TW201231058A - Pharmaceutical composition for inhibiting growth of virus - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for inhibiting growth of virus, which comprises Angelicae Sinensis Radix, Rehmanniae Radixet Rhizom, Coptidis Rhizoma, Moutan Radicis Cortex and Cimicifuga foetida.

Description

201231058 VI. Description of the Invention: [Technical Field of the Invention] The present invention relates to a pharmaceutical composition for inhibiting virus growth. [Prior Art] Berberine is an isoquine alkaloid extracted from Chinese herbal medicines such as Coptis. In the past decade, many papers have reported the pharmacological properties of berberine and its derivatives and they can be used to treat tumors (Liu Z, Liu Q, Xu B, Wu J, Guo C, Zhu F, Yang Q,

Gao Q Gong Y, Shao C (2009) Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage. Mutation Res 662(1-2); 75-83 ; Muralimanoharan SB,

Kunnumakkara AB, Shylesh B, Kulkami KH, Haiyan X, Ming H, Aggarwal BB, Rita G, Kumar AP (2009) Butanol fraction containing berberine or related compound from nexrutine inhibits NFkappaB signaling and induces apoptosis in prostate cancer cells. Prostate 69(5) ); 494-504), hyperlipidemia (Wagner H, Ulrich-Merzenich G, 2009. Synergy research: approaching a new generation of phytopharmaceuticals. Phytomedicine 16 (2-3); 97-110), inflammation, bacteria (Yu HH, Kim KJ, Cha JD, Kim HK, Lee YE, Choi NY, You YO (2005) Antimicrobial activity of berberine alone and in combination with ampicillin or oxacillin against methicillin-resistant awrew. J Med Food 4; 454-461 ) and Viral infection (Li HL, Han T, Liu RH, Zhang C, Chen HS, Zhang WD (2008) Alkaloids from Corydalis saxicola and their anti-hepatitis B vims activity. Chem Biodiver 5 (5); 777-783). In addition, it is generally accepted that the dose of berberine used in clinical applications is neither genotoxic, cytotoxic, mutagenic, nor homologous recombination 201231058 (recombinogenicity). These results confirm that berberine has a wide range of physiological functions and great potential and can be used as a new drug for structural modification. Herpes simplex virus type 1 (HSV-1) and type 2 (HSV-2) are members of the alpha-race virus subfamily (a/p/za/jerpemWwae) in the herpesvirus family. Herpes simplex virus infection is characterized by blisters in the skin or mucous membranes of the mouth, lips or genitals. Although HSV-1 and HSV-2 are usually transmitted via different routes and involve different body parts, according to reports, the clinical manifestations of epidemiology and viral infections overlap. Herpes simplex virus (HSV) is widely accepted in the medical literature as a factor in the involvement of oral diseases. Previous studies by Professor Yang Jijiang have concluded that HSV-1 is associated with recurrent aphthous ulcers (Lin SS, Chou MY, Ho CC, Kao CT, Tsai CH, Wang L, Yang CC (2005) Study of the viral infections and Cytokines associated with recurrent aphthous ulceration. Microb Infect 7; 635-644). When it comes to oropharynx, the mouth and lips are the most common sites of HSV infection and cause gingivitis. General use antiviral drugs are usually used to reduce infection during treatment. Reducing the amount of virus reduces the severity of the disease associated with an outbreak and reduces the number of infected cells that fall off the body, thereby reducing the chance of transmission to others. The most commonly used antiviral drugs are aCyd〇vir or penciclovir; however, their long-term use and increased use have led to the emergence of drug-resistant viruses (Bacon TH, Levin MJ, Leary). JJ, Sarisky RT, Sutton D (2003) Herpes simplex virus resistance to acyclovir and penciclovir after two decades of antiviral therapy. Clin Microbiol Rev 16(1); 114-128). Therefore, there is currently a demand for alternative antiviral drugs. Another report by Professor Yang Jijiang has shown that a Chinese herbal medicine called "Qingwei San", which consists of berberine, angelica, rehmannia root, 201231058 peony bark and cohosh, exhibits antibacterial and regulatory cells when it resolves periodontal infection. Hormone effects (Lin SJ, Chen CS, Ho CC, Lin SS, Shih HT, Lee IP, Chou MY, Kao CT, Chen FL, Ho YC, Hsieh KH, Huang CR, Yang CC (2006) In vitro anti-microbial And in vivo cytokines modulation effects of different prepared Chinese herbal medicines. Food Chem Toxicol 44; 2078-2085). In addition, in terms of antimicrobial activity, Coptis seems to be the most effective among individual Chinese medicine ingredients (Lin SJ, Chen CS, Ho CC, Lin SS, Shih HT, Lee IP, Chou MY, Kao CT, Chen FL, Ho YC , Hsieh KH, Huang CR, Yang CC (2006) In vitro anti-microbial and in vivo cytokines modulation effects of different prepared Chinese herbal medicines. Food Chem Toxicol 44; 2078-2085 ). However, the antiviral effect of Qingwei San for oral diseases has not been studied. SUMMARY OF THE INVENTION The present invention discloses the antiviral effects of berberine, berberine and Qingwei Powder, especially against the pure vesicular virus (HSV)' and their antiviral mechanisms. The results of the present invention can be used to administer berberine, berberine and Qingwei Powder to clinically solve viral diseases in a wide range of patients, especially oral viral diseases, and not only for antibacterial use. The word "a" or "an" as used in the present invention may mean "one", but it is also consistent with the meaning of "one or more", "at least one" and "one or more". The word "or" as used herein is used to mean "and/or". The term "herpes simplex virus" as used herein is a generic term for herpes simplex virus type (HSV-1) and herpes simplex virus type 2 (10) ν · 2) in the herpesvirus family. 