TW201200525A - MYBL2 peptides and vaccines containing the same - Google Patents

Abstract

Peptide vaccines against cancer are described herein. In particular, epitope peptides derived from the MYBL2 gene that bind to HLA antigen and have cytotoxic T lymphocyte (CTL) inducibility, more particularly peptides having the amino acid sequence of SEQ ID NO: 5 and fragments thereof, are provided. The present invention further extends to peptides that include one, two, or several amino acid insertions, substitutions or additions to the aforementioned peptides or fragments, provided they retain cytotoxic T cell inducibility. Also provided as nucleic acids encoding any of the aforementioned peptides, antigen-presenting cells and isolated CTLs that target such peptides, and pharmaceutical agents and compositions including any of the aforementioned peptides, nucleic acids, and APCs as active ingredients. The components of the present invention have particular utility in connection with the treatment and/or prophylaxis (i.e., prevention) of cancers (tumors), and/or the prevention of a postoperative recurrence thereof.

Description

201200525 Chemical Formula 5 When there is a chemical formula on the right, please reveal the best indication of the invention. 6. Description of the Invention: TECHNICAL FIELD OF THE INVENTION The present invention relates to the field of biological sciences, and more particularly to the field of cancer treatment. In particular, the present invention relates to a novel peptide which is very effective as a cancer vaccine and a drug for treating and avoiding tumors. [Prior Art] It has been confirmed that CD8-positive cells are toxic to the tumor-associated antigen-complex (ina j〇r hist〇c〇mpatibi丨丨衿complex' MHC) class I tumor-associated tumor-associated The epitopes of the antigen (1; _ associated antigens, TAAs) are peptides, and then the tumor cells are killed. Since the discovery of the melanoma antigen family (melan〇maantigen MAGE) family as the first example of tumor-associated antigens, many other tumor-associated antigens have been discovered by immunological methods (NPL 1, Boon T, Int J Cancer 1 993 May 8, 54 (2): 1 77-80; NPL 2, Boon T & van der Bruggen P, J Exp Med 1 996 Mar 1,183(3): 725-9) ' and some of these tumor-associated antigens are currently in clinical development The process is labeled as an immunotherapy. The identification of new tumor-associated antigens that induce an effective and specific anti-tumor immune response has become a further development and clinical study of peptide vaccination strategies in various forms of cancer. 201200525 Based on ongoing (NPL 3 , Harris CC, J Natl Cancer Inst 1996 Oct 16, 88(20): 1442-55; NPL 4, Butterfield LH et al., Cancer Res 1999 Jul 1, 59(13): 3134-42; NPL 5, Vissers JL Et al. , Cancer Res 1999 Nov 1, 59(21): 5554-9; NPL 6, van der Burg SH et al. , J Immunol 1996 May 1, 1 56(9): 3308-14; NPL 7, Tanaka F et al. , Cancer Res 1 997 Oct 1 5, 57(20): 4465-8; NPL 8, Fujie T ei a;., Int J Cancer 1 999 Jan 18, 80(2): 1 69-72; NPL 9, Kikuchi M et al., Int J Cancer 1 999 May 5, 81 (3): 459-66; NPL 10, Oiso M et al., Int J Cancer 1999 May 5, 81(3): 387-94 ). Many clinical trials using these tumor-associated antigen-derived peptides have been reported to date. Unfortunately, many current cancer vaccine trials have shown a low objective response rate (NPL 11, Be 11 i F et al., J Clin Oncol 2002 Oct 15, 20(20): 4169-80; NPL 12, Coulie PG et al., Immunol Rev 2002 Oct, 188: 33-42; NPL 13, Rosenberg SA et al., Nat Med 2004 Sep, 1 0 (9): 909-1 5). Therefore, novel tumor-associated antigens are still required as immunotherapeutic targets. MYBL2 (GenBank Accession No: NM_002466, sequence identification: 6 sequence identification number: 5) has been identified by c-myb proto-oncogene probe by cDNA library, and there are too many v-myb-like myeloid cells. V-myb myeloblastosis viral oncogene homolog (avian)-like 2), a member of the MYB family of transcription factor genes (NPL 14, Nomura N et 3, Nucleic Acids 4 201200525)

V

Res· 1988 Dec 9,1 6(23): 1 1 075 - 1 1089) °MYBL2 is known to control cell cycle progression' and by CDK2-cyclin A (CDK2-cyclin A) and CDK2-cyclin Cyclin-driven phosphorylation of the E(CDK2-cyclin E) complex (NPL 15, Robinson C ei ai., Oncogene 1996 May 2; 12(9): 1855-64, NPL 16, Lane et al., Oncogene 1997 May 22; 14(20): 2445-53, NPL 17,

Sala Proc Natl Acad Sci 1997 Jan 21; 94(2): 532 - 536, NPL 18, Johnson K et al., J Biol Chem 1999

Dec 17; 274(51): 36741-9). It has recently been reported that Mip/LIN-9 controls the performance of MYBL2 and that both proteins play a key role in the promotion of cell cycle progression through the control of s and M-phase cyclins (NPL 199).

Pilkinton U et a 1. , J Biol Chem 20 07 Jan 5 ; 282(1 ): 168-75). Furthermore, by analyzing the gene expression profile of a genome-wide DNA microarray containing 23,040 genes, it has been identified that MYBL2 is included in many cancers, including, for example, testicular tumors, pancreatic cancer, bladder cancer, non-small A novel molecule in which cell lung cancer, small cell lung cancer, and esophageal cancer are regulated upward (PTL 1, US 60/937, 61 6, PTL 2, WO 2004/031410). MYBL2 is considered to be a novel oncoant antigen (oncoant igen), and the epitope peptide derived from MYBL2 can be applied to cancer immunotherapy in patients with several forms of tumor. [Citations] Patent Literature [PTL 1] US 60/937, 616 [PTL 2] WO 2004/031410 201200525 Non Patent Literature [NPL 1] Boon T, Int J Cancer 1993 May 8 , 54(2): 177-80 [NPL 2] Boon T &amp; van der Bruggen P, J Exp Med 1996 Mar 1, 183(3): 725-9 [NPL 3] Harris CC, J Natl Cancer Inst 1 996 Oct 16, 88(20): 1442-55 [NPL 4] Butterfield LH et al. , Cancer Res 1 999 Jul 1, 59(13): 3134-42 [NPL 5] Vissers JL et al., Cancer Res 1999 Nov 1, 59(21): 5554-9 [NPL 6] van der Burg SH et al. , J Immunol 1 996 May 1, 156(9): 3308-14 [NPL 7] Tanaka F et al., Cancer Res 1 997 Oct 15, 57(20): 4465-8 [NPL 8] Fujie T et al., Int J Cancer 1 999 Jan 18, 80(2): 169-72 [NPL 9] Kikuchi M et al., Int J Cancer 1999 May 5, 81(3): 459-66 [NPL 10] Oiso M et al., Int J Cancer 1 999 May 5, 81(3): 387-94 [NPL 11] Belli F et al., J Clin Oncol 2002 Oct 15, 20(20): 4169-80 [NPL 12] Coulie PG et al., Immunol Rev 2002 Oct, 5 201200525 188: 33-42 [NPL 13] Rosenberg SA et al., Nat Med 20 04 Sep, 10(9): 909-15 [NPL 14] Nomura N et al., Nucleic Acids Res. 1988 Dec 9, 1 6(23): 1 1 075 - 1 1 089 [NPL 15] Robinson C et al Oncogene 1 996 May 2; 12(9):1855-64 [NPL 16] Lane et al. , Oncogene 1997 May 22; 14(20): 2445-53 [NPL 17] Sala et al., Proc Natl Acad Sci 1 997 Jan 21; 94(2): 532 - 536 [NPL 18] Johnson K et al., J Biol Chem 1999 Dec 17;274(51):36741-9 [NPL 19] Pilkinton M et al., J Biol Chem 2007 Jan 5:282(1): 168-75 SUMMARY OF THE INVENTION The present invention is based, in part, on the discovery of suitable targets for immunotherapy. Since tumor-associated antigens (TAAs) are sometimes perceived by the immune system as "self" and therefore often have no immunogenicity, the discovery of suitable targets is extremely important. As mentioned above, it has been confirmed that MYBL2 (sequence number encoded by GenBank numbered _002466 (SEQ ID NO: 5) is encoded by the gene: 6) in cancers such as sputum tumor, pancreatic cancer, bladder cancer Small cell lung cancer, 201200525 Small cell lung cancer and esophageal cancer tissue are up-regulated. Therefore, MYBL2 is a candidate for cancer/tumor immunotherapy. The present invention is based, at least in part, on the recognition of specific epitope peptides of MYBL2 which have the ability to induce cytotoxic T lymphocytes specific for MYBL2. As discussed in detail below, a candidate peptide from MYBL2 that binds to Hu (human leukocyte antigen)-A2 is used to stimulate peripheral blood mononuclear cells (peripheral M〇C) d mc)nc) from a health provider. ]_ cel Is, PBMCs). Specifically, a cytotoxic cytotoxic T lymphocyte having a specific cytotoxicity against HLA-A2 positive target cells pulsed by each candidate peptide was established. Thus, these results demonstrate that these traits are HLA-A2-restricted epitopes, which induce a strong and specific immune response against cells expressing MYBL2. Therefore, these results show that Μγβ [2 is potently immunogenic and its epitope is a valid target for tumor immunotherapy. Accordingly, it is an object of the present invention to provide an isolated peptide which binds to an HLA antigen, which is MYBL2 (SEQ ID NO: 6) or a fragment thereof. These traits are expected to have cytotoxic T lymphocyte evokengs and can therefore be used to induce cytotoxic thymocytes or can be administered to a body to induce an immune response against cancer, cancer Examples include, but are not limited to, testicular tumors, smear cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer. Preferably, the peptides are a nine-peptide or a ten-peptide, and more preferably have an amino acid sequence selected from the sequence identification number: 2 to 4, particularly the sequence identification number: 3 The nine peptide or the ten peptide of the amino acid sequence has a particularly strong cytotoxic T lymphocyte evoking ability. 201200525 The peptide of the present invention considers a modified peptide having a sequence identification number of 2 to 4 amino acid sequence in which one, two or more amino acids are substituted or added, and the modification is to be successful. The peptide maintains the original cellular toxic T lymphocyte evoking ability. Further, the invention provides isolated polynucleotides encoding any of the peptides of the invention. These polynucleotides can be used to induce antigen-presenting cells having cytotoxic cadmium-inducing ability, or as the peptide of the present invention can be administered to a body to induce an immune response against cancer. When administered to a body, the peptide of the present invention is expressed on the surface of the antigen-presenting cell to induce a cytotoxic tau lymphocyte to which the respective peptide is targeted. Accordingly, it is an object of the present invention to provide an agent comprising any of the peptides or polynucleotides of the present invention for inducing cytotoxic lymphocytes. Furthermore, an agent, substance or composition comprising any of the peptides or polynucleotides of the invention can be used for the treatment and/or prevention of cancer, and/or its avoidance of recurrence after surgery, including but not limited to such cancers Sputum tumors, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer and esophageal cancer. Accordingly, it is yet another object of the present invention to provide pharmaceutical agents for the treatment and/or prevention of cancer, and/or the avoidance of recurrence after surgery, such agents comprising any of the peptides or polynucleotides of the present invention. In place of the peptide or polynucleotide of the present invention/except for the peptide or polynucleotide of the present invention, the agent or pharmaceutical agent of the present invention may comprise an antigen-presenting cell or an exosome which exhibits any of the peptides of the present invention as an active ingredient. The peptide or polynucleotide of the present invention can be used to induce an antigen-presenting cell which exhibits a complex of a HLA antigen and a peptide of the present invention on the surface, for example, 201200525, such as by presenting an antigen from a body to a cell. The peptide is contacted or a polynucleotide encoding the peptide of the present invention is introduced into the antigen-presenting cell. Such antigen-presenting cells have a high anti-target peptide cell toxic lymphocytosis-inducing ability and are therefore useful for cancer immunotherapy. Therefore, another object of the present invention is to provide a method for inducing an antigen-presenting cell having a cytotoxic lymphoblast-inducing ability and an antigen-presenting cell obtained by the method. A still further object of the present invention is to provide a method for inducing a cytotoxic tau lymphocyte, the method comprising the steps of co-cultivating a CD8-positive cell with an antigen-presenting cell or an exosome expressing a peptide of the invention, or introducing A step of encoding a gene encoding a polynucleotide of a cellular receptor (t cei receptor, TCR) subunit in combination with a peptide of the present invention. The cytotoxic tau lymphocytes obtainable by such methods are also useful in the treatment and/or avoidance of cancer, and examples of cancer include, but are not limited to, testicular tumors, smear cancer, bladder cancer 'non-small cell lung cancer, Small cell lung cancer and esophageal cancer. Another goal of this month is to provide a cytotoxic sputum lymphocyte obtainable by the method of the present invention. Still another object of the present invention is to provide a method for inducing an anti-cancer immune response in a subject in need thereof, which comprises administering a polynucleotide comprising a diaphragm 2 or a fragment thereof and a code of MYBL2 or a fragment thereof, and presenting MYBL2 Or the step of exosome or antigen presenting a reagent or composition of the cell. One: the applicability of the invention extends to or is caused by excessive performance; any of the diseases, including cancer, examples including, but not limited to, tumor sputum cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer 10 201200525 With esophageal cancer. More specifically, the present invention provides the following: [1] An isolated oligopeptide comprising an amino acid sequence selected from the group consisting of 2 to 4, wherein the oligopeptide It binds to a human leukocyte tissue antigen and has a cytotoxic T lymphocyte evoking ability. [2] an isolated oligopeptide, wherein the oligopeptide binds to a human leukocyte antigen and has cytotoxic T lymphocyte evoking ability, wherein the peptide is selected from sequence identification number: 2 to One of amino acid sequences of 4, wherein 1, 2 or several amino acids are inserted, substituted, deleted or added to the oligopeptide of [3] [2], wherein the recruit peptide has one of the following characteristics Or both: (a) the second amino acid from the N-terminus is selected from the group consisting of leucine and acesulfame; and (b) the C-terminal amino acid is selected from the group consisting of proline and leucine . [4] The isolated oligopeptide of [1] to [3] wherein the human leukocyte antigen is an isolated oligopeptide of human leukocyte antigen-A2 [5] [1] to [4] The recruit peptide is a nine-peptide or a ten-peptide. [6] An isolated polynucleotide encoding the oligopeptide of any one of [丨] to [5]. [7] An agent for inducing a cytotoxic thymocyte, wherein the agent comprises any one of [1] to [5] - or a plurality of the peptides, 11 201200525 or at [6] One or more of the polynucleotides described in the . [8] a pharmaceutical agent for the treatment and/or prevention of cancer, and/or prevention of recurrence after surgery, wherein the agent comprises one of any one of [1] to [5] or a plurality of the oligopeptides, or one or more of the polynucleotides described in [6]. The pharmaceutical agent of [9] [8] is formulated for administration to a human, and the human leukocyte tissue antigen is human leukocyte antigen-A 2 . A pharmaceutical agent of [1 0 ] [8] or [9] which is formulated for the treatment of cancer. [11] A method of inducing an antigen-presenting cell having a cytotoxic T lymphocyte-inducing ability, wherein the method comprises one of the following steps: (a) jy? hiro, ez 叩 or /v? Wfo presents an antigen to cells and The oligopeptide contact of any one of [1] to [5]; or (b) introducing a polynucleic acid encoding the oligopeptide of any one of [1] to [5] into an antigen-presenting cell . [12] A method for inducing cytotoxic T lymphocytes by any method comprising at least one of the following steps: (a) co-culturing CD8-positive T cells with antigen-presenting cells, the antigen-presenting cells exhibiting a human leukocyte The tissue antigen and the oligo-synthesis of any one of [1] to [5] are on the surface thereof; (b) the CD8-positive tau cells are co-cultured with the exosome, and the human white blood cells are exosome a tissue antigen and a peptide complex of any one of [1] to [5] on its surface; and (c) a nucleic acid comprising a T cell receptor subunit multi-peptide 12 201200525 w nucleus The bitter acid gene is introduced into a T cell which binds to the oligopeptide of any one of [1] to [5]. [13] An isolated antigen-presenting cell which exhibits a complex of a human leukocyte antigen and a peptide of any one of [1] to [5] on its surface. The antigen of [1 4 ][ 1 3 ] presents cells which are induced by the method of [11]. [1 5 ] An isolated cytotoxic tau lymphocyte, which is characterized by a peptide of any one of [1] to [5]. [1 6 ] [ 1 5 ] cytotoxic τ lymphocytes, which are induced by the method of [1 2 ]. [1 7] A method for inducing an immune response against cancer in a body, which comprises the step of administering to the individual a reagent comprising the oligopeptide of any one of [i] to [5], An immunologically active fragment thereof, or a polynucleotide encoding one of the oligopeptide or immunologically active fragment. It is to be understood that the invention is not intended to In addition to the above, other objects and features of the present invention will become more fully apparent from the following detailed description. However, the present invention and the following detailed description are exemplary embodiments of the invention, and are not intended to limit the invention or other alternative embodiments of the invention. In particular, the invention as set forth in the Detailed Description of the Invention is to be understood as illustrative of the invention and is not to be construed as a limitation. Various modifications and applications can be made by those skilled in the art without departing from the spirit and scope of the invention, as described in the scope of the claims. Likewise, other objects, advantages, advantages and advantages of the invention are apparent from the following description and the particular embodiments set forth below, and are readily understood by those skilled in the art. Such terms, features, advantages and advantages are apparent from the above-described combination of the accompanying examples, the <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> and all reasonable inferences that are to be described as a separate reference. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the embodiments of the present invention, the preferred methods, elements and materials are now described, however, prior to describing the materials and methods of the present invention, The invention is not limited to the particular size, dimensions, methods, steps, etc. described herein, such as may be modified by conventional experimentation and/or optimization. It is also to be understood that the specific terms used herein are for the purpose of describing particular variations or embodiments and are not intended to limit the scope of the invention, The patent application is hereby specifically incorporated into the A i V two references. However, this is also interpreted as the intent of the invention. The effect of the invention is not given the prior disclosure. In the event of a conflict, the date of this issue + praise of the instructions, including definitions, will be controlled 14 201200525 In addition, the materials, methods and examples are illustrative only and are not intended to be limiting. I. Definitions The words "a" and "the", as used herein, mean "at least-, unless explicitly stated otherwise. The phrase "polypeptide," "peptide," and "protein" means a polymer of one of the amino acid residues. This term applies to amino acid polymers in which one or more amino acid residues are modified residues or non-naturally occurring residues 'for example, artificial chemical mimics corresponding to naturally occurring amino acids' and nature An amino acid polymer is produced. As used herein, the term "amino acid" means naturally occurring and synthetic amino acid' and an amino acid analog and an amino acid mimetic which function similarly to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code and those modified in the cell after translation (eg hydroxyproline, r _ carboxy glutamate (gamma-08) ^ 30 乂 7 tolerate 1111311 ^16) with 〇-phosphoric acid (〇11108?乜0361'1116)). The expression "amino acid analog" means a compound having the same basic chemical structure as the naturally occurring amino acid (a &lt; 2 barrier to a hydrogen, a slow group, an amine group and an R group), but Having a modified R group or modified backbone (eg, homoserine, norleucine, methionine, sulfoxide, methyl sulfoxide) Methionine methyl sul f on ium)). The expression "amino acid mimetic" means a chemical compound which has a different structure from a general amino acid but which has a similar function. The amino acid herein can be indicated by the three-letter symbol or the letter symbol generally known by IUPAC-IUB Biochemical Nomenclature 15 201200525 C_issiGn. Here, the terms "gene", "multi-nucleotide", "nuclear" may be used interchangeably.

