TW201002826A - Method for quantitative analysis of transcripts with nucleotide polymorphism at specific site - Google Patents

Abstract

The present invention provides a quantitative method for assaying the expression ratio between alleles differed by a single nucleotide polymorphism. The present invention also provides a quantitative method for assaying the expression ratio between alleles differed by a single nucleotide polymorphism.

Description

201002826 IX. Description of the invention: [Technical field to which the invention pertains] The present invention is a method for quantitatively analyzing a ratio of expression of a variant having a single-nuclear polymorphism by quantitative polymerase chain reaction. [Prior Art] Germ cell mutations and somatic mutations cause many human diseases. Specificity (4) acid variability, such as mutations, insertions, deletions, and other transformations, can serve as a reference indicator for many diseases, including certain cancers. For example, mutations in the BRCA gene are known to be one of the features of breast cancer, and mutations in the p53 cell cycle regulatory gene are associated with many cancers, particularly colorectal cancer. Sidmnsky et al. have suggested that specific mutations may be used for molecular screening analysis as a basis for early detection of certain cancers (Science, 1992, 256: 102-105). Therefore, molecular screening assays have now evolved to detect whether certain mutations have occurred and to further confirm whether the subject is at high risk for the mutation-related disease. Ribonucleic acid (RNA) editing refers to the modification of specific sites on a ribonucleic acid molecule, including insertions, deletions, substitutions, and deformations of nucleotides. RNA editing such as selective deamin nucleoside (A to I) and selective deamination cytosine (C to U) can cause metazoan nuclear transcription and genomic DNA (DNA) BL Bass, RNA editing by adenosine deaminases that act on RNA,

Annu. Rev. Biochem. 71, 2002, 817-46; J.E. Wedekind, G.S. Dance, M.P. Sowden, and H.C. Smith, Messenger RNA editing in mammals: new members of the APOBEC family seeking roles in the family business, 5 201002826

Trends Genet" 2003, 19: 207-16). Many protein-containing captures (these proteins contain neurotransmitter receptors, ion channels, coat proteins of hepatitis D virus, and catalyzable RNA editing (A to I) ) one of the enzymes ^^ and so on) in a specific position

The dots were modified with A to I edits (PH Seeburg, M. Higuchi, and R. Sprengel, RNA editing of brain glutamate receptor channels: mechanism and phvsiologv Brain Res. Brain Res. Rev., 1998, 26: 217-29; SM , Rueter, TR Dawsf^ and RB Emeson, Regulation of alternative splicing by RNA editing,

Nature, 1999, 399: 75-80). Since I will be recognized as G, the (10) eight edits of the aforementioned transcript will affect the splicing of the pre-mRNA and the subsequent splicing.

The sequence that was translated. The A to I editing of RNA is often incomplete, resulting in a heterogeneous RNA coexistence of A or I(G) at a particular site' and producing protein isomers with different properties. A to I editors also modify non-coding regions and microRNA precursors and affect the production and activity of these RNAs (W. Yang, T.P. Chendrimada, Q. Wang, M.

Higuchi, PH Seeburg, R. Shiekhattar, and K. Nishikura, Modulation of microRNA processing and expression through RNA editing by ADAR deaminases. Nat. Struct. Mol. Biol., 2006, 13: 13-21; Y. Kawahara B. Zinshteyn , P. Sethupathy, H. Iizasa, AG Hatzigeorgiou, and K. Nishikura, Redirection of silencing targets by adenosine-to-inosine editing of miRNAs,

Science, 2007, 315: 1137-40). The activity of RNA editing is not only affected by developmental stage and tissue specificity, but also by pathological conditions (S. Maas, Y. Kawahara, KM Tamburro, and K. Nishikura, A-to-I RNA Editing and Human Disease RNA Biol., 2006, 3: 1-9). A number of methods have been developed to quantify how many of the amplicons in the reverse transcript PCR (RT-PCR) are edited transcripts. For example, sequence analysis or the limited primer extension with double deoxynucleotide 6 201002826 (dideoxynucleotide) is widely used to quantitatively measure RNA editing efficiency (H.H. Schiffer, and S.F.

