TW201122105A - Polycistronic expression cassettes for producing cellulosomes and applications thereof - Google Patents

Abstract

The present invention relates to a polycistronic expression cassette for producing a cellulosome and applications thereof.

Description

201122105 VI. Description of the invention: [Technical field to which the invention pertains] The versatility of the enzyme complex The present invention relates to a method for producing a cellulose hydrolyzed anti-expression profile and its use. [Prior Art] ^Beibei cellulose is abundant in the natural world' mainly in plants

^The sugar produced after decomposition can be converted into ethanol, which is the raw material of biomass energy. However, in the case of plant cell pairs, other components such as hemicellulose and lignin form a complex g structure, which requires pre-treatment to improve conversion efficiency. The pre-treatments currently used include physical and chemical methods such as 'powder, breaking, high temperature, high pressure and acid-base treatment; but these methods consume energy, and will poison the waste liquid, which is harmful to the environment and easy to produce other vices. product. The biological rule is to add enzymes or special strains to avoid the above shortcomings, but it is necessary to have multiple types of acid II to achieve effective fractionation. (4) Enzymes " Clostridium thermocells erwoce// Cong) is a heat-resistant anaerobic ‘, capable of decomposing cellulose. Studies have shown that Clostridium thermocellum forms a high molecular weight and complex multi-enzyme complex called cellulosome, which can be efficiently decomposed by the synergistic action of various decomposing enzymes. Cellulose. In addition to Clostridium thermocellum, many other microorganisms in the natural world have similar cellulolytic enzyme complexes, for example, Clostridium fibrosus/C_c^//"/〇v〇rara), Clostridium cellulosae (C. π 仇 / 〇 / 冲. cww), Clostridium clostridium (C_), Trichoderma longissima (bngibmchiatum), lyophilized I bacillus (Bacer〇ides, Vibrio lyticum (also咖./〇ce/秘细·(10)), rumen fungus Ν-type bacterium (A/e〇ca//z'wa^:x, zhou to/), rumen fungus ρ-type bacterium {Piromyces spp), giant spore Bacillus (5 (10) γ / (10) off her), 201122105 Bacillus licheniformis, Bacillus licheniformis (and ^. / such as cellidosohens), special tumors (Ruminococcus flavefaciens), and solutions Vibrio anguillarum (. Studies have shown that 'cellulolytic enzyme complex of Clostridium thermocellum mainly contains three subunits: scaffold protein, decomposing enzyme and cell surface anchoring protein; As a skeleton, it has multiple type Icohesin domains, which can be decomposed The type 1 dockerin domains bind; the scaffold protein has a type II dockerin domain, which can interact with the cell surface in the second type of binding domain of glutinous protein (type II). The cohesin domain combines with each other to enable the cellulolytic enzyme complex to be immobilized on the surface of the bacteria; the scaffold protein has a carbohydrate-binding d〇main (fBM)' to bind to the cellulose carbohydrate substrate. Figure 丨 shows the structure of the cellulolytic enzyme complex of Clostridium thermocellum. In the cellulolytic enzyme complex of Clostridium thermocellum, the scaffold protein (CipAj has nine first-type binding domains, which can combine nine decompositions). Enzyme 丨 cell table = mislocalized protein (01pB, SdbA and 〇rf2p) can each be linked to one or more scaffold proteins; and decomposing enzymes include at least exoglucanases (ex〇glucanases)

CelS CblA and CelK), endoglucanase (en〇gjucanases such as ceiR, CelA CelF CelN and CelB), polyxylase (Xy[anases (such as Xync, ^ηΥ ϋΥηΖ) and hemicellulase (hemiceIlul) Ases, such as LicB and ChiA), etc. 'The heat fiber (4) will be different due to the environment (for example, facing the correct ratio of different carbon glutenolytic enzymes) to achieve synergistic decomposition efficiency. For example: : stone bismuth - in microcrystalline fiber * (avicel) when 'H. thermocellum has the highest performance j, knife:, is CelK, followed by Cels, cdR, CdA, 乂 (4) Temple · and the above-mentioned decomposing enzymes when the carbon source comes from fiber II When sugar ce, = s:), the thermal fiber is adjusted to the highest amount of decomposing enzymes, such as XynC, CelA, CelK, CelR and CelS. The ratio of the content of the enzymes to the specific carbon source is determined. How to regulate the correctness of various degrading enzymes for Clostridium thermocellum 201122105 The molecular mechanism of the ratio is not very clear. For related literature, see Gold et al., 5<3cier/c»/. 189(19): 6787-6795, 2007; Bayer et al.,/·do"Gara/ 〇/· 124 : 221-234, 1998 Demain et al., Μοό—/· Shi/. Intestines/69: 124-154, 2005; and Wu, 乂〇^do—.516: 251-264, 1993 Bayer et al., Curr Opin Biotechnol. 18(3) :237-45, 2007; Cha et al, J Microbiol Biotechnol 17(11): 1782-8, 2007; Blouzard et al, JOURNAL OF BACTERIOLOGY 189 (6): 2300-9, 2007. Artificially manufactured "Designer Cellulolytic Enzyme Complex (designer

Cellulosome) is considered to be an important tool for studying the hydrolysis system of cellulolytic enzyme complexes, and can also be applied to the industrial process of biomass energy. However, due to the complexity of the cellulolytic enzyme complex itself and the technical bottleneck of multi-gene transfer, it is still not possible to construct a complete or nearly complete cellulose hydrolase complex by artificial techniques.取 取 取 取 取 取 使用 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌 大肠杆菌'. The technique of a fusion type cellulolytic enzyme complex (chimedc ce丨lu丨〇s〇mes) is proposed. Fierobe et al. produced a fusion scaffold protein (chimencscaffoldins) containing two kinds of binding domains from different bacterial sources by recombinant technology, each of which has strong specificity for the anchoring domain corresponding to the degrading enzyme of the species and does not Mutual H thus 'containing the corresponding localized degrading enzyme can be precisely bound to the corresponding binding domain of the fusion scaffold protein, thereby combining the expected cellulose hydrolase complex in vitro (j. Bi〇 1 Chem. 27_ 21257-21261 ). However, this technique purifies each recombinant protein, and then combines the cellulose hydrolase complex in vitro. There are many limitations. For example, the pairing between the selected binding domain and the anchoring domain must be specific. The pairing between Cognac and his anchoring domain and the anchoring domain to avoid affecting the cellulose hydrolyzed complex: formation, and the types of pairings that can be used for this technology are limited, no more than three. And even if there is new in the future The pairing_ appears, and each time it has to be reconstructed ^ the fusion of 201122105 type uncollected protein 'to be sure that the new pairing type will not interfere with the original pairing type before it can be used, the project involved is very cumbersome, very not Conveniently, there is no way to adjust the ratio of various decomposing enzymes to achieve synergistic decomposition efficiency for a specific substrate. On the other hand, Cho et al. have constructed a expression vector carrying the gene for Clostridium clostridium fragment (mini-CbpA) and EngB degrading enzyme and transferred it into Bacillus subtilis 'to confirm that these genes can be A cellulolytic enzyme complex (minicellul〇s〇mes) that is expressed and composed of Bacillus subtilis (ch〇et aL 2004. Production of Minicellulosome form Clostridium in bacillus subtilis WB800. cellulovorans - called - (4) AppUed and

Ermronmental Microbiology 70(9): 5071-5707). Arai et al. constructed the individual vectors of the scaffolding protein, EngB decomposing enzyme and XynB, and confirmed that the same culture contains the scorpion branch and the EngB _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ Bacillus subtilis, which decomposes the gene of the enzyme, can produce tiny cellulose hydrolase complexes (mmicellulosomes), one consisting of a fragment scaffold protein and a fragmentase protein and a ca6 decomposing enzyme - 2007. Synthesls of Clostridium cellulovorans minicellulosomes by intercellular complementation. Proc Natl Acad Sci USA 104^5): 1456·6()). Fine, the scaffold protein used in the above technique has only a small fraction of the fragment, and the number of adhesive domains contained is only for testing. And the decomposition of eight; and only in the ^ host to transfer the most - a breakdown of the enzyme gene; the entire cellulolytic enzyme complex has a considerable gap, also solve the enzyme to achieve a synergistic decomposition efficiency for a specific substrate: various Knives [Summary of the Invention] The present invention provides a novel technical solution for the first time, in which the ratio of the cellulose hydrolase complex containing a plurality of decomposing enzymes can be determined. It is intended to adjust the synergistic decomposition efficiency of 'Lim imitation micro ^. Compared with the prior art (for example, the melt enzyme complex) 'the invention makes the coffee reorganization step simple, and the pairing type of 201122105 Γΐίί' can be easily and conveniently in the ground cell.穿 』 合 合 水解 水解 ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私 私a sub-nucleotide sequence, which is linked to the promoter #, an enzyme: two = and a plurality of subunits encoding the plurality of decomposing enzymes;; the order of the plurality of decomposed 醢 aws In the nucleotide sequence, the performance of the performance of the control group under the control of the ^^ early & mover {£.Φ本毛明 provides a vector comprising the above-described polycistronic donor host cell , which comprises the above-mentioned carrier. The method of the body, I? The method for producing the cellulolytic enzyme complex enzyme and the cellulose hydrolyzed substance in vivo, and guiding the human (4): in this 201122105, the amount of the cellulolytic enzyme subunit is The method of achieving the modulation ratio. The details of the inclusions between the hard-numbered decomposing enzyme subunits are as follows. The detailed descriptions of the other specific examples of the present invention and the scope of the patent application are generally described in the technical field of the present invention. Having a knowledge of tongwei can be based on _ remuneration _ == Description is merely an illustration and is not limited in any way. [Embodiment] Women have indicated that 'all are here (10) technical and scientific terms have X Ming The general knowledge of the technical towel is generally understood. The word "-" used by a person, if not specified, means at least one (one or more) quantity. The term "cellulolytic enzyme complex" used in this paper is a multi-enzyme complex, which is called the self-cultivating unit of the cockroach, and has the ability to efficiently administer the lysin. A cellulolytic enzyme complex comprises scaffoldin subunits and a plurality of enzymatic subunits. The scaffold protein subunit acts as a natural cellulose hydrolase complex, which typically comprises one or more type I cohesive domains, which are used in conjunction with the first type of each subunit of the decomposition enzyme. The 定6 II dockerin domains are combined with each other. A plurality of decomposing enzyme subunits having two or more decomposing enzyme subunits including, but not limited to, cellulase (extension), exoglucanase (ex〇giucanases), endoglucanase (enoglucanases) ), Xyianases, hemicellulases, ceU〇bi〇hydr〇lase, β-glucosidase, exo-β_ι, 4· Glucanase (BGLU, EC3.2.1.21), lichenitanase (nchenase, β_1,3-1,4-endopoly 201222105)

ClaclI; ^ ^ knows the ratio of the amount of expression of each (Pectmase), carbohydrate esterase i: l = SteraSeS), proteolytic enzyme Wes), which is regulated by different growth environments (eg, different carbon sources), To achieve synergistic decomposition efficiency. The cellulose plate further comprises a cell surface anchor protein subunit which immobilizes the multi-enzyme complex on two less surfaces. Code · ‘ cell table to determine the egg from the subunit

The j-type two-type binding domain can be combined with the second type of scaffold protein. The "scene protein (tetra) acid sequence" and "multiple decomposing enzyme nucleus f-sequences" = "cell surface tin-binding protein nucleotide acid sequence" used in it j text respectively refers to the code 0 killing white · human unit, plural The nuclear-sequence of the degrading enzyme subunit and the cell surface tin-fixing protein subunit, which can encode the full-length amino acid sequence of the end-of-life self-primary sub-S, can also be its fragment or its (four), including genes. Engineering variants, which preferably have at least a personal bonding domain and/or a defined domain. In the natural world, 'microorganisms that can produce cellulolytic enzyme complexes include, but are not limited to, thermal fiber pike (c.), C. brevis (c. (^/// 〇 55), fiber-optic shuttle Bacteria ((:^/〇/>俭证), Clostridium erythraea (C. p印少row/vMs), Trichoderma longissima (Conghua heart & face longibmchiatum), dissolved Dawei I Rod BaQ Bacer〇ides ceU^Iosohem), Acetivibri〇celljMyticusas, Helicobacter pylori N-type bacteria (refueling 3 along), Ruminal fungus p-type (Piromyces spp), Huge> Bacmus megaierium, Bacillus licheniformis (ugly &<:丨111^如满1'11^), Bacillus licheniformis (5 ships 7/along celhilosolvens), Staphylococcus aureus (Rumin〇) C〇ccus only (10) is like a coffee, and the fiber vinegar arc (Shi.vz.Wo ce//W_yi/cw5·). Table 1 lists information on the cellulolytic enzyme complexes of various microorganisms. Table 1: 201122105 Microorganisms of the genus Fusarium oxysporum protein subunit scaffold protein subunit CipA. With nine binding domains' can be combined with decomposing enzymes, tin-localization, decomposing enzyme subunit exoglucanase endoglucanase X. velutipes polyxylase: hemicellulase: cell surface anchoring protein OlpB: with seven binding domains binding to SdbA with one binding domain binding to 0rf2p with two binding domains __ domain binding scaffold protein subunit CbpA: with nine bonding domains

For example, CelS, CblA and CelK such as CelR, CelA, CelF, CelN and CelB such as XynC, XynY and XynZ such as LicB and ChiA can be anchored to the scaffold protein and anchored to the scaffold protein to bind to the scaffold protein, and Decomposing enzyme subunit exoglucanase: endoglucanase: polyxylase: hemicellulase: can be combined with the enzyme

- A cell surface anchors the adhesion. For example, CelF, such as CelA, CelD, CelC, CelG, CelE, such as Cel5A, xyni〇A, such as Gal27A, V. velutipes scaffold protein subunit CbpA. With nine binding domains, it can bind to the β-嶋 binding domain of the degrading enzyme. : 201122105 Exoglucanase: Endoglucanase: Semi-fibrillar:

Such as ExgS

Such as EngH, £ngK, EngL, EngM:, and EngN, such as ManA Chengze's "performance card E" refers to a technique by recombination techniques or humanity; in = cell, due to performance. Table; , 1, 軏: pro-nucleoside 驮 sequence encodes two or more beautiful traitors = household shun counter nuclear position" B: = ^ bitter acid sequence. 3. Flat code - one or more gene products of the intrinsic acid to be transcribed = gene sequence or giant knife. The skilled artisan can clearly _Yes, by = : Γ "The egg-based white factor sequence can encode the same polypeptide. Therefore, in addition to ΐ ΐ ΐ 彼 彼 彼 彼 互 互 或 = = = = = = = = = 「 「 「 「 「 「 「 「 「 「 「 「 「 The word B is used to describe the number of points in the environment - the growth of the environment or the activity of the enzyme = 3 is the case of Clostridium clostridium, when the culture environment contains microcrystalline cellulose as the stone anti-correction 'miao _ _ water _ The re-cutting of the age-resolving enzymes & 201122105 = the current = yeast = fs low ranking is one, the word "lignocellulosic biomass" used in this article refers to the decomposition of the hydrolase complex into energy Woody impurities. The cellulosic biomass comprises - or a plurality of components selected from the group consisting of _ Ί, hemicellulose, and lignin - or any of them. In a aspect, the present invention provides a polycistronic expression card g for producing a "cellulolytic enzyme complex" in a host cell, the cellulose complex comprising a scaffold protein subunit and a plurality of 4 S=resolving enzymes The unit is characterized by its presence in the growth of the environment, and the polycistronic expression cassette comprises: (a) a promoter; and a SIT anti-severe nucleotide sequence operably linked to the promoter, = 夕 反 子 酸 酸 酸 酸 包括 包括 包括 包括 包括 包括 包括 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸 酸In the order of r and (4) ^Weiquan's prime hydrolase to the next: workability; Cheng; second 'because of the various nuclear training sequences of the lead in the position of the position! The second set is related to its performance, so it can be designed Arbitrarily adjust the base and obtain two: the relative expression of the product corresponding to the ϊίΐ acid sequence, the enterin hydrolase complex, which simulates the synergistic separation of the natural microbial cellulose; 201122105 white times two _:, cellulose hydrolase complex Body bracket egg domain), and multiple points ^ ( Coffee I - domain), and in the middle of the brother - type mislocalization (typel combined with each other, therefore, branch; type = domain and the first type of tin localization can be combined - in - instance can be, and decomposition The enzyme subunit complex domain can provide nine decomposing enzymes; ^ nine first type sticky CipA). Early 兀, ·, σ 5 position (eg, Clostridium thermocellum * Bausin f-enzyme complex can be Into the - domain), and the brackets are obedient, the pa-binding alpha domain (type II cohesive d-, wherein the second lion, therefore, the scaffold protein for a long time, - or "e brother-type anchoring domain can mutually The surface of the tinned egg is fixed from: the unit is retorted ^^ reading a decomposing enzyme can be combined with the cell surface, and the surface of the cell can be provided separately, one or two (for example, sdbA, 0rf2p wood of Clostridium thermocellum) - White one position body. The sub-expression can be constructed by constructing a high-order protein compound with a type-type adhesion.

