TW200540276A - Immobilization of bead-displayed ligands on substrate surfaces - Google Patents

Abstract

Disclosed are two different approaches for immobilization of beads on a substrate, one of which involves forming a bead-nanoparticle composite by cross-linking of the bead mixtures with nanoparticles. The other method involves surface modification of the substrate, using multi-layered polyelectrolytes. With either method, the beads are immobilized on the substrate in a manner suitable for viewing, as when the beads are used in assays and need to be analyzed following the assay. Different designs of depressions are also disclosed, some of which are suitable for holding beads in place without any deposition of nanoparticles or polyelectrolytes.

Description

200540276 IX. Description of the Invention: Related Applications This application claims priority to US Provisional Application No. 60 / 478,01 1 filed on 6/12/2003. [Technical Field to which the Invention belongs] The disclosed methods are two different methods of immobilizing beads on a substrate. One of them involves forming a bead-nanoparticle combination by cross-linking the bead mixture with the nanoparticle. The other method involves surface modification using multilayer polyelectrolytes. Background [Prior art] Microarrays have become widely used for proteomics and genomic analysis because of their diverse analysis of many analytes. 3, eg, Ramass, Biotechnol., 16, 40.44 (1988); P. BroWn, D. Botstein,

Nat. Genet., 21, 33-37 (1999); D. Duggan, M. Bittner ^ Y. Chen, P. Meltzer > JM Trent «Nat. Genet_, 21, 10.14 (W9); R. UpshutZ, SPA Fodor, TR Pharmacist, D. J. Lochart 'Neway, 21, 2024 (i999). In the microarray ' binding agents such as antibodies and / or oligonucleotides are spotted on a planar substrate. These binding agents are then allowed to bind or hybridize by contacting a sample containing a complementary ligand (protein or complementary nucleic acid, depending on the user). Theta binding or hybridization was then measured. Since the identification of the binding agent or complementary ligand is known 200540276, by tracking them on the array, the complementary oligonucleotide or protein can be determined. This is an effective method for identifying and quantifying analytes in a sample. The main techniques for making oligonucleotide arrays include: as described in VG Cheung et al., Gae / ·, 21, 15-19 (1999), dot the array and transfer it in a needle-like or ink-jet printing format. Small aliquots of the original "spots" of the probe solution are accurately placed on a variety of substrates; as described in Cheng et al., &Quot; this' 541-546 (1998), sequence electrophoresis of the binding agent in individual charged matrix regions Deposition; and such as U. Mask〇s, EM

Southern ^ Nucleic Acids Res ^ 20 ^ 1679-1684 (1992) ^ S. P.A. Fodor et al., Science 251, 767-773 (199i), a method for promoting spatially resolved in situ synthesis of nucleotides Or as described in α.v. Vasiliskov et al., Lambe Technology, Issue 27, 592 6006 (i99 "), co-polymerization of nuclear picric acid. These technologies produce spatially encoded arrays, where the positions between the arrays Indicate the chemical confirmation of any component probes. Reproducible fabrication of custom arrays by these techniques requires controlling microfluidics and / or fairly complex photochemical fabrication to ensure consistent performance in quantitative testing. Performed in a quantitatively reproducible manner Microfluidic dots to make ιιιη diameter deposition features, including tight volume control for the application of aliqUGt aliquots (aliqUGt), a task that exceeds the capabilities of today's available liquid handling methodologies. In addition, Exposure of the binding agent to the air generally requires several hours. The subsequent binding test has uncontrollable effects on the molecular configuration and the affinity of the binding agent. In-situ array synthesis relies on a series of multiple masks Cover the photon reaction step 'It must be designed to accommodate any modification of the double-K moxibustion of the array combination'. Each array after the binding agent is fixed. Examination 200540276 The performance caused by the concept of array manufacturing must be tested. Add “in situ, evaluate difficult quality control and implementation issues. As an alternative to solving many of the problems associated with spotted arrays, oligonucleopic acid probes that incorporate microbead particles have been used., See 10/15/2002 Shen Jingxi Gaiyangshi ▲ Shi Shi °, Guoshen M Case No. 10/271, 602, "μ Simultaneously Asks and Enzyme Media Interpretation / Regulations to Enter Polymorphic Loci ( Polymorphic Loci), Multiple Secrets, ^ Xi Geng An, 8/23/2002 Application No. 10 / 204,799, "Beida_ m ία. Utilization of Application-Specific Random Particle Arrays for Multianalyte Molecular Analysis "Both are incorporated into the two underpinnings. The bead is deposited on the substrate 'and is preferably attached to it to form an array. Its main benefit is the encoding of the bead to make specific beads relevant. Specific probes can be determined by decoding This eliminates the need for a dot array and forms an array with a specific probe (spatial coding) at a specific location. Attaching beads to a substrate is desirable because it cannot be interpreted if it is moved on the substrate. Localized and explained by Yang. One of the benefits of bead arrays is that signals from the array and decoding can be done with a general microscope. For example, the microscope can obtain fluorescent signals from the array's bound ligands, or it can be encoded The color of the beads is different. The size of the array should be adjusted so that the entire array can be viewed under a microscope with a single field of view, that is, a panoramic view. One method of fixing the beads includes confining them to grooves in the matrix, where the diameter of the grooves is sized to match the beads (i.e., only slightly larger than the beads). The height of the grooves is also preferably about the same as the beads. Figure 丨 shows a cross section 200540276 of beads collected in a trough that is not a mechanical trap. As long as the matrix is facing up, the tongue #a gravity will inhibit the beads from running out of the trough. However, the forces created by the liquid transport ^ ^ ^ 扪 such as the lateral and positive forces generated by the movement of the gas-liquid interface on the Kibe 卩 can expel the Zhu particles that are not attached to the substrate. Overcoming this kind of power and earning a fixed family name ... Old, mouthfuls and methods that do not allow for a consistent array of beads are needed. According to the background, the strong adhesion between the two solid surfaces that need to be pronounced θ ^ member / heart depends on some of these factors' including surface chemistry, relative fishing, temperature, broad: rotation, contact time, material nature, and others. However, if adhesive contact is established between the two surfaces, the i-film can be pulled together in six densities ^^ //, and must approach each other closely. Several kinds of powers control and adjust the two surfaces ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ J Double Welcome Figure 2 shows that there are many other commonly encountered forces in the other interaction platform t Dependence on the month "u". Each of these forces can be counted by changing various parameters. For example, 'Long-range static thunder between two surfaces with similar symbols Den Ho +