Heinemann, A quantitative method to detect RNA editing events, Anal. Biochem., 1999, 276: 257-60; LP Keegan, J. Brindle, A. Gallo, A. Leroy, RA Reenan, and MA O'Connell, Tuning of RNA editing by ADAR is required in Drosophila, EMBO J., 2005, 24: 2183-93). However, these methods are costly and labor intensive, and sometimes require cloning or the use of radioactive isotopes. Another method is to limit the enzyme assay, which can be applied when RNA editing changes the recognition sequence on the enzyme (S_M. Belcher, and JR Howe, Characterization of RNA editing of the glutamate-receptor subunits GluR5 and GluR6 in granule cells during cerebellar Development, Brain Res. Mol. Brain Res, 1997, 52: 130-8 ) 'However, this method can only detect j^a editing sites on the restriction enzyme recognition sequence. In addition, there are other methods for analyzing nucleic acids by detecting one or a few nucleotide differences in a sequence, such as a ligase chain reaction (LCR), a ligase detection reaction, and a mutant dual gene specificity. PCR-mutant allele specific amplification (PCR-MASA) (U.S. Patent Publication No. US 2008/0075662), and single strand conformation polymorphism and the like. SUMMARY OF THE INVENTION As used herein, the term "allele" encompasses different nuclear faces, usually representing another or a plurality of other types of a gene; - there may be two different genotypes for a dual gene ( Alleles), the products or functions encoded may vary in quantity and nature. 7 201002826 Here, the vaginal vafiants are used to mutate the sequence of different genotypes with or without known functional differences. The term "3, a fully complementary complex nucleotide" as used herein means that the designed nucleoside primer has a 'terminal 3 nucleotide, except for the most 3' nucleotide, which can be completely different from the different variant sequences. Complementary. The term "unstable non-complementary nucleus (IV)" as used herein means the substitution of one or more internal non-complementary nucleotides in a previously complementary primer sequence, disrupting the stability of base pairing between the primer and the template. The term "completely complementary nucleotide sequence at the 5' end" as used herein means that the most 5, the end sequence can be complemented by all variants. The fully complementary crane at the 5' end can be adjacent to the "unstable thief" and then the "3' end completely lion complex (four) acid or directly connected to the "3' end fully complementary complex nucleotides". The term "RNA editing" as used herein refers to a modification at a specific site of an RNA molecule by insertion, deletion, or deformation of a nucleotide comprising deamination of the gland (tetra) (A) to a nucleoside ( I) Deamination of cytosine (C) into uracil (u). The present invention provides a solution-based and cost-effective green, by differentially amplifying variant mRNAs translated from different genotypes by means of differential-inducible primers, to quantify different genotypes (or edited and Unmixed _Α) formed by the mixed nucleotide variation of the 201002826 type of a variant (or unedited variant milk ~ ratio. This method does not require pure replication, or to make the positional, while saving manpower And time requirements. The present invention therefore provides a method for quantitatively analyzing the performance ratio of variants having different mono-nucleic acid polymorphisms, comprising: U) designing a variant based on a single-variant gamma neophase - (iv) scorpion, its 3' to 5' end is a 3, a hydroxy-variant-specific nucleotide, a 3, a fully complementary complex nucleotide, and a 5, fully complementary complex nucleoside An acid in which a variant-specific nucleotide is derived from a known single nucleotide polymorphic site; (b) a quantitative polymerase chain reaction is performed using a combination of general primers on which both variants are attached to obtain the entire Number of transcript molecules; (c) Quantitative polymerase chain reaction using a primer in a variant specific primer and a general primer combination to obtain the number of molecules of a single variant transcript; and (d) dividing the number of molecules of a single variant transcript by the total number of transcripts The number of body molecules to calculate the frequency of performance of a single variant. In a preferred embodiment, the polymerase chain reaction is quantified by quantitative polymerase chain reaction (qPCR) using cybrin stain (SYBr Green) or instant polymerase chain using Tekman probe (TagMan). Reaction (realtime PCR). The method of the invention can be applied to microRNA detection, gene expression, disease gradient, cancer diagnosis or mononuclear acid polymorphism. 