CipA) and the combination of nine knives and angles, such as the combination of the seven scaffold protein subunits including seven second-type binding domains k for the combination of the 63 decomposing enzymes and the single S. Then, ~, the stipulations = the present invention 'plural number of decomposition enzyme subunits according to their in-environment growth in the multi-sequence of the present invention = position / position / order, so that the mother is 7C early Ranked under the control of Qianzizi 13 201122105 顺f and the yuan gambling name to be added. More specifically, the complex financial enzymes ^ sequence according to their distance from the promoter distance (four) into - (four) order, the more The gene sequence of the promoter is higher, and the higher the amount of expression, the farther the gene from the promoter is, the lower the amount of expression is. Therefore, the order of the genes can be arbitrarily adjusted as needed, so that the corresponding multiple decomposition enzyme subunits are The ranking order of the performance under the control of the promoter is consistent with its natural ranking order. The resulting multiple decomposition enzymes are 7L in a competitive manner and bind to the binding site provided by the scaffold protein subunit to form a biomimetic cellulose hydrolysis. Enzyme complex. According to the present invention, we can design a cellulolytic enzyme which can be produced in a host cell according to the cellulolytic enzyme complex of any natural microorganism (especially according to the natural ranking order of the amount of the decomposing enzyme subunit) The multi-cis scorpion complex of the complex exhibits a ruthenium. The cellulolytic enzyme complex according to the present invention can be derived from various microorganisms including, but not limited to, Clostridium thermocellum (C_ceZ/w/ovoram) ), Clostridium cellulosic (cc^hMytic dirty), lysin (c papyr〇s〇h; ens), Campylobacter sinensis (THc/zoiier dirty. / 〇 / 7g / 6rac / z / Ai surface), Bacteroides lysate ce//w/(10)/v(10)), Bacillus fluorescens "Caf. celluhlytjcusas", tumor type N (Ne〇callimasHxfr〇ntaUs), rumen fungus P type bacteria (corporate z > om less ces ψ ρ), Bacillus megaterium (such as c / / 仏), Bacillus licheniformis (Baciilus lichenif〇rmis), soluble fiber teeth only ΐ ί (such as (? / / / (10) ce / Zw /ow/ve), yellow rumen cocci (Gam/(10)coccw /7ανφ6), and Vibrio anguillarum/v./〇celMolyticu s). In a preferred embodiment, the polycistronic expression cassette of the present invention is designed according to a cellulolytic enzyme complex derived from a thermophilic microorganism, and is contained in a cellulolytic enzyme complex of such a microorganism. The various decomposing enzyme subunits have thermal stability. Therefore, the polycistronics exhibit a cellulose hydrolyzate/enzyme 'high enzyme activity at high temperature' which is beneficial to the industrial biomass energy process. In a preferred embodiment, the thermophilic microorganism is Clostridium thermocellum. In a specific embodiment, the scaffold protein subunit is CipA. 14 201122105 In a specific embodiment of the present invention, the scaffold protein subunit CipA and the plurality of decomposing enzyme subunits include exoglucanases CelS and CelK, endoglucoside per CelA, and xylase XynC and XynZ. In a specific example, the cleavage enzyme nucleotide sequence of the polycistronic nucleotide sequence is sequentially encoded by CelS, CelK, CelA, XynC and Xynz. In yet another specific example, the polycistronic nucleotide sequence encodes CipA, CelS, CelK, CelA, XynC, and Xynz sequentially. In another preferred embodiment, the polycistronic expression cassette of the present invention Designed according to a cellulolytic enzyme complex from Clostridium thermocellum, the natural cellulolytic enzyme complex further comprises a cell surface anchoring protein subunit. In a specific embodiment, the scaffold protein subunit is CipA. In still another embodiment, the cell surface anchoring protein subunit is selected from the group consisting of 〇lpB, SdbA, and 0rf2p. In another embodiment, the plurality of degrading enzyme subunits comprise exoglucanases CelS and CelK, endoglucanase CelR and CelA, and polyxylases XynC and XynZ. In a specific example, the degrading nucleotide sequence k of the polycistronic nucleotide sequence encodes CelK, CelS 'CelR, CelA, XynC, and XynZ. Preferably, the cell surface tin-fixed protein The unit line SdbA, more preferably the polycistronic nucleotide sequence, encodes CipA, CelK, CelS, CelR, SdbA, 'CelA, XynC and XynZ sequentially. In another specific example, the polycistronic nucleotide sequence degrading enzyme nucleotide sequence encodes XynZ, XynC, CelA, CelK, CelR, and CelS in sequence. wherein 'preferably' cell surface tin-fixation protein The unit line SdbA, more preferably the polycistronic nucleotide sequence, encodes CipA, XynZ, XynC, CelA', SdbA, CelK, CelR, and CelS. In still another embodiment of the invention, the scaffold protein subunit is CipA' and the cell surface anchoring protein subunit is 〇ιρΒ. A promoter is a transcription of a nucleic acid sequence in which a member of a nucleotide sequence' can initiate operably. At the very least, the promoter contains an RNA polymerase binding site. It may further comprise one or more enhancer elements that are by definition 15 201122105 transcriptional or comprise one or more regulatory elements that control the on/off state of the promoter. The appropriate promoter selected for construction of the performance cassette is determined by the type of host cell into which the performance cassette is introduced. When E. coli is used as a host cell, 'the promoter of the aptamer includes' but is not limited to the β-endoprolinase and the lactose promoter system (see Chang Temple, 275: 615-624, 1978); SP6, Τ3 And the T7 RNA polymerase promoter (Studier et al., cf. 〇 〇 185: 60-89, 1990); λ-promoter (Elvin et al., Ge. 87: 123-126, 1990); (Nichols and Yan0fsky, Cabin 1〇1: 155-164 '1983); tac and trc promoters (Russell et al., 2〇: 231-243, 1982) ' and pCold (see US Patent 6,479, 26) . When the dry grass rod is selected, the hemp promoter includes the pr promoter, the Spol promoter, the Tac promoter, and the LacI promoter. These promoters are also used in other bacterial hosts, for example, Escherichia coli (汾, Clostridium (C/o magnetic//biliary), mycoplasma (Mt./M), Lactococcus (10) (10)), lactic acid Bacillus (1 coffee), Vibrio (de-sounding) =^Green bathing your coffee). For yeast (eg, Saccharomyces cerevisiae)

Promoters for ίιίϊ® (eg 'Kluyveromyces, Pichia, Aspergillus, Trichoderma 2') include Lac4 promoter, Adh4 promoter, GapDH, sub-, Adhl promoter, Pgk promoter, Aac promoter , ph〇5 promoter and Gal7 promoter. In the preferred concrete real towel, the (four) guided promoter structure _ performance card = this ^ Kai, the child money compared to the (four) if the tree is corrected (for example, or four% prime) or at a specific temperature (for example, a thief Or above). ί ί = methods such as gene sequencing or restriction enzyme sequencing, target genes and their locations. 'The indicator is then introduced into the appropriate host cell of the ΐ/complex. You can do this when you need it. Ίί = Performance card: The host of the remaining notes is recorded: 曰Μ. Since the thermophilic enzyme is encoded, the host cell is preferably sinister. W selection strains can be identified by, for example, antibiotic resistance selection method, with 201122105 S5ii=^=^^ tear===card activation secondary reading) or at special temperature (for example, 4〇t or above). The egg-making card can be used for the body. The present invention provides a cellulolytic enzyme complex, and the present invention provides a carrier which comprises a host cell which contains the aforementioned carrier. Set. Then, the expression of the thermophilic enzyme, the host (2) such as = gene encoding the desired enzyme activity is determined by the clock, and by measuring γ to express the gene encoded by the gene, bacteria, lactococcus, lactobacillus, Qufu or other fungi (eg, Kluyveromyces, koji, sputum, and Candida). (4) Yeast, body = ΐ = ί:;; = = enzymatically complex to obtain the cellulose hydrolyzed complex 1, the method of the invention still includes purification of the cellulolytic enzyme t rtf typically, since the scaffold protein has carbon water The compound (carbohydrate-binding domain, 201122105 method is used for the purification, and the other method, such as the cell p-culture is separated from the # cell, and can be combined, so that the simple step can be used to carry out the purification step. Mixing the material with the cellulose in a specific vegetal granule, and collecting the fiber by centrifugation, and detailing the implementation. The method of squeezing and squeezing the woody biomass of the wood, cellulose a steroid-like biomass. Typically, the xylem component. One or more human host cells of oryzanol, hemicellulose, and/or lignin are prepared by preparing the aforementioned carrier and guiding it. In order to achieve the complex ratio; Content (1) Preparation of Carrier Anti-Performance Card Players: 'the poly- (a) promoter; and the multiple of the plurality of degrading enzymes === the position of the sub-match ΓΓ relative to the promoter (2) the vector is introduced into the host cell and The plurality of decomposing enzyme subunits are described, wherein the ratio of the content of the fossils is thus adjusted. The details of each specific example of the sub-units are as follows. The technique of the present invention - The win will be more clearly presented by the detailed descriptions in the following specific examples and the application 201122105. Example 1: Construction of the multi-cistronic performance card of the present invention using the KOD-Plus kit of Japan TOYOBO Co., Ltd., pCR respectively Amplifying a DNA fragment encoding a cellosome protein such as CaspA, exo-glucanase CelS and CelK, endoglucanase CelA, and polyxylase XynC and χ%ζ; CipA contains a cellulose binding domain (CBM), a surface layer homology module (SLH), and nine [type binding domains. The resulting PCR products are separately cloned into the plastid pCR_XL_T〇p〇 and introduced into E. coli. In the host cell, using the Qiagen plastid Mid丨 set California

Qiagen Company) prepared DNA plastids from positive transformants and restriction enzymes, and isolated and purified by agarose gel electrophoresis to obtain the above-mentioned DNA fragments.疋 (2) In addition, the method of combining genes in the order of Bacillus subtilis (ordered gene assembiy in bad丨丨us subt丨, 〇Ga ^ the above DNA fragment is ligated to the gut of gut and Bacillus subtilis) The carrier "in the PGEST118", the shuttle carrier comprises a heat-receiving & promoter, and the material of the sulphur-containing sulphur-semi-milk (4) (iptg) is added to the stalks of the grass (Knowledge 31: Η3·3)) The genetic sequence of the design is C1pA_CelS-celK_celA_xynC_xynZ, which is derived from the produced enzymes. The method is to use a DNA fragment (such as the molar number) and the carrier. After using the Takara joint set ver. Bu 2 2: JI & π t V , - 5, drag hCUph called, 13, 2mMMgc: mM ATP, 300 mM NaC1, 2〇% (w/v ) ^ mitol, 0.2

Wako Purification Company), at 16. )); Japan's 7-knife 1 junction reaction, by 19 201122105 This produces recombinant DNA molecules, the performance of which includes the promoter and the polycistronic encoding sequence cipA-celS-celK-celA-xynC-xynZ The nucleotide sequence is shown in Figure 8 (SEQ ID NO: 1). Example 2: Screening of a transgenic strain containing the polycistronic expression cassette of the present invention

The polycistronic DNA fragment obtained in Example 1 was introduced into the B. subtilis mutant strains RM125 and BUSY9166. Briefly, a two-stage culture method was used to prepare a competent subtilis cell, Ur/〇/. 1961 81(5): 741-6 (1961), and then an appropriate amount of polycistronic DNA fragment with 100 ml of competent subtilis Bacillus cells were mixed 'incubated at 37 ° C for 30 minutes. 300 ml of LB medium was added to the mixture of the DNA and the cells, and then the cells were cultured at 37 for 丨 hours. The cultured cells were plated on LB plates containing tetracycline (10 mg/ml) to create a positive transformant. The seeding machine was cultured in thieves for 5 hours in a medium containing 1 mM isopropyl thiopurine 1-half-glycoside OPTG and then chopped for 3 hours. The supernatant was then collected and then concentrated and concentrated using an Amic〇n filter (3〇 & 阙 value). The degree of fluorescing of the sputum was measured by measuring the degree of fluorescing activity of the sputum to determine the glucanase activity of the selected strain.

Α Because of the f and 1 '13', it can show glucanase activity' " φ, 7 CR / knife analysis results are not obvious, the DNA from these plants can follow the gene Digestion of Na•CdS-CelK_celA;:c:fz is arranged according to the design order'' Example 3: Enzyme activity analysis strain) === Colonization = ' and empty vector (control "protein performance. _, to 5 , _ g will induce the supernatant to collect the supernatant, and use Viva 2 5G (ϋ 1〇 minutes. U U0 coffee threshold) (Germany 20 201122105

In the case of anti-displacement buffer (50 mM Tris, 10 mM CaCL and 5 mM DTT pH 6.8), it was concentrated at 4 ° C in the case of anti-displacement buffer (Styots, Goettingen). On the other hand, the cell sink was also collected; the temple 'resuspend in PBS' by ultrasonic vibration (pulse: 3 seconds; stop: 2 seconds every 12 minutes) dissolved 'and then centrifuged at 13,200 rpm for 40 minutes' A sample containing intracellular proteins ("intracellular sample") is formed by removing particles. Alternatively, the cell pellet is collected and then resuspended in PBS to produce a sample containing intact cells. The protein content of the supernatant and the intracellular sample was measured by the Bradford method, and then the enzyme activities of the samples were analyzed by the following methods.

丄1 endoglucanase activity using azurite cross-linking (AZCL)-β-glucan (dye CMC) (purchased from

Endoglucanase activity was determined as a substrate by Megazyme. Briefly, 1% (v/w) dye CMC with 50 mM sodium acetate was incubated with the above supernatant sample and intracellular sample for 3 hours, respectively, and then the absorbance at 590 nm of each sample was measured (ΟΕ&gt (59 〇 value), which is related to the activity intensity of glucanase. Figure 2 (a) and (b) show the activity and specific activity of the endoglucanase of the sample, respectively. The supernatant samples of the selected strains 1 and f 13 had more than 2 times the endoglucanase activity than the supernatant samples of the control colonies; Significantly elevated _glucanase activity was also measured in the cells of the selected strains, 13 (see Figure 2 (a). Compared to the control plants, the intracellular protein content of the selected strains 1 and 13 was The 'hi table does not contain a certain amount of exogenous protein in the cell, which is the same as that in Fig. 2. The specific activity (the activity of the enzyme against the total egg self-content) is 3·2 total glucan. The activity of the enzyme is the activity of the total glucanase, and the supernatant and the intracellular sample are buffered in the buffer of 60 2 acetate steel (pH 5 〇), and the final 4-methyl umbrella is used. Cellulose disaccharide (c) was mixed for 3 hours. The activity was measured by fluorescence spectrometry at 365 nm UV irradiation in 201122105 1% NaCCb. Figures 2 (c) and (4) show the total glucan of the sample, respectively. ^Sexuality and specific activity. Each time/ancient result shows that the activity of the glycoside from the supernatant of the selected strain.i*13 is higher than that observed from the supernatant of the selected strain. The activity ^ is shown in Figure 2 (c); and a certain amount of exogenous 2 is found in the cells. Figure 2 (d). Insect, see Example 4: Detection of the formation of the oryzanol hydrolase complex by SDS:PAGE The formation of the cellulolytic enzyme complex in the selected strains i and 13 was detected. First, the extracellular protein from the two selected strains was placed at 5-15 含/containing 0.1 〇/〇SDS/ 〇 (w / v) polyacrylamide amine gel electrophoresis analysis. The polyacrylamide gel was then placed on top of a lignan- or "CMC-containing loam gel" and the bubbles between the two gels were removed. Take the two gels and incubate at 4 (TC for 3 hours (if the gel contains CMC): Incubate overnight at 60 ° C (if the rouge gel contains xylan). After the gel and poly _ _ separate, _ and carry out the egg from #钱〇(^r〇mby) protein staining. The agar gel is soaked in lmg/ml Congo red in %-仞, then soaked in lMNaCl for 10-60 minutes. The position where the CMC xylan matrix was decomposed on the gel showed a yellow color, while the position where no decomposition occurred showed a dark red color. The polypropylene guanamine gel was also cultivated to contain 0 2 mg/ml Muc and 5 〇IMN, 〇Ac The solution (pH 5.0) was incubated at 6 (TC for 30 minutes to measure its glucanase activity. By examining the gel at 365 nm to detect the degree of decomposition of MUC. The results showed that the selected strains 1 and 丨3 exhibited the activity of extracellular endoglucanase, xylan and total glucanase. 依月?,4田述在]\^31^如,/5/0 /.(^Chen 262:1〇〇35~1〇〇38 (1,987) or Salinovich and Montelaro^a/. 5ζ.π/ζ饿156:341-347 _(L986lt method, the above polyacrylamide Protein transfer on the gel Vinyl film (GE). Block the film with pbS containing 5% skim milk, 22 201122105 Wash '= with anti-rCipA antibody 0: 5000-fold dilution) in the ginseng for i6 hours. After several cleanings, 'make the difficulty The ancestors p_ total light goat anti-co-culture, (1: 5000-fold dilution) co-cultivation. The cultivar was co-cultured with the solution of p, and the protein was extracted from the gel with the above-mentioned protein at the position where the activity was shown. , ', and then with 5-15% (w / v) polyacrylamide gel and two-dimensional D-ship gel electrophoresis analysis. In this analysis, found that each peptide system and (7) eight, ^ "

The fragments of the CelS, QpA and XynZ proteins are highly similar, indicating that these proteins form a protein complex and exhibit the desired degrading enzyme activity. / Example 5: Determination of Enzyme Thermal Stability t The above method 'CCM and MUC were used as the test for the control strain and the strain 1 for extracellular degrading enzyme activity at different temperatures. Figure 3 shows the knot. The results showed that the selected strain 1 showed higher decomposing enzyme activity at higher than 5 ° C and a greater difference at higher temperatures than the control selection, see Fig. 3 (a). In addition, the 'selected strains have similar extracellular protein content at each test temperature. See Figure 3(8), indicating that the selected strain i has elevated decomposing enzyme activity at high temperature, which is attributed to the stability of the decomposing enzyme thief. . Example 6: Other examples 6.1 Other polycistronic expressions The construction of cassettes and the selection of transformed plants are based on the aforementioned biomimetic strategy 'Simulation of Clostridium thermocellum to different carbon sources and the enzymes of the modulin hydrolase complex The order of performance is ranked, and other examples of the polycistronic expression cassette of the present invention are designed, wherein the pattern [the polycistronic expression 匣 is based on microcrystalline cellulose (avicel) as a carbon source, and its genetic order is cipA. -celK-celS-celR-sdbA-celA-xynC-xynZ ; and the mode Η ^ cistron performance card 匣 based on cellobiose as a carbon source, its genetic sequence $ 23

» I 201122105 cipA-xynZ-xynC-celA-sdbA-celK-celR-celS. The experimental method is the same as described above. First, 'each code QpA, CelS,

DNA fragments of cellulosic proteins such as CelK, CelA, CelR, XynC, XynZ and sdbA were cloned into the Topo vector system and subjected to restriction enzyme map analysis, sequence verification and colloid extraction purification. Then, the aforementioned DNA fragment encoding each cell body protein was ligated to the shuttle vector pGETS 188 in the designed order using the 〇GAB method. The ligation product was introduced into the B. sphaericus mutant BUSY9797 (strain of the CI inhibitor mutation), and a positive selection plant having tetracycline resistance was selected under the culture condition of 37 C. By restricting the digestion analysis of the enzyme, it is confirmed that the recombinant vector produced by the 5% sex-selective plant has the desired polysaccharide, and the polycistronic expression of the pattern I shows that the gene sequence of the cassette is cultA-celK-celS-celR- sdbA-celA-xynC-xynZ (Fig. 4(a)), whose sequence is shown in Figure 9 (SEQ ID NO: 2), and the polymorphism of the mode π

The gene sequence of card E is cipA-xynZ-xynC-celA-sdbA-celK-celR-celS (Fig. 4(b))' and its sequence is shown in Figure i(SEqIDn〇: 3). 6.2 Gene transcription analysis Using the RNeasy Protect Bacteria kit (high purity leg a separation kit 'Roche'), the whole leg was isolated from the bacilli after 20 hours of culture. Use the f-transcription kit (iScript cDNA synthesis kit, BioRad) and the SYBR green IRT-PCR kit (Roche 48 〇 SYBR, Roche) and the gene-specific primer set (the size of the amplified product is 113 to 137 bp; see below) RT-PCR was performed on a LightCycler (LightCycler 480, Roche) instrument with absolute quantitation of RNA. ° ° The result shows 'in mode! And in pattern B of the Bacillus subtilis strain, the largest amount of the eight traces of the gene from the gene located downstream of the promoter of the 'the rest of the primer' (four) sets decreased with the increase in the number of promoters; It is indicated that the eight genes can be successfully transcribed by a single Pr promoter, and the order of the expression of each gene has the same tendency as the order of these genes in the recombinant plasmid. , 24 201122105 6·3 formation of weaving hydrolase complex to determine the cellulolytic enzyme of Clostridium thermocellum; species: main? In the case of bacteria, it is expressed and combined with ΐ and t f cultures, strong this = ice knife analysis. In the case of Lu, the culture mode 1 and the pattern TT 铋 铋 seedlings * 曰丼, after the colony, the bacterial culture, at 4. 〇 with 35〇, such as dry, clear liquid sample and 4 mg of crystalline cellulose

= 4 ml of 5 〇 粦 粦 缓冲 buffer (yang 7). Two ‘Yu Days: ί Fibre collection of cellulose and flushing two L with Gu salt buffer will “

