TW201412980A - An isolated yeast strain having high xylose consumption rate and process for production of ethanol using the strain - Google Patents

Abstract

The invention utilizes cloning and transformation techniques in combination with mutation and strain taming techniques to obtain yeasts having high xylose consumption rate and ethanol yield. The cloning and transformation used in the invention are to transform xylose metabolism genes to yeasts to solve the problem that some yeast strains cannot utilize xylose to produce ethanol. The mutation and strain taming used in the invention are to increase xylose consumption rate and ethanol yield to solve the problem of low rate and yield. By combining the above-mentioned technical means, the invention unexpectedly obtain a mutant having high xylose consumption rate and ethanol yield.

Description

Isolated yeast strain with high xylose consumption rate and method for producing alcohol using the same

The present invention relates to an isolated yeast strain having a high xylose consumption rate and a fermentation process for producing ethanol. In particular, the present invention provides a strain of Saccharomyces having a high xylose consumption rate.

The large-scale consumption of traditional fossil fuels (oil-based fuels) has paid a high price and caused a lot of pollution in the past few decades. Moreover, it has been recognized that the world's oil reserves are not endless, and as environmental awareness grows, it has stimulated the feasibility of alternative fuels, such as fiber ethanol, which can reduce CO ₂ production.

Current methods for producing ethanol include the following stages of operation: (a) fermenting the appropriate starting materials to obtain the fermentation product and (b) distilling the product obtained by fermentation, thereby producing ethanol. At present, yeast Saccharomyces cerevisiae belonging to the genus Saccharomyces is mainly used as an inoculum for ethanol fermentation. Saccharomyces cerevisiae cells are round to oval, 5-10 microns in diameter and can effectively utilize hexoses, including glucose, mannose, galactose and the like. The fermentation method mentioned above includes inoculating Saccharomyces cerevisiae in a medium containing a nitrogen source, a carbon source, and a trace element, and performing fermentation under appropriate conditions, and it involves a chemical reaction: C ₆ H ₁₂ O ₆ → 2 CH ₃ CH ₂ OH+2 CO ₂ .

Alcohol production can be carried out using a variety of raw materials. A wide variety of raw materials for the production of ethanol via fermentation can be conveniently classified into three types of agricultural raw materials: sugar, starch and lignocellulosic materials. Although raw ethanol can be produced by fermentation of sugar or starch obtained from many different sources, For the industrial scale production of fuel alcohol, the sugar system and corn starch. The use of sugar or starch to produce ethanol has matured; however, such substrates are costly and may compete with food supplies and produce ethanol from such sources to meet future demand for the fuel industry. Therefore, the industry is increasingly interested in the production of ethanol from lignocellulose. Since lignocellulose is renewable, resource-rich, does not compete with food supplies and can be obtained at relatively low cost, lignocellulose is a desirable alternative to other ethanol feedstocks such as corn kernels. Expanding fuel ethanol production requires the use of lower cost raw materials. Currently, only lignocellulosic feedstocks can be obtained from plant biomass in sufficient quantities to replace crops used to produce ethanol. The main fermentable sugars in lignocellulosic materials are glucose and xylose, which account for about 40% and 25% of lignocellulose, respectively.

