TW201038590A - Antibodies specific for the protofibril form of beta-amyloid protein - Google Patents

Abstract

Isolated antibodies have been characterized which show specific affinity to a repeating conformational epitope of a protofibril form of the human β -amyloid peptide as compare to low molecular weight forms of β -amyloid peptide. These isolated antibodies and related pharmaceutically effective compositions may be useful in the therapeutic and/or prophykactic treatment of Alzheimer's disease by effectively blocking the ability of the protofibril form of β -amyloid peptide to form fibril forms linked with complications associated with Alzheimer's disease. The isolated antibodies of the present invention are also useful in various diagnostic assays and associated kits.

Description

201038590 VI. Description of the invention: [Technical field to which the invention belongs]

Alzheimer's disease (in the form of Alzheimer's with minimal or no detectable affinity I for diagnosis, treatment and/or prevention of disease) and the onset and progression of p-like amyloid deposits. [Prior Art] The β-based starch (Αβ) peptide is considered to be a pathogen causing Alzheimer's disease (“AD”) by forming insoluble Αβ-peptide fibrils and depositing such fibrils to form amyloid plaques. It is believed that the formation of such plaques in brain regions critical to memory and other cognitive functions causes dementia associated with the disease (see

Selkoe, 1994, J. V; 53: 438_447). The β_ amyloid peptide comprises a group of 39-43 amino acid peptides which are processed by a secretase and a γ-secretase, respectively, in an amine group and a thiol end protein hydrolyzed from a powder-killing precursor protein (ΑΡΡ). Come. There are at least five distinct isoforms of ΑΡΡ: 563, 695, 714, 75 1 and 770 amino acids (see Wirak et al., 1991 253: 323). This equivalent work isoform of APP is produced by alternatively splicing the primary transcript of the APP gene. Numerous misidentification mutations have been identified in App in families with somatically dominant early onset Alzheimer's disease. Some mutations cluster near the secretase cleavage site and affect App metabolism by increasing the yield or ratio of the Αβ form (eg Αβ42), which tends to be more fibrogenic than other forms and is more 139769.doc 201038590 faster . Neurotoxicity may be present in large molecular weight fibrils formed by aggregating soluble Αβ peptides into insoluble fibrils and subsequently incorporating fibrils into the amyloid plaques. The intermediate fibril form is in the form of a fibril (PF), a large molecular weight valency of the Αβ peptide, which is soluble in vitro and can be isolated in a form of about 67 〇 kDa. Thus, the formation of insoluble Αβ-peptide fibrils in vitro is the final result of the formation of a structurally unique soluble higher molecular weight primordial fiber. These temporary fibrillar structures are precursors of starch fibers that cause cell dysfunction and loss of sacral neurons in Alzheimer's disease (AD) and other protein aggregation diseases. Various treatments have been developed to try to prevent the formation of Aβ peptides, such as inhibitors that prevent proteolytic processing of APP. Similarly, immunotherapeutic strategies such as administration of anti-Aβ antibodies (to induce clearance of starch-like deposits) or immunization with Αρ peptide antigens (to promote humoral responses) have been sought to reduce plaque size and density. U.S. Patent No. 7,179,463 to Lannfelt et al. discloses the treatment of Azhai by administering antibodies raised against the Q-based fibrils of the Arctic Mutant (Arctic mutati〇n) group in the Αβ peptide coding region. The method of Mohs disease. An illustration of the antibodies produced is not provided in the specification and no comparison is provided regarding the affinity for the low molecular weight form of the Aβ peptide. U.S. Patent Nos. 6,761,888 and 6,75,324, both to Schenk et al., disclose a series of antibodies which recognize various epitopes along the AP42 amino acid sequence. The specific antibody to the N-terminal and central regions of Αβυ demonstrates the efficacy of reducing plaques both in vitro and in vivo. There is a current knowledge in the field of treating and preventing Alzheimer's disease, but there are still improved compositions and methods for treating and/or preventing this disease. 139769.doc 201038590 is needed. The composition and method of the present invention solves and satisfies this by revealing an antibody having a minimum detectable affinity for a low molecular weight form of Αβ peptide, which is specific for the octene (3 peptide) fibril, quasi-v-type specificity The pharmaceutically effective composition comprising the antibody will be suitable for the treatment and/or prevention of [3]-like amyloid plaque deposits known to be associated with the onset and progression of Alzheimer's disease. The invention relates to an isolated antibody which exhibits a specific binding to a conformational epitope of a powdery fibrillar form of the genus. The monomer of the wild type starch (Αβ) peptide has been It is known and shown herein as SEQ ID NO: 1. The isolated antibody of the present invention has an affinity for this repetitive conformation epitope of the larger molecular weight fibril form of octa, while exhibiting other forms of the Αβ peptide. (such as a monomeric or dimeric form of the Αβ peptide) with minimal or no affinity. The present invention also relates to a specific interaction with the conformational epitope of the 原β peptide in the form of a fibril form and exhibits a basis for the matter. Fibrous shape = structure An isolated antibody having a measurable affinity, wherein the basal fibril epitope is represented by an exposed region in the form of Αβ-based fibrils comprising an amine terminal of the exposed portion of the Αβ peptide. An isolated antibody having a measurable affinity for a conformational determinant-specific interaction with a ruthenium-based peptide-based fibril form and exhibiting a measurable affinity for a basal fibril-shaped 抗原-configuration epitope of Αρ-peptide The epitope is derived from the exposed region of the Αβ-based fibril form of the exposed portion of the Αβ peptide (SEQ ID NO: 2). The present invention also relates to a profibrillar form of the Αβ peptide. I39769.doc 201038590 An isolated antibody that binds to a specific interaction and exhibits a measurable affinity for a conformational epitope of the basal fibril form of the Αβ peptide, wherein the basal fibril epitope is derived from the exposed portion comprising the Αβ peptide The exposed regions of the Αβ-based fibril form of the amino acids 4-12 and 9-20 (SEQ ID NOS: 3 and 4, respectively) are represented.

The present invention is directed, in part, to any affinity matured form of monoclonal antibodies 13C3, 1D1 and 19Α6, and 13C3, 1D1 and 19Α6. The invention further relates to a 〇 antibody that mimics the functional specificity of 13C3, 1D1 and 19Α6 as described herein. For this purpose, the invention also relates to biologically active fragments and/or mutants of 13C3, 1D1, 19Α6 or 13C3-like, 1D1-like or 19Α6-like antibodies, including, but not necessarily limited to, amino acid substitutions (eg, such as VH or Affinity-maturation in the VL region), deletions, additions, amino-terminal truncation, and thiol-terminal truncation, such that the mutations are similar or modified versions of the 13C3, 1D1, 19A6 or 1 3C3-like antibody binding protein. Or the antibody binding moiety provides the basis. In an embodiment of this aspect of the invention, the VH and VL regions of 13 C 3 comprise an amino acid as set forth in SEQ ID NO: 7 (VH) and/or SEQ ID 〆 NO: 5 (VL), respectively. sequence. The invention further relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding a VH and/or vL region of a 13C3, 1D1 or 19A6 antibody; and, in particular, an isolated nucleic acid molecule encoding a biologically relevant portion of 13 C3 ( Polynucleotide), or an affinity matured version of the 13C3, 1D1 or 19A6 antibody or other mutant version. To this end, an embodiment of the invention relates to a nucleic acid molecule comprising 13C encoded as set forth in SEQ ID NO: 8 (13C3: VH region) and SEQ ID NO: 6 (13C3: VL region, respectively) 139769.doc 201038590 nucleotide sequence of VH and VL regions. The present invention is also directed to an isolated antibody, 丨3C3, Μ or 19Α6, as disclosed herein, i.e., a conformational epitope-specific interaction with the basal fibril form of the Αβ peptide and exhibiting a fibril for the Αβ peptide group. Formal conformational epitopes are antibodies with measurable affinity. The present invention also relates to a fusion tumor capable of producing a monoclonal antibody of the present invention. The specific fusion tumor of the present invention comprises a fusion tumor of the exemplified monoclonal antibodies 13 〇, 19 Α 6 and 1 D1, respectively. The present invention relates to a pharmaceutically effective composition comprising an isolated antibody as disclosed and further defined herein: a repetitive conformational epitope specific interaction with a fibril form of the base and exhibiting a The repeating conformation epitope of the fibrillar form has the ability to measure affinity and specifically bind to the repeating conformational epitope of the A-based fibril form, while exhibiting minimal or no An isolated antibody that measures affinity. Such compositions may optionally comprise one or more carriers, one or more excipients and/or one or more chemical derivatives. The invention also relates to a method of treating an individual suffering from Alzheimer's disease, wherein the individual is administered a pharmaceutically effective composition comprising the isolated antibody disclosed herein, ie, the isolated antibody Repeated conformation epitope specific interaction with the 原β peptide-based fibril form and exhibits a measured affinity for the repetitive conformation epitope of the 原ρ peptide in the fibrillar form, while exhibiting a lower molecular weight of the Αβ peptide for 7F Methods such as antibodies with minimal or no affinities will provide therapeutic intervention to reduce the amount of parenchyma deposits in the brain of individuals with Alzheimer's disease. The present invention is directed to a method for treating an individual having Alzheimer's disease, comprising administering a pharmaceutically effective composition formulated with an antibody, the antibody exhibiting Configuration antigenic determination of the fibrillar form of the Αβ peptide: specificity-affinity (as compared to at least the low molecular weight form of the Αβ peptide), especially where the basal fibril epitope is composed of an amine comprising an exposed portion of the Αρ peptide Exposed area of the repaired fibril form of the base acid l-2〇 (SEQ ID ΝΟ·· 2) = No. Specific examples of such therapeutic and prophylactic methods disclosed herein may utilize exemplary mouse monoclonal antibodies 13C3, 19Α6, ι〇ι, and affinity maturation patterns, chimeric antibodies, humanization of any such antibodies Antibodies, human monoclonal antibodies, and/or any of such antibody forms known in the art include, but are not limited to, antibody-binding members that are reviewed herein. Any such antibody or specific binding member may be referred to as a "13C3-like antibody" in this specification. Thus, "13(:3-like antibody) means also encompasses the 13C3 monoclonal antibody disclosed herein. The present invention also relates to screening and selection for fibrillation and/or senile plaque formation associated with Alzheimer's disease. A method of a compound of an inhibitor. The method comprises the use of an antibody having a 13C3-like characteristic (for example, a specific affinity for pF compared to the LMW form of the Aβ peptide) to select for regulation in various antibody/peptide/test compound interaction assays. Compounds of the fiber and/or plaque forming process. The invention further relates to a diagnostic assay for the specific determination of the fibril content in an individual or patient. Such assays can be performed by any technique known and available to the skilled artisan. Such techniques include, but are not limited to, Western blot, ELISA, radioimmunoassay, immunohistochemical assay 139769.doc 201038590, immunosuppression or other immunochemical assays known in the art. Accordingly, one embodiment of this aspect of the invention is directed to obtaining a tissue sample from an individual or patient and using a diagnostic kit and associated assay to determine the sample. The content of PF Αβ; wherein the kit contains 13C3-like antibodies, thus allowing specificity to determine the PF Αβ content in tissue samples. The tissue samples used for analysis are usually blood, plasma, serum, mucus or from individuals or patients. Cerebrospinal fluid. For this purpose, the antibodies of the invention can be used for at least the following purposes: (1) alone or in combination with any available combination therapy as a prophylactic or therapeutic agent for preventing or reducing plaque deposits associated with Alzheimer's disease (2) designing a peptide immunogen that can be used to elicit an effective antibody response in a prophylactic or therapeutic vaccination strategy associated with treating Alzheimer's disease; (3) producing a secret antigen that mimics the antibody of the present invention a deterministic or therapeutic anti-genetic antibody (Ab2); and '(4) a peptide derived from a complementarity determining region (CDR) of a neutralizing antibody of the invention for use in screening for prophylactic and/or A fibrillation inhibitor of a therapeutic regimen, and (5) a diagnostic reagent for determining the amount of serum or CSF-based fibril A{3 in a patient at risk of developing AD. It is an object to provide an antibody that specifically interacts with an exposed conformation epitope in the form of a fibril form of the A卩 peptide and exhibits an affinity for an exposed conformation epitope of the base fibril form of the Ap peptide, the exposed configuration The epitope comprises the amino acid of the exposed portion of the Αβ peptide. NO: 2). Another object of the present invention is to provide an exposed conformation epitope which is associated with an exposed conformation epitope of the Αβ peptide in the form of fibrils and exhibits a fibril form of octapeptide 139769.doc •10· 201038590 An affinity antibody that comprises an exposed portion of the amino acid 4-12 and 9-20 (8 卩 1 〇 NO: 3, 4) of the octapeptide. Another object of this is to provide a 13C3-like antibody that prevents or reduces the formation of Αβ-peptide fibrils associated with plaque deposition associated with Alzheimer's disease. Another object of the present invention is to provide assays for the use of 13C3-like antibodies to select compounds suitable for the treatment of plaque deposits associated with Alzheimer's disease in an antibody/peptide/test compound interaction assay. As used herein, "Ka" is intended to mean the association constant for a particular antibody antigen interaction 'Kd' is intended to mean the dissociation constant for a particular antibody-antigen interaction. As used herein, the term "antigenic determinant" or "antigenic determinant" refers to a site at which a B cell and/or tau cell on an antigen reacts or a site on which an antibody is raised and/or the antibody will bind. For example, an epitope can be identified by an antibody that defines an epitope. An epitope may be a "linear epitope" (wherein the primary amino acid primary sequence comprises an epitope; typically comprises at least 3 contiguous amino acid residues in a unique sequence and more typically at least 5 ' and up to about 8 Up to about 1 amino acid or a "configurational epitope" (the primary contiguous amino acid sequence is not the epitope of the sole determinant of the epitope). The conformational determinant may comprise an increased number of amino acids relative to a linear epitope, as this conformational determinant recognizes the three dimensional structure of the peptide or protein. For example, when a proteinaceous molecule is folded to form a three-dimensional structure, some of the amino acid and/or polypeptide backbone forming the conformational epitope are contiguous, allowing the antibody to recognize the antigen 139769.doc 201038590. Methods for determining the configuration of an epitope include, but are not limited to, xenon ray crystallography, two-dimensional nuclear magnetic resonance spectroscopy, and her-directed spin labeing and electron paramagnetic resonance spectroscopy. Example: See Epitope Mapping Pr〇t〇c〇Is in Meth〇ds & M〇iecu^r

Biology, Vol. 66, ed., Glenn E. Morris (1996), the disclosure of which is incorporated herein by reference in its entirety. As used herein, "specificity" between two entities means at least Μ6 Μ 1, ΙΟ7 Μ-ι, 1〇8 μ-, 1,〇9 Μ.^ι〇ί〇μ·, Affinity. As used herein, "base fibrils" are base fibril aggregates that appear to represent a cluster of spherical structures that form a curved structure, including a spherical structure comprising an indole beta peptide. The term "isolated" as used herein is used herein as it is used in the art. That is, the antibody/specifically binds to the state in which sputum, nucleic acid molecules, and the like exist. The antibody/specific-specific binding member and the nucleic acid knives will be free or substantially free of the substance to which they are associated, such as in their natural environment or their preparation environment (eg, cell culture) (when this preparation is Other polypeptides or nucleic acids in recombinant DNA technology (when in vitro or in vivo). "Separated" encompasses any form containing the identified and characterized components of the invention after removal from the initial environment. Examples (but of course not limiting) include pharmaceutical formulations with diluents, antibody/specific-binding members, nucleic acid molecules and their in vitro or in vivo modifications (eg, 'antibody glycosylation) and removed from the environment Part of the adjustment 139769.doc .12- 201038590