SDS-PAGE analysis was performed after the protein on the Ju sap pellet was dissolved in 100 mU = amine colloid (SDS_PAGE). Figure 5 shows the results. ..., the amount pattern 1 and the pattern K of the Bacillus subtilis strain showed molecules, the protein bands of 5'82'69-5' and 52-5 milk, divided into ί'Cels 'CelR, XynC and (10), indicating the pattern The human and the selected strains are induced to exhibit various hydrolase enzymes, and the scaffold protein cipA of the group of cellulose binding regions (CBM) can be purified by the cellulose adsorption method. 6.4 Enzyme spectrum of cellulose hydrolase complex (Nove-electrophoresis analysis) The culture of Bacillus subtilis I and model n Bacillus subtilis strains was added to the buffer containing diterpene concentration without boiling and not added. Reducing agent, % gradient SDS colloidal electrophoresis analysis, in which the intrinsic charge of each protein molecule Π 1 can be separated by the power of electrophoresis. Figure 丄 = Coomassie Brilliant Blue Element Electrophoresis, followed by polyxylose and CMC Qualitative zymogram assay, followed by staining with Congo red, stained with polyxylase and endo-degraded regions in dark stained back with a transparent color 25 201122105 f, Figure 6 (b) and 6 (c) Observed fruit. The colloid was immersed in a buffer containing MUC in glucanase activity, and then the activity was measured by a 365 nm w light source; Figure 6 (a) shows the result. The secreted protein with pGETS _ straw pure strain 1 and the model ^ 栝 杆 自 = = = = = = = = = = = = 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 , xylose and the pattern of Hit enzyme activity ° These results are shown in mode 1 It can be used to add 1 μ of the early rf and the hydrolyzing enzyme-producing protein produced by the strain i. The lp 帛 帛 结合 结合 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 形成 孅 形成 形成 形成 孅 孅 孅 孅 孅Analysis of 9rwn culture mode 1 and model Bacillus licheniformis strains, and at 42 ° C into the buffer and low DTT concentration of buffer ^ Ξ = liquid and intracellular substances, then: daily cellulose, The staining agent CMC, and the activity of poly-taiji enzymes. Figure 7 shows the results. "Xylose is a variety of sub-mode breaks in the glutinous rice, mode 1 and the mode η of the grass = the second ff is crystalline cellulose , mode ί high, 苴t type I, g #姓%: the activity of the exo-glucanase is significantly suppressed and the sex is higher (the supernatant of the figure shows the highest score, =囷& The culture of the strain is degraded by the activity of the enzyme, and the sequence of the nucleotide sequence is echoed. The sequence of the different nucleotide sequences of the two strains echoes each other; the micro-simulation of the performance of the plant is different. Performance card n, which can arbitrarily select 26 201122105 protein subunit types, and control each by adjusting the amount of performance === The application of white matter sub-units. This ice 4,,,... the purpose of the organism, and the enzymes that can be used for the development of biomass energy, r = on the cell surface, the whole cell can be regarded as a solid follow-up ^ _des) It is conducive to the purification and then can be # == Lai 彳 grade _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ It is common to know the fiber; it is stated that it is believed that the invention has the broadest scope of the invention in the technical field to which the invention pertains. Therefore, the rest of the disclosure is only used as an example, rather than Any party [simple description of the schema] =1 结构 疋 热 热 热 疋 疋 纤维素 纤维素 纤维素 纤维素 纤维素 纤维素 纤维素 纤维素 纤维素 纤维素 纤维素 。 。

A chart showing the extracellular and intracellular fibrillar-decomposing activity of a cellulose hydrolyzate-removing body containing a Clostridium thermophilus f, CdA, 々π and XynZ proteins in a CiPA bacillus host cell, t Γ f CMC (4)® glycanase activity as a substrate; (b) Glycerase specific activity 'determined by normalization of Γ, ΐ white δΐ by endoglucanase activity in the sample; (c) shows utilization MUC as a substrate for glucanase activity; and (4) showing total glucanase ratio;; normal, total endoglucanase activity for normalization of its protein content Figure 3 shows heat production in Bacillus subtilis Clostridium cilia cipA, CeIS glucanase activity under different climax; and (b) control clonal strain and selection 27 201122105 stalk 1 at different temperatures Figure 4 shows Example 6/&; "protein content The order ', the mode I, and the (iv) acid sequence cis sample ice results, the sputum is the result of the control group zymase electrophoresis analysis of the glycanase drop position W shows the internal 4 dry out , (c) the location of the degradation of the wood (4); and (4), the staining results of the smuggling; First] is a control channel "dead what sample Cloth pull Formula I, and the second channel is a sample of π mode. Specific activity shows the results of the analysis of the enzyme activity of 'f (4) _ dextran shame activity; and (4) shows the xylose shame two. Figure 8-1 to 8-5 shows the polycistronic expression shown in Example 1. The nucleotide sequence of cipA-celS-celK-cdA-xynC-xynZ contained in the card g (SEQ ID N〇: 1) 'where the italic part represents the restriction enzyme region, the bottom line portion represents each protein coding region, and the shaded portion represents ribose Body binding site. Figures 9-1 to 9-7 show the nucleotide sequence of cipA-celK-celS-celR-sdbA-celA-xynC-xynZ contained in the polycistronic expression card S of the mode I described in Example 6.1 (SEQ ID NO: 2), wherein the italic portion represents the restriction enzyme region, the bottom line knife represents each protein coding region, and the shaded portion represents the nuclear brew binding site. Figures 10-1 to 10-7 show the nucleotide sequence of cipA-xynZ-xynC-celA-sdbA-celK-celR-celS contained in the polycistronic expression cassette of the mode II described in Example 6.1 (SEQ ID NO: 3) Wherein the italic portion represents the restriction enzyme region, the bottom line portion represents each protein coding region, and the shaded portion represents the ribosome binding site. 28

201122105 <110> Central Research Institute

<120> Production of a polycistronic expression cassette of a cellulose hydrolase complex and its application <130> ACA0050TW <150> Republic of China invention patent application No. 098143083 <151> 2009-12-16 <lt;;160> 3 <170> Patentln version 3.5 <210> 1 <211> 16446 <212> DNA <213>Artificial sequence<220><223> Recombination sequence <400> 1 ggcctgtttg gcctttggga ggaatggtag atgagaaaag tcatcagtat gctcttagtt gtggctatgc tgacgacgat ttttgcggcg atgataccgc agacagtatc ggc ^ gccaca atgacagtcg agatcggcaa agttacagca gccgttggat caaaagtaga aatacctata accctgaaag gagtgccatc caaaggaatg gccaattgcg acttcgtatt gggttatgat ccaaatgtgc tggaagtaac agaagtaaaa ccaggaagca taataaaaga tccggatcct agcaagagct ttgatagcgc aatatatccg gatcgaaaga tgattgtatt tctgtttgca gaagacagtg gaagaggaac gtatgcaata actcaggatg gagtatttgc aacaattgta gccactgtca aatcagctgc agcggcaccg attactttgc ttgaagtagg tgcatttgcg gacaacgatt tagtagaaat aagcacaact Tttgtcgcgg gcggagtaaa tcttggtagt tccgtaccga caacacagcc aaatgttccg tcagacggtg tggta gtaga aattggcaaa gttacgggat ctgttggaac tacagttgaa atacctgtat atttcagagg agttccatcc aaaggaatag caaactgcga ctttgtgttc agatatgatc cgaatgtatt ggaaattata gggatagatc ccggagacat aatagttgac ccgaatccta ccaagagctt tgatactgca atatatcctg acagaaagat aatagtattc ctgtttgcgg aagacagcgg aacaggagcg tatgcaataa ctaaagacgg agtatttgca aaaataagag caactgtaaa atcaagtgct ccgggctata ttactttcga cgaagtaggt ggatttgcag ataatgacct ggtagaacag aaggtatcat ttatagacgg tggtgttaac gttggcaatg caacaccgac caagggagca acaccaacaa atacagctac gccgacaaaa tcagctacgg ctacgcccac caggccatcg gtaccgacaa acacaccgac aaacacaccg gcaaatacac cggtatcagg caatttgaag gttgaattct acaacagcaa tccttcagat actactaact caatcaatcc tcagttcaag gttactaata ccggaagcag tgcaattgat ttgtccaaac tcacattgag atattattat acagtagacg gacagaaaga tcagaccttc actggagtaa ctat tggtgtgacc atgctgcaat aatcggcagt aacggcagct acaacggaat tacttcaaat gtaaaaggaa catttgtaaa aatgagttcc tcaacaaata acgcagacac ctaccttgaa ataagcttta caggcggaac tcttgaaccg ggtgcacatg ttcagataca aggtagattt gcaaagaatg acacag tcaaatgact actcattcaa gtctgcttca cagtttgttg aatgggatca ggtaacagca tacttgaacg gtgttcttgt atggggtaaa gaacccggtg gcagtgtagt accatcaaca Page 1 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 201122105 cagcctgtaa caacaccacc tgcaacaaca aaaccacctg caacaacaaa accacctgca L680 ucaacaatac cgccgtcaga tgatccgaat gcaataaaga ttaaggtgga cacagtaaat 1740;! caaaaccgg gagacacagt aaatatacct gtaagattea gtggtatacc atccaaggga 1800 atagcaaact gtgactttgt atacagctat gacccgaatg tact tgagat aatagagata 1860 aaaccgggag aattgatagt tgacccgaat cctgacaaga gctttgatac tgcagtatat 1920 cctgacagaa agataatagt attcctgttt gcagaagaca gcggaacagg agegtatgea 1980 ataactaaag acggagtatt tgctacgata gtagcgaaag taaaatccgg agcacctaac 2040 ggactcagtg taatcaaatt tgtagaagta ggcggatttg Cgaacaatga ccttgtagaa 2100 cagaggacac agttctttga cggtggagta aatgttggag atacaacagt acctacaaca 2160 cctacaacac ctgtaacaac accgacagat gattegaatg cagtaaggat taaggtggac 2220 a cagtaaatg caaaaccggg agacacagta agaatacctg taagattcag cggtatacca 2280 tccaagggaa tagcaaactg tgactttgta tacagctatg acccgaatgt acttgagata 2340 atagagatag aaccgggaga cataatagtt gacccgaatc ctgacaagag ctttgatact 2400 gcagtatatc ctgacagaaa gataatagta ttcctgtttg cggaagacag cggaacagga 2460 gcgtatgcaa taactaaaga cggagtattt gctacgatag tagcgaaagt aaaatccgga 2520 gcacctaacg gactcagtgt aatcaaattt gtagaagtag gcggatttgc gaacaatgac 2580 cttgtagaac agaagacaca gttctttgac ggtggagtaa atgttggaga tacaacagaa 2640 cctgcaacac ctacaacacc tgtaacaaca ccgacaacaa cagatgatct ggatgcagta 2700 aggat taaag tggacacagt aaatgcaaaa ccgggagaca cagtaagaat acctgtaaga 2760 ttcagcggta taccatccaa gggaatagca aactgtgact ttgtatacag ctatgacccg 2820 aatgtacttg agataataga gatagaaccg ggagacataa tagttgaccc gaatcctgac 2880 aagagctttg atactgcagt atatcctgac agaaagataa tagtattcct gtttgcggaa 2940 gacagcggaa caggagcgta tgcaataact aaagaeggag tatttgctac gatagtageg 3000 aaagtaaaat ccggagcacc taacggactc agtgtaatca aatttgtaga agtaggcgg a 3060 tttgcgaaca atgaccttgt agaacagaag acacagttct ttgacggtgg agtaaatgtt 3120 ggagatacaa cagaacctgc aacacctaca acacctgtaa caacaccgac aacaacagat 3180 gatctggatg cagtaaggat taaagtggac acagtaaatg caaaaccggg agacacagta 3240 agaatacctg taagattcag cggtatacca tccaagggaa tagcaaactg tgactttgta 3300 tacagctatg acccgaatgt acttgagata atagagatag aaccgggaga cataatagtt 3360 gacccgaatc ctgacaagag ctttgatact gcagtatatc ctgacagaaa gataatagta 3420 ttcctgtttg cagaagacag cggaacagga gcgtatgcaa taactaaaga cggagtattt 3480 gctacgatag tagcgaaagt aaaagaagga gcacctaacg gactcagtgt aatcaaattt 3540 gtagaagtag gcggatttgc gaacaatgac cttgtagaac agaagacaca gttctttgac 3600 ggtggagtaa atgttggaga tacaacagaa cctgcaacac ctacaacacc tgtaacaaca 3660 ccgacaacaa cagatgatct ggatgcagta aggattaaag tggacacagt aaatgcaaaa 3720 ccgggagaca cagtaagaat acctgtaaga ttcagcggta taccatccaa gggaatagca 3780 aactgtgact ttgtatacag ctatgacccg aatgtacttg agataataga gatagaaccg 3840 ggagaattga tagttgaccc gaatcctacc aagagctttg atactgcagt a Tatcctgac Page 2 3900

201122105 agaaagatga tagtattcct gtttgcggaa gacagcggaa caggagcgta tgcaataact gaagatggag tatttgctac gatagtagcg aaagtaaaat ccggagcacc taacggactc agtgtaatca aatttgtaga agtaggcgga tttgcgaaca atgaccttgt agaacagaag acacagttct ttgacggtgg agtaaatgtt ggagatacaa cagaacctgc aacacctaca acacctgtaa caacaccgac aacaacagat gatctggatg cagtaaggat taaagtggac acagtaaatg caaaaccggg agacacagta agaatacctg taagattcag cggtatacca tccaagggaa tagcaaactg tgactttgta tacagctatg acccgaatgt acttgagata atagagatag aaccgggaga cataatagtt gacccgaatc ctgacaagag ctttgatact gcagtatatc ctgacagaaa gataatagta ttcctgtttg cagaagacag cggaacggga gcgtatgcaa taactaaaga cggagtattt gctacgatag tagcgaaagt aaaagaagga gcacctaacg gactcagtgt aatcaaattt gtagaagtag gcggatttgc gaacaatgac cttgtagaac agaagacaca gttctttgac ggtggagtaa atgttggaga tacaacagta cctacaacat cgccgacaac aacaccgcca gagccgacga taactccgaa caagttgaca cttaagatag gcagagcaga aggaagacct ggagacacgg tggaaatacc ggttaacttg tatggagtac ctcaaaaagg aatagcaagc ggtgacttcg tagtaagcta tgacccgaat gtacttgaga taatagagat agaaccggga gaattgatag ttgacccgaa tcctaccaag agctttgata ctgcagtata tcctgacaga aagatgatag tattcctgtt tgcggaagac agcggaacag gagcgtatgc aataactgaa gatggagtat ttgctacgat agtagcgaaa gtaaaagaag gagcacctga aggattcagt gcaatagaaa tttctgagtt tggtgcattt gcagataatg atctggtaga agtggaaact gaccttatca atggtggagt acttgtaact aataaacctg taatagaagg atataaagta tccggataca ttttgccaga cttctccttc gacgctactg ttgcaccact tgtaaaggcc ggattcaaag ttgaaatagt aggaacagaa ttgtatgcag taacagatgc aaacggatac tttgaaataa ccggagtacc tgcaaatgca agcggatata cattgaagat ttcaagagca acttacttgg acagagtaat tgcaaatgtt gtagtaacgg gagatacttc agtttcaact tcacaggctc caataatgat gtgggtagga gacatagtga aagacaattc tatcaacctg ttggacgttg cagaagttat ccgt tgcttc aacgctacta aaggaagcgc aaactacgta gaagaacttg acattaatag aaacggcgca attaacatgc aagacataat gattgttcat aagcactttg gagctacatc aagtgattac gacgcacagt aacactgacg gctaacggga ggtagattta tgaatttcag aagaatgttg tgcgcagcca tagtgttgac aattgtactg tccattatgc tgccgtcaac tgtttttgct ttggaagac a agtctccaaa gttgccggat tataaaaacg accttttgta tgaaagaaca ttcgacgaag gtctttgctt tccgtggcat acttgcgaag acagtggagg aaaatgtgat ttcgctgttg ttgatgttcc aggagagcct gggaacaaag ctttccgctt gacagtaatt gacaaaggac aaaacaagtg gagtgtccag atgagacaca gaggtattac cctcgagcaa ggacatacat acacggtaag gtttacgatt tggtctgaca aatcctgtag ggtttatgct aaaattggtc agatgggtga accctatact gaatattgga acaataactg gaatccattc aaccttacac caggacagaa gcttacagtt gaacagaatt ttacaatgaa ctatcctact gatgacacat gcgagttcac attccatttg ggtggagaac ttgctgcagg tacaccttac 3 Page 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 201122105 tatgtttacc ttgatgatgt atctctctac gatcctaggt ttgtaaagcc tgttgaatat 6240 gtacttccgc agccggatgt acgtgttaac Caggtaggat acttaccgtt tgcaaagaag 6300 tatgctactg ttgtatcttc ttcaaccagc ccgcttaagt ggcagcttct caattcggca 6360 aatcaggttg ttttggaagg taatacaata ccaaaaggac ttgacaaaga tt cacaggat 6420 tatgtacatt ggatagattt ctccaacttt aagactgaag gaaaaggtta ttacttcaag 6480 cttccgactg taaacagcga tacaaattac agccatcctt tcgatatcag tgctgatatt 6540 tactccaaga tgaaatttga tgcattggca ttcttctatc acaagagaag cggtattcct 6600 attgaaatgc cgtatgcagg aggagaacag tggaccagac ctgcaggaca tattggtgtt 6660 gctccgaaca aaggagacac aaatgttcct acatggcctc aggatgatga atatgcagga 6720 agacctcaaa aatattatac aaaagatgta accggtggat ggtatgatgc cggtgaccac 6780 pgtaaatatg ttgtaaacgg cggtatagct gtttggacat tgatgaacat gtatgaaagg 6840 ncaaaaatca gaggcatagc taatcaaggt gcttataaag acggtggaat gaacataccg 6900 aagagaaata acggttatcc ggacattctt gatgaagcaa gatgggaaat tgagttcttt 6960 aagaaaatgc aggtaactga aaaagaggat ccttccatag ccggaatggt acaccacaaa 7020 attcacgact tcagatggac tgctttgggt atgttgcctc acgaagatcc ccagccacgt 7080 tacttaaggc cggtaagtac ggctgcgact ttgaactttg cggcaacttt ggcacaaagt 7140 gcacgtcttt ggaaagatta tgatccgact tttgctgctg actgtttgga aaaggctgaa 7200 atagcatggc aggcggcatt aaagcatcct gatatttatg ctgag tatac tcccggtagc 7260 ggtggtcccg gaggcggacc atacaatgac gactatgtcg gagacgaatt ctactgggca 7320 gcctgcgaac tttatgtaac aacaggaaaa gacgaatata agaattacct gatgaattca 7380 cctcactatc t tgaaatgcc tgcaaagatg ggtgaaaacg gtggagcaaa cggagaagac 7440 aacggattgt ggggatgctt cacctgggga actactcaag gattgggaac tattactctt 7500 gcattagttg aaaacggatt gccgtctgca'gacattcaaa aggcaagaaa caatatagct 7560 aaagctgcag acaaatggct tgagaatatt gaagagcaag gttacagact gccgatcaaa 7620 caggcggagg atgagagagg cggttatcca tggggttcaa actccttcat tttgaaccag 7680 atgatagtta tgggatacgc atatgacttt acaggcaaca gcaagtatct tgacggaatg 7740 caggatggta tgagctacct gttgggaaga aacggactgg atcagtccta tgtaacaggg 7800 tatggtgagc gtccacttca gaatcctcat gacagattct ggacgccaca gacaagtaag 7860 aaat tccctg ctocacctcc gggtataatt gccggtggtc cgaactcccg tttcgaagac 7920 ccgacaataa ctgcagcagt acaccgccgc agaagtgcta cattgaccat 7980 acagactcat ggtcaaccaa cgagataact attaactgga atgctccgtt tgcatgggtt 8040 acagcttatc tcgatgaaat tgact taagaaggat Taata acacc gccag gaggagtaga cccagaagaa 8100 ccggaggtta tttatggtga ctgcaatggc gacggaaaag ttaattcaac tgacgctgtg 8160 gcattgaaga gatatatctt gagatcaggt ataagcatca acactgataa tgctgatgta 8220 aatgctgatg gcagagttaa ctctacagac ttggcaatat tgaagagata taMcttaaa 8280 gagatagatg tattgccaca taaataagcc acgagtgagg ggaagatgga gagaatggta 8340 aaaagcagaa agatttctat tctgttggca gttgcaatgc tggtatccat aatgataccc 8400 acaactgcat tcgcaggtcc tacaaaggca cctacaaaag atgggacatc ttataaggat 8460 Page 4