201231058 Therefore, the present invention provides a pharmaceutical composition for inhibiting virus growth, which comprises the following traditional Chinese medicines: (8) Angelica, Rehmannia, (6) selected from the group consisting of berberine, three (four) berberine and Yunlian, and (4) peony New Zealand (e) is selected from the group consisting of cohosh, large three-leaf cohosh and Xing'an cohosh. Preferably, the traditional Chinese medicine (C) is coptis and the traditional Chinese medicine (e) is cohosh. The preferred ratio of the traditional Chinese medicine (4), the traditional Chinese medicine (8), the traditional Chinese medicine (6), the traditional Chinese medicine (4) and the traditional Chinese medicine (6) is 15 - 5 〇 : 15 - 5 〇 : i 5-5 〇 : 2.5-8.0: 5.0-15. The Chinese medicine (4), the traditional Chinese medicine (9), the traditional Chinese medicine (4) Chinese medicine (4) and the traditional Chinese medicine (4) are better _ 3.6 : 3.6 : 3.6 : 6 : 12. The drug composition is difficult to extract. In the case of better implementation, the scales are obtained by the following method: the scales, rehmannia root, berberine, peony bark and ascending and hearing, and transfer to the age. In another preferred embodiment, the extract is prepared by mixing the angelica, the raw land, the yellow lotus, the peony bark, and the cohosh separately from the extractant. Miscellaneous water. In a preferred embodiment, the pharmaceutical composition can steal and/or treat diseases caused by the virus. More preferably, the pharmaceutical composition is in the form of a mouthwash or an oral form for preventing and/or treating a disease caused by a virus. The disease includes, but is not limited to, oral diseases. The virus that causes the disease to be caused by the disease includes, but is not limited to, the virus of the blister (four) toxic family, in which the scaly pure virus type 1 (HSV-1) or the herpes simplex virus type 2 ( Hsv_2). In a preferred embodiment, the drug composition inhibits the synthesis of late viral gene products in a manner that inhibits the growth of the drug. This late gene product includes but is dilute to glycoprotein B (gB) and/or listener E (gE). The present invention also provides a pharmaceutical composition 'S comprising a berberine for inhibiting the growth of a virus of the alpha vesicular virus subfamily. In a preferred embodiment, the pharmaceutical composition can be used in the form of fresh water or oral to prevent and/or treat diseases caused by the virus. The 201231058 disease includes but is still in the mouth. In the implementation of the money, the disease is simply treated with virus type 1 (HSV-1) or herpes simplex virus type 2 (HSV_2). In a preferred embodiment, the manner in which the pharmaceutical composition inhibits growth is by inhibiting the synthesis of viral late gene products. Such late gene products include, but are not limited to, glycoprotein B (gB) and/or glycoprotein E (gE). The present invention further provides a pharmaceutical composition for inhibiting the growth of a virus of the herpesvirus family, which comprises a Coptidis Rhizoma extract. In a preferred embodiment, the Coptidis Rhizoma extract is an aqueous extract. In a preferred embodiment, the pharmaceutical composition can be used in mouthwash or oral form to prevent and/or treat diseases caused by the virus. The disease includes, but is not limited to, oral diseases. In a preferred embodiment, the virus is herpes simplex virus type 1 (HSVq) or herpes simplex virus type 2 (HSV-2). In a preferred embodiment, the pharmaceutical composition inhibits viral growth by inhibiting the synthesis of viral late gene products. Such late gene products include, but are not limited to, glycoprotein B (gB) and/or glycoprotein E (gE). [Embodiment] The present invention may be embodied in different forms and is not limited to the examples mentioned below. The following examples are merely representative of the various aspects and features of the present invention. Example 1 Materials and Methods: Preparation of L Chinese Herbal Medicine Preparation of Qingwei Powder and Coptidis Rhizoma Extract was as described in the previous literature (Lin SJ, Chen CS,