Glycosidic acid and "nucleic acid", and unless otherwise indicated by U, other special methods, similar to amino acids, which are referred to by their commonly accepted mono-letter codes. [herein the term "replaceable" reagent, '肖' By composition, it is meant a product which is included in a particular amount of a particular ingredient, in combination with any product which is derived directly or indirectly from a particular amount of a particular octant. This terminology, when used in connection with "pharmaceutical agent" and "pharmaceutical composition, is meant to include a product which includes - the active ingredient with any inert ingredient which forms a carrier, and any product which is derived directly or indirectly from either or both Combinations of multiple components, complex or aggregated, or dissociation from one or more components, or other forms of reaction or interaction from - or multiple components, as used herein, the term "pharmaceutical reagents," "Pharmaceutical composition," means a product of a molecule or compound and a pharmaceutically or physiologically acceptable carrier. As used herein, the phrase "pharmaceutically acceptable," physiologically acceptable carrier "meaning pharmaceutically or physiologically... or a material, composition, substance or carrier, including, but not limited to, - liquid = material filler, diluent, excipient, solvent or sheath material, = solid official or One part of the body carries or transports a controlled scaffold, scaffolded p〇lypharmac〇ph〇res to another part of the effect. The term "active ingredient" as used herein refers to a substance in a reagent or a substance that is biologically or physiologically active. Special 3, = ^ ° 疋, in a pharmacy 16 201200525 Reagent or composition By "active ingredient" is meant a pharmaceutical substance which exhibits a pharmaceutical effect. For example, if a pharmaceutical agent or composition is used in the treatment or avoidance of cancer, the active ingredient in the agent or composition may directly or indirectly cause Biological or physiological action of cancer cells and/or tissues. Preferably, the action may include reducing or inhibiting the growth of cancer cells, damaging or killing cancer cells and/or tissues, etc. In general, the indirect action of the active ingredients is induction. Cytotoxic tau cells recognize or kill cancer cells. Before preparation, "active ingredient" also means "bulk", "drug substance" or technical product, unless Other definitions, the term "cancer," means cancer that overexpresses the MYBL2 gene, examples of which include, but are not limited to, testicular tumors, pancreatic cancer, bladder cancer, non-small cell lungs , Small cell lung cancer and esophageal cancer. Unless otherwise defined, it may be used interchangeably and unless otherwise specifically indicated by the term "cytotoxic tau lymphocytes," "cytotoxic tau cells," and "CTLV to mean lymphocytes. A subgroup refers to a subgroup of lymphocytes (sub_group) that recognizes non-self cells (eg, 'tumor cells, cells infected with the virus) and induces death of these cells. 2. Not specifically defined, the term "HLA_A〇 2 ” means “HLA-A2 containing a subtype, such as 1201 or HLA-A*-0206. “Treatment = provides a clinical use of cancer in the context of the methods and compositions of the present invention: content It is considered “effective” if it causes a reduction in cancer money, or a small, prevalence or metastatic potential of the individual. 201200525 Less when the treatment is provided for preventive (pr0phy itical ly) "Effective" means slowing or avoiding the formation of cancer, or avoiding or ameliorating the clinical symptoms of cancer. Validity is identified in any known method of diagnosis or treatment of a specific form of tumor beta unless special The term "set" as used herein is used in connection with reagents and other materials. The set considered here includes microarrays, positives, markers, etc. It is not intended to use the term "set" to limit reagents. And/or a specific combination of materials. As used herein, in the context of a subject or patient, the word ''positive') means that the individual or patient has the same type of binding (h〇m〇zyg〇usly) or heterogeneous binding. (heter0zyg0USly) has the HLA_A2 antigen gene, and

The HlA_A2 antigen is expressed in the cells of the individual or patient as a hla antigen. "For the context of the use of the substances and methods of the invention to provide for the avoidance and prevention of cancer, such terms are used interchangeably to mean any activity which reduces mortality or mortality from disease. Avoidance and prevention can occur in the "initial, second and third phase avoiding hierarchy". Early avoidance and prevention avoids the development of the disease, while the avoidance and prevention of the second and third stages includes the restoration of function and the reduction of disease-related complications, and the development and symptoms of the disease are degraded/symptoms. Now, and to reduce the negative development of the established disease, the avoidance of the pre-requisites, ', top anti-horse. Alternatively, treatment or avoidance may include a wide range of disease prevention treatments, with the goal of slowing the severity of particular diseases, such as reducing tumor proliferation and metastasis. In the context of the present invention, the avoidance of postoperative recurrence of cancer, bis, argon/cafe/alpha therapy and/or prevention, and/or its hand 18 201200525 includes any of the following steps, such as surgical removal of cancer cells : growth inhibition of cancer cells, tumor regression or degeneration, induction of slowing and inhibition of cancer, and reduction and inhibition of metastasis. Effective treatment and/or prevention of cancer reduces mortality and improves the prognosis of individuals with cancer, reduces the extent to which cancer marks in the blood, and slows the detectable symptoms associated with cancer. For example, amelioration or amelioration of symptoms constitutes effective treatment and/or prevention, including 10%, 20%, 30% or less, or stabilization of the disease. All technical or scientific terms used herein have the same meaning as commonly understood by those skilled in the art, unless otherwise defined. 11. Peptide In order to also recognize the phenotype of MYBL2, such as an antigen recognized by cytotoxic T lymphocytes (CTLs), the peptide derived from MYBL2 (SEQ ID NO: 6) was analyzed to determine whether it was a general condition. To the HLA (a 11 e 1 e) HLA (human leukocyte antigen)-a2 restricted epitope (Date Y ei a /., Tissue Antigens 47: 93-101, 1996; Kondo A et al. , J Immunol 155: 4307-12, 1995; Kubo RT a/., J Immunol 152: 391 3-24, 1 994). Candidates for HLA-A2 binding peptides from MYBL2 were confirmed based on their binding affinity for HLA-A2. The following peptides are considered to be candidate peptides: MYBL2-A02-9-597 (SEQ ID NO: 2), MYBL2-A02-9-1 44 (SEQ ID NO: 3) and MYBL2-A02-10-596 C sequence Identification number: 4). i/7 h After stimulating T cells by dendritic cells (dendr itic cel 1, DC) carrying these peptides, the following peptides were used to successfully establish cytotoxicity 19 201200525 τ lymphocytes: MYBL2-A02-9-144 (SEQ ID NO: 3) These established cytotoxic τ lymphocytes showed a strong and specific cytotoxic thymocyte activity against the target cells of the respective peptides. Here, these results demonstrate that MYBL2 is an antigen recognized by the cytotoxic lymphocytes, and the peptide is an antigen-resolved peptide of MYBL2 restricted by HLA-A2. Since the MYBL2 gene is overexpressed in cancer cells and tissues, including but not limited to, for example, testicular tumors, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer, and is not expressed in large Part of the normal organs, so it constitutes a good immunotherapeutic target. Accordingly, the present invention provides a nine-peptide (the peptide consists of nine amino acid residues) and ten peptides (the peptide consists of ten amino groups) corresponding to the epitope of the cytotoxic lymphocyte recognition of MYBL2. Preferred Examples of the Nine Peptides and Decapeptides of the Invention include those peptides having the amino acid sequence of 'Special 3' selected in Sequence Numbers: 2 to 4.

It is common to use software programs now available, for example, on the Internet, such as those described in Parker KC et al., J Immunol 1994 Jan 1, 152(1): 163-75, to calculate between various peptides and Binding affinity between hla antigens. For example, refer to parker kc aA, J

Immunol 1994 Jan 1, 1 52(1): 163-75; The binding affinity to HLA antigens can be measured as described in Kuzushima Ka/., Blood 2001, 98(6): 1872-81. A method for measuring affinity is described, for example, in Journal of Immunological Methods, 1995, 185: 181-190 20 201200525 and Protein Science, 2000, 9: 1838-1 846. Therefore, a fragment derived from MYBL2, which has a high binding affinity to Hu antigen, can be selected using this software program. The invention thus encompasses peptides consisting of any of the fragments from MYBL2, which are confirmed to be combined with Η&quot; by using such known programs. The peptide of the present invention can be composed of full length mYBL2. Preferably, the peptide P of the present invention has the additional amino acid residues on the side of the nine peptides and the ten peptides of the present invention as long as the peptides produced maintain their cell killing T lymphocyte inducing ability. The amino acid residues located on the side of the peptide of the present invention may be composed of any kind of amino acid, and they do not reduce the cytotoxic lytic lymphocyte inducing ability of the original peptide. Thus, the invention encompasses a peptide comprising a peptide derived from MYBL2 and having a binding affinity for an HLA antigen. Such peptides are generally less than about 4 amino acids, often less than about 20 amino acids, typically less than about 15 amino acids. In general, the modification of one, two or more amino acids in a peptide does not affect the function of the peptide and, in some instances, even enhances the desired function of the original protein. In fact 'known modified peptides (ie, peptides include one, two or more amino acid residues that have been modified (ie, substituted, deleted, added or inserted) when compared to the original reference sequence The amino acid sequence) maintains the biological activity of the original peptide (Mark et al., Proc Nat 1 Acad Sci USA 1984, 81: 5662-6; Zoller and Smith,

Nucleic Acids Res 1982, 10: 6487-500; Dalbadie-

McFarland et al., Proc Natl Acad Sci USA 1982, 79: 6409-13). Thus, in one embodiment, the peptide of the present invention has a cytotoxic T lymphocyte evoking ability and is selected from the sequence identification numbers: 2 to 4, and the specific 21 201200525 is the amino acid sequence of 3, wherein Insert, delete and/or replace one, two or even more amino acids. It is well known to those skilled in the art that changing the individual addition or substitution of a single amino acid or a small percentage of amino acid to an amino acid sequence tends to produce the property of preserving the original amino acid branch. Thus, they are often referred to as "conservative substitutions" or "conservative modifications" in which a change in a protein results in a modified protein having a function similar to that of the original protein. The conservative representation of providing functionally similar amino acids is well known in the art. Examples of the characteristics of the amino acid bond required to be protected include, for example, hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T) and a branch having the following common functional groups or characteristics: an aliphatic branch (G, A, V, L, I, P); Branch with hydroxyl group (S, Τ, Y); branch with sulfur atom (C, M); branch with carboxylic acid and amine (D, N, E, Q); branch with alkali (R, K, H); and containing aromatic branches (H, F, Y, W). In addition, the following eight groups are each included in the art as a conservatively substituted amino acid: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamine Acid (E); 3) Aspartame (N), glutamine (Q); 4) Arginine (R), lysine (K); 5) Isoleucine (I), white Amino acid (L), thioglycolic acid (M), proline (V); 6) albinoic acid (F), tyrosine (Y), tryptophan (w); 5 201200525 7) silk Amino acid (S), sulphonic acid (Τ); and 8) cysteine (C), methylthiobutyric acid (Μ) (see, for example, Creighton, Proteins 1984). Such conservatively modified peptides are also considered to be peptides of the invention. However, the peptide of the present invention is not limited thereto, and may include a non-conservative modification as long as the resulting peptide is produced to maintain the cytotoxic T lymphocyte stimulating ability of the original peptide. Further, the modified peptide does not exclude a polymorphic variant, an interspecies homologues, and a cytotoxic τ lymphocyte-inducing peptide of the MYBL2 allele (alleles). In order to maintain the necessary cellular toxic T lymphocyte eliciting ability, a small number (e.g., one, two or several) or a small percentage of amino acid can be modified (inserted by 'deletion, addition and/or substitution). The term "several" means 5 or less amino acids, for example 4, 3 or less. The percentage of the amine group to be modified is preferably 2% or less. 15% or less 'and even more preferably, 10% or less, or 1 to 5%. Further, the peptide of the present invention may be inserted, substituted or added with an amino acid residue or an amino acid residue. Can be deleted to achieve a higher affinity. When used in the immunotherapy herein, the peptide of the present invention should be expressed on the surface of a cell or exosome, preferably as a complex with Hu antigen. Therefore, it is preferred to select a peptide which not only induces a cytotoxic thymocyte but also has a high affinity for an HLA antigen. For this purpose, (iv) can be replaced, inserted and/or added by an amino acid residue. Modification to produce a modified peptide having improved binding affinity. In addition to the naturally expressed peptide, 23 201200525 is known to bind to the peptide sequence represented by the HLA antigen (j Immunol 1994, 152: 3913; Immunogenetics 1995, 41: 178; J Immunol 1994, 155: 4307) 'So can be based on Modification of this rule introduces the immunogenic peptide of the present invention. The peptide having high HLA-A2 binding affinity tends to have a leucine or methionine residue as the second amino acid from the N-terminus, The amino acid or leucine residue is a C-terminal amino acid. Accordingly, the present invention also encompasses a peptide having the amino acid sequence of SEQ ID NO: 2 to 4, wherein the amino acid sequence of the sequence number is The second amino acid at the N-terminus is substituted with leucine or methylthiobutanoic acid, and/or the C-terminal amino acid of the amino acid sequence of the sequence number is substituted with amic acid or leucine. Substitutions can be introduced not only at the terminal amino acid, but also at the potential T cell receptor (TCR) of the peptide. Some studies have demonstrated that a peptide with an amino acid substitution can be equal to or better than the original. For example, CAP1, p53 ( 264 - 2 72 ), Her~2/neu C 36 9 -377 ) or gplOO ( 209- 2 1 7 ) (Zaremba et al. Cancer Res. 57, 4570-4577, 1997, TK Hoffmann et Al. J Immunol. (2002) Feb 1;168(3): 1338-47., S. 0. Dionne et al, Cancer Immunol immunother. (2003) 52: 199-206 and S. 0. Dio Nne et al. Cancer Immunology, Immunotherapy (2004) 53, 307-314). The invention also contemplates the addition of one, two or several amino acids to the N and/or C terminus of the desired peptide. The present invention also encompasses such modified peptides having high HLA antigen binding affinity and maintaining cytotoxic T lymphocyte eliciting ability. 24 201200525 However, when a part of the amino acid sequence of an endogenous or exogenous protein with different functions is identical, it may induce side effects, such as autoimmune diseases and/or Or anti-adhesive drugs will be allergic to the substance. Therefore, it is preferred to use the available database to first perform a homologous search to avoid the amino acid sequence of the peptide being in conformity with the amino acid sequence of the other protein. When it is compared with the target peptide, there is more than one. When the homologous search for a peptide having one or two amino acids is clear, in order to increase its binding affinity with the comfort antigen, and/or increase The cytotoxic lytic lymphocyte-inducing ability without any risk of side effects can modify the target amino acid. Although the peptide having high binding affinity for HLA antigen as described above is expected to be highly potent, the candidate peptide selected as the indicated high affinity performance is further tested for the cytotoxicity of the cell toxic lymphocytes. . The phrase "cytotoxic lymphocyte-inducing ability" means the ability of a peptide to induce a cytotoxic lymphocyte in a cell, although it is expressed in an antigen-presenting cell. In addition, "the cytotoxic lytic lymphocyte-inducing ability, including The traits induce the activation of cytotoxic lymphocytes, the proliferation of cytotoxic lymphocytes, and the ability of cytotoxic lymphocytes to decompose target cells and increase the production of cytotoxic lymphocytes IFN- τ. Presenting cells (such as sputum-lymphocytes, macrophages, and dendritic cells (DCs)) or more specifically dendritic cells derived from human peripheral blood mononuclear cells by inducing antigens carrying human MHC antigens, and After stimulation, it was mixed with CD8-positive cells, and then IFN-τ produced and released by the cytotoxic T lymphocytes of the target cells was measured to determine the cytotoxic T lymphocyte-inducing ability. Such a reaction system can use genetically modified animals that have been produced to express human 25 201200525 HLA (for example, at BenMohamed L, Kr i shnan R, Longmate J, Auge C, Low L, Primus J, Diamond DJ, Hum Immunol 2000 Aug, 61 (8): Description in 764-79). For example, 51Cr can be labeled with such a radioactive target cell, and the cytotoxic activity can be calculated from the radioactivity released from the target cell. Or by measuring IFN-τ produced and released by cytotoxic tau lymphocytes in the presence of antigen-presenting cells carrying a fixed trait, and using anti-IFN-τ monoclonal antibody to IFN_r on the medium It can be seen to analyze the cytotoxicity of the cytotoxic lymphocytes. Due to the cytotoxic T lymphocyte eliciting ability of the test peptide as described above, it was found that the free sequence identification number shown here: 2 to 4, in particular, the nine peptide or the ten peptide in the amino acid sequence indicated by 3 It has a particularly high cytotoxic T lymphocyte inducing ability and high binding affinity to HLA antigen. These peptides are therefore preferred embodiments of the invention. Furthermore, the results of the homology analysis showed that those peptides did not have significant homology to peptides derived from any other known human gene product. When used in immunotherapy, it reduces the likelihood of an unknown or unwanted immune response increase. Therefore, also from this aspect, these peptides provide the use of an anti-MYBL2 immune response in cancer patients. Therefore, the peptide of the present invention is preferably a peptide having a sequence selected from the group consisting of 2 to 4, particularly 3 amino acid sequence. In addition to the above-described modification of the peptide of the present invention, the desired peptide can be further linked to other substances as long as they maintain the cytotoxic thymocyte inducing ability of the original peptide, and more preferably maintain the essential HU binding. The substances in the example of 2012 20122525 include: victoria, lipid, sugar and sugar chain, acetyl group, natural and synthetic polymers. The peptide of the present invention may additionally comprise modifications such as glycosylation branch oxidation and/or phosphorylation as long as the modification does not damage the biological activity of the original peptide. Such modifications may confer additional functionality (eg, target function and delivery function) and/or or stabilize the peptide. For example, in order to increase the stability of a multi-peptide in i.77 h叩, it is known in the art to introduce a D-amino acid, an amino acid mimetic or an unnatural amino acid; this content is also suitable for the multi-peptide of the present invention. . The stability of a multi-peptide can be analyzed in some ways. For example, peptidase can be used to test for stability using a variety of biological media, such as human plasma and serum (see, for example, Verh〇ef M,