201122105 cttttccttg aactctacgg aaaaattaaa gatcctaaga acggatattt cagcccagac gagggaattc cttatcactc aattgaaaca ttgatcgttg aagcgccgga ctacggtcac gttactacca gtgaggcttt cagctattat gtatggcttg aagcaatgta tggaaatctc acaggcaact ggtccggagt agaaacagca tggaaagtta tggaggattg gataattcct gacagcacag agcagccggg tatgtcttct tacaatccaa acagccctgc cacatatgct gacgaatatg aggatccttc atactatcct tcagagttga agtttgatac cgtaagagtt ggatccgacc ctgtacacaa cgaccttgta tccgcatacg gtcctaacat gtacctcatg cactggttga tggacgttga caactggtac ggttttggta caggaacacg ggcaacattc ataaacacct tccaaagagg tgaacaggaa tccacatggg aaaccattcc tcatccgtca atagaagagt tcaaatacgg cggaccgaac ggattccttg atttgtttac aaaggacaga tcatatgcaa aacagtggcg ttatacaaac gctcctgacg cagaaggccg tgctatacag gctgtttact gggcaaacaa atgggcaaag gagcagggta aaggttctgc cgttgcttcc gttgtatcca aggctgcaaa gatgggtgac ttcttgagaa acgacatgtt cgacaaatac ttcatgaaga tcggtgcaca ggacaagact cctgctaccg gttatgacag tgcacactac cttatggcct ggtatactgc atggggtggt ggaattggtg catcctgggc atggaagatc ggatgcagcc acgcacactt cggatatcag aacccattcc agggatgggt aagtgcaaca cagagcgact ttgctcctaa atcatccaac ggtaagagag actggacaac aagctacaag agacagcttg aattctatca gtggttgcag tcggctgaag gtggtattgc cggtggagca accaactcct ggaacggtag atatgagaaa tatcctgctg gtacgtcaac gttctatggt atggcatatg ttccgcatcc tgtatacgct gacccgggta gtaaccagtg gttcggattc caggcatggt caatgcagcg tgtaatggag tactacctcg aaacaggaga ttcatcagtt aagaatttga ttaagaagtg ggtcgactgg gtaatgagcg aaattaagct ctatgacgat ggaacatttg caattcctag cgacctcgag tggtcaggtc agcctgatac atggaccgga acatacacag gcaacccgaa cctccatgta agagtaactt cttacggtac tgaccttggt gttgcaggtt cacttgcaaa tgctcttgca acttatgccg cagctacaga aagatgggaa ggaaaacttg atacaaaagc aagagacatg gctgctgaac tggttaaccg tgcatggtac aacttctact gctctgaagg aaaaggtgtt gttactgagg aagcacgtgc tgactacaaa cgtttctttg agcaggaagt atacgttccg gcaggttgga gcggtactat gccgaacggt gacaagattc agcctggtat taagttcata gacatccgta caaaatatag acaagatcct tactacgata tagtatatca ggcatacttg agaggcgaag ctcctgtatt gaattatcac cgcttctggc atgaagttga ccttgcagtt gcaatgggtg tattggctac atacttcccg gatatgacat ataaagtacc tggtactcct tctactaaat cgtcaatgat gacggaaaag ttaactcaac tgacgctgta gcattgaaga gatatgtttt gagatcaggt ataagcatca acactgacaa tgccgatttg aatgaagacg gcagagttaa ttcaactgac ttaggaattt tgaagagata tattctcaaa gaaatagata cattgccgta caagaactaa cacatggtga aaaggaggaa aaaaaagtga agaacgtaaa aaaaagagta ggtgtggttt tgctgattct tgcagtgttg ggggtttata tgttggcaat gccggcaaac actgtgtcag cggcaggtgt gccttttaac acaaaatacc cctatggtcc tacttctatt gccgataatc Page 5 tatacggcga 8520 8580 8640 8700 8760 8820 8880 8940 9000 9060 9120 9180 9240 9300 9360 9420 9480 9540 9600 9660 9720 9780 9840 9900 9960 10020 10080 10140 10200 10260 10320 10380 10440 10500 10560 10620 10680 10740 201122105 agtcggaagt aactgcaatg ctcaaagcag aatgggaaga ctggaagagc aagagaatta 10800 cctcgaacgg tgcaggagga tacaagagag tacagcgtga Tgcttccacc aattatgata 10860 cggtatccga aggtatggga tacggacttc ttttggcggt ttgctttaac gaacaggctt 10920 tgtttgacga tttataccgt tacgtaaaat ctcatttcaa t ggaaacgga cttatgcact 10980 ggcacattga tgccaacaac aatgttacaa gtcatgacgg cggcgacggt gcggcaaccg 11040 atgctgatga ggatattgca cttgcgctca tatttgcgga caagttatgg ggttcttccg 11100 gtgcaataaa ctacgggcag gaagcaagga cattgataaa caatctttac aaccattgtg 11160 tagagcatgg atcctatgta ttaaagcccg gtgacagatg gggaggttca tcagtaacaa 11220 acccgtcata ttttgcgcct gcatggtaca aagtgtatgc tcaatataca ggagacacaa 11280 gatggaatca agtggcggac aagtgttacc aaattgttga agaagttaag aaatacaaca 11340 acggaaccgg ccttgttcct gactggtgta ctgcaagcgg aactccggca agcggtcaga 11400 gttacgacta caaatatgat gctacacgtt acggctggag aactgccgtg gactattcat 11460 ggtttggtga ccagagagca aaggcaaact gcgatatgct gaccaaattc tttgccagag 11520 acggggcaaa aggaatcgtt gacggataca caattcaagg ttcaaaaatt agcaacaatc 11580 acaacgcatc atttatagga cctgttgcgg cagcaagtat gacaggttac gatttgaact 11640 ttgcaaagga actttatagg gagactgttg ctgtaaagga cagtgaatat tacggatatt 11700 acggaaacag cttgagactg ctcactttgt tgtacataac aggaaacttc ccgaatcctt 11760 tgagtgacct ttccggccaa ccgacaccac cgtc gaatcc gacaccttca ttgcctcctc 11820 uggttgttta cggtgatgta aatggcgacg gtaatgttaa ctccactgat ttgactatgt 11880 taaaaagata tctgctgaag agtgttacca atataaacag agaggctgca gacgttaatc 11940 litgacggtgc gattaactcc tctgacatga ctatattaaa gagatatctg ataaagagca 12000 taccccacct accttattag cactgggtgt tttgggaggt agatctatgc tgaagaaaaa 12060 actgttgacc cttttgacag tctttgctct gctgactgtc ggtatctgcg gaagtttttt 12120 gccgttaccc aaagcatccg cagcagctct gatttacgat gattttgaaa caggtctgaa 12180 cggatgggga ccaagaggac cggaaaccgt cgaacttacc accgaggaag cttactcggg 12240 aagatacagt ttgaaggtca gcggacgtac cagcacatgg aacgggccca tggttgacaa 12300 aaccgatgtg ttgactttgg gcgaaagcta taagttgggc gtatatgtaa aattcgtggg 12360 tgattcctat tcaaatgagc aaagattcag tttgcagctt caatataacg acggagcagg 12420 agatgtatac caaaatataa aaaccgccac ggtttacaag ggaacatgga ctttgctgga 12480 aggacagctt acagttccca gccatgcaaa ggacgtaaaa atatatgtgg aaaccgaatt 12540 taaaaattct ccgagtccgc aggacttgat ggatttctat attgacgatt tcacagcaac 12600 acctgcaaat ttgcctgaaa ttgaga aaga tattccaagc ttgaaagatg tctttgccgg 12660 ttatttcaaa gtgggtggtg ccgcaactgt ggcggaactg gcgccgaagc ctgcaaaaga 12720 gcttttcctc aagcattata acagcttgac ttttggtaat gagttaaaac cggaaagtgt 12780 acttgactat gatgctacaa ttgcttatat ggaggcaaac ggaggcgacc aggttaatcc 12840 gcagataacc ttgagagcgg caagacccct gttggagttt gcgaaagaac acaacatacc 12900 tgtaagagga catacccttg tatggcacag ccagacaccg gactggttct tcagagaaaa 12960 ttactctcag gacgaaaatg ctccctgggc atccaaggaa gtaatgctgc aaaggttgga 13020 Page 6

201122105 aaactacata aagaatttaa tggaagcttt ggcgaccgaa tatccgacgg ttaagttcta tgcatgggac gttgtgaatg aggctgttga tcctaatact tcagacggta tgagaactcc gggttcgaat aacaaaaatc ccggaagctc cctgtggatg caaaccgttg gaagagattt tattgttaaa gcttttgaat atgcaagaaa atatgctcct gcggattgta aactcttcta caatgactat aatgaatatg aagacagaaa atgtgatttt attattgaaa ttcttaccga acttaaagcc aaaggcctgg ttgacggtat gggtatgcaa tcccactggg ttatggatta tccaagcata agcatgtttg aaaaatccat cagaagatat gcagcattgg gattggaaat tcagcttacc gagctggata taagaaatcc tgacaacagc cagtgggctt tggaacgtca ggctaatcgt tataaggagc ttgtaacaaa attggtcgat ttgaaaaaag aaggcataaa cattacggca ttggtattct ggggaataac cgacgcgaca agctggcttg gaggatatcc gctcctgttt gacgcggaat acaaggcaaa acctgcattt tatgctatag ttaacagcgt tccgccgctt ccgacagaac cgccggttca ggttataccc ggtgatgtaa acggtgacgg tcgtgtaaat tcatccgact tgactcttat gaaaagatac cttttaaaat ccataagcga cttcccgaca ccggaaggaa aaattgcggc ggatttaaac gaagacggca aggtaaactc gacagatttg ttagcgctga aaaaactcgt tctgagagaa ctttgacact aggtgcaaaa aggaggagaa acatgtcaag aaaacttttc agtgtattac ttgttggctt gatgcttatg acatcgttgc ttgtcacaat aagcagtaca tcagcggcat ccttgccaac catgccgcct aacagtctta ttccctatat cgaatctaac tcgggatatg accaggtaag gaacggcgtt ccgagagggc aggtcgtaaa tatttcttat ttctccacgg ccaccaacag taccaggccg gcaagagttt atttgccgcc gggatattca aaggacaaaa aatacagtgt tttgtatctc ttacacggca taggcggtag tgaaaacgac tggttcgaag ggggaggcag agccaatgtt attgccgaca atctgattgc cgagggaaaa atcaagcccc tgataattgt aacaccgaat actaacgccg ccggtccggg aatagcggac ggttatgaaa atttcacaaa agatttgctc tattcagtct acaccgaccg cgaacatcgg gcgattgcag gactttcaat gggtggagga caatcgttta atattggatt gaccaatctc gataaatttg cctatattgg cccgatttca gcggctccaa acacttatcc aaatgagagg ctttttcctg acggaggaaa agctgcaagg gagaaattga aactgctctt tattgcctgc ggaaccaatg acagtctgat aggttttgga cagagagtac atgaatattg cgttgccaac aacattaacc atgtctattg gcttattcag ggcggaggac acgattttaa tgtgtggaag cccggattgt ggaatttcct tcaaatggca gatgaagccg gattgacgag ggatggaaac actccggttc cgacacccag tccaaagccg gctaacacac gtattgaagc ggaagattat gacggtatta attcttcaag tattgagata ataggtgttc cacctgaagg aggcagagga ataggttata ttaccagtgg tgattatctg gtatacaaga gtatagactt tggaaacgga gcaacgtcgt ttaaggccaa ggttgcaaat gcaaatactt ccaatattga acttagatta aacggtccga atggtactct cataggcaca ctctcggtaa aatccacagg agattggaat acatatgagg agcaaacttg cagcattagc aaagtcaccg gaataaatga tttgtacttg gtattcaaag gccctgtaaa catagactgg ttcacttttg gcgttgaaag cagttccaca ggtctggggg atttaaatgg tgacggaaat attaactcgt cggaccttca ggcgttaaag aggcatttgc tcggtatatc accgcttacg page 7 13080 13140 13200 13260 13320 13380 13440 13500 13320 13380 13680 13740 13560 13620 13680 13740 13800 13860 13920 13980 14040 14100 14160 14220 14280 14340 14400 14460 14520 14580 14640 14700 14760 14820 14880 14940 15000 15060 15120 15180 15240 15300 201122105 ggagaggctc ttttaagagc ggatgtaaat aggagcggca aagtggattc tactgactat tcagtgctga aaagatatat actccgcatt attacagagt tccccggaca Aggtgatgta cagacaccca atccgtctgt tactccgaca caaactccta tccccacgat ttcgggaaat gctcttaggg attatgcgga ggcaagggga ataaa aatcg gaacatgtgt caactatccg ttttacaaca attcagatcc aacctacaac agcattttgc aaagagaatt ttcaatggtt gtatgtgaaa atgaaatgaa gtttgatgct ttgcagccga gacaaaacgt ttttgatttt tcgaaaggag accagttgct tgcttttgca gaaagaaacg gtatgcagat gaggggacat acgttgattt ggcacaatca aaacccgtca tggcttacaa acggtaactg gaaccgggat tcgctgcttg cggtaatgaa aaatcacatt accactgtta tgacccatta caaaggtaaa attgttgagt gggatgtggc aaacgaatgt atggatgatt ccggcaacgg cttaagaagc agcatatgga gaaatgtaat cggtcaggac taccttgact atgctttcag gtatgcaaga gaagcagatc ccgatgcact tcttttctac aatgattata atattgaaga cttgggtcca aagtccaatg cggtatttaa catgattaaa agtatgaagg aaagaggtgt gccgattgac ggagtaggat tccaatgcca ctttatcaat ggaatgagcc ccgagtacct tgccagcatt gatcaaaata ttaagagata tgcggaaata ggcgttatag tatcctttac cgaaatagat atacgcatac ctcagtcgga aaacccggca actgcattcc aggtacaggc aaacaactat aaggaactta tgaaaatttg tctggcaaac cccaattgca atacctttgt aatgtgggga ttcacagata aatacacatg gattccggga actttcccag gatatggcaa tccattgatt tatgacagca attacaatcc gaaaccggca tacaatgcaa taaa Ggaagc tcttatgggc tattga <210> 2 <211> 20869 <212> DNA <213> artificial sequence <220><223> recombination sequence <400> 2 ggcctgtttg gcctttggga ggaatggtag atgagaaaag tcatcagtat gctcttagtt gtggctatgc tgacgacgat ttttgcggcg atgataccgc agacagtatc ggcggccaca atgacagtcg agatcggcaa agttacagca gccgttggat caaaagtaga aatacctata accctgaaag gagtgccatc caaaggaatg gccaattgcg acttcgtatt gggttatgat ccaaatgtgc tggaagtaac agaagtaaaa ccaggaagca taataaaaga tccggatcct agcaagagct ttgatagcgc aatatatccg gatcgaaaga tgattgtatt tctgtttgca gaagacagtg gaagaggaac gtatgcaata actcaggatg gagtatttgc aacaattgta gccactgtca aatcagctgc agcggcaccg attactttgc ttgaagtagg tgcatttgcg gacaacgatt tagtagaaat aagcacaact tttgtcgcgg gcggagtaaa tcttggtagt tccgtaccga caacacagcc aaatgttccg tcagacggtg tggtagtaga aattggcaaa gttacgggat Ctgttggaac tacagttgaa atacctgtat atttcagagg agttccatcc aaaggaatag caaactgcga ctttgtgttc agatatgatc cgaatgtatt ggaaattata gggatagatc ccggagacat aatagttgac ccgaatccta ccaagagctt tgatac Tgca Page 8 15360 15420 15480 15540 15600 15660 15720 15780 15840 15900 15960 16020 16080 16140 16200 16260 16320 16380 16440 16446 60 120 180 240 300 360 420 480 540 600 660 720 780 840 840