—The repulsive force on f can be controlled by adding salt. JL should repel the force and make Yiqu sinner closer. In the absence of shielding; under ': the balance of the contact distance between the electrostatic repulsion force against gravity, the charge from glass, the π negative charge of the surface, and the polystyrene particles (a few microns in diameter), 1 on αα is in the order of 00 nm. In these cases, the particles remain far enough from the surface, and the maintainer is not affected by the interaction of the attractive parent operating on a short-range scale. 鈇Establishing ..., must think, ligand-receptor type interactions (such as 'hybrid interactions of complementary complementary nuclear gates') are qualitatively attractive and capable of operating at long distances? Capillary force can also be very effective in breaking the crime on both sides.

For example, a hard ball with a radius of R, the capillary force between the tile limbs and the thousand faces (& Interfacial tension. Name / 5 ^ e / aAvz7 / 5 JN, Intermolecular and Surface Forces, Academic Journal, New York, 1985. For wet films, the large interfacial tension of the liquid leads to correspondingly large values. Will the two surfaces be contacted once they are in contact? Attachment is not completely determined by the intermolecular net attraction. In response to the deformation of the macroscopic body caused by its contact, this bulk contact geometry and the properties of materials such as the coefficient of elasticity and hardness all affect the surface Consistency and adhesion on the other surface. According to JKR theory (Johnson, K.L., Kendall, K., Roberts, A.D., Surface energy and contact with elastic solids, H. Roc. Brother Heart Dagger, Yu Jiao ^ 1971 '324' 301), under external load 'p', the variability of the contact radius < a has the following formula P + 3nR W + WP + (3nR W) 2 where κ represents the elastic constant, w ~, rin Represents work of attachment (where r! And r2 are the two contact surfaces Surface energy), and 化 represents the radius of curvature. In the absence of any externally applied negative # ⑴, the equilibrium contact radius is

6nR2W ~ K ~ The theory also predicts the adhesion contact force (Fadh) as:

