TW201102434A - DNA microarray for identifying Phellinus species and method using the same - Google Patents

Abstract

The developed oligonucleotide microchip for simultaneous, rapid identification of multiple crucial forest Phellinus pathogens was based on the DIG or biotin-labeled specific probes derived form ribosomal DNA genes (ITS1-5.8S-ITS2), by using reverse-dot hybridization. The chip can precisely and accurately identified and diagnosed seventeen Phellinus species, including notorious hardwood and conifer tree killer, P. noxius and P. weirii, with a sensitivity of 1 pg DNA/ μ l on Nylon membrane, and 100 fg DNA/ μ l on plastic chip, respectively. Verification and identification of forest Phellinus pathogens infested authentic samples or voucher specimens can be accomplished within 7 hr.

Description

201102434 VI. Description of the Invention: [Technical Field] The present invention relates to a biochip and a detection method for identifying a genus of fungi, and more particularly to a biochip and a detection method for identifying different strains of the genus Caenorha. [Prior Art] There are about 80,000 species of fungi known, of which about 8,000 are plant pathogens. • Can cause various types of diseases in various agronomy, horticulture or forests, and some diseases even cause food famine. A large number of forest trees have died. Therefore, how to quickly, accurately and sensitively diagnose the pathogens of fungi, to take appropriate and effective control measures to reduce the loss of life and property and to improve the welfare of the whole people is an urgent task. Phem_noxius of the genus Pheliinus is especially a fungal pathogen that is notorious and is considered a forest killer. The bacteria infects the roots and stems of the forest, causing the decomposition and decay of the tissues, and finally the whole plant is dead. It has been reported in Asia, Africa, New Zealand and Australia, and has been reported to have infected at least 14 in recent years. Different kinds of forests, including the trees, fruit trees and afforestation trees, cause acute or chronic atrophy, landscape damage, economic loss and environmental problems. In addition, the genus Pythium genus (the other members of p-heart milk · ^) is like a layer of rot fungi of different species (P secret 娜 ,, p Gu 〇 or belong to the genus of fake honey ring (Arm-ie (four) child meUea (Pseudomonas aeruginosa), or Armillaria (4) attached to Qin (4) a _) and other forest fungal pathogens, also reported in the United States and Canada, New Zealand and Australia, Europe and other places infected with many coniferous trees or woven trees 'cause growth Poor, weak, deciduous, early flowering, decay, 201102434 Withering and lodging have become a major limiting factor and a serious threat to forestry management. The diagnosis of traditional plant diseases is based on Koch's postulates, which are generally caused by rickets The lesion (lesi〇n) separates, identifies the pathogen, propagates it, and returns to the healthy plant to produce the same disease and disease, and then separates and verifies the relevant pathogens. This is the process of reconstructing and verifying the disease cycle. Obviously, the identification of pathogens is the main axis of disease diagnosis. Traditionally, the characteristics of microscopic or macroscopic forms, structures, and sp〇regenesis of pathogenic fungi have been the main basis, but these types must be correctly identified. Color, the construction of complex fungi, in addition to familiarity with various types of differences, still need long-term study, education and training, administrative operations and experience accumulation, is not easy. In recent years, the rapid progress of molecular biology, in the identification In terms of plant pathogens, there are significant classification progresses and breakthroughs, such as amplified DNA fragment length polymorphism (AFLP), rapid amplification of polymorphism (what is ^ρΐ^Μοη 〇f) DNA seiected characterized amplified region of DNA (SCAR)] nano-magnetic bead polymerase ehain_tion (NMB-PCR)] multi-package polymerase chain reaction (multi_plexPCR) , Microsphere-Based Array... and other technologies, but as of 2009, no one can be used to quickly diagnose brown root rot fungi that are seriously endangered by forests (family calendars and close relatives of fungal pathogens) The method makes the domestic and foreign quarantine units lack the monitoring and rapid and accurate diagnosis of the fungal pathogens of these plants, and the early signs caused by these pathogens follow There are many variations in the breeding habitat, plant growth, age of the tree or the infection potential of the pathogen, and even the initial symptoms are not obvious, and the difficulty of correct identification is increased. If the early diagnosis and rapid identification of 201102434 is detected, it is the prevention and control of such diseases. The development of rapid, accurate diagnosis and identification technology has become an urgent issue in the breeding, afforestation and breeding habitats. SUMMARY OF THE INVENTION The intemai transcribed spacer (ITS) of all biological species has a highly repetitive sequence. The present invention mainly utilizes 18S, ITS1-5.8S-ITS2 ' 28S. A differentially designed oligonucleotide probe that together constitutes an operon repeat sequence. ITS1 and ITS2 are internal transcribed regions. This sequence can be spliced when rRNA transcribes rRNA (mRNA), so it has no function, and is called pseudo intron. It has high variability. The adjacent 58S, 18S, and i8S rRNAs have transcriptional functions and are relatively conservative, so the variability is low. Because _α(γΙ)Να) has the dual characteristics of variability and conservation, it can be more or less The sequence difference is the objective reference standard for the classification of the species, the species, the genus, and even the genus. The difference of the _HDNA paste, combined with the polymerase chain reaction (PCR), reversed membrane hybrid microarray (say, w〇t hybridization 'microarray) and other methods to engage in similar fungi Identification of species. The invention uses a universal primer, increasing the 'sequence, ratio, and analyzing the importance of the forest _ fungi, brown root rot (/) secret · smuggling 17 kinds of related forest fungi _, design needle (dig_deGtide pfQbe), with dig〇xigenin^^4«(biotin)#^ , #it^^#^.t^#^(reverse dot ♦—on) 'by a specific probe The color reaction' can accurately and sensitively detect and identify these important counties. The hair of the hair should be included in the micro-_ _ _ (mie_ (four), this 201102434 ” special probe points on the plastic wafer or nylon film (four) (10) coffee time (10) this) made micro-array U 曰 tablets with polymerase chain The reaction (pCR), which is the target nucleic acid of the forest pathogenic fungi, can be used together, quickly, accurately, and detect and identify the 17 important forest pathogenic fungi β. It is a nucleic acid probe for identifying different strains of the genus Caenorha. Another object of the present invention is to provide a biochip for identifying different strains of the genus Komodori. Another object of the present invention is Provided is a method for identifying different strains of the genus Caenorhas. The technical means adopted by the present invention for solving the problems of the prior art provides for the identification of different bacteria in the genus Phellinus. . apidhyrms, p. cesatn, p gHvus, Ρ. linteus ' Ρ. inrmis ' R laevigatus ' P. melleoporus ' P. membrance &gt; P. noxius ' P. pirii »P. quercinus ' P. ribis » P. formosanus ' P. igniarius * P. torw/oswi, P&gt;m&gt;77) (Table 1 a nucleic acid probe having the probe sequences of SEQ ID NO: SEQ ID NO: 2, SEQ ID NO: 3, SEQ Π) NO: 4, SEQ Π) NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 ( Table 2). Using the aforementioned 17 kinds of nucleic acid probes to establish a biochip for identifying the genus Caenorha, wherein the substrate used for the biochip can be a nylon membrane, a plastic substrate or 201102434, and other suitable materials such as broken glass. A further object of the present invention is to provide a method for detecting a fungus of the genus Phellinus using the biochip of the present invention comprising: 0) extracting deoxyribonucleic acid from a sample to be tested; (9) increasing the amount to be tested# The sequence of the internal transcribed region (4) of the 18S_28S paving nucleic acid gene of the product '· (6) using the biochip described in the patent scope 与! and the product obtained by the amplification of the step (9) for the hybrid reaction; (4) the reaction result of the detecting step (c) According to the silk of the squad and the ship of the squad on the U, it can be based on the location of the probe. Bacteria, fungal pathogens were identified which of the genus Phellinus infection test sample. The present invention can utilize the biochip or the probe of the present invention according to the technical means adopted by the present invention, and can quickly and accurately touch the forest tree by the technical means of the present invention, which has high accuracy and cost. The advantages of short time and easy operation are available for _ external defense quarantine conifers, reliance, forest, tender Lai _ check coffee f, gift silk, prevention, afforestation, management, decision-making applications. The biochip of the invention can be used for nursery, seedlings, parks, campuses, street trees, hiking and recreation (four) (four) leveling, testing, and health seedlings hall, and can be recorded (4) music touch correction surface _, forest tending, ecological control Take measures to decide on governance. L S] 8 201102434 The specific remuneration of the present invention will be further explained by the facts of the town and the accompanying drawings. The above described objects, features and advantages of the present invention will become more apparent to those skilled in the <RTIgt; Definitions • The “nuclear transcribed region (ITS)” as used herein refers to the transcribed region and non-transcribed region of rRNA encoding rRNA, particularly the ITS1 region between 18S and 58S, and 5.8S and The ITS2 region between 28S is often used to identify different fungal species within the fungus genus. The term "fungal pathogen" as used in the present invention is used herein to include a Phytopathogenic fungus which causes a plant disease in the genus Pseudomonas (the phytopathogenic fungus used in the present invention. Is a small single-stranded DNA fragment (ten to several hundred bases) used to detect complementary nucleic acid sequences. The "universal primers" used in the invention of the invention refers to the common use of wood layers. A nucleic acid primer for the rDNA of 18S to 28S of different species in the genus Pseudomonas. The term "biochip" as used herein refers to a gene chip, also known as a DNA microarray, that is, Nucleic acid sequence determination by hybridization with a set of nucleic acid probes of known sequence. "Nylon membrane wafer" as used herein refers to immobilization of a nucleotide probe on a nylon membrane (Nylon Membrane) substrate. Biofilm formed. The "plastic wafer" used in the present invention refers to a biochip formed by immobilizing a nucleotide probe on a plastic substrate of a plastic 201102434. Example 1 Collection of test fungal strains Purification culture see - ϋ (Α), (B), the first figure shows a schematic diagram of the probe design and biochip construction and application of the present invention, and the first figure (B) is a flow chart corresponding to the steps of the first figure (VIII). And collecting, purifying and cultivating the brown root rot pathogen and related pathogenic fungi of the genus Chlamydomonas (step 101). Test strains The strains used in the examples of the invention include, but are not limited to, 17 reference strains listed in Table 1. 'All members of the genus Pseudomonas (P; 2e//i«ws): Corpse (BCRC 35468) 'P cesatii (BCRC 35431) 'P gilvus (BCRC 35458) 'P. linteus (TFRI 1100 ) ' P. inrmis (BCRC 35430) ' P. laevigatus (BCRC 35495) »/! Calling melleoporus (BCRC 35429) ' P. membrance (BCRC 35411) »/! noxius (BCRC 35248) ' P. pirn (BCRC 35348) ' P. quercinus (BCRC 35352) ' P. ribis (BCRC 35326) - P. formosanus (TFRI 1129) ' P. igniarius (TFRI 1543 ) ' P. pachyphloens (TFRI 1131) 'P torulosus (TFRI 1132 ) , P. weirii (FP155613-A-Sp), respectively, by the Bioresource Collection and Research Center of the Republic of China Food Industry Development Institute (Bioresource Collection and R Esearch Centre (BCRC), Hsinchu) and the Taiwan Forestry Research Institute (TFRI) and the US Department of Agriculture's Wisconsin Division Forest Fungi Research Center (USDA Northern 201102434)