9 201002826 The present invention further provides a method for quantitatively analyzing a ratio of expression of variants having different single nucleotide polymorphisms, comprising: (a) designing a variant specific primer based on the nucleotide sequence of a single species 3, the end to the 5' end is a 3, a hydroxyl terminated variant specific nucleotide, a string of 3, a fully complementary complex nucleotide, at least one of the primers causes unstable non-complementary nucleotides And a fully complementary nucleotide at the 5' end, wherein the unstable non-complementary nucleotide acid dual gene is selected from upstream 3, 4, 5, 6 of the 3'-end nucleotide-specific nucleotide or 7 nuclear swearing and doing transgenic or transversion substitution, in which the variant specific nucleotide is derived from a known single nucleotide polymorphic site; (b) using two variants Quantitative polymerase chain reaction is performed on a combination of general primers to obtain the total number of transcript molecules; (c) Quantitative polymerase chain reaction is performed using a variant specific primer and a primer in a general primer combination to obtain a quantitative polymerase chain reaction. The number of molecules of a single transcript variant; and (d) the number of molecules of a single transcript variant molecules divided by the total number of transcripts, to calculate the frequency performance of a single variant. In a preferred embodiment, the "unstable non-complementary nucleotide" is located upstream of the 3, 4, 5, 6 or 7 nucleotides in the 3' nucleotide of the variant 蜇-specific primer. In a more preferred embodiment, the "unstable non-complementary nucleotide" is located at the 4th, 5th or 6th nucleotide upstream of the variant 蜇-specific primer 3, the terminal nucleotide. 201002826 In the preferred embodiment, the primer has two "constant unstable * complementary nuclear bitter acid". In a better implementation, the primer has a "non-complementary nucleotide that causes instability." In a preferred embodiment, the polymerase chain reaction is an instant quantitative polymerase chain reaction using Saibai Green stain (SYBR Green) or an instant quantitative polymerase chain reaction using a Tekman probe (TagMan). The method of the invention can be applied to microRNA detection, gene expression, disease gradient, cancer diagnosis or mononuclear acid polymorphism. [Embodiment] The present invention may be embodied in different forms and is not limited to the examples mentioned below. Example 1: Materials and Methods Preparation and amplification of a complementary deoxyribonucleic acid (cDNA) template for quantitative analysis The developmental period is expressed as the hour after fertilization (hpf, hour postfertilization) and the number of days after fertilization (dpf, day postfertilization) at 28.5 °C. The zebrafish ren_o) embryo was collected at the 15th minute after the start of the photoperiod and defined as 〇 hpf at this time. All RNA was extracted with the RNeasy kit (Qiagen) and the first deoxyribonuclease (DNasel) was applied. Next, oligonucleotides T (oligo-d(T)) and random hexamers (rand〇m hexamer) were used as primers, and RNA was reverse transcribed by Superscript III reverse transcriptase (Invitrogene) (1 to 201002826 5 μg). 20 microliters of reaction mixture containing 1 microliter of cDNA, 20 micromoles primer, 4 deoxyribonuphosphate (dNTPs) at a concentration of 200 micromoles, and potassium carbonate at 50 millimolar , 10 millimolar concentration PH=8.3 tris-hydroxymethylamino decane-hydrochloric acid buffer (Tris-HCl), 1.5 millimolar concentration of magnesium chloride, and 0.5 unit high accuracy KOD-plus DNA polymerase (Toyobo ). When purification of the RT-PCR amplicon is not required, the reagent amount and reaction volume are halved. The reaction was allowed to proceed for 35 cycles (94 ° C for 10 seconds, 55-60 ° C for 20 seconds, 68 ° C for 1 minute)' and finally extended at 68 ° C for 10 minutes.

