiments have shown that the glucose level in these two chambers may reach an equilibrium state within 4 hours.

Sub-phenotype cell differentiation : Cells were cultured in 5% CO ₂ at 37 ° C in conditions α- MEM containing 20% FBS, 1% penicillin-streptomycin and 10 μg/mL bFGF (CytoLab Ltd, Rehovot, Israel) )in. The medium is generally updated every 3 days. After 5 generations of culture, differentiation into a variety of specific cell phenotypes was performed by a variety of different strategies (as shown in the table of Figure 12). For osteogenic differentiation, the cytochemical mineral matrix was analyzed using an Alizarin red S assay (Sigma-Aldrich, St. Louis, MO) to detect Calcium mineral content. To identify calcium deposits, cells were fixed and incubated in the dark with 2% silver nitrate solution (w/v) for 10 minutes followed by thorough washing with deionized water followed by exposure to bright light for 15 minutes. Cells were treated with a commercial kit (Sigma-Aldrich, St. Louis, MO) and stained with von Kossa to detect alkaline phosphatase activity. Chondrogenic differentiation was confirmed using Alcian blue staining (Sigma-Aldrich, St. Louis, MO) at an acidic pH level. For myogenic differentiation, cells were incubated with 3% hydrogen peroxide in phosphate buffered saline solution (PBS) for 10 minutes to inhibit endogenous peroxidase enzyme activity. The non-specific address was blocked by PBS containing 10% human serum and 0.1% Triton X-100 for 60 minutes and washed by blocking buffer for 5 minutes. The cells were cultured in blocking buffer (Vector Laboratories, Burlingame, CA) containing skeletal muscle myosin heavy chain-specific monoclonal antibody for 1 hour, followed by VectaStain The ABC kit (Vector Laboratories) was stained. For adipogenic differentiation, cells were induced by conditioned medium and fixed in 4% paraformaldehyde containing 1% calcium for 60 minutes followed by 70% ethanol. After 5 minutes of exposure to 2% Oil Red O reagent (Sigma-Aldrich, St. Louis, MO), excessive staining was removed by 70% ethanol followed by water rinsing. Oil red O dye is used as an indicator of intracellular lipid aggregation. Neural stem cells were induced by 10 μM all-trans retinoic acid (Sigma-Aldrich, St. Louis, MO) in ethanol.

Example 2: plastid transfection

For plastid transfection, hTS cells were induced overnight by a full-trans retinoic acid (10 μM) (Sigma-Aldrich, St. Louis, MO) followed by a F1B-GFP DNA. The mixture was co-transfected (Myers). Briefly, the DNA mixture was slowly added to contain DOTAP (30 μL) liposome transfection reagent (Roche Applied Science, Indianapolis, IN) and 70 μL HBSS buffer [containing NaCl (867 g in 80 mL H ₂ O) at 4 °C. Medium]] DOTAP (100 μL) solution [addition of 2 mL HEPES solution (1 M, pH 7.4, Gibco)] for 15 minutes. After washing with PBS, the cells were thoroughly mixed with a DNA mixture. After overnight incubation, stable cell lines were obtained by G418 selection (400 μg/mL, Roche Applied Science) which was cultured for 2-3 weeks until the formation of colonies. G418-resistant cells were pooled and lysed and analyzed by Western blotting using a single anti-GFP antibody (Stratagene, La Jolla, CA) to quantify the transfection of GFP. percentage. The transfected hTS cells were fixed with methanol (10 min) by subcultures to detect the expression of GFP by immunofluorescence. The transfection rate is more than 95% effective.

Example 3: RT-PCR and quantitative PCR (qPCR)

For RT-PCR, total RNA from 105-106 cells was extracted by using TRIZOL reagent (Invitrogen) and mRNA expression was performed by using a Ready-To-Go RT-PCR bead set (Ready-To -Go RT-PCR Beads kit) (Amersham Biosciences, Buckinghamshire, UK). Briefly, the reaction product was resolved on a 1.5% agarose gel and developed with ethidium bromide. β - actin or β -2 microglobulin (β -2 microglobulin) is used as a positive control. All experiments were performed 3 repetitions. For qPCR, gene expression was measured using the iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories) and Bio-Rad iQ5 optical system software, version 2.0 (Bio-Rad iQ5 Optical System) Software, version 2.0) (Bio-Rad Laboratories) was analyzed. The relative mRNA levels were calculated using the comparative Ct method (Bio-Rad, manual) and presented as a ratio relative to the biological control. All primer pairs were confirmed to approximately double the number of products in one cycle and produce a single product of the expected size.

Example 4: Western ink dot method

Cells were seeded in 10 cm dishes with serum-free medium overnight and processed or not treated with RA (10 μM) for various different time intervals as indicated. After stimulation, the cells are ice-cold The PBS was washed twice and dissolved by RIPA lysis buffer (Minipore). The protein concentration was determined by a BCA protein assay kit (Thermo). An equal amount (30 μg) of protein was resolved by 8% SDS-PAGE, transferred to a PVDF membrane and blocked with 5% skim milk powder for 1 hour at room temperature. After blocking, the membrane was incubated at 4 °C with a primary antibody for 4 hours. The cells were washed 3 times with PBST and then incubated with a secondary antibody conjugated with HRP for 1 hour at room temperature. After washing 6 times with PBST buffer, the membrane was incubated with a chemiluminescent substrate (GE Healthcare) for 1 minute. The specific band was developed using an enhanced chemiluminescence kit (ECL) (Amersham).

Example 5: Southern ink dot method

The telomere length of hTS cells was measured by Southern immunoblot analysis at the 3rd and 7th generations as previously described (Tsai). Briefly, the fragments were transferred to Hybond N+ nylon membranes (Amersham Biosciences) and hybridized to a Ready-To-Go labeling beads at 65 °C. (Amersham Biosciences) probe labeled with TTAGGG repeat of α - ³² P-dCTP. The terminal restriction fragment is developed by hybridization to labeled oligonucleotides (oligonucleotides) complementary to the telomeric repeat. The size distribution of TRFs is compared to a DNA length standard.

Example 6: End Restriction Fragment (TRF) Southern Ink Point Method

Since a cell initiates its cancer, its telomeres will become very short. The telomere length was measured at the 3rd and 7th passages in the culture of hTS cells. Briefly, fragments were transferred to Hybond-N+ nylon membrane (Amersham Biosciences) and hybridized to one at 65 °C by using Ready-To-Go labeled beads (Amersham Biosciences) labeled α- [ ³² P ]-dCTP TTAGGG repeat probe. The terminal restriction fragment is developed by hybridization to a labeled oligonucleotide complementary to a telomeric repeat. The size distribution of the end restriction fragments is compared to a DNA length standard. For electron microscopy, the hTS cell-derived grape-like cell mass was detected by penetration electron microscopy (JEM-2000 EXII, JEOL, Tokyo, Japan).俾 to identify the cellular structure.

Oct4 , Sox2 , NANOG , fgfr2 , FGF4 , BMP4 , Cdx2, and the endogenous control group β -actin (ACTB) differed between hTS and hTS cells treated with 500 units of LIF (Chemicon, Temecula, CA) Gene expression is by IQ5 real-time PCR detection using fluorescein as an internal passive reference dye for normalizing well-to-well optical variation The measurement system (Bio-Rad Laboratories) was measured. PCR amplification was performed in a total volume of 25 μL [containing 12.5 μL of 2X SYBR Green supermix (Bio-Rad), 0.5 μL of 10 μM of each primer, and 0.5 μL of cDNA sample and mixed with sterile water]. The reaction was initiated at 95 ° C for 3 minutes, followed by 60 denaturation by 30 s at 95 ° C, annealing at 60 ° C for 30 s, extension reaction at 72 ° C for 15 s (extension) The 3-step amplification cycle is constructed. At the end of the final dissociation phase, it is carried out to produce a melting curve for confirming the specificity of the amplification product. The real-time qPCR was monitored and analyzed by Bio-Rad IQ5 optical system software version 2.0 (Bio-Rad). The relative mRNA levels were calculated using the comparative Ct method (Bio-Rad manual) and presented in a ratio relative to the biological control. The ACTB transcript level was confirmed to be highly correlated with the total RNA amount and was therefore always used for standardization. All of the primer pairs used were confirmed to approximately double the number of products in one cycle and produce a single product of the expected size. The primer sequences of Oct4 , Sox2 , NANOG , fgfr2 , FGF4 , BMP4 , Cdx2, and the endogenous control β -actin (ACTB) are shown in Figure 13.

OCT4-F: CCATCTGCCGCTTTGAGG; OCT4-R: ACGAGGGTTTCTGCTTTGC; ACTB-F: GATCGGCGGCTCCATCCTG; ACTB-R: GACTCGTCATACTCCTGCTTGC; CDX2-F: GGTGTACCGGACCACCAGCG

CDX2-R: GGTGGCTGCTGCTGCTGTTG

MIG7-F: TCCACTACCAAGAGACAGGCTT

MIG7-R: TCAAGGCTGTGTTGCACCCAA

IPF-1-F: GGAGGAGAACAAGCGGACGC

IPF-1-R: CGCGCTTCTTGTCCTCCTCC

Example 7: Immunocytochemistry

The culture was fixed with 4% paraformaldehyde at room temperature for 30 minutes and then washed 3 times with PBS. The LSAB kit (Dako, CA) was used for immunocytochemical staining as recommended by the manufacturer. For SSEA-1, cells tris- phosphate buffered saline solution (tris-phosphate buffered saline, TBS ) -4 be dyed and rinsed well as H ₂ O ₂ for 10 minutes to be washed. After blocking the reaction with goat serum (1:200, Dako) for 30 minutes, the cells were then incubated with primary antibody overnight. After washing the cells with TBS and being treated with streptavidin for 20 minutes, the cells were stained by biotin (20 minutes), washed again, and processed to 3, 3'-3'-diaminobenzidine tetrachloride (Boehringer-Mannheim, Mannheim, Germany) lasted 10 minutes. Finally, the cells were stained with hematoxylin stain. For SSEA-3 staining, a similar procedure was followed except that the exposed antigen (which was obtained using a high-pressure cooker for 15 minutes in citrate buffer) was washed before washing with H ₂ O ₂ Add outside. Finally, the cells were thoroughly washed with PBS and subjected to immunofluorescence assays.

Example 8: Immunoprecipitation (IP)

Cells were serum-deprived overnight and processed with RA (10 μM) for 30 minutes. After pre-clearing with protein G-agarose (Minipore) for 30 minutes, specific antibodies or IgG were added and incubated overnight. The beads were washed 3 times with RIPA lysis buffer, boiled in buffer, resolved by 8% SDS-PAGE and used for various indications as indicated by incubation with protein G-Sepharose for 2 hours. Immunoblot analysis of the subject matter.

Example 9: Flow Cytometry

Cells (5 x 10 ⁶ cells/mL) were incubated with various primary antibodies for 30 minutes and then incubated at 4 ° C to fluorescein isothiocyanate under conditioned dilution. FITC)-, phycoerythrin (PE)- or Rho-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA) lasted 1 hour. After thorough washing, the cells were re-spread in PBS (1 mL) followed by flow cytometry (FACScan, BD Biosciences, San Jose, CA). Data were analyzed using Cell-Quest software (BD Biosciences).

Example 10: Microarray

hTS cells were treated individually with or without RA (10 [mu]M) for 1- and 5-day days. Total RNAs were extracted using TRIzol reagent and Affymetrix Human Genome U133 plus 2.0 GeneChip was used according to the manufacturer's protocol (Santa Clara, CA, http://www.affymetrix.com). The Affymetrix microarray was performed [in the Center for Genomic Medicine Research at the National Taiwan University School of Medicine (Taipei, Taiwan)].

Example 11: Double immunogold electron transmission microscopy (IEM)

Cells, with or without treatment with RA (10 μM), were tested as previously described (Tsai et al ). Briefly, the fixed ultrathin sections were pretreated with an aqueous solution of 5% sodium metaperiodate (10 minutes) and washed with distilled water. The net was incubated with an aliquot of IgG antibodies against RXR α (1:50) or G α _q/11 (C-19; sc-392; 1:50) and was followed by a primary antibody - Mouse 6 nm gold particles (1:10; AB Chem, Dorval, Canada) or anti-rabbit IgG 20 nm gold particles (1:10; BB International, UK) were probed. The grid was washed with PBS between the incubation steps and sectioned by blocking the grid on 1 drop of PBS with 1% ovalbumin (15 minutes). After IgG gold, the carrier was spray-washed with PBS followed by distilled water. All steps are performed at room temperature. Sections were then stained with uranyl acetate and lead citrate and observed on a Hitachi H-700 model penetrating electron microscopy (Hitachi Ltd., Japan).