The important root rot strains obtained by the Research Station Center for Forest Mycology Research (Table 1). Table 1 shows 17 strains of the genus Caenoria obtained from the Food Industry Development Institute (BCRC), the Forestry Laboratory (TFRI), and the US Department of Agriculture's Wisconsin Division of Forest Fungi Research (USDA NRS).

Target Fungi Source and Strain code Phellinus apiahynus (Speg.) Rajch. et Wright BCRC 35468 Phellinus cesatii (Bresadola) Ryvarden BCRC 35431 Phellinus gilvus (Schweinitz) Patouillard BCRC 35458 Phellinus linteus TFRI1100 Phellinus inermis (Ellis: Everh.) Cunningham BCRC 35430 Phellinus lavegatus (Fr. ex Karst.) Bourd. et Galz. BCRC 35495 Phellinus melleoporus (Murrill) Ryvarden BCRC 35429 Phellinus membraneceus Wright et Blument BCRC 35411 Phellinus noxius (Corner) Cunningham BCRC 35248 Phellinus pini (Thore; Fries) Pilat BCRC 35384 Phellinus quercinus Bond , et Ljub. BCRC 35352 Phellinus ribis (Schumacher: Fries) Karsten BCRC 35326 Pheltinus igniarius (L.) Qu0l. TFRI1129 Phellinus formosanus TFRI543 Phellinus pachyphioens TFRI1131 Phellinus torulosus TFRI1132 Pheliinus weirii (Murrill) Gilbertson FP133613-A-SP Mycelial proliferation culture The collected strains were inoculated on a petri dish of potato dextrose agar (PDA) and cultured at 26 ° C for 7 days, followed by The mycelium can be scraped and collected for DNA extraction. Example 2 [S] 11 201102434 18S-28S ribosomal nucleic acid gene internal transcribed region (Internal transcHbed traitor, ITS) amplification and sequencing First, the mycelium obtained in step 101 is subjected to mycelial nucleic acid extraction ( Step 1〇2), the method is as follows: scrape the mycelium from the culture dish about O.lg into a microcentrifuge tube (epend〇r, add 500 μΐ CTAB buffer [ 2% CTAB ' 1.4 M NaCl ' 20 mM EDTA &gt; 100 mM Tris (pH 8), 2% PVP-40) (preheating 65 ° C)], grind using a tissue grinding rod, grind and add 3 W2-mercaptoethanol, shake and mix evenly, place 1 at 65 _2 〇 minutes, then add 500 μΐ CI (chloroform : is〇amylalcohol=24 : 1) gently mix up and down 'then' then centrifuge at 13,200 rpm for 2 minutes, remove the supernatant (about 500 μl) to the new microcentrifuge tube Add '300 μl (〇.6 times the volume) isopropanol to the top and bottom spin mix to precipitate the DNA, then centrifuge at 13,200 rpm for 2 minutes, carefully remove the supernatant, add 5 μμΐ of the wash buffer (76% ethanol) 10 mM ammonium acetate), shake gently and leave for 2 minutes to 13,200ipm After 2 minutes, remove the supernatant, dry it in a vacuum centrifuge (Labconco), add 200 μΐ ddH20 to dissolve it, add 〇”μι RNaes to remove RNA, and then use a universal primer pair (universal primer). Performing a polymerase chain reaction (step 103) 'The primer pair is: a reverse primer lTS4e (SEQ1DNO: 19; K5, -TCC TCC GCT TAT TGA TAT GCT TAA G -3,) and a forward primer iTS5e ( SEQ ID NO: 18) (5,- TTA GAG GAA GTA AAA GTC GTA ACA AGG TT -3,), co-amplifying the sequence of the ITS1-5.8S-ITS2 rDNA fragment of the species of the wood of the present invention. The polymerase chain reaction (PCR) process is as follows: 5 〇μΐ inverse m 12 201102434 volume (35.9 μΐ ddH2 〇; 5 μ) 10 times the reaction concentration buffer; 10 mM dNTP 1 μΐ; 10 μΜ ITS4e Primer 1.5 μΐ; 10 μΜ ITS5e primer 1.5 μΐ; Template DNA 5 μΐ; 1 unit Taq polymerase) was placed in a polymerase chain reaction thermal reactor (Bi〇metra T3 thermocycler) for amplification. The temperature reaction conditions were 94 ° C for 4 minutes; 941: 1 minute, 50 ° C for 1 minute, 72 ° C for 2 minutes (35 cycles), followed by 72 ° C, 7 minutes. The positive control group (p0Sitive control) is based on the growth of D. sphaeroides (J/Gagarujia (4) and the above method. After PCR reaction, electrophoresis analysis was carried out with 1% acacia to determine the presence or absence of pCR nucleic acid increase. The product 'finally preserves the PCR product at 4 ° C for sequencing. Use EasyPure PCR Clean Up/Gel Extraction to purify the kit (BIOMAN,

Scientific Co., Ltd.) ' Take 100 μΐ of the PCR product into a microcentrifuge tube, add wo's PG buffer, and mix well. The mixed liquid was placed in a centrifuge tube, and the centrifuge was placed in a collection tube, and centrifuged at 6, 〇〇〇 g (8, rpm) for 30 seconds to remove the liquid. Remove the centrifuge and place it in a new collection tube. Add 5 〇〇... of the washing buffer to the centrifuge tube to centrifuge with a desktop centrifuge at 6, § (8, 〇〇〇 ah). In the leap second, the filtrate was removed. The microcentrifuge tube was placed in a new collection tube and the sample in the tube was air dried by centrifugation at 2 knives at a maximum speed (14, _ ah). Transfer the air-dried centrifuge tube to a new microcentrifuge tube, add 15 μl of buffer (elmi〇n buffer) or set it to the sample, and place it for 2 minutes to make the extraction buffer or ddH2〇 as sample absorption. Then, centrifuge at the highest speed (14 〇〇 () φ Π 1) for 2 minutes. The transition product contains the amplified PCR product, which is placed in _2 〇. (: Save the spare. Refer to the second figure, which shows the electrophoresis results of the products obtained by the enzyme chain reaction of the genus Phaeoporus with the above-mentioned extensive primers. The first to the 14th rows are sequentially Household 13 t

201102434 noxius, R gilvus, P. laevigatus &gt; P. igniarius, P. robustus, R longisetulosus, P. melleoporus, P. apiahynus, P. cesatii, P. hoehnelii 'P-inermis, pini, P· quercinus, P. For ribis, the nucleotide product of about 7〇Q~75〇bp can be increased, and the 15th behavior is positive control of the nucleotides of the chlorophyll. In the embodiment of the present invention, the ITS1-5.8S-ITS2r DNA product of the ITS4 and ITS5 primer pair is amplified, and the sequence thereof comprises a small portion of the 28S posterior segment, and a short segment of the ITS1, 5.8S, ITS2 and 18S front ends. Since the ITS fragments are very similar in size, and a single fragment product is produced by PCR amplification via a broad primer pair, it is quite convenient in sequencing and operation. Next, the amplified nucleotides are sequenced, compared, and analyzed (step 1〇4) by the following methods: Colloidal nucleotide extraction The electrophoresis knee piece after electrophoresis is placed on a UV light box, and the ultraviolet lamp is turned on. The nucleotide bands on the film were visualized, the DNA fragment to be purified (about 300 mg) was cut from the film, placed in a microcentrifuge tube, and the above-mentioned EasyPure PCRCleanUp/Gel Extraction purification kit was used to add 500 μM PG buffer. 'Using the shock to evenly mix the solution with the rubber block, heat it at 55 ° C for 5 minutes, and invert it several times every 2 to 3 minutes until the gel is completely dissolved. The dissolved gel solution was placed in a centrifuge tube (Spin c〇lumn), and the centrifuge tube was placed in a collection tube and centrifuged at 6,000 g (8,000 φ Π 1) for 3 sec seconds to remove the filtrate. Then, the centrifuge tube was placed in a collection tube, and a centrifuge was added to the centrifuge tube to remove the filtrate. The centrifuge was centrifuged at M00g for 30 seconds to remove the filtrate, and then the centrifuge tube was placed in a collection tube at a maximum speed (14,000 rpm). Centrifuge for 2 minutes' to air-dry the sample in the test tube, transfer the air-dried sample 201102434 to a new microcentrifuge tube. Add '15 μl of buffer buffer or ddH20 to the sample' for 2 minutes to make the buffer or ddH2 The 吸收 is absorbed by the sample and centrifuged at the highest speed (14,000 rpm) for 2 minutes. The filtrate contains the purified PCR-grown nucleotide product, which is stored at -20 ° C for later use. Example 3 Oligonucleotide Probe Design As described above, the kit was purified using EasyPurePCR Clean Up/Gel Extraction, and the PCR amplified nucleotide product was directly purified or electrophoresed and then subjected to gel purification. The purified product was subjected to selection (p〇M) by pGEM-T Easy vector (Promega, WI, USA). The ligation was carried out according to the manufacturer's operating manual, and the joined product was transformed into [co/z·DH5ct. The blue-white colony screen (blue-white selection; Sambrook and Russell, 2001) was then used to select successful transformed strains (ci〇ne) and further confirmed by colony polymerase chain reaction (colony PCR). The confirmed strains were directly sequenced. The strains subjected to TA cloning were sequenced: sequencing using automated nucleic acid sequencer (Applied DNA Sequencer, Applied Biosystems, ABI 3730, Taipei, Taiwan), using BigDye Terminators fluorescent labeling, each sample consisting of The fluorescence photometer can be interpreted with the computer to interpret the lkb, and its accuracy is over 88.5 % of the interpretable length. Self-sequencing sequence, the sequence sequence was corrected by the ContigExpress function of the computer software Vector NTI 9.0 (Infor Max Inc., USA), and then AlignX was performed [S3 15 201102434 nucleotide sequence sorting alignment, after bacteria Sequences of various species within and between the same genus or different genus of related genus can be designed to have a sequence specific to the genus P. sylvestris (step 105). By designing the oligonucleotide probe from the comparison result, it is possible to design about 2 〇 6 6 base pairs, and the bonding temperature Tmtemperature is set at 55 to 65 ° C.