As used herein, the term "recombinant human antibody" refers to a "antibody" produced by various recombinant DNA techniques and a viable subset of non-human transgenic genes well known in the art. The method is for producing antibodies from one or a source: (i) an scFv* surrogate antibody isolated from a combinatorial human antibody library; (11) self-stabilized or transiently transfected into a host cell (preferably a mammalian host cell) Partial or complete antibodies produced by the respective expression vectors (for example, binding to the respective cH and cL nucleotide sequences to sub-select the nucleotide sequences encoding the % and V1 chains in the expression vector to facilitate display of the pair a PF form of a specific form of a specific antibody; and/or (iii) from a non-human transgenic animal containing a human immunoglobulin gene or by any other known human immunoglobulin An antibody that is "mixed and matched" with the recombination of other Dn a sequences to produce a recombinant human antibody of interest. The term "individual" or "patient" is intended to include any member of the chordae, including but not limited to humans and other primates, including non-human primates, such as chimpanzees and other baboon and monkey species; Farm animals, such as cattle and sheep, pigs, goats and horses, domesticated mammals such as dogs and cats; experimental animals, including rodents such as mice, rats and guinea pigs; birds and birds, including domestic, wild and for game birds Birds such as chickens, turkeys and other cockroaches* chickens, ducks, geese and the like. "Disease" refers to a regimen that can include administering one or more drugs to an individual (human or other) to alleviate the signs or symptoms of the disease. The mitigation may occur before and after the onset of symptoms or symptoms of the disease. Therefore, "treatment" includes "preventing" the disease. In the case of Alzheimer's 2 139769.doc -13- 201038590, 'prevention' can also occur in the case of advancing treatment to prevent or stop the onset of symptoms associated with Alzheimer's disease. In addition, "therapy does not require complete relief of signs or symptoms, no need for cure, and especially package 1 has a minimal positive effect on the individual. As used herein, the term "active ingredient" refers to the display. A 13C3-like antibody having affinity and specificity (e.g., specific binding) to the amino terminal portion of the p-type starch-based fibril structure. As used herein, the term "effective amount" or "pharmaceutically effective amount" of an antibody as used herein refers to an amount of an active ingredient that is non-toxic but sufficient to provide the desired biological result. The appropriate "effective" amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation. As used herein, the term "pharmaceutically acceptable" or "pharmacologically acceptable" means that the substance can be administered to an individual in a drug delivery device along with the formulated biological agent' without causing (4) undesirable organisms. Any component of the composition or composition contained therein (e.g., "pharmaceutically acceptable composition") interacts in a detrimental manner. As used herein, the terms "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" are used interchangeably and refer to a substance that does not cause significant irritation to the organism and does not abolish the administered compound. Carriers, diluents and excipients of activity and characteristics. Adjuvants are included under these phrases. As used herein, the term "excipient" refers to an inert substance that is added to a pharmaceutical composition to further facilitate administration of the active ingredient. The term "minimum affinity" when used to compare the affinity of an antibody for the fibril form of the Αβ peptide with other forms of the antibody to the 郸 peptide (such as fibrils, sheets 139769.doc 14 201038590-like structures and low molecular weight oligomers and singles) The affinity of the body indicates a ratio of affinity for the basal fibril Αβ form to affinity for other Αβ forms of greater than about 2. The ratio is preferably greater than about 3, or about 4, or about 5. [Embodiment] A starch-like precursor protein (ΑΡΡ) plays an important role in the pathogenesis of Alzheimer's disease (AD). The proteolytic processing of hydrazine by β-secretase and γ-secretase produces an Αβ peptide (Αβ) which is usually in the range of 39 to 43 amino acids in length. The onset of Alzheimer's disease is characterized by the accumulation of oligomeric or aggregated forms of Aβ in the brain. The immunological compositions of the present invention are useful in the treatment or prevention of Alzheimer's disease, as reagents for use in diagnostic assays, and as small molecule inhibitors for the design of starch-like deposits. The 13C3-like antibody of the present invention can be administered prophylactically to a general population of mammals, particularly humans, in a formulation that is expected to be pharmaceutically acceptable, in an amount and/or dosage regimen sufficient to eliminate, reduce or delay the onset of the disease. For individuals known to be at the genetic or family risk of Alzheimer's disease, the use of prophylactic treatment is particularly permitted. Numerous genetic markers for the risk of Alzheimer's disease have been identified, including (but not limited to) ΑΡΡ mutations (eg, Indian mutation (Val717Phe), Swedish mutation (Lys670Asn, Met671Leu), Hendrick Hendricks mutation (Ala692Gly), Dutch mutation (Glu693Gln), Iranian mutation (Thr714Ala), German mutation (Val715Ala), and Florida mutation (Ile716Val) ). Other mutations that may indicate an increased risk of Alzheimer's disease include mutations in the presenilin genes (PS1 and PS2) and ApoE4. The present invention is also directed to a medicinal drug comprising a 13C3-like antibody to an individual currently suffering from 139769.doc 15 201038590 Alzheimer's disease (identified by characteristic dementia), particularly in the presence of the above risk factors or having suffered from the disease. The composition received is therapeutically administered in an amount sufficient to cure or at least partially arrest the symptoms and complications of Alzheimer's disease. Methods based on prophylactic or therapeutic treatments encompassed herein can be used to address early-onset or late-onset Alzheimer's disease. In view of the importance of the oligomeric form of Aβ in the onset of Alzheimer's disease, the present invention relates to an isolated antibody that specifically interacts with the repetitive conformation epitope of the 原β peptide in the form of a fibril form and exhibits Repeated conformation epitopes in the form of fibrils of the Αβ peptide have measured affinities. The monomer of the wild type Αβ peptide (Αβ42; the form of 42 amino acids) is known in the art and is shown herein as SEQ ID NO: 1 :

Asp Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His His Gin

Lys Leu Val Phe Phe Ala Glu Asp Val Gly Ser Asn Lys Gly Ala lie lie Gly Leu Met Val Gly Gly Val Val lie Ala (SEQ ID NO: l) 经 The isolated antibody of the present invention will exhibit a larger molecular weight for the Αβ peptide The repetitive conformational epitope of the oligomeric fibril form has affinity while exhibiting minimal affinity for other forms of the Αβ peptide, such as low molecular weight monomers and dimers. The present invention is also directed to an isolated antibody that interacts with a conformational epitope of the fibril form of the Aβ peptide and exhibits a measurable affinity for a conformational epitope of the fibril form of the Aβ peptide, wherein The fibril epitope is represented by an exposed region in the form of an Aβ-based fibril comprising an amine-terminal portion of the exposed portion of the Aβ peptide. 139769.doc -16- 201038590 The invention further relates to an isolated antibody which specifically interacts with a conformational epitope of the Αβ peptide in the form of a fibril form and exhibits a conformational antigen to the basal fibril form of the Αβ peptide The substrate is determined to have a measurable affinity, wherein the fibril epitope is represented by an exposed region of the Αβ-based fibril in the form of the amino acid 1-20 (SEQ ID NO: 2) comprising the exposed portion of the Αβ peptide:

Asp Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His His ' Gin Lys Leu Val Phe Phe (SEQ ID NO: 2) As exemplified herein, it has been identified that a fibril (PF), especially for the Αβ peptide, has been identified. The form has a specific affinity and simultaneously displays mouse monoclonal antibodies with minimal affinity for the low molecular weight species of the Αβ peptide. The dimeric form of Αβ (about j 5 kDa) polymerizes over time to form a soluble PF form having a molecular weight of 〇β of about 67 〇 kDa. Mice were immunized with this higher molecular weight PF Ap. Individual antibodies were screened for their specificity for the high molecular weight PF form of octapeptide while exhibiting minimal or no ability to bind to the lower molecular weight form of Αβ. This portion of the invention screens, isolates, and characterizes UC3 series monoclonal antibodies (i.e., 13C3, 1D1, and 19A6) produced in the form of about 67 〇 kDa high 分子量 molecular weight fibrils of Αρ peptide. This series of monoclonal antibodies demonstrates predetermined in vitro specificity in the transgenic mouse Alzheimer's disease, and also reduces Alzheimer's-related plaque formation. Thus, in a particular embodiment of the invention, the isolated antibody specifically interacts with the conformational epitope of the Αβ peptide in the form of a fibril form and displays a conformational epitope of the fibrillar form of the Αβ peptide Having a measurable affinity, wherein the fibril epitope is from the ♦-based fibril form of the amino acid 4_12 (clear m ν〇: 3) and 92 〇 (SEQ ID ΝΟ: 4) comprising the exposed portion of the Αβ peptide The exposed area indicates: 139769.doc -17- 201038590

Phe Arg His Asp Ser Gly Tyr Glu Val (SEQ ID N〇: 3) . Gly Tyr

Glu Val His His Gin Lys Leu Val Phe Phe (SEX ID N〇: 4) An embodiment of the invention pertains to an antibody comprising VH (SEQ ID NO: 7) and/or VL as disclosed in relation to 13C3 (SEQ ID NO: 5) region to confer 13C3-like specificity for PF compared to the LMW form of the Aβ peptide. Another embodiment is a 13C3-like antibody or a biologically relevant fragment thereof that exhibits specificity for the PF form over the LMW form of the Aβ peptide. Thus, the invention also relates to biologically active fragments and/or mutants of 13C3, 1D1, 19Α6 or 13C3-like antibodies including, but not necessarily limited to, amino acid substitutions (eg, as a site for affinity maturation of the VH or VL regions) Forms, deletions, additions, amino terminal truncations, and carboxy-terminal truncations provide a basis for such mutations to produce similar or modified versions of antibodies or antibody binding portions of 13C3, 1D1, 19A6 or 13C3-like antibody binding proteins. As described herein, one embodiment of this aspect of the invention pertains to vH and/or such antibodies comprising an amino acid sequence as set forth in SEQ ID N: 7 and/or SEQ ID NO: 5, respectively. Or VL area. The present invention contemplates the presence of codon redundancy that can produce different molecules that represent the same antibody or portion thereof (e.g., 'alternative nucleic acid molecules encoding the same scFv or IgG % and/or VL portion). For the purposes of this specification 'a sequence with one or more permuted codons will be defined as a degenerate variation. Another source of sequence variation can occur through RNA editing. This RNA editing can result in another form of codon redundancy' where changes in the open reading frame do not cause alterations in the amino acid residues in the expressed protein. Also included within the scope of the invention are mutations in the DNA sequence or in the translated antibody that improve the final physical properties of the expressed antibody. For this purpose 139769.doc -18- 201038590

'The present invention relates to an affinity matured version of (1) 13C3, 1D1, 19A6 or any other such 13C3-like antibody, and/or (1) a mutant form of 13C3, 1D1, 19A6 or any other such 13C3-like antibody, including (but not Limited to one or more mutations in the CDR1, CDR2 and/or CDR3 regions as produced by known affinity maturation methods and recombinant DNA techniques known to introduce site-specific mutations. Therefore, the isolated antibody of the present invention is an antibody which specifically interacts with a conformational epitope of the basal fibril form of the Αβ peptide. The isolated antibody of the present invention will exhibit affinity for this conformational epitope of the larger molecular weight fibril form of the Aβ peptide, while exhibiting other forms of the Aβ peptide (such as fibrils, lamella structures, and low molecular weight oligos). Polymer and monomer) have minimal affinity. The invention also relates to isolated monoclonal antibody 13C3. This part of the invention is also directed to the production of a fusion tumor of monoclonal antibody 13C3. The fusion cell producing monoclonal antibody uc3 can be obtained by ATCC accession number ρτΑ_883〇. The invention also relates to isolated monoclonal antibody 1D1. This part of the invention is also directed to the production of a fusion tumor of monoclonal antibody 1D1. The invention also relates to isolated monoclonal antibody 19A6. This part of the invention is also directed to the production of a fusion tumor of monoclonal antibody 19-8. The invention is also directed to methods of screening and selecting compounds that act as inhibitors of fibrils and/or senile plaque formation associated with Alzheimer's disease. This method involves the use of antibodies having a 13C3-like affinity for the PF form of the peptide in various antibody/peptide/test compound interaction assays to select for compounds that modulate fibril and/or plaque formation processes. The compound may be a non-proteinaceous organic or inorganic molecule, a peptide (for example, in the form of a prophylactic or therapeutic trait 139769.doc 201038590 seedling), a protein, a DNA (single or double strand) or an rNA (such as siRNA or shRNA) in review After the disclosure and teaching of this stipulation, any such peptide or small molecule that effectively competes with the 1 3^3-like antibody for binding to the PF form of the Αβ peptide represents a prophylactic or therapeutic treatment for Alzheimer's disease. It is possible that the dominant compound will become apparent. For this purpose, interaction assays can be used for high yield screening purposes to identify compounds that occupy the 13C3 epitope of the PF form of the Aβ peptide or interact with the 13C3 epitope of the pF form of the Aβ peptide and modulate the antibody. Various antibody/antigen-based assays known in the art can be used which also rely on and rely on the 13C3-like antibody of the present invention as an essential reagent for screening compounds suitable for prophylactic or therapeutic treatment of Alzheimer's disease. (eg, inorganic small molecule or candidate peptide vaccines), including, but not limited to, ELISA assays, radioimmunoassays, Western blot analysis, any homogenization assay that relies on detectable biological interactions without separation or washing steps (See, for example, PerkinElmer's AlphaScreen) and/or SPR-based technology (see, for example, BIACore). Compounds and/or peptide vaccine candidates identified using 13C3-like antibodies can be detected by a variety of assays. The assay can be a simple "yes/no" check to determine if the ability to form a known antibody/antigen complex changes, or can be quantified using, for example, an ELIS A-based assay, a homogenization assay, or an SPR-based assay. . To this end, the present invention relates to any such assay, regardless of which known method is employed, which measures the appropriate peptide or protein of the amine-terminal portion of the 13C3 epitope of the PF form of the Αβ peptide that competes with the 13C3-like antibody. The ability to simulate objects. The antibodies described herein can be used as a primary reagent in the determination of the presence of the Αβ-based fibril form in tissue 139769.doc 20· 201038590 in a number of different immunoassays. In general, such antibodies can be used in any type of immunoassay' whether qualitative or quantitative. This includes non-competitive types as well as two-point sandwich assays and single-site immunoassays in traditional competitive binding assays. For ease of detection and quantification, one embodiment of interest is a sandwich or diabody assay in which there are many variations, all of which are intended to be encompassed in this part of the invention. For example, in a typical positive sandwich test (f〇rward