Eur J Drug Metab Pharmacokin 1986, 11: 29 Bu 302). Furthermore, as mentioned above, in a modified peptide substituted, deleted or added by one, two or several amino acid residues, the same or higher than the original peptide can be screened or selected. Those active. The invention therefore also provides a method of screening or selecting a modified peptide having the same or higher activity as the original. The method comprises the steps of: a: substituting, deleting or adding at least one amino acid residue of the peptide of the present invention, b. determining the activity of the winning form, and C: selecting the same or higher than the original one. Active peptide. Here, the activity to be analyzed may include HLA binding activity, antigen presenting cells or cytotoxic T lymphocyte inducing ability and cytotoxic activity. Here, the peptide of the present invention can also be described as "MYBL2 peptide, or "MYBL2 multipeptide". 27 201200525 111. Preparation of MYBL2 peptide The peptide of the present invention can be prepared using well-known techniques. For example, The winning form can be synthesized synthetically using recombinant DNA technology or chemical synthesis. The peptide of the present invention can be synthesized alone or as a longer multi-peptide consisting of two or more peptides. The peptide can be isolated, ie purified or Is isolated so that it is substantially free of other naturally occurring host cell proteins and fragments thereof or any other chemical. The peptides of the invention may comprise modifications, such as glycosylation, branched oxidation or phosphorylation, which provide modification without damaging the original peptide Biological activity. Other modifications include combinations of amino-amino acids or other amino acid mimetics that can be used, for example, to increase the serum half-life of the peptide. The invention can be obtained by chemical synthesis according to selected amino acid sequences. Peptides. Examples of general peptide synthesis methods suitable for this synthesis include, but are not limited to: (i) Peptide Synthesis Interscience, New York, 1966; (ii) Protein (The Proteins), Vol. 2, Academic Press, New York, 1976; (iii) Peptide Synthesis (in Japanese), Maruzen Co., 1 975; (iv) Basis and experiment of peptide synthesis (Basics and Experiment of Peptide Synthesis) (in Japanese), Maruzen Co., 1 985; (v) Development of Pharmaceuticals 28 201200525 (second volume) (in Japanese), Vo 1. 14 (peptide synthesis) , Hirokawa, 1991; (vi) W099/67288; and (vii) Barany G. &amp; Merrifield RB, Peptides Vol. 2, "Solid Phase Peptide Synthesis", Academic Press, New York, 1980, 100-118. The peptide of the present invention can be obtained by using any genetic engineering method known to produce a peptide (for example, 'M〇rris〇nj, 】 Bacteri〇i〇gy 1977, 132: 349-51; C1ark-Curtiss &amp; Curtiss, Methods in Enzymology (eds. Wu e纟a/.) 1983, 101: 347-62). For example, a suitable vector is first prepared which harbors a polynucleotide encoding a target peptide in an expressible form (eg, downstream of a regulatory sequence corresponding to a promoter sequence) and transfers the vector Colonization into a suitable host cell. The host cells are then cultured to produce a peptide of interest. Using a ^ KJ iro translation system can generate a victory. IV. Polynucleotides The present invention also provides a multi-nucleotide acid which encodes any of the above-described peptides of the present invention. These include those from the genes of naturally occurring ships ((5) (10) Accession No. _2466 (SEQ ID NO: 5)) and those with conservatively modified nucleotide sequences. The term "conservatively modified nucleotide acid sequence" as used herein refers to a sequence of amino acid sequences which are identical or substantially identical. Due to the degradation of the genetic code, the large number of nucleic acids with the same function encodes any known protein. For example, the codes gca, gcc, CG, and GCU all encode amino acid alanine. Therefore, the password can be changed by specifying a position of each of the alanine by a password 29 201200525 to become any corresponding password which does not change the encoded winning. This nucleic acid change is ", sir lent variation", which is one of the conservative modification changes. Each nucleic acid sequence encoding a peptide here also describes every possible silent change in the nucleic acid. Those skilled in the art will appreciate that the various codes in a nucleic acid (except AUG' which is originally the unique code for methionine, and the unique code for tgg which is originally a tryptophan) can be modified to produce a functionally identical molecule. Thus, each silent change in the nucleic acid encoding a peptide is described as being implicitly described in each of the disclosed sequences. The polynucleotide of the present invention may be composed of DNA, RNA and derivatives thereof. The DNA suitably consists of bases such as bases a, τ, c and G, and T is substituted by U in RNA. The polynucleic acid of the present invention encodes a plurality of peptides of the present invention with or without an intermediate amino acid sequence therebetween. For example, an intermediate amino acid sequence can provide a polynucleotide or a translated peptide-cleavage site (e.g., an enzyme recognition sequence). Still further, a polynucleotide may comprise any additional sequence to a coding sequence that encodes a peptide of the invention. For example, the polynucleotide may be a recombinant polynucleotide comprising a regulatory sequence required for the performance of the peptide or may be a representation vector (plastid) having a marker gene and such. Generally, such recombinant polynucleotides can be prepared by manipulation via a polynucleotide using a general recombinant technique such as a polymerase and an endonuclease. Both recombinant and chemical synthesis techniques can be used to produce the polynucleotides of the invention. For example, a polynucleotide can be produced by insertion into a suitable vector which can be expressed when transfected into a competent cell. Alternatively, a polynucleotide can be amplified using the technique of 30 201200525 or expressed in a suitable host (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1989). Alternatively, polynucleotides can be synthesized using solid state techniques as described in Beaucage SLS Iyer RP, Tetrahedron 1992, 48: 2223-311; Matthes et al., EMBO J 1984, 3: 801-5. V. Exosomes The present invention further provides intercellular vesicles called exocytosis, which exhibit a complex formed between the peptide of the present invention and human leukocyte antigen. On the surface. Exosomes can be prepared using methods such as those detailed in Japanese Patent Application Kohyo Publications Nos. Hei 11_510507 and WO99/03499, and antigen-expressing cells obtained from patients receiving treatment and/or prevention. The exosome of the present invention can be vaccinated as a vaccine in a manner similar to the peptide of the present invention. The human leukocyte antigen form contained in the complex must conform to the human leukocyte antigen form of the individual in need of treatment and/or prevention. For example, in the Japanese group, HLA-A2, (especially α*〇201 and a*0206) is common and thus suitable for the treatment of Japanese patients. High performance The use of the A2 type between the person and the Caucasian helps to obtain an effective total fruit. It is generally pre-study in the clinical form of human leukocyte antigens in patients who are in need of treatment, which can appropriately select peptides with high binding affinity for specific antigens or cytotoxic T lymphocyte-induced properties via antigens. The peptide. In addition, in order to obtain a peptide with high binding 31 201200525 affinity and cytotoxic tau lymphocyte-inducing, it is possible to, based on, the amino acid sequence of the naturally occurring MYBL2 partial peptide of j μ, and then enter Substitution, insertion and/or addition of 2 or several amino acids. When the A2 type HLA antigen is used for the exosome of the present invention, the peptide having the sequence identification number: 2 to 4, particularly the sequence of 3, provides use VI. Antigen presenting cells The present invention also provides isolated antigen presentation. A cell which exhibits a complex formed between the HLA antigen and the peptide of the present invention on its surface. The antigen presenting cells may be derived from a patient being treated and/or avoided and may be administered by itself or in combination with a drug comprising the peptide of the present invention, exosome or cytotoxic T lymphocytes. Such as a vaccine. Antigen presenting cells are not limited to a particular type of cell, and include dendritic cells, Langerhans cells (Langerhans ce 11), macrophages, b cells, and activated T cells, which are known to represent proteinaceous antigens. The cell surface is recognized by the lymphocytes. Since dendritic cells are a typical antigen-presenting cell, which has the strongest cytotoxic T lymphocyte-inducing effect in antigen-presenting cells, dendritic cells are supplied using antigen-presenting cells such as the present invention. For example, the antigen presenting cells of the present invention can be obtained by inducing dendritic cells derived from peripheral blood mononuclear cells to be contacted (stimulated) with the peptide of the present invention by J λ H h or h叩. When the peptide of the present invention is administered to a body, an antigen-presenting cell which exhibits the peptide of the present invention is induced in the body of the individual. Therefore, the antigen-presenting cells of the present invention can be obtained by collecting antigen-presenting cells from the individual after administration of the peptide of the present invention to a single body. Or 32 5 201200525 The present cells are contacted with the peptide of the present invention. The antigen presenting cells of the present invention can be obtained by expressing the antigen collected from the individual. The antigen-presenting cells of the present invention can be administered to a single body to induce an anti-cancer immune response in an individual, alone or in combination with other drugs including the peptide of the present invention, exosome or cytotoxic lymphocytes. For example, ^mm administration can include the steps of: a: collecting antigen presenting cells from a first individual, b: presenting the cells with the peptide contacting step a, and c: administering the antigen presenting cells of step b to a second individual . The first individual and the first individual may be the same individual or may be different individuals. The antigen-presenting cells obtained from the step b can be administered as a vaccine for treating and/or preventing cancer, and the cancer includes a testicular tumor, a pancreatic cancer, a bladder cancer, a non-small cell lung cancer, a small cell lung cancer, and an esophageal cancer. The invention also provides a method or process for making a pharmaceutical composition comprising an antigen presenting cell, wherein the method comprises the step of mixing or formulating the peptide of the invention with a pharmaceutically acceptable carrier. According to one aspect of the invention, the antigen presenting cells have a high degree of cytotoxic T lymphocyte evoking ability. In the phrase "high degree of cytotoxic tauria-inducing ability", the degree of contact with the peptide by the antigen-presenting cells or the peptide which is incapable of inducing the cytotoxic tau lymphocytes is highly correlated. The antigen-presenting cell having the high degree of cytotoxic lytic lymphocyte inducing ability can be prepared by the method comprising the step of transferring the polynucleotide encoding the peptide of the present invention to the antigen-presenting cell by the method of /yj W and the method described above. . The introduced gene can be in the form of DNA or RNA. Examples of introduction methods 33 201200525 Sub-includes 'are not particularly limited' various methods generally performed in this field, such as scorpion plastid transfection (lip0fecti〇n), electroporation (electroporation) and calcium phosphate method. More particularly, it can be performed as in Cancer Res 1996, 56: 5672-7; J Immunol 1998, 161: 5607-13; J Exp Med 1996, 184: 465-72;

Japanese Translation of International Publication No. 20 00-509281. By transferring the gene into the antigen-presenting cell, the gene undergoes transcription, translation and such in the cell, and then the obtained protein is processed and carried out via a presentation pathway to present the peptide of the present invention. V11 - cytotoxic tau lymphocytes against any of the peptide-inducible cytotoxic tau lymphocytes of the present invention enhances the immune response of η叩 to cancer cells, and thus, as such, can be used as a vaccine similarly The present invention also provides an isolated cytotoxic axillary lymphocyte which is specifically induced or activated by any of the peptides of the present invention. Such a cytotoxic 7 lymphocyte can be obtained by (1) The peptide of the present invention is administered to an individual to collect a cytotoxic tau lymphocyte from the individual; or (2); the word is derived from an individual antigen presenting cell and (10) positive cell or a peripheral blood mononuclear lymphocyte and the present invention The peptide is contacted (stimulated) with &gt; 且 and then isolated by cytotoxicity p ^ ^ 林 1 linba ball, or (3) CD8 positive cells or

Peripheral blood mononuclear lymphocytes and sputum A octopus complex HLA antigen and peptide complexes on the surface of the antigen present cells or exocytosis in the heart and then separate the cell toxic T lymphocyte j ^ 丨 G G G bad, or (4) the introduction of a gene encoding a polynucleotide which is combined with the singularity of the present invention and which is combined with the singularity of the invention. 34 201200525 The above method can be described in detail in the following "viii. Cell or exosome, and (4) square T cell receptor (TCR), paragraph of the present invention cell cytotoxicity A lymphocyte "avoiding a disease, and can be administered by itself to a therapeutic or/or invention*, or for the purpose of modulation, in combination with other drugs including the peptide of the present month or the exosome The obtained cytotoxicity of the secondary cells [the lymphocytes act exclusively against the target cells, and the target cells exhibit the peptides of the present invention, for example, the same peptides for induction. The target cells may be the endogenous tables of the cells. Such as cancer cells, or cells that have been transferred to the #(四) gene; The peptide stimulates the expression of the peptide of the present invention on the cell surface, and can also serve as a target for activated cytotoxic T lymphocyte challenge. VI11_τ cell receptor (TCR) The present invention also provides a composition comprising the coding A nucleic acid capable of forming a multi-peptide of a subunit of a tau cell receptor, and a method of using the same, the subunit of the sputum cell receptor has the ability to form a tau cell receptor, which confers a specific cell to a tumor cell of a tumor cell The cells express MYBL 2. The τ cell-receptor subunits of the cytotoxic lymphocytes are identified by using methods known in the art: - and stone-branched nucleic acids, while the cytotoxic tau lymphocytes are Induction of one or more peptides of the invention (w〇2〇〇7/〇32255 with

Morgan et al., Jimmun〇i, 171, 3288 (2003)). For example, it is preferred to analyze the T cell receptor subunit by the polymerase chain reaction method. The polymerase chain reaction primer for analysis can be, for example, a 5'-R primer (5, -gtctaccaggcattcgcttcat-3') is a 5' end primer (Sequence 35 201200525 column identification number: 7) and 3-TRa-C primer (5'-tcagctggaccacagccgcagcgt-3') specific to the t-cell receptor alpha chain C region (SEQ ID NO: 8), 3-TRb-Cl primer (5'-tcagaaatcctttctcttgac-3') specific to tau cell receptor beta bond The C1 region (SEQ ID NO: 9) or the 3-TRbeta-C2 primer (5, ~ ctagcctctggaatcctttctc1; t-3') is specific to the T cell receptor beta chain C2 region (SEQ ID NO: 10) is the 3' primer. But not limited to it. The extracted T cell receptor can bind to the target cell expressing MYBL2 peptide with high affinity, and if necessary, /y?f/fo and "h iro centering effectively kill target cells expressing MYBL2 peptide. Encoding T cell receptor The subunit nucleic acid sequences can be combined into a suitable vector, such as a retroviral vector. Such vectors are well known in the art. Nucleic acids or vectors comprising the same can be transferred to a T cell, such as a T from a patient. Usefully, the present invention provides a ready-made (of-f-the-shelf) composition that allows rapid modification of tau cells (or other mammalian ones) possessed by a patient to quickly and easily produce excellent cancer cell killing Characteristic modified sputum cells. The specific sputum cell receptor can specifically recognize the complex of one peptide and HLA molecule of the present invention, and the specific activity of the sputum cell against the target cell when the sputum cell receptor is on the surface of the sputum cell. The specific recognition of the above complex can be confirmed by any known method, and preferred methods include, for example, the use of HLA molecules and tetramer analysis of the peptide of the present invention, and E LI SPOT analysis. By performing an EL I SPOT analysis, it was confirmed that a T cell expressing a tau cell receptor on the cell surface recognizes a cell by a T cell receptor, and message 5 201200525 is transmitted inside the cell. The above complex can also be used to confirm the cytotoxic activity of a tau cell by the known method when present on the surface of the tau cell. The preferred method includes, for example, '丨', &gt; UT Λ, for example, 'anti-HLA risk target cell Cytotoxic activity assays, such as chromium release assays. The invention also provides cytotoxic tau lymphocytes by encoding in the presence of HLA-2 with, for example, sequence identification numbers: 2 to 4, particularly 3 The MYBL2 peptide binds to the nucleic acid of the sputum cell receptor subunit polypeptide to be transduced. The transduced cytotoxic sputum lymphocytes can be "&gt; 〇 guided to cancer cells, and can be cultured by well-known methods. Expansion (for example