201122105 atatatcctg acagaaagat aatagtattc ctgtttgcgg aagacagcgg aacaggagcg tatgcaataa ctaaagacgg agtatttgca aaaataagag caactgtaaa atcaagtgct ccgggctata ttactttcga cgaagtaggt ggatttgcag ataatgacct ggtagaacag aaggtatcat ttatagacgg tggtgttaac gttggcaatg caacaccgac caagggagca acaccaacaa atacagctac gccgacaaaa tcagctacgg ctacgcccac caggccatcg gtaccgacaa acacacegac aaacacaccg gcaaatacac cggtatcagg caatttgaag gttgaattct acaacagcaa tccttcagat actactaact caatcaatcc tcagttcaag gttactaata ccggaagcag tgcaattgat ttgtccaaac tcacattgag atattattat acagtagacg gacagaaaga tcagaccttc tggtgtgacc atgctgcaat aatcggcagt aacggcagct acaacggaat tacttcaaat gtaaaaggaa catttgtaaa aatgagttcc tcaacaaata acgcagacac ctaccttgaa ataagcttta caggcggaac tcttgaaccg ggtgcacatg ttcagataca aggtagattt gcaaagaatg actggagtaa ctatacacag tcaaatgact actcattcaa gtctgcttca cagtttgttg aatgggatca ggtaacagca tacttgaacg gtgttcttgt atggggtaaa gaacccggtg gcagtgtagt accatcaaca cagcctgtaa caacaccacc tgcaacaaca aaaccacctg caacaacaaa accacctgca acaacaatac cgccgtcaga tgatccgaat gcaataaaga ttaaggtgga cacagtaaat gcaaaaccgg gagacacagt aaatatacct gtaagattca gtggtatacc atccaaggga atagcaaact gtgactttgt atacagctat gacccgaatg tacttgagat aatagagata aaaccgggag aattgatagt tgacccgaat cctgacaaga gctttgatac tgcagtatat cctgacagaa agataatagt attcctgttt gcagaagaca gcggaacagg agcgtatgca ataactaaag acggagtatt tgctacgata gtagcgaaag taaaatccgg agcacctaac ggactcagtg taatcaaatt tgtagaagta ggcggatttg cgaacaatga ccttgtagaa cagaggacac agttctttga cggtggagta aatgttggag atacaacagt acctacaaca cctacaacac ctgtaacaac accgacagat gattcgaatg cagtaaggat taaggtggac acagtaaatg caaaaccggg agacacagta agaatacctg taagattcag cggtatacca tccaagggaa tagcaaactg tgactttgta tacagctatg acccgaatgt acttgagata atagagatag aaccgggaga cataatagtt gacccgaatc ctgacaagag ctttgatact gcagtatatc ctgacagaaa gataatagta ttcctgtttg cggaagacag cggaacagga gcgtatgcaa taactaaaga cggagtattt gctacgatag tagcgaaagt aaaatccgga gcacctaacg gactcagtgt aatcaaattt gtagaagtag gcggatttgc gaacaatgac cttgtagaac agaagacaca gttctttgac ggtggagtaa atgttggaga tacaacagaa cctgcaacac ctacaacacc tgtaacaaca ccgacaacaa cagatgatct ggatgcagta aggattaaag tggacacagt aaatgcaaaa ccgggagaca cagtaagaat acctgtaaga ttcagcggta taccatccaa gggaatagca aactgtgact ttgtatacag ctatgacccg aatgtacttg agataataga gatagaaccg ggagacataa tagttgaccc gaatcctgac aagagctttg atactgcagt atatcctgac agaaagataa tagtattcct gtttgcggaa gacagcggaa caggagcgta tgcaataact aaagacggag tatttgctac gatagtagcg aaagtaaaat ccggagcacc taacggactc agtgtaatca aatttgtaga agtaggcgga page 9 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 I860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 201122105 tttgcgaaca atgaccttgt agaacagaag acacagttct ttgacggtgg agtaaatgtt 3120 ggagatacaa cagaacctgc aacacctaca acacctgtaa caacaccgac Aacaacagat 3180 gatctggatg cagtaaggat taaagtggac acagtaaatg caaaaccggg agacacagta 3240 agaatacctg taagattcag cggtatacca tccaagggaa tagcaaactg tgactttgta 33 00 tacagctatg acccgaatgt acttgagata atagagatag aaccgggaga cataatagtt 3360 gacccgaatc ctgacaagag ctttgatact gcagtatatc ctgacagaaa gataatagta 3420 ttcctgtttg cagaagacag cggaacagga gcgtatgcaa taactaaaga cggagtattt 3480 gctacgatag tagcgaaagt aaaagaagga gcacctaacg gactcagtgt aatcaaattt 3540 gtagaagtag gcggatttgc gaacaatgac cttgtagaac agaagacaca gttctttgac 3600 gntggagtaa atgttggaga tacaacagaa cctgcaacac ctacaacacc tgtaacaaca 3660 ccgacaacaa cagatgatct ggatgcagta aggattaaag tggacacagt aaatgcaaaa 3720 ccgggagaca cagtaagaat acctgtaaga ttcagcggta taccatccaa gggaatagca 3780 aactgtgact ttgtatacag ctatgacccg aatgtacttg agataataga gatagaaccg 3840 ggagaattga tagttgaccc gaatcctacc aagagctttg atactgcagt atatcctgac 3900 agaaagatga tagtattcct gtttgcggaa gacagcggaa caggagcgta tgcaataact 3960 gaagatggag tatttgctac gatagtagcg aaagtaaaat ccggagcacc taacggactc 4020 agtgtaatca aatttgtaga agtaggcgga tttgcgaaca atgaccttgt agaacagaag 4080 acacagttct ttgacggtgg agtaaatgtt ggagatacaa cagaacctgc aacacctaca 4140 aca cctgtaa caacaccgac aacaacagat gatctggatg cagtaaggat taaagtggac 4200 acagtaaatg caaaaccggg agacacagta agaatacctg taagattcag cggtatacca 4260 tccaagggaa tagcaaactg tgactttgta tacagctatg acccgaatgt acttgagata 4320 atagagatag aaccgggaga cataatagtt gacccgaatc ctgacaagag ctttgatact 4380 gcagtatatc ctgacagaaa gataatagta ttcctgtttg cagaagacag cggaacggga 4440 j; cgtatgcaa taactaaaga cggagtattt gctacgatag tagcgaaagt aaaagaagga 4500 gcacctaacg gactcagtgt aatcaaattt gtagaagtag gcggatttgc gaacaatgac 4560 cttgtagaac agaagacaca gttctttgac ggtggagtaa atgttggaga tacaacagta 4620 cctacaacat cgccgacaac aacaccgcca gagccgacga taactccgaa caagttgaca 4680 cttaagatag gcagagcaga aggaagacct ggagacacgg tggaaatacc ggttaacttg 4740 tatggagiac ctcaaaaagg aatagcaagc ggtgacttcg tagtaagcta tgacccgaat 4800 gtacttgaga taatagagat agaaccggga gaattgatag ttgacccgaa tcctaccaag 4860 agctttgata ctgcagtata tcctgacaga aagatgatag tattcctgtt tgcggaagac 4920 agcggaacag gagcgtatgc aataactgaa gatggagtat ttgctacgat agtagcgaaa 4980 Gtaaaaga ag gagcacctga aggattcagt gcaatagaaa tttctgagtt tggtgcattt 5040 gcagataatg atctggtaga agtggaaact gaccttatca atggtggagt acttgtaact 5100 aataaacctg taatagaagg atataaagta tccggataca ttttgccaga cttctccttc 5160 gacjictactg ttgcaccact tgtaaaggcc ggattcaaag ttgaaatagt aggaacagaa 5220 ttgtatgcag taacagatgc aaacggatac tttgaaataa ccggagtacc tgcaaatgca 5280 agcggatata cattgaagat ttcaagagca acttacttgg acagagtaat tgcaaatgtt 5340 Page 10 201 122 105

gtagtaacgg gagatacttc agtttcaact caataatgat gtgggtagga 5400 gacatagtga aagacaattc tatcaacctg ttggacgttg cagaagttat ccgttgcttc 5460 aacgctacta aaggaagcgc aaactacgta gaagaacttg acattaatag aaacggcgca 5520 attaacatgc aagacataat gattgttcat aagcactttg gagctacatc aagtgattac 5580 gacgcacagt aacactgacg gctaacggga ggtagattta tgaatttcag aagaatgttg 5640 tgcgcagcca tagtgttgac aattgtactg tccattatgc tgccgtcaac tgtttttgct 5700 ttggaagaca agtctccaaa gttgccggat tataaaaacg accttttgta tgaaagaaca 5760 ttcgacgaag tcacaggctc gtctttgctt tccgtggcat acttgcgaag acagtggagg aaaatgtgat 5820 ttcgctgttg ttgatgttcc aggagagcct gggaacaaag ctttccgctt gacagtaatt 5880 gacaaaggac aaaacaagtg gagtgtccag atgagacaca gaggtattac cctcgagcaa 5940 ggacatacat acacggtaag gtttacgatt tggtctgaca aatcctgtag ggtttatgct 6000 aaaattggtc agatgggtga accctatact gaatattgga acaataactg gaatccattc 6060 aaccttacac caggacagaa gcttacagtt gaacagaatt ttacaatgaa ctatcctact 6120 gatgacacat gcgagttcac attccatttg ggtggagaac ttgctgcagg tacacctta c 6180 tatgtttacc ttgatgatgt tgt atctctctac gatcctaggt ttgtaaagcc tactccaaga tgaaatttga tgcattggca tgaatat 6240 gtacttccgc agccggatgt acgtgttaac caggtaggat acttaccgtt tgcaaagaag 6300 tatgctactg ttgtatcttc ttcaaccagc ccgcttaagt ggcagcttct caattcggca 6360 aatcaggttg ttttggaagg taatacaata ccaaaaggac ttgacaaaga ttcacaggat 6420 tatgtacatt ggatagattt ctccaacttt aagactgaag gaaaaggtta ttacttcaag 6480 cttccgactg taaacagcga tacaaattac agccatcctt tcgatatcag tgctgatatt 6540 ttcttctatc acaagagaag cggtattcct 66⑻ attgaaatgc cgtatgcagg aggagaacag tggaccagac ctgcaggaca tattggtgtt 6660 gctccgaaca aaggagacac aaatgttcct acatggcctc aggatgatga atatgcagga 6720 agacctcaaa aatattatac aaaagatgta accggtggat ggtatgatgc cggtgaccac 6780 ggtaaatatg ttgtaaacgg cggtatagct gtttggacat tgatgaacat gtatgaaagg 6840 gcaaaaatca gaggcatagc taatcaaggt gcttataaag acggtggaat gaacataccg 6900 gagagaaata acggttatcc ggacattctt gatgaagcaa gatgggaaat tgagttcttt 6960 aagaaaatgc aggtaactga aaaagaggat ccttccatag ccggaatggt acaccacaaa 7020 attcacgact tcagatggac tgctttgggt atgttgcctc acgaagatcc ccagccacgt 7080 tacttaaggc cggtaagtac ggctgcgact ttgaactttg cggcaacttt ggcacaaagt 7140 gcacgtcttt ggaaagatta tgatccgact tttgctgctg actgtttgga aaaggctgaa 7200 atagcatggc aggcggcatt aaagcatcct gatatttatg ctgagtatac tcccggtagc 7260 ggtggtcccg gaggcggacc atacaatgac gactatgtcg gagacgaatt ctactgggca 7320 gcctgcgaac tttatgtaac aacaggaaaa gacgaatata agaattacct gatgaattca 7380 cctcactatc ttgaaatgcc tgcaaagatg ggtgaaaacg gtggagcaaa cggagaagac 7440 aacggattgt ggggatgctt cacctgggga actactcaag gattgggaac tattactctt 7500 gcattagttg aaaacggat t gccgtctgca gacattcaaa aggcaagaaa caatatagct 7560 aaagctgcag acaaatggct tgagaatatt gaagagcaag gt tacagact gccgatcaaa 7620 page 11 201122105 caggcggagg atgagagagg cggttatcca tggggttcaa actccttcat tttgaaccag 7680 atgatagtta tgggatacgc atatgacttt acaggcaaca gcaagtatct tgacggaatg 7740 caggatggta tgagctacct gttgggaaga aacggactgg atcagtccta tgtaacaggg 7800 tatggtgagc Gtccacttca g aatcctcat gacagattct ggacgccaca gacaagtaag 7860 aaattccctg ctccacctcc gggtataatt gccggtggtc cgaactcccg tttcgaagac 7920 ccgacaataa ctgcagcagt taagaaggat acaccgccgc agaagtgcta cattgaccat 7980 acagactcat ggtcaaccaa cgagataact attaactgga atgctccgtt tgcatgggtt 8040 acagcttatc tcgatgaaat tgacttaata acaccgccag gaggagtaga cccagaagaa 8100 ccggaggtta tttatggtga ctgcaatggc gacggaaaag ttaattcaac tgacgctgtg 8160 gcattgaaga gatatatctt gagatcaggt ataagcatca acactgataa tgctgatgta 8220 aatgctgatg gcagagttaa ctctacagac ttggcaatat tgaagagata tattcttaaa 8280 gagatagatg tattgccaca taaataagcc acgagtgagg ggaagatgga gagaatggta 8340 aaaagcagaa agatttctat tctgttggca gttgcaatgc tggtatccat aatgataccc 8400 acaactgcat tcgcaggtcc tacaaaggca atgggacatc cctacaaaag tggaaatctc 8640 acaggcaact ttataaggat 8460 cttttccttg aactctacgg aaaaattaaa gatcctaaga acggatattt cagcccagac 8520 gagggaattc cttatcactc aattgaaaca ttgatcgttg aagcgccgga ctacggtcac 8580 gttactacca gtgaggcttt cagctattat gtatggcttg aagcaatgta ggtccggagt agaaaca gca tggaaagtta tggaggattg gataattcct 8700 gacagcacag agcagccggg tatgtcttct tacaatccaa acagccctgc cacatatgct 8760 gacgaatatg aggatccttc atactatcct tcagagttga agtttgatac cgtaagagtt 8820 ggatccgacc ctgtacacaa cgaccttgta tccgcatacg gtcctaacat gtacctcatg 8880 cactggttga tggacgttga caactggtac ggttttggta caggaacacg ggcaacattc 8940 ataaacacct tccaaagagg tgaacaggaa tccacatggg aaaccattcc tcatccgtca 9000 atagaagagt tcaaatacgg cggaccgaac ggattccttg atttgtttac aaaggacaga 9060 tcatatgcaa aacagtggcg ttatacaaac gctcctgacg cagaaggccg tgctatacag 9120 gctgtttact gggcaaacaa atgggcaaag gagcagggta aaggttctgc cgttgcttcc 9180 gttgtatcca aggctgcaaa gatgggtgac ttcttgagaa acgacatgtt cgacaaatac 9240 ttcatgaaga tcggtgcaca ggacaagact cctgctaccg gttatgacag tgcacactac 9300 cttatggcct ggtatactgc atggggtggt ggaattggtg catcctgggc atggaagatc 9360 ggatgcagcc acgcacactt cggatatcag aacccattcc agggatgggt aagtgcaaca 9420 cagagcgact ttgctcctaa atcatccaac ggtaagagag actggacaac aagctacaag 9480 agacagcttg aattctatca gtggttgcag tc ggctgaag gtggtattgc cggtggagca 9540 accaac.tcct ggaacggtag atatgagaaa tatcctgctg gtacgtcaac gttctatggt 9600 atggcatatg ttccgcatcc tgtatacgct gacccgggta gtaaccagtg gttcggattc 9660 caggcatggt caatgcagcg tgtaatggag tactacctcg aaacaggaga ttcatcagtt 9720 aagaatttga ttaagaagtg ggtcgactgg gtaatgagcg aaattaagct ctatgacgat 9780 ggaacatttg caattcctag cgacctcgag tggtcaggtc agcctgatac atggaccgga 9840 acatacacag gcaacccgaa cctccatgta agagtaactt cttacggtac tgaccttggt 9900 12 Page 201122105

gttgcaggtt cacttgcaaa acttatgccg cagctacaga aagatgggaa 9960 ggaaaacttg atacaaaagc aagagacatg gctgctgaac tggttaaccg tgcatggtac 10020 aacttctact gctctgaagg aaaaggtgtt gttactgagg aagcacgtgc tgactacaaa 10080 cgtttctttg agcaggaagt atacgttccg gcaggttgga gcggtactat gccgaacggt 10140 gacaagattc agcctggtat taagttcata gacatccgta caaaatatag acaagatcct 10200 tactacgata tagtatatca ggcatacttg agaggcgaag ctcctgtatt gaattatcac 10260 cgcttctggc atgaagttga ccttgcagtt gcaatgggtg tattggctac atacttcccg 10320 gatatgacat tgctcttgca ataaagtacc tggtactcct tctactaaat tatacggcga cgtcaatgat 10380 gacggaaaag ttaactcaac tgacgctgta gcattgaaga gatatgtttt gagatcaggt 10440 ataagcatca acactgacaa tgccgatttg aatgaagacg gcagagttaa ttcaactgac 10500 ttaggaattt tgaagagata tattctcaaa gaaatagata cattgccgta caagaactaa 10560 caccaagtga aagggggaga tatatagtga aaaaactcat tatcactgtt atagtatctg 10620 ctgtcctttt aactgctctt ataccgcagt tgcctgtttt tgcagcagac tataactatg 10680 gagaagcact ccaaaaagca attatgttct atgaatttca aatgtccg ga aagcttcccg 10740 acaacatccg taacaactgg cgcggtgatt catgtctcgg agacggaagc gatgtaggtc 10800 ttgacctcac aggaggttgg tttgacgccg gtgaccatgt aaaattcaat ctgcctatgg 10860 cttacacagc cactatgctt gcatgggctg tgtatgagta caaggacgcg ttacaaaaaa 10920 gcggtcaatt gggctattta atggatcaga ttaaatgggc atcggactac ttcataagat 10980 gccatcccga aaaatatgta tattattatc aagtgggtaa cggtgacatg gaccacagat 11040 ggtgggtgcc ggcagaatgt atagatgttc aggcaccaag accgtcttac aaagtagatc 11100 tgtcaaatcc cggttccaca gttactgcgg gtacagctgc cgcacttgct gcaactgcct 11160 tggtattcaa agacactgat ccggcatatg ccgctctgtg catacgtcat gcaaaagaac 11220 tctttgattt tgctgaaacc actatgagtg ataaaggata taccgcagca ttgaatttct 11280 acacatctca cagtggatgg tatgacgagc tttcctgggc aggtgcatgg atttatcttg 11340 cagacggtga cgaaacttat cttgaaaaag ctgaaaagta tgtggataaa tggccaatcg 11400 aaagccagac aacttacatt gcttattcat ggggtcactg ctgggacgac gttcactacg 11460 gagcagcact tcttttggca aagat tacaa acaaatcctt atacaaagaa gcgatagaaa 11520 gacacctgga ctattggaca gttggat tta atggtcagag agtcagatat acaccaaagg 11580 gtcttgctca cctcactgac tggggtgtat taagacatgc cactactact gcattccttg 11640 catgtgttta ttccgactgg tcagaatgtc caagggaaaa agccaatatt tacatagatt 11700 ttgccaagaa acaggctgac tatgccttag gcagcagcgg cagaagttat gtagtcggat 11760 ttggtgtaaa tcctccgcag catccgcacc acagaactgc ccacagctca tgg Shu gtgaca 11820 gtcaaaaagt tcctgaatac cacagacacg ttctttacgg agcactcgta ggcggacctg 11880 atgccagcga tgcttatgtt gatgatatag gaaactatgt aacaaatgag gttgcctgcg 11940 actacaatgc cggttttgta ggattgctcg ccaagatgta tgaaaaatat ggcggaaacc 12000 ccataccaaa cttcatggct atagaagaaa aaacaaatga agaaatttat gttgaagcta 12060 ccgccaattc aaataacggt gtcgaattga aaacatacct ttacaataaa tccggatggc 12120 cggcaagagt ttgcgacaag ctttccttca gatatttcat ggaccttacg gaatatgtat 12180 page 13 201122105 ccgccggata caatcctaat gatataactg tttctataat ttacagtgca gcaccaactg 12240 caaaaatttc aaaaccaata ctttatgacg catccaaaaa catatattat tgcgaaatcg 12300 atctctccgg taccaagata ttccccggaa gcaactcaga ccaccagaaa gaaacccaat 12360 ttagaataca gcctcctgca ggcgcacctt gggacaacac caacgacttc tcctatcagg 12420 gaatcaagaa aaacggtgaa gttgtaaaag aaatgcctgt ttatgaagac ggaattctca 12480 tattcggtgt agaacccaat ggtaccggtc ctgcaacacc aacgc-cgaaa ccgtccgtaa 12540 atccttcacc ttcacctacg ccaacatcgg atat tcttta cggtgacatc aatctggacg 12600 gaaaaattaa ctcttcagat gttacactgt taaaaagata tattgtgaag tccatagatg 12660 ttttcccaac cgctgatccg gaacggagct taatagcatc agatgtaaac ggagacggaa 12720 gggtaaactc tacagactat tcatacctta aacgttatgt cttgaaaatc ataccaacca 12780 tacccggaaa ttcatgacac gtcgtgtccg aatttattct attggcagag atttttgttt 12840 tttcggcatt ttcacaaaaa catatgaagt aagggtgagg gggtttggat gaaaacaaaa 12900 gaaaaagaag aaattttgca gtataaataa attataatga aaaatttaag agaaatttaa 12960 atgaggaggc aattatcaaa tgaggaagaa aaaaagat ta atatcattac tgcttgcggt 13020 ttttatcgcc gttgcatgtc tgccggcggg aattgcaagg gcagataaag cctcgagcat 13080 tgagcttaag tttgaccgca ataagggaga agttggagat atacttattg gtaccgtaag 13140 i; ataaacaat Atcaagaatt tcgc aggatt tcaggtaaac attgtatatg atccaaaagt 13200 cttaatggct gttgaccctg aaacggggaa agaatttact tcttcaacat ttccgccagg 13260 acgcactgta ctgaaaaaca atgcttacgg cccaatacag attgcggaca atgatccgga 13320 aaaagggata ctgaacttcg cgcttgcata ttcatatatt gcgggataca aagaaacagg 13380 agta ^ cggag gaaagcggca taattgcgaa aattggattt aaaatactcc agaaaaagag 13440 cactgccgta aaattccagg atacattaag catgcccgga gctatttcgg gaacacagct 13500 gtttgactgg gacggagaag ttattaccgg atatgaggta atacagccgg atgtgctgag 13560 tttgggtgac gagccttatg agacaccggg aacggatatt ccgatatccg acaatccggc 13620 agcaactccg tcatccacgc cgtcagttac tccttcaccg gaagttaaac cgactcagac 13680 gccttcgcct gcagaaaatt ctgcaaaagt ggagcttgaa cctgtgttgg ataatgcaac 13740 aggagaagca aaggcggcaa tagatgaaga aaaattaaac aaggctcttg atgaagcgaa 13800 aaaatcggaa gatgacaaac ttgtggaact taacataaag aaggttgaaa atgccgatgc 13860 ttacatacaa cagcttccgg cgaaattcct gataaaaagt gacgccgaat ataagctgag 13920 aatagctaca gagcagggaa ttatagaagt accggccaac atgctgaata ctgcggatat 13980 ttca aagctt gtaaaaaatg actccgttgt tgaattcgtc ataagaaaag taaaagtcga 14040 tgaacttggt gcagagctca aagagaagat aggcaacagg ccggtgattg acataagcgt 14100 ggttgttgac ggcaaaaaag ttgaatggag caattacaaa gccaaggtta aaatatcaat 14160 tcct tacaag cctgatgcaa aagagctgga gaaccacgag catattgttg tactccatat 14220 tgatgacgcc ggcaaggcag tttccgtacc cagcggaaaa tatgaacctt ctttgggcgt 14280 cgttacgttt gagacgaatc at t taagcaa gtatgcggtt tcatatgttt acaagacttt 14340 cgc ^ gatatt ggttcatatg cctgggctaa Aaagcagata gaggttttgg cttccaaagg 14400 agtaattaac ggtacatccg ataccacttt tacgccccag gcagacataa caagggcgga 14460 Page 14 201122105