Example 12: Confocal immunofluorescence microscopy

Cells were cultured overnight on coverslips coated with 2% gelatin and processed or not treated with RA (10 [mu]M) for 5, 15 and 30 minutes each. Subsequently, the cells were washed 3 times with PBS, fixed with 4% paraformaldehyde in PBS for 5 minutes, and permeabilized with 2% FBS containing 0.4% Triton X-100 in PBS. ) lasted 15 minutes. The reaction was blocked overnight at 4 ° C with 5% FBS and then incubated at 4 ° C to equip the primary antibody RXR α (1:100) or G α _q/11 (1:100) in PBS overnight. After washing, the cells were incubated with a secondary antibody (1:50; Rockland Immunochemicals Inc., Gilbertsville, PA) conjugated with Dye Light 488 or Dye Light 549 for 1 hour. The coverslips were air dried by incubation with DAPI (1:5,000) for 5 minutes and sealed for confocal immunofluorescence microscopy (Olympus, Tokyo).

Example 13: Analysis of the only ethnic group of the inner layer of human germs defined as hTS cells

Cells derived from ectopic chorionic villi are cultured; the colonies initially form and subsequently proliferate into adherent fibroblast-like cells. Immunocytochemistry, these cells express phase-specific embryonic antigens (SSEA)-1, -3, and -4 [stage-specific embryonic antigen (SSEA)-1, -3, and -4] (Fig. 1b). These SSEAs-positive cells exhibited the same germinal inner layer as histologically in ectopic chorionic villi. However, in the term placental villi, they are mainly found in the compartment of the villus core.

To determine the characteristics of stem cells, flow cytometric analysis showed that these cells exhibited high levels of mesenchymal stem cell markers: CD90, CD44, intermediate filament protein and neurofilament, and trophoblastic marker cytokeratin (CK)-7. . They do not exhibit hematopoietic stem cell markers: CD34 and CD45 as well as epithelial cell markers: E-cadherin, α 6-integrin, and L-selectin. They also exhibit weak nestin and CD9. These facts indicate that these linings are different from the trophoblast subpopulations isolated from mature placental tissue (Aboagye-Mathiesen et al. , 1996; Baczyk et al. , 2006). In addition, other supporting evidence includes: 1) treatment of these cells with all-trans retinoic acid (RA) results in a formation similar to that of the previously described giant cells (Fig. 1d) (Yan et al., 2001); 2) A series of chromosomal analyses revealed unaltered karyotypes (Fig. 11); 3) subsequent measurement of telomere length confirmed chromosomal stability (Fig. 1c); and 4) implanted cells in severely combined immunocompromised mice (Severe combined immunodeficient mice) produces a positive immune chimeric reaction. In summary, these isolated cells may represent a highly homogenous inner lining of the germ, exhibiting the characteristics of mesenchymal stem cells. Therefore, these cells are considered to be hTS cells.

Example 14: Gene and biological similarity between hTS and hES cells

To investigate gene profiling of hTS cells, reverse transcription-polymerase chain reaction (RT-PCR) was performed using a variety of different primers (Figure 13). The results showed that hTS cells not only exhibited TS cell markers ( Cdx2 , BMP4 , Eomes, and Fgfr-2 ) but also ES cell markers ( Oc4 , Nanog , Sox2, and FGF4 ) (Fig. 1a). By comparing the global gene profiles analyzed by the Affymetrix Human Genome U133plus 2.0 Gene Chip (Santa Clara, CA, http://www.affymetrix.com), hTS cells differ in gene distribution. PDMS cells (a gift from Dr. C.-P. Chen) (Fig. 1i).

Interestingly, hTS cells exhibit gene expression in three germ layers of ES cells, including: mesoderm osteopontin, osteocalcin, perlecan, scorpion-type collagen, myogenin, myo D1 PPAR γ -2 and lipid-lowering proteins; neurofilaments of ectoderm, neuronal elements NgN3, CD133, MAP-2, Neo-D, and nestin; and endoderm insulin, Pdx-1 (Fig. 7), CK-19, Somatostatin, Isl-1, Nkx-2.2, Nkx-6.1, and Pax-6 (data not shown). Functionally, hTS cells can be differentiated into specific ones by using appropriate breeding methods with modifications (Figure 12) (In't Anker et al. , 2004; Fukuchi et al. , 2004; Yen et al. , 2005) . A phenotypic mesoderm lineage (as seen in hTS cells), including osteoocytes, chondrocytes, myocytes, and adipocytes (Figure 9). hTS cells are selectively induced to differentiate into dopamine NSCs and insulin-producing islet progenitor cells (see below), such as those derived from ectoderm and endoderm, respectively. These results demonstrate that hTS cells have the characteristics of both genes and biology of hES cells, which can differentiate into three germ layers with specialized phenotypes.

Example 15: Nanog maintains pluripotency of human trophoblastic stem cells by LIF withdrawal

Since hTS cells express pluripotency gene markers (such as Oct4, Nanog, Sox2, and Cdx2) in both embryonic stem (ES) cells and trophoblastic stem (TS) cells (Fig. 1a), LIF is removed in human trophoblasts (hTS) The utility on the cells is detected. hTS cells were treated with different doses of LIF [ie 500 (simulated at the ampulla), 250 (simulated at the middle), and 125 units (simulated at the isthmus) for 3 days, showing :LIF promotes Oct4 expression but inhibits Cdx2 , Nanog, and Sox2 expression in a dose-dependent manner (Fig. 1e). Quantitative PCR analysis supports these findings (Fig. 1f). Because the relative performance ratio of Oct4 to Cdx2 determines cell fate in early embryonic differentiation (Niwa et al. , 2000), the Oct4 / Cdx2 ratio (0.4-fold) appears to be the highest in the ampulla, it is in the middle - Part of it is reduced to 0.2-fold and becomes close to the part of the gorge (Fig. 1g). This decreasing trend in Oct4 / Cdx2 ratio substantially promotes differentiation towards the fate of trophectoderm (Niwa et al. , 2005). Remarkably, a higher Nanog / Cdx2 ratio (2-fold) appeared in cells treated with 125 units of LIF, while 0.1-fold was observed at 500 units of LIF. These results strongly suggest that Nanog, a responder to the relatively reduced Oct4 expression, is an important determinant of hTS cells to maintain pluripotency. The respondent's role is to use a significantly higher Nanog / Oct4 ratio of 125 units of LIF compared to a ratio of 500 units of LIF and a significant increase in the Cdx2 / Oct4 ratio using 125 units of LIF. Further supported (Figure 1e). No obvious changes were found in Sox2 / Cdx2 .

Collectively, these results demonstrate that the gradual withdrawal of the LIF concentration from the ampulla of the human fallopian tube towards the gorge primarily induces an increase in Nanog in hTS cells, thereby maintaining the self-renewal and pluripotency properties of hTS cells, simulating In the absence of feeding cells in mouse ES (mES) cells and human ES cell growth. The results indicate that Nanog plays a role in maintaining the pluripotency of hTS cells.

Example 16: RA Enhances Nanog Performance

RA is a potent regulator of neuronal differentiation and is usually bound by a nuclear receptor (Maden) that interacts with retinoic acid reaction elements (RAREs) in the regulatory regions of the underlying gene. It has been shown that retinol (vitamin A), a donor of RA production in one cell, inhibits cell differentiation regulated by upregulation of Nanog in ES cells (Chen). A similar utility was tested regardless of whether RA exhibited a Nanog in hTS cells. hTS cells were treated with RA for 1 day followed by flow cytometry. The results showed that RA promoted the performance of Nanog, Oct4 and Sox2 but did not have Cdx2, which was associated with the Affymetrix gene wafer oligonucleotide microarray. The microarray mRNA expression profiling is consistent. Furthermore, knockdown of Nanog using siRNA inhibited RA-induced Nanog but increased Cdx2 performance. In contrast, Cdx2 siRNA promoted Nanog and inhibited Cdx2 in RA-induced hTS cells by flow cytometry (Fig. 1h). Taken together, these results show that RA induces excessive expression of Nanog in hTS cells, whereby RA does not alter the Nanog/Cdx2 ratio when determining cell fate.

Example 17: RA promotes its receptor RXR alpha activation

By Western blot analysis, RA first promoted its receptor RXR alpha activation in 5 minutes, however, this effect lasted only 30 minutes. Instead, once increased RAR beta production was observed within 60 minutes (Fig. 3b). RA was observed to interact directly with RXR α and RAR β by immunoprecipitation analysis (Fig. 3c). Furthermore, by immunofluorescence microscopy, the activated RXR α was indexed toward the nucleus at the 15th minute and then the nuclear intensity decreased (Fig. 3a). The protein G α _q/11 subunit was also activated within 30 minutes (Fig. 21a). To this end, it is possible that RA interacts with RARs in the initial reaction phase without the aid of cellular retinoic acid-binding protein 2 (CRABP-2).

Example 18: RXR α /RAR β may belong to members of the G protein-couple receptors (GPCRs) superfamily

This concept was confirmed by direct interaction between RXR α and G α _q/11 subunits by observation of double immunogold electron microscopy (Fig. 26e). Then, in order to link the relationship between RXR α /RAR β and Nanog, immunoprecipitation assay analysis suggested that RXR α , but not RAR β , acts directly on the promoter of Nanog (Fig. 3g). Furthermore, unlike ES cells, hTS cells contain major RA-producing enzymes: 2nd and 3rd type retinal aldehyde dehydrogenases (RALDH-2 and -3), which enable hTS cells to retinol Metabolism becomes RA. It was demonstrated that RA acts on hTS cells to form Nanog by direct interaction with the RXR α /RAR β complex associated with GPCRs to bind to the promoter of Nanog.

Example 19: RA-induced Nanog expression in hTS cells is affected by gradient LIF content in the fallopian tubes

With flow cytometry, the removal of LIF significantly enhanced RA-induced Nanog expression in hTS cells (Fig. 18), suggesting that hTS cell-derived NSCs can be induced by RA in the absence of LIF. It behaves like a progenitor cell, maintaining the pluripotency of neuron subtypes under a suitable microenvironment.

Example 20: RA promotes TH performance via a non-RARE pathway

These results show that RA induces a non-gene signaling pathway based on the initial results of RA stimulation of RXR- α , RAR- β, and c-Src in hTS cells up to 120 minutes as measured by Western blotting. (Figures 3a and 3b). To determine whether the RXR- α /RAR- β interaction belongs to the superfamily of G protein-coupled receptors (GPCRs), double immunogold electron microscopy was used to study the G-protein between G α _q/11 and RXR- α Interaction. The results show: RXR- α and in having a G α _{q / 11} binding interactions at the plasma membrane and subsequently, the decomposed G α _{q / 11} stimulation of membrane phospholipase C β (membrane-bound phospholipase C beta, PLC β) To cut PIP ₂ [a primary membrane phosphoinositol] becomes two secondary carriers: IP3 and diglyceride (DAG).

Subsequently, RA induced a scaffold formation of RXR α , RAR β and [c-Src] by immunoprecipitation analysis and using a specific c-Src inhibitor PP1 analog (Fig. 3c).

Example 21: RA activation of Wnt2B/Fzd6/ β -catenin pathway

Western blot analysis demonstrated that RA significantly up-regulated Wnt2B and proto-oncogene FRAT1 after 4 hours and 24 hours of incubation by Western blotting (Fig. 24a). hTS cells were incubated with RA overnight or without siRNA against Wnt2B. Flow cytometric analysis showed that RA significantly upregulated Wnt2B and its downstream targets [including the mediator Dishevelled 3 (Dvl3) and the proto-oncogene FRAT1] leading to inhibition of hepatic synthase kinase-3 beta (glycogen synthase kinase-3) β , GSK3 β ), which can be inhibited by attenuating Wnt2B by siRNA (Fig. 24b and 24c). A similar result was also observed by RT-PCR analysis (Fig. 27). RA also promoted overexpression of Fzd6 mRNA, a member of the frizzled family of 7 transmembrane receptors (Fig. 24d). To confirm the role of RA in the expression of Wnt2B-regulated Fzd6, we also analyzed the expression level of Dvl3 and its downstream effector FRAT1 and showed that the enhancement of RA-regulated Fzd6 may be through the presence of anti-Wnt2B siRNA A cancellation is cancelled with a decrease in GSK3 β (Figs. 24b and 24c). Subsequently, Western blot analysis showed that RA significantly activated β -catenin between 30 minutes and 24 hours (Fig. 24e). RA induces a novel, typical Wnt2B/Fzd6/ β -catenin signaling pathway in hTS cells, allowing for the inhibition of inhibitory GSK3 β and activation of cytoplasmic β -catenin.

Example 22: RA regulates tissue protein deacetylase 6 (HDAC6)

Western blot analysis showed that RA promoted the rise of a tissue protein deacetylase 6 (HDAC6) (a transcriptional regulatory enzyme) within 2 hours by co-immunoprecipitation (IP), which was processed in RA. It was able to interact directly with β -catenin after 24 hours (Fig. 24f). In addition, we show that nuclear translocation of a β -catenin occurs by cell separation assay (Fig. 24g), supporting a typical Wnt2B/Fzd6/ β -catenin signaling in hTS cells after 24 hours of RA treatment. The existence of the route. These observations were further confirmed by confocal immunofluorescence microscopy. Nuclear localization of β -catenin was blocked in the presence of siRNA against HDAC6 (Fig. 25). Interestingly, we found that: a very early manifestation of beta -catenin may occur at the cell membrane (synapse) in hTS cell-derived neuron-like cells within 5 minutes after RA treatment. In the nucleus, β -catenin involves transcriptional regulation by association with transcription factors of the TCF/LEF family. Cell separation assay analysis showed that this interaction resulted in nuclear translocation of β -catenin (Fig. 24e).