Fndh ^ -rcRW The large-scale contact increases the supplementary work1, and it alone is not enough for 20052005276. For example, wetting liquids make good contact but do not produce sufficient adhesion because they cannot resist shear deformation. In fact, the surface of the material is rough and therefore never comes in close contact. If the actual area of contact is small, the supplementary work is weak. For rough surfaces, a single surface phenomenon cannot be regarded as adhesion, but is handled by many other macroscopic phenomena. It includes the degree of surface roughness, the maximum positive force applied to the contact, the time of the surface contact angle, Molecular structure and dynamics, among others. And Tripp (Greenwood, JA, Tripp, jH ·, Elastic contact of rough spheres, but ρ / ϋ 1967 (March) 153.159) One of the early studies concluded that the effective initial contact area between rough surfaces is as follows ... ~ Is the rough square root of the surface and R is the overall radius of curvature of the system (the sphere + diameter of the seven systems of spheres and plane turning) ° Quone et al. Ί ^ anderllCk, TK, Deformation of rough solids in contact with Ding Xiao, J. Phys, C / iem, β 1999, 5320-5327) Recent researches on surname recognition, u , 九九, 、, σ, 为, 为, 取, 取, 之, 面积, 的, 面积, 面积, 面积, 面积, 面积, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, σ, 系, 面积, σ, 的, 面积, 面积, 的, and σ, which have a larger radius than expected, will adhere strongly, and those with a smaller radius of contact will not be weak. Attachers will not attach. Therefore, as far as solids are concerned, the attached works are used to dazzle — 'to increase the initial load on rough, ._ ^ θ slaves. After the addition of the initial load, t t has changed, t ^ ^ 7 7 ~, the rough deformation can make this allows Van der Waals to attract Liu Qi Shi Shi surface closer, because ~ and% force contribute to the adhesion effect. Diversity = Wafer) The bead array is fixed for multi-analyte. And :: Formula 2: The chemical conversion must occur after the array assembly process is completed. Instead, it should affect the bioassay on the wafer in any substantial way. The test should be carried out. Instead, the part of the receptor displayed on the surface of the bead should be preserved so that the binding kinetic energy is not affected and non-specific binding is minimized. . Summary [Summary of the Invention] The direct indicator is two different methods for immobilizing beads on a substrate. Among them, including the formation of a bead-nano particle combination by cross-linking the bead mixture with the nano-particles. Another method involves surface modification of the substrate using multi-layered polyelectrolyte. In the first method, the array of functionalized beads is specified on the wafer: to be assembled (preferably in a groove or other type of bead localization, such as in 7/9/02, please No. 10 / 192,352 described in "Small particles: trains and their preparations." Secondly, a drop of nanometer particle suspension was introduced into the wafer i. Then the suspension solution was evaporated for a predetermined period of time, During this period, the nano-particles aggregated a lot and attached to the beads and the substrate surface. During the culture, care must be taken to avoid the complete evaporation of water, which will form a dry sintered film. After the culture, the excess nano-particles are suspended The solution is drained, and the wafer surface is cleaned by scrubbing and washing. This will remove the attached nano particles from the exposed part of the wafer and the beads, leaving behind the nano particles collected between the beads and the matrix. In the beads The aggregated nano particles collected between the particles and the surface of the substrate are used to fix the beads in the tank. The concentration and culture time of the nano particle suspension are measured by measuring the efficiency of immobilization under optimal cleaning conditions. By experience Adapted. Named below is Example 1. Although this method is effective in immobilizing beads, a possible disadvantage 200540276 lies in the increase in nonspecific binding of knife educts (eg, oligonucleosides) to nanoparticle. Nano Rice grains accumulate around the beads in the grooves, and are collected between the beads and the groove-slots' and this non-special descending branch leads to non-specific signals. Non-specific binding can be reduced by pre-treating the substrate with a polymer such as polyethylene, FEG, etc., where the polymer system coats the matrix and nanoparticle and thus reduces the non-specific binding of the analyte 1 实施 例 2。 Embodiment 1. Ultra-thin surface films are conventionally used to modify and / or increase the solid support and functionality. Traditional chemical absorption techniques usually require 100% reaction yield or large amounts: then cross-linking to build and maintain a uniform film. A relatively new technology for the development of ultra-thin surface films is the continuous deposition of alternating layers of cationic and anionic polyelectrolytes (Iler, RK ·, ·· Colloidal interface% ·, 1966, 2 569; Decher, G., Hong, JD, European Patent No. 0472 990 A2 '1992; Decher, G.' Fuzzy 'Nano-components: Polymerization towards layers

Multi-composition ", Science, 277, 1232, 1997). In this method, electrostatic attraction adheres continuously |. Recently, there have been several reports using oppositely charged polymer-nanoparticle systems to develop these multilayer films. Long T. Specialist, Journal of Colloid and Interface Science, 254, 222-226 (2002);

Serizawa, T. et al., Langmuir, 1998, 14, 4088-4094; Lvov, J. et al., Langmuir, 1997, 13, 6195-6203; Kotov. Ν · Α, J.

Phys. Chem., 1995, 99, 13065-13069. This type of multilayer assembly is described in Figure 5A, and is performed as follows. A solid substrate with a negatively charged surface is immersed in a solution containing a cationic polyelectrolyte to absorb a layer of polyelectrolyte. Because the absorption is performed at a high concentration, some positive charges are not offset at the interface and therefore the surface charges are effectively reversed. After thoroughly washing in pure water, the substrate was immersed in a solution containing an anion-type polyelectrolyte to absorb a layer of a polyanionic group. Repeat the two steps in a cyclic fashion to form a multilayer assembly with alternating cation / anion layers. Also disclosed are different groove designs', some of which are suitable for holding the beads in place without any deposition of nano particles or polyelectrolytes. The illustrations and embodiments of the drawings, and a more detailed description are as follows. Figure 1 is a cross-sectional illustration of the localization of microparticles on the substrate.