In the sandwich assay, the unlabeled antibody is immobilized on a solid substrate (e.g., a microtiter well) and the sample to be tested is contacted with the bound molecule. After a suitable incubation period that is sufficient to allow for the formation of the antibody-antigen binary complex for a period of time, followed by the addition of a second antibody capable of inducing a detectable signal to the reporter molecule, and continuing cultivation, allowing for sufficient The time at which the site binds to the antigen and forms a ternary complex of the antibody-antigen-labeled antibody. Any unreacted material is washed away and the presence of the antigen is determined by observing the signal, which can be quantified by comparison to a control sample containing a known amount of antigen. Variations of the positive sandwich assay include simultaneous assays in which the sample is added to the bound antibody simultaneously with the antibody, or in the reverse triad 'treatment', the labeled antibody is first combined with the sample to be tested' To the unlabeled surface bound antibody. These techniques are well known to those skilled in the art and the possibilities for minor variations will be apparent. As used herein, a "sandwich check" is intended to encompass all variations of the basic two-point technique. The limiting factor is two-sex. Thus, for the sandwich assay of the present invention, the only antibodies have different combinations of Αβ-based fibril forms. 139769.doc 21 201038590. As a more specific example, in the code m:::: often glass: ? antibody covalently or passively combined with a solid carrier. The surface of the mouth is usually glass or polymer 'the most commonly used polymer is cellulose polypropylene Dilute amine, ruthenium 'polystyrene, polyvinyl chloride, '.,, the carrier can be tube, bead, disc or 彳^, solid-board' or any (four) material for free pulse Other surface forms. The binding method is known in the art::: The 'washing solid phase-antibody complex is a test sample. == An aliquot of the body fluid in the test field fibril form is added to the solid phase complex. Medium and 'cultivation at 25t is sufficient to allow the presence of the Αβ-based fibril form of the protein with a specific antibody binding to the Ap-based fibril form for a period of time. Then add the _ _ VIII, s... The solid phase complex is k months sufficient to allow the second antibody to bind to the primary antibody-antigen solid phase complex for a further period of time. The second antibody is remote from the reporter molecule, and the visible signal of the reporter molecule is used to indicate the second The binding of the antibody to any antigen in the sample. The "reported points ~" used for their chemical properties provide a positive 2 (four) signal that allows detection of antigen-binding antibodies. The pre-test must be at least relatively quantitative to allow determination: the amount of antigen in the present, which can be absolute (abs〇 Lme {called calculation or can be compared with the standard (or series of standards) containing: known normal content of antigens. The most commonly used reporter in the two-type assay is an enzyme or a fluorophore. In the case of an enzyme immunoassay, The enzyme is often co-administered with the first antibody by means of a pentane disk or perrhenate. However, it will be readily recognized that there are a variety of different peach technology known to those skilled in the art. Common enzymes include, in particular, horseradish peroxidation 139769. .doc -22· 201038590

Ο Enzyme, glucose oxidase, β-galactosidase and alkaline phosphatase. It is generally preferred to use a specific enzyme to produce a detectable color change upon hydrolysis by the corresponding enzyme. For example, p-nitrophenyl phosphate is suitable for alkaline ligase complexes; for peroxidase conjugates, 1,2-phenylenediamine or formalamine is typically used. Fluorescent receptors that produce fluorescent products other than the enamels described above may also be employed. In all cases, the enzyme-labeled antibody is added to the first antibody-Αβ-based fibrillin complex and allowed to bind to the complex, and then the excess reagent is washed away. The solution containing the appropriate substrate is then added to the ternary complex of the antibody-antigen-labeled antibody. The receptor is reacted with an enzyme linked to the second antibody to obtain a visible signal, which can be input into ν疋1 (pass & spectrophotometrically) to obtain an estimate of the amount of antigen present in the sample. value. In addition, a fluorescent combination such as luciferin or rhodamine can be chemically coupled to the antibody without changing the binding ability of the antibody. When activated by irradiation with light of a specific wavelength, the fluorescent dye-labeled antibody absorbs light energy to induce the excited state of the molecule, and then emits light of a characteristic longer wavelength. The characteristic of the detection - r body II immunoassay (EIA) - combines the fluorescently labeled antibody with the first antibody-Αβ-based fibril form protein f complex. After the washing does not rejuvenate the reagent, then Exposing the remaining ternary complex to the appropriate wavelength: Fluorescence indicates the presence of antigen. Immunofluorescence and EIA techniques: fully established in this branch and for the method of the invention = two = with radioisotopes, chemiluminescence Or a biological octupole. How to change the program to suit the desired use 139769.doc -23- 201038590 will be apparent to those skilled in the art. In another embodiment, the sample to be tested (eg, containing 八基基原Fiber-like human blood or spinal fluid) can be used in single-site immunoassays where it is covalently or non-covalently attached to a solid substrate. Unlabeled anti-Αβ-based fibril protein Contacting the sample bound to the solid substrate. After a suitable incubation period for a period of time sufficient to allow formation of the antibody-antigen binary complex, followed by the addition of a second antibody that is capable of inducing a detectable signal indicative of the reporter molecule, And continue to grow, allowing a time sufficient to form a ternary complex of the antigen-antibody-labeled antibody. For a single site immunoassay, the first antibody may be capable of binding to the Α {3 fibril protein form of interest A universal antibody to a specific antibody (i.e., a heterologous immunoglobulin-producing steroid, particularly an antibody (IgM and IgG) linked to a reporter molecule). The 13C3-like antibody can be used in a variety of forms known in the art. Alternatively, the antibody can be any type of related antibody sheet & antibody binding moiety, specific-binding member, non-protein synthesis mimetic, or any of the art known in the art to at least substantially retain binding specificity/ Other related naming forms of the entity that neutralizes the activity. Therefore, the term "antibody" as used in any case in this specification means (including Not limited to any specificity binding members, immunoglobulin classes and/or isotypes (eg IgGi, igG2)

IgG3, IgG4, IgM, IgA, IgD, IgE and; and biologically relevant fragments or specific-binding members thereof, including but not limited to Fab, F(10))2, Fv and scFv (single-chain or related entities). Therefore, it is included herein only in the form of a review, "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or antigen binding thereof I39769. Doc -24· 201038590 part. The heavy chain comprises a heavy chain variable region (VH) and a heavy chain constant region (CHI, CH2 and CH3). The light chain comprises a light chain variable region (VL) and a light chain constant region (CL). The variable regions of the heavy and light chains each comprise a framework region (FWR) and a complementarity determining region (CDR). The four FWR regions are relatively inverted, while the CDR regions (CDR1, CDR2 and CDR3) represent hypervariable regions and are arranged from the NH2 terminus to the COOH terminus as follows: FWR1, CDR1, FWR2, CDR2, FWR3, CDR3, FWR4. The variable regions of the heavy and light chains contain a binding domain that interacts with the antigen, while the constant region, depending on the isotype, mediates binding of the immunoglobulin to the host tissue or factor. That is, chimeric antibodies, humanized antibodies, recombinant antibodies, such as human antibodies produced by non-human animals derived from transgenic genes, and antibodies selected from libraries using skilled enrichment techniques are also included in the working definition of "antibody". . As reviewed below, antibody fragments are obtained using techniques that are readily known and available to those of ordinary skill in the art. Thus, an "antibody" is any such entity or specific binding member that specifically binds to a conformational epitope of the ruthenium-based fibril form as described herein. Thus, the term "antibody" describes an immunoglobulin produced naturally or partially or completely synthetically; any polypeptide or protein having a binding domain that is homologous or substantially homologous to the binding domain of the antibody. Such antibodies may be derived from natural sources, or they may be produced in part or in whole synthetically. As hereinafter, non-limiting discussion, examples of antibodies are immunoglobulin isotypes and isoforms thereof; fragments comprising an antigen binding domain such as Fab, scFv, Fv, dAb, Fd and bifunctional antibodies. It is known in the art to manipulate monoclonal antibodies and other antibodies and use techniques of recombinant DNA techniques to generate additional antibodies or chimeric molecules that retain the specificity of the original antibody. Such techniques can include introducing DNA encoding an immunoglobulin variable region or complementarity determining region (CDR) 139769.doc -25-201038590 of an antibody into a constant region or constant region of a different immunoglobulin plus a framework region. The fusion-producing tumor or other cells that produce the antibody can be subjected to genetic mutations or other changes that may or may not alter the binding specificity of the antibody produced. The antibody can be migratory in a number of ways, and the term "antibody" should be considered to be any specific binding member or substance that has a binding domain with a versatility. Thus, such terms encompass antibody fragments, derivatives, functional equivalents and homologs of "antibodies" including any polypeptide comprising an immunoglobulin binding domain, whether natural or wholly or partially synthetic. The entity may be a binding fragment encompassed by the term "antigen-binding portion" or "specific binding member" of the antibody, including but not limited to (i) a Fab fragment consisting of V1, VH, cL and cH domains. a monovalent fragment; (ii) a F(ab,)2 fragment comprising two bivalent fragments of a Fab fragment joined by a disulfide bridge of the hinge region; (out) an Fd fragment consisting of Vh and CH domains; (iv) An Fv fragment consisting of the V1 and Vh domains of a single arm of the antibody; (v) a dAb fragment comprising the vH domain; (vi) an isolated complementarity determining region (CDR); (Vii), scAb, containing Vh&Vl and Cl or Antibody fragments of Ch: and (viii) artificial antibodies based on protein backbones, including but not limited to, type 111 fibronectin polypeptide antibodies (see, for example, U.S. Patent No. 6,703 issued to Koide on March 9, 2004. , No. 199, and PCT International Application No. WO 〇 2 / 3 2 9 2 5). Furthermore, although the two domains of the Fv fragment (VL and VH) are encoded by independent genes', they can be recombined by enabling them to be prepared as pairs of VL and VH regions to form a single protein chain of monovalent molecules (referred to as Synthetic linker ligation of single-chain Fv (scFv)). In one embodiment, the light chain variable (VL) region of an isolated 13C3 or 13C3-like antibody of the invention may comprise a peptide sequence of 11 3 amino acids (SEQ ID NO: 139769. doc -26- 201038590 5) , which is encoded by a 339 base pair nucleotide sequence (SEQ ID NO: 6):

Asp Val Val Met Thr Gin Thr Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gin Ala Ser lie Ser Cys Arg Ser Gly Gin Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gin Lys Pro Gly Gin Ser Pro Lys Leu Leu lie Tyr Thr Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Leu Lys lie Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gin Asn Thr Phe Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arg (SEQ ID NO: 5) 〇

GATGTTGTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCC ATCTCTTGCAGATCTGGTCAGAGCCTTGTACACAGTAATGGAAACACCTATTTACATTGG TACCTGCAGAAGCCAGGCCAGTCTCCAAAGCTCCTGATCTATACAGTTTCCAACCGATTT TCTGGGGTCCCGGACAGGTTCAGTGGCAGTGGATCAGGGTCAGATTTCACACTCAAGATC AGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTTCTGCTCTCAAAATACATTTGTTCCT TGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGG (SEQ ID NO: 6) In another embodiment, the present invention is the separation of heavy chain variable 13C3 or 13C3-like antibodies (VH) regions may comprise a peptide sequence of 115 amino acids ( SEQ ID NO: 7), which is encoded by a 345 base pair nucleotide sequence (SEQ ID NO: 8):

Gin Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Arg Pro Gly Val Ser Val Lys lie Ser Cys Lys Gly Ser Gly Tyr Thr Phe Thr Asp Tyr Ala Met His Trp Val Lys Gin Ser His Ala Lys Ser Leu Glu Trp lie Gly Val Lie Ser Thr Lys Tyr Gly Lys Thr Asn Tyr Asn Gin Lys Phe Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala lie Tyr Tyr Cys Ala Arg Gly Asp Asp Gly Tyr Ser Trp Gly Gin Gly Thr Ser Val Thr Val Ser Ser (SEQ ID NO: 7); CAGGTCCAGCTGCAGCAGTCTGGGCCTGAGCTGGTGAGGCCTGGGGTCTCAGTGAAGATT TCCTGCAAGGGTTCCGGCTACACATTCACTGATTATGCTATGCACTGGGTGAAGCAGAGT CATGCAAAGAGTCTAGAGTGGATTGGAGTTATTAGTACTAAGTATGGTAAGACAAACTAC AACCAGAAGTTTAAGGGCAAGGCCACAATGACTGTTGACAAATCCTCCAGCACAGCCTAT ATGGAGCTTGCCAGATTGACATCTGAGGATTCTGCCATCTATTACTGTGCAAGAGGGGAC GATGGTTATTCCTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO: 8) · 139769.doc 201038590 〇27 in another embodiment, The framework regions of the VL chain, FWR1, FWR2, FWR3 and FWR4 may comprise SEQ ID NO: 9, SEQ ID NO: 10, S, respectively. EQ ID NO: 11 and the amino acid set forth in SEQ ID NO: 12:

Asp Val Val Met Thr Gin Thr Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gin Ala Ser lie Ser Cys Arg Ser Gly (SEQ ID N〇: 9);

Leu His Trp Tyr Leu Gin Lys Pro Gly Gin Ser Pro Lys Leu Leu lie Tyr (SEQ ID NO: 10);

Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser

Gly Ser Asp Phe Thr Leu Lys lie Ser Arg Val Glu Ala Glu Asp

Leu Gly Val Tyr Phe Cys (SEQ D 〇: 11);

Phe Gly Gly Gly Thr Lys Leu Glu ly Lys Arg (SEQ ID NO: 12) In another embodiment, the complementarity determining region, CDR1, CDR2 and CDR3 of the VL chain may comprise the following SEQ ID NO: 13, SEQ, respectively. ID NO: 14. Amino acid as set forth in SEQ ID NO: 15:

Gin Ser Leu Val His Ser Asn Gly Asn Thr Tyr (SEQ ID NO: 13);

Thr Val Ser (SEQ ID NO: 14);

Ser Gin Asn Thr Phe Val Pro Trp Thr (SEQ ID NO: 15) In another embodiment, the framework regions of the VH chain, FWR1, FWR2, FWR3, and FWR4 may comprise the following: SEQ ID NO: 16 Amino acids as set forth in SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19:

Gin Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Arg Pro Gly

Val Ser Val Lys lie Ser Cys Lys (SEQ ID NO: 16);

Met His Trp Val Lys Gin Ser His Ala Lys Ser Leu Glu Trp lie

Gly Val (SEQ ID N〇: 17); •28· 139769.doc 201038590

Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala lie Tyr Tyr Cys Ala Arg (SEQ ID NO: 18);

Trp Gly Gin Gly Thr Ser Val Thr Val Ser Ser (SEQ ID N〇: 19) In another embodiment, the complementarity determining region, CDR1, CDR2 and CDR3 of the VH chain may comprise the following SEQ ID NO: 20, respectively. SEQ ID NO: 21, amino acid as set forth in SEQ ID NO: 22:

Gly Ser Gly Tyr Thr Phe Thr Asp Tyr Ala (SEQ ID NO: 20); lie Ser Thr Lys Tyr Gly Lys Thr Asn Tyr Asn Gin Lys Phe Lys Gly Lys (SEQ ID NO: 21);

Gly Asp Asp Gly Tyr Ser (SEQ ID N〇: 22) 多 Multiple strains or monoclonal antibodies used in the disclosed therapeutic methods can be produced by known techniques. Monoclonal murine (mouse) antibodies displaying specificity for the selected epitope of the selected target may be purified from mammalian antisera containing antibodies reactive in this region, or may use Kohler and Milstein The technique (1975, iVaiMre 256: 495-497) was prepared as a monoclonal antibody. As used herein, a single specific anti-system is defined as a mono- or antibody-like substance having a uniform binding characteristic, such as a mouse monoclonal antibody having a 13 C3 series monoclonal antibody as exemplified herein. The fusion tumor cell line is produced by mixing spleen lymphocytes with appropriate fusion partners (preferred myeloma cells) under conditions that will allow for the formation of stable fusion tumors. The spleen antibody-producing cells are fused with myeloma cells, selected and screened for antibody production. A fusion tumor from 139769.doc -29-201038590 antibody-positive wells was cloned by techniques such as MacPherson's Soft Agar Technique (1973, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, ed., Academic Press). cell. The monoclonal antibody system is produced in vivo by injecting individual fusion tumor cells into primary pre-sensitized mice (pristine primed mice) after a certain time interval, and is well known in the art. Technology is prepared. In addition to the species-specific monoclonal antibodies described above, the antibodies of the invention may also be in the form of "conjugated antibodies" which are derived from, for example, murine-derived variable regions and from a predetermined host source (eg, human; For review, see