However, most yeasts that can be subjected to alcoholic fermentation (such as Saccharomyces cerevisiae) cannot use xylose as a carbon source. In order to be able to produce ethanol from lignocellulosic hydrolysates, the industry requires organisms having such properties. Scientists use genetic techniques or strain domestication to improve the xylose fermentation of yeast or bacteria used to produce ethanol. US 5,789,210 provides yeast strains which are effective in fermenting xylose alone or simultaneously fermenting xylose and glucose, which can be produced using recombinant DNA and gene selection techniques, and which have been used to produce a reduction containing xylose Recombinant yeasts of the enzyme (XR), xylitol dehydrogenase (XD) and xylulose kinase (XK) genes, which are fused to a promoter that is not inhibited by the presence of glucose. US 6,582,944 is a novel recombinant yeast strain transformed with a xylose reductase and/or xylitol dehydrogenase gene which is capable of reducing xylose to xylitol and thus producing xylitol in vivo. Bjorn et al. provide the yeast strain TMB 3001, which solves the problem of not being able to metabolize xylose to produce ethanol by transforming with xylose reductase and/or xylitol dehydrogenase genes ( Biorn J , Barbel HH. The non-oxidative Pentose phosphate pathway controls the fermentation rate of xylose but not of xylose in TMB 3001, 2002, FEMS Yeast Research 2: 227-282 ). However, it still has problems such as low xylose consumption rate (0.13 g (g) xylose/gram biomass/hour) and low ethanol yield (0.15 g product/gram of xylose consumed). To address these issues, Johansson et al. additionally transformed the transaldolase gene into S. cerevisiae to obtain a new strain, TMB 3026, which increased the xylose consumption rate from 0.12 to 0.23. ( Biorn J, Barbel HH. The non-oxidative pentose phosphate pathway controls the fermentation rate of xylose but not of xylose in TMB 3001, 2002, FEMS Yeast Research 2: 227-282 ); however, the requirements for industrial production are still not met. . Kaisa et al. additionally produced transformed yeast TMB 3057, which modified the gene expression of xylose reductase and/or xylitol dehydrogenase and the deleted aldose reductase gene (GR3), thereby increasing ethanol yield and reducing xylose Formation of alcohol by-products ( Kaisa K, Romain F, Barbel HH, Marie GG. High activity of xylose reductase and xylitol dehydrogenase improves xylose fermentation by recombinant Saccharomyces cerevisiae, 2007, Appl . Microbiol . Biotechnol. 73: 1039-1046 ). However, this strain still had problems with low xylose consumption rate (0.25 g xylose/gram biomass/hour) and low ethanol yield (0.27 g product/gram xylose consumed). In addition, Elizebath et al. used the genetically modified yeast 424A (LNH-ST), which has the xylose reductase gene of N. crassa and C. parapsilosis and the trunk of the tree. The xylitol dehydrogenase gene of yeast ( P. stipitis ) is transformed and has optimized codons for three amino acids ( Eliabeth C, Miroslav S., Nancy W YH, Nathan SM, Effect of acetic acid and pH on the cofermentation). Of glucose and xylose to ethanol by a genetically engineered strain of Saccharomyces cerevisiae, 2010, FEMS Yeast Res . 10 :385-393 ). This strain also utilizes the GAPDH promoter to control the pentose phosphate pathways of TKL 1, TAL 1, RKL 1 and RPE 1. However, it still has the following problems: low xylose consumption rate (0.27 g xylose/gram biomass/hour at pH 5) and low ethanol yield (0.785 g product/g xylose consumed) and tolerance to acetic acid Low (the xylose consumption rate decreased from 0.354 to 0.15 when the medium contained 1 g/L (g/L) acetic acid).

Therefore, there is a great need in the industry for strains with improved conversion of biomass (e.g., xylose) to ethanol and methods for producing ethanol in higher yields.

The present invention provides an isolated yeast strain having a xylose consumption rate higher than 1.1 grams of xylose per gram of biomass per hour and comprising one or more Saccharomyces cerevisiae strains FENC-000 from DSMZ accession number 25508 (registered on November 8, 2011) In the Food Industry Development Institute, the xylose metabolism gene numbered BCRC 920077) was deposited.

The invention further provides a method of producing ethanol comprising the steps of: (a) fermenting a medium containing xylose or glucose source using the isolated yeast strain of the invention under suitable fermentation conditions; and (b) recovering ethanol from the medium.

The present invention utilizes selection and transformation techniques as well as mutation and strain acclimation techniques to obtain yeasts having high xylose consumption rates and ethanol yields. The selection and transformation used in the present invention can convert the xylose metabolism gene into yeast to solve the problem that some yeast strains cannot utilize xylose to produce ethanol. The mutations and strain acclimation used in the present invention can increase the xylose consumption rate and the ethanol yield to solve the problem of low consumption rate and low yield. By combining the technical means mentioned above, the present invention surprisingly obtains mutants having high xylose consumption rates and ethanol yields.