Example 23: RAR β and G β and RXR α and G α _q/11 Interaction between

Western blot analysis in hTS cells demonstrated that RA induced rapid production of both G α _q/11 and G β at the 30th minute and also induced retinoids at 30 minutes and 4 hours, respectively. Rapid generation of X receptor alpha (RXR alpha ) and retinoic acid receptor beta (RAR beta ) (Fig. 26a). Analysis by real-time confocal fluorescence microscopy revealed that the GFP-tagged RXR alpha rapidly moved from the cytosol compartment to the subcellular region within a few minutes by RA stimulation (Figures 26b and 26c), where it interacts with G α _{q/ 11} immunocytochemistry co-exhibition (Fig. 26d). This phenomenon is further supported by double immunogold penetrating electron microscopy, in which RA stimulates the binding of small gold-marked RXR α and large gold-marked G α _q/11 at the cell membrane (Fig. 26e) . By IP analysis, biochemically, RXR alpha interacts substantially with G α _q/11 and this effect is inhibited by the use of RXR α siRNA (Fig. 26f). By IP analysis, a similar event occurred between RAR β and G β and this effect was also inhibited by the use of RAR β siRNA (Fig. 26g). IP analysis revealed a selective c-Src inhibitors PP1 analogs can prevent the formation of RXR α -RAR β shaped dimer (FIG. 26h), suggesting a role of allowing an unknown individually RXR α and RAR β presence mechanisms. This concept is further penetration by double immunogold transmission electron microscopy observed in the endoplasmic reticulum (ER) induce the anchoring of the gold particles RA- - flag is supported RXR α (FIG. 26i). In summary, the data suggests: RA- induced by RXR α and RAR β independently with G α _{q / 11} and G β interactions on the cell membrane.

Example 24: Akt3/mTOR signaling and mRNA translation

Real-time PCR (RT-PCR) analysis and the discovery that RA induced a rapid transient increase in both RXR α mRNA and RAR β mRNA for only 15 minutes (Fig. 28a), and rapid RAR β and RXR α in 1 hour. Generation (Figure 26a). Based on the fact that there is an increase in mRNA in the axon growth core and its association with mRNA localization in neurons and RA-enhanced RAR alpha level regulation of local GluR1 synthesis in dendritic RNA particles, motivating The RAR α -modified translation of synapse formation at the neuronal membrane focuses on detecting whether subcellular mRNA localization of RXR α is involved in these cellular processes. Then, IP analysis: internal, RA-induced binding G β and 3 (FIG. 26g) between a kinase (phosphatidylinositol 3-kinase, PI3K) by Western blot analysis and phosphatidyl inositol between 30 minutes and 4 hours Activate all of the Akt isoforms of PI3K and its downstream effectors, including Aktl and Akt2, and a transient Akt3 within 1 hour (Fig. 28b). After 24 hours of treatment with RA, by flow cytometry (Fig. 28c) and RT-PCR analysis (Fig. 29a), the overall performance of the Akt isoform was by pretreatment of the PI3K inhibitor wortmannin (Wortmannin). ) is suppressed, showed the presence of G β / PI3K / Akt signaling. Notably, Akt has recently been shown to be an important regulator of neurite outgrowth that promotes neuronal survival, and RA-induced Akt3 (4 hours) may bind to mechanical markers of rapamycin. (mTOR), which was detected by the use of a specific antibody (Cell Signaling Technology), which was inhibited by siRNA against Akt3 (Fig. 28d), resulting in mTOR at position 2448 of serine in 4 hours. A brief phosphorylation. However, this effect disappeared after 24 hours of incubation (Fig. 28e). This function was inhibited by Akt3 knockdown using siRNA by Western blotting (Fig. 28f) and by flow cytometry (Fig. 29c). Directly, Western blot analysis showed that phosphorylated mTOR interacted directly with eukaryotic translation initiation factor-4E binding protein 1 (eIF4EBP1) by RA treatment for 4 hours (Fig. 28g) and activated eIF4EBP1 (Fig. 28) 28h). Phosphorylation of eIF4EBP1 was inhibited by attenuating phosphorylated mTOR using siRNA; phosphorylation of elongation initiation factor 4E (eIF4E) was activated (Fig. 28h), meaning: eIF4E to eIF4E/eIF4EBP1 Complex separation occurs. Phosphorylation of eIF4E can result in cap-dependent translation of mRNA. In general, these observations explain how RA can induce subcellular mRNA translation through RXR α mRNA and RAR β mRNA activation to locally generate RXR α and RAR β , respectively, by IP analysis because of eIF4E by siRNA. Attenuation, the interaction between RXR α and G α _q/11 and between RAR β and G β was inhibited (Fig. 28i). These results support that Akt3/mTOR signaling plays a role in the initiation of local synthesis like RXR alpha and RAR beta . Although RA stimulation prolonged the increase in initiation factor 4B (eIF4B), this effect was not affected by siRNAs against mTOR or 4EBP1, suggesting another mechanism in regulating eIF4B expression (Fig. 28h).

Spatio-temporal Akt3 promotes secondary cell localization for RXR alpha and RAR beta production via mTOR signaling.

Example 25: The main tendency of CREB1 in dopamine specialization

The G β /PI3K downstream effector Aktl directly binds to and activates cAMP responsive element binding protein 1 (CREB1) through phosphorylation at the site of serine 133 (Fig. 30a). The interaction of Akt1 with CREB1 was inhibited by Aktl siRNA (Fig. 30c). By chromatin immunoprecipitation (ChIP) analysis, phosphorylated CREB1 targets and transcribes the dopamine precursor tyrosine hydroxylase (TH) gene (Fig. 30b), which is inhibited by CREB1 siRNA (Fig. 30d) . To this end, the results suggest that the RA-induced RAR β /G β /PI3K/Akt1/CREB1 pathway plays a role in TH transcription in dopaminergic neurogenesis. To support this in vivo concept, a model of 6-OHDA-induced PD rats that received intracranial transplantation of hTS cell-derived tNSCs at the injured striatum was used. Examination of brain sections at the 12th week after implantation showed that the co-expression of CREB1 and TH in the substantia nigra parsing is neonatal dopamine (DA) in the treated side by immunofluorescence tissue analysis. Neurons (which can be contiguous with those in the normal side) were observed (Fig. 30e). The activity of both TH and CREB1 in the regenerated DA neurons was higher than in normal subjects (Fig. 30f). Interestingly, an apparent CREB1 expression was observed in the nucleus of DA neurons. These findings may explain why CREB1-deficient mice are susceptible to neurodegeneration.

Example 26: RXR α /G α _q/11 Study on ER calcium regulation

Western blot analysis showed between 30 minutes and 4 hours: RA induced the gradual activation of G α _q/11 catalyzed by membrane phospholipase C (PLC- β ), leading to degradation of membrane phosphoinositide PIP ₂ (Fig. 21a) to generate a secondary sub-inositol (1,4,5) triphosphate [inositol (1,4,5) triphosphate, IP3] consistent with the conventional G α signaling described previously. IP3 activates its receptor IP3R (Fig. 21a) at the ER, causing an increase in intracellular calcium (Fig. 21b). To determine the origin of intracellular calcium, cells were cultured in medium without calcium, where RA induced a transient intracellular Ca ²⁺ release by immediate live cell immunofluorescence microscopy (Fig. 21b). Depletion of ER calcium levels may be restored by the addition of external CaCl ₂ for homeostasis and cell protection, exhibiting a store-operated calcium entry (SOCE) The type of ). The process of calcium release in the ER was inhibited by the IP3R specific inhibitor 2-APB in a dose-dependent manner (Fig. 21b). These results show that the intracellular calcium elevation of ER-release is due to the RA-induced G[ alpha] _q/11 signaling pathway in hTS cells.

KCl activates L-type calcium ion channels in hTS cells after depletion of RA-induced ER calcium in medium without calcium (Fig. 21b). N-type calcium channel antagonist nifedipine blocks this signaling (Fig. 21b). RA regulation of intracellular ER calcium is associated with L-type calcium channel.

Example 27: Study of CaMKII on excitation-neural formation coupling

Western blot analysis showed that RA induced a spatiotemporal activation of CaMKII within 1-2 hours (Fig. 21a). Immunoprecipitation assays demonstrated that CaMKII directly phosphorylates and activates CREB1 (Fig. 21c), which is compatible with previous studies: CaMKII locally encodes L-type calcium channel activity into CREB for nuclear on excitation-transcriptional coupling Signal. Western blot analysis showed that eukaryotic initiation factor 4B eIF4B siRNA inhibited the expression of CaMKII, calcineurin and eIF4B (Fig. 21d). Axons contain a variety of different mRNAs that locally encode specific protein synthesis, including CaMKII, calcineurin and CREB1 in developing neurons. CREB1 is capable of returning to a specific transcriptional process for the responsibility of the signal for the negative axons in the nucleus. Local protein synthesis of the external RA-triggered CaMKII is inhibited by eIF4B siRNA in hTS cells. therefore, This locally activated CaMKII signaling acts similarly to CREB1, suggesting a rapid inducible gene transcription of extracellular signals.

Transient CaMKII binding and activation of eukaryotic initiation factor 4B (eIF4B) (Fig. 21c) initiates mRNA translation via a cap-independent mechanism. Western blot analysis suggested that this effect was inhibited by RA after a selective CaMKII inhibitor KN93 (Fig. 21e). This CaMKII/eIF4B signaling then integrates the eIF4B/c-Src/Nanog signaling pathway to complete the self-renewal of tNSCs and the signal transduction pathway from RXR α /G α _q/11 to Nanog for proliferation. These results are the first to explore the G α _{q / 11} signal - derived CaMKII relates to self-excitation of tNSCs - maintained updated.

Western blot analysis and immunoprecipitation assays demonstrated that CaMKII binds to and activates parkinson protein 2 (parkin) (Figures 21a and 21f). In turn, parkin interacts directly with the microtubule-associated protein tau (MAPT) and activates the microtubule-associated protein tau (Figures 21a and 21f), which preferentially resides in the axons and stimulates microtubule assembly. Thus, MAPT binds directly to SNCA (Figures 21a and 21g) to form a parkin/MAPT/SNCA complex. When MAPT interacts with tubulin and activates it (Figures 21a and 21h), a microtubule element is exclusively expressed in neurons that stabilize and promote microtubule combination. At the same time, these results suggest the importance of axon behavior in early neurogenesis.

Example 28: Activation of Calcine Dephosphatase/NFAT1 Signaling

Western blot analysis showed that RA induced calcium dephosphatase Generation (Figure 21a). Pretreatment with 2-APB inhibited calcium dephosphorylation, NFAT1, and MEF2A expression (Fig. 21i), linking ER calcium to calcium-regulated dephosphatase molecules. Calcium phosphatase immediately dephosphorylates NFAT1 (a T cell activation and a key regulator of fatigue), showing a transient pattern in 30 minutes to 2 hours (Figure 21a). As demonstrated by immunoprecipitation assays, this effect was also inhibited by 2-APB (Fig. 21h), linking ER calcium to calcium dephosphatase/NFAT1 signaling. In addition, RA induced a transient interaction between NFAT1 and the endogenous protein (primoplasmic cytoplasmic transporter) by cell separation assays (Figures 21a and 21j), resulting in nuclear translocation of NFAT1 (Fig. 21k). The transient utility of this NFAT1 is thought to be a mechanism by which a cell can be distinguished between persistent and transient calcium signals.

Example 29: Study of Wnt and G protein signaling pathways

GSK3 β inhibition of canonical Wnt signaling (at serine / threonine place here) cytoplasmic beta] After the process is maintained overnight RA - catenin stabilized but with a slightly reduced level within 30 to 120 minutes . Unexpectedly, Akt2 binds to GSK3 β within 4 hours in the Akt isoform (Fig. 21l); however, flow cytometric analysis showed that GSK3 beta was initially activated within 4 hours but was subsequently treated by RA. The transition becomes suppressed (Fig. 21m). This phenomenon was further confirmed by using Akt2 siRNA (Fig. 21n). To explain this functional divergence, it was confirmed that the initial activation of GSK3 β was due to phosphorylation at the Tyr 216 site by Akt2 followed by inhibition due to the site of the serine/threonine site. Phosphorylation (Fig. 21m). These results demonstrate that site-specific phosphorylation of GSK3 beta by a variety of different protein kinases determines the fate of downstream effectors. In addition, active GSK3β phosphorylates MAPT via direct interaction (Fig. 21h). In turn, MAPT interacts with tubulin and activates it (Figures 21a and 21h) to promote microtubule assembly. In particular, in Wnt2B, G β and G α _{q / 11} signaling pathway is a bridge is established during early neurogenesis.