Ho CC, Lin SS, Shih HT, Lee IP, Chou MY, Kao CT, Chen FL, Ho YC, Hsieh KH, Huang CR, Yang CC (2006) In vitro anti-microbial and in vivo 201231058 cytokines modulation effects of different prepared Chinese herbal medicines. Food Chem Toxicol 44; 2078-2085 ). In short, the composition ratios of Angelica sinensis, Radix Rehmanniae, Rhizoma Coptidis, Cortex Moutan and Cimicifuga were 3.6 : 3.6 : 3.6 : 6 : 12 (based on dry weight). Add these five ingredients to a beaker containing 1 liter of water and heat to 1 〇〇〇c. The hot composite was cooled and then filtered 4 times with Whitman filter paper. The collected filtrate was concentrated by low temperature drying to prepare a stock solution containing 25,000 mg/mL (w/v) of Qingwei Powder Extract. The stock solution was then diluted with distilled water for use in the test. Individually decoctioned Qingwei Sanhuang extract (3,125 mg/mL (w/v)) was decoctioned in the same manner. 2. High-abrasive liquid chromatography (HPLC) analysis of Qingwei Powder and Coptidis Rhizoma Extracts purchased from Sigma-Aldrich Co. Ltd. (MO, USA) with a purity test of more than 95% hydrochloric acid (QoHuClNO4, molecular weight 371.8 1), and all other commercially available reagents are HPLC grade. The Qingwei Powder and Coptidis Rhizoma extract were dried and redissolved in one tenth of the amount of methanol. The dissolved solution was then filtered through a 0.22 Å microporous membrane to produce a sample solution. The concentration of berberine in the Qinggan Powder aqueous extract was determined according to the peak area of the linear calibration curve, and each calibration curve contained five berberine concentrations: 〇〇〇1, 〇〇〇2, 〇〇〇3, 〇〇 〇4 and 0.005 mg/mL. 3. HPLC instrument and chromatographic analysis conditions The RP HPLC-UV analysis of the small-scale test results of the aqueous extracts of Coptis and Qingwei Powder. The HPLC system consisted of a Shimadzu LC-10AT HPLC pump, a SIL-10AD autoinjector, a -SPD-M1GA diode array side, and a CT〇_1GA column header. The conditions are as follows: The column is Inertsil ODS-2 (C18, 25〇x 46 mm id 'particle size, 1 2 I1111 ' GL Sciences Inc., Japan) with a protective column; the solvent system is acetonitrile -50 mM KH2P〇4 30 : 70 (equal elution); flow rate 0.8 mL/min; uy detection wavelength set to 265 nm; injection volume 20 μm; column temperature 30 °C. HPLC analysis was performed 5 times. The data is processed by the Sigma-Plot software program. 4. Viruses, cells and chemicals As described in the previous literature, HSV-1 F strain and HSV-2 333 strain were grown in African green monkey kidney cells (Vero cells) with 2 mM cucurbitine added. Cultured in high temperature autoclaved Dulbecco's medium (Sigma-Aldrich, MO, USA) with 0.12 mg/mL penicillin, 0.1 mg/mL streptomycin and 10% (w/v) fetal bovine serum (FBS) (Huang CR,