An exemplary form of a slot. H Figure 2 shows the dependence of the interaction energy (u) of several commonly encountered forces. Figure 3A is a cross-sectional view of a matrix containing beads collected in a groove. Fig. 3B is a cross-sectional view showing the arrangement of beads in a collection well and the cross-section of a nano-particle bridge across the hole wall and micro-particles. It can be seen that with the exception of the bridge-crossing region, there is a low density of nano-particles on the exposed surface of the micro-particles, thereby minimizing the effect on the functionality of the beads. Figure 4 shows the evaluation of immobilization efficiency. FIG. 4A depicts the array after assembly, and FIGS. 4B, 4C, and 4D show the array after the shear force is applied. FIG. 4B does not have any nano particles, and FIG. 4C has an insufficient nano particle concentration (04% ( w / v)), and Figure 4D carries enough nano particles (10% (w / v)) to affect immobilization. The nanobeads used in this experiment were ~ 80 nanometer diameter silica particles while the microparticles were avidin (Nonavdin) functionalized green glory particles (3.2 micron diameter).

FIG. 5A shows the method flow of the deposition of the polyelectrolyte bilayer structure. Fig. 5B 13 200540276 depicts a polyelectrolyte-coated collection with ± MM 丁 ’丁 米 m, and deposited in a thin film system on the wall of the collection well, with no coating on the exposed beads and wafer surface. 6 A 60 display wafers without multi-layer electrolyte modification. Hybridization test According to the size of the collected If, two, three or five bilayers were deposited to fix the results. Into. Figures 6 and 6C ′ show the results of specific signals and head 6β and India show the results of non-specific 5fl #u. Figures 6A and 6B are the results of a modified wafer and Figures 6C and 6D represent the results of a control wafer.

Figures 7A to 7C show three different exemplary structures of grooves in a matrix in cross sections. Figure 8 shows the effect of the layer-by-layer method to keep the beads in the tank

rate. Figure 8A depicts a plan view of a slot array; ® is similar to the slot array shown in Figure 8A, after the beads have been assembled and cleaned without additional processing; Figure 8C depicts a five-layer electrolysis f double layer An image of the array of grooves of the wafer after the beads are assembled and cleaned; FIG. 8D shows the average relative size of the grooves and beads as shown in FIG. 8 to FIG. 8 and FIG. 8E. Figure 9A shows the design of the holes (or collection wells) of the beads in the seed matrix in a plan view according to the plan _ ^ ^ ^. The hexagonal shape is extruded, wherein the space between two opposite sides is smaller than the diameter of the beads. Figure 9B depicts the design of the pores (or collection bells) of the beads in a matrix, which is an asymmetric hexagonal opening > where the two opposite sides have narrower voids at the -end than the other-and The design is such that at the narrower end, the space between the two sides is smaller than the diameter of the beads. Detailed description 14 200540276 [Embodiment] Turning first to FIG. 1, an exemplary group of grooves (holes) in a matrix is described, which is suitable for inserting beads displaying biomolecules. Test analytes and reagents can be added to the surface of the substrate and brought into contact with the beads and the biomolecules displayed thereon. Figures 7A to 7C depict three different designs of such grooves. In Figure 7A, the holes are reduced at the bottom to help keep the beads at the bottom of the holes. In FIG. 7B, the holes are circular cones to hold the beads. In Fig. 7C, the hole, in cross section, is U-shaped and the beads may exist on either side of the hole.

Figures 9A and 9B depict two different designs of holes, which have a narrower area than the diameter of the beads. The beads are squeezed into the pores and held in place for the resulting expansion force. With any design of the pores described herein, other techniques can be used, including deposition of an electrolyte layer or a Nile particle suspension, to keep the beads in place within the pores. An example of this expertise is stated below. Alternatively, if the beads are snapped in or squeezed in, the groove is called & ^ ^ ^ Encountering the grooves of the cloud, and g, there is no need for other steps to keep the beads in place. EXAMPLES Example 1: Determining the key concentration of immobilized nano particles for experiments to evaluate the immobilization of the particles on the nano particles required to collect the brown ......... The milk base is made in a size of 3.5 microns (diameter from side to side) and 3. An array of 5 micron ^ ^ ^ ^ octagonal collection wells for clothes. 32 lives coated with avidin 丨: Jiu Nian Da, wood upright gum particles are stained with green fluorescence. Storage of spheroid beads was 80nm silica 15 200540276 from Feng 34 li% (Snwtex-ZL, Nlssan Chemicais, Huston, τχ). An equivalent sample was taken from the nanoparticle storage solution and diluted with 10% MTvs buffer (pH 80) containing 3% (v / v) glycerol to make the desired concentration. These diluted suspensions were then used for experiments. The beads were assembled on a substrate using the following protocol. Example: Bead Assembly Scheme An example of the processing steps for forming a bead array is as follows. Two micro $

The particles (direct control about 3.2 micrometers) in microliters of sodium phosphate buffered saline (also known as · ρ 只 ς |., Two pBS · 150mM, NaCl; 100mM, phosphorus g sodium pH 7.2 ) Is used to assemble micro-particle arrays on individual Shi Xi wafers (u X 1.75 mm) with micro grooves on each wafer. Use the following steps: To leave. Action (", 〇〇〇〇 depletion,] minutes) in a 5 w centrifuge tube to collect microparticles from PBS. Other collection methods can also be used. Use the transfer pipette to discard the supernatant with suction effect. Particles resuspended in 5 μl of 3