KaWakami J 1 with unol., 142, 3452-3461 (1 989)). The cytotoxic T lymphocytes of the present invention can also be used to form a consensus immunological composition which is effective in treating or avoiding cancer in a patient in need of treatment or protection (W02006/031221). IX. Pharmaceutical agents or compositions due to normal Compared with tissues, MYBL2 is particularly enhanced in cancer, including testicular tumors, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer. 'The peptide of the present invention or the stone of the invention is such a victory. Polynuclear acid can be used for the treatment and/or prevention of cancer or tumors, and/or to avoid recurrence after surgery. Accordingly, the present invention provides a pharmaceutical agent or composition for treating and/or preventing cancer or tumor 'and/or avoiding recurrence after surgery'. Such agents or compositions include one or more of the present invention. This triumphant multi-nucleotide is used as an active ingredient. Alternatively, the peptide of the present invention can be expressed on any uranium exosome or cell surface&apos;, e.g., antigen presenting cells, for use as a pharmaceutical agent or composition. Further, the above-mentioned cytotoxic tau lymphocytes which are the target of the present invention 37 201200525: the peptide can also be used as an active ingredient of the pharmaceutical agent or composition of the present invention. In another embodiment, the invention also provides for the use of an active ingredient in the manufacture of a pharmaceutical composition or agent for treating cancer or a tumor, selected from: (a) a peptide of the invention; a form of expression encoding a nucleic acid of such a peptide as disclosed herein; (C) exhibiting a peptide of the present invention on a sputum; an antigen present on the surface of a u σ job having a cell or an exosome; and (d) The cells of the invention are toxic to lymphocytes. Alternatively, the present invention further provides that the active ingredient for treating cancer of the tumor is selected from: (a) a peptide of the invention; (8) a nucleic acid encoding the peptide as disclosed herein in a form that can be expressed; c) exhibiting a win of the present invention in Gansheng LL, the antigen on the surface of the peptide exhibiting cells or exocytosis; and (4) the cytotoxic tau lymphocytes of the present invention. Or 'the invention further provides a method; a method and system for treating a pharmaceutical composition or a reagent for cancer or a tumor, and a sputum, a 'cracking sputum, wherein the method or process includes placing a drug on the drug Or a physiologically acceptable step of formulating the gamma carrier together with the active ingredient, the active ingredient being selected from: / (a) the peptide of the invention; (b) in the form of a representable x' bat code as disclosed herein Such a nucleic acid of the peptide 5 38 201200525; (C) exhibiting an exosome of the present invention; and presenting an antigen presenting cell on the surface thereof or (d) the cell toxic lymphocyte of the present invention is an active ingredient . In still other embodiments, the invention also provides a method or process for making a pharmaceutical composition or agent for treating or avoiding cancer or a tumor, and wherein the method or process comprises - combining the active ingredient with - pharmaceutically or physiologically The step of admixing the accepted carriers, wherein the active ingredient is selected from: (a) a peptide of the invention; (b) a nucleic acid encoding the peptide as disclosed herein in a form that can be expressed; (c) a performance An antigen presenting a peptide on its surface exhibits a cell or an exocytosis; and (d) a cytotoxic tau lymphocyte of the invention. Alternatively, the pharmaceutical composition or agent of the present invention can be used for either or both of the prevention of cancer or tumor and the avoidance of recurrence after surgery. The pharmaceutical agent or composition of the present invention provides for use as a vaccine. In the context of this term, the wording "vaccine", (also referred to as a consensus immunological composition) means that the inoculum to the animal has the function of inducing anti-tumor immunity. The pharmaceutical agent or composition of the invention can be used for Treating and / or avoiding cancer or swelling,; beta 4 and / or its recurrence after surgery is avoided in a body or patient order, individual or, forgetting $ h / including humans and any other mammals, including, but Not limited to mice, gentry, guinea pigs, rabbits, miscellaneous, dogs, sheep, goats, 39 201200525 牛牛.马#子, 狒狒 and black, especially a commercially important animal or domesticated animal According to the present invention, it has been found that the peptide having the sequence identification number: 2 to 4, particularly the amino acid sequence of 3, is a hu_a2 restricted epitope peptide or candidate which can induce strong and specific An immunological reaction. Therefore, the pharmaceutical agent or composition of the present invention comprising any of the two peptides having the sequence identification number: 2 to 4', particularly the amino acid sequence of 3, is particularly suitable for administration to an individual having an antigen of HLA-A2. The same thing To a pharmaceutical agent or composition comprising a polynucleotide encoding any of the peptides (i.e., the polynucleotide of the present invention). The cancer or tumor treated by the pharmaceutical agent or composition of the present invention is not limited to and includes wherein MYBL2 ( For example, all types of cancer or tumors that are overexpressed, including 'eg, pill cancer, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer. The pharmaceutical agent or composition of the present invention may include In addition to the active ingredient, there are other peptides that induce the ability of the cytotoxic lymphocytes to resist cancer-like cells, other polynucleotides encoding the other peptides, other cells expressing the other peptides, or the like. Other peptides having the ability to induce cytotoxic T lymphocytes against cancer-like cells are exemplified by cancer-specific antigens (eg, defined tumor-associated antigens), but are not limited thereto. If desired, the pharmaceutical agents of the invention or The composition may include other therapeutic substances as an active ingredient as needed, as long as the substance does not inhibit the antitumor effect of the active ingredient, the active ingredient Such as any of the peptides of the present invention. For example, the formulation may include anti-inflammatory agents, analgesics, chemotherapeutics and the like. In addition to the package 5 40 201200525 including other therapeutic substances in the agent itself, the agent of the present invention may be combined with or The other pharmaceutical agents are administered sequentially or simultaneously. The amount of the agent and the pharmaceutical agent depends on, for example, which pharmaceutical agent is used, the disease to be treated, and the manner of administration. It should be understood that, in addition to the ingredients specifically mentioned herein. In addition, the pharmaceutical agents or compositions of the present invention may include other agents generally in the art having formulation forms in question. In one embodiment of the invention, the pharmaceutical agents or compositions of the invention may be included in the manufacture. Goods and kits that contain materials useful for the pathology of the disease to be treated, such as cancer. The article of manufacture may comprise a container of any of the pharmaceutical agents or compositions of the invention having a label. Suitable containers include crucibles, vials and test tubes. The container can be formed from a variety of materials such as glass or ". The label on the container indicates that the reagent is used to treat or avoid the disease - or multiple conditions. The label may also indicate the indication of administration. In addition to the above-described containers, the kit comprising the pharmaceutical agent or composition of the present invention may further comprise, if desired, a second container which stores a pharmaceutically acceptable diluent. It may further comprise a commercial or user point of view. Other materials needed 'include other buffer solutions, diluents, buffers, needles, syringes, and package inserts with instructions for use. ° 药学 Pharmaceutical reagents or compositions can be presented in a pack or dispenser if desired 'It may comprise one or more unit dosage forms containing the active ingredient. The package may, for example, comprise a metal or _, such as a foam box (10). The pack or dispenser may be accompanied by a dosing indication. 41 201200525 (1) Pharmaceutical reagents Or the composition comprising the peptide as an active ingredient can be directly administered to the peptide of the present invention as a pharmaceutical reagent or composition, if necessary, which can be formulated by a general formulation method. In the following examples, in addition to the peptide of the present invention, It is not particularly limited as long as it is suitable to include a carrier, an excipient, and the original as a drug. An example of the above carrier is sterilized water physiological saline, phosphorus. A buffer solution and a culture fluid and the like. Further, if necessary, the pharmaceutical agent or composition may contain a stabilizer, a suspension, a preservative, a surfactant, and the like. Or the composition can be used for anti-cancer purposes. The peptide of the present invention can be prepared as a combination consisting of two or more peptides of the present invention to induce cytotoxic T lymphocytes with h W . They may be performed in the form of cocktails or may be combined with each other using standard techniques. For example, 'the peptides may be chemically linked or behave as a single fused multi-peptide sequence 歹! The winnings may be the same or different. By giving the triumph of the invention 'High-density presentation of peptides to antigen-presenting cells by HLA antigens, followed by induction of cytotoxic T lymphocytes that form a specific response to the complex between the peptide and the HLA antigen" or antigen-presenting cells (eg The dendritic cells are removed from one body and then stimulated with the peptide of the present invention to obtain antigen-presenting cells which exhibit any of the peptides of the present invention on the cell surface thereof. The cells are then administered to the individual to induce cytotoxic T lymphocytes in the individual, and thus may increase the invasion toward the tumor-associated endothelium. - A pharmaceutical agent or composition for treating and/or avoiding cancer or tumor, the package thereof The peptide of the present invention is an active ingredient, and may also comprise an adjuvant known to effectively build up the cell immunity of 42 201200525. Alternatively, the pharmaceutical agent or composition may be administered with other active ingredients or formulated. Fine particles are administered. An adjuvant refers to a compound that, when administered (or sequentially) with an immunologically active protein, enhances the anti-protein immune response. Adjuvants considered herein are included in the literature (Clin M1Cr〇b1) 〇1 Rev 1 994, 7: m 89. Examples of suitable adjuvants include aluminum phosphate, aluminum hydroxide, alum, cholera toxin, salmonella toxin, Freund's incomplete adjuvant (Inc〇mpiete) Freund*s adjuvant, 〖FA), Freund's complete adjuvant (c〇mplete

Freund’s adjuvant, CFA), ISCOMatrix, GM-CSF, CpG, 0/W emulsions and the like, but are not limited thereto. Further, it can be conveniently used in a liposome formulation and a fine particle formulation in which a peptide is linked to a bead of several micrometers in diameter, and in a formulation in which a lipid is linked to a peptide. In another embodiment of the invention, the peptide of the invention may also be administered in the form of a pharmaceutically acceptable salt. Preferable examples of the salt include a metal salt, a metal salt, a salt having an organic base, a salt having an organic acid, and a salt having an inorganic acid. As used herein, the phrase "pharmaceutically acceptable salts" means maintaining the biological effectiveness and properties of the compound and obtaining it from inorganic acids or assays such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, acid, and acid. (methanesulfonic acid), ethanesulfonic acid, p-toluenesul fonic acid, salic acid (sal icy 1 ic acid) and those analogs thereof. Examples of preferred salts include salts having a metal test, a salt having a metal, a salt having an organic base, a salt having an organic acid, and a salt having an inorganic acid. 43 201200525 In some embodiments, a pharmaceutical agent or composition of the invention may further comprise a component that initiates a cytotoxic T lymphocyte. Lipids have been defined as agents that can initiate cytotoxic T lymphocytes of antiviral antigens. For example, a palmitic acid residue can be attached to the epsilon- and a-amino group of an amine acid residue, and then linked to one of the peptides of the present invention. The lipid peptide can then be administered directly into the micelles or granules, incorporated into the liposomes or emulsified in an adjuvant. Another example of a lipid-inducing cytotoxic lymphocyte reaction is [co / / lipoprotein, such as tripalmitoyl-S-glycerylcysyl-seryl-serine (tripalmitoyl-S-glycerylcysternyl-seryl-serine, P3CSS) can be used to initiate cytotoxic tau lymphocytes, when covalently attached to a suitable peptide (see 'eg Deres et al., Nature 1989, 342: 561-4) , intradermal, subcutaneous, intravenous injection or the like, as well as systemic administration or topical administration to adjacent areas of the target location. It can be administered by a single person or by multiple administrations. The dosage of the present invention can be suitably adjusted depending on the disease to be treated, the age of the patient, the body weight, the administration method, and the like, and the dosage of the peptide of the present invention is generally 〇1〇〇 to 1 000 mg, for example, i. i mg to 10 mg, and can be administered once every few days to several months. Those skilled in the art will be able to suitably select a suitable dosage. (2) The pharmaceutical agent or combination does not include polynucleic acid as the active ingredient. The pharmaceutical agent or composition of the present invention may also comprise a nucleic acid in an expressible form which encodes the peptide disclosed herein. The phrase "in a form that is expressible" as used herein means a polynuclear acid which, when introduced, is expressed as a multi-peptide which induces anti-tumor immunity. The nucleic acid sequence of the polynucleotide of interest in __ represents Example 5 44 201200525 includes regulatory elements necessary for the expression of the polynucleotide. The polynucleotide can be assembled to achieve stable insertion of the target cell into the target cell (see, for example, Thomas KR &amp; Capecchi MR, Cell 1 987. 51: 503-1 2, which describes the homologous recombination cassette vector). See, for example, w〇lff ei a/., Science 1990, 247: 1465-8; US Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO 98/04720) Examples of DNA delivery techniques Including "naked dna", delivery (bupi vacaine, polymer, peptide centered) delivery, cationic lipid complex and particle centered ("gene gun") or pressure centered delivery (see, for example, US Patent No. 5, 922, 687). The peptide of the present invention can also be expressed by a viral or bacterial vector. Examples of performance vectors include attenuating viral hosts such as vaccinia or fowl pox. This method involves the use of a vaccinia virus, such as a vector to represent the nucleotide sequence encoding the peptide. By introducing a host, the recombinant vaccinia virus exhibits an immunogenic peptide and thus causes an immune response. The vaccinia carrier and method which are effective in the immunization step are described, for example, in U.S. Patent No. 4,722,848. Another vector is BCG (Baci lie Calmette Guerin). The BCG vector is described in St〇ver et al., Nature 1991, 351: 456-60. A variety of other vectors useful for administration or immunization, such as a gland-and adenovirus-related vector, a retroviral vector, a Salmonella tymphium (Salm0nella ty ph 1) vector, a detoxified anthrax toxin vector, and the like are apparent. See, for example, Shata ei a, Mol Med Today 2000, 6: 66-71;

Shedlock et al., J Leukoc Biol 2000, 68: 793-806; Hipp 45 201200525 ef 3 plant, /λ 2000, 14: 571-85. The delivery of the polynucleotide into a single body can be direct, in which case the individual is directly exposed to a vector carrying the polynucleotide, or indirectly, in which case the cell is first /λ I//ire? The polynucleotide is transformed and the cells are then transferred into the individual. These two methods are known as _/yj j/·/ and ez 7/ κσ gene therapy. For a general review of methods of gene therapy, see Goldspiel ei a, Clinical Pharmacy 1993, 12: 488-505; Wu and Wu, Biotherapy 1991, 3: 87-95; Tolstoshev, Ann Rev Pharmacol Toxicol 1993, 33: 573-96 Mulligan, Science 1993, 260: 926-32; Morgan &amp; Anderson, Ann Rev Biochem 1993, 62: 191-217; Trends in Biotechnology 1993,

11 (5): 155-215). Methods well known in the art of recombinant DNA can also be used in the present invention, described in the editor Ausubel ei a/,, Current Protocols in Molecular Biology, John Wi I ey &amp; Sons, NY, 1993; and Krieger, Gene Transfer and Expression , A

Laboratory Manual, Stockton Press, NY, 1990. The method of medicinal administration can be administered orally, intradermally, subcutaneously, intravenously, or the like, as well as in the vicinity of systemic administration or topical administration to a targeted location. A single administration can be performed or by multiple administrations. The dosage of the polynucleotide in a suitable vector or in a cell transformed with a polynucleotide encoding the peptide of the present invention may suitably be according to the disease to be treated, the age of the patient, the body weight, the method of administration, and the like. Adjusted, and the dosage of the peptide of the present invention is generally from 0.001 mg to 1 〇〇 0 mg, for example, 〇i mg to 1 〇, and can be 46 201200525 % mother days once to prepare for B, mother months Give it once. Those skilled in the art will be able to suitably select a suitable dosage. X·Use wins, outer buckets/丨, cards.

Method for stimulating j, body, antigen-presenting cells and cytotoxic T lymphocytes The use of the present invention and polynucleic acid can be used to prepare or induce antigen-presenting cells and cytotoxic T lymphocytes. The extracorporeal and antigen-presenting cells of the present invention can also be used to induce cytotoxic T lymphocytes. The phenotype, the polyglucoside and the antigen presenting cells can be used in combination with any other compound, as long as the compound does not inhibit its cytotoxic T lymphocyte evoking ability, any of the above-mentioned pharmaceutical agents or compositions of the present invention can be used Induction of 'field cytotoxic tau lymphocytes' and in addition, the second including the peptide and the polynucleoside complex can also be used to induce antigen-presenting cells, as discussed below. (1) Method for inducing antigen-presenting cells The present invention provides a method of inducing antigen-presenting cells having high cytotoxic tau lymphocyte-inducing ability using the peptide or polynucleotide of the present invention. The method of the present invention comprises the step of contacting the antigen presenting cells with the peptide of the present invention by M &quot;叩 or h. For example, the method of contacting the antigen presenting cells with the peptide may comprise the steps of: a: collecting antigen presenting cells from one body; and b: contacting the antigen presenting cells of step a with the peptide. The antigen presenting cells are not limited to a specific kind of cells, and include dendritic cells, Langerhans cells (cegerhans ceU), macrophages, B cells, and activated tau cells, which are known to express proteins (pr〇teinace〇us). The antigen is recognized by the lymphocytes on its cell surface. Dendritic cells can be preferably used, 47 201200525 because of their strongest cytotoxic thymocyte-inducing ability in antigen-presenting cells. Any of the peptides of the invention can be used as the peptide of step b either by themselves or with other peptides of the invention. Alternatively, the peptide of the present invention can be administered to a body such that the antigen exhibits cell Η FC? in contact with the peptide. Therefore, an antigen-presenting cell having a high cytotoxic lymphocyte-inducing ability can be induced in an individual. Accordingly, the present invention also contemplates a method of administering a peptide of the present invention to a body to induce antigen-presenting cells. It is also possible to administer a polynucleotide encoding the peptide of the present invention to an expressible form such that the peptide of the present invention is expressed and the knife F/F0 is brought into contact with the antigen presenting cells, thereby An antigen-presenting cell having an ability to induce cytotoxic lymphocyte inducing cells is induced. Thus, the present invention also contemplates the administration of a polynucleotide of the present invention to a single body to "h叩 induce antigen-presenting cells. The expression "expressible form," is defined in the above paragraph 'IX. Pharmaceutical reagent or composition pharmaceutical reagent Further, the present invention may include introducing the polynucleotide of the present invention into an antigen-presenting cell to induce an antigen-presenting cell having a cytotoxic T lymphocyte-inducing ability. For example, the method may include the steps of: a: collecting antigen-presenting cells from one body; and b: introducing a polynucleotide encoding one of the peptides of the present invention. Step b can be performed as described in the reference to the VI-antigen-presenting cells. 2) Method for Inducing Cytotoxic Thirteen Lymphocytes The present invention also provides a method for inducing cytotoxic tau lymphocytes using the peptide, polynucleotide, exosome 48 201200525 or antigen presenting cells of the present invention. The present invention also provides A method for inducing a cytotoxic tau lymphocyte using a polynucleotide encoding a multi-peptide, the ability of the multi-peptide to form a tau cell receptor subunit And the tau cell receptor subunit recognizes a complex of the invention and the HLA antigen. Preferably, the method for inducing the cytotoxic tau lymphocyte comprises at least one step of selecting the following: a) positing a CD8 The sputum cell is contacted with an antigen presenting cell and/or an exosome, the antigen presenting the cell and/or the exosome exhibiting a complex of an HLA antigen and a peptide of the present invention on its surface, and b) A polynucleotide is introduced into a CD8-positive T cell, wherein the polynucleotide encodes a multi-peptide that has a force to form a tau cell receptor subunit, and the tau cell receptor subunit identification A complex of a peptide of the invention and an HLA antigen. When the peptide, polynucleotide, antigen-presenting cell or exosome of the present invention is administered to a body, the cell toxic lymphocytes are induced in the body. And the intensity of the immune response targeting cancer cells is enhanced. Therefore, the present invention also contemplates a method comprising administering a peptide, a polynucleotide, an antigen presenting cell or an exosome of the present invention to a body. Induced cytotoxic T-leaching The step of the ball. Or, by their use of ex h, it can also induce cytotoxic thymocytes. In such cases, 'inactivated cytotoxic lymphocytes after inducing cytotoxic T lymphocytes Returning to the individual. For example, the method of the invention for inducing cytotoxic tau lymphocytes can include the steps of: a) collecting antigen presenting cells from one body; 49 201200525 b): bringing the antigen of step a) to the cell and contacting the peptide And co-culturing the antigen-presenting cells of step b with CD8-positive cells. The antigen-presenting cells to be co-cultured with (10) positive cells in the above step c can also be obtained by transferring a gene including the polynucleic acid of the present invention into an antigen. The cell, as prepared in the aforementioned paragraph "VI. Antigen presenting cells, described in j; however, the invention is not limited thereto" and includes any effective expression - a complex of the HLA antigen and the peptide of the present invention on its surface The antigen presents the cells. Instead of such an antigen presenting cell, an exosome expressing a complex of a single-heart antigen and a peptide of the present invention on its surface may also be used. In other words, the present invention also contemplates a method in which an exosome having a complex of a HU antigen and a peptide of the present invention on its surface is co-cultured with (10) positive cells. Such exosomes can be prepared by the method described in the above paragraph "V. U.S. s., by including the T-cell-human-single that encodes a peptide of the present invention. The gene of the polynucleotide is introduced into (10) positive cells to induce, cytotoxic T lymphocytes. This transduction can be performed as described in the aforementioned paragraph ""VIJ. τ cell receptor (TCR)". The invention also provides a method or process for the manufacture of a pharmaceutical agent or composition for inducing a cytotoxic tau lymphocyte, wherein the method comprises the step of mixing or formulating the peptide of the present month with a pharmaceutically acceptable carrier. Method for Inducing Immune Response Further, the present invention provides a suitable disease for inducing an immune response against a disease associated with 峨2, including cancer, and examples thereof include, but are not limited to, testicular 50 201200525 small cell lung cancer and oncology, pancreatic cancer, bladder cancer Non-small cell lung cancer tract cancer. The method of the invention may comprise the step of administering 4 doses or compositions comprising any of the peptides of the invention or encoding ceramide nucleoside i. The method of the invention also contemplates administration of any of the inventions Peptide outside the peptide Or antigen presenting cells. Section II refers to the item "IX. Pharmaceutical Reagents or Compositions", particularly the part in which the reagent or composition of the present invention is used for a vaccine. Further, it can be used in the method of inducing an immune response of the present invention. The exocytosis and antigen-presenting cells are described in detail in the previous "v. Xi Bu Tu Body", "νι· &amp; original cells and X. use wins, exosome, antigen presenting cells and The method of cytotoxic sputum lymphocytes" (1) and (7). The present invention further provides a method of inducing an anti-cancer disease in an individual, such as a pill tumor, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer. To this end, the invention includes a method of making a pharmaceutical agent, substance or composition for inducing an immune response, wherein the method comprises mixing or formulating a peptide or polynucleotide of the invention together with a pharmaceutically acceptable carrier step. Alternatively, the method for inducing an immune response comprises the step of formulating and administering a vaccine of the invention, the vaccine comprising: (a) - or more antigenic epitope peptides of the invention, or an immunologically active fragment thereof; - or a plurality of polynucleotides encoding the epitope of the (a) peptide or immunologically active fragment; (c) one or more of the isolated cell toxic lymphocytes of the invention; or 51 201200525