Lin SS, Chou MY, Ho CC, Wang L, Lee YL, Chen CS, Yang CC (2005) Demonstrating different modes of cell death upon HSV-1 infection in different oral cell populations. Acta Virol 49; 7-15 ). The viral infection stocks of HSV-1 and HSV-2 were produced in African green monkey kidney cells at a titer of 1.8 χ 1〇3 and 2.5 ® χ 1〇4 plaque forming units/ml, respectively. Acneville (Acyclovir Acyclovir, C8H „N503, molecular weight 225.2) with a purity higher than 99% was purchased from Sigma-Aldrich Co. Ltd. (MO, USA). 1 Cell viability 2 As described in the previous literature, Spectrophotometric analysis using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) as a base 3 YLj Chen CS, Yang CC (2005) Demonstrating different modes of cell 4 Cell viability (Huang CR, Lin SS, Chou MY, Ho CC, Wang L, Lee 201231058 death upon HSV-1 infection in different oral cell populations. Acta Virol 49; 7-15; Lee YJ, Liao PH, Chen WK , Yang CC (2000) Preferential cytotoxicity of caffeic acid phenethyl ester analogues on oral cancer cells. CancerLettl53; 51-56). African green monkey kidney cells were seeded into 96-well culture dishes (105 cells per cell) at 37°. The cells were infected in medium containing 2% (v/v) FBS at C. At the 44th hour after the treatment, 20 μM of MTT solution (5 mg/mL) was added to each cell, and incubation was continued for 4 hours. Then discard the supernatant and add 200 μΐ of the diterpene to each cell. Sulfone. Α 570 was measured in a BIO-RAD spectrophotometer Model 550. All samples were repeated three times with appropriate control groups. 6. Antiviral assays As described in the previous literature, the plaque reduction method was used. Antiviral test (Hou W, Yang ZQ, Chen KL, Yang CC, Wang WH, Xiao H, Cheng L (2003) Study of emodin against herpes simplex virus in vitro. Chin J Pharmaceut Anal 23(4); 259-262 Diluted the virus in 2 mL of tissue culture medium and pipet it onto 2 x 106 Vero cells (with or without different concentrations of berberine, berberine extract, Qingwei San, or acyclovir), 37. (: oscillate for 30 minutes. Then suspend the suspension with 8 mL of tissue culture maintenance medium containing 0.8 ° / (w / v) high viscosity carboxymethyl cellulose (Sigma-Aldrich Co. Ltd., MO, USA) Mix. Divide into two 24-well plates and incubate for 2 days at 37 ° C, 5% C 〇 2. Use the normal saline solution (containing 10% (v / v) formaldehyde and 0.85% (w / v) NaCl Fixation and staining with 0.1% (w/v) Gentian Violet, washing with water, air drying, and counting spots. All samples were tested in the appropriate control group for three replicate experiments. Reed & Muench formula 201231058 for IC5 Calculation of 〇 (50% inhibitory concentration) as described by Hsiung et al. (Hsiung GD, Fong CKY, Landry MI (1994) In Hsiung's Diagnostic Virology (4th ed.), Chapter 6, virus assay, neutralization test, and antiviral assay Yale University Press, pp 46-55. 7. Virus Adsorption Inhibition Test This test was performed according to the method of Andries et al. (Andries K, Dewindt B, Snoeks J, Willebrords R, van Eemeren K, Stokbroekx R, Janssen PA (1992) 】n vitr〇activity of pirodavir (R 77975), a substitut Ed phenoxy-pyridazinamine with broad-spectrum antipicomaviral activity.

Antimicrob Agents Chemother 36; 100-107). The infection center analysis test in the above report was used to evaluate the effect of berberine, berberine extract, or Qingwei Powder on HSV binding to host cells. Briefly, HSV-1 or HSV-2 (lm.oi, multiplicity 〇finfecti〇n), Vero cell suspension (lx 1〇6 cells/ml), and a concentration of ten times IC5Q The berberine, berberine extract, or clear stomach was cooled on ice and then mixed at 4 °C. After incubating for 1 hour at 4 ° C, the cell suspension was washed with ice-cold PBS to remove the bound virus and free compound. The cell pellet was diluted 103-fold, 1.4-fold, and 5-fold in ice-cold PBS, and immediately added to a Vero cell monolayer in a 24-well plate for plaque analysis. 8. Virus Penetration Inhibition Test This test was performed according to the method of Highlander et al. SL, Sutherland SL, Gage PJ, Johnson DC, Levine M, Glorioso JC (1987) Neutralizing monoclonal antibodies specific for herpes simplex virus 11 201231058 glycoprotein D inhibit Virus penetration. J Virol 61 (11); 3356-3364). The Vero cell monolayer in a 24-well plate was pre-cooled on ice and then infected with HSV-1 or HSV_2 (100 PFU per well) for 1 hour at 40C. After washing the chilled pBS with the chilled pBS, the cells were cultured at 37 in a single layer. (: containing berberine, berberine extract, and Qingwei Powder (concentration is about 1〇 IC50) in the medium. After the temperature is moved to 37〇c, 〇, 〇5, 卜2, 3, 6, and For 10 hours, the cell monolayer was treated with 40 citric acid citrate buffer (pH 3 〇) for 1 minute to deactivate the unpenetrated virus and covered with medium containing 5% 5% methylcellulose for plaque analysis. 9. Treatment with Phosphoric Acid The Vero cells were infected with HSV-1/F or HSV-2/333 at 10-20 moi. During the cell exposure to the virus and subsequent culture, 'maintained culture with 2 〇〇 gg of acid per ml In the medium of acetic acid (Sigma-Aldrich Co. Ltd., MO, USA), until post infection (pi) for 24 hours. 1〇·Virus-infected cell antigen and sodium dodecyl sulfate polyacrylamide Gel electrophoresis (SDS-PAGE) as described in the previous inventors' laboratory (Cheng MH, Cheng HT, Lin SS, Young SC, Pai CJ, Liao PH, Chen SC, Chou MY, Yang JJ, Yang CC ( 2009) Apoptotic characteristics of MMC-treated HeLa cells and cellular localization and characteristics of ind Uced P-glycoprotein 170. Drug Chem Toxicol 32; 158-168; Yang CC, Lin SJ, Lin KL (1999) A newly identified true late protein of HSV-1 possibly encoded by UL49.5. J Biomed Lab Sci 11(4 ); 111-117; Yang CC, Yang YY, Lin KL, Lin SJ (2000) The different 12 201231058