Opened 3% glycerol in 10 nM Tris p 7.5. Collect the granules from glycerol> valley by centrifugation. Other collection methods can also be used. The glycerin solution was aspirated from the granules. The pellets were resuspended in 2 microliters of Glycerin, 10 mM Tris, pH 7.5 using a silicon wafer pre-bonded to a glass slide. 〇 · 25 microliter volume of yuccote A small suspension of liquid was pipetted to the area containing microgrooves on each crystal. 16 200540276 Leave the assembled wafer in the enclosure for a short period of time (such as 30 min) to settle the beads and allow excess water to evaporate. After incubation, the drip became a sticky slurry. Wash the cotton applicator (appHcator) with water from a water bottle. Dry the wet cotton applicator with absorbent toilet paper to remove excess water. To assemble the microparticle array, the bead slurry was erected with a wet cotton applicator and gently stirred several times in a circular motion. Loose fibers on the cotton ball feed the beads into microgrooves on the surface. Tank Following the above steps, centrifuge the slide to make the beads sink to the wafer (micro). Use the following materials and settings:

Centrifuge spinner speed time

Sorvall Centrifuge Model RT6000B Sorvall Centrifuge Model H1000B 2000 RPM 5 min Use a fluorescence microscope to check the particle occupancy of the microwells. If the occupancy rate is unsatisfactory, you can repeat the above steps. Excessive particles use a cotton applicator to warm

Sweep off the wafer gently. To avoid excessive water on the surface, do not press the cotton applicator on the wafer. The wafer was dried by blowing the surface of the wafer with nitrogen but nitrogen. The assembled microparticles prepared in this way can be used for inspection or stored in solution at 40 ° C for later use. After the assembly, the occupancy of the collection well is detected by a fluorescence microscope. Name Figure 4 A Secondly, droplets of 2 // 1 nm particle suspension are used for immobilization, which is performed by placing them on a substrate (having a size of 1.75 mm x 1.75 mm 17 200540276 and at 30 Incubate at 30 ° C and 30% relative humidity for 30 minutes. The selected culture conditions are to avoid complete evaporation, resulting in the formation of unwanted dry sintered films. After the culture is over, the excess nanoparticle suspension is sucked off and the wafer surface is completely scrubbed And cleaned and cleaned. The occupancy of the collection well was again checked with a fluorescence microscope. The results are shown in Figures 4B to 4D. Example 2: Inspection results of beads immobilized with nanometer particles immobilized by polymer blocks The particle assembly was performed as described in Example 1 using a 1% nanoparticle solution. The polymer solution used in this study was 1% (w / v) PEG 20,000, which was dissolved in a solution containing 3% (v / v ) 1 OmM Tris of glycerol Following the assembly and immobilization of the particles using the nanosuspension, a 15 # 1 polymer solution was added to each wafer, which was stored overnight at 4 ° C in a humidity cabinet. For inspection First, the excess polymer solution is removed from the wafer surface and the The slices were washed with deionized water. The hybridization test was performed using a 90-nt Cy5 labeled polynucleotide target. Two microliters of a 10 // M synthetic target (5'-Cy5 dye was coupled to the recruitment: TCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAA TATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGA AGCGTCATCAA-3 '(Serial Identification Number 1)) solution in deionized water at 18 // 1 lx TMAC (4.5 M tetramethylammonium chloride, 75 mM Tris pH 8.0, 3 mM EDTA, 0.15% SDS) diluted to a final volume of 20 / z 1. Two types of fluorescently functionalized microparticles were assembled onto a planar array on a silicon wafer using the protocol proposed above. The first type of microparticles The type is functionalized with a paired probe sequence (sequence identification number 2) 5 amine 18 200540276 / (TEG spacer) / CCAAAGATGATATTTTC / -3 '("TEG" is triethylene glycol). The second micro The particle type was functionalized with a mismatched probe sequence (SEQ ID NO: 3) amine / (TEG space) / ATAACCAGGAGGAGTTCG / -3. Twenty microliters of synthetic target was added to the surface of the substrate and the substrate was placed Heat at 55 ° C for 20 minutes. The substrate was then removed from the heater and the target solution was aspirated. The substrate was washed three times with lx TMAC at room temperature. Next, 10 " 1 of lx TMAC was placed on the surface of the substrate, which was covered with a coverslip and used Fluorescence microscope to record the fluorescence intensity of the array. The control array is completed on the wafer without any added nano particles or polymers. Unoccupied collection wells in control tests have some non-specific binding of targets in the collected taste. The results are shown in Tables 2 and 3, where CV is the coefficient of variation. Table 2 · Nanoparticles immobilized via the polymer group, said chip # Paired probe signal error Paired probe signal ratio Unoccupied collection well 1 9603 CV8% 783 CV36% 12.26 558 CV 20% 2 11,902 CV5% 695 CV 24% 17.12 545 CV21% 3 10,264 CV10% 731 CV30% 14.04 539 CV18% 4 10,631 CV11% 1058 CV33% 10.04-Table 3: Results for uncoated (controlled) wafers 19 200540276

The immobilization scheme and the polymer step absolutely retain the signal to the paired probe (~ 10% decrease in the specificity test signal), and reduce the non-specific signal (~ 20%) from the surface of the wafer, but from the incorrect pairing The signal bound by the probe is essentially unaffected.