Cd) - or a plurality of isolated antigens of the invention present cells. In the context of the present invention, cancers that overexpress MYBL2 can be treated with these active ingredients. Examples of such cancers include, but are not limited to, testicular tumors, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer. Therefore, prior to administration of the vaccine or pharmaceutical composition comprising the active ingredient, it is preferred to confirm whether the expression of MYBL2 is increased in the cancer cells or tissues to be treated compared to the normal tissues of the same organ. Thus, in an embodiment, the invention provides a method of treating (over-expressing) a cancer of MYBL2, the method comprising the steps of: i) measuring MYBL2 expression obtained from cancer cells or tissues having an individual to be treated by the cancer Degree; ... 1 i) comparing the degree of MYBL2 performance with the normal control group; and ui) selecting at least one component of the group consisting of (3) to (1) above to have excessive performance compared with the normal control group The individual of the cancer of mybl2. Alternatively, the invention may also provide a vaccine or pharmaceutical composition comprising at least one component selected for administration to an individual having an over-expressed cancer. In other words, the invention Further, it is a method for identifying an individual to be treated by the present invention, and the method includes the step of measuring the degree of 峨2 in the cancer cells or tissues of the individual, wherein the degree of normal control of the gene is compared , to the extent that the individual has a cancer that can be treated by the multi-peptide of the present invention. The method of treating cancer of the present invention is described in more detail below. The individual to be treated by the present invention is more It is a mammal. The mammals of Momo 52 201200525 include, but are not limited to, for example, animals, mice, rats, dogs, horses, horses and cattle. Non-human primates are determined according to the present invention. The degree of MYBL2 expression of an individual. The degree of performance was determined using the technique, the degree of product in the I, or the acid in the tissue. Example: domain borrowing:: can use the probe to transcribe (nuclear phase hybrid method "handling l northern hybrid") can use the probe to execute the amount of the offense. It can be executed on the array (4). The use of the array is preferably used. For detection of the second degree. Using the sequence information of the ship 2, those skilled in the art can prepare such a probe. For example, the 瞧 2 峨 can be used as a probe. If a suitable marker can be used to mark the probe, for example Dyes, fluorescent substances and isotopes' and the degree of expression of the gene can be said to be the intensity of the heterozygous marker: any cell or tissue derived from the individual can be used for the determination of mybl2 expression as long as it includes the target transcription of MYBL2 Or translation products. Examples of suitable samples include, but are not limited to, body tissues or liquids, such as blood, saliva, and urine. Preferably, the cells or tissues derived from the individual comprise a cell population comprising an epithelial cell, preferably It is a cancer epithelial cell or an epithelial cell from a tissue suspected of being cancerized. Further, if necessary, the cell can be purified from the obtained body tissue or liquid, and then used as a sample derived from the individual. An amplification-base detectin method (eg, RT-PCR) can be used to quantify the transcript of MYBL2 using primers. Such primers can be prepared based on the available sequence information of the gene. In particular, for use in the method. Probes or primers are heterozygous to MYBL2 mRNA under stringent, moderately stringent, low stringency conditions. As used herein, the phrase "stringent (heterozygous) conditions" means that at this time, 53 201200525 probes or primers under conditions Will be heterozygous to its target sequence, rather than other sequences. Severe conditions are sequence dependent (seqUence_dependent) and will be different under different circumstances. Compared to shorter sequences, specific heterozygous sequences of longer sequences are observed at higher temperatures. In general, the temperature of a stringent condition selected at a defined ionic strength and pH is about 5 ° C below the melting point (Tm) of a particular sequence. Tm is the temperature (in a defined ionic strength versus pH and nucleic acid concentration) Lower) '5% of the probes under the equilibrium with the complementary target sequence are hybridized to the target sequence. Since the target sequence is usually present in excess, at Tm, under equilibrium 50 % of the probe is occupied. Generally speaking, the 'stringent condition is that the salt concentration is less than 1.0 Μ sodium ion, generally about 〇. 〇1 to 1. 〇μ sodium ion (or other salt) at pH 7.8 to 8. 3, and for short probes or primers (eg '10 to 50 nucleotides) the temperature is at least about 3 〇. 〇, for longer probes or primers &amp; temperature is at least about 6 〇°c. It is also possible to add destabi 1 izing agent, such as formamide, to meet stringent conditions. Probes or primers can be of a specific size. The range of sizes starts at least one. Nucleotide, at least 12 nucleotides, at least 15 nucleotides, at least 2 nucleotides, at least 25 nucleotides, at least 3 nucleotides, and the probe and primer extensions begin at 5-1 nucleotides, 1 〇 _ 5 nucleotides, 1 〇 2 nucleotides, 20-25 nucleotides and 25-30 nucleotides. Alternatively, the translation product can be detected for the diagnosis of the present invention. For example, the amount of MYBL2 protein (SEQ ID NO: 6) can be determined. A method for determining the amount of a protein as a transcription product includes an immunoassay method which specifically recognizes the protein using an antibody. The antibody may be single or multiple plants. In addition, any fragment or modification of antibody 54 201200525 (eg, chimeric antibody, scFv, Fab, F(ab,) 2, Fv, etc.) can be used to detect, as long as the fragment or modified antibody is maintained Binding ability to MYBL2 protein. Methods for the preparation of these classes of antibodies for protein detection are well known in the art, and any method can be used in the present invention to prepare such antibodies and their equivalents (equ i va ent). For another method for detecting the degree of expression of the MYBL2 gene based on the MYBL2 gene translation product, the staining intensity can be measured by immunohistochemical analysis using an antibody against the MYBL2 protein. That is, in this assay, strong staining indicates the presence/degree of increased protein and the high degree of expression of the MYBL2 gene. It can be confirmed that the expression weight of the target gene such as the mYBL2 gene is increased in cancer cells if it is increased compared to the degree of control group of the target gene (for example, 'degree in normal cells), for example, i, (10), Or %, or increase greater than hl times, greater than 1.5 times, greater than 2.0 times, greater than 5. 〇 times, greater than 1 〇. 〇 times or more. The degree of the control group can be determined simultaneously with the cancer cells by using a sample that is previously known from the individual/the disease stage (cancerous or non-cancerous) and the left and the left. In addition, the normal fine-feathers that were obtained from the non-cancer areas of the organs to be treated with cancer were inferior, and were used as the normal control group. Alternatively, the degree of the control group can be determined by statistical methods based on the results of the degree of expression of the 2 genes in the sample from the individual whose disease degree is known by the knife analysis. In addition, the degree of tamper formation can be a database of performance profiles from previous test cells. Further, according to one aspect of the present invention, the degree of expression of the MYBL2 gene in a biological sample of a 55 201200525 can be compared with a plurality of control group degrees, and the degree of the control group is determined from a plurality of reference samples. Preferably, a control panel is used to determine a reference sample from a tissue form that resembles a tissue form derived from an individual biological sample. Furthermore, it is preferred to use a standard value of the degree of expression of the MYBL2 gene in a group of known disease stages. Standard values are available from any method known in the art. For example, the average value 仏 2 standard deviation or the average value +/_3 standard deviation ' can be used as the standard value. In the context of the present invention, the degree of control of a biological sample known to be non-cancer from P 4 is considered to be - "normal control group degree" m if the control group is determined from a biological tissue of a cancer, Means a degree of cancer control, which can be normalized to the degree of expression of the control group to control the degree of expression of the nucleic acid, such as the ousekeeping gene, cancer and non-cancer according to the cell The degree is known to be... and different. Exemplary control genes include, but are not limited to, beta actin, glycerol _3_phosphate dehydrogenase

Cglyceraldehyde-3-phosphate dehydrogenase)^ ^ ^ ^ White P Bu When compared with the normal control group, the degree of expression of the MYBL2 gene is increased or phase A / equivalent to the degree of cancer control group, the individual can be diagnosed as having cancer to be treated. The present invention also provides (1) a method of diagnosing or confirming whether a subject is suspected of having cancer to be treated, knife/and/or (11) selecting an individual to be treated for cancer, the method comprising the steps of · 201200525 a) measuring in cancer 钿In cells or tissues, the degree of expression of MYBL2 is obtained from individuals suspected of having cancer to be treated; b) the degree of expression of MYBL2 compared with the normal control group; the degree of performance of 〇若丑2 and the degree of normal control group The individual is diagnosed as having the cancer to be treated; and d) the individual who is selected or confirmed to be treated for cancer if the individual is expected to have the cancer to be treated in (4) c). Or 'this method may include the steps of: a) determining the extent of expression of MYBL2 in a cancer cell or tissue obtained from an individual suspected of having a cancer to be treated; b) comparing MYBL2 with a cancer control group Degree of performance; c) if the degree of expression of MYBL2 is similar or equal to the extent of the cancer control group, the individual is diagnosed as having cancer to be treated; and d) if the individual is diagnosed as having cancer to be treated in step c) Select or confirm the individual to be treated for cancer. The invention is also intended for use in a kit to determine that a subject is suffering from a cancer that can be treated with the MYBL2 multipeptide of the invention, which is also useful in assessing and/or monitoring the efficacy of cancer immunotherapy. Preferably, the cancer includes, but is not limited to, sputum tumor, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer, and esophageal cancer. More particularly, the kit preferably includes at least one reagent for detecting the degree of expression of the MYBL2 gene from an individual cancer cell, the reagents being selected from the group: (a) - the reagent for detecting the MYBL2 gene (b) - a reagent for detecting MYBL2 protein; and 57 201200525 (C) a reagent for detecting the biological activity of MYBL2 protein. Examples of a reagent suitable for detecting mRNA of the MYBL2 gene may include a nucleic acid which specifically binds or recognizes MYBL2 mRNA, for example, a nucleotide having a sequence partially complementary to one of the 2 mRNAs. These types of oligonucleotides are exemplified by primers and probes specific for 瞧2 mRNA. These kinds of raised nucleotides can be prepared according to methods well known in the art. If necessary, the reagent for detecting MYBL2 mRNA can be immobilized on a solid substrate (in addition, more than one reagent for detecting MYBL2 mRNA can be included in the kit. On the other hand, it is suitable for Examples of the reagent for detecting the MYBL2 protein include an antibody against the MYBL2 protein. The antibody may be a single plant or a plurality of strains. Further, any fragment or modification of the antibody (e.g., chihhc antibody, ScFv, Fab, F (ab) , ) 2, Fv, etc. can be used as a reagent as long as the fragment or modified antibody maintains the ability to bind to the MYBL2 protein. Methods for preparing these kinds of antibodies for protein detection are well known in the art, and Any method can be used in the present invention to prepare such an antibody and its equivalent e. Alternatively, the signal generating molecule can be labeled by direct ligation or an indirect labeling technique. Methods and detection of markers and marker antibodies The binding of antibodies to their targets is well known in the art, and any of the markers and methods can be used in the present invention. In addition, more than one is used for The reagent for measuring the MYBL2 protein can be included in the kit. The kit can contain more than one of the foregoing reagents. For example, a tissue sample obtained from an individual without cancer or suffering from cancer can be used as a useful control group test 5 58 201200525. The kit of the present invention may further comprise other materials required by the commercial or user and user perspective, including buffer solution, diluent clearing 15 / main shot needle, syringe and package insert with operational instructions for use (eg, f face, — etc.. These reagents or the like can be maintained in one of the following contents: Suitable containers include bottles, small glass bottles (~υ and test tubes. Containers can be formed from a variety of materials, such as glass Or plastic. In the present invention - when the reagent is a probe against the (four) heart test, the reagent may be immobilized on a solid substrate, such as a porous strip ("(8) to form at least - (four) positions. The measurement or zone of the porous strip can include a plurality of locations 'each containing a nucleic acid (probe). A test strip can also contain a negative and/or positive control set position. Alternatively, the position of the control set can be located The strip is separated by one strip. Full two &amp; - depending on the 'different detection bits may contain different amounts of immobilized nucleic acid' ie a higher amount in the first measurement position and a lower content in the subsequent Positional order. By adding the test sample, some positions of the detectable number are provided to provide a quantitative indication of the amount of MYBL2 mRNA present in the sample. The 1 position can be set to any suitable detectable shape and is generally across - the shape of the strip or dot of the width of the test strip. The kit of the present invention may further comprise a positive control group sample or a MYBL2 standard sample. By collecting the ship 2 positive samples and then analyzing their ugly 2 degree A positive control group sample of the invention is prepared. Alternatively, purified MYBL2 protein or polynucleic acid can be added to cells that do not exhibit 2 to form a positive sampie or MYBL2 standard sample. In the present invention, a purified MYBL2 may be a recombinant protein. The degree of _2 of the positive control group sample is, for example, greater than the cutoff value (cut〇ff vaiue). 59 201200525 In one embodiment, the invention further provides a diagnostic kit comprising a protein or a portion thereof protein having the ability to specifically recognize an antibody or fragment thereof of the invention. Examples of partial peptides of the protein of the present invention include polypeptides consisting of at least 8, preferably 15, more preferably 20 contiguous amino acids in the amino acid sequence of the protein of the present invention. Using one of the proteins of the present invention or a peptide (polypeptide), cancer can be diagnosed by detecting one of the antibodies (e.g., blood, tissue). The method of preparing the protein of the present invention and the peptide is as described above. As described above, the diagnosis method of cancer can be performed by measuring the difference between the amount of the anti-MYBL2 antibody and its amount in the corresponding control group. If the individual's cells or tissues contain an antibody against the gene expression product (MYBL2) and the amount of the anti-MYBL2 antibody is determined to be greater than the cut-off value in the extent of its normal control group, the individual is suspected of suffering from cancer. In another embodiment, the diagnostic kit of the present invention may comprise a method of the present invention and a method for detecting an antigen-cell cytotoxic T lymphocyte with an antigen peptide and an intestinal molecule for HLA molecule 1 bound thereto Build (for example,

Altman JD et al., Science. 1996, 274(5284): 94-6) 〇 Therefore, the complex of the peptide of the present invention and the HLA molecule can be applied to the tumor cell antigen-cytotoxic T lymphocyte The method of measurement is used to enable early detection of recurrence and/or metastasis of cancer. Furthermore, it can be used for the selection of the individual, or the evaluation of the therapeutic efficacy of the drug, which comprises a drug comprising the peptide of the present invention as an active ingredient. , in particular ' according to known methods (see 'for example, M t JD吋Μ · 5 60 201200525 j

Science. 1996, 274(5284): 94_6), can prepare a radiolabeled HLA molecule and an oligomeric poly(polyligomer) complex of the peptide of the present invention, such as a tetramer. Along with the use of the complex, a diagnosis can be performed, for example, by quantifying the antigen-peptide specific cell toxic T lymphocytes in peripheral blood lymphocytes from individuals suspected of suffering from cancer. The invention further provides diagnostic methods or reagents for assessing an individual's immune response by using the peptide epitopes described herein. In one embodiment of the invention, the HLA-A-2 restricted peptide as described above is used as an agent for assessing or predicting an immune response in a subject. The immune response to be assessed can be induced by contacting the immunizing antigen (i mmun〇gen) with immunocompetent cells/;? or η. iro. In a preferred embodiment, the immunocompetent cells used to assess an immune response are selected from peripheral blood, peripheral blood lymphocytes (PBL), and peripheral blood mononuclear cells (pBMc). Methods of collecting or isolating such immunocompetent cells are well known in the art. In some embodiments, any agent that results in the production of antigen-specific cytotoxic T lymphocytes can be used as a reagent&apos; and cytotoxic T lymphocytes recognize and bind to a peptide epitope. The peptide reagent must not be used as an immunoreactive antigen. Analytical systems for such assays include fairly recent technological developments such as tetramers, staining of lymphocytes in lymphocytes and interferon release assays or EL I SPOT assays. In a preferred embodiment, the immunocompetent cells to be contacted with the victer reagent may be antigen presenting cells including dendritic cells. For example, the peptide of the present invention can be used in a tetramer staining assay to evaluate 61 201200525 for peripheral blood mononuclear cells in the presence of antigen-specific cytotoxic lytic lymphocytes after exposure to a tumor antigen or an immune antigen. HLA tetrameric complexes can be used to directly visualize antigen-specific cytotoxic lytic lymphocytes (see, for example, 〇gg et al., Science 279: 2103-2106, 1998; and Altman et al, Science 1 74: 94- 96,1 996), and measures the frequency of antigen-specific cytotoxic T lymphocyte populations in samples of peripheral blood mononuclear cells. A tetrameric multimeric reagent, for example, a tetrameric reagent using the peptide of the present invention can be produced as follows, as described below. The peptide that binds to HLA is refolded in the presence of the corresponding HLA heavy chain and cold 2-microglobulin to produce a three molecule complex. In the complex, the carboxy terminus of the heavy bond is biotinylated at a pre-designed location into the protein. The avidin is then added to the complex to form a tetramer composed of a tri-molecular complex and streptavidin. The antigen can be stained with cells by using tetramers in the form of fluorescently labeled avidin. The cells can then be identified, for example by flow cytometry. Such analysis can be used for diagnostic and prognostic purposes. Cells identified by this procedure can also be used for therapeutic purposes.

The invention also provides reagents for assessing immune recaH responses (see ' for example, Bertoni etaL, J. Clin.

Invest. 100: 503-513, 1997 and Penna et al, J Exp. Med. 174: 1565-1570, 1991) 'which includes the peptide of the present invention. For example, for the presence of antigen-specific cytotoxic T lymphocytes, a patient-specific pBMC sample from an individual having a cancer to be treated can be analyzed using a specific specific peptide. Blood samples containing singular 62 5 201200525 nucleated cells can be evaluated by culturing PBMC and stimulating cells with the peptide of the present invention. The expanded cell population is analyzed, for example, for cytotoxic tau lymphocyte activity during a suitable culture period. The peptide can also be used as an agent for evaluating the efficacy of the vaccine. The PBMC obtained from the patient vaccinated with the 1-immuno antigen can be analyzed using, for example, any of the above methods. The patient is, HLA-typed, and selected to recognize the peptide antigen reagents present in the allele specific molecule of the patient for analysis. By the presence of the antigenic determinant in the PBMC sample _ specific cell toxic τ lymphocytes, it is only possible to immunize antigenicity (丨(10)叩印丨c丨^).