Example 30: Study of transcription factors for dopaminergic neurogenesis

In the nucleus, the interaction of β -catenin and CREB1 represents a major propensity for TH transcription (Figures 30a and 30b). The active β -catenin, in turn, binds to lymphon enhancer factor 1/T cytokine 1 (LEF1) (Fig. 22a), resulting in the conversion of LEF1 from a transcriptional repressor to an activator. LEF1 then recruits and interacts with Pitx2 (a member of a superfamily of bicoid -related factors) (Fig. 22a). By chromatin immunoprecipitation (ChIP) analysis, LEF1 promotes Pitx2 gene transcription instead of Pitx3 (Fig. 22b), interacting with β -catenin, Pitx2, and LEF1 to synergistically regulate LEF-1 promoters. .

In addition, transient nuclear activity NFAT1 acts as a transcription factor to generate cytokines for use in immune responses as well as TNF- α . However, this effect is unlikely to occur in this case because phosphorylated GSK3 beta is able to inhibit calcium dephosphatase-induced DNA binding in the nucleus and promote nuclear export. Thus, since this effect is inhibited by NFAT1 siRNA (Fig. 22e), the active cytoplasmic NFAT1 will interact and activate the cytoplasmic transcription factor myogene cell enhancer factor 2A (MEF2A) (Figs. 22c and 22d). Specifically, the rapidly inducible CREB1 enters the nucleus and is transcribed to generate the MEF2A gene of the MEF2A protein (Fig. 22f). MEF2A may act in a variety of ways on gene transcription (Fig. 22g), including autoregulation of autoregulation to generate more MEF2A, transcription of the TH gene for dopamine specialization, and transcription of the SNCA gene for SNCA/MAPT/parkin complexation. Body formation, and interaction with EP300 and Pitx2 (which was inhibited by MEF2A siRNA) (Fig. 22h).

By ChIP analysis, the active EP300 not only targets the HDAC6 gene but also the TH gene (Fig. 22i). HDAC6 is then able to carry beta -catenin for nuclear translocation (Figures 24e and 24f). In summary, an executed transcriptional complex is formed and designated for transcription of the TH gene. Among them, CREB1, EP300, and MEF2A can directly target the promoter of the TH gene, while β -catenin, LEF1, and Pitx2 perform a coactivator as an enhancer during the transcription process. Western blot analysis showed various molecular activities at 4 hours and 24 hours (Fig. 22j).

Example 31: Animal Research

For animal studies, reporter cells were prepared by transfection of F1B(-540)-GFP and pSV2neo plastids into hTS cell relays with G418 selection. More than 95% of hTS cells showed a co-expression of F1B and TH-2. Second, Parkinson's disease in "young" Spraque-Dawley rats (n=12, body weight, 225-250 gm) is as described below by the neurotoxin 6-hydroxydopamine (6-hydroxydopamine, 6-OHDA) was induced by unilateral injection into the rat brain.

The entire experiment was based on the ethical board of the Human Body Test Committee of the hospital attached to the Kaohsiung Medical University Hospital. The Institutional Review Boards of the Hospital, Kaohsiung Medical University Hospital, and the Ethical Committee at Medical College of National Chung Kong University (Taiwan, Taiwan) were implemented and implemented.

Induction of Parkinson's disease

Twelve Spraque-Dawley rats [560+65 g (pre), 548+46 g (post) body weight] were used as a model for Parkinson's disease with 6-OHDA-injury (Javoy et al. , Brain Research, 102:201-15, 1976). For surgery, after anesthesia caused by chloral hydrate (4%, 1 cc / 100 g body weight), stereotaxic lesions were treated with 6-hydroxydopamine (Sigma). It was injected into the right median forebrain bundle (AP 2.8/Lat 2.2/Dep 8.0 mm) at a rate of 1 μg/0.5 μL/min for 8 minutes (injection pump: CMA 100). After 10 minutes, the tube was removed. After 2 weeks, the dehydrated morphine-induced rotation was tested in a plastic bowl (in a diameter of 36 cm) 20 minutes after subcutaneous injection of dehydrated morphine (25 mg/kg). The contralateral rotational rotation was monitored using a camera and recorded for 20 minutes. Rats with more than 25 rotations per 5 minutes were eligible for the study. For cell transplantation, the cells were transplanted into the 2 sites in the striatum on the right side (each address: 3 × 10 ⁶ /4 μL) (1st address: AP+1/Lat+2.7/Dep 6.4mm; 2nd Address: AP+0/Lat+2.7/Dep 6.4mm). The control group was administered PBS using the same method. Dehydrated morphine-induced rotation was measured at 0, 3, 6, 9, and 12 weeks after cell injection. The result was expressed as the opposite side of the rotation for 5 minutes (Fig. 5a).

To examine the utility of NSCs induced by RA at different times, eligible rats were randomly divided into 3 groups: 1- and 5-day RA-induced groups and control groups. Prior to transplantation, hTS cells were transfected with F1B-(-540)-green fluorescent protein (GFP) and pSV2neo recombinant plastid DNA followed by G418 selection to achieve a yield of over 95%. In each rat received a total of NSCs GFP- mark of ⁶ × 10 6 cells, while the control group were receiving saline solution as a carrier of the phosphate buffer. Therapeutic utility was assessed every 3 weeks after implantation by a dehydrated morphine-induced rotation test (Iancu et al. , 2005).

Experiment 1 : Adult Spraque-Dawley rats (BW: 225-250 g) were used as transplant recipients and were bred using food and water in an ad libitum under a 12 h light/dark cycle. The injured rats were first divided into 3 groups: (a) injured and transplanted with 1-day RA-induced NSCs (n=4), (b) damaged and transplanted 5-day RA- Induced NSCs (n=4) and (c) injured and non-transplanted controls (n=4). Rats were anesthetized with Zoletil (50 mg/kg, sc, Virbac Lab. Carros, France) and the injured rats were singled according to the anterior iliac crest and the bregma and dura. Side-injection with 6-OHDA (8 μg / 4 μL in 0.1% 1-ascorbic acid-saline; Sigma-Aldrich, Mo) to the left MFB (AP 2.8, Lat 2.0, Dep 8.0 mm) and SN (AP 5.0, Lat 2.2, Dep 7.5 mm) and wait for 10 minutes at this address. hTS cell-derived NSCs (1×10 ⁶ cells/5 μL/5 min) were transplanted into 2 addresses in the DA-depleted striatum (AP+1.0, Lat+2.7, Dep 6.4 and AP+0, Lat+2.7, Dep 6.4) and the cannula was left in position for 5 minutes before slowly retracting it. Cell viability remained stable between 96 and 98% during the implantation procedure. Sham-operated rats receive a carrier without cells. The lesion was assessed by dehydrated morphine-induced rotation every week after 6-OHDA injury to achieve a stable Parkinson's disease status (>300 rotations/hour). Transplantation efficacy was assessed every 3 weeks by a dehydrated morphine-induced rotation test until week 12. At the 18th week after implantation, the rats were sacrificed and brain sections were subjected to TH-DAB immunostaining.

Experiment 2 : PD rats were controlled to have 560 +/- 65 g on pre-test weight and post-test at 548 +/- 46 g. The injured rats (n=16) were divided into 2 groups as established in Experiment 1 and transplanted with 1-day RA-induced NSCs by transplantation: (a) damaged and transplanted with cells ( n=8) and (b) the control group (n=8) that was damaged and not transplanted with cells. Cells were transplanted by injection at AP+1.0, Lat+2.7, and Dep 6.4. The behavioral assessment was performed every 3 weeks as described below until 12 weeks after implantation. At the 13th week, all rats were sacrificed and brain sections were subjected to TH-DAB immunostaining and TH-positive cells were analyzed by densitometry.

Behavioral assessment

Locomotor Activity Assays : In rats, spontaneous action behavior is in a circular channel (10 cm wide and 60 cm in diameter with a 30 cm high wall; Med Associates Inc., St Albans, VT) And being monitored. The four optoelectronic components equidistantly located around the round wall detect the horizontal ambulatory activity of an animal via beam interruption. The data was recorded via a PC equipped with custom software (Med Associates). Individual groups of animals were tested using 10 mg/kg (n=6 per group) and 20 mg/kg (n=12 per group) cocaine. Animals were randomized into treatment groups (HSV-LacZ and HSV-RGS9-2) and were accustomed to exercise equipment for 2 hours. On the next day, the animals received the HSV vector in a nucleus accumbens shell on a stereotaxic frame. After 2 days of recovery, the animals were tested for colic activity for 2 hours on the behavioral activity. Data were analyzed by two-way ANOVA (HSV x time) B Bonferroni post hoc test.

In relation to mice, the behavioral activity is determined in an automated system in which the active chamber is a plastic cage (12 x 18 x 33 cm) with 10 pairs of photocell beams that divide the chamber into 11 rectangular ranges ( Hiroi et al. , 1997). Mice were tested daily at the same time by an experimenter who did not know the genotype of the mouse. For acute experiments, animals were accustomed to the room for 30 minutes, after which time they received saline or diversified doses of amphetamine, cocaine or morphine for dehydrated morphine, and exercise activity was assessed over an additional 30 minute. For chronic experiments, animals were placed in the chamber immediately after a three-day ip saline injection. The horizontal activity was then measured for 10 minutes. At day 4-8 (C1-C5), animals were given cocaine (7.5 mg/kg ip) and activity was measured for 10 minutes. Short time periods used in rats as well as mice have been shown in previous studies to avoid potential confounding effects of stereotypy on the measurement of mobile action behavioral activity.

Three behavioral tests were performed: (i) drug-induced rotation to assess damage and graft effects, (ii) footprint analysis to assess hind limb gait patterns, and (iii) ladder rung walking test Evaluate skilled walking performance (hind limb/fore limb coordination and foot placement accuracy).

Dehydrated morphine-induced spin test : Briefly, rats were administered subcutaneously with dehydrated morphine (0.5 mg dehydrated morphine with 0.01% ascorbic acid in 0.9% saline/kg body weight, Sigma-Aldrich) Placed in a large circular chamber (in a diameter of 16 cm) for a period of 40 minutes. All rotations are recorded in the videotape and the net rotational asymmetry is calculated. The data is calculated as the total number of revolutions in 30 minutes. The data was analyzed by using Matlab software.

Dehydrated morphine-induced rotation (apo) was also observed after an intraperitoneal injection of 0.5 mg/kg dehydrated morphine solution (Sigma-Aldrich, 0.5 mg dehydrated morphine in 0.9% saline with 0.01% ascorbic acid). 60 minutes. As previously described ([59]; Figure 6a), the rotational offset was after the injury (2 and 3 weeks after injury) and after transplantation (3 and 6 weeks after transplantation) in the rotating flowmeter box Evaluation. Data for drug-induced rotation 2 weeks after injury and 3 weeks after transplantation were not shown. After 3 days, amphetamine-induced rotation (amph) was performed for 90 minutes after intraperitoneal injection of 1 mL/kg of amphetamine solution (Sigma-Aldrich, Steinheim, Germany: 2.5 mg d-amphetamine per 1.0 mL of saline). Five animals were excluded from the study because they were shown after morphine injection The whole body rotation of the injured side and the whole body rotation of the injured side of <6.0 on the opposite side of <6.0 after the injection of amphetamine were shown. Dehydrated morphine-induced rotation is a net rotation that is presented as a negative value, and amphetamine-induced rotation is a net rotation that is presented as a positive value.

Drug-induced rotation after injection of dehydrated morphine (A) and injection of amphetamine (B). The rotational offset is shown as the total amount of body rotation. The money symbol ($) indicates a significant difference between sham and transplanted rats. Pre-transplantation = 6 weeks after injury, post-transplantation = 6 weeks after transplantation. Note that there is a significant graft effect [reduced rotational offset after dehydrated morphine injection; overcompensation after amphetamine injection].

Bar test for sports disability : For the bar test, the forefoot of the rat with both sides and the same side is selectively placed on a horizontal acrylic plastic bar having a size of 0.7 x 9 cm. The posture is gently placed on one. The time from the placement of the forefoot to their first complete removal from the bar is recorded. The total time spent by each foot on the block is recorded as previously described (Fantin).

Footprint analysis (space-time gait analysis) : Footprint analysis (including walking speed, pace length, stride length, and support basis) was performed as previously described to assess hind limb walking pattern (Klein). Rats must walk through a channel (50 cm long, 8 cm wide) on a plastic plate. Parameters [including stride length, limb rotation (between an imaginary line passing through the third toe and the palm and an imaginary line parallel to the walking direction) and the distance between the feet at 5 consecutive steps (The distance between the left and right foot step cycles)] was recorded by a camera (Casio EX-F1, Japan) and analyzed by Matlab software.