Example 3 · Manufacturing of a polyelectrolyte bilayer on a wafer A negatively charged wafer (polysilicone coated with a layer of silicon dioxide) was immersed in a cationic polyelectrolyte solution 0% w / v polyallylamine hydrochloride Compound solution 'which has Mol · Wt. 15,000, manufactured by Aldrich Chemicals,

Milwaukee, WI in 1 M calcium chloride) for 2 minutes. Then remove the wafer, wash it thoroughly with deionized ultrafiltration water, and put it back into 3.4% (w / v) with a negative charge (f potential 56 mV at 1 mM ionic strength and pjj ~ 4.0) 22nm

Ludox granules (Aldrich Chemicals) are dissolved in a solution of PBS (0.1M sodium phosphate, 0.15M sodium chloride, pH 7.2) and incubated for 2 minutes. Then, the wafer was taken out and thoroughly washed again with deionized ultrafiltration water. This process results in the formation of a double-layered structure as shown in FIG. 5 (a). Subsequent double layers can be similarly deposited by alternately exposing the wafer to cationic / anionic polyelectrolyte baths. Figure 5 (b) shows a collection well array with ten double layers. Example 4: The critical number of double layers required for immobilization. 20 200540276 ° A test is also performed to investigate the minimum number of double layers required for beads to immobilize in the collection well. number. Two different collection well sizes were selected for this study (see Table 4). Sobe / Epiphyll 3.2 // M coupons are functionalized with beads. The calculated collected taste size and the difference between the collected taste size and the bead size (mismatch) M are shown in Table 4. -The size of the size is incorrectly matched to the wafer it ~ ΓΓΓΤ-ΤΓ ~: ~-Collecting well size (micron) -------- ’3.5! 4

----- I _XUU The double-layer coating system was introduced into H 5 as described in Example 3 above to display various collection: size results. For larger mismatches between bead and collection well sizes, ′ requires more bilayer coating for immobilization.