The following terms and methods are explained to better illustrate the invention and to guide those skilled in the art to practice the invention. The word "comprising" as used herein means "including" and the singular forms "a" or "the" are meant to include the plural. Unless the context clearly indicates otherwise, the term "or" refers to the single element or a combination of two or more elements.

Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are set forth below. The materials, methods, and examples are illustrative only and are not intended to be limiting. Other features of the invention will be apparent from the description and appended claims.

The term "yield" as used herein refers to the amount of product produced relative to the amount of starting material.

The term "strain" as used herein refers to a particular species having general characteristics. microorganism. The terms "strain" and "cell" are used interchangeably herein unless indicated to the contrary. As will be appreciated by those skilled in the art, microbial strains are composed of individual yeast cells. In addition, individual microbial cells have specific characteristics that can identify such cells as members of their particular strain.

The term "parent strain" as used herein refers to a microbial strain that is subjected to mutagenesis to produce a microorganism of the present invention. Therefore, the use of the phrase "parent" is not necessarily equivalent to the phrase "wild type" or provides information about the history of the strains mentioned.

The term "mutation" as used herein refers to an insertion, deletion or substitution in a nucleic acid molecule.

The term "mutagenization" as used herein refers to a method by which one or more mutations can be produced in a genetic material (eg, DNA) of an organism. When using "random" mutagenesis, it is impossible to predict the exact site of the mutation, which occurs anywhere in the microbial chromosome.

As used herein, the phrase "mutagering cycle" generally refers to the treatment of cells with a combination of mutagens or mutagens, followed by culturing the cells to allow viable cells to reproduce. In each case, the mutagenized cells will be screened after each mutagenesis cycle to identify cells with specific characteristics. Additionally, as part of the mutagenesis cycle, the mutagen-treated cells can be exposed to a selection agent or selection medium either immediately after mutagenesis or while still being exposed to the mutagen.

As used herein, the term "suitable fermentation conditions" generally refers to fermentation media and conditions that can be adjusted for pH, temperature, aeration, etc., preferably, the optimum conditions are such that the microorganisms produce the desired carbonaceous product. To determine if the culture conditions are The product is allowed to be produced, and the microorganism can be cultured for about 24 hours to one week after inoculation, and the sample can be obtained and analyzed. The presence of the desired product is tested in a sample or medium with cell growth.

In accordance with the above description, the present invention provides an isolated yeast strain having a xylose consumption rate of greater than 1.1 grams of xylose per gram of biomass per hour and comprising one or more xylose derived from the Saccharomyces cerevisiae strain FENC-000 of DSMZ Registry No. 25508 Metabolic genes. In a preferred embodiment, the isolated strain of Saccharomyces cerevisiae FENC-000 of the yeast strain DSMZ accession number 25508 is isolated.

In one embodiment, the yeast strain of the invention exhibits a high xylose consumption rate; preferably greater than 1.1 grams xylose per gram of biomass per hour. More preferably, the xylose consumption rate is higher than 1.5 grams of xylose per gram of biomass per hour.

According to the present invention, the yeast strain of the present invention includes, but is not limited to, a strain of Saccharomyces, a strain of Kluyveromyces , a strain of Pichia and a strain of Candida. More preferably, the yeast strains of the invention include, but are not limited to, Saccharomyces cerevisiae strains, Saccharomyces carlsbergensis strains, Saccharomyces bulderi strains, Saccharomyces barnetti strains, snails Yeast ( Saccharomyces exiguus ) strain, Saccharomyces uvarum strain, Saccharomyces diastaticus strain, Carlsberg strain, Kluyveromyces lactis strain, Kluyveromyces marxianus The strain, the fungus Kluyveromyces fungus strain, the Pichia stipitis strain, the Candida stellata strain, and the Candida shehatae strain. Most preferably, the present invention provides an isolated strain of S. cerevisiae FENC-000 having DSMZ accession number 25508 .