The peptide of the present invention can also be used to make antibodies using techniques well known in the art (see, for example, CURRENT PR0T0C0LS IN IMMUNOLOGY, Wi1ey/Greene, NY; and Antibodies A Laboratory Manual, Harlow and Lane, Cold Spring Harbor Laboratory Press , 1 989 ), which is effective as a reagent for diagnosing or monitoring cancer. Such antibodies may include those recognized as peptides in the context of HLA molecules, i.e., antibodies that bind to the peptide-MHC complex. Alternatively, the invention also provides some uses, some of which are described herein. For example, the present invention provides a diagnosis or detection of a disease characterized by the expression of a MYBL2 immunoreactive multi-peptide. These methods comprise assaying the expression of a MYBL2 HLA-binding peptide in a biological sample or a complex of a MYBL2 HLA-binding peptide with an HLA c 1 ass I molecule. The expression of a peptide or the complex of a peptide with an HLA c 1 ass I molecule can be determined or detected by analysis of a binding partner for a peptide or complex. In a preferred embodiment, the binding partner for the peptide or complex is an antibody that recognizes and specifically binds to the peptide. The standard PCR amplification step using the MYBL2 primer is also 63 201200525. The performance of MYBL2 in a biological sample, such as a tumor slice, can be tested. Examples of tumor manifestations The further disclosure of conditions and primers for MYBL2 amplification presented and demonstrated herein can be found in WO 2003/27322. Preferably, the diagnostic method comprises biological samples separated from one body and specific ones. One of the MYBL2 HLA binding peptides is contacted to detect the presence of the MYBL2 HLA binding peptide in the biological sample. As used herein, "contacting" means placing a biological sample in an effective proximity reagent and, for example, at a concentration, temperature, time 'ion strength, for example, to allow binding of the peptide to the MYBL2 HLA in the biological sample. Specific interaction. In general, §, the conditions under which the agent is contacted with the biological sample are those known to those skilled in the art to promote cognate between the molecule and the biological sample (eg, a protein and its receptor analog, an antibody) A specific interaction with its protein antigen congener, a nucleic acid and its complementary sequence congener. U. s. Patent proposed by L〇wetal to promote the specific interaction between the molecule and its congeners.

No. 5, 1 08, 921. The diagnostic method of the present invention can be performed at one or both of 2/7 H or "Juice 0. Thus, in the present invention, the biological sample can be located in plus or wiro. For example, the biological sample can be a y λ h tissue and is specific to The MYBL2 immunoreactive peptide peptide can be used to detect the presence of such molecules in the tissue. Alternatively, the biological sample (e.g., blood sample, tumor section, tissue extract) can be collected or isolated by h(10). In an embodiment, the ± sample may be a cell-containing county, more preferably the same as the tumor cell collected from the individual to be diagnosed or tested 64 201200525. Alternatively, the diagnosis may be performed by a method by Fluorescence of fluorescein labeled HLA polyplex allows direct quantification of antigen-specific T cells (eg, A1 tman, JD et al., 1996, Science 274: 94; Altman, JD eta 1., 1 993 , Proc. Natl. Acad. Sci. USA 90: 1 0330 ). Intracellular lymphokines staining and interferon tau release assay or ELISPOT analysis have also been provided. Tetramer multimer staining, intracellular lymphokines Dyeing and ELI SPOT analysis revealed at least 10 times more sensitivity than general analysis (Mural i-Krishna, K. et al., 1998, Immunity 8: 177; Lalvani, A. et al., 1 997, J. Exp. Med. 1 86: 859; Dunbar, PR et al., 1 998, Curr. Biol. 8 : 413 ;) Pentamers (for example, US 2004-209295A), dextramers (for example, w〇) can also be used. 02/072631), a streptamer (eg, Nature medicine 6. 631-637 (2002)). For example, 'in some embodiments, the invention provides for the diagnosis or evaluation of at least one MYBL2 peptide administered to the invention. A method for the individual's immune response, the method comprising the steps of: (a) contacting the immunogen with an immunologically active cell under conditions suitable for inducing a lymphocyte specific to the immunogen; (b) detecting or measuring The degree of induction of cytotoxic j lymphocytes induced in step (a); and (c) correlating the individual's immune response with the induction of cellular toxic lymphocytes. 65 201200525 In the present invention, the immunogen For (a) the MYBL2 peptide in the amino acid sequence of sequence identification number: 2 to 4, with such an amine The peptide of the acid sequence is at least one of a peptide having such an amino acid sequence modified therein by substitution with hydrazine, 2 or more amino acids. Conditions suitable for inducing immunogenic cytotoxic T lymphocytes during the period are well known in the art. For example, immunocompetent cells can be cultured in vitro in the presence of an immunogen to induce immunogenic cytotoxic T lymphocytes. To induce immunogen-specific cytotoxic T lymphocytes, any stimulating factor can be added to the cell culture. For example, IL-2 is a preferred stimulator of cytotoxic tau lymphocyte induction. In some embodiments, monitoring or assessing immunity of an individual to be treated with a peptide cancer can be performed before, during, and/or after treatment. The step of the reaction. In general, in the course of cancer treatment, the immunogenic peptide is repeatedly administered to the individual to be treated. For example, the immunogenic peptide can be administered weekly for 3-1 0 weeks. Thus, an individual's immune response can be assessed or monitored during the cancer treatment procedure. Alternatively, the step of assessing or monitoring the immune response to cancer treatment may be at the completion of the treatment procedure. According to the present invention, the induction of the enhanced immunogen-specific cytotoxic T lymphocytes indicates that the individual to be evaluated or diagnosed immunologically responds to the administered immunogen when compared with the control group. A suitable control set for assessing an immune response can include, for example, 'when the immunocompetent cells are not in contact with the peptide or with a control group having an amino acid sequence other than any MYBL2 peptide (eg, a 'random amino acid sequence') The degree of induction of cytotoxic T lymphocytes upon exposure. 66 201200525 In a preferred embodiment, an individual's immune response is assessed in a sequence-specific manner by comparing the immune responses administered between the individual immunogens administered to the individual. In particular, even when a mixture of some species of MYBL2 peptide is administered to an individual, the immune response can be diversified depending on the peptide. In this example, by comparing the immune responses between the individual peptides, it was confirmed that the peptide which showed a higher response to the individual was confirmed. XI. Antibodies The present invention provides antibodies which bind to the peptides of the present invention. Preferably, the antibodies bind specifically to the peptide of the present invention and do not bind (or weakly bind) to the present invention. Alternatively, the antibody binds to the peptide of the invention and its homolog (h〇m〇1〇gs). The antibody against the peptide of the present invention can be used for cancer diagnosis and prognosis analysis and imaging methods (i mag i ng me thodo 1 ogi es ). Similarly, such antibodies may provide for the treatment, diagnosis, and/or prognosis of other cancers for the extent that they also exhibit or overexpress MYBL2 in cancer patients. In addition, antibodies that are expressed intracellularly (eg, single-chain antibodies) are therapeutically effective in treating cancers associated with their performance, and examples of cancers associated with the expression of MYBL2 include, but are not limited to, breast cancer, cervical cancer, large intestine Rectal cancer, esophageal cancer, lunar cancer, sputum-type gastric cancer, lymphoma, neuroblastoma, pancreatic cancer. The present invention also provides various immunological activity assays for detecting and/or quantifying MYBL2 protein (SEQ ID NO: 6) or a fragment thereof, MYBL2 protein (SEQ ID NO: 6) or a fragment thereof comprising the selected sequence identification number: 2 Multi-peptide of the amino acid sequence up to 4. Such assays may include one or more anti-fighting muscle 2 antibodies that recognize and bind to the MYBL2 protein or a fragment thereof as 67 201200525. In the context of the present invention, an anti-MYBL2 antibody&apos; that binds to a MYBL2 polypeptide is preferably a multi-peptide which is an amino acid sequence having the sequence identification number. The binding specificity of the antibody can be confirmed by the inhibition test (丨n h i b i t i ο η 1: e s t). In the presence of any fragment of the peptide having the amino acid sequence selected from the sequence identification numbers: 2 to 4, the binding between the antibody to be analyzed and the full-length MYBL2 polypeptide is inhibited. When it shows that this antibody binds specifically to the fragment. In the context of the present invention, including but not limited to radioimmunoassayS, immuno-chromatgraph techniques, enzyme-linked immunosorbent assays (ELISA), enzyme linkages Various forms of enZyme-linked immunofluorescent assays (ELIFA) and the like perform such immunoassays in immunoassay formats well known in the art. The immunological but non-antibody analysis of the present invention may also include a T cell immunogenic assay (inhibition or stimulation) in combination with a major histocompatibility complex. Furthermore, the present invention also provides immunoimaging assays having the ability to detect cancers that exhibit MYBL2, including, but not limited to, radio scintigraphic waging using the labeled antibodies of the present invention. Such analysis is clinically effective in detecting, monitoring, and prognosing cancers in mYBL2, and MYBL2 is a cancer, examples of which include, but are not limited to, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, and monthly cancer. Diffuse gastric cancer, lymphoma, neuroblastoma, pancreatic cancer. The invention provides antibodies that bind to the peptides of the invention. The antibody of the present invention can be used in any form, for example, single or multiple antibodies, and includes obtained from

Humanized antibody. The peptide of the present invention which is used as a monoclonal antibody to obtain an antibody may be derived from any dairy animal 'for example, a human, mouse or human derived peptide may be obtained from a mammalian species, but preferably from a mammalian rat. Better from a human being. Human nucleotides or amino acid sequences. The peptide used as an immunizing antigen according to the present invention may be a complete protein or a partial peptide of a protein. The partial peptide may include, for example, an amine (N) terminal or a carboxyl (c) terminal fragment of one of the peptides of the present invention. Here, an antibody is defined as a protein which reacts with the full length or fragment of the MYBL2 peptide. In a preferred embodiment, the antibody of the invention recognizes the MYBL2 fragment peptide which has the amino acid sequence selected from Sequence Numbers: 2 to 4. Methods of synthesizing oligopeptides are well known in the art. After synthesis, the peptide can be purified as needed prior to use as an immunizing antigen. In the present invention, an oligopeptide (e.g., 9 or 10 members) can be bound or linked to a carrier to enhance immunogenicity. Keyhole-1 impet hemocyanin (KLH) is known as a vector. Methods for binding keyhole limpet hemocyanin and triumph are well known in the art. Alternatively, a gene encoding a peptide of the present invention or a fragment thereof can be inserted into a known expression vector, which is then transformed into a host cell, as described herein. The desired peptide or fragment thereof can be re-acquired externally or internally to the host cell by any standard method and can then be used as a 69 201200525 antigen. Alternatively, the entire cell expressing a victory or a cell thereof, a chemically synthesized peptide, can be used as an antigen. 5 Any animal that is drinking milk can be immunized with an antigen, but it is preferred to consider the compatibility of the parental cells used for cell fusion. In general, use Rodentia, Ug〇m〇rpha or Pnmates. Animals of the caries include, for example, mice, rats, and hamsters. Rabbit-shaped animals include, for example, rabbits. $long-eyed animals include, two narrow-nose (old world monkey) monkeys + 'such as Malay wolf fas (10) laris), (four) (rhesus _key), (four) 拂 (ca (4) bab〇on) and chimpanzees. Methods for immunizing animals with antigens are well known in the art. Intraperital injection (intraperit〇neal injecti〇n) or subcutaneous injection is a standard method for immunizing mammals. More specifically, the antigen may be diluted or suspended in a suitable amount of phosphate buffer/mixed liquid 'physiological saline or the like. If desired, the antigen suspension may be mixed with a suitable amount of a standard adjuvant, such as Freund's complete adjuvant (Freund, s c〇mplete adjuvant) to prepare an emulsion (emulsi〇n) and then administered to the mammal. Preferably, it is administered followed by an antigen mixed with a suitable amount of Freunds incomplete adjuvant every 4 to 21 days. A suitable vector can also be used for immunization. After the above immunization, serum was tested by standard methods in order to increase the amount of antibody required. The multi-strain antibody against the present invention can be prepared by collecting blood from an immunologically active animal that has been tested to increase the desired antibody in serum and by separating the serum from the blood by any general method. A plurality of antibodies may include a serum containing a plurality of antibodies 70 201200525, and a portion containing a plurality of antibodies isolated from serum (fracti〇n). For example, using an affinity column coupled to a peptide of the present invention and further purifying the portion using a protein A or protein G column, the immunoglobulin G or μ can be purified from only a portion of the peptide of the present invention. To prepare a monoclonal antibody, the mammalian cells are collected from the mammals which have been immunized with the antigen and confirmed to the extent of the desired antibody in the serum as described above and subject the immune cells to cell fusion. The immune cells used for cell fusion are preferably obtained from the spleen. Other parental cells to be fused with the above-described immune cells include, for example, myomas of mammals, and preferably myeloma cells having acquired characteristics of drug-selected fused cells. The above immune cells can be fused with myeloma cells according to known methods, for example, by Milstein et al. (Galfre and Milstein, Methods EnZymol 73: 3-46 (1981)). Fusion tumors obtained from cell fusion by culturing them in standard screening media, such as HAT medium (medium containing hypoxanthine, amin〇pterin, and thynudine), Can be screened. Usually, the cells are continuously cultured in HAT medium for several days to several weeks, and _ between them is to allow death of other cells (non-fused cells) other than the desired fusion tumor. Thereafter, standard limiting dilutions are performed to screen and replicate the fusion tumors that produce the desired antibodies. In addition to the above method in which a non-human animal is immunized with an antigen in order to prepare a fusion tumor, the cell which is capable of winning, expressing the peptide or its cell extract "immunizes human lymphocytes, such as those infected with another virus. Thereafter, The immunized lymphocytes are fused with human myeloma, such as U266, with a non-clear cleavage ability to produce a fusion tumor that produces the desired human antibody. The desired human antibody can be combined with the peptide that can be obtained. (Unexamined Published Japanese Patent Application

No. Sho 63-17688). The obtained fusion tumor was then transferred into the abdominal cavity of the mouse and the ascites was extracted. The obtained monoclonal antibody can be purified by, for example, precipitation by sulfuric acid, a protein A or protein G column, DEAE ion exchange chromatography or an affinity column coupled to the peptide of the present invention. The antibody of the present invention can be used not only to purify and detect the peptide of the present invention, but also as a candidate for the promoter and antagonist of the peptide of the present invention. Alternatively, an antibody-producing immune cell, e.g., an immunized lymphocyte, can be immortalized by a consensus oncogene and used to prepare a monoclonal antibody. Genetic engineering techniques can also be used to recombinantly prepare the individual antibodies thus obtained (see, for example, Borrebaeck and Larrick, Therapeutic

Monoclonal Antibodies, published in the United

Kingdom by MacMillan Publishers LTD (1990)). For example, a DNA encoding an antibody can be replicated from an immune cell, e.g., an antibody-producing tumor or an immunized lymphocyte, inserted into a suitable vector, and introduced into a host cell to produce a recombinant antibody. The present invention also provides a recombinant antibody prepared as described above.

Furthermore, the antibody of the present invention may be a fragment of an antibody or a modified antibody as long as it binds one or more of the peptides of the present invention. For example, the antibody fragment can be a Fab, F(ab,)2, Fv or single-chain Fv (scFv) in which the Fv fragments from the heavy and light chains are joined by a suitable linker (Hust〇n e1: aI 72 5 201200525

Proc Natl Acad Sci USA 85: 5879-83 (1988)). More specifically, antibody fragments can be produced by treating antibodies with enzymes such as papain or pepsin. Alternatively, the gene encoding the antibody can be constructed, inserted into a performance vector and displayed in a suitable host cell (see, for example, C〇 et al., J Immunol 152: 2968-76 (1 994); Better and Horwitz , Methods Enzymol 178: 476-96 (1989); Pluckthun and Skerra, Methods Enzymol 178: 497-515 (1989); Lamoyi, Methods Enzymol 121: 652-63 (1 986); Rousseaux et al., Methods Enzymol 121: 663-9 (1986); Bird and Walker,

Trends Biotechnol 9: 132-7 (1991)). The antibody can be modified by binding to various molecules such as p〇ly ethylene glycol (PEG). The present invention provides such modified antibodies. A modified antibody can be obtained by chemically modifying an antibody. These methods of modification are common in the art. Alternatively, an antibody of the invention can be obtained as a chimeric antibody, between a variable region from a non-human antibody and a fixed region from a human antibody, or a humanized antibody, including a complementarity determining region from a non-human antibody. , framework work area (frame work regi〇n' FR) and fixed areas from human antibodies. Such antibodies can be prepared according to known methods. Humanization can be performed by substituting the sequence of the rodent complementarity determining region for the complementary sequence corresponding to the human antibody (see, for example,

Verhoeyen et al., Science 239: 1534-1536 (1988)). Thus, such humanized antibodies are chimeric antibodies in which substantially less than intact human variable regions have been substituted with corresponding sequences from non-human species. It is also possible to use fully human antibodies including the human variable 73 201200525 region in addition to the framework and the target region. Such antibodies can be produced using a variety of techniques known in the art. For example, the i n v i ro method includes the use of a recombinant database of human antibody fragments presented on bacillus (eg, Hoogenboom &amp;

Winter, J. Mol. Biol. 227:381 (1991)). Similarly, human antibodies can be made by introducing a human immunoglobulin locus (loci) into a transgenic animal, such as a mouse in which the endogenous immunoglobulin gene has been partially or completely deactivated. This method is described, for example, in US Patent Nos. 6, 1 50, 584, 5, 545, 807; 5, 545, 806; 5, 569, 825; 5, 625, 126; 5, 633, 425; 5, 661, 016. The antibodies obtained above can be purified to homogeneity. For example, isolation and purification of antibodies can be performed according to methods for isolation and purification of general proteins. For example, by suitable selection and combined column chromatography, such as affinity tube, filtration, ultrafiltration, salting out, dialysis, sodium lauryl sulfate polyacrylamide gel electrophoresis (SDS polyacrylamide) The use of gel electrophoresis and isoeiectric focusing can separate and isolate antibodies (Antibodies: A Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor Laboratory (1 988)) 'but is not limited thereto. The protein a column and the protein G column A can be used as an affinity column. Exemplary protein A columns to be used include, for example, Hyper D, P0R0S and Sepharose FF (Pharmacia) 0 in addition to affinity 'exemplary chromatographic analysis including, for example, ion exchange chromatography, hydrophobic chromatography, colloid filtration, Reverse Chromatography, Adsorption Chromatography, etc. (Strategies f0r protein Purificati〇n and 74 201200525

Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratofy Press (1996). The chromatographic analysis step can be performed by liquid chromatography, for example with FPLC. Absorption measurements, enzyme-linked immunosorbent assays such as (ELISA), enzyme immunoassay (EU), radioimmunoassay, and/or immunofluorescence can be used to measure the antigen binding activity of the antibodies of the invention. In an enzyme-linked immunosorbent assay, the antibody of the present invention is immobilized on a culture plate, providing the present invention to a culture plate, and then providing a sample containing the desired antibody, for example, a culture suspension of the antibody-producing cells or Purified antibody. Thereafter, a secondary antibody which recognizes the steroid and is labeled with an enzyme such as alkaline phosphatase is provided, and then the culture disk is cultured. Next, after washing, the enzyme substrate, for example, p-ni tr〇pheny i ph〇sphate, was added to the culture plate, and the absorption was measured to evaluate the antigen binding activity of the sample. Fragments of peptides, such as C-terminal or N-terminal fragments, can be used as antigens to assess antibody binding activity. According to the present invention, BIAcore (Pharmacia) can be used to evaluate the activity of an antibody. The above method allows the detection or measurement of the peptide of the present invention by exposing the antibody of the present invention to a sample presumed to contain the peptide of the present invention and detecting or measuring the immune complex formed by the antibody and the peptide. Since the peptide detection or measurement method according to the present invention can specifically detect or measure the peptide, the method is useful in various experiments using the peptide. Χπ. Vectors and Host Cells The present invention also provides vectors and host cells in which nucleotides encoding the phenoxypeptides of the present invention 75 201200525 are introduced. The vector of the present invention is effective for maintaining the nuclear acid of the present invention, particularly DNA in a host cell to express the peptide of the present invention, or for administering the nucleotide of the present invention for gene therapy.