The gray grid indicates that the immobilization takes place there. Table 5 Minimum number of show double layers _ Example 5: Wait for what, what for? Test results of X-layer coated wafers Several layers were coated as in Example 3. Next to the minimum number of double masters in the & chemical laboratory, the beads will be assembled, for example, Ar1, and the wafer watch will be assembled to the shirt exposed from the wafer. Part of this path removes the double-layer film but leaves a film on the wall of the well, which helps maintain the beads in the collection well (see Figure 5). The DNA hybridization test was performed as described in Example 2. Two microliters of 10 // M synthetic target in deionized water (TCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAA TATCATCTTTGGTGTTTCCTATGATGAATTAGATACAGA AGCGTCATCAA-3, (Serial Identification Number 4)) solution in l / TMAC (4 · 5 M tetramethylammonium chloride, 75 mM Tris pH 8.0, 3 mM EDTA, 0.15% SDS) was diluted to a final volume of 20 / z 1. Two types of oligonucleotide-functionalized fluorescent microparticles are assembled onto a planar array on a silicon wafer using a protocol as described above. The first type of microparticles is functionalized with a paired probe sequence: | J 5, -amino / (TEG space) / CCAAAGATGATATTTTC / -3 '(sequence identification number 5). The second type of microparticles is functionalized with a mismatched probe sequence amine / (TEG space) / ATAACCAGGAGGAGTTCG / -3 '(sequence identification number 6). Twenty microliters of the synthetic target was added to the surface of the substrate and the substrate was placed in a 55 ° C oven for 20 minutes. The matrix is then removed from the oven and the target solution is aspirated. The matrix was washed three times with lx TMAC at room temperature. Next, 10/1/1 of lx TMAC was placed on the surface of the substrate, and the fluorescence intensity of the array was covered with a coverslip and recorded. The results are shown in Fig. 6. The pairing or specific signal is unchanged but the non-specific signal is enhanced by a factor of two, most likely due to non-specific binding to the coated substrate. Example 6: Inhibition of non-specific signals on a polyelectrolyte-coated wafer A polyelectrolyte bilayer-coated wafer was manufactured as described in Example 5, but after the last exposure to the Ludox solution, two additional bilayers were added. The 22 200540276 is a solution of polyallylamine solution and 1% (w / v) polypropionic acid, sodium salt (Mol. Wt. 8,000, Aldric Chemicals, Milwaukee, WI) in 1M chloride. After the final polyacrylic acid deposition, the wafer was thoroughly washed with deionized ultrafiltration water and incubated at 120 ° C for 2 hours. Beads were assembled on these coated wafers as described previously and the hybridization test was performed as described in Example 5. In some tests, in addition to the two types of Example 5, a third type of mismatched probe sequence amine / (TEG space) / CCCCCCCCCCCCCC / -3 is used (Sequence No. 4 and J No. 7) Function > ί dagger table 6 contains% (^ chip # specific signal non-specific signal _1 non-specific signal (another probe) unoccupied collection well chip — 1 5555 (10%) 186 (26 %) 200 (25%) 184 (24%) Wafer—2 5553 (14%) 224 (30%) 237 (30%) 186 (37%) Wafer—3 5593 (14%) 222 (34%) 237 ( 34%) 174 (31%) Chip 1 4 5780 (14%) 247 (22%) 263 (22%) 239 (24%) Chip-5 5800 (10%) 214 (22%)-214 (27%) Chip_6 5542 (10%) 251 (23%)-207 (24%) Chip_7 5573 (10%) 270 (22%)-240 (16%) Chip 5398 (10%) 280 (24%)- 210 (26%) Control 5600 (10%) 210 (20%)-186 (30%) Control_2 5800 (10%) 240 (24%)-216 (25%) It should be understood that the terms described above , Representations, examples, and specific examples are merely illustrative and not restrictive, and the scope of the present invention is defined only in the scope of subsequent patent applications, and includes all equal persons applying for the scope of patent applications. 23 200540276 [Brief description of the figure] Figure 1 is a cross-sectional diagram illustrating an exemplary type of localization of the grooves of microparticles on the substrate. Figure 2 shows the interaction energy of several commonly encountered forces (. Figure 3A is a cross-sectional view of a matrix containing beads collected in grooves. Figure 3B shows the arrangement of beads in a collection well and spanning nanoparticle bridges between pore walls and microparticles A cross-sectional view. It can be seen that except for the cross-bridge area, there is a low density of nano particles on the exposed surface of the micro particles, thus minimizing the impact on the functionality of the beads. Figure 4 shows the efficiency of the immobilization. Evaluation. Figure 4A depicts the assembled array 'and Figures 4B, 4C, and 4D show the array after the shear force is applied. Figure 4b does not contain any nano particles and κ 4C has an insufficient nano particle concentration (04% ( W / V)), and Figure 4D has enough nano-particles (丨 (W / V)) to affect the immobilization. The nano-beads used in this experiment are ~ 80-nanometer-diameter stone syrup particles and slightly Granular avidin (Nelmavdin) functionalized green light particles (3.2 microns diameter). FIG. 5A shows a method flow of the deposition of a polyelectrolyte bilayer structure. Figure 5β depicts an array of polyelectrolyte-coated collection cards. The double-layered system is deposited, and the nanometer-thin film is deposited on the collection wall 'and is not coated on the exposed beads and wafer surfaces. Figures 6A-6D show the results of a hybridization test on a multi-layer polyelectrolyte Schona wafer. Depending on the size of the collection well, two, three, or five bilayers are deposited to fix. Figures 6A and 6C show the results of non-specific signals and Tunew and India show 24 200540276 non-specific signals * 5 tiger results. Figures 6a, 8a and 63 are modified wafer results and Figures 6C and 6D represent the results of the control wafer. Figures 7A to 7C show three different exemplary structures in cross-sections of a plane. Figure 8 shows the effectiveness of the layer-by-layer method to keep the beads in the tank. Figure 8 A depicts the flatness of the slot array.

Ten views, FIG. 8B depicts an image similar to the slot array as shown in FIG. 8A after the beads are assembled and cleaned, and then there are other treatments; FIG. 8C depicts the coating with five polyelectrolyte, > egg An image of the groove array of the double-layered wafer, after the beads are assembled and cleaned, is shown in FIG. 8D, and the average relative sizes of the grooves and the beads are shown in FIGS. 8A to 8C and FIG. 8E. FIG. 9A is a plan view depicting the design of a hole (or collection card) of beads in a matrix, which is a “extruded” hexagon, in which the space between two opposite sides is

The interval is smaller than the diameter of the beads. FIG. 9B depicts the design of the holes (or fat collection) of the beads in the # 山 A ^ species of matrix, which is a misaligned & tooth boat /, angled, where the two opposite sides are at one end more than the other end It has narrower six, two, and two branches, and is designed so that at the narrower end, the space between the two sides is smaller than the diameter of the beads. [Explanation of Symbols of Main Components] Yi 25 200540276 Sequence List < 110 >

< 120 > Immobilization of bead-displayed ligands on the substrate surface < 130 > IMBD < 150 60 / 478,011 < 151 > 2003-06 * 12 < 160 7 < 170 > Quick SEQ Window V4.0

< 210 > 1 < 211 > 88 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > artificial target < 400 > 1 icagttttcc tggattatgc ctggcaccat taaagaaaat atcatctttg gtgtttccata tgat 60 tgat

< 210〉 2 < 211 > 17 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > probe < 400〉 2 ccaaagatga tattttc 17