Monozymes constructed in the constant region of Morrison and 〇i, 1989, /«/, W0/0gy, 44: 65-92). For example, light and heavy chain variable DNA sequences (e.g., SEQ ID NOS: 6 and 8, respectively) from rodent (e.g., mouse) antibodies can be selected for expression in a mammalian expression vector. These light and heavy "chimeric" expression vectors are co-transfected into recipient cell lines by known techniques and selected and amplified. This cell line can then be subjected to known cell culture techniques to produce the light and heavy chains of the chimeric antibody. Such chimeric antibodies such as guanidine have historically demonstrated the antigen binding ability of the original & rodent I strain antibody while significantly reducing the immunogenicity of the host after administration. A reasonable improvement of the antibody to the fungus is a "humanized antibody" which appears to reduce the likelihood of a patient developing an immune response against the chemobody when compared to the use of a chimeric or intact murine monoclonal antibody. & "Mouse Mab" humanization strategy based on the induction of site-directed mutagenesis by individual residues or by grafting the entire complementarity determining region (Jones et al., 1986, Fine (10) 321: 522_526) to replace amines different from human sequences. An amino acid residue of a base acid residue. This technology is now again known in the art and is represented by numerous strategies for improving this technology; that is, by implementing a strategy including, but not limited to, the following strategies: "re- 139769.doc 201038590 shape" ( See Verhoeyen et al., 1988, 239: 1534-1536), "hyperchimerization" (see Queen et al., 1991, Proc. Natl. Acad. Sci. 88: 2869-2873) or "veneering" (Mark et al., 1994, Derivation of Therapeutically Active Humanized and Veneered anti-CD18 Antibodies Metcalf end. Dalton, Cellular Adhesion:

Molecular Definition to Therapeutic Potential. New York: Plenum Press, 291-312). These strategies include, to some extent, sequence comparisons between rodent and human sequences to determine if a particular amino acid substitution from a rodent to human consensus sequence is appropriate. Regardless of the variation, the central subject involved in the production of humanized antibodies depends on CDR grafting, in which all three antigen binding sites from the light and heavy chains are efficiently removed from rodents exhibiting antibody-only lines and Secondary selection (or "transplantation") in expression vectors encoding the framework regions of human antibodies. For example, humanized antibodies can be expressed using the above techniques, wherein the CDR1, CDR2 and CDR3 regions of the variable light chain are set forth in SEQ ID NOs: 13, 14, and 15, respectively, and the CDR1, CDR2 and CDR3 of the variable heavy chain The regions are set forth in SEQ ID NOS: 20, 21 and 22, respectively. Thus, a "humanized antibody" is effectively an antibody constructed only with a murine CDR (minus any other modification resulting from the incorporation of one or more of the above strategies), wherein the remainder of the variable region and all of the constant regions It is derived from human sources. The invention also relates to an isolated nucleic acid molecule and related amino acid sequence associated with the VH and/or VL region of a 13C3 antibody, and more particularly an affinity matured version encoding a 13C3 or 13C3, 1D1, 19A6 or other 13C3-like antibody. Or 139769.doc -31 · 201038590 Isolated nucleic acid molecules (polynucleotides) of other dog's type-related biologically relevant parts. These nucleic acids are substantially free of other nucleic acids. For most purposes of selection, DNA is the preferred nucleic acid. These DNA molecules can be sub-selected in a performance vector and subsequently transfected into a host cell of choice, wherein the recombinant host cell is a 13C3 '1D1, 19A6 or 13C3-like, 1D1-like or 19A6-like antibody or an affinity matured version thereof. The source of the relevant content provides the source. Such procedures are used for the utility of the invention, such as the production of scFvs* which are co-presented in the mammalian expression vector system encoding the human Ch& Cl region of, for example, an igG antibody. For all amino acids except for the two amino acids, the degeneracy of the genetic code allows more than one codon to encode a particular amino acid. This allows for the construction of synthetic DNA encoding an antibody of the invention wherein the nucleotide sequence of the synthetic DNA differs significantly from the nucleotide sequence disclosed herein, but still encodes the antibody. Such synthetic DNA is intended to be within the scope of the invention. If such synthetic DNA is to be expressed in a particular host cell or organism, the codon usage of such synthetic DNA can be adjusted to reflect the codon usage of the particular host, thus producing a higher expression of the antibody of the invention. . In other words, this redundancy of the various codons encoding a particular amino acid is within the scope of the invention. Thus, the present invention is also directed to the encoding of the DNA sequences comprising the alternative codons, which encode the final translation of the same amino acid as follows: A = Ala = alanine: codon GCA, GCC, GCG, GCU C=Cys=cysteine··codon UGC, UGU; D=Asp=aspartic acid: codon GAC, QAu · E=Glu=face acid: codon GAA, GAG; F= Phe=phenylalanine: codon UUC, UUU; G=Gly=glycine: codon GGA, i39769.doc -32- 201038590 GGC, GGG, GGU; H=His=histamine: 密石马子CAC, CAU ; I = Ile = isoleucine: codon AUA, AUC; AUU; K = Lys = lysine: codon AAA, AAG; L = Leu = leucine: codon UUA, UUG, CUA, CUC, CUG, CUU; M=Met=methionine: codon AUG; N=Asp=aspartate: codon GAU, GAC; P=Pro=proline: codon CCA, CCC, CCG, CCU; Q=Gln= glutamine amide: codon CAA, CAG; R=Arg=arginine: codon AGA, AGG, CGA, CGC, CGG, CGU; S = Ser=serine: 〇 codon AGC, AGU, UCA, UCC, UCG, UCU; T=Thr=threonine: codon ACA, ACC, ACG, ACU; V=Val=proline: codon GUA, GUC, GUG, GUU; W=Trp=tryptophan: codon UGG; Y=Tyr=tyrosine: codon UAC, UAU. These recombinant expression vectors can then be stably or transiently transfected into an appropriate cell line for production of a surrogate antibody. The present invention contemplates the presence of codon redundancy that can produce different DNA molecules that represent the same antibody or portion thereof (e.g., a replacement nucleic acid molecule encoding a VH and/or VL portion of the same scFv or IgG). For the purposes of this specification, a sequence with one or more altered codons will be defined as a degenerate variant. Another source of sequence variation can occur via RNA editing. This RNA editing • can produce another form of codon redundancy in which changes in the open reading frame do not cause changes in the amino acid residues in the expressed protein. Mutations in the DNA sequences or in the translated antibodies that improve the final physical properties of the expressed antibodies are also included within the scope of the invention. To this end, the present invention relates to (i) 13C3-like antibody affinity maturation patterns including, but not limited to, 13C3, 19A6 and 139769.doc-33-201038590 1D1, and/or (n) i3C3-like antibody mutant forms , which includes, but is not limited to, 13C3, 19A6 and/or 1D1, including but not limited to, known affinity maturation methods in the CDR1, CDR2 and/or CDR3 regions, such as via a known site-specific mutation Recombinant DNA technology produces one or more mutations. Such isolated or purified nucleic acid molecules will represent the VH and/or VL portions of the 丨3C3-like antibody. These nucleic acids are substantially free of other nucleic acids. DNA is the preferred nucleic acid for most purposes of selection. These DNA molecules can be sub-selected in a performance vector and subsequently transfected into a host cell of choice, wherein the recombinant companion cell provides a source for the conformation of the 13C3-like antibody or a portion of its affinity matured version. Such procedures can be used for a variety of utilities, such as generating scFvs or co-presenting such vH and VL chains in a mammalian expression vector system encoding human CH and CL regions of, for example, IgG antibodies. The invention also relates to recombinant vectors and recombinant hosts (prokaryotic and eukaryotic) comprising nucleic acid molecules encoding respective heavy and/or light chain regions of a 13C3-like antibody. These nucleic acid molecules may be ligated in whole or in part with other DNA molecules not naturally linked (ie, DNA molecules encoding recombinant immunoglobulin genes for the production of recombinant human antibodies) to form a "recombinant" encoding recombinant antibodies of various other classes. DNA molecule." Such vectors may comprise DNA or RNA. A DNA vector is preferred for most purposes of selection. Typical vectors include plastids, modified viruses, phage, plastids, yeast artificial chromosomes, and other forms of free or integrated DNA. It is within the skill of the art to identify appropriate vectors for specific gene transfer, production of recombinant human antibodies, or other uses. Well-known methods for sub-selecting a nucleic acid molecule of interest in a performance vector, transforming or transfecting a host cell containing the vector, and methods for preparing a substantially pure protein, 139769.doc • 34- 201038590 which comprises introducing individual expression vectors The step of culturing the host cells in the host cell and under appropriate conditions. The antibodies thus produced, such as IgG recombinant human antibodies, can be collected from host cells in a conventional manner. This portion of the invention can be practiced using any known expression vector and includes any vector containing a suitable promoter and other appropriate transcriptional regulatory elements. The resulting expression construct is transferred to a prokaryotic or eukaryotic host cell to produce a recombinant protein. A expression vector is defined herein as the DNA sequence required to transcribe a selected DNA and translate its mRNA in a suitable host. Such vectors can be used to express eukaryotic DNA in a variety of hosts, such as bacteria, blue-green algae, plant cells, insect cells, and animal cells. A specially designed vector allows DNA to shuttle between hosts, such as bacterial-yeast or bacterial-animal cells. A suitably constructed expression vector shall contain: an origin of replication for autonomous replication in the host cell, a selectable marker, a limited number of suitable restriction enzyme sites, the potential for a high number of copies, and an active promoter. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is a promoter that initiates mRNA at a high frequency. Techniques for such operations are described in Sambrook et al. (1989, Molecular Cloning. A Laboratory Manual; Cold Spring Harbor Laboratory, Cold Spring Harbor, New York), which are well known and available to those skilled in the art. Expression vectors can include, but are not limited to, selection vectors, modified selection vectors, specially designed plastids or viruses. Commercially available mammalian expression vectors that may be suitable include, but are not limited to, pcDNA3.neo (Invitrogen), pcDNA3.1 (Invitrogen), pCI-neo (Promega), pLITMUS28, pLITMUS29, pLITMUS38, and pLITMUS39 (New England Bioloabs), 139769.doc -35- 201038590 pcDNAI ' pcDNAIanp (Invitrogen), pcDNA3 (Invitrogen), pMClneo (Stratagene), pXTl (Stratagene), pSG5 (Stratagene), EBO pSV2-neo (ATCC 37593), pBPV-1 (8-2 (ATCC 37110) > pdBPV-MMTneo (342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460) and 1ZD35 (ATCC 37565) ). Also, a variety of bacterial expression vectors are available, including (but not limited to) pCR2.1 (Invitrogen), pETla (Novagen), λ gtl 1 (Invitrogen), and pKK223-3 (Pharmacia). In addition, a variety of fungal cell expression vectors can be used including, but not limited to, pYES2 (Invitrogen) and Pichia expression vector (Invitrogen). Likewise, a variety of insect cell expression vectors can be used including, but not limited to, pBlueBacIII and pBlueBacHis2 (Invitrogen), and pAcG2T (Pharmingen). The recombinant host cell can be a prokaryotic or eukaryotic cell, including but not limited to bacteria, such as E. coli (f.; fungal cells such as yeast; mammalian cells including, but not limited to, cattle, pigs, monkeys, and rodents) Cell lines of origin; and insect cells. Suitable mammalian species (-26) include, but are not limited to, L cell LM (TK-) (ATCCCCL1.3), L cell LM (ATCC CCL 1.2), Saos- 2 (ATCCHTB-85), 293 (ATCCCRL1 573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-l (ATCC CRL1650), COS-7 (ATCC CRL 1651), CHO-Kl ( ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26), MRC-139769. Doc -36- 201038590 5 (ATCCCCL171) and CPAE (ATCC CCL 209). A further improvement of the re-engineered antibody as reviewed above is the production of fully human monoclonal antibodies. The first involves the use of genetically engineered mouse strains with the immune system. , in which the mouse antibody gene has been deactivated and in turn replaced with a full set of functional human antibody genes, while making the mouse immune system His composition remains unchanged. These genetically engineered mice allow natural in vivo immune responses and affinity maturation processes that produce high-affinity, fully human monoclonal antibodies. This technique is now well known and fully detailed in this technology. Included in various publications, including but not limited to, U.S. Patent Nos. 5,939,598; 6,075,181; 6,114,598; 6,150,584 and related family members (transferred to Abgenix, which reveals its XenoMouse technology); Patent Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299; and 5,770,429 (transferred to GenPharm International and via Medarex is available in the "UltraMab Human Antibody Development System (UltraMab Human)

Q

Under the protection of Antibody Development System). See also the review from Kellerman and Green (2002, Curr. Opinion in Sz'oiec/z(10)/og less 13: 593-597). Finally, techniques for selecting antibody fragments from libraries using enrichment techniques can be obtained by the skilled artisan including, but not limited to, phage display, ribosome presentation (Hanes and Pluckthun, 1997, Proc. Nat. Acad. Sci. 94: 4937-4942 ), bacterial presentation (Georgiou et al., 1997, 15: 29-34) and/or yeast presentation (Kieke et al., 1997, 139769.doc -37- 201038590)

Proiez'w £« and 10: 1303-13 10), which can be used as an alternative to the previously discussed techniques to select a single-chain antibody that specifically binds to a target cytokine. The single-stranded anti-system is selected from a single-chain antibody library that is directly produced using filamentous phage technology. Phage presentation techniques are known in the art (see, for example, the technology from Cambridge Antibody Technology, CAT), as disclosed in U.S. Patent Nos. 5,565,332; 5,733,743; 5,871,907; 5, 872, 215; 5, 962, 255; 5, 962, 255; 6,140, 471; 6,225,447; 6,291,650; 6,492,160; 6,521,404; 6,544,73 1; 6,555,3 13 ; No. 6,582,915; No. 6,593,081 and other US family members, or applications that rely on the priority document GB 92〇63 18 of May 24, 1992; see also

Vaughn et al., 1996, less 14: 309-314. Single-chain antibodies can also be designed and constructed using available recombinant DNA techniques (such as DNA amplification methods (e.g., pcr)) or by using individual fusion tumor cDNAs as templates. Single-chain antibodies can be either monospecific or bispecific; bivalent or tetravalent antibodies. As described below, the nucleotide sequence encoding the single chain antibody can be constructed using manual or automated nucleotide synthesis, selected in the expression construct using standard recombinant DN a methods, and introduced into cells to express the coding sequence. The invention further relates to an antibody-based pharmaceutical composition comprising an effective amount of a 13C3-like antibody or an affinity matured form which provides prophylactic or therapeutic treatment for inhibition of Alzheimer's disease-related fibrils and/or senile plaque formation Sexual treatment options. The antibody-based pharmaceutical compositions of the present invention may be by any number of strategies known in the art (see, for example, McG〇ff & Scher, 139769.doc -38- 201038590 2000, Solution Formulation of Proteins/Peptides: In McNally , EJ ed. Protein Formulation and Delivery. New York, NY: Marcel Dekker; pp. 139-158; Akers and

Defilippis, 2000, Peptides and Proteins as Parenteral Solutions. in .Pharmaceutical Formulation Development of Peptides and Proteins· Philadelphia, PA: Talyor and Francis; pp. 145-177; Akers et al., 2002,