A1 primer (SEQ ID NO: 5'-GGAATGGCATGGTTGGAGAACTGG-3') derived from the sense and antisense sequences of exons 10 and 12, respectively, and A2 primer (SEQ ID NO 2: 5'-ACACCACCAACTATACGGCCAGACAA-3) ') is used to amplify the message RNA ( W.-H. Lin, Wu, C.-H, Chen, Y.-C. and

Chow, W.-Y., Embryonic expression of zebrafish AMPA receptor genes: zygotic gria2a expression initiates at the midblastula transition. Brain Res.

1110 (2006) 46-54). The complementary DNA containing the Y/C site (ie gWMa) on the zebrafish kainite receptor subunit uses the K1 primer (SEQ ID NO 3: 5'-AGCTGATCTTGCAGTGGCGC-3') and the K2 primer (SEQ) ID NO 4: 5 '-GGCCGTGTAGGAGGAGATGATG-3 ') to amplify. The PCR amplicons were separated by 2% gelatin electrophoresis and purified by Geneclean (BiolOl). Here's another way to use a 2% low melting point gelatin gel electrophoresis (SeaPlaque, Bio Whittaker Molecular Applications) to isolate PCR amplicons, which can be used for real-time quantitative polymerase chain reaction analysis without cutting and washing. Further purification is required. When the 12th 201002826 is performed, the fixed-polymerized scale lock reaction is first read by RT_PCR to amplify the lion. The results of the jy^A editing frequency obtained from the purified amplicon or the unpurified amplicon directly cleaved by the colloid were similar, with only a difference of less than 2% (data not shown). DNA template for the pure line replication and preparation control group First copy the PCR amplicon pure line to the pGEMTeasy (Promega) vector, followed by