When E. coli is a host cell and the vector is amplified and produced in large quantities in E coli (eg 'JM109, DH5 alpha, HB101 or XLlBlue), the vector should have the "ori" to be amplified in Ε·coli and screened The genes of the form E · c 01 i (for example, by drug screening such as ampicillin, tetracycline 'kanamycin ' chloramphenicol or the like One of the drug resistance genes). For example, an M13_series vector, a pUc_ series vector, pBR322, pBluescript, pCR-Script, or the like can be used. In addition, pGEM-T 'pDIRECT and pT7 can also be used for secondary replication and extraction of cDNA with the above vectors. A performance vector is particularly useful when the vector is used to produce a protein of the invention. For example, one of the expression vectors to be represented in E. co 1 i should have the above characteristics to be magnified in E. coli. When using E. coli, such as JM109, DH5 alpha, HB101 or XLlBlue as the host cell, the vector should have a promoter, such as the lacZ promoter (Ward et al., Nature 341: 544-6 (1989); FASEB J 6: 2422-7 (1 992)), araB promoter (Better et al., Science 240: 1041-3 (1988)), T7 promoter or analog, which can effectively express the desired gene in E. col i. Based on that aspect, 'can be used, for example, ρΟΕχιχΗ (Pharmacia), &quot;QIAexpress system&quot; (Qiagen), pEGFP and pET (in this example, the host is preferably BL21, which expresses T7 RNA polymerase), 5 76 201200525 replaces the above vector In addition, the vector may also contain a signal sequence for peptide secretion. An exemplary signal sequence that directs the peptide to be secreted to the periplasm of E. col i is the pelB signal sequence (Lei et al). J Bacteriol 169: 4379 (1987)). The manner in which the vector is introduced into the host cell of interest includes, for example, the calcium-calcification method, and the electroporation method, except for E·co 1 i, for example, from mammals. Vectors (eg, pcDNA3 (Invitrogen) and pEGF-B〇S (Nucleic Acids Res 18(17): 5322 (1 990)), pEF, pCDM8), expression vectors from insect cells (eg, &quot;Bac-to-BAC) Baculovirus expression system&quot; (GIBCO BRL), pBacPAK8), plant-derived expression vectors (eg, pMH1, pMH2), expression vectors from animal viruses (eg, pHSV, pMV, pAdexLc) w), a expression vector from a retrovirus (for example, pZ i pneo ), a expression vector derived from yeast (for example, ' 'Pichia Expression Kit&quot; (Invitrogen), pNVll, SP-Q01) and from Bacillus subtilis (BaciUus subti 1) A performance vector of is) (e.g., ppL6〇8, ρκτΗ50) can be used to produce the multi-peptide of the present invention. In order to express a vector in an animal cell, such as a CH0, COS or NIH3T3 cell, the vector should have a promoter necessary for expression in such a cell, such as the SV40 promoter (MUlligan et al., Nature 277: 1〇8 (1 979) )) 'MMLV-LTR promoter, £F1 alpha promoter (Mizushima et al·' Nucleic Acids Res 18: 5322 (1990)), CMV promoter, etc., and marker genes for screening transformants (eg by drug) Screening (drug resistance gene of Example 77 201200525) is preferred. Examples of known vectors having such features as pMAM, pDR2, pBK-RSV, such as 'neomycin, G418' include pBK-CMV, p〇 PRSV and p〇p13 The following examples are presented to illustrate the invention and are intended to be illustrative of the invention and the invention is not intended to limit the scope of the invention in any manner. Methods Cell line T2 (HLA-A2), human B lymphoblastoid cell line and c〇S7, African green monkey kidney cell line were purchased from ATCC. The candidate for peptide from MYBL2 was selected to use "NetMHC 3. 0". Combined predictive servo (binding prediction server) (http://www.cbs.dtu.dk/services/ NetMHC/) (Buus et al. (Tissue Antigens., 62:378-84, 2003), Nielsen eisA (Protein Sci., 1 2:1 007-1 7,2003, Bioinformatics, 20(9):1 388-97, 2004)) Predicting 9 and 10 member peptides from MYBL2, which bind to HLA-A* 0201 molecules. These wins Peptides were synthesized by Biosynthesis (Lewisville, TX) according to a standard solid phase synthesis method and purified by reversed phase high performance liquid chromatography (HPLC), respectively by analytical HLPC and mass spectrometry. Confirm the purity (&gt; 90%) and identity of these peptides. Dissolve the peptide in dimethyl sulfoxide 78 5 201200525 (dimethylsulf〇xide, DMS0) at 20 mg/ml and store at _8〇 °C. I n v i tro cytotoxic tau lymphocyte induction The dendritic cells derived from mononuclear leukocytes were used as antigen-presenting cells to induce cellular toxic T lymphocyte responses against peptides expressed on human leukocyte antigen (HLA). Dendritic cells are produced as described elsewhere (Nakahara S et al., Cancer Res 2003 Jul 15, 63(14): 4112-8). In particular, peripheral blood mononuclear cells isolated from a normal volunteer (HLA_A* 〇2〇1 positive) are attached by a Fic〇H-Piaque (Pharmacia) solution to a plastic tissue culture plate (Bect〇n) Dickins〇n) to separate to enrich it as a mononuclear white blood cell part. The population of abundant mononuclear white blood cells is cultured in 1 〇〇〇U/m 1 of human granulocyte-macrophage colony-stimulating factor (GM-CSF) (R&amp;D System) with 1 000 AIM-V medium in the presence of U/ml interleukin (IL)-4 (R&amp;D System) in serum containing 2% of heat deactivated itself (aut〇l〇g〇us serum, as) (Invitrogen). After 7 days of culture, the synthesized peptides were pulsed at 20 /zg/ml in the presence of 3 &quot;g /ml of 2-diglobulin in aim-V medium. Hormone-induced dendritic cells produced at 37 hC for 3 hours showed dendritic cell-associated molecules such as CD80, CD83, CD86 and HLA Class 11 on their cell surface (data not shown). The dendritic cells pulsed with these peptides were then deactivated with χ-rays (2〇Gy) and mixed with CD8-positive T cells in a ratio of 1:2 ,, while cd8-positive T cells were treated with 79 201200525 The CD8 Positive Isolation Kit (Dynal) is being selected. These cultures a were placed in a 48-well plate (c〇rning); each well contained 丨&amp; χ 1 〇 4 peptide-pulsed dendritic cells, 3 X 1〇5 CD8-positive sputum cells and 1 〇ng/ml IL-7 (R&amp;D System) was taken in serum medium at 0.5 ml of AIM-V/2% itself. Three days later, IL-2 (CHIR〇N) was added to the culture to a final concentration of 20 IU/ml. On day 7 and day 14, dendritic cells with peptide peptides were further stimulated by T cells. Dendritic cells were prepared each time in the same manner as above. On day 21, after the third round of peptide stimulation, the cytotoxic T lymphocytes were tested for anti-peptide pulsed T2 cells (Tanaka H et aL, Br J Cancer 200 1 Jan 5, 84(1): 94 -9; Umano Y et al., Br J Cancer 2001 Apr 20, 84(8): 1052-7; Uchida N et al., Clin Cancer Res 2004 Dec 15, 10(24): 8577-86; Suda T et aJ., Cancer Sci 2006 May, 97(5): 411-9; Watanabe T et aJ.t Cancer Sci 2005 Aug, 96(8): 498-506). The cytotoxic T lymphocyte expansion step is used by Riddell et al. (Walter EA et a 1., N Engl J Med 1 99 5 Oct 19, 333(1 6): 1038-44; Riddell SR et al·

A similar method as described in Nat Med 1 996 Feb, 2(2): 216-23) expands cytotoxic T lymphocytes in culture. All 5 x 1 〇4 cytotoxic sputum lymphocytes were suspended in 25 m 1 of AIM-V/5% of two human sputum lymphoblastoid cell lines to obtain serum medium, deactivated by MMC at 40 ng/ml In the presence of anti-CD3 monoclonal antibody (Pharmingen). One day after the start of cultivation, 120 IU/ml of IL-2 was added to the culture. On the 5th, 8th, and 11th, 5th, 5th, 2012th, 2012, the serum medium was obtained from the fresh AIM-V/5% self containing 30 IU/ml of IL-2 (Tanaka H et al., Br J Cancer 200 1 Jan). 5, 84(1): 94-9; Umano Y et al., Br J Cancer 200 1 Apr 20, 84(8): 1052-7; Uchida N et al., Clin Cancer Res 2004 Dec 15, 10(24 ): 8577-86; Suda T et al., Cancer Sci 2006 May, 97(5): 411-9; Watanabe T et al., Cancer Sci 2005 Aug, 96(8): 498-506). Establishment of cytotoxic T lymphocyte replication was performed to have a 0.3, 1 and 3 cytotoxic T lymphocyte/well in a 96 round-bottomed micro-valence plate (Nalge Nunc International) . Cytotoxic T lymphocytes and 1 χ 1〇4 cells/well of two human B-type lymphoblastoid cells, 30 ng/m 1 anti-CD antibody and 125 U/ml IL-2 in all 150 // 1 / well of AIM-V medium containing 5% of the serum obtained by itself. After 10 days, 50 // 1/well of IL-2 was added to the medium to reach a final concentration of 125 U/ml IL-2. The activity of the cytotoxic T lymphocytes was tested on day 14 and the cytotoxic T lymphocyte replication was expanded using the same method described above (Uchi da N eia / ., Clin Cancer Res 2004 Dec 15, 10(24): 8577-86 Suda T et al., Cancer Sci 2006 May, 97(5): 411-9; Watanabe T ei a., Cancer Sci 2005 Aug, 96(8): 498-506). Specific Cytotoxic T Lymphocyte Activity To test the specific cytotoxic T lymphocyte activity, IFN-r enzyme binding immunospot (ELISP0T) analysis and IFN-γ enzyme binding immunosorbent (EL IS A) analysis were performed. Specifically, T2 (1 81 201200525 x l〇Vwell) of the peptide pulse was prepared to stimulate the cells. The cultured cells were used as responder cells in 48 wells. IFN-7 enzyme binding immunospot analysis was performed under the manufacturer's step with IFN-7&quot; enzyme binding immunosorbent assay. Establishment of cells that strongly express either or both of the target gene and HLA_〇2 The cDNA encoding the open reading frame of the target gene or HLA_A&gt;|! is amplified by PCR. The PCR amplification product is copied into a performance vector. Using lipofectamine 2000 (invitr〇gen), the plastid was transfected into COS7 according to the manufacturer's recommended procedure, which is a target gene and HLA_A* 〇2〇1 null cell line. Two days after transfection, transfected cells were harvested as versene (Invi trogen) and stimulator cells (5 X 1 〇 4/we 11) analyzed for cytotoxic T lymphocyte activity were used. Results Prediction of HLA-A02 Binding Peptides from MYBL2 Tables la and lb show that HLA-A02 of MYBL2 binds 9 members and 10 members in order of high binding affinity. A total of 4 peptides with potential JJLA-A02 binding ability were selected and tested to determine epitopes. 201200525 Table la, HLA-A02 from MYBL2 binding partner peptide amino acid sequence Kd (nM) Sequence ID 355 VLPPRQPSA 213 1 597 LMMSTLPKS 285 2 144 RIICEAHKV 493 3 Table lb, HLA-A02 from MYBL2 Binding of the 10-member peptide start position amino acid sequence Kd (nM) Sequence ID 596 KLMMSTLPKS 226 4 The starting position refers to the number of amino acid residues from the N-terminus of MYBL2. The binding fraction and the dissociation constant [Kd (nM)] are derived from "BIMAS" and "NetMHC3.0". The predicted peptide derived from MYBL2, restricted by HLA-A* 0201, induces cytotoxic T lymphocytes. The cytotoxic tau lymphocytes from those peptides derived from MYBL2 are produced according to the procedure described in "Materials and Methods". The peptide-specific cytotoxic lymphosphere activity was determined by iFN_r enzyme sigma immunospot assay (Fig. 1). Compared with the control group, the hole number #8 (a) stimulated by MYBL2-A02-9-144 (serial identification number: 3) showed strong IFN-γ production. On the other hand, specific cytotoxic T lymphocyte activity was not determined by stimulation with other peptides shown in Table 1, although those peptides had a possible binding activity to HLA-A* 〇201. As a typical example of negative data, from cytotoxic T lymphocytes stimulated with MYBL2-A02-9-355 (SEQ ID NO: 1) ((1), no specific IFN-7 was observed. Therefore, it was indicated that MYBL2-A02-9-144 from MYBL2 (sequence recognition 唬·3) is a peptide that induces potent and potent cytotoxic lysate. 83 201200525 Cytotoxic T lymphocyte cell line against MYBL2 specific peptide The establishment of the replication was detected by IFN-7 enzyme-binding immunospot assay, and the peptide-specific cytotoxic sputum was displayed in the hole number #8 stimulated by MYBL2-A0 2-9-144 (SEQ ID NO: 3). The spheroidally active cells are expanded and the cytotoxic TNF lymphocyte cell line is established by expansion procedures as described in the above section "Materials and Methods." Those cytotoxic kills are determined by IFN-r enzyme binding immunosorbent assay. Cytotoxic T lymphocyte activity of the tau lymphocyte cell line (Fig. 2). Compared with the target cell of the peptide-free pulse, the 'cytotoxic tau lymphocyte cell line showed a strong resistance to the target of the corresponding peptide pulse. Cell IFN-7 production. This , as described in "Materials and Methods," by establishing a cytotoxic T lymphocyte replication by limiting dilution from a cytotoxic T lymphocyte cell line, and determined by iFN_r enzyme binding immunosorbent assay IFN-r production by cytotoxic τ lymphocyte replication of peptide-pulsed target cells. Strong IFN- r production was determined from cytotoxic tibia lymphocyte replication stimulated with MYBL2-A02-9-144 (SEQ ID NO: 3) Figure 3). Specific anti-exogenous MYBL2 and HLA-A* 0201 target cells were tested for specific cytotoxic T lymphocyte activity by increasing anti-MYBL2-A02-9-144 (SEQ ID NO: 3) The ability of the cytotoxic T lymphocyte cell line to recognize target cells expressing MYBL2 and HLA-A* 0201 molecules. The cytotoxic τ lymphocytes promoted by MYBL2-A02-9-144 (SEQ ID NO: 3) were used. The cell line was replicated as a responsive cell to test the specific 84 201200525 cytotoxic T lymphocyte activity of anti-C〇s7 cells, while the c〇S7 cells were transfected with both the full-length MYBL2 and HLAH201 molecular genes (for the expression of mYBL2 and HLA-A). * 020 1 gene target Cell specific mode) MYBL2 .c〇S7 cells or the full-length HLA-A * 020 1 transfected prepared as a control group. In FIG. 4, to

MYBL2-A02-9-144 (SEQ ID NO: 3) stimulated cytotoxic T lymphocyte replication showed strong cytotoxic thymocyte activity in COS7 cells expressing both MYBL2 and HLA-A*020 1 . On the other hand, significant specific cytotoxic T lymphocyte activity in the anti-control group was not detected. Therefore, these data clearly demonstrate that MYBL2-A02-9-144 (SEQ ID NO: 3) is naturally expressed on target cells with HLA-A* 020 1 molecule and is recognized by cytotoxic T lymphocytes. These results show that MYBL2-A02-9-144 (SEQ ID NO: 3) from MYBL2 is a cancer vaccine that can be suitable for the treatment of patients with tumors with MYBL2 expression. Homologous analysis of antigenic peptides The cytotoxic T lymphocytes stimulated with MYBL2-A02-9-144 (SEQ ID NO: 3) showed significant and specific cytotoxic thymocyte activity. This result may be due to the fact that the sequence of MYBL2-A02-9-144 (SEQ ID NO: 3) is homologous to a peptide derived from other molecules known to be sensitive to the human immune system. To rule out this possibility, homology analysis was performed on this peptide sequence that was searched for the BLAST algorithm (http://www.ncbi.nlm.nih.gov/blast/blast, cgi) for the keyword, while BLAST The algorithm shows that no sequences show significant homology. The results of the homology analysis indicated that the sequence of MYBL2-A02-9-144 (SEQ ID NO: 3) is unique 'and therefore only a small probability for our greatest knowledge. The molecule will be 85 201200525 for some non-related molecules Unwanted immune response. Therefore, it was confirmed that MYBL2-A02-9-144 (SEQ ID NO: 3) was a novel HLA-A* 0201 epitope peptide derived from MYBL2. The results here demonstrate that MYBL2-A02-9-144 (SEQ ID NO: 3) may be suitable for use in cancer immunotherapy. Industrial Applicability The present invention provides novel tumor-associated antigens, particularly those from MYBL2, which induce a strong and specific anti-tumor immune response and are useful for a wide variety of cancer forms. This tumor-associated antigen is the basis for the development of a peptide vaccine against MYBL2-related diseases, diseases associated with MYBL2, such as cancer, more particularly, testicular tumors, pancreatic cancer, bladder cancer, non-small cell lung cancer, small cell lung cancer. With esophageal cancer. While the invention has been described with respect to the specific embodiments thereof, it will be understood that In the course of routine experimentation, it will be readily apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit of the invention. Therefore, the present invention is not defined by the foregoing, but is defined by the following claims and their equivalents. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 consists of a series of photographs '(4) to (8) showing IFN-y-enzyme-binding immunospot assay (ELISP0T) on a cytotoxic lytic lymphocyte induced by a peptide derived from MYBL2. As a result, compared with the control group, 86 5 201200525 cytotoxic τ lymphocytes & stimulating by MYBL2-A〇2_9_144 (SEQ ID NO: 3) in hole number #8 showed strong IFN-γ production. The squares on the holes of these pictures indicate that the cells from the corresponding holes are expanded to establish a cytotoxic lymphocyte cell line. In contrast, as a typical example of negative data, no specific IFN_T was detected from the cytotoxic tau lymphocytes stimulated with Mm2-AQ2_9_355 (SEQ ID NO: 1). In the ® towel, + indicates that IF N - 7 is produced against the target cell pulsed with the appropriate peptide, while "" refers to the mountain 4 A A # 曰 曰 IFN-γ production against the target cells not pulsed with any peptide . Fig. 2 is a one-line diagram showing the results of IFN_T enzyme-binding immunosorbent assay debt assay showing IFN_r production by cytotoxic T cell lymphocytes stimulated with MYBL2_a〇2_9_U4 (SEQ ID NO: 3). The results were not as compared with the control group. The cytotoxic T lymphocyte cell line established by this peptide stimulation showed strong IFN_r production. In the figure, ''+,, indicates the production of IFN_y against target cells pulsed with a suitable peptide, and - indicates the production of target cells that are not pulsed with any peptide. Figure 3 is a one-line diagram' display by IFN-r production from cytotoxic tau lymphocytes replicated by limiting dilution of cytotoxic tau lymphocyte cell lines stimulated with MYBL2-A02-9-144 (SEQ ID NO: 3). ,,’. It was shown that the cell-killing T lymphocyte replication established by this peptide stimulation showed strong IFN-γ production compared to the control group. In the figure, 5 "+,, 匕 匕 ^ 抗 以 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 适合 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 The figure is a one-line diagram showing the specific cytotoxic T lymphocyte activity against target cells expressing MYBL2 and HLA-A* 0201. The C0S7 cells transfected with hlA-A* 0201 or the full-length MYBL2 gene were prepared as control groups. The cytotoxic T lymphocyte replication established by MYBL2-A02-9-144 (SEQ ID NO: 3) showed specific cytotoxic τ lymphocytes against C0S7 cells transfected with both MYBL2 and HLA-A* 0201 Ball activity (black diamond). On the other hand, no significant specific cytotoxic T lymphocyte activity was detected in target cells expressing HLA-A* 0201 (triangle) or deaf 2 (circle). [Major component symbol description] None. 88 5 201200525 Sequence Listing <110> Tumor Therapy Science Co., Ltd. &lt;120&gt; MYBL2 peptide and vaccine containing the peptide &lt;130〉 0NC-A0922-TW <150> US 61/266,871 &lt;151> 2009-12-04 &lt;160〉 10 <170> Patent In version 3.5 &lt;210> 1 &lt;211&gt; 9 <212> PRT <213> Labor &lt;220> <223> Synthetic peptide sequence <400> 1