Xylose is a five-carbon aldose (pentose, monosaccharide) that can be catabolized or metabolized by a variety of organisms into useful products. According to the present invention, the xylose metabolism gene includes one or more genes selected from the group consisting of a xylose reductase gene, a xylitol dehydrogenase gene, a xylulokinase gene, and a xylose isomerase.

According to the invention, the yeast strains of the invention are produced based on genetic selection, transformation, mutagenesis, mutagenesis cycles and strain domestication. In one embodiment, the yeast strain of the invention is produced by selecting a xylose metabolic gene and transforming the gene into a parent strain to obtain a transformed strain. A plasmid carrying an antibiotic resistance marker gene (e.g., kan, which encodes kanomycin resistance) can be constructed and used as a vector to deliver a desired xylose metabolism gene into a chromosome. The xylose metabolism gene can be isolated and purified by digestion with a suitable restriction enzyme, and then introduced into a host cell by transformation or electroporation. In one embodiment of the invention, Saccharomyces cerevisiae BCRC 22743 is used in a host for transformation.

Thereafter, the transformed strain is mutated with a mutagen. The invention is not limited to cells exhibiting high xylose consumption rates and ethanol yields. In other words, the invention includes cells characterized by high speed xylose consumption after a specified period of culture growth. In a specific embodiment, the strain of the invention is produced by subjecting yeast cells having a related xylose metabolism gene on the chromosome to one, two, three, four, five under the control of a non-native promoter. One or more cycles of post-mutation screening to identify cells that exhibit high xylose consumption rates.

Numerous methods for mutagenesis are known in the art and can be used to produce bacterial strains of the invention. In general, such methods involve the use of chemical agents or radiation to induce mutations. Examples of chemical compound classes used in mutagenesis procedures include, but are not limited to, ethyl methanesulfonate (EMS), N-methyl-N-nitrosourea N-nitroso-N, N-diethyl Amine (NDEA) and N-ethyl-N'-nitro-N-nitrosoguanidine (ENNG), hydroxylamine, bisulfite and nitrofuran (eg 7-methoxy-2-nitronaphthalene) [2,1-p]furan), which is known in the art to induce mutations in nucleic acid molecules. Those skilled in the art will understand how to adjust the concentration of the mutagen and/or specific conditions to achieve a desired mutation rate.

After the cells have been subjected to mutagenesis, they can be screened to determine if they have particular characteristics as described herein. Examples of such characteristics include high xylose consumption rate and ethanol yield. Strains of the invention can be produced by using multiple cycles of mutagenesis and screening. After each mutagenesis treatment, the mutagenized cells can be screened for increased xylose consumption rate.

In accordance with the above description, the present invention provides a method of producing ethanol comprising the steps of: (a) fermenting a medium containing xylose or glucose source using the isolated yeast strain of the invention under suitable fermentation conditions; and (b) from the medium Recover ethanol.

According to the present invention, the isolated yeast strain of the present invention is used to ferment a carbon source comprising xylose or glucose sources. The xylose or glucose source can be xylose or glucose itself or can be any carbohydrate oligomer or polymer comprising xylose or glucose units, such as lignocellulose, xylan, cellulose, starch, and the like. For the release of xylose or glucose units from such carbohydrates, appropriate carbohydrate enzymes (eg xylanase, dextran) may be employed Enzymes, amylases, and the like) are added to the fermentation medium, or the enzymes can be produced by transformed host cells. In the latter case, the transformed host cells can be genetically engineered to produce and secrete the carbohydrate enzymes. In a preferred method, both the xylose and the glucose are fermented by the transformed host cell. In addition to the source of xylose (and glucose) as a carbon source, the fermentation medium may additionally comprise the appropriate ingredients for growth of the transformed host cell; for example, compositions well known in the art for use in fermentation media for the growth of microorganisms such as yeast.