The Bigdye terminator system (Applied Biosystems) is sequenced and confirms the A and G variants on steps 2« and 皮说2«. The plastids with the edited G and unedited A variants were cut into linear lines with appropriate restriction enzymes and washed with phenol (phen〇1) or chloroform. The DNA concentration was measured spectrophotometrically. Quantitative polymerase chain reaction analysis An instant quantitative polymerase chain reaction (qpcR) was performed using SYBR Green Master Mix and in accordance with its instructions (Applied Biosystems). The primer pair was designed using PrimerEXpress (Applied Bi〇systems), the smear temperature was set to 60 ° C, and the length of the amplicon was kept within the range of 8 〇 to 1 验. Table 1 shows the sequence of the instant quantitative polymerase chain reaction primer. The total volume of the reaction was 1 〇 microliters, where each primer was 800 femtomol. The Ct value is measured using the pRISM 75〇〇TM Sequence Detection System (default setting). Initially, 2 minutes at 5 °C and 10 minutes at 95 °C, then set 1 hour at 95 °C and 6 minutes at 6 ° 〇c for 45 cycles. However, the reaction usually reaches the plateau period before the 30th cycle, and the reaction of 35 Jade clothes is sufficient. Amplification of 13 201002826 single product was confirmed by dissociation analysis after the reaction. The sample is repeated twice and the final result is the average. If the two replicated samples show a difference above 0.3 Ct, they are re-measured. Table 1 Sequence of the instant quantitative polymerase chain reaction primer used in the present invention (5'-3') a Use b AU3 TCTTCCTCGTTAGCCGCTTC Pre-general primer AU4 CAAAGACCTTGGCGAAATATCG Reverse general primer A2Q1 CGAAATATCGCATCCCTGCT Unedited form of reverse KU3 TCCAAACCCTTCATGACGCT pre-general introduction KU4 CAGCACACAACTGACACCCAA reverse general primer K2Y1 GCACACAACTGACACCCAAGT unedited form s 2α reverse primer K2Y2 CAGCACACAACTGACACTCAAGT unedited form gr 2α reversed introduction K2Y3 CAGCACACAACTGACACTTAAGT unedited form gr recognized 2α reverse The primer K2Y4 CAGCACACAACTGACACCTAAGT unedited form recognizes that the reverse index of 2« is drawn at the bottom line to cause unstable non-complementary base positions. The position of a single base variant is marked with a gray background. The relative position of the primers is shown in Figure 1B. Measurement of RNA editing frequency by qPCR The amplification efficiency (standard curve) of the parent primer pair can be constructed by measuring the ct value of the linear dilution DNA template of series dilution. In the simulation experiments, the amount of DNA containing the A and G variants was determined by universal primers, respectively. Next, a known amount (predicted number of molecules) of the A and G variants were mixed at different ratios, and qpCR analysis was performed. In order to determine the RNA editing frequency, the number of products of RT_pcR is first determined using a universal primer, 14 201002826 so every qPCR analysis will use about! The microgram amplicon is such that the value of the ^ is about 17. In addition, the same number of RT_PCR amplicons are quantified by a specific primer pair and a universal primer pair. By substituting the Ct value into the formula of the standard curve, A can be calculated. The number of variant molecules and the total number of molecules (A and G variants). The equation is l〇g[gn.fl2cc(A) number of molecules]=-〇.314Ct+10.74, l〇g[gnii2a number of molecules]=- 0.3005Ct+10.655, \og[grik2a(A) number of molecules]=-〇.297Ct+l5.72407, and log[number of 汝2α molecules]=_0.30178Ct+15.724. 1- (Α 分子 分子 分子 / The value of all molecular numbers is the RNA editing frequency.Example 2: Measurement of the editing frequency by quantitative polymerase chain reaction Figure 1 shows the procedure for determining the RNA editing frequency at a specific site using qPCR. The translational body with the edited site. The rt-PCR amplicon is a mixture of A (unedited) and G (edited) variants. After running the electrophoresis, the amaranth containing the RT_pcR amplicon is cut. Bars (Fig. 1A). The number of RT-PCR amplicons is quantified by the universal primer pairs on both the A and G variants, and the A variant of the RT-PCR amplicon is pre-positioned. Universal primers and A-specific inverted primers were quantified (Fig. 1B). The most 3' end of the A-specific primer was placed at the edited position to differentially amplify (quantify) the A and G variants (Figure 1B and Table). 1) The method and primer for measuring the RNA editing frequency of the Q/R site and the Υ/C site of zebrafish have been established. Compare the amplification of A-specific primer pair (AU3-A2Q1) 15 201002826 Efficiency and generality The amplification efficiency of the primer pair (AU3_AU4) on the octagonal and 〇 variants of the template can be used to evaluate the performance of the qPCR primer pair (Fig. 2Α). The universal primer pair and the α-specific primer pair are displayed on the complete __template. The same amplification efficiency, in which the Α-specific primer pair (secret 2φ) is in the fully complementary Α variant (unedited Q form) than the incompletely complementary G variant (edited R form, Figure 2α) The 'efficiency is 32 times higher (Λα=-5). In terms of f, the eight-specific primer pairs (10)3_Κ2Υ1) are amplified with the same efficiency (4) 2« Α variant (unedited γ form) and G Variant (edited c form), which means that the strip only has 3, the end has no __ Κ 2 Υ 1 trait, it can not be distinguished It is a variant on the γ / e editing (data not shown). Non-complementary nucleotides (K2Y2, K2Y3, and K2Y4, Table 1) were placed inside the Α-specific primer. Κ2γ2, Κ2γ3 and Κ2Υ4 contain 丨 or 2 non-complementary nucleotides which cause pairing instability within a few nucleotide intervals upstream of the 3' end. Two concentrations of template were used to test the ability of these primers to distinguish between the Α and G variants (Table 2). The specificity of the a-specific primers containing the internal non-complementary amplification 2 (%, the A variant is more efficient than the amplification 0 variant). However, compared to the amplification efficiency of the universal primer (KU4), The amplification efficiency of the non-complementary primers containing the internal and A variants is 1-12 times less (Table 2). The standard curve established from the universal primer pair (KU3_KU4) and the a-specific primer pair (KU3-K2Y1), It can be confirmed that the K2Y4 primer containing the internal non-complementary nucleotide can distinguish the A and G variants of gr/^2a (Fig. 2B). 16 201002826 Table 2 Internal non-complementary nucleotide acid to amplify (4) 2β at the Y/c position Effects of a and g variants ~ (concentration a) KU4 A variant (high) 15.12 G variant (high) 15.16 A variant (low) 19.81 G variant (low) 19.82