The nucleotide probe&apos; and the addition of 7 thymines at the 3' end of the probe (Thymine) can increase the sensitivity of the probe of the invention (pr〇be). In addition, with the relevant pure strains, PCR was performed with a forward primer in conjunction with the designed broad primer (ITS4) for m fragment amplification for sensitivity and specificity testing. When designing the probe of the present invention, it is necessary to pay attention to the three points of the town. (1) Avoid selecting a sequence with a too high gc ratio as a probe to eliminate the non-specific heterozygous reaction of the secret, preferably 4%%; (7) Avoid selecting multiple consecutive identical test sequences in the sequence (for example, 5 consecutive cell (Cytosin hetero) _ touch probes; (7) 戦 序 财 财 造成 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针...sequence analysis of the sequence of the sequence of the strains (including the title ITS2), using the computer software Vect〇11 y*° Gnfor Max Inc., USA) ^ Thief-function to correct the sequence of the sequence, then AHgnX For the sequencing of nucleic acid sequences, 17 specific probes were designed to identify the fungus of the genus Pseudomonas (P. sinensis). The n oligosaccharide probes are not labeled as SEQ ID. NO·: 1~17, the sequence and length are shown in Table 2. 16 201102434 {dq5^ os s s mses s s ms s s s s s s s s . Tile ridge Friends mechanically 2 Shu lacewing &gt;(§:;.? // ^ /) trained Hori ^ _4 "^ uorSHA ^ fsl4f male lilDDVS-mows-ulcmLDDSisls & vvsllllDV:} 13 ulsvJJJJUDivuDSDSVlllDDVWlDDWOEXLVSiDsliEuvis vaLLLDW.LLDUDlsvslsvDvllculrJiDisilvysblDiw USSVEXLDivwuD-LLLLOiloviwuvDWSUDVDJJJLDUVDVSDOS IvlwoLLOVUWSDSlEXLDVUWSDOWlsiDvlDvllDssomv ιδϋοαακΕχϋονο &amp; νοδϋοννιΰΰιιονυιΕΌΙΟνοιοννυδν lD9VJLOV11919SUJULDlDVu9: &gt; ws99wiwll9ivi9wuviu9ilv EJEOiEJEDVivz ^ wvssvsmslsviEJVliaLLDVDliDDDSis;}:} 13 sllvmvuilvllisuvillslovDVSDVOVSOVOVDVSVDWDlD l &lt; iDUB09w991ivl9ilosv9btl9i9wlvlv9wv919sl99v w9i99199v99w ° 919 \ ow99v9s9si9w9119sbw.LDVW: u Ixlou-moLwlaLDSVSWVDV & vsiwlwosvsvlllsDsil -oulwxsvDDWUDDSVVWSVli0 b9ivi9w9J_LLD99svwsiwx9.Dtl9vl9v99b9wsl9 &lt; 9v llllsvlDJ_u: owv9v9v99XDV911uius99vsi9vw9ilv99 ywH99s9w9vu911vullvli9b9illv: n991D9i9iivl9viwi Hsyby «uhEHO &lt; uu &lt;yo^yoyoo&lt;yy&lt;K&lt;uhEubuuuH^hG5 A Jd uostaql!9llll.unlAIr.c/a/M 3u///a5 Jo-d snsolnjal snuffld^d uedqd ^SOZMUaa 3C5^S Jo-d snuDSOLUJOfsfl Uffld^d UMIqd .-^30 ss^0^3φ-0-526-531-:-19^31^---^3-//35 anbLjd .qn IJa.pcos^nupJ^ntJsufffaLfd u!d£ 3C1S xouqd lueqMuluuro {JWUJO0) sn/xousn-/pi/c/ E3 Jd ;ualun5&quot;£--_J/v\ snauauojqilu snusa£ ιωιυιι11·u^PJe/VA^-ljJJnlAOSTIJOC/o'-ui Aezd snu-^qcf zleds.pJno^--Je^xaJ^^nJO/sdAofsnumLftf a-qd ε^ιίω-υυηυ-ψωΛω'ιι--'ια^·5'03·5/'5!^ u!zd sn-u!l Snunmd l!°°Md PJell!n01rad~z--u!a,§-cu-s:3/\//0,'o3c///,1J-cCL ssud 5050 a deqd£3μΜ Ϊ .Ipfs-sads Suxt/o/do ss//as 201102434 Example 4 Construction of Oligonucleotide Microarray Biochips Construction of Microarray Biochips (Step 106), Embodiments of the Invention Use Nylon Film Wafers' In addition, the implementation of the rewards;, the hair _ can use other suitable materials as the substrate of the wafer, the construction method is as follows: Preparation of a nylon membrane wafer (Nylon membrane array) preparation 96-well round chassis (ELISA plate) 'The present invention The probes listed in the second are mixed with the microarraytmcking dye in equal proportions, and each probe is added to the arranged holes. 'Each hole contains 20 μM probe and dye mixture (probe: dye = 1 μμΙ : 10 μΐ, the final concentration of the probe is 20 μΜ) using EzspotTM arrayer RA-300 (Yuesheng Technology) 'Taipei' Taiwan') Place each probe spot on a nylon membrane (p0sjtjvely charge (j, R〇che, Mannheim, Germany), each oligonucleotide probe at the position of the wafer as shown in the third figure (A ) as shown. The center distance between the point and the point is 800 μηι. The wafer size is 0.5 cm X 〇·42 cm and can be used for 6x5 points. The nylon film which has been finished and dried has been irradiated with ultraviolet light of 12 J energy (Stratagene, USA), and the finished nylon film wafer entity is shown on the left side of the third figure (B), where the probe position is from the top left to The lower right is followed by /&gt;, /! cesatii(Phces) ^P. gz7vwi(Phgil) &gt; P lmteus(?h\in) ^ P. inrmis {Phinr) Έ laevigatus(Ph\ao) ' P. Melleoporusi^hmoX) » P. membrance (Phmem) ' P. noxius(?hnox) ' P. pwz(Phpin) ' R quercinus(?hquG) ' P .r/6w(Phrib) &gt; P. formosanus(Phfor) ' P. ignianus(?hign) ' P. pachyphloens (Phpac) ' P. iorw/osiw (Phtor), corpse wez'nY (Phwei). In addition, it includes a positive control group (PC), a hybridization control (HC), a negative reaction pair 201102434 (negative control, NC), and a cross-type orientation marker (p0siti0n). Marker, PM). The probe of the positive reaction control group is a highly conserved 5 8S fragment sequence (5, one

ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGT TCTTCATCGATGC -3 '), the probe of the heterozygous reaction control group is the fragment sequence of the cgram//eto·graminicola KS domain gene, j ( 5’_

The GCTGTCATTTTGGGTACTGCCACCAACCACTCTGCCGATGCCATC TCCATCACCC -3')' negative reaction control group was an equal amount of sterile water, and the position was marked with digoxigenin (DIG) or biotin (biotin) labeled at 5, oligo-(dT)10. Preparation of the plastic wafer The probe is mixed with the probe buffer (pr〇be buffer, crystal biotechnology, Hsinchu, Taiwan) in equal proportions. The final concentration of the probe is 20 μΜ, and the prepared probe will be prepared. The company is commissioned by Jingyu Biotech Co., Ltd., and the wafers that have been ordered can be used directly. The probes used and the portions of the control group were distributed in the same position as the probes described above, and the completed plastic wafer entity was shown to the right of the third figure (Β). Example 5 Heterozygous reaction of oligonucleotide biochip 1. DNA extraction of forest sample The ricket forest was organized into the next small piece, liquid nitrogen was added, and it was ground into a powder, and about 1 g of powder was placed. Inside the microcentrifuge tube, add 500 μl CTAB (preheating 65. 〇, grind using a tissue grinding rod), add 3 μΐ 2- mercaptoethanol after grinding, shake and mix approximately 10 ° at 65 ° C, then add 500山19 [$3 201102434 CI(chloroform:isoamylalcohol=24:l), gently mix up and down, then centrifuge at 13 2 rpm for 2 minutes. Remove the supernatant (about 500 μl) and place it into a new microcentrifuge tube. In the middle, add 3〇〇μ1 (0.6 times the volume) isopropano b. Mix slightly up and down to rotate the ^8 precipitate, then centrifuge at 13,200 mark 1 for 2 minutes, carefully pour off the supernatant (pour into the waste tank), Add 5 〇〇 4 of wash buffer (wash buffer) 'Slightly shake and leave for 2 minutes, centrifuge at 13 2 2 for 2 minutes, remove the supernatant', drain it, and finally add 2 〇 0μ1 (1 (1Η2〇) Re-dissolve it (0.1 plRNaes can be added to remove RNA). 2. Increase the aforementioned forest bacterium to be tested ITS fragment of DNA (ITS1-5.8S-ITS2 rDNA fragment sequence) (step 107) When performing ITS fragment amplification, the primer sequences used are forward primer (ITS5e) and reverse primer (ITS4e), respectively, and at 5 The terminal is labeled with Digoxin (DIG) or Biotin. The reaction conditions of the polymerase chain reaction are shown in Step 1〇3, and no further description is given here. Reaction (Step 1〇8) ® (1) Hybridization of nylon membrane wafers. Add each nylon membrane wafer to 0.5x SSC [lx SSC 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0, 0.1% sodium dodecyl sulfate ( SDS)], wash twice at room temperature [rotational oscillation on the orbital shaker, 75 rpm 'same below], 2 minutes each time to remove the trace dye. At the same time, the forest species to be tested The PCR-amplified DNA was mixed with 2 μΐ of Co//e/oir/c/mw KS domain PCR product as a heterozygous reaction control group and added to 200 μΐ of the hybrid solution [hybridization solution, 5χ SSC, 1 % (w/v) blocking reagent (Roche), t 5] 20 201102434 〇·1% N-laurylsarcosine (Sigma) And 0.02% SDS]' was heated at 95 °C for 6 minutes to denature the DNA, and the double helix was unwrapped into a single strand, which was immediately placed on an ice bath to maintain it in a single strand state. Add the wafer and the denatured product to a 24-well cell culture dish (Techn〇)

Plastic Products, Trasadingen, Switzerland); 5 in a hybrid reaction tank. Helium, a heterozygous reaction was carried out at 120 rpm for 2 hours. The nylon membrane wafer after completion of the hybridization reaction was washed with 〇25χ SSC-0.1% SDS buffer at 58t: four times for 5 minutes each time to wash away the residual hybrid probe. Further, add 2,500-fold alkaline phosphatase anti-hair foxglove diluted with a filling buffer {1% (w/v) blocking reagent dissolved 鲁 in maleic acid buffer [0.1M maleic acid (Sigma) and 0.15 M NaCl]}. Fab fragments, Roche, Germany) [for target DNA calibrated with digoxigenin (Dig)] or Streptavidin-AP diluted 1000-fold with tamping buffer [for DNA labeled with biotin (Bi〇tin) The reaction was allowed to stand at room temperature for 1 hour (Dig system) or half an hour (Biotin system). Add 200μl ΜΑΒ Wash Buffer [MAB Wash Buffer, 0.3% (v/v)