Ο 14:47_127) to deploy. A pharmaceutically acceptable composition suitable for administration to a patient will contain an effective amount of the antibody in the formulation which retains the biological activity while also promoting maximum stability over an acceptable temperature range during storage. Depending on the desired formulation, the pharmaceutical composition may also comprise a pharmaceutically acceptable diluent, a pharmaceutically acceptable carrier, and/or a pharmaceutically acceptable excipient, or any conventionally formulated formulation. Such a vehicle for pharmaceutical compositions of animals or humans. The diluent is selected so as not to affect the combined biological activity. Examples of such diluents are distilled water, physiological phosphate buffered saline, Ringer's solution (Ringer, s s〇iuti〇n), dextrose solution and Henk's solution (Hank, s s〇luti〇n). The amount of excipient suitable for use in the pharmaceutical compositions or formulations of the present invention is such that the antibody is uniformly distributed throughout the composition such that it is uniformly dispersible when delivered to an individual in need thereof. . It can be used to dilute the antibody to a concentration that provides the desired beneficial mitigation or cure while minimizing any undesirable side effects that can occur due to excessive concentrations. It can also have a preservation effect. Therefore, for antibodies with high physiological activity, more excipients will be employed. In addition, for any active ingredient that exhibits lower physiological activity, 139769.doc -39- 201038590 * excipients. Generally, the amount of excipient in the composition will be between about 50% by weight (w) and 99% by weight of the total composition. If the antibody exhibits a particularly low physiological activity, the amount of excipient can be as little as 1% by weight. On the other hand, for antibodies having particularly high physiological activity, the amount of excipient may be between about 98.0% by weight and about 99.9% by weight. Alternatively, the antibody can be administered as a "chemical derivative" (a molecule containing an additional chemical moiety that is not normally part of the basic molecule). These parts improve the solubility, half-life, absorption, etc. of the biological agent. Alternatively, such moieties may impair the undesirable effects of the antibody. Pharmaceutical compositions may also include large, slow-metabolizing macromolecules, such as proteins, polysaccharides, polylactic acid 'polyglycolic acid, and copolymers (such as latex B agarose gel, sephar〇se, agarose (agar〇) Se), cellulose and its analogues), polymeric amino acids, amino acid copolymers and lipid aggregates (such as small oil droplets or lipids in vitro, this f carrier can be used as an immunizer: a stimulant (ie an adjuvant) For parenteral administration, the agent of the present invention can be administered as an injectable dose of the substance in a physiologically acceptable diluent and a solution or suspension in a pharmaceutical carrier, which can be Sterilizing liquids such as water oil, saline, glycerol or ethanol. In addition, auxiliary substances such as wetting or emulsifying agents, surfactants, pH buffering substances and the like may be present in the composition. Other groups of pharmaceutical compositions Parts are petroleum animal, vegetable or synthetic sources such as peanut oil, soybean oil and mineral oil. In general: especially for injectable solutions, such as propylene glycol or one of the polyvinyl alcohols are preferred liquid carriers. anti- The formulation may be in liquid form or in solid form. The solid formulation is typically lyophilized and prepared as a solution for single or multiple administration prior to administration. Formulation 139769.doc -40- 201038590 The substance should not be exposed to extreme temperatures or PH to avoid thermal denaturation. Therefore, the antibody composition of the present invention must be formulated within a biologically relevant range. Especially for liquid formulations that are stored for a longer period of time between formulation and doping, the indication needs to be buffered to A solution that maintains an appropriate positive range during storage. Until now, both liquid and solid formulations need to be stored at a lower temperature (usually 2-8 C) to maintain stability over a longer period of time. Formulations may contain a bacteriostatic agent that prevents or minimizes protein 0" storage during storage including, but not limited to, an effective concentration (usually <1% w/v) of benzoquinone, bismuth, and chlorine. Butanol, p-aminobenzoic acid and / or p-propyl benzoate. Bacteriostatic agents may be banned for some patients. Because !t匕, can be in the solution with or without this component Medium bed compounding complex Adding the burr component to a buffer oxime or solid antibody formulation, including but not limited to, a sugar as a cryoprotectant (including but not necessarily limited to) polyhydroxy hydrocarbons such as Yamanashi Sugar alcohols, mannitol, glycerol and galactitol, and/or disaccharides such as sucrose, lactose, maltose or sorghum trehalose and, in some cases, related salts including but not limited to Nacn, KC1 or LiCl). These antibody formulations (especially liquid formulations) intended for long-term storage will depend on the range of total volume osmotic concentration to promote long-term stability at temperatures above 2-8 C or above 8 C. The formulation is adapted for parenteral injection. The effective range of total volume osmotic concentration (total number of molecules in solution) is from about 200 mOs/L to about 800 mOs/L. It will be apparent that the amount of cryoprotectant (such as sucrose or sorbitol) will depend on the amount of salt in the formulation to maintain the volumetric osmolality of the solution within an appropriate range. Thus, the salt-free formulation may contain from about 5% to about 25% sucrose, with sucrose preferably ranging from 139769.doc • 41 to 201038590 from about 7% to about 5%, with particularly preferred in salt-free formulations. The sucrose concentration is 10% to 12%. Alternatively, the sorbitol-based salt-free formulation may contain sorbitol in the range of from about 3% to about 12%, with a preferred range of from about 4% to about 7%. And especially preferred ranges are from about 5% to about 6% sorbitol in the salt-free formulation. Unsalted formulations will of course permit an increase in the range of individual cryoprotectants to maintain an effective volume osmotic concentration level. These formulations may also contain second order cations (including but not necessarily limited to MgCl2, CaCh and MnCl2); and non-32 ionic surfactants (including but not necessarily limited to) polysorbate vinegar _ 8 〇 (Tween 80®) , Polysorbate _6〇 (Tween 6〇®), Polysorbate _ 4〇 (Tween 4〇®) and Polysorbate 2〇 (Τνναη 2〇®), polyoxyethylene alkyl ether, Includes, but is not limited to, Brij 58®, Brij 3 5®, and others, such as Triton X-100®, Triton X-114®, NP40®, Span 85, and Pluronic series of nonionic surfactants ( For example, Polonik (2))). Any combination of such components, including possibly bacteriostatic agents, may be suitable for filling the antibody-containing formulations of the invention. The antibody composition of the present invention may also be a "chemical derivative" which describes an antibody containing an additional chemical moiety (e.g., PEGylated) that is not normally part of the immunoglobulin molecule. These components improve the solubility, half-life, absorption, etc. of the basic molecule. Alternatively, such moieties may impair the undesirable side effects of the base molecule or reduce the toxicity of the basic molecule. Numerous examples of various carriers, diluents, excipients, and the like are known in the art and are disclosed in the references cited herein, and

Remington's Pharmaceutical Sciences (第]^版., from

In Publishing Company, Easton, Pa_, 1990), within the literature I39769.doc •42- 201038590

The contents are incorporated herein by reference to < t 4 U .. . Briefly, it will be appreciated that a combination of carrier, excipient, 5g, and other agents can be formulated to formulate a pharmaceutical composition to provide improved transfer, delivery, tolerance, and the like. The method of incorporating a biological agent and/or/or a tongue component into a carrier ώ u 1 heart 戟 τ τ is known to the general practitioner and is a property of the medicinal agent and a carrier selected by the inventors of the present invention. Depending on the nature. Ion ', 'gel' encapsulation or physical entrapment in the carrier, iontophoresis: contained in the bio-agent solution for the formulation of the pharmaceutical composition to be used in the formulation: Ding's oral therapy A suitable example. Alternatively, the carrier can be equivalent to a diluent for the biological agent. Such formulations may include, for example, powders, pastes, ointments, gelling agents, soils, oils, lipids, anhydrous absorbent bases, water, oil or water-in-oil emulsions, emulsion cardopheres (earb_x) (multiple molecular weights) The polyethylene glycol), the semi-solid gel, and the semi-solid mixture containing the Kappa wax are selected according to various factors, such as the type of the patient, the species, the age, the body weight, and the like. Sex and medical conditions; severity of the condition to be treated; route of administration; kidney, liver and cardiovascular function of the patient; and the specific biological agent used. A physician or veterinarian of ordinary skill can readily determine and specify an effective amount of the drug required to prevent, combat or arrest the progression of the condition. The best accuracy in achieving a drug concentration in a range that produces efficacy without toxicity requires a regimen based on the kinetics of the availability of the drug to the target site. This involves considering the distribution, balance and elimination of the drug. In the treatment and therapy according to the present invention, any of the foregoing formulations may be suitable provided that the active ingredient in the formulation is not inactivated by the formulation and the formulation is physiologically compatible. Any of the ways, strategies, and/or combinations that may be used in the art, 139769.doc -43. 201038590 administering the pharmaceutical composition of the present invention to a host in an amount sufficient to provide a therapeutic treatment against Alzheimer's disease . Such compositions may be provided to an individual by a variety of routes known in the art, including, but not limited to, parenteral routes, such as intravenous (ιν), Muscles are administered intramuscularly or subcutaneously (sc), with IV administration being a typical mode of therapeutic antibody administration. Such compositions can be administered in the form of separate or multiple doses (i.e., administration of the antibody at staggered times by maintaining the sterile conditions of the formulation via a therapeutic regimen). Dosage regimens utilizing the compounds of the invention are selected based on a variety of factors, including the type, species, age, weight, sex, and medical condition of the patient (such as a human patient); to:: the severity of the condition; administration Route; kidney, liver and cardiovascular function of the patient; and the specific antibodies used. A physician or veterinarian of ordinary skill can determine the effective therapeutic amount of the antibody. Achieving the best accuracy of antibody metrics in the range of efficacy without 毋1" requires a regimen based on the kinetics of the availability of the drug to the target site. This involves considering the distribution, balance and elimination of the drug. The antibodies described herein can be used alone in appropriate dosages. Alternatively, it may be necessary to co-administer or continuously administer other agents. An alternative prophylactic or therapeutic regimen can be administered in combination to provide a sexual sex regimen of the antibodies of the invention. The effective dosage regimen will vary depending on many different factors... factors such as the method of administration, the site of the target, the physiological state of the patient, the string = for humans or animals, other drugs administered, and treatment are preventive: or therapeutic. For the administration of a 13C3-like antibody, the dose is in the range of about mg to (10) mg per kg of host body weight, and more typically in the range of 0.01 mg to 5 ng per kg of body weight. In the case of Alzheimer's disease 139769.doc -44· 201038590, the deposit of the genus powder is present in the brain, and may also be administered in combination with other agents that increase the throughput of the agent of the present invention through the brain barrier. The agent of the invention. Another aspect of the delivery and dosage regimen of the 13C3-like antibody compositions of the present invention relates to drug delivery via the parenteral route, which may include non-injectable and injectable devices. The injectable compositions are usually prepared as a liquid solution or suspension; solid forms suitable for dissolving or suspending in liquid vehicles prior to injection may also be prepared. As discussed above, the formulation may also be emulsified or encapsulated in liposomes or microparticles (such as polyacetic acid vinegar, polyacetamide or copolymer), (see Langer, 199, et al. (10) Foot (1) to (3); and Hanes, 1997, from (4) "Missing Heart 28: 97_119". The agent of the present invention can be administered in the form of a sputum injection or an implant preparation which is formulated in such a manner as to allow sustained or pulsatile release of the active ingredient. Particular embodiments include PLGA microspheres (as discussed herein and otherwise known in the art) and polymer-based non-degrading vehicles comprising poly(ethylene-co-vinyl acetate; PEVAc). Reviewing Antibody-Based Therapy in & Heart Calling, et al., 2004, Magic, z. «. 〇 〇 /. 广 4(7): 1〇291〇44 (incorporated herein by reference in its entirety) Controlled release and local delivery of the product. Suitable microcapsules capable of encapsulating the antibody may also include hydroxymethylcellulose or gelatin-microcapsules and polymethyl methacrylate microparticles prepared by coacervation techniques or by interfacial polymerization. Capsule. See the title "Method for Producing I GIM SustainedRelease

PCT Publication No. WO/99/24061, in which the protein is encapsulated in PLGA microspheres. This reference is incorporated herein by reference in its entirety by reference. Alternatively, microemulsion or colloidal delivery systems such as liposomes and albumin microspheres can be used. Other preferred sustained release compositions employ a bioadhesive to retain the antibody at the site of administration. As described above, the sustained release formulation can comprise a biodegradable 4 & internally disposed antibody that provides non-immediate release. Non-injectable devices can be described herein as "implants", "medical reservoir implants", "tank implants", non-injected reservoirs, or some similar terms. Common reservoir implants may include, but are not limited to, solid biodegradable and non-biodegradable polymer devices (such as elongated polymer or coaxial rod devices), as well as numerous pumps also known in the art. system. The injectable device is divided into rapid injection (the drug is released and dissipated after injection), and the library or reservoir injection provides a reservoir at the main site, allowing for sustained release of the agent over time. The reservoir implant can be surgically limited to the delivery point to provide a suitable reservoir for long-term release of antibodies over time. The device will be capable of carrying a therapeutic formulation in a preselected period of time such as therapeutic or prophylactic. The reservoir implant can also provide protection from degradation of body processes, such as proteases, for the duration of treatment. As used in the art, the term "sustained release" refers to the gradual (continuous or intermittent) release of the agent from the block and matrix over an extended period of time. The sustained release of the (10)-like antibody composition will produce a local biologically effective concentration of the antibody, regardless of the particular device. Depending on the formulation, the sustained release of the biological agent will take a day, a few days, a week or more, and it will most likely last for a month or more than or more than six months. Due to characteristics such as general degradation kinetics, queen sex, and biocompatibility, days known in the art 139769.doc -46 · 201038590 or synthetic polymers would be suitable for use as a reservoir implant. These copolymers can be manipulated to improve the pharmacokinetics of the active ingredient, to protect the agent from enzymatic attack, and to degrade over time at the attachment or injection site. The skilled artisan will appreciate that there are a wealth of teachings in the art for operating the properties of such copolymers, including the individual production process, the catalyst used, and the final molecular weight of the sustained release reservoir implant or reservoir injection. Natural polymers include, but are not limited to, proteins (eg 'collagen, albumin or gelatin); polysaccharides (cellulose, starch, alginate, chitin, polyglucosamine, cyclodextrin, dextran, glass) Uronic acid) and lipids. Biodegradable synthetic polymers can include, but are not limited to, various polyesters, copolymers of L-glutamic acid and gamma L-glutamate (Sidman et al, 1983, Biopolymers 22: 547-556), polypropylene. Lactide ([PLA]; U.S. Patent Nos. 3,773,919 and EP 058,481), polylactide polyglycolate (PLGA), such as polylactide-co-glycolide (see, for example, U.S. Patent No. 4,767,628 and 5,654,008), polyglycolide (PG), poly(α-hydroxy acid) polyethylene glycol (PEG) conjugate, polyorthoester, polyaspirin, poly-creatine, ethylene η ratio laugh. Ketone, polyacetal (PVA), PVA-g-PLGA, PEGT-PBT copolymer (multi-activity), methacrylate, poly(N-isopropyl acrylamide), PEO-PPO-PEO ( Polonik), PEO-PPO-PAA copolymer, PLGA-PEO-PLGA, polyorthoester (POE), or any combination thereof (as described above, for example, see U.S. Patent No. 6,991,654 and U.S. Patent Application Serial No. No. 20050187631, each of which is incorporated herein by reference in its entirety in its entirety, in the the the the the the the the the the the the the the the the the the the the the the the the the the the Chem. Tech. 12:98-105), Non-degradable Ethylene-B 139769.doc • 47· 201038590 Vinyl acetate (eg ethylene vinyl acetate disk and poly(ethylene-co-acetate)), Degradation of lactic acid-glycolic acid copolymers such as Lupron DepotTM, poly-D-(-)-3-hydroxybutyric acid (EP 133,988), and hyaluronic acid gel (see, for example, U.S. Patent No. 4,636,524), alginic acid suspension Polyortic acid lysate (POE) and its analogues. Since the commercialization of Lupron DepotTM (approved in 1989 as the first parenteral sustained release formulation using PLA polymers), polylactide (PLA) and its copolymer with glycolide (PLGA) have been here. It is well known in the art. Other examples of products that utilize PLA and PLGA as excipients to achieve sustained release of the active ingredient include Atridox (PLA; periodontal disease), Nutropin Depot (PLGA; with hGH), and Trelstar Depot (PLGA; prostate cancer). Other synthetic polymers include, but are not limited to, poly(c-caprolactone), poly-3-hydroxybutyrate, poly(beta-malic acid), and poly(dioxanone); polyanhydrides, polyamines Carbamates (see WO 2005/013936), polyamines, cyclodextrins, polyorthoesters, n-vinyl alcohol, polyethylene oxide/polyethylene terephthalate, polyphosphazenes, polyphosphates , polyphosphonates, polyorthoesters, polycyanoacrylates, polyethylene glycols, polydihydropyrans and polyacetals. Non-biodegradable devices include, but are not limited to, various cellulose derivatives (carboxymethyl cellulose, cellulose acetate, cellulose acetate propionate, ethyl cellulose, hydroxypropyl fluorenyl cellulose), sulfhydryl implants (polydidecyl decane), acrylic polymer, (polydecyl acrylate, polymethyl methacrylate, polyalkyl (ethyl propyl acrylate), and polyethylene - A total of - (S S B fine vinegar), poloxamer (p〇l〇xamer), polyethylene. Billing. ketone, decanoic acid, polypropylene, polyamide, polyacetal, polyester , polyethylene-gas trifluoroethylene, polytetrafluoroethylene (PTFE or "TeflonTM"), styrene-butadiene 139769.doc -48- 201038590 rubber, polyethylene, polypropylene, polyphenylene ether-polystyrene, poly-a • Gas-p-dioxene, polydecylpentene, polyhard and other related biostable polymers. Carriers suitable for sustained release reservoir formulations include, but are not limited to, microspheres, membranes, capsules, particles , gels, coatings, matrices, wafers, pills or other pharmaceutical delivery compositions. These sustained release are described above Examples of the ligands was also reference to U.S. Pat. No. 6,953,593; No. 6,946,146, No. 6,656,508; of 6,541, No. 〇33; and No. 6,451,346, Ο