tttcatgata cttcttgtaa aggcactggg attgactgcc gaggttactt ccaattttga 14520 tgatgtgtcc gaaaaagact actattatga atacgtggga attgcaaaag agcttggaat 14580 tacgacagga gtcggaaaca acaagttcaa tccgaaagcc aaaattacaa gacaggatat 14640 gatggtactt acaacaaatg ctctcaggat tgcaggaaaa atatcgagca caggaacccg 14700 cgctgatgtt gaaagatttt cggacaagga ccagatagct tcatatgcgg ttgaaggcgt 14760 tgcaaccttg gtaaaagaag.gtattgtagt gggaagcggc gatattataa atccaagggg 14820 aaatgcttca agagccgaac ttgcagcaat catatacaag atttactaca agtaaaattg 148S0 ttttttgcat aagtcaagtg aaggataaac aggggatacg gcccagggtg aaaagccttt 14940 tgattgggtc gtttccctaa aattatattt ctggtaaaat attcacatgg tgaaaaggag 15000 gaaaaaaaag tgaagaacgt aaaaaaaaga gtaggtgtgg ttttgctgat tcttgcagtg 15060 ttgggggttt atatgttggc aatgccggca aacactgtgt cagcggcagg tgtgcctttt 15120 aacacaaaat acccctatgg tcctacttct attgccgata atcagtcgga agtaactgca 15180 atgctcaaag cagaatggga agactggaag agcaagagaa ttacctcgaa cggtgcagga 15240 ggatacaaga gagtacagcg tgatgcttcc accaattatg atacggt atc cgaaggtatg 15300 ggatacggac ttcttttggc ggtttgcttt aacgaacagg ctttgtttga cgatttatac 15360 cgttacgtaa aatctcattt caatggaaac ggacttatgc actggcacat tgatgccaac 15420 aacaatgtta caagtcatga cggcggcgac ggtgcggcaa ccgatgctga tgaggatatt 15480 gcacttgcgc tcatatttgc ggacaagt ta tggggttctt ccggtgcaat aaactacggg 15540 caggaagcaa ggacattgat aaacaatctt tacaaccatt gtgtagagca tggatcctat 15600 gtattaaagc ccggtgacag atggggaggt tcatcagtaa caaacccgtc atattttgcg 15660 cctgcatggt acaaagtgta tgctcaatat acaggagaca caagatggaa tcaagtggcg 15720 gacaagtgtt accaaattgt tgaagaagtt aagaaataca acaacggaac cggccttgtt 15780 cctgactggt gtactgcaag cggaactccg gcaagcggtc agagttacga ctacaaatat 15840 gatgctacac gttacggctg gagaactgcc gtggactatt catggtttgg tgaccagaga 15900 gcaaaggcaa actgcgatat gctgaccaaa ttctttgcca gagacggggc aaaaggaatc 15960 gttgacggat acacaattca aggttcaaaa at tagcaaca atcacaacgc atcatttata 16020 ggacctgttg cggcagcaag tatgacaggt tacgatttga actttgcaaa ggaactttat 16080 agggagactg ttgctgtaaa ggaca gtgaa tattacggat attacggaaa cagcttgaga 16140 ctgctcactt tgttgtacat aacaggaaac ttcccgaatc ctttgagtga cct ttccggc 16200 caaccgacac caccgtcgaa tccgacacct tcattgcctc ctcaggttgt ttacggtgat 16260 gtaaatggcg acggtaatgt taactccact gatttgacta tgttaaaaag atatctgctg 16320 aagagtgtta ccaatataaa cagagaggct gcagacgtta atcgtgacgg tgcgattaac 16380 tcctctgaca tgactatatt aaagagatat ctgataaaga gcatacccca cctaccttat 16440 tagcactggg tgttttggga ggtagatcta tgctgaagaa aaaactgttg acccttttga 16500 cagtctttgc tctgctgact gtcggtatct gcggaagttt tttgccgtta cccaaagcat 16560 ccgcagcagc tctgatttac gatgattttg aaacaggtct gaacggatgg ggaccaagag 16620 gaccggaaac cgtcgaactt accaccgagg aagcttactc gggaagatac agtttgaagg 16680 tcagcggacg taccagcaca tggaacgggc ccatggttga caaaaccgat gtgttgactt 16740 page 15 201122105 t ^ ggcgaaag ctataagttg ggcgtatatg taaaattcgt gggtgattcc tattcaaatg 16800 agcaaagatt cagtttgcag cttcaatata acgacggagc aggagatgta taccaaaata 16860 taaaaaccgc cacggtttac aagggaacat ggactttgct Ggaaggacag cttaca gttc 16920 ccagccatgc aaaggacgta aaaatatatg tggaaaccga atttaaaaat tctccgagtc 16980 c;? caggactt gatggatttc tatattgacg atttcacagc aacacctgca aatttgcctg 17040 aaattgagaa agatattcca agcttgaaag atgtctttgc cggttatttc aaagtgggtg 17100 gtgccgcaac tgtggcggaa ctggcgccga agcctgcaaa agagcttttc ctcaagcatt 17160 ataacagctt gacttttggt aatgagttaa aaccggaaag tgtacttgac tatgatgcta 17220 caattgctta tatggaggca aacggaggcg accaggttaa tccgcagata accttgagag 17280 cggcaagacc cctgttggag tttgcgaaag aacacaacat acctgtaaga ggacataccc 17340 ttgtatggca cagccagaca ccggactggt tcttcagaga aaattactct caggacgaaa 17400 atgctccctg ggcatccaag gaagtaatgc tgcaaaggtt ggaaaactac ataaagaatt 17460 taatggaagc tttggcgacc gaatatccga cggttaagtt ctatgcatgg gacgttgtga 17520 atgaggctgt tgatcctaat acttcagacg gtatgagaac tccgggttcg aataacaaaa 17580 atcccggaag ctccctgtgg atgcaaaccg ttggaagaga ttttattgtt aaagcttttg Π640 aatatgcaag aaaatatgct cctgcggatt gtaaactctt ctacaatgac tataatgaat 17700 atgaagacag aaaatgtgat tttattattg aaattcttac Cgaactta aa gccaaaggcc 17760 tggttgacgg tatgggtatg caatcccact gggttatgga ttatccaagc ataagcatgt 17820 ttgaaaaatc catcagaaga tatgcagcat tgggattgga aattcagctt accgagctgg 17880 atataagaaa tcctgacaac agccagtggg ctttggaacg tcaggctaat cgttataagg 17940 agcttgtaac aaaattggtc cttccgacag 18120 aaccgccggt gatttgaaaa aagaaggcat aaacattacg gcattggtat 18000 tctg ^ ggaat aaccgacgcg acaagctggc ttggaggata tccgctcctg tttgacgcgg 18060 aatacaaggc aaaacctgca ttttatgcta tagttaacag cgttccgccg tcaggttata cccggtgatg taaacggtga cggtcgtgta aattcatccg 18180 acttgactct tatgaaaaga taccttttaa aatccataag cgacttcccg acaccggaag 18240 gaaaaattgc ggcggattta aacgaagacg gcaaggtaaa ctcgacagat ttgttagcgc 18300 tgaaaaaact cgttctgaga gaactttgac actaggtgca aaaaggagga gaaacatgtc 18360 aagaaaactt ttcagtgtat tacttgttgg cttgatgctt atgacatcgt tgcttgtcac 18420 aataagcagt acatcagcgg catccttgcc aaccatgccg ccttcgggat atgaccaggt 18480 aaggaacggc gttccgagag ggcaggtcgt aaatatttct tatttctcca cggccaccaa 18540 cagtaccagg ccggcaagag tttatttgcc gccgggatattcaaaggaca aaaaatacag 18600 tgttttgtat ctcttacacg gcataggcgg tagtgaaaac gactggttcg aagggggagg 18660 cagagccaat gttattgccg acaatctgat tgccgaggga aaaatcaagc ccctgataat 18720 tgtaacaccg aatactaacg ccgccggtcc gggaatagcg gacggttatg aaaatttcac 18780 aaaagatttg ctcaacagtc ttattcccta tatcgaatct aactattcag tctacaccga 18840 ccgcgaacat cgggcgattg caggactttc aatgggtgga ggacaatcgt ttaatattgg 18900 attgaccaat ctcgataaat ttgcctatat tggcccgatt tcagcggctc caaacactta 18960 tccaaatgag aggctttttc ctgacggagg aaaagctgca agggagaaat Tgaaactgct 19020 Page 16 201122105

ctttattgcc ttgcgttgcc taatgtgtgg gagggatgga agcggaagat aggaggcaga ctttggaaac tgaacttaga aggagattgg tgatttgtac aagcagttcc tcaggcgtta agcggatgta tatactccgc tgttactccg ggaggcaagg tccaacctac gaagtttgat gcttgctttt tcaaaacccg gaaaaatcac ggcaaacgaa aatcggtcag acttcttttc taacatgatt ccactttatc atatgcggaa ggaaaacccg ttgtctggca atggattccg tccgaaaccg tgcggaacca aacaacatta aagcccggat aacactccgg tatgacggta ggaataggtt ggagcaacgt ttaaacggtc aatacatatg ttggtattca acaggtctgg aagaggcatt aataggagcg attattacag acacaaactc ggaataaaaa aacagcattt get ttgcagc gcagaaagaa teatggetta attaccactg tgtatggatg gactaccttg tacaatgatt aaaagtatga aatggaatga ataggegtta gcaactgcat aaccccaatt ggaactttcc gcatacaatg atgacagtct accatgtcta tgtggaattt ttccgacacc ttaattette atattaccag cgtttaaggc cgaatggtac aggagcaaac aaggccctgt gggatttaaa tgctcggtat gcaaagtgga agt tccccgg ctatccccac tcggaacatg tgcaaagaga cgagacaaaa aeggtatgea caaacggtaa ttatgaccca attccggcaa actatgcttt ataatattga aggaaagagg gccccgagta tagtatcctt tccaggtaca gcaatacc tt caggatatgg caataaagga gataggtttt ttggcttatt ccttcaaatg cagtccaaag aagtattgag tggtgattat caaggttgca tctcataggc ttgeageatt aaacatagac tggtgacgga atcaccgctt ttctactgac acaaggtgat gatttcggga tgtcaactat attttcaatg cgtttttgat gatgagggga ctggaaccgg ttacaaaggt eggettaaga caggtatgca agacttgggt tgtgccgatt ccttgccagc taccgaaata ggcaaacaac tgtaatgtgg caatccattg agetettatg ggacagagag cagggeggag gcagatgaag ccggctaaca ataataggtg ctggtataca aatgcaaata acactctcgg agcaaagtca tggttcactt aatattaact aegggagagg tattcagtgc gtacagacac aatgetetta ccgttttaca gttgtatgtg ttttcgaaag catacgttga gattcgctgc aaaattgttg ageageatat agagaageag ccaaagtcca gaeggagtag at tgatcaaa gatataegea tataaggaac ggattcacag atttatgaca ggctattga tacatgaata gacacgattt ccggattgac cacgtattga t tccacctga agagtataga cttccaatat taaaatccac ccggaataaa ttggcgttga cgtcggacct ctcttttaag tgaaaagata ccaatccgtc gggattatgc acaattcaga gagaccagt atcccgatgc atgeggtatt gattccaatg aaaatgaaat t tttggcacaa ttgcggtaat agtgggatgt ggagaaatgt atattaagag tacct Cagtc ttatgaaaat ataaatacac gcaattacaa 19080 19140 19200 19260 19320 19380 19440 19500 19560 19620 19680 19740 19800 19860 19920 19980 20040 20100 20160 20220 20280 20340 20400 20460 20520 20580 20640 20700 20760 20820 20869 <210> 3 <211> 20869 <212> DNA caaaggaatg gccaattgcg 400> 3 ggcctgtttg gcctttggga ggaatggtag atgagaaaag tcatcagtat getettagtt gtggctatgc tgaegaegat ttttgcggcg atgataccgc agacagtatc ggcggccaca page 17 60 120 201122105 atgacagtcg agatcggcaa agttacagca gccgttggat caaaagtaga aatacctata 180 accctgaaag gagtgccatc; < 213 > artificial sequence < 220 > < 223 > recombination sequence & lt acttcgtatt gggttatgat 240 ccaaatgtgc tggaagtaac agaagtaaaa ccaggaagca taataaaaga tccggatcct 300 agcaagagct ttgatagcgc aatatatccg gatcgaaaga tgattgtatt tctgtttgca 360 gaagacagtg gaagaggaac gtatgcaata actcaggatg gagtatttgc aacaattgta 420 gccactgtca aatcagctgc agcggcaccg attactttgc ttgaagtagg tgcatttgcg 480 gacaacgatt tagtagaaat aagcacaact tttgtcgcgg gcggagtaaa tcttggtagt 540 tccgta ccga caacacagcc aaatgttccg tcagacggtg tggtagtaga aattggcaaa 600 gttacgggat ctgttggaac tacagttgaa atacctgtat atttcagagg agttccatcc 660 aaaggaatag caaactgcga ctttgtgttc agatatgatc cgaatgtatt ggaaattata 720 gggatagatc ccggagacat aatagttgac ccgaatccta ccaagagctt tgatactgca 780 atatatcctg acagaaagat aatagtattc ctgtttgcgg aagacagcgg aacaggagcg 840 tatgcaataa ctaaagacgg agtatttgca aaaataagag caactgtaaa atcaagtgct 900 ccgggctata ttactttcga cgaagtaggt ggatttgcag ataatgacct ggtagaacag 960 aaggtatcat ttatagacgg tggtgttaac gttggcaatg caacaccgac caagggagca 1020 acaccaacaa atacagctac gccgacaaaa tcagctacgg ctacgcccac caggccatcg 1080 gtaccgacaa acacaccgac aaacacaccg gcaaatacac cggtatcagg caatttgaag 1140 gttgaattct acaacagcaa tccttcagat actactaact caatcaatcc tcagttcaag 1200 gttactaata ccggaagcag tgcaattgat ttgtccaaac tcacattgag atattattat 1260 acagtagacg gacagaaaga tcagaccttc tggtgtgacc atgctgcaat aatcggcagt 1320 aacgiicagct acaacggaat tacttcaaat gtaaaaggaa catttgtaaa aatgagttcc 1380 tcaacaaata acgcaga cac ctaccttgaa ataagcttta caggcggaac tcttgaaccg 1440 j ^ gtgcacatg ttcagataca aggtagattt gcaaagaatg actggagtaa ctatacacag 1500 tcaaatgact actcattcaa gtctgcttca cagtttgttg aatgggatca ggtaacagca 1560 tacttgaacg gtgttcttgt atggggtaaa gaacccggtg gcagtgtagt accatcaaca 1620 cagcctgtaa caacaccacc tgcaacaaca aaaccacctg caacaacaaa accacctgca 1680 acaacaatac cgccgtcaga tgatccgaat gcaataaaga ttaaggtgga cacagtaaat 1740 gcaaaaccgg gagacacagt aaatatacct gtaagattca gtggtatacc atccaaggga 1800 atagcaaact gtgactttgt atacagctat gacccgaatg tacttgagat aatagagata 1860 aaaccgggag aattgatagt tgacccgaat cctgacaaga gctttgatac tgcagtatat 1920 cctgacagaa agataatagt attcctgttt gcagaagaca gcggaacagg agcgtatgca 1980 ataactaaag acggagtatt tgctacgata gtagcgaaag taaaatccgg agcacctaac 2040 ggactcagtg taatcaaatt tgtagaagta ggcggatttg cgaacaatga ccttgtagaa 2100 cagaggacac agttctttga cggtggagta aatgttggag atacaacagt acctacaaca 2160 cctacaacac ctgtaacaac accgacagat gattcgaatg cagtaaggat taaggtggac 2220 acagtaaatg Caaaaccggg a Gacacagta agaatacctg taagattcag cggtatacca 2280 tccaagggaa tagcaaactg tgactttgta tacagctatg acccgaatgt acttgagata 2340 atagagatag aaccgggaga cataatagtt gacccgaatc ctgacaagag ctttgatact 2400 Page 18 201122105