Ankle stiffness assessment is assessed using a suitable method. Suitable electrophysiological assays are used to determine the % recovery of dopamine neurons in the brain.

immunochemistry

For TH immunohistochemistry, animals received a terminal dose of 60 mg/kg sodium pentobarbitone (Apoteksbolaget, Sweden) and were per-cardially perfused with 50 mL saline (0.9% w). /v), followed by 200 mL of ice-cold paraformaldehyde (4% w/v in 0.1 M phosphate buffered saline solution). The brain was removed, post-fixed in 4% paraformaldehyde for 2 hours and frozen before being sliced on a frozen microtome (Leica) - protected with sucrose (25% w/v) In a 0.1 M phosphate buffered saline solution) overnight. Coronal sections were collected in 6 series at a thickness of 20 μm.

The immunohistochemistry procedure was performed as follows. Free-floating sections were incubated at room temperature to prepare a incubation solution containing 0.5% phosphate buffered saline solution containing 5% standard serum and 0.25% Triton X-100 (Amresco, USA) with potassium. The primary antibody in the overnight. Secondary antibodies were diluted in phosphate buffered saline solution with potassium containing 2% standard serum and 0.25% Triton X-100 and applied to the original solution for 2 hours at room temperature. The detection of the primary-secondary antibody complex is the precipitation of di-amino-benzidine driven by peroxidase or the conjugation of a fluorophore (directly to the second The antibody is achieved, if necessary, using a streptavidin-biotin amplification step). For c-Fos detection, nickel sulphate (2.5 mg/mL) was used to enhance staining. Slides that were labeled with fluorescent labeling were mounted using polyvinyl alcohol-1,4-diazabicyclo [2.2.2] octane (polyvinyl alcohol-1,4-diazabicyclo [2.2.2] octane The sections labeled with bis-amino-benzidine were covered with a cover slip and dehydrated in alcohol and xylene and covered with DePeX mounting media (BDH Chemicals, UK). Cover the slide. And a primary antibody dilution factor as follows: mouse anti - calbindin _{28KD (mouse anti-Calbindin 28KD)} (1: 1000; Sigma), rabbit anti -c-Fos (1: 5000; Calbiochem), anti-chicken -GFP (1 : 1000; Abcam), rabbit anti-GFP (1:20000; Abcam), rabbit anti-GIRK2 (1:100; Alomone Labs, Jerusalem, Israel), rabbit anti-PITX3 (1:100; Invitrogen), and mouse anti- - tyrosine hydroxylase (TH: 1:4000; Chemicon). Secondary antibodies (used at a 1:200 dilution) were as follows: (i) Direct detection - conjugated anti-mouse conjugated with cyanine 3 or cyanine 5 (cyanine 3 or cyanine 5 conjugated donkey anti) -mouse), cyanine 2 conjugated donkey anti-chicken, cyanine 5 conjugated donkey anti-mouse (Jackson ImmunoResearch) And (ii) indirect use of streptavidin-biotin amplification-biotin-conjugated goat anti-rabbit or horse anti-mouse (Vector Laboratories) followed by oxidase-conjugated streptavidin Protein (Vectastain ABC kit, Vector laboratories) or streptavidin (Jackson ImmunoResearch) conjugated to phthalocyanine 2/cyanide 5.

In vivo study of CREB1 expression in dopamine trimming

To obtain brain slices, rats were anesthetized with sodium pentobarbital (60 mg/kg ip, Apoteks bolaget, Sweden) and perfused-heart-infused with saline (50 mL, 0.9% w/v) followed by ice-cold Paraformaldehyde (200 mL, 10% w/v in 0.02 M PBS) was performed in acute and chronic PD rats at 18- and 12-week, respectively. Brain sections were subjected to immunocytochemistry, immunohistochemistry, and immunofluorescence tissue analysis as indicated.

Intracranial transplantation of 6-OHDA-induced PD rats receiving hTS cell-derived trophoblastic NSCs (tNSCs) at the injured striatum was examined to study CREB1 expression. Examination of brain sections at the 12th week after implantation showed that the co-expression of CREB1 and tyrosine hydroxylase (TH) in the substantia nigra in the substantia nigra parsing was analyzed by immunofluorescence tissue analysis. Neonatal dopamine (DA) neurons (obtained in the normal side) were observed (Fig. 30e, insert). The activity of both TH and CREB1 in the regenerated DA neurons was higher than in normal subjects (Fig. 30f). An apparent CREB1 expression was observed in the nucleus of DA neurons. These findings can help explain why CREB1-deficient mice are susceptible to neurological degeneration.

In vivo study on the regeneration of the dopamine nigrostriatal pathway

To further confirm the regeneration of the dopamine nigral striatum pathway after cell therapy, immunofluorescence tissue analysis was performed (TissueGnostics Gmbh, Vienna, Austria). Brain slices were studied, including 14 acute PD rats (ie, 2 at the 1st week after injury and 2 at the 6th week after injury and 2 control groups, 6 at 12th week after cell transplantation) Time and 2 control groups) and 4 chronic PD rats (i.e., 2 at the 12th week after cell treatment and 2 control groups). In SNC, 6-OHDA caused progressive neurodegeneration, resulting in a variety of different sized cavities at the 6th week after injury (Figure 31). Interestingly, after treatment with tNSCs, many DA neurons with TH-positive nerve endings protruding into the cavity appeared in the cavity wall (Fig. 31, insert). Quantitative analysis showed that the number of DA neurons was significantly reduced to 48% and 13% in SNC at 1 and 6 weeks after injury, respectively, compared to the non-lesion side (Figures 32a and 32b). Remarkably, the loss of DA neurons can be reduced by up to 67% after treatment with tNSCs.

When in the striatum, DA neurons were reduced to 78% and 4% at the 1st and 6th weeks after injury, respectively (Fig. 32a). Similarly, lost DA neurons may be regenerated up to 73% after treatment with tNSCs. Consistent with previous observations (Figure 5), the DA neuron loop was well established in the treated side of the SNC immunohistochemically similar to the non-lesion side (Figure 32b). The recovery rate of DA neurons was calculated to be 78.4 ± 8.3% (mean ± SEM; n = 4) in the SNC (Fig. 32c), which was compatible with 67% in the immunofluorescence assay.

Since glial cells act as mediators in guiding the movement of neurons to their destination or as a source of nerve regeneration, 6-OHDA not only causes degradation of both DA neurons and GFAP(+) cells but also causes Striate pallid black axon axon Disturbance (striato-pallido-nigral axons) (Wilson bundle). These phenomena were clearly improved after tNSC treatment, indicating that many GFAP(+) cells were embedded in the fine myelinated fibers (Fig. 32d). As observed, GFAP(+) cells in the injured striatum regenerated from 65.5% at week 6 post-injury to 93.9% after tNSC treatment (Fig. 32e). This fact may reflect astrocytic activation, attributable to the implanted subtypes of tNSCs, namely GRP and stellate cells. These results show that transplantation of tNSCs in chronic PD rats regenerates the dopamine nigrostriatal pathway, thereby explaining the improvement of behavioral defects. Based on the retention of tNSCs in the injured pathway, regeneration of the optimized DA neurons will last for at least 18 weeks after implantation (Figure 5).

In vivo, hTS cells were intramuscularly implanted into male severe complex immunodeficiency (SCID) mice for 6-8 weeks. Histologically, no teratoma was found; however, a slight chimeric reaction with a mucin-like singular cell was observed between muscle fibers (Fig. 10). These results show the advantages of hTS cells and tNSCs in translating drugs compared to hES cells related to teratoma formation.

statistics

All data are expressed as mean ± SEM. The difference was determined by using the repeated measures analysis of the variance (ANOVA) assay (SPSS Release 12.0 software) and the dehydrated morphine-induced rotation analysis using the least significant difference test after repeated measurements between 2 groups of ANOVA assays ( LSD) was evaluated after the fact. The Stutton's t test, paired t test is used when appropriate. A p -value <0.05 was considered significant.

Animal experiments show that tNSCs injected into the injured striatum can be moved upstream to the substantia nigra pars compacta via the nigrostriatal pathway after 18 weeks of implantation by the GFP-labeled immunofluorescence study. . Second, the efficacy in improving behavioral deficits was higher than expected. For example, the recovery of dopamine neurons at the 12th week after implantation was 28.2%. Third, no immunosuppression or tumor formation was observed. Further, improvement in 28.2% of dopamine neurons and behavioral deficits was maintained in a chronic PD rat for more than 1 year after 6-OHDA induction. These results indicate that transplantation of tNSCs regenerates the dopamine nigrostriatal pathway and functionally improves behavioral disorders in acute PD rats.

Chronic PD animal model

In order to more closely mimic the pathological progressive nature of PD patients, a chronic PD rat model was developed by breeding methods over a year (average 12.3 months). The dehydrated morphine-induced spin test was performed every month to determine the PD status of the rat throughout the experiment. Group I (n=6) received tNSCs and group II was control (n=6). Behavioral assessments were performed every 3 weeks, including dehydrated morphine-induced rotation tests, bar tests for exercise disability, stepping tests for stiffness, and footstep analysis for postural imbalances and gait lesions. .

In Group I, a significant improvement in a dehydrated morphine-induced contralateral rotation was achieved from week 3 to week 12 post-implantation, similar to previous studies in acute PD rats (Fig. 6a). The bar test showed that the grip time of the affected forelimbs was significantly shortened at the 3rd week and at week 12 Continued improvement at the time (Figure 6b). All evaluations by step length (Fig. 6c), stride length (Fig. 6d), walking speed (Fig. 6e), and support base (Fig. 6f) show significant improvement from week 3 to week 12 after implantation. . These studies were performed on well-designed channels (Figure 6g). These results show that transplantation of tNSCs can regenerate the dopamine nigrostriatal pathway and functionally improve behavioral disorders in chronic PD rats.

Embodiment 32: Pull and Push Mechanism

G protein-coupled receptors (GPCRs) communicate between the internal and external environment and are coupled to heterotrimeric G proteins at the cell membrane. However, the mechanism for elucidating how activated GPCRs initiate this process is less clear. A recent report has shown that when a ligand is introduced, both G α ₁₃ and G α _q/11 subunits interact with the AhR-interacting protein, where G α ₁₃ leads to cells. Destabilization, translocation, and ubiquitination of solute AhR. The role of G protein signaling in the non-genetic AhR pathway was explored. BBP was selected as an exogenous ligand and COX-2 as an activated target because COX-2 causes inflammation, metabolism, and carcinogenesis in a variety of different human cells, including liver cancer cells. Carcinogenesis).

The ability to capture snapshots of molecular changes in cells is studied by immunofluorescence, which are believed to be important for dynamic studies of message delivery. Human liver Huh-7 cancer cells were pre-transfected with pGFP-C1-AhR by using LT1 transfection reagent (Mirus Bio LLC, WI), and total internal reflection fluorescence microscopy (total internal Reflection fluorescence microscopy) is used to selectively observe molecular events in the cytoplasmic region below the cell membrane. When BBP is introduced, a rapid but transient recruitment of GFP-tagged AhR and translocation occurs in the subcellular membrane region, which shows a rapid increase in AhR over 115 seconds and a peak and then a gradual decrease It took more than a few minutes (Figure 14a). This rapid dynamic movement of memAhR at the subcellular membrane is reminiscent of the concept of soft-wired signal transduction. AhR has been found to supply an adaptive function through its regulation of biotransformation enzymes and changes in intracellular localization, which triggers its own activation.

Then, the correlation between BBP and AhR was detected by reverse transcription polymerase chain reaction (RT-PCR). BBP significantly induced mAhR performance within 5 minutes, peaked at 15 minutes and gradually returned to a slightly higher constitutive steady state (Fig. 14b). Interestingly, Western blot analysis showed a BBP-induced increase in AhR production at the 15th minute, a slight decrease in the 30th minute, and a repeated increase at the 1st hour ( Figure 14c). The different patterns of AhR exhibited at these time points in these two analyses can be explained by the difference between subcellular mRNAs activation and constitutive synthesis, which supports the cytoskeleton in mRNA trafficking. "the concept of. Thus, it is possible that Huh-7 cells contain a structural machinery for the mRNA required for local protein translation in response to exogenous stimuli and are referred to hereinafter as memAhR. Lower mRNA levels may represent constitutive AhR activity over the maintenance of differential stability of the cells. When the ligand is activated, the heterotrimeric G protein dissociates into a G β γ dimer and a G α subunit (including G _s , G _i , G _{q/11 ,} and G _12/13 each performing a different function). BBP induced the production of both G α _q/11 and G β within 30 minutes (Fig. 14d). The increase in G α _q/11 is due to the direct interaction between memAhR and G α _q/11 (Fig. 14e). These results were further confirmed by knocking out AhR using siRNA in cells (Fig. 14f). These data clearly indicate that GBP is stimulated by BBP stimulation and causes the dissimilar G α β γ to dissociate into G α and G β γ subunits, allowing G α _q/11 to go to their upstream activator memAhR Interaction. Since AhR has _{/ 11} activity associated with the G α ₁₃ and G α _q, and liver tumor (hepatoma) cells, inflammatory cell activity may AhR fate process, whereby a continuous performance of the AhR can promote tumor cell growth. This experiment was directed to molecular events involving G α _q/11 signaling.