The fermentation method is a method for producing a fermentation product such as ethanol, lactic acid, acetic acid, succinic acid, acrylic acid, citric acid, 3-hydroxy-propionic acid, amino acid, 1,3-propane-diol, ethylene, Glycerin, β-inactamine antibiotics (such as penicillin G or penicillin V and its fermentation derivatives) and cephalosporins. The fermentation process can be an aerobic or anaerobic fermentation process. An anaerobic fermentation process is defined herein as a fermentation process that operates in the absence of oxygen or that does not substantially consume oxygen (eg, less than 5 mmol/L/h), and wherein the organic molecules are used as electron donors and electron acceptors By. In the absence of oxygen, NADH produced in glycolysis and biomass formation cannot be oxidized by oxidative phosphorylation. To solve this problem, many microorganisms use one of pyruvate or a derivative thereof as an electron and a hydrogen acceptor, thereby regenerating NAD+. Therefore, in a preferred anaerobic fermentation process, pyruvate is used as an electron (and hydrogen acceptor) and reduced to a fermentation product such as ethanol, lactic acid, 1,3-propanediol, ethylene, acetic acid or succinic acid. .

The fermentation process is preferably carried out at a temperature most suitable for the growth of the transformed host cell. Therefore, for most yeasts, the hair is applied at temperatures below 38 °C. Fermentation method. For yeast or filamentous fungal host cells, preferably at temperatures below 37, 36, 35, 34, 33, 32, 31, 30, 29 or 28 ° C, and above 20, 21, 22, 23 The fermentation process is carried out at a temperature of 24 or 25 °C.

According to the present invention, the ethanol volumetric productivity in the process is preferably at least 0.6 grams of ethanol per liter per hour; preferably at least 0.7 grams of ethanol per liter per hour, 0.8 grams of ethanol per liter per hour, and 0.9 grams of ethanol per liter. /hour, 1.0 g ethanol / l / h, 1.1 g ethanol / l / h, 1.5 g ethanol / l / h, 2.0 g ethanol / l / h, 2.5 g ethanol / l / h, 3.0 g ethanol / l / h , 3.5 g ethanol/liter/hour, 4.0 g ethanol/liter/hour, 4.5 g ethanol/liter/hour or 5.0 g ethanol/liter/hour; more preferably about 0.6 g ethanol/liter/hour to about 2.5 g ethanol/ Liters/hour, or about 1.0 gram ethanol/liter/hour to about 3.0 gram ethanol/liter/hour. The ethanol yield based on xylose and/or glucose in the process is preferably at least 50%, 60%, 70%, 80%, 90%, 95 or 98%.

The isolated yeast strain has an unexpected xylose consumption rate and a high ethanol yield, so the yeast strain is advantageous for producing ethanol by a fermentation process.

Instance Example 1 Selection of xylose metabolism gene and construction of recombinant plasmid

Thirty wild-type S. cerevisiae strains from the Food Industry Research and Development Institute (FIRDI) were cultured and selected using SX medium containing 10% ethanol, and one was selected to be highly resistant to high-content ethanol. The strain, Saccharomyces cerevisiae BCRC 22743. Polymerase chain reaction (PCR) is used under the following conditions The following genes were selected:

pGK promoter

Length: 643 bp

Type: DNA

Original strain: Saccharomyces

Gene annotation: pGK promoter

Forward primer: GACTACGCATGCGGCGCGAATCCTTTATTTTGGCTTC (SEQ ID NO: 1)

Reverse primer: TGAATTACTGAACACAACATTGTTTTATATTTGTTGTAAAAAGTAG (SEQ ID NO: 2)

Xylose reductase

Length: 957 bp

Type: DNA

Original strain: Pichia stipitis

Gene annotation: xylose reductase

Forward introduction: AAAACAATGCCTTCTATTAAGTTGAACTCT (SEQ ID NO: 3)

Reverse primer: CAATTCAATTCAATTTAGACGAAGATAGGAATCTTGTC (SEQ ID NO: 4)