The content of each of them is incorporated herein by reference. The dosage form must be capable of carrying a pharmaceutical formulation in a quantity and concentration required to treat the treatment in a preselected stage, and the formulation must be provided with protection sufficient to protect against degradation by the body process for the duration of the treatment. For example, the dosage form can be surrounded by an exterior made of a material having properties that protect against degradation by metabolic processes and, for example, leakage, breakage, breakage, or distortion. This prevents the dosage form from being expelled in an uncontrolled manner under the stresses it will experience during use. These stresses are applied to the drug release device, for example, by the positive f-joint and other movements of the individual. Or caused, for example, in a convective drug delivery device with physical forces associated with the pressure generated within the reservoir. Drug reservoirs or other components that are used to hold or contain drugs must have multiple materials to avoid unintended reactions with the active agent formulation, and are preferably biocompatible (eg, in the case of implanted dosage forms) In the meantime, it does not substantially react with respect to the body or body fluid of the individual. Generally, it lasts for at least Η hours to at least one week, and most likely by design to take at least 1 〇, 20, 30, 1 或 or at least 4 months or at least 6 months or more than 6 months or more as needed. The implant of the musical substance is delivered, and the individual biological agent is administered to the individual. 13 C 3 -like antibodies can be delivered at a lower volume rate relative to 139769.doc -49· 201038590 (eg, about 〇_〇〇1 ml/day to 1 ml/day) to allow tissue near the release site of the formulation. Interference or trauma is minimal. Depending on the particular biological agent, the formulation may, for example, be at about O.Oi pg/hr! 1. 1 pg/hr, 0.25 pg/hr, 1 gg/hr', typically at a rate of up to about 200 pg/hr at low doses. The formulation is delivered, or at a low volume rate, for example, from about 1 ml/day to about 1 ml/day, for example, from 0.01 μg/day to about 20 mg/day. The dosage will depend on a number of factors, such as the potency of the active ingredient employed (e.g., &apos; IgG antibody), bioavailability and toxicity, and the individual's needs. These and other objects, advantages and features of the present invention will become apparent from the <RTIgt; EXAMPLES Example 1: Preparation of a fibrillar form of a starch-like β (Αβ42) The Αβ42 synthetic peptide was prepared according to the method described by Fezoui et al. (Fezoui et al. Amyloid 7(3): 166-178. (2000)) (American peptide) Company, Inc" CA). Briefly, lyophilized Αβ42αι mg/ml concentration (pH is approximately dissolved in 2 mM NaOH, followed by ultrasonic treatment and /Donggan. NaOH treated Αβ at 1 mg The concentration of /ml was dissolved in water and passed through a 0'22 μιη ULTRAFREE-MC filter (Millipore, MA). The 0.5 mg/ml peptide solution was buffered at a final concentration of 50 mM phosphate, 1 mM nitrocellulose. And incubated for 4 hr at room temperature. The supernatant was fractionated from the low molecular weight protein separation fibril form using size exclusion chromatography. The purified SEC fraction was then stored at 4 ° C. 139769.doc - 50- 201038590 Various forms of the Αβ 4 2 protein have been shown to demonstrate their ability to associate together as monomers or dimers to form high molecular weight oligomers (based fibrils) (Figure 丨). Solvent-based fibrils Further aggregation to produce an insoluble form of the protein while the fibrils It can be re-dissociated into a lower molecular weight form. To purify the base fibril form of Αβ from low molecular weight proteins, the samples were fractionated using a Superdex 75 size exclusion column chromatography system. Figure 2Α shows that Αβ was not incubated at room temperature. *2 In the case of a synthetic peptide, there is no aggregation of oligomers forming fibrils. Figure 2A shows that after incubation of the Αβ42 synthetic peptide for 4 hr, subsequent SEC purification shows the determination of the fibrils of the basal fibrils. Fibril Αβ has a specific monoclonal antibody by using a protocol known in the art (Harl〇w et al., c〇ld

Spring Harbor Laboratory (1988)), immunized with fibrillar Αβ protein

Balb/c mice were used to generate 13C3, 19Α6 and 1D1 antibodies. The spleen was removed and fused to SP2 myeloma cells in several 96-well plates. The growth of the fused culture was monitored and the supernatant was screened for the ability of the supernatant to bind to the fibrils of the fibrils by antibody capture immunoassay. Example 3. Characterization of monoclonal antibodies specific for basal fibrillary Αβ The antibody capture assay was used to further characterize individual antibodies (13C3, 19Α6 and 1D1) produced from fusion tumors. 50 μL of 2 pg/ml basal fibril octa 042 protein solution was added to each well of the microtiter plate and the plate was at 4. Underarm cultivation lasted overnight. The residual antigen solution was removed after incubation and washed with pBS solution. Serial dilutions of the fusion tumor supernatant were added to plates containing the bound antigen and incubated for 1 hour at room temperature. This primary antibody solution was removed and the wells were washed again with PBS solution. Enzyme-labeled secondary antibodies were then added and incubated for 1 hour at room temperature 139769.doc • 51 - 201038590. After removal of the secondary antibody solution, a conjugated chromogenic receptor with specificity is added to the reaction and the captured antibody is detected to produce a quantitative result. In addition, the secondary reagent was changed to a homotypic specific anti-immunoglobulin antibody to identify the specific immunoglobulin isotype of each individual plant. In these experiments, commercially available anti-Aβ42 antibodies were used to compare the binding specificity of 13C3, 1986 and 1〇1 monoclonal antibodies. Figure 3 Α and Β illustrate the fibril (PF) and low molecular weight (lmw) forms of the Αβ42 peptide used to test the specificity of the 1 antibody in an antibody capture immunoassay. Specifically, Figure 3A illustrates a graph generated from ELISA showing that the 13C3 antibody is specific for the fibril form (pF) of Αβυ and does not recognize the low molecular weight (LMW) form of the protein. Figure 3B illustrates ELISA data obtained using commercially available 4G8 antibodies demonstrating their recognition of the low molecular weight and basal fibril forms of Αρη protein. Example 4: Specificity of the fibril form of Αβ η measured by surface electrochemical resonance (bIAC〇RE) using a surface antibody according to the published protocol (Nice et al., BioEssays 21: 339-352 (1999)) The purified monoclonal antibodies listed in Table 丨 (below) were immobilized on BIAcore sensing wafers. The high sensitivity of the BIAcore optical reaction quantifies the change in reflectance and produces a baseline response to the individual ligand. Interaction analysis was performed when the analyte (LMW form or PF form of Αβ42) was injected over the induction wafer in solution and the change in surface plasma resonance produced a specific response that identified the ability of each antibody to bind LMW and PF Αβ42. . All of the 13C3 and 19a6 antibodies were combined with the specificity of the LMW form in combination with the PF of Αβ42 139769.doc •52· 201038590. In all of the antibodies used in this experiment, as indicated by the ratio of PF binding/LMW binding, commercially available antibodies exhibited specificity for LMW Αβ42 that was higher than the PF form of AP42. Table 1 BIACORE binding assay name epitope haplotype source LMW PF ratio (PF/LMW) 1D1 structure IgGl Ravetch 23.2 122.3 5.3 13C3 structure IgGl Ravetch 25 124.8 5.0 19A6 structure IgG3 Ravetch 3D6 Αβ 1-5 IgG2b Elan Pharmaceuticals 424.6 402.7 0.9 4G8 Αβ 17-22 IgG2b Senetek Inc. 228.6 340.3 1.5 6E10 Αβ 3-8 IgG2b Senetek Inc. 400.1 541.1 1.4 82E1 Αβ 1-17 IgGl IBL 69.9 68.4 1.0 Surface plasmon resonance analysis shows 13 C3 (Fig. 4Β) by means of an induction diagram Binding to the LMW form of Αβ42 protein. However, '4G8 (Fig. 4A) shows a standard association/dissociation curve for LMW Αβ42 protein. The antibody isotype control 1 § 〇 1 (panel c) also does not bind LMW Αβ. An automated BIAcore system utilizing the principle of surface plasma resonance detection was used in these experiments. Binding specificity data for the 19Α6 antibody shows that 19A6 has a binding ratio of 5.8, which is similar to 13C3 with a ratio of 5.3. Example 5: epitope mapping of 13C3 antibodies according to the published protocol (Korth et al, 390: 74 (1997))

The RepliTope microarray system (JPT Peptide Technologies GmbH) performed epitope mapping of 13 C3, 1D1 and 19A6. Each point on the microarray contains a peptide of 13 amino acids of Αβά, wherein each position shift on the microarray represents an amino acid shift (from the Ν to the C terminus), ie SEQ ID NO: 23, SEQ ID NO: 24...SEQ ID NO: 51; and SEQ ID NO: 52. The peptides and their precise amino acid sequences are listed below, corresponding to positions on their slide arrays. After immobilizing the peptide to the RepliTope microarray, the sample was incubated with 13C3 antibody 139769.doc-53-201038590 and then subsequently labeled with a secondary antibody conjugated to the selected chemiluminescent tag. The point at which the signal is generated represents the antigen binding site binding site on the protein bound by the antibody.

Asp Ala Glu Phe Arg His Asp Ser 23)

Ala Glu Phe Arg His Asp Ser Gly 24)

Glu Phe Arg His Asp Ser Gly Tyr 25)

Phe Arg His Asp Ser Gly Tyr Glu 26)

Arg His Asp Ser Gly Tyr Glu Val 27)

His Asp Ser Gly Tyr Glu Val His 28)

Asp Ser Gly Tyr Glu Val His His 29)

Ser Gly Tyr Glu Val His His Gin 30)

Gly Tyr Glu Val His His Gin Lys 31)

Tyr Glu Val His His Gin Lys Leu 32)

Glu Val His His Gin Lys Leu Val 33)

Val His His Gin Lys Leu Val Phe 34)

His His Gin Lys Leu Val Phe Phe 35)

His Gin Lys Leu Val Phe Phe Ala 36)

Gin Lys Leu Val Phe Phe Ala Glu 37)

Lys Leu Val Phe Phe Ala Glu Asp 38)

Leu Val Phe Phe Ala Glu Asp Val 39)

Val Phe Phe Ala Glu Asp Val Gly 40)

Phe Phe Ala Glu Asp Val Gly Ser 41)

Phe Ala Glu Asp Val Gly Ser Asn 42)

Ala Glu Asp Val Gly Ser Asn Lys 43)

Glu Asp Val Gly Ser Asn Lys Gly 44)

Asp Val Gly Ser Asn Lys Gly Ala 45)

Val Gly Ser Asn Lys Gly Ala lie 46)

Gly Ser Asn Lys Gly Ala lie lie 47)

Gly Tyr Glu Val His (SEQ ID NO: Tyr Glu Val His His (SEQ ID NO: GHi Val His His Gin (SEQ ID NO: Val His His Gin Lys (SEQ ID NO: His His Gin Lys Leu (SEQ ID NO: His Gin Lys Leu Val (SEQ ID NO: Gin Lys Leu Val Phe (SEQ ID NO: Lys Leu Val Phe Phe (SEQ ID NO: Leu Val Phe Phe Ala (SEQ ID NO: Val Phe Phe Ala Glu (SEQ ID NO: Phe Phe Ala Glu Asp (SEQ ID NO: Phe Ala Glu Asp Val (SEQ ID NO: Ala Glu Asp Val Gly (SEQ ID NO: Glu Asp Val Gly Ser (SEQ ID NO: Asp Val Gly Ser Asn (SEQ ID NO: Val Gly Ser Asn Lys (SEQ ID NO: Gly Ser Asn Lys Gly (SEQ ID NO: Ser Asn Lys Gly Ala (SEQ ID NO: Asn Lys Gly Ala lie (SEQ ID NO: Lys Gly Ala lie lie (SEQ ID NO: Gly Ala lie lie Gly (SEQ ID NO: Ala He lie Gly Leu (SEQ ID NO: lie lie Gly Leu Met (SEQ ID NO: lie Gly Leu Met Val (SEQ ID NO: Gly Leu Met Val Gly (SEQ ID NO: -54- 139769.doc 201038590

Ser Asn Lys Gly Ala lie lie Gly Leu Met Val Gly Gly (SEQ ID NO: 48)

Asn Lys Gly Ala lie lie Gly Leu Met Val Gly Gly Val (SEQ ID NO: 49)

Lys Gly Ala lie lie Gly Leu Met Val Gly Gly Val Val (SEQ ID NO: 50)

Gly Ala lie lie Gly Leu Met Val Gly Gly Val Val lie (SEQ ID NO: 51)