Forms of HSV-1 VP22a within purified virion and infected cells. J Microbiol Immun〇i (10) 33; 63_68 ). By using a protein lysis buffer (〇(2)M

The Tns/HCI pH 6.8, 4% (w/v) glycerol and one drop of bromine blue) directly lyse the cell mass to obtain the virus-infected antigen. The antigen was collected and subjected to sonication treatment by a probe ultrasonic cell pulverizer (Pr0be S〇nicator), followed by centrifugation at 1,500 for 15 minutes. Protein and G.G1M dithiothreitol (DTT) were added to the sample buffer for immediate use and loaded onto the substrate after 3 to 5 minutes of protein solubilization. Electrophoresis was carried out for about 4 hours at a constant current of 4 mA. 11. Western blotting method as described in the previous inventor's laboratory (Cheng MH, Cheng HT, Lin SS, Young SC, Pai CJ, Liao PH, Chen SC, Chou MY, Yang JJ, Yang CC (2009) Apoptotic characteristics of MMC-treated HeLa cells and cellular localization and characteristics of induced P-glycoprotein 170. Drug Chem Toxicol 32, 158-168; Yang CC, Lin SJ, Lin KL (1999) A newly identified true late protein of HSV- 1 Maybe encoded by UL49.5. J Biomed Lab Sci 11(4); 111-117; Yang CC, Yang YY, Lin KL, Lin SJ (2000) The different forms of HSV-1 VP22a within purified virion and infected cells. J Microbiol Immunol Infect 33; 63-68). Briefly, Vero cells were infected with HSV-1 or HSV-2 at 3 moi and treated with 0.9 mg/mL berberine, 29 mg/mL berberine extract, 250 mg/mL Qingweisan, or 300 pg PAA 24 Hour or no treatment. The multi-peptide isolated by SDS-PAGE was transferred and fixed to nitrocellulose paper at 0.025 Μ

Tris/0.192 Μglycine, 20% methanol, at 30 to 40 volts overnight. The paper was then blocked for 1 hour at 37 °C with 10% calf serum in PBS.接13 201231058 HSV_1 Thymidine kinase (TK) (SC-28038), HSV-1/2 gB (10B7) (Santa) washed three times with PBS and added to PBs in 〇% of calf serum at 37 °C Cruz Blotechnol〇gy, (v)., CA, USA) or pooled HSV-1 gE (H600) HSV-2 gE ePH^Antibodies-online GmbH, Germany) Multiple or monoclonal antibodies (1/100 dilution) treatment 1 to 2 hours, then washed again three times with PBS and added to horseradish peroxidase-conjugated rabbit anti-mouse antiserum (1/400 dilution) in 10% of calf Jinqing in PBS using primary anti-beta-actin Monoclonal antibody (Cruz Biotechnology, Inc. CA, USA) was used as an internal control. After 1 hour at 37 °C, the enzyme substrate was added and reacted for 10 to 20 minutes. 12. DNA extraction and quantification of instant polymerase keying reaction (PCR) DNA extraction methods were previously established by the inventors (Lin ss, Chou MY, Ho CC,

Kao CT, Tsai CH, Wang L, Yang CC (2005) Study of the viral infections and cytokines associated with recurrent aphthous ulceration. Microb Infect 7; 635-644; Tsai JH, Tsai CH, Cheng MH, Lin SJ, Xu FL, Yang CC (2005) Association of viral factor with non-familial breast cancer in Taiwan by comparison with non-cancerous, fibroadenoma, and thyroid tumor tissues. J Med Virol 75;276-281; Yang YY, Koh LW, Tsai JH, Tsai CH, Wong EFC, Lin SJ, Yang CC (2004) Correlation of viral factors with cervical cancer in Taiwan. J Microbiol Immunol Infect 37(10); 282-287; Yang YY, Koh LW, Tsai JH, Tsai CH, Wong EFC , Lin SJ, Yang CC (2004) Involvement of viral and chemical factors with oral cancer in Taiwan. Jpn J Clin Oncol 34; 176-183). The DNA was extracted according to the traditional scent/gas simulation. Vero cells were infected with HSV-1 or HSV-2 at 3 mo丄, which was treated with 0.9 mg/mL sputum, 29 mg/mL berberine extract, 201231058 25 〇mg/mL qingwei powder, or 3 〇 0 pg PAA 24 hours or no treatment. A total of 106 virus-infected cells per sample were collected into 1.5 ml eppendorff tubes with HIRT buffer (〇.〇1 μ Tris-HCl, 0.01 M EDTA, and 0.6% SDS). After treatment with proteinase K (200 pg/ml) at 560 C for 60 minutes, the DNA was extracted using a guanidine/chloroform procedure and purified by alcohol precipitation. The dried DNA was resuspended in 20 μl of deionized water for PCR analysis experiments. HSV primers and probes and PCR settings have been described in previous literature (Sugita S, Shimizu Ν,