Ct value _K2Y2 K2Y3 T7.95 17.94 20-54 30.09 20.29 23.44 25.76 36.87 K2Y4 ΙόΤ" 22.87 20.47 28.13 The amount of DNA at a constant concentration is about 5 times that of a low concentration of DNA. f Also use a mixed template with a non-rate A, G variant to evaluate the performance of the a-specific primer pair. The estimated value or age of the A change ratio is converted into the turn-up rate (the number of mutated molecules/the total number of molecules), and then compared with the actual value of the ratio of the G variants in the mixed eDNAs. The fresh 峨 翻 翻 翻 shows the linear relationship of the job towel (r > 0·98, Figure 3). These results confirm that genotype (variant) specific primers, whether or not they have internal unstable non-complementary nucleotides, can be designed to determine the frequency of expression of the tested translation, in which the interpreters come from two The single-nuclear-differenced dual-gene has a trustworthy distinction. Reproducibility of qPCR analysis The reproducibility of this method was tested by measuring the proportion (edit frequency) of a variant of the amplicon obtained by 6 independent RT-PCRs of the same batch of RNA. The average edit frequency of the 2a mRNA in the RNA extracted from the 24 hours after fertilization was 4〇 9%, and the standard 17 201002826 was 1.0/. 'The editing frequency of the devil's extract extracted from the embryos 4 hours after fertilization is 62.3 ± 3.2% (mean standard deviation); the Q/R Rna editing frequency of the milk-derived mRNA extracted from the embryos after the fertilization is 9 i 2 ± 〇 8% ( n = 3 ). These results confirm that the method (3) is highly reproducible. Example 3 Comparison of RNA editing frequency determined by qPCR and rna editing frequency determined by primer extension method According to Lin et al_ (W.-H. Lin, Wu, C.-H, Chen, Y.-C· and Chow, W.-Y.,

The method of Embryonic expression of zebrafish AMPA receptor genes: zygotic eria2 expression initiates at the midblastula transition. Brain Res. 1110 (2006) 46-54) performs a finite primer extension to determine the q/r editing frequency of the buckle. Briefly, an primer extension reaction consists of a 1 〇 micromolar number with a labeled nucleotide at the end, a gnVi2ocPCR amplicon purified by gel, 1 〇〇 nanogram, and 3 units of Klenow enzyme (Klenow enzyme). (Roche)), 1 mM concentration of dideoxy-GTP, and deoxythymidine triphosphate (dTTP), deoxycytidine tri-acid, both at 0.1 millimolar (dCTP) and deoxyadenosine tri-acid (dATP). The edited and unedited variant extension products (having only one differential nucleotide acid) were resolved at 8 molar concentrations of urea/20% polyacrylamide gel electrophoresis. The intensity of the modified and unedited variant extension products was calculated and quantified using autoradiography and UN-SCAN-IT gelTM version 5.1 software. 18 201002826 Using qPCR / 疋 9 9 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎 胚胎The eighth edition of the editorial meeting will be higher than the q editing (four) RNA editing frequency. The average difference in RNA editing terms between the two methods is 3%. When the editing frequency is higher than 9〇%, the average difference will be less than 2% (Fig.*, sample π). A higher average difference (4.86%, n=6) occurs when the q/r editing frequency is between 62-75% (Figure 4, samples 1-6). The efficiency correlation between the RNA editing frequencies measured by the two methods is 〇 96. Most importantly, the rank order of RNA editing efficiency (rank 〇rders) is the same in both methods (Fig. 4). The qpcR method is the same as the primer extension method, which can be used to analyze changes in RNA editing activities. . Using qPCR with internal non-non-complementary primers and applying Y/C editing frequency in Quantitative Biological Samples qPCR method was used to analyze the surface editing of zebrafish development (10) μ at the Y/c locus (Fig. 5A). 