gcagtatatc ctgacagaaa gataatagta ttcctgtttg cggaagacag cggaacagga 2460 gcgtatgcaa taactaaaga cggagtattt gctacgatag tagcgaaagt aaaatccgga 2520 gcacctaacg gactcagtgt aatcaaattt gtagaagtag gcggatttgc gaacaatgac 2580 cttgtagaac agaagacaca gttctttgac ggtggagtaa atgttggaga tacaacagaa 2640 cctgcaacac ctacaacacc tgtaacaaca ccgacaacaa cagatgatct ggatgcagta 2700 aggattaaag tggacacagt aaatgcaaaa ccgggagaca cagtaagaat acctgtaaga 2760 ttcagcggta taccatccaa gggaatagca aactgtgact ttgtatacag ctatgacccg 2820 aatgtacttg agataataga gatagaaccg ggagacataa tagttgaccc gaatcctgac 2880 aagagctttg atactgcagt atatcctgac agaaagataa tagtattcct gtttgcggaa 2940 gacagcggaa caggagcgta tgcaataact aaagacggag tatttgctac gatagtagcg 3000 aaagtaaaat ccggagcacc taacggactc agtgtaatca aatttgtaga agtaggcgga 3060 tttgcgaaca atgaccttgt agaacagaag acacagttct ttgacggtgg agtaaatgtt 3120 ggagatacaa cagaacctgc aacacctaca acacctgtaa caacaccgac aacaacagat 3180 gatctggatg cagtaaggat taaagtggac acagtaaatg caaaaccggg agacacagt a 3240 agaatacctg taagattcag cggtatacca tccaagggaa tagcaaactg tgactttgta 3300 tacagctatg acccgaatgt acttgagata atagagatag aaccgggaga cataatagtt 3360 gacccgaatc ctgacaagag ctttgatact gcagtatatc ctgacagaaa gataatagta 3420 ttcctgtttg cagaagacag cggaacagga gcgtatgcaa taactaaaga cggagtattt 3480 gc.tacgatag tagcgaaagt aaaagaagga gcacctaacg gactcagtgt aatcaaattt 3540 gtagaagtag gcggatttgc gaacaatgac cttgtagaac agaagacaca gttctttgac 3600 ggtggagtaa atgttggaga tacaacagaa cctgcaacac ctacaacacc tgtaacaaca 3660 ccgacaacaa cagatgatct ggatgcagta aggattaaag tggacacagt aaatgcaaaa 3720 ccgggagaca cagtaagaat acctgtaaga ttcagcggta taccatccaa gggaatagca 3780 aactgtgact ttgtatacag ctatgacccg aatgtacttg agataataga gatagaaccg 3840 ggagaattga tagttgaccc gaatcctacc aagagctttg atactgcagt atatcctgac 3900 agaaagatga tagtattcct gtttgcggaa gacagcggaa caggagcgta tgcaataact 3960 gaagatggag tatttgctac gatagtagcg aaagtaaaat ccggagcacc taacggactc 4020 agtgtaatca aatttgtaga agtaggcgga tttgcgaaca atgaccttgtagaacagaag 4080 acacagttct ttgacggtgg agtaaatgtt ggagatacaa cagaacctgc aacacctaca 4140 acacctgtaa caacaccgac aacaacagat gatctggatg cagtaaggat taaagtggac 4200 acagtaaatg caaaaccggg agacacagta agaatacctg taagattcag cggtatacca 4260 tccaagggaa tagcaaactg tgactttgta tacagctatg acccgaatgt acttgagata 4320 atagagatag aaccgggaga cataatagtt gacccgaatc ctgacaagag ctttgatact 4380 gcagtatatc ctgacagaaa gataatagta ttcctgtttg cagaagacag cggaacggga 4440 gcgtatgcaa taactaaaga cggagtattt gctacgatag tagcgaaagt aaaagaagga 4500 gcacctaacg gactcagtgt aatcaaattt gtagaagtag gcggatttgc gaacaatgac 4560 cttgtagaac agaagacaca gttctttgac ggtggagtaa atgttggaga tacaacagta 4620 cctacaacat cgccgacaac aacaccgcca gagccgacga taactccgaa caagt tgaca 4680 page 19 201122105 cttaagatag gcagagcaga aggaagacct ggagacacgg tggaaatacc ggttaacttg 4740 tatggagtac ctcaaaaagg aatagcaagc ggtgacttcg tagtaagcta tgacccgaat 4800 gtacttgaga taatagagat agaaccggga gaattgatag ttgacccgaa tcctaccaag 4860 agctttgata ctgcagtata Tcc tgacaga aagatgatag tattcctgtt tgcggaagac 4920 agcggaacag gagcgtatgc aataactgaa gatggagtat ttgctacgat agtagcgaaa 4980 gtaaaagaag gagcacctga aggattcagt gcaatagaaa tttctgagtt tggtgcattt 5040 gcagataatg atctggtaga agtggaaact gaccttatca atggtggagt acttgtaact 5100 aataaacctg taatagaagg atataaagta tccggataca ttttgccaga cttctccttc 5160 gacgctactg ttgcaccact tgtaaaggcc ggattcaaag ttgaaatagt aggaacagaa 5220 ttgtatgcag taacagatgc aaacggatac tttgaaataa ccggagtacc tgcaaatgca 5280 agcggatata cattgaagat ttcaagagca acttacttgg acagagtaat tgcaaatgtt 5340 gtagtaacgg gagatacttc agtttcaact tcacaggctc caataatgat gtgggtagga 5400 gacatagtga aagacaattc tatcaacctg ttggacgttg cagaagttat ccgttgcttc 5460 aacgctacta aaggaagcgc aaactacgta gaagaacttg acattaatag aaacggcgca 5520 attaacatgc aagacataat gattgttcat aagcactttg gagctacatc aagtgattac 5580 ^ acgcacagt aacactgagt gcaaaaagga ggagaaacat gtcaagaaaa cttttcagtg 5640 tattacttgt tggcttgatg cttatgacat cgttgcttgt cacaataagc agtacatcag 5700 cggcatcctt gccaaccatg ccgccttcg g gatatgacca ggtaaggaac ggcgttccga 5760 gagggcaggt cgtaaatatt tcttatttct ccacggccac caacagtacc aggccggcaa 5820 iiagtttattt gccgccggga tattcaaagg acaaaaaata cagtgttttg tatctcttac 5880 acggcatagg cgg ^ agtgaa aacgactggt tcgaaggggg aggcagagcc aatgttattg 5940 ccgacaatct gattgccgag ggaaaaatca agcccctgat aattgtaaca ccgaatacta 6000 acgccgccgg tccgggaata gcggacggtt atgaaaattt cacaaaagat ttgctcaaca 6060 gtcttattcc ctatatcgaa tctaactatt cagtctacac cgaccgcgaa catcgggcga 6120 ttgcaggact ttcaatgggt ggaggacaat cgtttaatat tggattgacc aatctcgata 6180 aatttgccta tattggcccg atttcagcgg ctccaaacac ttatccaaat gagaggcttt 6240 ttcctgacgg aggaaaagct gcaagggaga aattgaaact gctctttatt gcctgcggaa 6300 ccaatgacag tctgataggt tttggacaga gagtacatga atattgcgtt gccaacaaca 6360 ttaaccatgt ctattggctt attcagggcg gaggacacga ttttaatgtg tggaagcccg 6420 gattgtggaa tttccttcaa atggcagatg aagccggatt gacgagggat ggaaacactc 6480 cggttccgac acccagtcca aagccggcta acacacgtat tgaagcggaa gattatgacg 6540 gtattaattc ttcaagtatt Gagataatag gtg ttccacc tgaaggaggc agaggaatag 6600 gttatattac cagtggtgat acaagagtat agactttgga aacggagcaa 6660 cgtcgtttaa ggccaaggtt gcaaatgcaa atacttccaa tattgaactt agattaaacg 6720 gtccgaatgg tactctcata ggcacactct cggtaaaatc cacaggagat tggaatacat 6780 atgaggagca aacttgcagc attagcaaag tcaccggaat aaatgatttg tacttggtat 6840 tcaaaggccc tgtaaacata gactggttca cttttggcgt tgaaagcagt tccacaggtc 6900 tggKggattt aaatggtgac ggaaatatta actcgtcgga ccttcaggcg ttaaagaggc 6960 Page 20 201122105 tatctggtat

atttgctcgg tatatcaccg cttacgggag aggctctttt aagagcggat gtaaatagga 7020 gcggcaaagt ggattctact gactattcag tgctgaaaag atatatactc cgcattatta 7080 cagagttccc cggacaaggt gatgtacaga cacccaatcc gtctgttact ccgacacaaa 7140 ctcctatccc cacgatttcg ggaaatgctc ttagggatta tgcggaggca aggggaataa 7200 aaatcggaac atgtgtcaac tatccgtttt acaacaattc agatccaacc tacaacagca 7260 ttttgcaaag agaattttca atggttgtat gtgaaaatga aatgaagttt gatgctttgc 7320 agccgagaca aaacgttttt gatttttcga aaggagacca gttgcttgct tttgcagaaa 7380 gaaacggtat gcagatgagg ggacatacgt tgatttggca caatcaaaac ccgtcatggc 7440 ttacaaacgg taactggaac cgggattcgc tgcttgcggt aatgaaaaat cacattacca 7500 ctgttatgac ccattacaaa ggtaaaattg ttgagtggga tgtggcaaac gaatgtatgg 7560 atgattccgg caacggctta aggtgtgccg attgacggag taggattcca agaagcagca tatggagaaa tgtaatcggt caggactacc 7620 ttgactatgc tttcaggtat gcaagagaag cagatcccga tgcacttctt ttctacaatg 7680 attataatat tgaagacttg ggtccaaagt ccaatgcggt atttaacatg attaaaagta 7740 tgaaggaaag atgccacttt atcaatgga a 7800 tgagccccga gtaccttgcc agcattgatc aaaatattaa gagatatgcg gaaataggcg 7860 ttatagtatc ctttaccgaa atagatatac gcatacctca gtcggaaaac ccggcaactg 7920 cattccaggt acaggcaaac aactataagg aacttatgaa aatttgtctg gcaaacccca 7980 attgcaatac ctttgtaatg tggggattca cagataaata cacatggatt ccgggaactt 8040 tcccaggata tggcaatcca ttgatttatg acagcaatta caatccgaaa ccggcataca 8100 atgcaataaa ggaagctctt atgggctatt gacaccgagt gttttgggag gtagatctat 8160 gctgaagaaa aaactgttga cccttttgac agtctttgct ctgctgactg tcggtatctg 8220 cggaagtttt ttgccgttac ccaaagcatc cgcagcagct ctgatttacg atgattttga 8280 aacaggtctg aacggatggg gaccaagagg accggaaacc gtcgaactta ccaccgagga 8340 agcttactcg ggaagataca gtttgaaggt cagcggacgt accagcacat ggaacgggcc 8400 catggttgac aaaaccgatg tgttgacttt gggcgaaagc tataagttgg gcgtatatgt 8460 aaaattcgtg ggtgattcct attcaaatga gcaaagattc agtttgcagc ttcaatataa 8520 cgacggagca ggagatgtat accaaaatat aaaaaccgcc acggtttaca agggaacatg 8580 gactttgctg gaaggacagc ttacagttcc cagccatgca aaggacgtaa a aatatatgt 8640 ggaaaccgaa tttaaaaatt ctccgagtcc gcaggacttg atggatttct atattgacga 8700 tttcacagca acacctgcaa atttgcctga aattgagaaa gatattccaa gcttgaaaga 8760 tgtctttgcc ggttatttca aagtgggtgg tgccgcaact gtggcggaac tggcgccgaa 8820 gcctgcaaaa gagcttttcc tcaagcat ta taacagcttg acttttggta atgagttaaa 8880 accggaaagt gtacttgact atgatgctac aattgcttat atggaggcaa acggaggcga 8940 ccaggttaat ccgcagataa cct tgagagc ggcaagaccc ctgttggagt ttgcgaaaga 9000 acacaacata cctgtaagag gacataccct tgtatggcac agccagacac cggactggtt 9060 cttcagagaa aattactctc aggacgaaaa tgctccctgg gcatccaagg aagtaatgct 9120 gcaaaggttg gaaaactaca taaagaattt aatggaagct ttggcgaccg aatatccgac 9180 ggttaagttc tatgcatggg acgttgtgaa tgaggctgtt gatcctaata cttcagacgg page 21 9240 201122105 tatgagaact ccgggttcga ataacaaaaa tcccggaagc tccctgtgga tgcaaaccgt 9300

Uigaagagat tttattgtta aagcttttga atatgcaaga aaatatgctc ctgcggattg 9360 taaactcttc tacaatgact ataatgaata tgaagacaga aaatgtgatt ttattattga 9420 aattcttacc gaacttaaag ccaaaggcct ggttgacggt atgggtatgc aatcccactg 9480 g ( «ttatggat tatccaagca taagcatgtt atcagaagat atgcagcatt 9540 gilgattggaa attcagctta ccgagctgga tataagaaat cctgacaaca gccagtgggc 9600 tttggaacgt caggctaatc gttataagga gcttgtaaca aaattggtcg atttgaaaaa 9660 agaaggcata aacattacgg cattggtatt ctggggaata accgacgcga tgaaaaatcc caagctggct 9720 tggaggatat ccgctcctgt ttgacgcgga atacaaggca aaacctgcat tttatgctat 9780 agttaacagc gttccgccgc ttccgacaga accgccggtt caggttatac ccggtgatgt 9840 aaacggtgac ggtcgtgtaa attcatccga cttgactctt atgaaaagat accttttaaa 9900 atccataagc gacttcccga caccggaagg aaaaattgcg gcggatttaa acgaagacgg 9960 caaggtaaac tcgacagatt tgttagcgct gaaaaaactc gttctgagag aactttgaca 10020 cccagtgaaa aggaggaaaa aaaagtgaag aacgtaaaaa aaagagtagg tgtggttttg 10080 ctgattcttg cagtgttggg ggtttatatg ttggcaatgc cggcaaacac tgtgtcagcg 10140 gcaggtgtgc cttttaacac aaaatacccc tatggtccta cttctattgc cgataatcag 10200 tcggaagtaa ctgcaatgct caaagcagaa tgggaagact ggaagagcaa gagaattacc 10260 tcgaacggtg tttgcggaca agttatgggg ttcttccggt caggaggata caagagagta cagcgtgatg cttccaccaa ttatgatacg 10320 atatccgaag gtatgggata cggacttctt ttggcggttt gctttaacga acaggctttg 10380 tttgacgatt tataccgtta cgtaaaatct catttcaatg gaaacggact tatgcactgg 10440 cacattgatg ccaacaacaa tgttacaagt catgacggcg gcgacggtgc ggcaaccgat 10500 gctgatgagg atattgcact tgcgctcata 10560 gcaataaact acgggcagga agcaaggaca ttgataaaca atctttacaa ccattgtgta 10620 gagcatggat cctatgtatt aaagcccggt gacagatggg gaggttcatc agtaacaaac 10680 ccgtcatatt ttgcgcctgc atggtacaaa gtgtatgctc aatatacagg agacacaaga 10740 tggaatcaag tggcggacaa gtgttaccaa attgttgaag aagttaagaa atacaacaac 10800 ggaaccggcc ttgttcctga ctggtgtact gcaagcggaa ctccggcaag cggtcagagt 10860 tacgactaca aatatgatgc tacacgttac ggctggagaa ctgccgtgga ctattcatgg 10920 tttggtgacc agagagcaaa ggcaaactgc gatatgctga ccaaattctt tgccagaga c 10980 ggggcaaaag gaatcgttga cggatacaca attcaaggtt caaaaattag caacaatcac 11040 aacgcatcat ttataggacc tgttgcggca gcaagtatga caggttacga tttgaacttt 11100 gcaaaggaac tttataggga gactgttgct gtaaaggaca gtgaatatta cggatattac 11160 ggaaacagct tgagactgct cactttgttg tacataacag gaaacttccc gaatcctttg 11220 agtgaccttt ccggccaacc gacaccaccg tcgaatccga caccttcatt gcctcctcag 11280 gttgtttacg gtgatgtaaa tggcgacggt aatgttaact ccactgattt gactatgtta 11340 aaaagatatc tgctgaagag tgttaccaat ataaacagag aggctgcaga cgttaatcgt 11400 gacggtgcga ttaactcctc tgacatgact atattaaaga gatatctgat aaagagcata 11460 ccccacctac cttattagca cgtcgtgtcc gaatttattc tattggcaga gatttttgtt 11520 Page 22 201122105