In one embodiment, modulation of AhR activity can inhibit or reduce cell growth. In another embodiment, modulation of AhR activity kills one cell. In one embodiment, the down regulation that modulates the activity of the AhR protein in a cell is modulated. In another embodiment, the modulation comprising the inhibition of the activity of the AhR protein in a cell is modulated. In another embodiment, the modulation comprises inhibiting association of the AhR protein with a G protein in a cell. In another embodiment, the down regulation that comprises the expression of the AhR gene in a cell is modulated. In one embodiment, the cell is a tumor cell. In one embodiment, the tumor is a lung, breast, colon, brain, bone, liver, prostate, stomach, esophagus, skin, or leukemia tumor cell. In one embodiment, the tumor is a solid tumor. In another embodiment, the tumor is a liquid tumor. In one embodiment, the AhR activity is modulated with an AhR agonist. In another embodiment, the AhR activity is modulated by an AhR antagonist. In another embodiment, the AhR activity is modulated with a compound having anti-estrogen activity. In another embodiment, the AhR activity is modulated with a compound having anti-androgen activity. In one embodiment, the tumor cell is present in a mammal. In another embodiment, the tumor cell is present in a human. In another embodiment, a method for treating a tumor present in a human is provided by administering a compound that inhibits or reduces the activity of one of the AhR proteins in the tumor to the human. In another embodiment, a method for treating a tumor present in a human is provided by administering a compound that inhibits or reduces the gene expression of one of the AhR proteins in the tumor to the human.

For confocal immunofluorescence imaging microscopy, cells were each treated with BBP for 5 and 15 minutes, followed by immunofluorescence staining for both AhR and G[ alpha] _q/11 . In the absence of the BBP, AhR G α _{q / 11} both in the cytoplasm and is less compared to the performance in the core is observed (FIG. 15a). In the cells stimulated by BBP, the expression of AhR in the nuclear and nuclear-peripheral regions showed a clear increase at the 5th minute, and then an outward expansion of AhR was observed at the 15th minute. (Fig. 15b, line 1). These results show a constitutive AhR activity as well as cytosolic translocation. Regarding the performance of G α _q/11 , it was stimulated at the 5th minute in a manner similar to that of AhR (Fig. 15b, line 2). However, G α _q/11 has been translocated from the cytosolic compartment towards the cell membrane at the 15th minute, which supports the on-generate view that the maturation of a GPCR-G protein complex has reached a correct transport to The ability of the cell membrane, although the exact mechanism is unclear. Subsequently, the AhR siRNA knockout inhibited the nuclear AhR but not the cytosolic AhR expression, which was confirmed by knocking out AhR using scrambled siRNA (Fig. 15c). However, when BBP was added, the AhR expression was increased in both the nuclear and nuclear-perimeter regions at the 5th minute, and reached a homeostatic state in the cytosol at the 15th minute (Fig. 15d, line 1). Obviously, G α _q/11 was inhibited by AhR siRNA (Fig. 15d, line 2), which was partially restored by the addition of BBP at the 5th minute, and at the 15th minute It was completely recovered and showed a significant accumulation of G α _q/11 at the cell membrane (Fig. 15d, line 2). These results show that G α _q/11 is a downstream effector of memAhR. The dynamic movement and constitutive activity of both AhR and G[ alpha] _q/11 further imply a compensatory effect involving their activation, translocation and maturation in the cell.

Because of spatio-temporal dynamics, double immunogold electron microscopy (IEM) was used to show the interaction of memAhR at the cell membrane. The cells were treated with BBP for 20 minutes, and a large gold particle-labeled G α _q/11 (in the size of 20 nm) and a small gold particle-labeled AhR (in a size of 6 nm) were used. Primary antibodies and secondary antibodies are used for immunocytochemistry. Samples were immediately embedded in LR White Resin (Ted Pella, Redding, CA) and prepared for use in IEM. In the absence of a ligand, three individual immunogold-labeled G α _q/11 entities (including single, double and triple colonies) were shown at the cell membrane (Fig. 16a), reflecting different GPCR-G The presence of an entity of a protein complex. Cells were treated with BBP, and several small gold-marked AhRs were attached to the large gold-marker G α _{q/11 and} an AhR-G α _q/11 complex was observed to form at the cell membrane (Fig. 16b). In addition to the typical monomers and the recently accepted dimers, the presence of polymeric GPCR-G α _q/11 was observed at the cell membrane. This suggests a variety of different conformational changes on GPCRs, including monomers, dimers, and multimers (Figure 16c). The AhR-G α _q/11 complex was found mainly at the cell membrane. There are a few in the cytosol, but not in the compartment of the nucleus (a large amount of AhR and G α _{q/11 are} independently present). No such AhR-G α _q/11 interaction was seen in the control cells. The data shows that the communities of memAhR and GPCRs-G[ alpha] _q/11 complexes were not pre-coupled prior to ligand activation. The polymerization of GPCRs [homo- or hetero-multimers] is of interest because it is an effective mode for regulating the function, subcellular localization and biophysical properties of interacting molecules. It may create more spatial docking sites for screening of exogenous ligands (such as agonists and antagonists) or synergistic binding at the cell surface. Alternatively, it provides a clue to one of the most confusing aspects of biological influence, particularly how the environmental polycyclic aromatic hydrocarbon compounds are associated with toxicity, metabolism, and Carcinogenic reaction.

To investigate the biochemical process of G protein signaling, it was confirmed that when activated by BBP, memAhR can interact with G α _q/11 as previously described. Subsequently, a decrease in the phospholipid inositol (PIP ₂ ) level was observed to result from the cleavage of PIP ₂ as the following two secondary messengers: diglyceride (DAG) and IP3 (Fig. 17a) , District 1). IP3 is known to induce intracellular calcium release through its receptor IP3R at the endoplasmic reticulum (Fig. 17a, Zone 2). Since G protein activation is usually accompanied by the influx of a calcium ion, the origin of the BBP-induced intracellular fluo-4-tag Ca ²⁺ level is by real-time immunofluorescence microscopy (real-time). Live cell immunofluorescence imaging microscopy) was detected (Fig. 17b, middle upper). The cells were cultured in calcium-free medium and were found to have intracellular calcium release (Fig. 17b, lower middle), which shows release from the internal calcium store. This result was further confirmed by the addition of the IP3R blocker 2-APB, and 2-APB was found to dose-dependently inhibit intracellular calcium levels (Fig. 17b, right line). However, an abnormal calcium release induces an inflammatory response as well as tumor formation. Therefore, BBP was observed to induce COX-2 production within 15 minutes and was blocked by the addition of 2-APB (Fig. 17c), which would increase intracellular calcium and activation of COX-2. link. In addition, BBP induces phosphorylation of an extracellular signal-regulated protein kinase ERK and activation of COX-2 (Fig. 17d), which is efficacious by the chemical PD98059 [MAPK pathway and selective non-competitive inhibition It was blocked by a noncompetitive inhibitor (Fig. 17e), which shows that ERK is an upstream activator of COX-2. For this purpose, BBP was shown to induce COX-2 activation via memAhR-activated G[ alpha] _q/11 signaling during molecular processes. This shows the presence of a non-genetic AhR pathway, as BBP significantly inhibits the expression of ARNT [a gene encoding the AhR nuclear translocator protein] (Fig. 17f). This inhibitory utility can be interpreted as the action of co-activated G[ alpha] ₁₃ as previously described.

It has been shown that AhR can act as a message transmitter for external signals, resulting in excitation of GPCR-G protein signaling. It is proposed that the signal "pulls" the adjacent cytosolic memAhR (as an activator) to the cell membrane to bind and activate the dissociated G α _q/11 (as an effector), while "pushing" the downstream molecular cascade for Role in human liver Huh-7 cancer cells. As illustrated in Figure 17g, this "pull-and-push" model strongly promotes understanding how GPCR-G protein signaling is initiated and how AhR-regulated signaling is outside the typical AhR pathway. control. These findings may further have an impact on the development of therapeutic agents that focus on the regulation of GPCRs and G proteins.

Cell cultures and chemicals : Huh-7 cells were obtained from the National Institutes of Health of Taiwan and cultured in DMEM (Gibco) [ supplemented with 10% fetal bovine serum (Gibco), 1% penicillin (100U) /mL), streptomycin (10 μg), amphotericin-B (amphotericin-B) (0.25 mg)] and grown at 37 ° C in 5% CO ₂ . The medium included BSS containing CaCl ₂ (2 mM), D-glucose (5.5 mM), NaCl (130 mM), KCl (5.4 mM), HEPES (20 mM, pH 7.4), and MgSO ₄ (1 mM). The calcium-free medium contained D-glucose (5.5 mM), NaCl (130 mM), KCl (5.4 mM), HEPES (20 mM, pH 7.4), and MgSO ₄ (3 mM). The chemicals included are Fluo-4 (Invitrogen), Benzyl butyl phthalate (BBP) (Sigma), 2-aminoethoxydiphenyl borate (2-aminoethoxydiphenyl borate). 2-APB) (Sigma), ERK1/2 inhibitor [PD98059 (Calbiochem)], 6-diamidino-2-phenylindole (DAPI) (Sigma). The antibodies included are AhR (Santa Cruz), Cox-2 (Minipore), G α _q/11 (sc-392), and G β (sc-378, Santa Cruz), β -actin (Sigma), p44. /42 MAPK(Erk1/2) (Cell Signaling), phospho-p44/42 MAPK (Cell Signaling), horseradish peroxidase (HRP)-labeled anti-mouse, and anti-rabbit secondary antibody [Horseradish peroxidase (Horseradish peroxidase) HRP)-labeled anti-mouse and anti-rabbit secondary antibodies] (Santa Cruz), Dye Light 488-conjugated secondary antibody (green), and Dye Light 549-conjugated secondary antibody (red) (Rockland).

The hTS cells in preimplantation embryos obtained from women with early tubal ectopic pregnancy are previously described. The attached hTS cells were cultured in conditional α- MEM (conditioned α- MEM) at 37 ° C, 5% CO ₂ [containing 10 μg/mL bFGF (JRH, Biosciences, San Jose, CA), 10% FBS, and 1%). Penicillin-streptomycin]. Cells were processed by RA (10 μM) for various time intervals (depending on the experiment).

RNA isolation and RT-PCR : Huh-7 cells (3 x 10 ⁵ ) were seeded into a 6-well dish and incubated for 24 hours. Cells cultured overnight in serum-free medium were treated with BBP (1 μM) for various time intervals. After BBP stimulation, the cells were washed twice with PBS. Total RNAs were extracted by the TRIzol method (Invitrogen). RNA (2 μg) was used to synthesize cDNA by the reverse transcription system (Promega). These c-DNAs are amplified by specific primers. The primer pair was designed as follows: AhR, forward 5'-TACTCTGCCGCCCAAACTGG-3', reverse 5'-GCTCTGCAACCTCCGATTCC-3'; β -actin, forward 5'-CTCGCTGTCCACCTTCCA-3', reverse 5'-GCTGTCACCTTCACCGTTC -3'. The PCR conditions were set at 95 ° C for 5 minutes and 95 ° C for 30 seconds, 54 ° C for 30 seconds, 72 ° C for 1 minute, and then 72 ° C for 10 minutes (36 cycles). The product was isolated by 2% agarose gel and developed by ethidium bromide.

Western blot analysis: Huh-7 cells (1 x 10 ⁶ ) were inoculated into 10 cm dishes and incubated overnight. The medium was switched to serum-free medium for another night. Cells were treated with BBP (1 μM) for various time intervals. For additional studies, cells were pretreated with chemicals PD98059 (20 μM) or 2-APB (30 μM) for 1 hour followed by BBP. The cells were then washed twice with ice-cold PBS and dissolved by RIPA lysis buffer (Minipore). Protein concentration was measured by the BCA Protein Assay Kit (Thermo). An equal amount of protein (30 [mu]g protein) was resolved by 8% SDS-PAGE, transferred to a PVDF membrane and blocked with 5% skim milk powder for 1 hour at room temperature. After blocking, the membrane was incubated with primary antibodies at 4 °C [including AhR (1:1000), Cox-2 (1:1000), G α _q/11 (1:100), G β (1 :100), β -actin (1:5000), p44/42 MAP kinase (1:1000) or phospho-p44/42 MAP kinase (1:1000)] overnight. Cells were washed 3 times with PBST and then incubated at room temperature with HRP-conjugated secondary antibodies for 1 hour. After washing, the dots were developed using an enhanced chemiluminescence kit (ECL) (Amersham).

ChIP : Cells were serum-deprived overnight and treated with RA (10 μM) for 4 hours by using a ChIP kit (Upstate Biotechnology, Lake Placid, NY). For analysis, in short, the lysate is sonicated on ice and sputum is used to shear the DNA. The cross-linked chromatin was incubated with protein G agarose plus anti-RNA polymerase II (positive control) or normal mouse IgG (negative control) or the indicated primary antibody. After sequential treatment with 5 M NaCl, RNase A, EDTA, Tris, and proteinase K, the DNA mixture was obtained by a spin filter and subjected to polymerase chain reaction (PCR).