Watanabe K, Mizukami Μ, Morio Τ, Sugamoto Υ, Mochizuki Μ (2008) Use of multiplex PCR and real-time PCR to detect human herpes virus genome in ocular fluids of patients with uveitis. Br J Ophthalmol 92;

928-932). Using a two-type specific probe labeled with different fluorescent dyes, the optimized gB primer pair amplifies HSV-1 and HSV-2 with the same efficiency ( HSV-F : CGCATCAAGACCACCTCCTC ( SEQ ID NO.l ) , HSV-R : GCTCGCACCACGCGA (SEQIDN0.2) ) The HSV-1 probe is labeled with JOE at the 5' end and TAMRA (HSV-1-P: JOE-TGGCAACGCGGCCCAAC-TAMRA (SEQ ID NO. 3) at the 3' end. 〇HSV- 2. The needle is labeled with FAM at the 5' end and TAMRA (HSV-2-P: FAM-CGGCGATGCGCCCCAG-TAMRA (SEQ IDN0.4)) at the 3' end. The specific primer for the virus was used with Accuprime Taq (Invitrogen, Carlsbad, CA). The product was PCR amplified for 40 cycles. The hybridization probe is then mixed with the pcR product. use

Gold and real-time PCR 7300 systems (ABI, Foster City, CA) perform real-time PCR. All products obtained were subjected to PCR amplification for 45 cycles (96 (1 minute, 67 °C 2 minutes, 15 201231058 72 °C 3 minutes). When more than 50 replicates were observed, the virus in the sample was considered The number of copies was meaningful.Results: 1. Quantitative analysis of berberine from Rhizoma Coptidis extract and Qingwei Powder. The mobile phase was selected as: acetonitrile (methane cyanide)-5〇 mMKH2P0430: 70 (equal 2586 degrees elution); flow rate 0.8 The reverse phase HPLC method of mL/min can be successfully applied to identify and determine berberine in the extract of Coptidis Rhizoma and the extract of Qinggan Sanshui, as shown in Figure 2. The small test at the wavelength of 265 rnn The time was !4.66 minutes. The results showed that the quantitative analysis of berberine from 6.25-mg/mL (w/v) berberine extract or 50.00-mg/mL (w/v) Qingweisan was 0.26 mg/mL (equivalent At 0.70 mM) 2. Cytotoxicity, anti-HSV-1 and anti-HSV-2 activity The cytotoxicity and anti-cancer virus of berberine, berberine extract and Qingwei Powder were analyzed by MTT assay and plaque assay. Activity, and Aceville as a positive control group for comparison. Different concentrations of berberine, yellow Extracts, Qingwei San, or Aseville's 10-fold dilution (105 mg/mL to 10-5 mg/mL) were treated with Vero cells and simultaneously infected with HSV-1 or HSV-2 'three replicates, respectively. Table 1 shows Cytotoxicity (50% cytotoxicity, CC50), anti-HSV-1 and anti-HSV-2 activity (50% inhibitory concentration, ic5〇) of Veronica cells, berberine extract, Qingweisan, or Aseville on Vero cells The selection index (SI) of the small test is higher than the selection index of Coptis extract and Qingweisan by about 12 to 15 times; however, it is about 2.2 times lower than the selection index of Aseville. 201231058 Table 1 Coxi cytotoxicity (CC5〇, Mg/mL) Anti-HSV-1 activity (IC5o, mg/mL) Anti-HSV-2 activity (IC50, mg/mL) Selection index (SI, CC5〇/IC5〇) Small test 13.2±1_6 8·2±1 ·2χ10·2 9.〇±1.1 χ ίο2 147-161 Coptis extract 321±21.4 2.4+0.6 2.9+0.7 111-134 . Qingwei San 2500±248 24.3±6.4 25.3±7.6 99-103 Aseville 7.8±0.9 X 10'2 2.2±0.5 x IQ·4 2.410.6Χ10·4 325-355 3. Effects of berberine, berberine extract, and Qingwei Powder on virus adsorption and penetration Through the infection center analysis test, test Xiaoyan Sensitive targets for HSV replication in virus adsorption and penetration after treatment with Huanglian extract and Qingwei Powder (Andries K, Dewindt B, Snoeks J, Willebrords R, van Eemeren K, Stokbroekx R, Janssen PA (1992) In vitro Activity of pirodavir (R77975), a substituted phenoxy-pyridazinamine with broad-spectrum antipicomaviral activity.