24 hours after fertilization, there is about 44.6 ° /. The gr/A:2ct mRNA was edited (C at the γ/c site) and there was a significant increase in editing at the γ/c site 24-48 hours after fertilization. The γ/c edit reached 54.4±5 45% (n=5) 48 hours after fertilization and remained relatively stable during the subsequent developmental phase. The #2' amplicon was also analyzed by direct sequence analysis. The sequencing method used an internal primer (SEQ ID NO 3: 5, AGCTCATCTTCeAarGCjeGC: 3') to purify the RT_PCR amplicon with mgdye termination subsystem sequencing (Applied Biosystem) to estimate the coffee at the γ/c site. Eight editing frequencies. Figure 5B is a representative diagram of 19 201002826. Consistent with the results of the qPCR analysis, the ratio of G to A peaks derived from amplicons in the brain would be souther than the ratio of g to A peaks at 24 hours after the party sperm (Fig. 5B). The present invention has been described in detail with reference to the embodiments of the present invention, and the invention may be Spirit and scope. Any person skilled in the art can obtain sufficient knowledge from the present invention to carry out the subject matter of the invention, achieve the object, and obtain the benefits mentioned or implied in the invention. Those skilled in the art will be able to make modifications or other applications which are included in the spirit of the invention and are defined in the scope of the claims. [Simple illustration of the diagram] Figure - is a flow chart for the quantitative analysis of the polymerase chain reaction of riboseuclear (RNA) ugly rate. A. Steps for quantitative analysis of polymerase chain reaction. B: Relative position of the polymerase chain reaction primer. The arrow is referred to as the adhesion point of the quantitative polymerase chain reaction (qPCR) primer. Figure 2 shows the amplification efficiency of the A-(4) subpair and the general primer pair. Eight: The standard curve established by (4) template. B: The standard curve established by the clock 2M board. The solid line and the dotted line indicate the amplification efficiency of the A#-sex pair (open triangle) and the general pair (solid circle) on the A and G variant templates, respectively. Figure 3 shows the frequency of the occupational RNA and the measured rna scales _. Legs 20 201002826 The frequency can be calculated from the qPCR analysis results (real _ rate), and the % is plotted on the graph and compared with the known ratio of the A and G variants (expected solution) ^ _ shows the expected (10)a There is a linear relationship between the editing frequency and the measured RNA editing frequency. Virtual _ shows the expected linear relationship. Figure 4 shows the comparison between the RNA obtained by qPCR, the editing frequency and the editing frequency of the limited primer analysis. The real <read and open bars represent the RNA editing frequency of the n-a2a at the Q/R site, respectively, obtained by the qPCR entanglement amplification method. Figure 5 shows the edit of ge in the development of zebrafish: 2α on Y/c. (A) qPCR analysis of the obtained γ/c editing frequency. The result values are mean ± standard deviation. Except for 72 hours after fertilization and three independent samples of adult fish brain, the number of samples in the rest was more than five. The month of the month is expressed as the hour after fertilization (hpf, hour postfertilization) and the number of days after fertilization (dpf, day postfertilization). Statistical analysis was performed using Student's 丨 test. The asterisk indicates a significant difference from the 24 hour RNA editing frequency after fertilization (p<〇 〇 5). (B) Representative sequence analysis map. 21 201002826 [Sequence List] <110> National Tsinghua University <120> A method for quantitatively analyzing nucleotide polymorphic transcription at a specific site <130> 0744-NTHU-US <160> 13 <170 〉 Patentln version 3.4 <210><211> 1 24 ^ <212> DNA <213> Zebrafish (Danio rerio) <220><221> primer-bind <222>(1)"(24)<400> 1 ggaatggcat ggttggagaa ctgg 24 <210> ξ 2 \ <2Π> 26 <212> DNA <213> Zebrafish (Danio rerio) <220><221> primer-bind <222>;(1)"(26)<400> 2 acaccaccaa ctatacggcc agacaa 26 l 201002826