< 210 > 3 < 211 > 18 < 212 > DNA < 213 > artificial sequence < 220〉 < 223 > probe < 400〉 3 ataaccagga ggagttcg 18 200540276

< 210 4-< 211 > 90 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > artificial target < 400 > 4 tcagttticc tggaUatgc ctggcaccattaaagaaaatatcatctttg gtg cc cca 60tgatgatgatgat

< 210〉 5 < 211 > 17 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > probe < 400 > 5. ccaaagatga tattttc 17 < 210> 6,

< 211 > 18 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > probe < 400 > 6 ataaccagga ggagttcg 18

< 210> 7 < 211 > 14 < 212 > DNA < 213 > artificial sequence < 220 > < 223 > probe < 400 > 7 cccccccccc cccc 14

Claims (1)

200540276 10. Scope of patent application: 1. A method for attaching microparticles to the substrate on the base, wherein the microparticles are locally localized on the surface of the substrate, and include: The rice particle suspension is placed on the substrate. The liquid is evaporated from the nano particle suspension so that the nano particles are between the groove wall. Ren U '2 · Gen She asked the method of item 1 in which evaporation did not completely remove the liquid from the surface of the substrate. 3. According to the method of item 丨 of the towel range, the surface of the towel substrate is k-folded to inhibit non-specific binding of the oligonucleotide compound in negative contact with the base. VIII. Oral 4. The method according to item 3 of the patent application, wherein the coating is a polymer. 5. The method according to item 4 of the scope of patent application, wherein the polymer is pEG 20,000, which is first applied by dissolving it in 10% of 3% (v / v) glycerol. 6. The method according to item 丨 of the patent application scope, wherein the microparticles are placed in the groove. 7. The method according to item 6 of the claim, wherein the groove is a cylindrical hole whose inner diameter is slightly larger than the outer diameter of the microparticles, or the inner diameter of the opening is large enough to have a side that gradually shrinks inward The micro-particles can be placed in holes in the grooves. 8. The method according to item 丨 of the patent application, wherein the microparticles are composed of a polymer. 26 200540276 Glue 9. According to the method of claiming patent No. 8, the polymer is milk 10. According to the scope of patent application! Term method for protein functionalization. According to the method of item 10 in the scope of the patent application, the particles of τ 铽 are conjugated with nucleotides. ， 二 二 能 能 微 12 · According to the scope of the patent application 10th Biotin egg Meta and avidlnb, Medium protein resistance 13. The method according to the scope of application patent item i, which consists of silicone, which is suspended in glycerol in. T /,;: stand 14. The method according to item i of the patent application range, wherein the substrate has a number of grooves, and each contains one microparticle. ? 15. A method of attaching microparticles to a surface of a substrate, which comprises depositing a continuous alternating matrix surface of cationic and anionic polyelectrolyte deposited. I6. The method according to item 15 of the patent application scope, further comprising subjecting the surface of the substrate to a negative charge before the depositing. ^ L7. The method according to item 16 of the application, wherein the negatively charged effect is performed by coating the substrate with a layer of silicon dioxide. ^ I8. The method according to item 16 of the scope of patent application, wherein the substrate is subsequently exposed to a cationic polyelectrolyte solution followed by the negatively charged chirping effect, and then to a negatively charged nanoparticle suspension. 19. The method according to item 18 of the scope of the patent application, wherein the cationic polycarp, and the Luo liquid system are 1% w / v polyallylamine hydrochloride solution in ιΜ gasification 27 200540276 calcium, and nano particles It is Ludox silica nanoparticle (Aid Chemicals, Milwaukee, WI), which is suspended in PBS (0.1M sodium phosphate, 0.15M sodium gasification, pH 7.2). 20. The method according to item 15 of the scope of the patent application, wherein the microparticles stay in grooves on the surface of the substrate. 21. The method according to item 20 of the patent application, wherein the groove is a cylindrical hole having an inner diameter slightly larger than that of the fine particles. 22. The method according to item 20 of the scope of patent application, wherein the groove has an inner diameter slightly smaller than the outer diameter of the fine particles. 23. The method according to item 20 of the scope of the patent application, wherein the groove has a side that is tapered inward and the inner diameter of the opening is large enough to allow the microparticles to be placed in the hole in the groove. 24. The method according to item 22 of the scope of patent application, wherein the grooves are formed in a flat view, N is different from each other, and the common grooves are shown in Figure 3 as a deformed hexagon, with two opposite sides at each end than the other. for near. 26. The method according to item 15 of the patent application, wherein the microparticles are composed of a polymer. 27. Method according to item 26 of the scope of patent application, where the aggregated character is%, where microparticles are subjected to 28. Method according to item 26 of the scope of patent application, protein functionalization. 29. The method according to item 28 of the scope of patent application, wherein the protein is anti-28 200540276 biotin protein. 30. The method according to item 28 of the scope of patent application, wherein the functionalized microparticle system is conjugated to an oligonucleotide. Eleven, schema: as the next page 29