Antimiei Ob Agents Chemother 36; 100-107). For convenience, 0.9 mg/mL berberine, 29 mg/mL berberine extract, and 25 〇mg/mL qingwei powder were used as 1 〇1 (^ to achieve complete inhibition in the following analytical tests. Virus adsorption inhibition The test was evaluated by directly reading the number of virus-containing cells in the presence of a small test, berberine extract, or Qingwei Powder. As a result, the cell adsorption of HSV-1 or HSV-2 was not 1〇 under the generation. A small test of IC5 〇 concentration, berberine extract, or Qingwei Powder inhibition. Subsequently, whether the small drug test, Coptis extract, or Qingwei Powder will inhibit the refinement of the disease (hsv replication test towel attached to the host cell after the order - The possibility of stage. As a result, Xiaoling, Coptis extract, and Qingwei 17 201231058 did not inhibit virus penetration, even though its concentration was 10 times IC5G. Table 2 shows berberine, berberine extract, and Qingweisan An overview of the results of the inhibition of virus adsorption and penetration. The two trials were performed in triplicate. Table 2 Reagents, sputum, scutellaria extract, Qingweisan, PFU (percentage) PFU (percent) PFU (percent) PFU (percentage) HSV-1 virus Adsorption 8.2 ± 1.1 X 105 8.4 ± 1.8 X 10s 8·2±1·2Χ105 8.8±1.6X105 (93.2%) (95.4%) (93.2%) (100%) Virus penetration Oh Oil 2±1 1±1 1 ±1 0.5 h 66±5 62±6 61±6 64±5 1 h 86±3 82 ±3 85±4 84±4 2h 3±3 4±3 3±2 89±4 3h 4±2 6±2 3±2 88±4 6h 2±2 3±1 3±1 90±3 lOh 5±3 4±3 5±2 89±4 HSV-2 virus adsorption 7.7± 1.5 X 105 8.0± 1.2 X 105 7.6±1.3 Χ105 8.2± 1.4 X 105 (93.9 %) (97.6%) (92.7%) (100%) Virus penetration Oh 2±1 2±1 1±1 2±1 0.5 h 50±6 47 Soil 5 45±7 52 ±5 1 h 66±7 62±8 65±7 74±6 2h 8±5 4±3 6±3 80±4 3h 4±3 40±5 8±4 86±5 6h 3±2 8±4 7 ±4 81±3 10 h 3±2 6 soil 3 7±2 86±4

4. Small sputum test, berberine extract, and Qingweisan on late protein and gene synthesis 18 201231058 Vero cells were infected with HSV-1 or HSV-2 at 3 moi, which was 0.9 mg/mL. Scopolamine, 29 mg/mL berberine extract, 250 mg/mL qingwei powder, or 3 〇〇paa treatment for 24 hours or no treatment. ΡΑΑ (--DNA synthesis inhibitor) was used as a positive control group. The effects of berberine, berberine extract, and Qingwei Powder on early and late protein synthesis were analyzed by SDS-PAGE and Western blotting. Since commercially available single or multiple antibodies against HSV early gene products have only HSV-1 TK polyclonal antibodies available, experiments were carried out using this antibody. Figure 3 shows the results of the Western blot method. No inhibition of HSV_1 early gene product # (TK) was observed. As for the late gene product, Figure 4 shows the results. Treatment of virus-infected cells with DNA synthesis inhibitors greatly reduces the synthesis of Glycoprotein B, although a small amount can be detected (Fig. 4A). However, treatment with PAA completely inhibited the synthesis of gE (Glycoprotein E) (Fig. 4B). To verify that trace amounts of gB are due to contamination, dna samples from Ver〇 cells were treated with the same SDS-PAGE and Western blotting, and by quantifying the instant pcR test, the optimized gB primer pair was used to amplify HSV_1&amp ;HSV_2. The results confirmed that a low number of sister genes would be produced (Fig. 4C). It is the result of Western blotting, so it can be inferred that the results of treatment with berberine, berberine extract, and Qingwei Powder will inhibit the late genes and proteins of HSV-1 and HSV-2 as well as the results of pAA treatment. synthesis. Moreover, this inhibitory effect is not lost due to the extraction or preparation process of the present invention by Coptis and Qingwei Powder. Those skilled in the art will readily appreciate that the present invention can be easily accomplished with the results and advantages obtained, as well as those present in their towels. The compositions, mixtures, and procedures and methods for their manufacture in the present invention are difficult to implement, and are representative of and not limited to the field of the invention. Those skilled in the art will be aware of the modifications and other uses therein. These modifications are intended to be included in the spirit of the invention and are defined in the scope of the claims. The present invention is to be construed as being limited to the scope of the invention. Different changes, modifications, and improvements will be made without departing from the spirit and scope of the invention. All patents and publications mentioned in the specification are subject to the general skills in the field of wealth management. All patents and publications are hereby incorporated into the same temple, as if each individual publication was specifically and individually indicated for inclusion. The invention, as exemplified herein, may be implemented in the absence of any element, perhaps multiple elements, conditions, or a combination of the limitations disclosed herein. The nouns and expressions of the singular are intended to be illustrative and not limiting, and are not intended to be used to exclude any nouns and expressions that are equivalent to the features or parts thereof shown and described. Specialized Wei _ may have a variety of different changes. It is intended that the present invention will be modified and altered by those skilled in the art, and such modifications and variations are still within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the chemical structure of berberine hydrochloride. 201231058 Figure 2 shows the HPLC chromatogram of the standard 丨 镇 镇 (Figure 2A), the HPLC chromatogram of berberine in the berberine extract (Figure μ, and the HPLC chromatogram of berberine in Qingwei San (Figure 2C). There is ___itiQntime). The results of Western blot analysis of the early HSV-1 early gene product τκ were not analyzed by Xiaozheng, Huanglian extract and Qingwei Powder. Sample] is simulated hsv_m infected cells' sample 2 is PAA-treated HSV-1/F-infected cells, samples 3-5 are _ 】 黄 黄 黄 萃取 extract, and Qingweisan treated HSV-1/F infected cells . Use actin as internal control. Figure 4 shows the results of Western blot analysis of the late gene product gB (Fig. 4A) & gE (Fig. 4B) synthesized by Xiaozheng, Huanglian extract, and Qingweisan. Use β-actin as an internal control. Figure of the instant pCR results. The sample was simulated HSV-1/F infected cells, and sample 2 was simulated HSV_2/333 sensitive cells. Sample 3 was PAA-treated HSV-1/F-infected cells, and sample 4 was PAA-treated HSV- 2/333 infected cells, samples 5-7 were berberine, berberine extract, and Qingwei Powder treated HSV-1/F infected cells, and samples 8-10 were berberine, berberine extract, and Qingwei Powder. Treated HSV-2/333 infected cells. [Main component symbol description] None. 21 201231058 Sequence Listing <110> Yang Jijiang