Tween 20 in maleic acid buffer], wash twice at room temperature for 15 minutes, wash away Φ unbound antibody or Streptavidin-AP. 200 μl of detection buffer (detecti〇n buffer, 0·1 M Tris-HCl and 0.15 M NaCl, pH 9.5) was added for 1 minute at room temperature, and the detection buffer was removed. NBT/BCIP (nitroblue tetrazolium chloride/ 5-bromo-4-chloro-3_ indolylphosphate, Roche) was diluted 5 times in assay buffer and mixed evenly. Place the nylon in each well in a 24-well cell culture dish. The membrane was dropped into a 1 (8) μΐ mixture and allowed to react at room temperature for 3 minutes in the dark, and the reaction was not shaken. After the color reaction is completed, it is washed four times with sterile water, and the remaining NBT/BCIP on the film is washed. After coloring, the nylon film is placed on the filter paper and dried in an oven. Scan with a high resolution (3 〇〇〇如丨) 21 t S'] 201102434 scanner (Umax powerlook 3000, Taipei, Taiwan) to store images of the hybrid reaction. (2) Hybridization reaction of plastic wafers The DNA of the strain to be identified is amplified by PCR 4 μΐ and 2 μΐ of the KS KS KS KS KS KS KS KS KS KS 〇 〇 〇 〇 〇 〇 〇 〇 〇 〇 〇

The group ' together with 220 μΐ of the hybridization solution, heated at 95 ° C for 6 minutes, the DNA denatured 'double helix unwrapped into a single strand, and immediately placed on the ice bath for 10 minutes, so that the dimension is held in a single strand In the state, it was added to the plastic wafers ordered by Jingyu Biotech Co., Ltd. (Hsinchu, Taiwan), and the wafers were placed in a small supply box (DR. Mini Ovan, Jingyu) to 5 〇. The hybridization reaction was carried out for 1 hour at the maximum rotation speed, and the wafer after the completion of the hybridization reaction was added to a 22 μl 〇.25 χ SSC in a small supply tank at 58 ° C for four times '5 minutes each time to wash away the residual heterozygous. needle. Further, 2,500-fold diluted retinoic acid antibody (anti_digoxigenin_AP Fab fragments, Roche, Germany) (target DNA labeled with Digoxigenin) diluted with blocking reagent, or bl〇 Ddng reagem Φ Dilute 丨, 000 times StrePtavidin-AP (for target DNA labeled with Biotin), sit at room temperature, and react for 1 hour (DIG system) or half an hour (Bi〇tin SyStem). The unbound antibody or Streptavidin-AP was washed away by adding 220 μM washing buffer twice at room temperature for one minute. Add 220 μL of assay buffer to room temperature for 丨 minutes, then remove assay buffer. The NBT/BCIP was diluted 5 times with the detection buffer and mixed uniformly. A 100 μM mixture was added dropwise to each wafer, and the reaction was allowed to stand at room temperature for 3 minutes without shaking. The reaction was not shaken. After the color reaction element was formed, it was washed four times with sterile water, and the remaining NBT/BCIP of the wafer was washed, and the wafer was dried in an oven after coloring. 22 m 201102434 4. Hybrid reaction signal detection (step ίο% The result of hybrid reaction with nylon film wafer/plastic wafer can be directly interpreted by visual inspection. The cross mark on the wafer (PM) can separate the nylon membrane. For the four regions, a color reaction can be detected by a heterozygous reaction, and the position of the probe for the reaction can be detected. The positive reaction control group (PC) and the heterozygous reaction control group (HQ must have a reaction, indicating a reaction The whole process is sister, and the anti-Lin Zhao group (NC) should have no coloring ship, indicating that no false positive reaction occurs. Lu, the hybrid result of nylon film wafer, please refer to the fourth item, and the valve For the hybrid results of the wafer, please refer to the fifth figure. Regardless of whether a nylon film wafer or a plastic wafer is used, a unique signal can be obtained for members of the 17 species of the wood genus, and can be directly marked by a cross position. ), the type of the detected strain is directly identified by the signal presented. The results of the hybridization reaction of the nylon membrane wafer can be seen that the background is high, and it is easier to have fouling to produce 'they are consumed in the hybrid reaction process. The time is also longer, and the reaction results on the plastic wafer are clearer. 'There are few background values and stains. The reverse phase is also faster than the nylon film wafer. The performance of the biochip is more than one hour. Refer to the sixth figure (4) ~ (8), the sixth figure (4) shows the detection result of the probe sensitivity of the nylon film wafer's sixth test results of the probe recording of the wafer. Extraction of brown root rot (breast W _ • (4) (4) Acid is serially diluted (nuclear phytic acid concentration is 1 ng/μb in sequence. Her her 10 post, i willow, 1 〇〇 卜 i i i i i 23 23 23 23 23 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 'A nucleotide amplification reaction (see Figure 6 (A), (B) left electropherogram) by polymerase chain reaction (PCR) or the nucleotides after dilution of the sequence? 01 Increase the target gene (cut 1^ over 1)^^^, and then mix and match with the specific probe on the nylon film or plastic wafer (see Figure 6 (A) ~ (B) ' (4) nylon film wafer; (B) plastic wafer]. The results show that the sensitivity of the ITS product detectable by PCr is lOpg/μΙ. The sensitivity of the nylon film wafer is 丨ρβ/μ1, and the sensitivity of the plastic wafer is 100 fg/μΐ. It is known that the sensitivity of the biochip is better than that of PCR. Example 7 Detection and identification of fungal pathogens of rickets forest samples using biochips For the test results of the biofilm on the different forest tissues suspected of rickets, refer to the seventh picture. The forest test site will be notified of the forest tissue suspected of suffering from brown root disease (Micang Xiaolongyan tree, mulberry tree; Taiwan University Yushu, Taipei City Education University) Bodhi Tree, Taipei City Botanical Garden Eucalyptus), CTAB-Mini DNA extraction kit (CTAB-Mini DNA extraction) • After DNA extraction, PCR is performed directly to prepare the target DNA. Since the extracted DNA contains plant DNA and other fungal or bacterial DNA, a smear phenomenon occurs after PCR, but a specific fragment is produced around the expected 7 bp. These products can be heterozygously reacted with the porphyra microarray array to obtain a specific signal generation, and the position of the signal is also in conformity with the expected β wmk to be detected 'to confirm that the dead forests are Caused by brown root rot fungus p. The determination process in this embodiment can be completed in seven hours, and has good timeliness. 2. Determining the specificity of the biochip test results of the present invention 24 m 201102434 1. The nucleotide products of the diseased forest tissue are sequenced by PCR and then compared with the NCBI GenBank. As a result, see the eighth figure. In order to determine that the signal presented by the biochip of the present invention is correct, the aforementioned isolated Rhizoctonia solani (10) diagnosed by the biochip of the present invention is extracted with its nucleotide ' and polymerase chained with a broad primer pair. The reaction (PCR) was amplified, the amplified product was sequenced and subjected to T-Acloning and sent to the biotechnology company for sequencing. After obtaining the sequence, BLAST alignment was performed in NCBI GenBank. The results of the comparison have not been compared to Luzhou "&quot;(10)·5如沿'(10)' This is due to the fact that it is contained in NCBI's Genbank database, and there is no PAe still; ms «〇幻·(10) sequence It is stored. However, it can be compared with species such as forest decay fungi that are quite close to the relatives. 7 plus (10) ping to Shaokun/from (10), Phellinus laeviqatus &gt; Fuscoporia cinchoensis 'Pseudochaete tabacina) &gt; The e value and similarity are quite high, so it is speculated that the pathogen culvert infected by the forest disease sample is indeed brown root rot (P heart calendar. 3. Determine the pathogenic fungus of the biochip identification result of the invention by tissue culture. For the separation culture and type identification results, please refer to the ninth figure (A) ~ (B). In order to reconfirm the test results obtained from the biochip, the forest ricket plant tissue (Micang Xiaolongyan tree, mulberry tree, Taiwan University mulberry tree, Taipei) Municipal Education University Bodhi Tree, Taipei City Botanical Garden eucalyptus, etc.) After disinfection with 1% sodium hypochlorite, the tissue was cut open, and small pieces of tissue were placed in potato dextrose culture. Above, cultured at 25 ° C. From the results of the ninth figure (A), it was observed that after five days of culture, the hyphae had covered the entire culture dish, and brown silk filaments were produced. Further, the hyphae were picked up to Observed by a complex optical microscope, see Figure IX (B), the staghorn hyphae formed by the extension of hyphae can be seen. These patterns 25 201102434 are unique structural features of PheHimis noxius. The results of the diagnostic identification obtained from the wafer are completely identical, and it is confirmed that it can be used to identify and detect specific pathogenic fungi. From the description of the above examples, it is known that the intracellular nuclear transcribed region gene of the genus Pseudomonas (P-like imitation m«) is used. The difference of sequence, and the design of a unique probe, the construction of nylon membrane or plastic biochip, can accurately, quickly, detect and identify the genus Caenorhas, including the important conifer, broad-leaved tree killer, brown Root rot fungi (A secretion) and layer of rot fungi (household 17 kinds of fungi. The biochip of the invention can be used for early detection and certification of pathogenic fungi of domestic and foreign quarantine conifers or broadleaf trees, forest trees and seedlings, The present invention has been described in detail in conjunction with the accompanying drawings and embodiments. However, those skilled in the art can understand the present invention without departing from the present invention. In the spirit and scope of the invention, the invention may be modified and modified as needed. Therefore, regarding the definition of the scope of the invention, please refer to the attached patent scope. [S] 26 201102434 [Simple description of the diagram] First diagram (A The flow chart showing the steps of establishing the biochip of the present invention and performing related detection, the first figure (B) is a schematic diagram corresponding to the first figure (A); the second figure is a broad introduction of the wood layer The electrophoresis results of the products obtained by the polymerase chain reaction of the genus (household; ^//plus milk); the third diagram (A) shows the probe position distribution table of the biochip of the present invention; the second diagram (B) shows A physical diagram of the biochip of the present invention; ^ the fourth figure shows the hybrid result of the nylon film wafer; the fifth figure shows the hybrid result of the plastic wafer; the sixth figure (A) shows the probe of the nylon film wafer Sensitivity test result The sixth figure (B) shows the detection result of the probe sensitivity of the plastic wafer; the seventh figure shows the detection result of the different forest trees of the biochip of the present invention for suspected rickets, and the eighth figure shows the increase of the forest tissue The results of the latter products were compared with the genetic database of the American Institutes of Health. The ninth graphs (A) to (B) show the isolation culture and type identification results of the pathogenic fungi of the forest rickets. [Explanation of main component symbols] 201102434 Sequence Listing &lt;110&gt; National Taiwan University &lt;120&gt; Identification of biochips of the genus Komonia and methods thereof &lt;160> 19 &lt;170&gt; Patentln version 3.5

