TW200533759A - Collapsin response mediator protein-1 (crmp-1) transcriptional regulatory nucleic acid sequences - Google Patents

Abstract

This invention provides a transcription unit which is isolated from the upstream nucleic acid sequence of the collapsing response mediator protein-1 (CRMP-1) gene, an invasion-suppressor gene. The transcription unit contains a nucleic acid regulatory sequence which demonstrates promoter and/or regulatory activities (such as providing a transcription factor binding site) to enhance the expression of the CRMP-1 and/or a reporter protein. The invention also provides a DNA construct containing this transcription unit which can be transected into a host cell. Additionally, the invention provides methods to enhance the expression of CRMP-1 and/or the reporter gene. The over-expression of CRMP-1 in a cancer cell can inhibit the metastasis of the cancer cell.

Description

200533759 IX. Description of the invention: [Technical field to which the invention belongs] The present invention relates to a transcription unit that is isolated from the upstream nucleic acid regulatory sequence of a brain serotonin response mediator protein-1 (CRMP-1) gene, preferably the one For human CRMP-1 gene or. The CRMP-1 gene is an invasion-suppressor gene that prevents cancer φ metastasis. The transcription unit contains a nucleic acid regulatory sequence, which has a promoter and / or regulatory activity (for example, provides a transcription factor binding site) to increase CRMP-1 and / or is linked to the transcription unit (such as a reporter protein) upon manipulation. Of foreign genes. The invention also provides a DNA construct comprising the transcription unit and a vector. The DNA construct can be transfected into a host cell. In addition, the present invention provides a method for promoting the expression of CRMP-1 and / or its reporter protein. CRMP-1 overexpression in a cancer cell can inhibit cancer cell metastasis. [Prior technology] Collapsin response mediator proteins (CRMPs) belong to the family of phosphoproteins, and their growth cones induced by semaphorin / brain cryptin are considered to be associated with Axon guidance and neural differentiation are closely related. CRMPs are mainly manifested in the nervous system, especially during embryogenesis. Immunochemical studies have shown that CRMPs are distributed in laminUipodia, filopodia, axons, and nerve cell bodies in growing vertebrae. Although 200533759 is still unclear about the molecular mechanism of their effects, their performance and phosphorylation will be regulated in time and space during development. Members of CRMPs carry a sequence that is homologous to the nematode protein UNC-33, and its lack will cause axonal extension and uncoordinated movement of nematodes (Caewor / zflM / e / egfl / w) (Liet al. Genetics (1992), 132 (3): 675_689). CRMP family members have 50% to 70% amino acid sequence homology. Five laboratories have independently cloned five members of the CRMP gene family (crmp-J, cfmp-2, crmp-3, crmp_4, crmp-5) that can translate into proteins with a diameter of approximately 60 to 66 kDa. Each CRMP is considered to have a unique function. The members of the CRMP family are called CRMP (brain failure protein response mediator protein), TOAD-64 (turned on after 64-kDa protein division), Ulip (UNC-33 phosphoprotein), DRP (dihydropyrimidinase-related protein) And TUC (TOAD / Ulip / CRMP). Nevertheless, the most commonly used name in the medical literature is CRMP. The transcription of the CRMP gene is regulated by differentiation (Katoet al., Histochem. Φ Cell Biol. (2000), 97 (11): 6212-6217; Matsuoet al., J. Biol. Chem. (2000), 275 (22): 16560-16568; Quachet al ·,