Ala He lie Gly Leu Met Val Gly Gly Val Val lie Ala (SEQ ID NO: 52) Figure 5A illustrates the point collapse of the RepliTope microarray experiment from the identification of the epitopes of the antibodies 13C3, 1D1 and 4G8 on the Αβ!-42 peptide. point. The bound antibody is presented by a chemiluminescent signal. Figure 5B illustrates the amino acid sequence of a polypeptide segment displaying the 13C3 epitope (when it is present in the sequence). The 1D1 antibody displays the same epitope as 13C3, while the commercially available 4G8 antibody identifies different epitopes. Example 6: Characterization of 13C3 specificity Fig. 6 illustrates the fractionation from size exclusion chromatography performed on the supernatant of the 7PA2 cell line (cell line secreting Αβ oligomer). Antibody capture assays were used to further characterize the binding of the 13C3 antibody to the fibrils and the low molecular weight dissolving fraction from the SEC purified 7PA2. 100 μM of each dissolved fraction of the ι:2 稀释 dilution was added to each well of the microtiter plate and the plate was incubated overnight at 4 °C. After incubation, the residual antigen solution was removed and the solution was washed with PBS solution. Serial dilutions of the 13C3 supernatant were added to plates containing antigen-binding and incubated for 1 hour at room temperature. This primary antibody solution was removed and the wells were again washed with PBS solution. The enzyme-labeled secondary antibody was then added and incubated for 1 hour at room temperature. After removal of the secondary antibody solution, a chromogenic receptor with a specific enzyme is added to the reaction and the captured antibody is tested for a quantitative result. This assay identified the 13C3 antibody to uniquely identify the fibril fraction, while the 4G8 antibody recognized all of the fractions. The 7PA2 cell line was supplied by Dennis J. Selkoe, M.D., of Harvard Medical School, Harvard Medical School, 139769.doc-55. Example 7: 13C3 reactivity was characterized by EM. The staining method was carried out using a standard protocol (Brenner et al. Biochim. Biophys. Ada 34, 103-110 (195 9)). A small volume of 〇〇 microliters;) 〇.2 mg/ml of fibril solution was applied to a carbon coated polyvinyl acetate (formvar) grid (400 mesh) for 2 min. The grid was then blocked in 1 〇/〇 BSA and incubated with the 13C3 antibody followed by subsequent incubation with secondary antibody (conjugated to colloidal gold). Samples were negatively stained by placing on 2 consecutive drops of 2% phosphotungstic acid for 30 seconds each. Excess stain solution was blotted with filter paper and the grid was air dried&apos; and observed on a JEOL 100 CX transmission electron microscope at 80 kV. The images were recorded on a large Kodak 4489 negative and digitized on a flatbed scanner. IEM (Immunoelectron Microscopy) images showed that the anti-Αβ antibody-pure 13C3 has binding specificity for Αβ42 fibers (Figs. 7B and 7C), while the isotype control antibody igG1 did not exhibit binding (Fig. 7A). The secondary resistance system is conjugated to the colloidal gold particles. Example 8: 13C3 treatment of a mouse model of human Ad The 13C3 monoclonal antibody was used to treat Αβ plaques in a mouse model of Alzheimer's disease (TgCRND8). The mouse contains the human APP695 cDNA transgene that accelerates the deposition of Αβ-like amyloid plaques in the mouse brain (appearing within a few months of age). The sample group of five five-week-old TgCRND8 mice was administered once a week for a duration of seven weeks for the immunization of 13C3 monoclonal antibody at a concentration of 10 mg per kg of mouse. A second group of 5 TgCRND8 mice was given a course of treatment, however, an isotype control IgGl antibody was administered. Replace the week twice a week - the second time 139769.doc -56- 201038590 treatment repeated experiments. Control and experimental animals were sacrificed at 12 weeks of age. The histological preparation of the brain revealed a decrease in Αβ plaques in 13C3 treated mice. Serial sections of cryopreserved brain from TgCRND8 mice were treated with 13C3 or IgG1 monoclonal antibodies. Figures 8A and 8B illustrate the difference in the number of Αβ-like starch plaques between each individual antibody. • Statistical Τ test shows that once-a-week 13C3 antibody treatment reduces Α beta-amyloid plaques in the Alzheimer's disease model (Figure 9Α). However, twice a week of treatment (Figure 9Β) shows the same degree of plaque reduction. All of the above TgCRND8 mice were obtained from Dr. David Westaway of the University of Toronto. Example 9: Molecular Characterization of the Variable Region of MAB 13C3

The IgG heavy chain variable region and the IgG κ light chain region were selected from the 13C3 fusion tumor. Analysis of heavy and light chain sequences using the database of germline variable genes from human and mouse immunoglobulin loci extracted from the EMBL-Bank and Ensembl databases VBASE2 (http://www.vbase2.org) (Figure 10). (Retter et al. Nucleic Acids Res. 33: D671-4 (2005)). The results of the analysis identified the heavy and light chain variable regions from the newly identified immunoglobulins, but with 73% and 81% of the other immunoglobulin variable regions in the database, respectively. For these databases, framework regions (FWR) and complementarity determining regions (CDRs) are also identified in these sequences. When analyzing sequences for the VBASE, KABAT, and IMGT/LIGM databases, the results were only slightly different. Example 10: Unlike the reference antibody 3D6 administration, short-term peripheral administration of 13C3 in APP transgenic mouse 139769.doc -57-201038590 did not cause an increase in plasma Αβ at 10 mg/kg (ie, '300 μg/mouse) The dose of the antibody, 13C3, control IgG1 (DM4, does not recognize Αβ) and reference anti-Aβ antibody 3D6 (identification of all conformations of Αβ) for peritoneal transgenic mice (Thy APPSL, 10-14 weeks old) peritoneum Injection inside. Plasma Αβ was quantified at 6 h, 24 h, and 7 days after injection in the same mouse at zero time pre-injection. Plasma Αβ quantification was performed using an immunoassay performed with an anti-Aβ antibody that does not interfere with the binding of 13C3 or 3D6 to Aβ. Administration of 3D6 (an antibody against all conformations of Αβ) may result in a substantial increase in plasma Αβ by protecting Αβ molecules from degradation. This effect was used to propose a potential "peripheral sink" hypothesis as a mechanism of action against Αβ immunotherapy (Demattos et al., 2001, PNAS 17:8850). Unlike 3D6, administration of 13C3 did not cause any increase in plasma Αβ content. This is consistent with the characteristics of the soluble monomer or oligomeric form of antibody 13C3 which is specific to the 原β-based fibril form and does not recognize the Αβ peptide. These forms are possible forms that are present in the plasma. Shell Example 11. Unlike the reference 3〇6 anti-Aβ antibody, 13C3 recognizes human-like powdered neuritic plaques (aggregation) in Ad brain rather than diffuse Aβ deposits using standard techniques, with 13C3 and 3D6 antibodies against humans. Brain histological sections diagnosed with Alzheimer's disease were subjected to immunohistochemical studies. Immunostaining with DAB chromogen detection antibody (Fig. 12). 13C3 marks a starch-like deposit with a typical morphology of mature amyloin neuritis plaques (also known as dense plaques), in which mature medullary neuritis plaques have extremely dense cores surrounded by lighter halos or Very strong staining for large plaques. In adjacent brain slices 139769.doc -58- 201038590 'as seen at lower magnification, 3D6 stains more targets than 13C3 (Figure 12' left image is further characterized at higher magnification (Figure 12, The image to the right shows that 3D6 and 13C3 mark the same mature amylin plaques' and additionally labeled a number of diffuse starch-like deposits that have traditionally been described using anti-Αβ immunolabeling. Diffuse plaques do not have as in the literature The fibril properties described are 'because they cannot be detected by thioflavin s (thi〇flavin illusion and other tissue markers) (Mann, 1989, Ann. Med. 21: 133). The difference in sensitivity between the two antibodies was similarly tested at a higher concentration (20 pg/ml) of 13C3 and again unable to detect diffuse deposits. This data is specific to the base fibril form of Αβ and is different from 3d6. The characteristics of the soluble monomer or the polymerized form of the antibody 13C3 which recognize the Αβ peptide are consistent. Industrial Applicability The present invention has application in the treatment and diagnosis of Alzheimer's disease. All publications cited in the specification (Patent Disclosure) Case and non-patent The opening of the file is intended to be within the skill of those skilled in the art, and all such disclosures are hereby to the same extent as each individual disclosure is specifically and individually indicated to be incorporated by reference. The manner in which it is recited is hereby incorporated by reference in its entirety in its entirety in its entirety in its entirety, the disclosure of the disclosure of the disclosure of Numerous modifications may be made to the illustrative embodiments and other configurations may be devised without departing from the spirit and scope of the invention as defined by the scope of the following claims. [Simplified Schematic] 139769.doc -59- 201038590 Figure 1 shows the process of Αβ fibril formation, which includes the formation of fibril oligomers; Figure 2Α-Β shows the process of Αβ fibril formation and purification at time 0 (Α) and 4 hours (Β) Αβ, such as The absorbance of the dissolved volume at mAU215 (absorption at 21 5 nm) is indicated. At 4 hours (B), the low molecular weight (LMW) form dissolves to about 15 kDa dimer, while the base fibril form size At about 67 Figure 3A-B shows the monoclonal antibodies 13C3(A) and 4G8(B) for Αβ-based fibrils (PF: and low molecular weight (LMW: form specificity, as by increasing concentrations of Αβ) The PF and LMW forms are indicated by the optical density (OD) read at 450/650 nm; Figures 4A-C show data from the Biacore® binding assay showing monoclonal antibodies 4G8(A), 13C3(B) and controls IgGJC) affinity for different concentrations of Αβ low molecular weight (LMW) form (0.25 pg/mL LMW Αβ to 4.0 pg/mL LMW Αβ); Figure 5 Α-Β shows identification of epitopes recognized by the above anti-Aβ antibody Information. Figure 5A illustrates Western dot blot analysis using a single antibody 13C3 (top plate), ID1 (middle plate), and 4G8 (bottom plate) for a series of overlapping 13 amino acid peptides as described in Example 5. Figure 5B illustrates the amino acid sequence of ΑβΝ42 (SEQ ID NO: 1), and the predicted epitopes of monoclonal antibodies 13C3 and 1D1; Figure 6 shows the monoclonal antibodies 13C3 (-«-) and 4G8 (j-) from The reactivity of the SEC dissolving fraction of the 7ΡΑ2 supernatant of the Αβ oligomer was secreted. The fibril 139769.doc -60-201038590 (PF) and low molecular weight (LMW) dissolving fractions are indicated on the X-axis as measured by optical density (OD) read at 450/650; Figure 7A-C Micrographs from thin section immunoelectron microscopy showing the affinity of monoclonal antibody 13C3 for repeating structures on Αβ fibrils (B, C) are shown. The control immunization ΕΜ is IgGJA); Figures 8A-B show data from electron micrographs showing that the representative TgCRND8 transgene is small after administration of the control IgGKA) antibody compared to the 13C3 monoclonal antibody (B). The number of plaques was reduced in mice; Figures 9A-B show that treatment of TgCRND8 transgenic mice with 13C3 monoclonal antibody reduced senile plaque formation by once-a-week (A) or twice-weekly (B) therapy; Figure 10 shows mAb The nucleotide and amino acid sequences of the selected light and heavy chain variable regions of 13C3; Figure 11A-B shows that unlike the reference antibody 3D6, short-term peripheral administration of 13c3 in APP transgenic mice is not Causes an increase in plasma Αβ; and Figure 12 shows that unlike the reference 3D6 anti-Αβ antibody, 13C3 recognizes (aggregates) human amylin plaques in the AD brain, rather than diffuse Αβ deposition 139769.doc -61 - 201038590 Sequence Listing &lt;ll〇&gt; Rockefeller University, USA &lt;120&gt; Antibody specific for the fibril form of β-amyloid protein &lt;140&gt; 098113213 &lt;141&gt; 2009-04-21 &lt;160&gt; 52 &lt;170&gt; Patentln version 3.5 &lt;210&gt;&lt;211&gt;&lt;212&gt;&lt;2]3&gt;&lt;400&gt;

Asp Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His His Gin Lys 15 10 15 o o

Leu Val Phe Phe Ala Glu Asp Val Gly Ser Asn Lys Gly Ala lie lie 20 25 30

Gly Leu Met Val Gly Gly Vai Val lie Ala 35 40 &lt;210&gt; 2 &lt;2!1&gt; 20 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 2

Asp Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val 】 5 10

Leu Val Phe Phe 20 &lt;210> 3 &lt;211&gt; 9 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 3

Phe Arg His Asp Ser Gly Tyr Glu Val &lt;210&gt; 4 &lt;211&gt; 12 &lt;212&gt; PR Ding &lt;2]3&gt; Homo sapiens &lt;400&gt; 4

Gly Tyr Glu Va! His His Gin Lys Leu Val Phe Phe ] 5 10 &lt;210&gt; 5 &lt;211&gt; 113 &lt;212&gt; PRT &lt;2Π&gt; Mus musculus &lt;400&gt; 5

Asp Val Val Met Thr Gin Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 139769 - Sequence Listing.doc 201038590 15 10 15

Asp Gin Ala Ser lie Ser Cys Arg Ser Gly Gin Ser Leu Val His Ser 20 25 30

Asn Gly Asn Thr Tvr Leu His Trp Ding Yi· Leu (Πη Lys Pro (i!y G’ln Ser 35 ' 40 45

Pro Lys Leu Leu lie Ding yr Thr Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Leu Lys He 65 70 75 80

Ser Arg Val Glu AJa G)u Asp Leu Gly Va! Ding yr Phe Cys Ser Gin Asn 85 90 95

Thr Phe Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys 100 105 110

Arg &lt;210&gt; 6 &lt;211&gt; 339 &lt;212&gt; DNA &lt;213&gt; Mus musculus &lt;400&gt; 6 60 120 ISO 240 300 339 gatgugtga tgaccciiaac iccacutcc ctgcctgica gu'ttggaga 丨caagcctc'c atctcttgca gatclggica gagccttgta cacagtaatg gaaacaccta Macaitgg laccigcaga agccaggcca gtclccaaag ctccigaict alacagtttc caaccgam tctggggtcc cggacaggtt cagtggcagt ggatcagggt cagatucac acicaagatc agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaaatac atttgttcct tggacgttcg gtggaggcac caagctggaa atcaaacgg

&lt;210&gt; 7 &lt;21]&gt; 115 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt;

Gin Val Gin Leu Gin Gin Ser Gly Pro Gtu Leu Va! Arg Pro Uly Val ] 5 10 15

Ser Val Lys lie Ser Cys Lys G!y Ser Gly Ding yr Thr Phe Thr Asp Ding yr 20 25 30 AJa Met His Ding rp Val Lys G]n See His Ala Ly.s Ser Leu Cilu Ding rp !le 35 40 45

Gly Val lie Ser Thr Lys Ding yr Gly Lys Thr Asn Tyr Asn Gin Lys Phe 50 55 60

Lys Gly Lys Ala Thr Mel Thr Va) Lyρ Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 139769 - Sequence Listing.doc 201038590

Met Clu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala lie Tyr Tyr Cys 85 90 95

Ala Arg Gly Asp Asp Gly Tyr Ser Trp Gly Gin Gly Ήίγ Ser Val Thr 100 105 110

Val Ser Ser 115 &lt;210&gt; 8 &lt;211&gt; 345 &lt;212&gt; DNA &lt;213&gt; Mus musculus &lt;400&gt;

60 120 180 240 300 345 caggiccagc tgcagcagtc igggcctgag ctggtgaggc ctggggtctc aglgaagatt tcctgcaagg gttccggcta cacattcact gattatgcta tgcactgggt gaagcagagt catgcaaaga gtctagagtg gattggagtt aitagtacta agtatgglaa gacaaactac aaccagaagt ttaagggcaa ggccacaatg aclgilgaca aaicciccag cacagcctat atggagcttg ccagatigac atctgaggat tctgccaict attactgtgc aagaggggac gatggttatt cctggggtca aggaacctca gtcaccgtct cctca &lt; 2) 0 &gt; 9 &lt;211&gt; 26 &lt;212&gt; PRT &lt;2Π&gt; Mus musculus &lt;400&gt; 9

Asp Val Val Met Thr Gin Thr Pro Leu Ser Leu Pro Val Ser Leu Gly ] 5 10 15

Asp Gin Ala Ser lie Ser Cys Arg Ser Gly 20 25 &lt;210&gt; 10 &lt;211&gt; 17 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt;

Leu His Ding rp Tyr Leu Gin Lys Pro Giy Gin Ser Pro Lys Leu Leu lie 15 10 】5

Tyr &lt;210&gt; 11 &lt;211&gt; 36 &lt;212&gt; PRT &lt;213> Mus musculus &lt;400&gt; 1 ]

Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly 15 10 15

Ser Asp Phe Thr Leu Lys lie Ser Arg Val Glu Ala Glu Asp Leu Gly 139769 - Sequence Listing.doc 201038590 20 25 30

Val Ding vr Phe Cys 35 &lt;210&gt; 12 &lt;2!1&gt;&lt;212&gt;&lt;213&gt; n PRT Mus musculus &lt;400&gt; 12

Phe Giy Gly Glv Thr Lys Leu Glu lie Lys Arg ) 5 】0 &lt;210> 13 &lt;2Π&gt;&lt;212&gt;&lt;213&gt; 11 PRT Mus musculus &lt;400&gt; 13

Gin Ser Leu Val His Ser Asn Gly Asn Thr Tyr I 5 10 &lt;210&gt;&lt;211&gt; 14 3 &lt;212&gt;&lt;213&gt; PRT Mus musculus &lt;400&gt;