Xylitol dehydrogenase

Length: 1,092 bp

Type: DNA

Original strain: Pichia stipitis

Gene annotation: xylitol dehydrogenase

Forward primer: GACTACGCGGCCGCGGCGCGAATCCTTTATTTTGGCTTC (SEQ ID NO: 5)

Reverse primer: AAGGAAGGGTTAGCAGTCATTGTTTTATATTTGTTGTAAAAAGTAG (SEQ ID NO: 6)

Xylulose kinase

Length: 1,803 bp

Type: DNA

Original strain: Saccharomyces

Gene annotation: xylulokinase

Forward primer: AAAACAATGTTGTGTTCAGTAATTCAGAG (SEQ ID NO: 7)

Reverse primer: CAATTCAATTCAATTTAGATGAGAGTCTTTTCCAGTTCG (SEQ ID NO: 8)

5. pGK terminator

Length: 433 bp

Type: DNA

Original strain: Saccharomyces

Gene annotation: pGK terminator

Forward introduction: GACTCTCATCTAAATTGAATTGAATTGAAATCGATAG (SEQ ID NO: 9)

Reverse primer: TAGAGTCCCGGGAGTCTGCTCGAGGAGATGCGGCCGCGACTTTTTTTGTTGCAAGTGGGAT (SEQ ID NO: 10)

The recombination gene was introduced into the pAUR101 plasmid using genetic modification techniques known in the art to construct a recombinant vector ( Li L, Shuqiu C, Anja J VB, Eric BK. Rad51p and Rad54p, but not Rap52p, elevate gene repair in Saccharomyces cerevisiae directed by Modified single-stranded oligonucleotide vectors, 2002, Nucleic Acids Research 30: 2742-2750 ). Saccharomyces cerevisiae BCRC 22743 was treated to form competent cells and transformed with a recombinant vector such that the xylose reductase, xylitol dehydrogenase and xylulose kinase genes could be introduced into the genomic DNA of S. cerevisiae BCRC 22743. The resulting transformants were selected to obtain transformed strains capable of using xylose and producing ethanol.

Example 2 Xylose Metabolism and Ethanol Production of Selected Transformants

According to the procedure described in Example 1, five transformed strains capable of using xylose and producing ethanol were selected from more than 1,000 S. cerevisiae transformants, and named as Saccharomyces cerevisiae RG 352, Saccharomyces cerevisiae RG 758, Saccharomyces cerevisiae RG 316, Saccharomyces cerevisiae RG 527 and S. cerevisiae RG 589. Among the selected strains, S. cerevisiae RG 589 was able to produce the highest ethanol concentration (16 g/L) in 5% SX medium and achieve a xylose consumption rate of 0.21 g xylose/g biomass/hour. However, the results mentioned above are superior to the strain TMB 3001, but with Strains TMB 3026, TMB 3057 and 424A (LNH-ST) were not significantly different. A comparison of xylose consumption rates is shown in Figure 1.

Example 3 Preparation of Saccharomyces Cerevisiae RG 589 Mutant

S. cerevisiae RG 589 cells were treated with ethyl methanesulfonate (EMS) solution for 20 minutes to obtain mutant strains. The resulting solution was centrifuged and the supernatant removed. The residual cell pellet was washed twice with 0.1 M phosphate buffer (pH 6). After appropriate dilution, the cells were seeded in 5% SX medium (4.7 g/L yeast nitrogen source base and 50 g/L xylose) and cultured at 30 ° C and shaking at 200 rpm. If the mutant strain cultured at a concentration of 50 g/L xylose can utilize xylose to maintain, grow, metabolize and produce ethanol, its ability to use xylose is better. After the mutant strain was cultured for three days at a concentration of 50 g/L xylose, the mutant strain was taken out and then subjected to the mutation and culture method mentioned above twenty times. The resulting mutants were plated on SX medium plates for selection of mutants. After two days, the rapidly growing mutant was selected and designated as Saccharomyces cerevisiae FENC-000, which was deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under the accession number 25508 . After culturing the selected mutants in SX 5% medium at 30 ° C and shaking at 200 rpm for 24 hours, the xylose consumption rate reached 1.54 g xylose / g biomass / hour, which was RG 589 and 424 A (LNH- ST) is 5 times to 7.14 times. The results are shown in Figure 2.