Immunoprecipitation : Huh-7 cells were serum deprived overnight and treated with BBP (1 μM) for 30 minutes. In the pre - Following protein G- Sepharose to remove (Minipore) over 30 minutes, antibodies specific G α _{q / 11} or rabbit IgG was added to the culture, and again incubated overnight. After incubation with protein G-agarose for 2 hours, the beads were washed 3 times with RIPA lysis buffer, boiled in sample buffer, resolved by 8% SDS-PAGE and subjected to AhR immunoblot analysis.

Cells were deprived of serum overnight and treated with RA (10 μM) for 4 hours. The cells were lysed by RIPA lysis buffer (Millipore). Lysate and protein A or protein G agarose The mixture of (Minipore) was incubated at 4 ° C for 2 hours in a shaking manner. A specific primary antibody or rabbit IgG (control group) was added and incubated overnight. The immune protein complex is then captured on beads with protein A or protein G. The antibody-bound protein was precipitated by shaking overnight. The immunoprecipitated protein was washed with RIPA lysis buffer, followed by SDS-PAGE analysis and another specific antibody for immunoblotting to measure interaction.

Immunofluorescence : For immunocytochemistry, cells were fixed in 4% paraformaldehyde (in PBS) and then permeabilized with 2% FBS/0.4% Triton X-100 (in PBS). Permeabilization) (15 minutes). The solution was incubated with 5% FBS (2 hours) and rinsed 3 times, and the cells were incubated at 4 °C with a specific primary antibody (in PBS) overnight. A suitable FITC or PE or Texas Red conjugated secondary antibody was added for 1 hour, followed by DAPI staining (5 minutes) for the nucleus and microscopy.

Total Internal Reflection Fluorescence (TIRF) Microscopy : Huh-7 cells were pre-transfected with pGFP-C1-AhR (H.Li) by using LT1 transfection reagent (Mirus Bio LLC, Madison, WI) A gift) lasted 24 hours. For TIRF microscopy, cells were cultured in serum-free medium on coverslips, followed by stimulation with BBP (1 μM, Sigma). The dynamic activity of the GFP-tagged AhR at the cell membrane was observed and analyzed by using a Zeiss TIRF microscope with Axio Vision Rel. 4.8 software.

Immediate live cell imaging microscopy : Cells were pre-treated at 37 °C prior to treatment with BBP (1 μM) to fit Fluo-4 (1 μM) in a BSS buffer [a Ca ²⁺ -specific dye] It lasted 20 minutes. Relative intracellular calcium intensity measurements were performed by real-time cell imaging microscopy and analyzed by the Cell-R software system (Olympus). Calcium-free medium or an IP3R inhibitor 2-APB used at various concentrations was used to test for intracellular calcium responses in cell culture.

Confocal immunofluorescence microscopy : Cells transfected with or without AhR siRNA were each cultured and treated with BBP (1 μM) for 5 and 15 minutes. After treatment with primary and secondary antibodies against AhR and G[ alpha] _q/11 , the cells were subjected to confocal immunofluorescence microscopy to analyze dynamic movement in the cell compartment.

Double immunogold electron microscopy : ultrathin sections of plastic-embedded cells obtained by microwave immobilization and processing were pretreated with 5% sodium metaperiodate (10 minutes). The grid was incubated with an aliquot of anti-AhR or G α _q/11 (C-19, sc-392, Santa Cruz) IgG antibodies, followed by a secondary anti-mouse IgG gold particle (in one Detection was performed for 6 nm size or anti-rabbit IgG gold particles (in a size of 20 nm). After washing, the sections were blocked (15 minutes) by placing the grid on 1 drop of PBS with 1% ovalbumin. The sections were then stained with uranyl acetate and lead citrate and observed by a transmission electron microscope (Hitachi H-700 model, Japan).

All publications, patents, and patent applications referred to in this specification are hereby incorporated by reference to the same extents Ming is to be incorporated as a reference.

references

[1] Olanow, C. W. The scientific basis for the current treatment of Parkinson’s disease. An. Rev. Med. 55, 41-60 (2004).

[2] Freed, CR et al. Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N. Engl. J. Med. 344, 710-719 (2001).

[3] Lindvall, O. & Kokaia, Z. Stem cells for the treatment of neurological disorders. Nature 441, 1094-1096 (2006).

[4] Kim, JH et al. Dopamine neurons derived from embryonic stem cells function in an animal model of Parkinson's disease. Nature 418, 50-56 (2002).

[5] Bjorklund, LM et al. Embryonic stem cells develop into functional dopaminergic neurons after transplantation in a Parkinson rat model. Proc. Natl. Acad. Sci. USA 99, 2344-2349 (2002).

[6] Reubinoff, BE, Itsykson, P., Turetsky T, Pera MF, Reinhartz E, Itzik, A. & Ben-Hur, T. Neural progenitors from human embryonic stem cells. Nat Biotechnol. 19, 1134-1140 (2001) ).

[7] Roy, N. S., Cleren, C., Singh, S. K., Yang, L., Beal, M. F. & Goldman, S. A. Functional engraftment of human ES cell-derived dopaminergic neurons enriched by co culture with telomerase-immortalized midbrain astrocytes. Nat. Med. 12, 1259-1268 (2006).

[8] Dunnett, S. B., Björklund A. & Lindvall, O. Cell therapy in Parkinson's disease: stop or go? Nat. Rev. Neurosci. 2, 365-369 (2001).

[9] Parolini, O. et al. Concise review: Isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells. Stem Cells 26, 300-311 (2008).

[10] Ilancheran. S. & Moodley, Y. & Manuelpillai, U. Human fetal membranes: a source of stem cells for tissue regeneration and repair? Placenta 30, 2-10 (2009).

[11] Surani, M. A., Hayashi, K. & Hajkova, P. Genetic and epigenetic regulators of pluripotency. Cell 128, 747-762 (2007).

[12] Yamanaka, Y., Ralston, A., Stephenson, R. O., & Rossant, J. Cell and molecular regulation of the mouse blastocyst. Dev. Dyn. 235, 2301-2314 (2006).

[13] Chen, H. F., Chao, K. H., Shew, J. Y., Yang, Y. S. & Ho, H. N. Expression of leukemia inhibitory factor and its receptor is not altered in the decidua and chorionic Villi of human anembryonic pregnancy. Hum. Reprod. 19, 1647-1654 (2004).

[14] Wånggren, K., Lalitkumar, PG, Hambiliki, F., Ståbi, B., Gemzell-Danielsson, K. & Stavreus-Evers, A. Leukaemia inhibitory factor receptor and gp130 in the human fallopian tube and endometrium before and After mifepristone treatment and in the human preimplantation embryo. Mol. Hum. Reprod. 13, 391-397 (2007).

[15] Keltz, M., Attar, E., Buradagunta, S., Olive, D., Kliman, H. & Arici, A. Modulation of leukemia inhibitory factor gene expression and protein biosynthesis in the human fallopian tube. Am. J. Obs. Gyn. 175, 1611-1619 (1996).

[16] Smith, AG, Heath, JK, Donaldson, DD, Wong, GG, Moreau, J., Stahl, M. & Rogers, D. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688-690 (1998).

[17] Williams, RL, Hilton, DJ, Pease, S., Willson, TA, Stewart, CL, Gearing, DP, Wagner, EF, Metcalf, D., Nicola, NA & Gough, NM Myeloid leukemia inhibitory factor maintains the Developmental potential of embryonic stem cells. Nature 336, 684-687 (1988).

[18] Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. & Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem Cells. Cell 113, 643-655 (2003).

[19] Boiani, L. A. & Scholer, H. R. Regulatory networks in embryo-derived pluripotent stem cell. Nat. Rev. Mol. Cell Biol. 6, 872-884 (2005).

[20] Adjaye, J. et al. Primary differentiation in the human blastocyst: comparative molecular portraits of inner cell mass and trophectoderm cells. Stem Cells 23, 1514-1525 (2005).

[21] He, S., Pant, D., Schiffmacher, A., Meece, A. & Keefer, CL Lymphoid enhancer factor 1-mediated Wnt signaling promotes the initiation of trophoblast lineage differentiation in mouse embryonic stem cells. Stem Cells 26 , 842-849 (2008).

[22] Maden, M. Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat. Rev. Neurosci. 8, 755-765 (2007).

[23] Wichterle, H., Lieberam, I., Porter, J. A. & Jessell, T. M. Directed differentiation of embryonic stem cells into motor neurons. Cell. 110, 385-397 (2002).

[24] Li, X. J., Du, Z. W., Zarnowska, E. D., Pankratz, M., Hansen, L. O., Pearce, R. A. & Zhang, S. C. Specification of motorneurons from human embryonic stem cells. Nat. Biotechnol. 23, 215-221 (2005).

[25] Zhang, X., Klueber, KM, Guo, Z., Cai, J., Lu, C., Winstead, WI, Qiu, M. & Roisen, FJ Induction of neuronal differentiation of adult human olfactory neuroepithelial-derived Progenitors. Brain Res. 1073-1074, 109-119 (2006).

[26] Jacobs, S., Lie, DC, DeCicco, KL, Shi, Y., DeLuca, LM, Gage, FH & Evans, RM Retinoic acid is required early during adult neurogenesis in the dentate gyrus. Proc. Natl. Sci. USA. 103, 3902-3907 (2006).

[27] Tsai, Y.-L., Tseng, S.-F., Chang, S.-H., Lin, C.-C. & Teng, S.-C. Involvement of replicative polymerases, Tel1p, Mec1p , Cdc13p, and the Ku complex in telomere-telomere recombination. Mol. Cell. Biol. 22, 5679-5687 (2002).

[28] Niwa, H., Toyooka, Y., Shimosato, D., Strumpf, D., Takahashi, K., Yagi, R. & Rossant, J. Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123 , 917-929 (2005).

[29] Cavaleri, F. & Scholer, H. R. (2003). Nanog: a new recruit to the embryonic stem cell orchestra. Cell 113, 551-552 (2003).

[30] Martín-Ibá Ez, R, Urbán, N., Sergent-Tanguy, S., Pineda, JR, Garrido-Clua, N., Alberch, J. & Canals, JM Interplay of leukemia inhibitory factor and retinoic acid on neural differentiation of mouse embryonic stem Cells. J. Neuron. Res. 85, 2686-2710 (2007).

[31] Bain, G., Kitchens, D., Yao, M., Huettner, J. E. & Gottlieb, D. I. Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168, 342-357 (1995).

[32] Tropepe, V., Hitoshi, S., Sirard, C., Mak, TW, Rossant, J. & van der Kooy, D. Direct neural fate specification from embryonic stem cells: a primitive mammalian neural stem cell stage acquired Through a default mechanism. Neuron 30, 65-78 (2001).

[33] Smith, C. R., Chan, H. S. & deSa, D. J. Placental involvement in congenital neuroblastoma. J. Clin. Pathol. 34, 785-789 (1981).

[34] Panicker, MM & Rao, M. Stem cells and neurogenesis. in Stem Cell Biology (eds Msrshak, DR, Gardner, RL & Gottlieb, D.) 399-438 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001).

[35] Yan, J., Tanaka, S., Oda, M., Makino, T., Ohgane, J. & Shiota, K. Retinoic acid promotes differentiation of Trophoblast stem cells to a giant cell fate. Dev. Biol. 235, 422-432 (2001).

[36] Chen, L. & Khillan, J. S. Promotion of feeder-independent self-renewal of embryonic stem cells by retinol (vitamin A). Stem Cells 26, 1858-1864 (2008).

[37] Li, L. et al. Human Embryonic Stem Cells Possess Immune-Privileged Properties. Stem Cells 22, 448-456 (2004).

[38] Swijnenburg, R. J. et al. Immunosuppresive therapy ss. immunological rejection of human embryonic stem cell xenografts. Proc. Natl. Acad. Sci. USA. 105, 12991-12996 (2008).

[39] Bavaresco, L., Bernardi, A., Braganhol, E., Cappellari, AR, Rockenbach, L., Farias, PF, Wink, MR, Delgado-Ca Edo, A. & Battastini, AM The role of ecto-5'-nucleotidase/CD73 in glioma cell line proliferation. Mol. Cell Biochem. 319, 61-68 (2008).

[40] Napoli, I. & Neumann, H. Microglial clearance function in health and disease. Neuroscience 158, 1030-1038 (2009).

[41] Song, H., Stevens, C.F. & Gage, F.H. Astroglia induce neurogenesis from adult neural stem cells. Nature 417, 39-44 (2002).

[42] Annerén, C., Cowan, C. A & Melton, D. A. The Src family of tyrosine kinases is important for embryonic stem cell self-renewal. J. Biol. Chem. 279, 590-598 (2004).

[43] Torres, J. & Watt, F. M. Nanog maintains pluripotency of mouse embryonic stem cells by inhibiting NFkappaB and cooperating with Stat3. Nat. Cell Biol. 10, 194-201 (2008).

[44] Myers, R., L., Ray, SK, Eldridge, R., Chotani, MA, Chiu, IM. Functional characterization of the brain-specific FGF-1 promoter, FGF-1B. J. Biol. Chem. 270, 8257-8266 (1995).