Thr Val Se &lt;2]〇&gt; J5 &lt;211&gt;&lt;212&gt;&lt;213&gt; 9 PRT Mus musculus &lt;400&gt; 15

Ser Gin Asn Thr Phe Val Pro Trp Thr &lt;210&gt; 16 &lt;211&gt;&lt;212&gt;&lt;213&gt; PRT Mus musculus &lt;400&gt; 16

Gin Vai G)n Leu Gin Gin Ser Gly Pro Glu Leu Val Arg Pro Gly Va) 15 10 15

Ser Val Lys lie Ser Cys Lys 20 &lt;210&gt;&lt;2]1&gt;&lt;2]2&gt;&lt;2J3&gt; 17 Π PRT Mus musculus &lt;400&gt; 17

Met His Trp Vai Lys Gin Ser His Ala Lys Ser Leu Glu Trp lie Gly I 5 10 15 4- 139769 - Sequence Listing.doc 201038590

Val &lt;210&gt; 18 &lt;2I1&gt; 31 &lt;212&gt; PRT &lt; 2i3 &gt; artificial &lt;220&gt;&lt;223&gt; Isolation of heavy chain variable region of 13C3 or 13C3-like antibody &lt;400&gt;

Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu ] 5 10 15

Ala Arg Leu Thr Ser Glu Asp Ser Ala lie Tyr Tyr Cys Ala Arg 20 25 30 &lt;210&gt; 19 &lt;211&gt; 1] &lt;212&gt; PRT &lt;213&gt; Mus musculus

&lt;400&gt; 19

Trp G)y Gin Gly Thr Ser Val Thr Val Ser Ser 1 5 10 &lt;210&gt; 20 &lt;2I1&gt; 10 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 20

Giy Ser Gly Tyr Thr Phe Thr Asp Tyr Ala 10 &lt;210&gt; 21 &lt;2ll&gt; 17 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 21

He Ser Thr Lys Tyr Gly Lys Thr Asn Tyr Asn Gin Lys Phc Lys Gly 15 10 15

Lys &lt;210&gt; 22 &lt;211&gt; 6 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 22

Gly Asp Asp Gly Tyr Ser &lt;210&gt; 23 &lt;211&gt; 13 139769 - Sequence Listing.doc 201038590 &lt;212&gt; PRT &lt;2丨3&gt; Homo sapiens &lt;400&gt; 23 Asp Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His 1 5 10 &lt;2]〇&gt;&lt;211&gt;&lt;2I2&gt;&lt;213> 2413 Muscle &lt;400&gt; 24 Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His His 1 5 l 〇&lt;210&gt;&lt;211&gt;&lt;212&gt;&lt;213&gt; 25,3 智智&lt;400&gt; 25 Glu Phe Arg His Asp Scr G]y Tyr Glu Val His His Gin J 5 10 &lt;210&gt;&lt;;2]]&gt;&lt;212&gt;&lt;213> 26,3 £&lt;400&gt; 26 Phe Arg His Asp Ser Gly Tyr Glu Val His His Gin Lys 1 5 10 &lt;2)0&gt;&lt;211&gt;&lt;2)2&gt;&lt;2]3&gt; 2713 £&lt;400&gt; 27 Arg His Asp Scr Gly Tyr Glu Val His His Gin Lys Leu 1 5 10 &lt;210&gt;&lt;211&gt;&lt;212&gt;&lt;2)3&gt;&lt;400&gt; 28 His Asp Ser Gly Tyr Glu Val His His Gin Lys Leu Val 1 5 10 &lt;2]0&gt; 29 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens&lt;Micro)&gt; 29

Asp Ser Glv Tyr Glu Val His His Gin Ly^ Leu Va) Phc 】 ’ 5 】 〇 139769 - Sequence Listing. doc 201038590 &lt;210&gt;&lt;211&gt;&lt;2I2&gt;&lt;213&gt;&lt;400&gt;

Ser G!y Tyr Glu Val His His Gin Lys Leu Va] Phe Phe 】 5 10 &lt;210&gt; 31 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 31 G1y Ty r Glu Va1 Is His Gin Lys Leu Val Phe Phe Ala 10 o &lt;210> 32 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 32 Tyr Glu Val His His Gin Lys Leu Val Phe Phe Ala Glu 1 5 10 &lt;210&gt;&lt;211&gt;&lt;212&gt;&lt;213&gt; 3313 with wisdom &lt;400&gt; 33 Glu Val His His Gin Lys Leu Val Phe Phe Ala GIu Asp 1 5 10 〇&lt;210&gt; 34 &lt ;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 34 Va] His His Gin Lys] 5 Leu Val Phe Phe &lt;210&gt; 35 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 35 His His Gin Lys 1 Leu Va] 5 Phe Phe A]a &lt;210&gt; 36 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 36 His Gin Lys Leu Va! Phe Phe A!a Glu 10 10 13 9769 - Sequence Listing.doc 10 201038590 &lt;2i0&gt; 37 &lt;2Π&gt; 13 &lt;212&gt; PRT &lt;213 &gt;Homo sapiens&lt;400&gt; 37 Gin Lys Leu Val Phe Phe Ala Glu Asp Val Gly Ser Asn 1 5 10 &lt;210&gt;&lt;211&gt;&lt;21'2&gt;&lt;213&gt;3813PR&lt;400&gt; 38 Lys Leu Val Phe Phe Ala Glu Asp Val Gly Ser Asn Lys 】 5 10 &lt;2)0&gt;&lt;21!&gt;&lt;212&gt;&lt;213〉&lt;400> snPRT material 39

Leu Val Phe Phe Ala Glu Asp Val Gly vSer Asn Lys Gly 】 5 10 &lt;210&gt; 40 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 40 VaJ Phe Phe Ala G]u Asp VaJ Gly Ser Asn Lys Gly Ala 1 5 10 &lt;210&gt;&lt;2))&gt;&lt;2!2&gt;&lt;213&gt; nPRTi &lt;400&gt; 41 Phe Phe Ala Glu Asp Val Gly Ser Asn Lys Gly Ala lie 1 5 10 &lt;2!0&gt;&lt;211&gt;&lt;212&gt;&lt;213> 4213 PRT wise &lt;400&gt; 42 Phe Ala Glu Asp Val Gly Ser Asn Lys Gly Ala ilc lie 1 5 10 &lt;210&gt; 43 &lt;;211> 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400> 43 139769 - Sequence Listing.doc 201038590

Ala GJu Asp Val Gly Ser Asn Lys Gly Ala !Je lie Gly 1 5 10 &lt;2!0&gt; 44 &lt;21]&gt; 13 &lt;212&gt; PRT &lt;2丨3&gt; Homo sapiens &lt;400&gt; 44

Glu Asp Val Gly Ser Asn Lys Gly Ala He Me Gly Leu 1 5 10 &lt;210&gt;&lt;211&gt;&lt;212&gt;&lt;213&gt;&lt;400&gt;

Asp Val Gly Ser Asn Lys Gly Ala lie He Gly Leu Met 1 5 10 o ❹ &lt;210&gt; 46 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 46

Val Gly Ser Asn Lys Gly Ala lie lie Gly Leu Mel Val 1 5 10 &lt;210&gt; 47 &lt;211&gt; 13 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt;

Gly Ser Asn Lys Gly Ala lie lie Gly Leu Met Val Gly 1 5 10 &lt;2I0&gt; 48 &lt;211&gt; 13 &lt;212&gt; PRT &lt;2丨3&gt; Homo sapiens &lt;400&gt; 48

Ser Asn Lys Gly Ala lie lie Gly Leu Met Val Gly Gly 1 5 10 &lt;210&gt; 49 &lt;2]1&gt; 13 &lt;2!2&gt; PRT &lt;2i3&gt; Homo sapiens &lt;400&gt; 49

Asn Lys Gly Ala lie He Gly Leu Mel Val Glv Gly Val I 5 10 &lt;2I0&gt; 50 &lt;211&gt; 13 &lt;2!2&gt; PRT &lt;213&gt; Homo sapiens 139769 - Sequence Listing.doc 201038590 &lt;400&gt; 50

Lys Gly A!a IJe He Q]y Leu Mel Va] Gly Gly Val Vai 1 5 10 &lt;2i0&gt; 51 &lt;21 )&gt;&lt;212&gt;&lt;213&gt; 13 PR Ding Homo sapiens &lt;400&gt; 5]

Gly Ala He lie Gly Leu Mel Val Gly Gly Val Val lie 1 5 10 &lt;21ϋ&gt; 52 &lt;2I1&gt;&lt;212&gt;&lt;213&gt; 13 PRT Homo sapiens &lt;400&gt; 52

Ala lie lie Cly Leu Met Val Gly Gly Val Val He Ala 1 5 10 10· 139769 - Sequence Listing.doc

Claims (1)

201038590 VII. Scope of Application: 1. An isolated antibody that specifically interacts with a conformational epitope of the 原β peptide in the form of fibrils and exhibits measurable affinity, wherein the fibril epitope is determined by The exposed region of the Αβ-based fibril form indicates that the exposed region comprises the amino acid sequence set forth in SEQ ID NO: 2, wherein the antibody exhibits minimal or no affinity for the monomeric or dimeric form of the Αβ peptide. 2. The antibody of claim 1, which is a monoclonal antibody. 〇 3. A monoclonal antibody such as Kiss 2, which is a humanized monoclonal antibody. 4. The monoclonal antibody of claim 2 which is a human monoclonal antibody. 5. An isolated antibody that specifically interacts with a conformational epitope of the fibril form of the Αρ peptide and exhibits a measurable affinity wherein the basal fibril epitope is in the form of Αβ_based fibrils Exposed region, the exposed region comprising an amino acid sequence selected from the group consisting of SEQ ID Ν〇: 3 and seq ID NO. 4, wherein the antibody exhibits minimal monomeric or dimeric forms to the D peptide Or no affinity. 6. The antibody of claim 5 which is a monoclonal antibody. 7. The monoclonal antibody of claim 6 which is designated as 13C3. 8. The monoclonal antibody of claim 6, which is a humanized monoclonal antibody. 9_ The monoclonal antibody of claim 6 which is a human monoclonal antibody. The antibody of claim 5, which further comprises a variable light chain comprising the amino acid sequence set forth in SEQ ID NO: 5. U. The antibody of claim 5, which further comprises a variable heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 7. 139769.doc 201038590 12. The antibody of claim 5, which further comprises the CDR1 region set forth in seq [ο N〇: 13 , the CDR2 region set forth in SEQ ID NO: 14 and SEQ ID NO: 15 The variable light chain of CDR3 as set forth. 13. The antibody of claim 5, which further comprises a CDR1 region comprising seq id no: 20, a CDR2 region set forth in SEQ ID NO: 21, and a CDR3 set forth in SEQ ID NO: Change the weight chain. 14. A specific antibody that produces a repetitive conformational epitope binding to a fibrillar form of a beta-type amyloid peptide in vitro while exhibiting a minimal antibody with minimal affinity for the low-knife form of the beta-type amyloid peptide. The method comprises the steps of: (a) immunizing a mammal in the form of a fibril of a beta-type amyloid peptide; (b) collecting beta cells of the mammal; (0 generating a fusion tumor from the B cells collected therefrom; Wherein the fusion tumor produces an antibody; and (d) is selected to produce an antibody that specifically binds to the fibril form of the beta-type amyloid peptide while exhibiting minimal affinity for the monomeric or dimeric form of the beta-type amyloid peptide 15. A method of quantifying the amount of a fibrillar form of a beta-type amyloid in a tissue or liquid sample, the method comprising: (a) obtaining the tissue or liquid sample from the individual; (b) The tissue or liquid sample is contacted with the fibril form of the p-type amyloid peptide to specifically bind to the low molecular weight form of the probe powder peptide with minimal affinity to the antibody or fragment thereof; and (c) quantify the sample Beta-amyloid peptide Forms of the original amount of the fiber group. 139769.doc 201038590 19A6 monoclonal antibody composition of the group. 17. A method for detecting β_ charm, 'sails Including: wherein the antibody is selected from the group consisting of HC3, 1D1, and 16. The method of claim 15, wherein the dibasic fibril form simultaneously exhibits a minimal affinity for β-, the set of antibodies or fragments thereof In vitro and β-type amyloid base The kit of claim 17, wherein the antibody is a monoclonal antibody selected from the group consisting of 13C3-sex binding, 1D1 and 19Α6. a pharmaceutical composition for treating or preventing deposition of β-type starch fiber plaque in a mammal, comprising at least a pharmaceutically effective amount of a specific interaction with a fibril-based fibril form An antibody variable region fragment that inhibits the formation and deposition of amyloplasty plaques. 20. The pharmaceutical composition of claim 19, wherein the antibody is a monoclonal antibody. 21. The pharmaceutical composition of claim 20 wherein the monoclonal antibody is an antibody selected from the group consisting of 13C3, 19Α6 and 1D1. 22. The pharmaceutical composition of claim 2, wherein the monoclonal antibody is a humanized monoclonal antibody. 23. The pharmaceutical composition of claim 2, wherein the monoclonal antibody is a human monoclonal antibody. 24. A fusion tumor which secretes an antibody selected from the group consisting of 13C3, 19A6 &amp; iDi. 139769.doc 201038590 25. 26. 27. 28. 29. 30. 31. 32. 33. An isolated nucleic acid molecule, which is spliced, a variable A fragment of the horse early strain antibody 1 3 C 3 , wherein Variable heavy chain fragment package $chain package 3 The amino acid sequence set forth in SEQ ID NO: 7. Single "month" An isolated nucleic acid molecule, a fragment, wherein the nucleic acid molecule sequence. The variable heavy chain encoding the monoclonal antibody 13C3 comprises the nucleus of SEQ iD N〇: 8 in the recombinant injured host cell 矣 phase nD u, and the nucleic acid molecule of the strand fragment expresses the variable 隹 expression of the early strain antibody 13C3 The vector, wherein the expression vector comprises a primary heavy cell of claim 26, which exhibits a variable heavy chain of the single-transfer early antibody 13C3, wherein the host cell contains a vector as claimed. An isolated nucleic acid molecule which encodes a variable fragment of monoclonal antibody nc3, wherein the variable light chain fragment comprises the amino acid sequence of SEQ m N〇:. January An isolated nucleic acid molecule 'which encodes a variable fragment of a monoclonal antibody (10)' wherein the nucleic acid molecule comprises the SEQ ID N:6: nucleotide sequence. (A nuclear expression vector for expressing a single antibody 丨3 c 3 in a recombinant host cell, wherein the expression vector contains, for example, a nucleic acid molecule, a host cell which exhibits a single antibody 13C3 A variable light chain fragment, wherein the host cell comprises a expression vector as claimed in claim 31. A variable heavy chain fragment of an isolated monoclonal antibody 13C3 comprising the amino acid sequence set forth in ID NO: 7. 139769 .doc 201038590 34. A variable light chain fragment of an isolated monoclonal antibody 13C3 comprising the amino acid sequence of 卩IDID: 5 in 闱明. 35. a fibril form with a beta-amyloid peptide The use of specific interactions to inhibit the formation of β-class molluscing fiber plaques and the deposition of antibody variable region fragments, which are used to manufacture drugs for the treatment or prevention of plaque deposits in mammalian starch plaques 3. The use of claim 35, wherein the antibody is a monoclonal antibody. 37. The use of claim 36, wherein the monoclonal antibody is an antibody selected from the group consisting of 13C3, 19Α6, and idi. For example, the use of item 36 'Wherein the monoclonal antibody is a humanized monoclonal antibody. 9. The use of 3 out seeking entry 36, wherein the monoclonal antibody is a human monoclonal antibody. ❹ 139769.doc