<120> Pharmaceutical composition for inhibiting virus growth <130> 1298-Dr. Yang-TW <160> 4 <170> Patentln version 3.4 <210> 1 <211> 20 <212> DNA <213> Synthetic <220><223> HSV Forward Primer<220><221>misc_binding<222> (1)..(20) <400>1 cgcatcaaga ccacctcctc <210&gt 2 201231058 <211> 15 <212> DNA <213> Synthetic <220><223> HSV reverse primer <220><221> misc_binding φ <222> (1). .(15) <400〉 2 gctcgcacca cgcga

<210>3 <211> 17 <212>DNA <213> Synthetic <220><223> HSV-1 probe <220><221> misc_binding <222>(1) ..(17) <400> 3 201231058 17 tggcaacgcg gcccaac <210> 4 <211> 16 <212> DNA <213> Synthetic <220><223>HSV-2 probe

<220><221> misc_binding <222> (1)..(16) 16 <400> 4 cggcgatgcg ccccag

3

Claims (1)

201231058 VII. Scope of application: 1. A pharmaceutical composition for inhibiting the growth of virus, 匕3 The following Chinese medicines: (a) Angelica, (b) κ, (c) selected from berberine, huanglian huanglian and money ( Cong's towel, (4) peony bark and (e) selected from the group consisting of cohosh, big three-leaf cohosh and Xing'an cohosh. 2. If applying for a pharmaceutical composition of Axis, the cap (4) is Coptis and The traditional Chinese medicine (4) is cohosh. 3. For the scope of patent application (the pharmaceutical composition of the 'in which the Chinese medicine (8), Chinese medicine (8), Chinese medicine (4), Chinese _ and Chinese medicine (e) ratio is L5 - 5. 〇: 1 > 5 - 5 〇: i 5 —5 〇: &8 〇,: 5 〇—15·0 〇4. For the pharmaceutical composition of Patent Application No. 3, the Chinese medicine (8), Chinese medicine (9), Chinese medicine (4), Chinese medicine (4) and Chinese medicine (e) The ratio is 3.6: 3.6: 3.6: 6: 12. 5. The pharmaceutical composition of the scope of the patent application can prevent and/or treat diseases caused by viruses. 6. If the patent application scope is 医药i a composition wherein the virus is herpes simplex virus type 1 (HSV-1) or herpes simplex virus type 2 (HSV-2). 7. If the application is specifically for an L-a compound, it inhibits virus growth. (10) The pharmaceutical composition of claim 7, wherein the late gene product is glycoprotein B (gB) and/or glycoprotein E (gE). A pharmaceutical composition for inhibiting the growth of a virus of the alpha herpesvirus subfamily, comprising berberine. The pharmaceutical composition of inhibiting the growth of virus Herpesviridae, comprising Coptis extracted 201231058