Val Leu Pro Pro Arg Gin Pro Ser Ala 1 5 &lt;210〉 2 &lt;211> 9 &lt;212&gt; PRT &lt;213>Artificial <220> <223&gt; Synthetic peptide sequence &lt;400〉 2

Leu Met Met Ser Thr Leu Pro Lys Ser 1 5 &lt;210> 3 201200525 &lt;211> 9 &lt;212> PRT &lt;213>Manual &lt;220> &lt;223> Synthetic peptide sequence &lt;400> 3

Arg lie lie Cys Glu Ala His Lys Val 1 5 10PRT person &lt;210&gt;&lt;211&gt;212>&lt;213>&lt;220>&lt;223>synthetic peptide sequence &lt;400> 4

Lys Leu Met Met Ser Thr Leu Pro Lys Ser 1 5 10 &lt;210> 5 &lt;211&gt; 2731 &lt;212&gt; DNA &lt;213&gt; Human &lt;400&gt; 5 gcgcttggcg ggagatagaa aagtgcttca acccgcgccg gcggcgactg cagttcctgc 60 gagcgaggag cgcgggacct gctgacacgc tgacgccttc gagcgcggcc cggggcccgg 120 agcggccgga gcagcccggg tcctgacccc ggcccggctc ccgctccggg ctctgccggc 180 gggcgggcga gcgcggcgcg gtccgggccg gggggatgtc tcggcggacg cgctgcgagg 240 atctggatga gctgcactac caggacacag attcagatgt gccggagcag agggatagca 300 agtgcaaggt caaatggacc catgaggagg acgagcagct gagggccctg gtgaggcagt 360 2 ⑤ 201200525 ttggacagca ggactggaag ttcctggcca gccacttccc taaccgcact gaccagcaat 420 gccagtacag gtggctgaga gttttgaatc cagaccttgt caaggggcca tggaccaaag 480 aggaagacca aaaagtcatc gagctggtta Agaagtatgg cacaaagcag tggacactga 540 ttgccaagca cctgaagggc cggctgggga agcagtgccg tgaacgctgg cacaaccacc 600 tcaaccctga ggtgaagaag tcttgctgga ccgaggagga ggaccgcatc atctgcgagg 660 cccacaaggt gctgggcaac cgctgggccg agatcgccaa gatgttgcca gggaggacag 720 acaatgctgt gaaga atcac tggaactcta ccatcaaaag gaaggtggac acaggaggct 780 tcttgagcga gtccaaagac tgcaagcccc cagtgtactt gctgctggag ctcgaggaca 840 aggacggcct ccagagtgcc cagcccacgg aaggccaggg aagtcttctg accaactggc 900 cctccgtccc tcctaccata aaggaggagg aaaacagtga ggaggaactt gcagcagcca 960 ccacatcgaa ggaacaggag cccatcggta cagatctgga cgcagtgcga acaccagagc 1020 ccttggagga attcccgaag cgtgaggacc aggaaggctc cccaccagaa acgagcctgc 1080 cttacaagtg ggtggtggag gcagctaacc tcctcatccc cgctgtgggt tctagcctct 1140 ctgaagccct ggacttgatc gagtcggacc ctgatgcttg gtgtgacctg agtaaatttg 1200 acctccctga ggaaccatct gcagaggaca gtatcaacaa cagcctagtg cagctgcaag 1260 cgtcacatca gcagcaagtc ctgccacccc gccagccttc cgccctggtg cccagtgtga 1320 ccgagtaccg cctggatggc cacaccatct cagacctgag ccggagcagc cggggcgagc 1380 tgatccccat ctcccccagc actgaagtcg ggggctctgg cattggcaca ccgccctctg 1440 tgctcaagcg gcagaggaag aggcgtgtgg ctctgtcccc tgtcactgag aatagcacca 1500 gtctgtcctt cctggattcc tgtaacagcc tcacgcccaa gagcacacct gttaagaccc 1560 tgcccttctc gccctcccag tttc tgaact tctggaacaa acaggacaca ttggagctgg 1620 agagcccctc gctgacatcc accccagtgt gcagccagaa ggtggtggtc accacaccac 1680 201200525 tgcaccggga caagacaccc ctgcaccaga aacatgctgc gtttgtaacc ccagatcaga 1740 agtactccat ggacaacact ccccacacgc caaccccgtt caagaacgcc ctggagaagt 1800 acggacccct gaagcccctg ccacagaccc cgcacctgga ggaggacttg aaggaggtgc 1860 tgcgttctga ggctggcatc gaactcatca tcgaggacga catcaggccc gagaagcaga 1920 agaggaagcc tgggctgcgg cggagcccca tcaagaaagt ccggaagtct ctggctcttg 1980 acattgtgga tgaggatgtg aagctgatga tgtccacact gcccaagtct ctatccttgc 2040 cgacaactgc cccttcaaac tcttccagcc tcaccctgtc aggtatcaaa gaagacaaca 2100 gcttgctcaa ccagggcttc ttgcaggcca agcccgagaa ggcagcagtg gcccagaagc 2160 cccgaagcca cttcacgaca cctgccccta tgtccagtgc ctggaagacg gtggcctgcg 2220 gggggaccag ggaccagctt ttcatgcagg agaaagcccg gcagctcctg ggccgcctga 2280 agcccagcca cacatctcgg accctcatct tgtcctgagg tgttgagggt gtcacgagcc 2340 cattctcatg tttacagggg ttgtgggggc agagggggtc tgtgaatctg agagtcattc 2400 aggtgacctc ctgcagggag ccttctgcca ccagcccctc cccagactct caggtggagg 2460 caacagggcc atgtgctgcc ctgttgccga gcccagctgt gggcggctcc tggtgctaac 2520 aacaaagttc cacttccagg tctgcctggt tccctcccca aggccacagg gagctccgtc 2580 agcttctccc aagcccacgt caggcctggc ctcatctcag accctgctta ggatggggga 2640 tgtggccagg ggtgctcctg tgctcaccct ctcttggtgc atttttttgg aagaataaaa 2700 ttgcctctct cttaaaaaaa aaaaaaaaaa a 2731 &lt; 210> 6 &lt; 211> 700 &lt; 212> PRT &lt;213>Human&lt;400&gt; 6 4 5 201200525

Met Ser Arg Arg Thr Arg Cys Glu Asp Leu Asp Glu Leu His Tyr Gin 15 10 15

Asp Thr Asp Ser Asp Val Pro Glu Gin Arg Asp Ser Lys Cys Lys Val 20 25 30

Lys Trp Thr His Glu Glu Asp Glu Gin Leu Arg Ala Leu Val Arg Gin 35 40 45

Phe Gly Gin Gin Asp Trp Lys Phe Leu Ala Ser His Phe Pro Asn Arg 50 55 60

Thr Asp Gin Gin Cys Gin Tyr Arg Trp Leu Arg Val Leu Asn Pro Asp 65 70 75 80

Leu Val Lys Gly Pro Trp Thr Lys Glu Glu Asp Gin Lys Val Me Glu 85 90 95

Leu Val Lys Lys Tyr Gly Thr Lys Gin Trp Thr Leu lie Ala Lys His 100 105 110

Leu Lys Gly Arg Leu Gly Lys Gin Cys Arg Glu Arg Trp His Asn His 115 120 125

Leu Asn Pro Glu Val Lys Lys Ser Cys Trp Thr Glu Glu Glu Asp Arg 130 135 140 lie Me Cys Glu Ala His Lys Val Leu Gly Asn Arg Trp Ala Glu lie 145 150 155 160

Ala Lys Met Leu Pro Gly Arg Thr Asp Asn Ala Val Lys Asn His Trp 165 170 175 201200525

Asn Ser Thr Me Lys Arg Lys Val Asp Thr Gly Gly Phe Leu Ser Glu 180 185 190

Ser Lys Asp Cys Lys Pro Pro Val Tyr Leu Leu Leu Glu Leu Glu Asp 195 200 205

Lys Asp Gly Leu Gin Ser Ala Gin Pro Thr Glu Gly Gin Gly Ser Leu 210 215 220

Leu Thr Asn Trp Pro Ser Val Pro Pro Thr lie Lys Glu Glu Glu Asn 225 230 235 240

Ser Glu Glu Glu Leu Ala Ala Ala Thr Thr Ser Lys Glu Gin Glu Pro 245 250 255 lie Gly Thr Asp Leu Asp Ala Val Arg Thr Pro Glu Pro Leu Glu Glu 260 265 270

Phe Pro Lys Arg Glu Asp Gin Glu Gly Ser Pro Pro Glu Thr Ser Leu 275 280 285

Pro Tyr Lys Trp Val Val Glu Ala Ala Asn Leu Leu lie Pro Ala Val 290 295 300

Gly Ser Ser Leu Ser Glu Ala Leu Asp Leu lie Glu Ser Asp Pro Asp 305 310 315 320

Ala Trp Cys Asp Leu Ser Lys Phe Asp Leu Pro Glu Glu Pro Ser Ala 325 330 335

Glu Asp Ser lie Asn Asn Ser Leu Val Gin Leu Gin Ala Ser His Gin 340 345 350 6 201200525

Gin Gin Val Leu Pro Pro Arg Gin Pro Ser Ala Leu Val Pro Ser Val 355 360 365

Thr Glu Tyr Arg Leu Asp Gly His Thr Me Ser Asp Leu Ser Arg Ser 370 375 380

Ser Arg Gly Glu Leu lie Pro lie Ser Pro Ser Thr Glu Val Gly Gly 385 390 395 400

Ser Gly Me Gly Thr Pro Pro Ser Val Leu Lys Arg Gin Arg Lys Arg 405 410 415

Arg Val Ala Leu Ser Pro Val Thr Glu Asn Ser Thr Ser Leu Ser Phe 420 425 430

Leu Asp Ser Cys Asn Ser Leu Thr Pro Lys Ser Thr Pro Val Lys Thr 435 440 445

Leu Pro Phe Ser Pro Ser Gin Phe Leu Asn Phe Trp Asn Lys Gin Asp 450 455 460

Thr Leu Glu Leu Glu Ser Pro Ser Leu Thr Ser Thr Pro Val Cys Ser 465 470 475 480

Gin Lys Val Val Val Thr Thr Pro Leu His Arg Asp Lys Thr Pro Leu 485 490 495

His Gin Lys His Ala Ala Phe Val Thr Pro Asp Gin Lys Tyr Ser Met 500 505 510

Asp Asn Thr Pro His Thr Pro Thr Pro Phe Lys Asn Ala Leu Glu Lys 515 520 525 201200525

Tyr Gly Pro Leu Lys Pro Leu Pro Gin Thr Pro His Leu Glu Glu Asp 530 535 540

Leu Lys Glu Val Leu Arg Ser Glu Ala Gly lie Glu Leu lie Me Glu 545 550 555 560

Asp Asp I le Arg Pro Glu Lys Gin Lys Arg Lys Pro Gly Leu Arg Arg 565 570 575

Ser Pro lie Lys Lys Val Arg Lys Ser Leu Ala Leu Asp Me Val Asp 580 585 590

Glu Asp Val Lys Leu Met Met Ser Thr Leu Pro Lys Ser Leu Ser Leu 595 600 605

Pro Thr Thr Ala Pro Ser Asn Ser Ser Ser Leu Thr Leu Ser Gly lie 610 615 620

Lys Glu Asp Asn Ser Leu Leu Asn Gin Gly Phe Leu Gin Ala Lys Pro 625 630 635 640

Glu Lys Ala Ala Val Ala Gin Lys Pro Arg Ser His Phe Thr Thr Pro 645 650 655

Ala Pro Met Ser Ser Ala Trp Lys Thr Val Ala Cys Gly Gly Thr Arg 660 665 670

Asp Gin Leu Phe Met Gin Glu Lys Ala Arg Gin Leu Leu Gly Arg Leu 675 680 685

Lys Pro Ser His Thr Ser Arg Thr Leu lie Leu Ser 690 695 700 5 201200525 &lt;210&gt; 7 &lt;211> 22 &lt;212> DNA <213> Manual&lt;220&gt;&lt;223>ArtificialSequence&lt;400&gt; 7 gtctaccagg cattcgcttc at 22 241 person &lt;210&gt;&lt;211> <212> &lt;213> &lt;220&gt;<223>&gt; artificial sequence&lt;400> 8 tcagctggac cacagccgca gcgt 24 &lt;210> 211 person&lt;211> &lt;212&gt;&lt;213&gt;&lt;220&gt;&lt;223&gt; artificial sequence&lt;400&gt; 9 tcagaaatcc tttctcttga c 21 &lt;210&gt; 10 &lt;211> 24 &lt;212&gt; DNA <213>&lt;220&gt;&lt;223>Artificial sequence 9 201200525 &lt;400> 10 ctagcctctg gaatcctttc tctt 24

Claims (1)

201200525 VII. Patent application scope: 1. An isolated recruit peptide, including an amino acid sequence, which is selected from the group consisting of 2 to 4, wherein the oligopeptide and a human leukocyte Tissue antigen binds and has a cytotoxic T lymphocyte evoking ability. 2. An isolated oligopeptide, wherein the oligopeptide binds to a human leukocyte antigen and has a cytotoxic T lymphocyte evoking ability, wherein the peptide is selected from sequence identification numbers: 2 to 4. One of the amino acid sequences consisting of 1, 2 or several amino acids inserted, substituted, deleted or added. 3) The peptide as described in claim 2, wherein the oligopeptide has one or both of the following characteristics: (a) the second amino acid from the N-terminus is selected from leucine and hydrazine In thiobutyric acid; and (b) the C-terminal amino acid is selected from the group consisting of proline and leucine. 4. The isolated oligopeptide described in paragraphs 1 to 3 of the patent application, wherein the human leukocyte antigen is a human leukocyte antigen _A2 〇5, such as Shen Qing patent scope items 1 to 4 The isolated oligopeptide is described as wherein the peptide is a nine-peptide or a ten-peptide. An isolated polynucleic acid, which encodes the oligopeptide according to any one of claims 1 to 5. 7. An agent for inducing a cytotoxic thymocyte, wherein the reagent comprises one or more of 201200525 as described in any one of claims 5 to 5, or such as Shen Guzhen The armor is called one or more of the polynucleic acid as described in item 6 of the patent scope. 8. A pharmaceutical agent for the treatment and/or prevention of cancer, and/or avoidance of recurrence after eight operations, wherein the agent comprises one or more of any one of items 1 to 5 of the patent scope of the patent application. The recruiting peptide, or as described in claim 6 of the patent application, or a plurality of the polynucleic acid. 9. The pharmaceutical agent according to item 8 of the patent application is formulated for administration to a human, and the human leukocyte tissue antigen is human leukocyte tissue antigen-A2. 10. The pharmaceutical agent of claim 8 or 9, which is formulated for the treatment of cancer. A method for inducing an antigen-presenting cell having a cytotoxic lymphoblast-inducing ability, wherein the method comprises one of the following steps: (a) i/3 la tr0, h叩 or y knife h叩 presenting an antigen to a cell Contacting the acetonide as described in any one of claims 1 to 5; or (b) encoding one of the oligopeptides as described in any one of claims 1 to 5 The polynucleotide introduces an antigen presenting cell. 12. A method of inducing cytotoxic T lymphocytes by any method comprising at least one of the following steps: (a) co-cultivating CD8-positive tau cells with antigen-presenting cells, the antigen-presenting cells exhibiting a human leukocyte antigen a complex of the oligopeptide according to any one of claims 1 to 5 on the surface thereof; (b) co-culturing the CD8-positive tau cells with the exosome, exosome 201200525 Demonstrating a human leukocyte tissue antigen on a surface thereof with a complex of the peptide as described in any one of claims 1 to 5; and (c) encoding a tau cell receptor The multi-nucleotide gene of the unit polypeptide is introduced into a T cell which binds to the oligopeptide described in any one of claims 1 to 5. An isolated antigen-presenting cell exhibiting a complex of a human leukocyte antigen and a oligopeptide as described in any one of claims 1 to 5 on the surface thereof. 14. The antigen-presenting cell of claim 13, which is induced by the method of claim 11 of the patent application. An isolated cytotoxic T lymphocyte, which is characterized by a peptide as described in any one of claims 1 to 5. 16. The cytotoxic τ lymphocyte as described in claim 5, which is induced by the method of claim 12 of the patent application. 17. A method of inducing an immune response against cancer in a body, comprising the steps of: administering to the individual an agent comprising: the agent according to any one of claims 1 to 5; A peptide, an immunologically active fragment thereof, or a polynucleotide encoding one of the recruit peptide or the immunologically active fragment.