ttttcggcat tttcacaaaa acatatgaag taagggtgag ggggtttgga tgaaaacaaa 11580 agaaaaagaa gaaattttgc agtataaata aattataatg aaaaatttaa gagaaattta 11640 aatgaggagg caattatcaa atgaggaaga aaaaaagatt aatatcatta ctgettgegg 11700 tttttatcgc cgttgcatgt ctgccggcgg gaattgcaag ggcagataaa gcctcgagca 11760 ttgagcttaa gtttgaccgc aataagggag aagttggaga tataettatt ggtaccgtaa 11820 ggataaacaa tatcaagaat ttcgcaggat ttcaggtaaa cattgtatat gatccaaaag 11880 tcttaatggc tgttgaccct gaaacgggga aagaatttac ttcttcaaca tttccgccag 11940 gacgcactgt actgaaaaac aatgcttacg gcccaataca gattgcggac aatgatccgg 12000 aaaaagggat actgaacttc gcgcttgcat attcatatat tgcgggatac aaagaaacag 12060 gagtagcgga ggaaagcggc ataattgcga aaattggatt taaaatactc cagaaaaaga 12120 gcactgccgt aaaattccag gatacattaa gcatgcccgg agetattteg ggaacacagc 12180 tgtttgactg ggacggagaa gttattaccg gatatgaggt aatacagccg gatgtgctga 12240 gtttgggtga cgagccttat gagacaccgg gaaeggatat tccgatatcc gacaatccgg 12300 cagcaactcc gtcatccacg ccgtcagtta ctccttcacc ggaagtt aaa ccgactcaga 12360 cgccttcgcc tgcagaaaat tctgcaaaag tggagcttga acctgtgttg gataatgcaa 12420 caggagaagc aaaggcggca atgaacttgg tgcagagctc aaagagaaga atagatgaag aaaaattaaa caaggctctt gatgaagega 12480 aaaaatcgga agatgacaaa cttgtggaac ttaacataaa gaaggttgaa aatgccgatg 12540 cttacataca acagcttccg gcgaaattcc tgataaaaag tgacgccgaa tataagctga 12600 gaatagctac agagcaggga attatagaag taccggccaa catgctgaat actgcggata 12660 tttcaaagct tgtaaaaaat gactccgttg ttgaattcgt cataagaaaa gtaaaagtcg 12720 taggcaacag gccggtgatt gacataagcg 12780 tggttgttga cggcaaaaaa gttgaatgga gcaattacaa agccaaggtt aaaatatcaa 12840 ttccttacaa gcctgatgca aaagagctgg agaaccacga gcatattgtt gtactccata 12900 ttgatgacgc cggcaaggca gtttccgtac ccagcggaaa atatgaacct tctttgggcg 12960 tcgttacgtt tgagacgaat catttaagca agtatgcggt ttcatatgtt tacaagactt 13020 tcgcggatat tggttcatat gcctgggcta aaaagcagat agaggttttg gcttccaaag 13080 gagtaattaa cggtacatcc gataccactt ttacgcccca ggcagacata acaagggcgg 13140 atttcatgat acttcttgta aaggcac tgg gattgactgc cgaggttact tccaattttg 13200 atgatgtgtc cgaaaaagac tactattatg aatacgtggg aattgcaaaa gagcttggaa 13260 ttacgacagg agtcggaaac aacaagt tea atccgaaagc caaaattaca agacaggata 13320 tgatggtact tacaacaaat gctctcagga ttgcaggaaa aatategage acaggaaccc 13380 gcgctgatgt tgaaagattt tcggacaagg accagatagc ttcatatgcg gttgaaggcg 13440 ttgcaacctt ggtaaaagaa ggtattgtag tgggaagcgg egatattata aatccaaggg 13500 gaaatgcttc aagagccgaa cttgcagcaa tcatatacaa gatttactac aagtaaaatt 13560 gttttttgca taagtcaagt gaaggataaa caggggatac ggcccagggt gaaaagcctt 13620 ttgattgggt cgtttcccta aaattatatt tctggtaaaa tattcacatg eggetaaegg 13680 gaggtagatt tatgaatttc agaagaatgt tgtgcgcagc catagtgttg acaattgtac 13740 tgtccattat gctgccgtca actgtttttg ctttggaaga caagtctcca aagttgccgg 13800 page 23 201122105 attataaaaa cgaccttttg tatgaaagaa cattcgacga aggtctttgc tttccgtggc 13860 atacttgcga agacagtgga ggaaaatgtg atttcgctgt tgttgatgtt ccaggagagc 13920 ctgggaacaa agctttccgc ttgacagtaa ttgacaaagg acaaaacaag tggagtgtcc 13980 agatgagaca cagaggtatt accctcgagc aaggacatac atacacggta aggtttacga 14040 tttggtctga caaatcctgt agggtttatg ctaaaattgg tcagatgggt gaaccctata 14100 ctgaatattg gaacaataac tggaatccat tcaaccttac accaggacag aagcttacag 14160 ttgaacagaa ttttacaatg aactatccta ctgatgacac atgcgagttc acattccatt 14220 tgggtggaga acttgctgca ggtacacctt actatgttta ccttgatgat gtatctctct 14280 acgatcctag gtttgtaaag cctgttgaat atgtacttcc gcagccggat gtacgtgtta 14340 accaggtagg atacttaccg tttgcaaaga agtatgctac tgttgtatct tcttcaacca 14400 gcccgcttaa gtggcagctt ctcaattcgg caaatcaggt tgttttggaa ggtaatacaa 14460 taccaaaagg acttgacaaa gattcacagg attatgtaca ttggatagat ttctccaact 14520 ttaagactga aggaaaaggt tattacttca agcttccgac tgtaaacagc gatacaaatt 14580 acagccatcc tttcgatatc agtgctgata tttactccaa gatgaaattt gatgcattgg 14640 cattcttcta tcacaagaga agcggtattc ctattgaaat gccgtatgca ggaggagaac 14700 agtggaccag acctgcagga catattggtg ttgctccgaa caaaggagac acaaatgttc 14760 ctacatggcc tcaggatgat gaatatgcag gaagacctca aaaatattat acaaaagatg 14820 taaccggtgg atggtatgat gccggtgacc acggtaaata tgttgtaaac ggcggtatag 14880 ctgtttggac attgatgaac atgtatgaaa gggcaaaaat cagaggcata gctaatcaag 14940 gtgcttataa agacggtgga atgaacatac cggagagaaa taacggttat ccggacattc 15000 ttgatgaagc aagatgggaa attgagttct ttaagaaaat gcaggtaact gaaaaagagg 15060 at-ccttccat agccggaatg gtacaccaca aaattcacga cttcagatgg actgctttgg 15120 iitatgttgcc tcacgaagat ccccagccac gttacttaag gccggtaagt acggctgcga 15180 ctttgaactt tgcggcaact ttggcacaaa gtgcacgtct ttggaaagat tatgatccga 15240 cttttgctgc tgactgtttg gaaaaggctg aaatagcatg gcaggcggca ttaaagcatc 15300 ctgatattta tgctgagtat actcccggta gcggtggtcc cggaggcgga ccatacaatg 15360 acgactatgt cggagacgaa ttctactggg cagcctgcga actttatgta acaacaggaa 15420 aagacgaata taagaattac ctgatgaatt cacctcacta tcttgaaatg cctgcaaaga 15480 tgggtgaaaa cggtggagca aacggagaag acaacggatt gtggggatgc ttcacctggg 15540 gaactactca aggattggga actattactc ttgcattagt tgaaaacgga ttgccgtctg 15600 cagacattc a aaaggcaaga aacaatatag ctaaagctgc agacaaatgg cttgagaata 15660 ttgaagagca aggttacaga ctgccgatca aacaggcgga ggatgagaga ggcggttatc 15720 catggggttc aaactccttc attttgaacc agatgatagt tatgggatac gcatatgact 15780 ttacaggcaa cagcaagtat cttgacggaa tgcaggatgg tatgagctac ctgttgggaa 15840 gaaacggact ggatcagtcc tatgtaacag ggtatggtga gcgtccactt cagaatcctc 15900 atgacagatt ctggacgcca cagacaagta agaaattccc tgctccacct ccgggtataa 15960 ttgccggtgg tccgaactcc cgtttcgaag acccgacaat aactgcagca gttaagaagg 16020 atacaccgcc Gcagaagtgc tacattgacc atacagactc atggtcaacc aacgagataa 16080 Page 24 201122105

ctattaactg gaatgctccg tttgcatggg tacagct ta tctcgatgaa attgacttaa 16140 taacaccgcc aactgctctt ataccgcagt tgcctgtttt aggaggagta gacccagaag aaccggaggt tatttatggt gactgcaatg 16200 gcgacggaaa agttaattca actgacgctg tggcattgaa gagatatatc ttgagatcag 16260 gtataagcat caacactgat aatgctgatg taaatgctga tggcagagtt aactctacag 16320 acttggcaat attgaagaga tatattctta aagagataga tgtattgcca cataaataag 16380 ccatgggtga aagggggaga tatatagtga aaaaactcat tatcactgtt atagtatctg 16440 ctgtcctttt tgcagcagac tataactatg t 16500 gagaagcact ccaaaaagca attatgttct atgaatttca aatgtccgga aagcttcccg 16560 acaacatccg taacaactgg cgcggtgatt catgtctcgg agacggaagc gatgtaggtc 16620 ttgacctcac aggaggttgg tttgacgccg gtgaccatgt aaaattcaat ctgcctatgg 16680 cttacacagc cactatgctt gcatgggctg tgtatgagta caaggacgcg ttacaaaaaa 16740 gcggtcaatt gggctattta atggatcaga ttaaatgggc atcggactac ttcataagat 16800 gccatcccga aaaatatgta tattattatc aagtgggtaa cggtgacatg gaccacagat 16860 ggtgggtgcc ggcagaatgt atagatgttc aggcaccaag accgt cttac aaagtagatc 16920 tgtcaaatcc cggttccaca gttactgcgg gtacagctgc cgcacttgct gcaactgcct 16980 tggtattcaa agacactgat ccggcatatg ccgctctgtg catacgtcat gcaaaagaac 17040 tctttgattt tgctgaaacc actatgagtg ataaaggata taccgcagca ttgaatttct 17100 acacatctca cagtggatgg tatgacgagc tttcctgggc aggtgcatgg atttatcttg 17160 cagacggtga cgaaact tat ct tgaaaaag ctgaaaagta tgtggataaa tggccaatcg 17220 aaagccagac aacttacatt gcttattcat ggggtcactg ctgggacgac gttcactacg 17280 gagcagcact tcttttggca aagattacaa acaaatcctt atacaaagaa gcgatagaaa 17340 gacacctgga ctattggaca gttggattta atggtcagag agtcagatat acaccaaagg 17400 gtcttgctca cctcactgac tggggtgtat taagacatgc cactactact gcattccttg 17460 catgtgttta ttccgactgg tcagaatgtc caagggaaaa agccaatatt tacatagatt 17520 ttgccaagaa acaggctgac tatgccttag gcagcagcgg cagaagttat gtagtcggat 17580 ttggtgtaaa tcctccgcag catccgcacc acagaactgc ccacagctca tggtgtgaca 17640 gtcaaaaagt tcctgaatac cacagacacg ttctttacgg agcactcgta ggcggacctg 17700 atgccagcga tgcttatgtt gat gatatag gaaactatgt aacaaatgag gttgcctgcg 17760 actacaatgc cggttttgta ggattgctcg ccaagatgta tgaaaaatat ggcggaaacc 17820 ccataccaaa cttcatggct atagaagaaa aaacaaatga agaaatttat gttgaagcta 17880 ccgccaattc aaataacggt gtcgaattga aaacatacct ttacaataaa tccggatggc 17940 cggcaagagt ttgcgacaag ctttccttca gatatttcat ggaccttacg gaatatgtat 18000 ccgccggata caatcctaat gatataactg tttctataat ttacagtgca gcaccaactg 18060 caaaaatttc aaaaccaata ctttatgacg catccaaaaa catatattat tgcgaaatcg 18120 atctctccgg taccaagata ttccccggaa gcaactcaga ccaccagaaa gaaacccaat 18180 ttagaataca gcctcctgca ggcgcacctt gggacaacac caacgacttc tcctatcagg 18240 gaatcaagaa aaacggtgaa gttgtaaaag aaatgcctgt ttatgaagac ggaattctca 18300 tattcggtgt agaacccaat ggtaccggtc ctgcaacacc aacgccgaaa on 25 ccgtccgtaa page 18360 201122105 atccttcacc ttcacctacg ccaacatcgg atattcttta cggtgacatc aatctggacg 18420. gaaaaattaa ctcttcagat gttacactgt taaaaagata tattgtgaag tccatagatg 18480 ttttcccaac cgctgatccg gaacggagct taatagcatc agatgtaaac gga gacggaa 18540 gggtaaactc tacagactat tcatacctta aacgttatgt cttgaaaatc ataccaacca 18600 tacccggaaa ttcatgacac taggtgaggg gaagatggag agaatggtaa aaagcagaaa 18660 gatttctatt ctgttggcag ttgcaatgct ggtatccata atgataccca caactgcatt 18720 ciicaggtcct acaaaggcac ctacaaaaga tgggacatct tataaggatc ttttccttga 18780 actctacgga aaaattaaag atcctaagaa cggatatttc agcccagacg agggaattcc 18840 ttatcactca attgaaacat tgatcgttga agcgccggac tacggtcacg ttactaccag 18900 tj? aggctttc agctattatg tatggcttga agcaatgtat ggaaatctca caggcaactg 18960 gtccgaagta gaaacagcat ggaaagttat ggaggattgg ataattcctg acagcacaga 19020 gcagccgggt atgtcttctt acaatccaaa cagccctgcc acatatgctg acgaatatga 19080 ggatccttca tactatcctt cagagttgaa gtttgatacc gtaagagttg gatccgaccc 19140 tgtacacaac gaccttgtat ccgcatacgg tcctaacatg tacctcatgc actggttgat 19200 ggacgttgac aactggtacg gttttggtac aggaacacgg gcaacattca taaacacctt 19260 ccaaagaggt gaac Valley ggaat ccacatggga aaccattcct catccgtcaa tagaagagtt 19320 caaatacggc ggaccgaacg gattccttga Tttgtttaca a aggacagat catatgcaaa 19380 acagtggcgt tatacaaacg ctcctgacgc agaaggccgt gctatacagg ctgtttactg 19440 ggcaaacaaa tgggcaaagg agcagggtaa aggttctgcc gttgcttccg ttgtatccaa 19500 ggctgcaaag atgggtgact tcttgagaaa cgacatgttc gacaaatact tcatgaagat 19560 cggtgcacag gacaagactc ctgctaccgg ttatgacagt gcacactacc ttatggcctg 19620 iitatactgca tggggtggtg gaattggtgc atcctgggca tggaagatcg gatgcagcca 19680 cgcacacttc ggatatcaga acccattcca gggatgggta agtgcaacac agagcgactt 19740 tgctcctaaa tcatccaacg gtaagagaga ctggacaaca agctacaaga gacagcttga 19800 attctatcag tggttgcagt cggctgaagg tggtattgcc ggtggagcaa ccaactcctg 19860 iiaacsgtaga tatgagaaat atcctgctgg tacgtcaacg ttctatggta tggcatatgt 19920 tccgcatcct gtatacgctg acccgggtag taaccagtgg ttcggattcc aggcatggtc 19980 aatgcagcgt gtaatggagt actacctcga aacaggagat tcatcagtta agaatttgat 20040 taagaagtgg gtcgactggg taatgagcga aattaagctc tatgacgatg gaacatttgc 20100 aattcctagc gacctcgagt ggtcaggtca gcctgataca tggaccggaa catacacagg 20160 caacccgaac ctccatgtaa gagtaacttc tt acggtact gaccttggtg ttgcaggttc 20220 acttgcaaat gctcttgcaa cttatgccgc agctacagaa agatgggaag gaaaacttga 20280 tacaaaagca agagacatgg ctgctgaact ggttaaccgt gcatggtaca acttctactg 20340 ctctgaagga aaaggtgttg ttactgagga agcacgtgct gactacaaac gtttctttga 20400 gcaggaagta tacgttccgg caggttggag cggtactatg ccgaacggtg acaagattca 20460 gcctggtatt aagttcatag acatccgtac aaaatataga caagatcctt actacgatat 20520 agtatatcag gcatacttga gaggcgaagc tcctgtattg aattatcacc gcttctggca 20580 tgaagttgac cttgcagttg caatgggtgt attggctaca tacttcccgg atatgacata 20640 Page 26 201122105 taaagtacct ggtactcctt ctactaaatt atacggcgac gtcaatgatg acggaaaagt 20700 taactcaact gacgctgtag cattgaagag atatgttttg agatcaggta taagcatcaa 20760 cactgacaat gccgatttga atgaagacgg cagagttaat tcaactgact taggaatttt 20820 gaagagatat attctcaaag aaatagatac attgccgtac aagaactaa 20869

Page 27

Claims (1)

201122105 VII, the scope of application for patents: solution of enzyme 1 complex bio-cellulose water, _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ The name of the gambling is, *, read the table when growing. 'The multi-cistronic performance card J includes: U) the promoter; and the state suffering f sequence, which is operatively connected to the promoter, ίίΪΓ and 编淡_ Decomposing a plurality of decompositions of the unit ^ ^, the complex _ points _ nuclear microphase system is sequentially arranged in the polycistronic nucleus, the number of decomposing enzyme subunits in the promoter control The order is consistent with the above natural ranking order. In the row, the tussah silkworm 2 white 2 please surround the first item of the cis-transformation of the genus. The woody protein-human early sputum includes one or more first-type binding domain^, etc., several decomposition enzymes The unit includes a first-type ^ domain ^= ==d_n), wherein the first-type bonded domain and the first-type 敕-domain are mutually interchangeable, and the multi-cistronic performance of the first application of the patent scope is set today. ',, fiber; vitamin hydrolase complex step - including cell surface _ white, "(cell surface anchoring protein subunits), X white code - cell surface tin-fixed protein subunit cell surface tin fixed egg 4. = Patent No. 3 of the patent scope cis-activator surface 跋 protein sub-single-- or multiple second-type adhesion 201122105 cohesive domains), the scaffold protein further includes type π dockerin domains Wherein the second type of binding domain and the second type of anchoring domain can be combined with each other. 5. The polycistronic performance of the first aspect of the patent application is characterized in that the microorganism is selected from Clostridium thermocellum, Clostridium faecium (C*. ce//w/ownms), Clostridium cellulosum (C·ce/Mo/rushing 'cmw), lysine Bacteria (C., Trichoderma longissima (7>7\:/2〇<^772<3. longibrachiatum)' contains the fluoride (Baceroides cellulosolvens), Vibrio anguillarum, rumen fungus N-type Bacteria {Nepcallimastix frontalis) 'Bacillus cerevisiae QPiromyces spp) 'Huge, Bacillus (5flcz7/(10)meg her r/wm), Bacillus licheniformis, Bacillus licheniformis (Parts (10)·// (10)), Rhizoctonia solani (T^mzViococo^), and Vibrio anguillarum (such as \7 plus / 〇 < ^ / / « / 0 / rush '<: secretion) group One of them. 6. The polycistronic performance card of the fifth paragraph of the patent application scope, wherein the microorganism is Clostridium thermocellum. 7. If the polycistronic performance card of the sixth application patent scope, Wherein the scaffold protein subunit is CipA. 8. The polycistronic expression cassette of claim 7 wherein the plurality of decomposition_subunits include exoglucanases Ceis and CelK, endoglucanase (en〇giucanases) ceiA, and polyxyxyases (xylanases) XynC and Xynz. >9. The polycistronic expression of the eighth aspect of the patent range is characterized in that the nucleotide sequence of the dissociation enzyme encodes Cels, CelK, CelA, XynC and Xynz in sequence. 10. The polycistronic nucleotide sequence of claim 9 wherein the polycistronic nucleotide sequence encodes CipA, CelS, CelK, CelA, XynC and Xynz in sequence. 11. The polycistronic performance card g as claimed in claim 3, wherein the microorganism is Clostridium thermocellum. 12. If the polycistronic performance card of the third paragraph of the patent application is applied, the 201122105 protein subunit is CipA. The cell is determined to be a multi-cistronic expression card E, wherein the group of the early readings is selected from the multi-cistronic performance card of the 13th item of the patent model 11 by Qin, sdbA and (10)p, wherein The cleavage subunit includes exoglucanase CelS and CelK, endo-CeC (C)R and CelA, and polyxylase and Xynz. The multi-cistronic expression card 11 of the eightth item of JiLUt Patent No. 11 in which the Ζ ^ 吹 blowing sequence is sequentially encoded by CelK, CelS, CelR, CelA, XynC and XynZ.帛 15 items of Spicy Anti-Sisters, in which the cell surface anchorage protein subunit is SdbA. The multi-cistronic performance card 11 of the ninth patent range, wherein the anti-nuclear technology paste sequentially encodes αρΑ, ωκ, (10), (10), SdbA, CelA, Xync, and xynZ. 19. ^ The polycistronic expression of the 18th patent application area, in which the cell surface anchorage protein subunit is SdbA. .丨 盾 2 and 0 · Early benefit range item 19 of the multi-cistronic performance card 11, wherein the cis-trans-sub-nucleus is in sequence, and the J-series encodes cipA SdbA, CelK, CelR, and Cds in sequence. Υ t21. t The polycistronics of the 13 patent application scope are light, and the subunit of the cell surface tin 疋 protein is 〇 lpB. Start 2 sub- 2 is 6 (4) good pay, of which 2 more than 3 cis-cards include as in the scope of patent application Nos. 1 to 22 - 24. - Host cells - which include the scope of patent application In the item 201122105, the body 25.25 subtilis) The host cell of the 24th item is temperate. . The monthly host cell of 24 patents, which is a method of Bacillus subtilis (and the host cell culture of the hydrolytic enzyme trend can express the fiber 细 娜 酶 enzyme complex. Phytophthora uLi) The host cell is a dry fiber, and the further step comprises the method of purifying the vitamin 29, wherein the step is the method using the fibrillation method 3 and the range 29 item 'where the step is 32 - A method for decomposing lignocellulosic biomass, please contact the host cell of the 24th H area in contact with lignocellulosic raw = = / above the application of the multi-cis anti-element = = = water; = contained in the complex a plurality of decomposing enzyme sub-tables including a vector comprising a polycistronic expression card (a) promoter; and (8) a genus (four) acid sequence, which is ligated to initiate cleavage, the cis-trans nucleoside The acid sequence includes a plurality of cleavage nucleoside cleavage sequences encoding the scaffold protein, and the number of the cleavage enzymes, wherein the positions of the plurality of cleavage enzyme nucleotides are sequentially sequential. In the 彡 sub-core I _ = in the plurality of decomposing enzyme subunits Under the control of the promoter, the number of the decomposing enzymes is determined by the promoter. The vector is introduced into the host cell and cultured in an appropriate environment to express the aforementioned plurality of decomposing enzymes. A subunit in which the amount of expression between the plurality of decomposing enzyme subunits is formulated such that the content ratio between the plurality of decomposing enzyme subunits on the cellulolytic enzyme complex is thus formulated.