Example 4 Ethanol Production and Comparative Yield Using Saccharomyces Cerevisiae FENC-000

The Saccharomyces cerevisiae FENC-000 (i.e., DSMZ 25508) mentioned in Example 3 and the S. cerevisiae RG 589 mentioned in Example 2 were cultured in SX medium mixed with one or two carbon sources at 30 ° C and shaking at 200 rpm. Ethanol yield display In the table below.

Saccharomyces cerevisiae FENC-000 had an ethanol yield of 1.3 times that of S. cerevisiae RG 589 when using 50 g/L xylose. For the use of two sugars as the carbon source, the ethanol yield of S. cerevisiae FENC-000 was about 1.394 times and 2 times that of RG 589 and TMB 3001, respectively.

Figure 1 shows the xylose consumption rates of the different strains mentioned in Example 2.

Figure 2 shows the xylose consumption rate of the S. cerevisiae mutant strain mentioned in Example 3.

<110> Far East New Century Co., Ltd.

<120> Isolated yeast strain having high xylose consumption rate and method for producing ethanol using the same

<130> F00734/US2207

<140> 101135655

<141> 2012/09/27

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 1

<210> 2

<211> 46

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 2

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 3

<210> 4

<211> 38

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 4

<210> 5

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 5

<210> 6

<211> 46

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 6

<210> 7

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 7

<210> 8

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 8

<210> 9

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 9

<210> 10

<211> 61

<212> DNA

<213> Artificial sequence

<220>

<223> Primers

<400> 10

Claims (12)

An isolated strain of Saccharomyces cerevisiae FENC-000 with DSMZ accession number 25508 (registered at the Food Industry Development Institute on November 8, 2011, accession number BCRC 920077). The isolated strain of claim 1, which has a xylose metabolism gene selected from the group consisting of a xylose reductase gene, a xylitol dehydrogenase gene, a xylulokinase gene, and a xylose isomerase. The isolated strain of claim 1, which is obtained by selecting one or more xylose metabolism genes, transforming the gene into a host yeast strain, mutating the obtained strain with a mutagenizing agent, and selecting a xylose consumption rate. A yeast strain above 1.1 grams of xylose per gram of biomass per hour. The isolated strain of claim 1, which produces ethanol and at least one of: lactic acid, acetic acid, succinic acid, acrylic acid, citric acid, 3-hydroxy-propionic acid, amino acid, 1,3-propane- Glycol, ethylene, glycerol, beta-inactine antibiotics and cephalosporins. A method of producing ethanol comprising the steps of: (a) fermenting a medium containing xylose or glucose source using an isolated strain according to claim 1 under suitable fermentation conditions; and (b) recovering the ethanol from the medium. The method of claim 5, wherein the source is a carbohydrate oligomer or polymer comprising xylose or glucose units. The method of claim 5, wherein the carbohydrate oligomer or polymer is lignocellulose, xylan, cellulose or starch. The method of claim 5, which additionally produces at least one of the following: lactic acid, acetic acid, succinic acid, acrylic acid, citric acid, 3-hydroxy-propyl Acid, amino acid, 1,3-propane-diol, ethylene, glycerol, β-indoleamine antibiotics and cephalosporins. The method of claim 5, wherein the ethanol has a productivity of at least 1.0 gram of ethanol per liter per hour. The method of claim 5, wherein the ethanol has a productivity of at least 1.5 grams of ethanol per liter per hour. The method of claim 5, wherein the ethanol has a productivity in the range of from about 0.6 grams of ethanol per liter per hour to about 2.5 grams of ethanol per liter per hour. The method of claim 5, wherein the ethanol yield is at least 70%.