[45] Wu, R. M., Murphy, D. L. & Chiueh, C. C. Suppression of hydroxyl radical formation and protection of nigral neurons by l-deprenyl (Selegiline). Ann. N. Y. Acad. Sci. 786, 379-389 (1996).

[46] Götz, M. Glial cells generate neurons--master control within CNS regions: developmental perspectives on neural stem cells. Neuroscientist 9, 379-97 (2003).

[47] Singh, SK, Hawkins, C., Clarke, ID, Squire, JA, Bayani, J., Hide, T., Henkelman, RM, Cusimano, MD & Dirks, PB Identification of human brain tumour initiating cells. Nature 432, 396-401 (2004).

[48] Zhu, Q. F., Ma, J., Yu, L. I. & Yuan, C. G. Grafted Neural stem cells migrate to substantia nigra and improve behavior in Parkinsonian rats. Neurosci. Lett. 462, 213-218 (2009).

[49] Lindvall O, Kokaia Z. & Martinez-Serrano A. Stem cell therapy for human neurodegenerative disorders-how to make it work. Nat. Med. 10 (Suppl), S42-50 (2004).

[50] Wagner, J. et al. Induction of a midbrain dopaminergic phenotype in Nurr1-overexpressing neural stem cells by type 1 astrocytes. Nat. Biotechnol. 17, 653-659 (1999).

While certain specific examples have been shown and described herein, it will be apparent to those skilled in the art that the specific embodiments are provided as an example. Many variations, modifications, and substitutions will be apparent to those skilled in the art without departing from the invention. It will be appreciated that various alternatives to the specific examples of the invention described herein may be employed in the practice of the invention. It is intended that the scope of the present invention be defined by the scope of the invention and the scope of the invention and the equivalents thereof

Claims (44)

A method for inducing or promoting differentiation of a stem cell into a cell having neuronal properties, comprising: a. contacting the stem cell with an inducing drug, wherein the inducing drug comprises: retinoic acid, nicotinamide or beta - 巯 ethanol, vitamin B12, heparin, putrescine, biotin or Fe ²⁺ , butyl hydroxy methoxy benzene, valproic acid, forskolin, 5-aza nucleoside, indomethacin, isobutyl Alkaloid or insulin; b. positively regulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins comprise: Wnt2B, Fzd6, Dvl3, FRAT1, HDAC6, β -catenin, G α _q/11 , G β , RXR α , RAR β , GLuR1 , PI3K, AKt1, AKt2, AKt3, mTOR, CREB1, TH (tyrosine hydroxylase), PLC- β , CaMKII, calcium dephosphatase, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300; c. negatively regulating GSK3 β or PIP ₂ with the inducing drug in the stem cell; and d. inducing or promoting the differentiation of the stem cell into a neuron characteristic cell. The method of claim 1, wherein the stem cells are selected from the group consisting of a mammalian trophoblast stem cell, a mammalian embryonic stem cell, and a mammalian induced pluripotent stem cell. The method of claim 1, wherein the stem cell is an endoderm, mesoderm, ectoderm or mesenchymal stem cell. The method of claim 1, wherein the stem cell is derived from a mouse, rat, human, chimpanzee, gorilla, dog, pig, goat, dolphin or cow. The method of claim 1, wherein the stem cell is a human trophoblast stem cell. The method of claim 1, wherein the cell having neuronal properties has a phenotype similar to: a neural stem cell (NSC), a dopamine producing cell, a dopamine neuron, a monopolar neuron, a bipolar neuron, Multipolar neurons, glutamate neurons, serum-based neurons, GABAergic ( gamma -aminobutyric acid) neurons, pyramidal cells, puffer cells, anterior horn cells, basket cells, Bayesian cells , Rayleigh cells, granulosa cells, GRP cells, NRP cells, MNS cells, AST cells or TGC cells, or medium spur cells. The method of any one of claims 1 to 6, wherein the positive regulation comprises: increasing the activity of at least one of the one or more proteins. The method of any one of clauses 1 to 6, wherein the positive regulation comprises: increasing the performance of at least one of the one or more proteins. The method of claim 8, wherein the increasing performance comprises: increasing the amount of mRNA encoding at least one of the one or more proteins, or increasing the amount of translation of at least one of the one or more proteins from an mRNA. . The method of any one of claims 1 to 6, wherein the negative regulation comprises: reducing the activity of GSK3 β or PIP ₂ . The method of any one of claims 1 to 6, wherein the negative adjustment comprises: reducing the performance of GSK3 β or PIP ₂ . The method of claim 11, wherein the reducing the expression comprises: reducing the amount of mRNA encoding GSK3 β or PIP ₂ , or decreasing the amount of GSK3 β or PIP ₂ translated from an mRNA. The method of any one of claims 1 to 6, wherein the neuron characteristic comprises: a dopamine, a subunit of a glutamate NMDA receptor, a synapsin I, a calcium channel label, a GAP-43, a voltage - Dependence on the performance of K ⁺ channels, a voltage-dependent Ca ²⁺ channel or a voltage-dependent Na ⁺ channel. The method of any one of claims 1 to 6, wherein the one or more proteins are Wnt2B. The method of claim 14, wherein the Wnt2B promotes differentiation or proliferation of the stem cells. The method of claim 14, wherein the Wnt2B promotes or induces dopamine manifestation. The method of any one of claims 1 to 6, wherein the GSK3 β promotes differentiation or proliferation of the stem cells. The method of any one of claims 1 to 6, wherein the one or more proteins are CREB1. The method of claim 18, wherein the CREB1 promotes differentiation or proliferation of the stem cells. The method of claim 18, wherein the CREB1 promotes or induces dopamine performance. The method of any one of claims 1 to 6, wherein the one or more proteins The quality is CaMKII. The method of claim 21, wherein the CaMKII promotes differentiation or proliferation of the stem cells. A method for inducing or promoting differentiation of a stem cell into a cell having reduced immunogenicity, comprising: a. contacting the stem cell with an inducing drug, wherein the inducing drug comprises: retinoic acid, nicotine Amine or β-巯 ethanol, vitamin B12, heparin, putrescine, biotin or Fe ²⁺ , butyl hydroxymethoxybenzene, valproic acid, forskolin, 5-aza nucleoside, 吲哚美辛辛Or isobutylmethylxanthine or insulin; b. positively regulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins comprise: Wnt2B, Fzd6, Dvl3, FRAT1, HDAC6, β -linkage , G α _q/11 , G β , RXR α , RAR β , GLuR1, PI3K, AKt1, AKt2, AKt3, mTOR, CREB1, TH (tyrosine hydroxylase), PLC- β , CaMKII, calcium Phosphatase, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300; c. negatively regulating GSK3 β or PIP ₂ with the inducing drug in the stem cell; and d. inducing or promoting the differentiation of the stem cell into a Reduced immunogenic cells. The method of claim 23, wherein the stem cells are selected from the group consisting of a mammalian trophoblast stem cell, a mammalian embryonic stem cell, and a mammalian induced pluripotent stem cell. The method of claim 23, wherein the stem cell is an endoderm, mesoderm, ectoderm or mesenchymal stem cell. The method of claim 23, wherein the cell having reduced immunogenicity has a phenotype similar to: a neural stem cell (NSC), a dopamine producing cell, a dopamine neuron, a monopolar neuron, a bipolar Neurons, multipolar neurons, glutaminic neurons, serum-based neurons, GABAergic ( gamma -aminobutyric acid) neurons, pyramidal cells, puffer cells, anterior horn cells, basket cells, Bayesian cells, Rayleigh cells, granulosa cells, GRP cells, NRP cells, MNS cells, AST cells or TGC cells, or medium spur cells. The method of claim 23, wherein the stem cells are from a mouse, rat, human, chimpanzee, gorilla, dog, pig, goat, dolphin or cow. The method of claim 23, wherein the stem cell is a human trophoblast stem cell. The method of any one of claims 23 to 28, wherein the cell having reduced immunogenicity does not induce an immune response or can inhibit an immune response. The method of any one of claims 23 to 28, wherein the cell having reduced immunogenicity does not induce an immune response, or may comprise a T cell, a B cell, a macrophage, a microglia Mast cells or NK cells inhibit an immune response. The method of any one of clauses 23 to 28, wherein the positive regulation comprises: increasing the activity of at least one of the one or more proteins. The method of any one of clauses 23 to 28, wherein the positive regulation comprises: increasing the performance of at least one of the one or more proteins. The method of claim 32, wherein the increasing performance comprises: increasing the amount of mRNA encoding at least one of the one or more proteins, or increasing the amount of translation of at least one of the one or more proteins from an mRNA. . The method of any one of clauses 23 to 28, wherein the negative regulation comprises: reducing the activity of GSK3 β or PIP ₂ . The method of any one of clauses 23 to 28, wherein the negative adjustment comprises: reducing the performance of GSK3 β or PIP ₂ . The method of claim 35, wherein the reducing the expression comprises: reducing the amount of mRNA encoding GSK3 β or PIP ₂ , or reducing the amount of GSK3 β or PIP ₂ translated from an mRNA. The method of any one of claims 23 to 28, wherein the method further comprises: inducing or promoting differentiation of the stem cell into a cell having neuronal properties, wherein the neuronal characteristic comprises: dopamine, glutamate NMDA Receptor subunit, synapsin I, a calcium channel label, GAP-43, voltage-dependent K ⁺ channel, a voltage-dependent Ca ²⁺ channel, or a voltage-dependent Na ⁺ channel. The method of any one of clauses 23 to 28, wherein the one or more proteins are NFAT1. The method of claim 38, wherein the NFAT1 promotes differentiation or proliferation of the stem cells. A method for inducing or promoting differentiation of a human trophoblast stem cell into a tNSC (trophoblastic neural stem cell), comprising: a. contacting the human trophoblast stem cell with an inducing drug, wherein the inducing drug comprises: retinoic acid , Nicotinamide or β-巯 ethanol, vitamin B12, heparin, putrescine, biotin or Fe ²⁺ , butyl hydroxymethoxybenzene, valproic acid, forskolin, 5-aza nucleoside, guanidine Comparing with saponin, isobutylmethylxanthine or insulin; b. positively regulating one or more proteins with the inducing drug in the stem cells, wherein the one or more proteins comprise: Wnt2B, Fzd6, Dvl3, FRAT1, HDAC6 , β -catenin, G α _q/11 , G β , RXR α , RAR β , GLuR1, PI3K, AKt1, AKt2, AKt3, mTOR, CREB1, TH (tyrosine hydroxylase), PLC- β , CaMKII Calcium phosphatase, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300; c. negatively regulating GSK3 β or PIP ₂ with the inducing drug in the stem cell; and d. inducing or promoting the human nourishment The stem cells differentiate into a tNSC. The method of claim 40, wherein the tNSC has reduced immunogenicity. The method of claim 40, wherein the tNSC does not induce an immune response or inhibits an immune response caused by an immune cell. The method of claim 42, wherein the immune cell is a T cell, a B cell, a macrophage, a microglial cell, a mast cell, or an NK cell. An induction or promotion of differentiation of a human trophoblast stem cell into a neural stem cell (NSC), dopamine-producing cell, dopamine neuron, monopolar neuron, bipolar neuron, multipolar neuron, glutamate Neurons, serum-based neurons, GABAergic ( gamma -aminobutyric acid) neurons, pyramidal cells, primordial cells, and anterior horn cells, basket cells, Bayesian cells, Raytheon cells, granulosa cells, GRP A method of phenotypic cells of a cell, NRP cell, MNS cell, AST cell or TGC cell, or medium spur cell, comprising: a. contacting the human trophoblast stem cell with an inducing drug, wherein the inducing drug comprises There are: retinoic acid, nicotinamide or β-巯 ethanol, vitamin B12, heparin, putrescine, biotin or Fe ²⁺ , butyl hydroxy methoxybenzene, valproic acid, forskolin, 5-nitrogen a nucleoside, indomethacin, isobutylmethylxanthine or insulin; b. positively regulating one or more proteins with the inducing drug in the stem cell, wherein the one or more proteins comprise: Wnt2B, Fzd6, Dvl3, FRAT1, HDA C6, β -catenin, G α _q/11 , G β , RXR α , RAR β , GLuR1, PI3K, AKt1, AKt2, AKt3, mTOR, CREB1, TH (tyrosine hydroxylase), PLC- β , CaMKII, calcine dephosphatase, NFAT1, endogenous protein, LEF1, Pitx2, MEF2A or EP300; c. negatively regulating GSK3 β or PIP ₂ with the inducing drug in the stem cell; and d. inducing or promoting the human Trophoblast stem cells differentiate into a neural stem cell (NSC), dopamine-producing cells, dopamine neurons, monopolar neurons, bipolar neurons, multipolar neurons, pyramidal cells, puffer cells, anterior horn cells, basket Cells, Bayesian cells, Raytheon cells, granulosa cells, GRP cells, NRP cells, MNS cells, AST cells or TGC cells, or medium spur cells.