&lt;210> 1 &lt;211&gt; 53 &lt;212>DNA&lt;213&gt;Artificial sequence&lt;220&gt;&lt;223&gt; Identification of PheHinus apiahynus probe &lt;400&gt; 1 gtcttgtccc ctcttttcat aggagggggg ggaccagtct ttcaagctgg tat &lt;210> 2 &lt;211&gt; 53 &lt;212>DNA &lt;213&gt; artificial sequence

&lt;220&gt;&lt;223&gt; Probe for identifying cera/// &lt;400&gt; 2 taatagtatt gtggtggcca tttgctgtta ttcattgtta gaagcgggta acc &lt;210> 3 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Artificial sequence&lt;220&gt; 201102434 &lt;223&gt; Identification of probe of PAeWnwj·gi7vw5·&lt;400&gt; 3 ggattgaaag tcgaggcgca agtcttgact ggagagaaac ctttctacgt ttt 53 &lt;210> 4 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Artificial sequence&lt;220&gt;&lt;223&gt; Identify probes for PheHinus linteus

&lt;400&gt; 4 agagtcgaag ctggagtagt ctctgtaatc gaaacgggct tttgaagtat get 53 &lt;210> 5 &lt;211&gt; 28 &lt;212>DNA &lt;213&gt; artificial sequence &lt;220&gt;&lt;223&gt; Identification /«mwh probe

&lt;400&gt; 5 gttagtaaaa ggggcaagga gtaatcct 28 &lt;210> 6 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt;Artificial sequence &lt;220&gt;&lt;223&gt; Identification of PheHinus /avegafus probe &lt;400> 6 Ttgggcgttt aggaeggagt aatgagtaga aaggaggtgt aatgcttcca ttt 53 t S '3 2 201102434 &lt;210&gt; 7 &lt;211&gt; 53 &lt;212&gt; DNA &lt;2I3&gt;Artificial sequence &lt;220&gt;&lt;223&gt; Identification of corpse we//eopor M5· Probe &lt;400&gt; 7 tcaaacttaa ctcggttgaa gtggggggag gaacagtgca aggaggtggt gaa &lt;210> 8 9 &lt;211&gt; 53 &lt;212>DNA &lt;213&gt;Artificial sequence&lt;220&gt;&lt;223&gt; Identification probe &lt;400&gt;; 8 aggtcggtga aagatataag tgtctctgac gcttgtattg gaagccttcc tat

&lt;210> 9 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt;Artificial sequence &lt;220&gt;&lt;223&gt; Identification of probe of PheHinus noxius&lt;400&gt; 9 ctgaagagag agagggagag ggagagtggt ttattcgttt attcatttat teg &lt;210&gt; 10 &lt; 211 &gt; 53 &lt; 212 &gt; DNA &lt; 213 &gt; artificial sequence 201102434 &lt; 220 &lt; 223 &gt; identification of probe of pim · &lt; 400 &gt; 10 gccgtcgggg ttgactttgt tagtagtgtt tcgacgggaga agcatacggt egg &lt; 210 &gt; 11 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; artificial sequence