<210> 3 <211> 20 <212> DNA <213> Zebrafish (Daniorerio) <220><221>primer-bind<222> (1)..(20) / \ &lt ;400> 3 agctgatctt gcagtggcgc

<210> 4 <211> 22 <212> DNA <213> Zebrafish (Danio rerio) <220><221> primer bind <222> (1)..(22) <400>; 4 ggccgtgtag gaggagatga tg

<210> 5 <211> 20 <2I2> DNA <213> Zebrafish (Danio rerio) <220> <221> primer-bind 201002826 <222> (1)..(20) <;400> 5 tcttcctcgt tagccgcttc

<210> 6 <211> 22 <212> DNA 〆' <213> Zebrafish (Danio rerio) <220><221><221> primer-bind <222> (1)..(22) <400〉 6 caaagacctt ggcgaaatat eg

<210> 7 <211> 20 <212> DNA <213> Zebrafish (Danio rerio) <220> <221>primer-bind <222> (1).. (20) < 400〉 7 egaaatateg catccctgct <210〉 8 <211> 20

DNA <212> 201002826

<213> Zebrafish (Danio rerio) <220><221>primer-bind<222> (1)..(20) <400> 8 tccaaaccct tcatgacgct <210> 9 <211> 21 <;212> DNA <213> Zebrafish (Danio rerio) <220><221>primer-bind<222> (1)..(21) <400> 9 cagcacacaa ctgacaccca a <210> 10 <;211> 21 <212> DNA <213> Zebrafish (Danio rerio) <220><221>primer-bind<222> (1)..(21) <400> 10 gcacacaact gacacccaag t 20 21 21 4 201002826 <210> 11 <211> 23 <212> DNA <213> Artificial sequence <220><223> Modified from zebrafish (Danio rerio) <220><221> primer -bind <222> (1)..(23) <400> 11 cagcacacaa ctgacactca agt 23 <210> 12 <211> 23 <212> DNA <213> Artificial sequence f <220>;223> Modified from zebrafish (Danio rerio) <220><221> primer bind <222> (1)-(23) <400> 12 cagcacacaa ctgacactta agt 23 <210〉 13 5 201002826 <211> 23 <212> DNA <213> Artificial sequence <220><223> Dependent from zebrafish (Danio rerio) <220> <221> primer bind <222> (1)-(23) f <400> 13 cagcacacaa ctgacaccta agt 23 .1' t. vy 6

Claims (1)

201002826 X. Patent application scope: 1. A method for analyzing the expression ratio of variants with different single nucleotide polymorphisms, including: · U) designing a nucleotide sequence based on single-variant Variant-specific scorpion scorpion, whose 3, end to 5' end is a 3, a hydroxy-variant-specific nucleotide, a 3, a fully complementary complex nucleotide, and a 5, fully complementary a complex nucleotide in which the variant specific nucleotide is derived from a known single nucleotide polymorphic site; (b) a quantitative polymerase chain reaction is performed using a combination of general primers that both variants are attached to. To obtain the total number of transcript molecules; (c) use a variant specific primer and a primer in a general primer combination to quantify the polymerase chain reaction to obtain the number of molecules of a single variant transcript; and (d) a single The number of molecules of the variant transcript is divided by the total number of transcript molecules to calculate the frequency of expression of the single variant. 2. According to the method described in item 1, the towel synthase should be used by the SYBR G_ quantitative polymerization reaction (quant ve pCR (qPCR)) or Quantitative polymerase chain reaction of Tekman probe (TagMan) (4) _ PCR) 〇 3 · Root shots Μ ! Li Xu green, its surface for micro (10) recording, gene expression, disease, grade (disease gradient), Cancer diagnosis or mononuclear acid polymorphism. 4. - Quantitative analysis of methods with different single-coating type performance ratios, 201002826 contains: (a) Designing a variant specificity primer based on the nucleotide sequence of a single species, 3, end to 5 'End-order is a 3'-terminal hydroxy variant-specific nucleotide, 3, a fully complementary complex nucleotide, at least one non-complementary nucleotide that causes instability, and a complex nucleus with 5, fully complementary Glycosyl acid, wherein the non-complementary nucleotide is selected from the 3, 4, 4, 5, 6 or 7 nucleotides upstream of the terminal hydroxyl-specific variant 111 nucleotide and is subjected to homologous or heterogeneous substitution (transition) Or transversion substitution), wherein the variant specificity is derived from a known single nucleotide polymorphic site; (b) quantitative polymerase chain reaction is performed using a combination of two primers To obtain the total number of transcript molecules; (c) use a variable frequency specific primer and a general primer combination to perform a quantitative polymerase chain reaction to obtain the number of molecules of a single variant transcript; and (4) The molecule of the single-mutation bribe The number of miscellaneous molecules is divided by the number to calculate the frequency of performance of the single variant. 5. According to the method described in item 4 of the heart tina na, the towel causes the * stable non-complementary nuclear acid duality gene line to be selected from the 3rd, 4th, upstream of the 3, end variant specific nuclear acid order. $, 6 or 7 nucleotides. 6. The method of claim 5, wherein the non-complementary nuclear acid causing *stability is selected from the upstream 4th, 5th or 6th acid in the 3' end-of-strain variant-specific (tetra) acid. . 201002826 7. Non-complementary nucleotides according to the method described in claim 4 of the patent application. Wherein the primer has two non-complementary nucleotides which cause instability 8. The method according to item 7 of the patent application. Among them, the primer has a method of causing an unstable f 9. root shot, please refer to the full-time _ 4 item, the enzyme synthase should be used in a quantitative polymerase chain reaction using cybrin dye (SYBR G swell) or Instant polymerase chain reaction of the Newman probe (TagMan). 10. The method according to claim 4, which is applied to micro-cafe detection, gene expression, disease gradient, cancer diagnosis or single nucleotide polymorphism.