&lt;220&gt;&lt;223&gt; Identification of gwerc/wws probe &lt;400> 11 attgctacaa gtatgttaat aaggcgaacg cactcttttc ggtgttacta get &lt;210&gt; 12 &lt;211&gt; 53 &lt;212>DNA &lt;213&gt;

&lt;223&gt; Identification probe &lt;400&gt; 12 acgcaagtga gtcgtcagtt cccctaagtt gggagtgact tgatttgctt cgt &lt;210&gt; 13 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt; 201102434 &lt;223&gt; Probe &lt;400&gt; 13 agttggcggt tagtagtcgt aaggcgaaca cttgtcggcg aacacttcaa tat 53 &lt;210&gt; 14 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Probe for identification (10) &lt;400&gt; 14 ggggcgagac ctttgagttc gaagacagta gttctttttg caaatgtgag ggc 53 &lt;210> 15 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;&lt;223&gt; Identification of the probe for unloading p/z/oem&lt;400&gt; 15 aatctctggc cattggtgtc tttcattaga cgtcgacgtg cctttaactt tga 53 &lt;210> 16 &lt;211&gt; 53 &lt;212>DNA &lt;213&gt; Artificial sequence &lt;220&gt; 223> Probe for identifying PheHinus toru/osus 5 201102434 &lt;400> 16 cgtatgttgg gtcgatggaa ggtaaagctt tacggcggca tcttctttag gtc &lt;210&gt; 17 &lt;2il&gt; 50 &lt;212>DN A &lt;213&gt;Artificial sequence&lt;220&gt;;223&gt; Identification of the probe of imWi

&lt;400&gt; 17 gcacttttcg aagtctgtcg tcggctccca tttggagcag ctggaggttt &lt;210&gt; 18 &lt;211&gt; 29 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;&lt;223&gt; ITS5e primer &lt;400> 18 ttagaggaag taaaagtcgt aacaaggtt &lt;;210> 19 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt;Artificial sequence&lt;220&gt;&lt;223&gt; ITS4e primer &lt;400> 19 tcctccgctt attgatatgc ttaag

Claims (1)

201102434 VII. Patent application scope: 1. A biochip for identifying a genus of Phytophthora, comprising: a wafer substrate; a plurality of probes fixed on the wafer substrate, wherein the probe is selected from the group consisting of Including: SEQ ID NO: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 'SEQ ID NO: 10 ' SEQ ID NO: 11 ' SEQ ID NO: 12 ' SEQ ID φ NO: 13 ' SEQ ID NO: 14 ' SEQ ID NO: 15 ' SEQ ID NO: 16 ' SEQ ID NO: The oligonucleotide sequence of 17, its complement, degenerate sequences, and combinations thereof. 2. The biochip of the genus Komonia, as described in claim 1, wherein the wafer substrate is a nylon membrane. 3. The biochip of the genus Caenorhas genus (corpse/^/&quot;«milk) as described in the scope of claim 1, wherein the wafer substrate is a plastic substrate. 4. A method for identifying a genus of Phytophthora, comprising: • (a) extracting deoxyribonucleic acid from a sample to be tested; (b) increasing the internal transcribed region of the 18S-28S ribosomal nucleic acid gene of the sample to be tested (ITS) (c) using a biochip as described in claim 1 and a product obtained by the amplification of step (b) for hybridization; (d) detecting the result of the reaction of step (c). 5. The method of identifying the genus Caenori by the method of claim 4, wherein the primer used in the step (b) is calibrated with a digoxigenin (DIG). 201102434 6. The method for identifying the genus Caenorhas according to item 4 of the application scope, wherein the primer used in the step (b) is labeled with a biotin (Biotin). 7_ - 探针 楂 疋 疋 疋 洲 洲 洲 洲 洲 洲 洲 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 探针 。 。 。 。 。 。 8. A probe for identifying a c. species of the genus Caenorhas, which has the sequence shown in SEQ ID NO: 2, its complement or degenerate sequence. A probe for identifying a species of the genus Caenorhasporium (p/^/milk), wherein the probe has a sequence as shown in SEQ ID NO: 3, a complement thereof or a degenerate sequence. 10. A probe for the /z_her (10) species of the genus Pythium genus (/&gt;/祀/// dish 5), wherein the probe has the sequence set forth in SEQ ID NO: , its complementary sequence or degenerate sequence. 11. A probe for a genus of the genus Schizophyllum, wherein the probe has the sequence set forth in SEQ ID NO: 5, its complement or degenerate sequence. 12. A probe for identifying a nus 〖avegafus species of the genus Pfje^nus, wherein the probe has the sequence set forth in SEQ ID NO: 6, its complement or degenerate sequence. </ RTI> </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> </ RTI> <RTIgt; K. A probe for the identification of PheHinus membraneceus bacterium of the genus Pheninus, wherein the probe has the sequence shown in SEQ ID NO: 8, its complement or the 201102434 degenerate sequence. 15. A probe for the "αχ/(10) strain of the genus Pseudostellaria (P/ie/Z/wMs), wherein the probe has the sequence shown in SEQ ID NO: 9, its complementary sequence or And sequence. 16. A probe for identifying a species of the genus Corynebacterium (Hui/^/plus (10)), wherein the probe has the sequence set forth in SEQ ID NO: 10, its complementary sequence or Degenerate sequence. 17. The probe of the p/jellimis quercimts species of the genus phe [iinus], wherein the probe has the sequence shown in SEQ ID NO: 11, its complementary sequence or the % sequence of degeneracy . 18. A probe for a η·ό/·5 strain of the genus Rhizoctonia (10), wherein the probe has a sequence as shown in SEQ ID NCU2, a complement or a degenerate sequence thereof. 19. A probe for identifying a genus of the genus Caenorha, and a probe of the M&gt;s kiss (10) strain, wherein the probe has the sequence shown in SEQ ID NO: 13, its complementary sequence or And a sequence, a complementary sequence thereof or a degenerate sequence. 2〇· A probe for identifying P/?e//z&gt;msybmasa;ms·strains of the genus Komonia (////10), wherein the probe has the SEQ ID NO: 14 A sequence, a complement or a degenerate sequence. - 楂 Identification of the Phellinus pachyphloens of the Phellinus, wherein the probe has the sequence set forth in SEQ ID NO: 15, its complement or degenerate sequence. 22. A probe of the PheUinus torubsus bacterium of the genus Phellinus, wherein the probe has the sequence set forth in SEQ ID NO: 16, its complement or degenerate sequence 201102434. A probe for identifying a we/Nymosis species of the genus Caenorhas, which has the sequence shown in SEQ ID NO: 17, its complement or degenerate sequence.