Gene (2000), 242 (1-2): 175-182). CRMP-1, CRMP-4, and CRMP-5 in mice are mainly expressed in the brain of embryos, not in the brains of adult mice. On the other hand, CRMP-2 and CRMP-3 are expressed in the brains of embryos and adult mice. However, in adult mice, CRMP-3 is located in the cerebellum. In PC-12 cells, after nerve differentiation induced by NGF, CRMP-4 is strongly up-regulated, while 200533759 CRMP-1 and CRMP-2 are only slightly increased, and crMP-3 is down-regulated (down-regulated) (Byket al., Eur.). Biochem. (1998), 254 (1): 14-24). At this time, only the promoter of human CRMP-4 was isolated and analyzed (Matsuoet al., J. B. Chem. (2000), 275 (22): 16560-16568). The regulatory elements of other members of the CRMP family have not been studied. Cerebral failure protein response mediator protein-1 (CRMP-1), also known as dihydropyrimidinase φ-related protein_1 (DRP-1), is a phosphoprotein with a molecular weight of 62 kOa. CRMP-1 was originally found in brain tissue and was thought to be closely related to brain failure protein-induced growth vertebral decay during neural development (Torreset al ·, DNA Res. (1998)? 5 (6): 393-395 ) 〇 Recently, the inventors of the present invention have found that the expression level of the CRMP-1 gene (hereinafter referred to as the "CRMP-1 gene") will adversely affect cancer invasion and metastasis (that is, the higher the expression level, the cancer invasion and The lower the incidence of metastasis), the CRMP-1 gene thus becomes an invasion suppressor gene (Shihet al., J. Natl. Φ Cancer Inst. (2001), 93 (18): 1392-1400; Chuet al.? Am. J. Respir · Cell Mol · (1997), 17: 353-360; Shihet al ·, Clinical & Exper. Metastasis (2003), 20: 69-76). The contents of the above documents are incorporated herein by reference. The inventors of the present invention found that patients with low CRMP-1 expression had worse disease course and lymph node metastasis, while patients with high CRMP-1 expression had significantly longer disease-free survival period. ) And overall survival period (200533759) The following description of the present invention will disclose and CRMP-1 Due to the discovery of related nucleic acid regulatory elements / sequences. These nucleic acid regulatory elements / sequences include, but are not limited to, a promoter, a basal transcription regulatory region, and are located upstream to operate with the CRMP-1 gene. Linked transcription factor binding sites. Understanding of the regulation of CRMP-1 gene expression will lead to a new strategy for treating cancer patients and can stop cancer metastasis. [Summary of the Invention] \ The present invention provides a transcription unit, It contains a nucleic acid regulatory sequence, which is isolated from the upstream region of the gene encoding the brain failure protein response mediator protein-1 (CRMP-1) (that is, it is located near the i-terminus of the gene). The nucleic acid regulatory sequence is characterized by its Has the ability to regulate the expression of the CRMP-1 gene and / or foreign genes linked to the nucleic acid regulatory sequence upon manipulation. The preferred CRMP-1 gene is the human CRMP-1 gene. The nucleic acid sequence of the CRMP-1 gene can Obtained from SWISS-PROT database entry Q14194, GenBank database locus D78012 and locus BAA11190. In one embodiment of the present invention, the nucleic acid regulatory sequence includes a nucleic acid sequence of SEQ ID NO: 2, which includes nucleotides -1920 to +50 upstream of the CRMP-1 gene. This nucleic acid sequence represents the entire promoter region. The transcription initiation nucleic acid of the CRMP-1 gene is designated as +1, and the start codon of the ATG is +151 to +153. 200533759 In another embodiment of the present invention, the nucleic acid regulatory sequence comprises a nucleic acid sequence SEQ ID NO: 3, which comprises nucleotides 80 to +50 located upstream of the CRMP- :! gene. This nucleic acid sequence represents the smallest promoter sequence. In another embodiment of the present invention, the nucleic acid regulatory sequence comprises a nucleic acid sequence of SEQ ID NO: 5, which comprises nucleotides -133 to -122 upstream of the CRMP-1 gene. The nucleic acid sequence includes a first regulatory factor binding site having a GGGAGGAG nucleic acid sequence. The shortness or mutation of this nucleic acid sequence will cause the expression of φ CRMP-1 gene and / or exogenous gene to be greatly reduced. In yet another embodiment of the present invention, the nucleic acid regulatory sequence comprises a nucleic acid sequence of SEQ ID NO: 6, which comprises nucleotides -115 to 100 upstream of the CRMP-1 gene. This nucleic acid sequence includes a second regulatory factor binding site with a CTCCTCCC nuclear gene, which is the GGGAGGAG sequence of the first regulatory factor binding site, the inverted sequence of J, J. In addition to the first regulatory factor (seq NO: 5), the shortage of the second regulatory factor (SEQ ID NO: 6) will cause the performance of the CRMP-1 gene and / or foreign genes to be further reduced. However, the first • Mutations in regulatory factors do not affect CRMP-1 gene and / or exogenous free transcriptional activity. ^ The exogenous gene linked to the nucleic acid regulatory sequence can be a reporter gene, such as a firefly luciferase gene or a green fluorescent protein gene ° The present invention Also provided is a nucleic acid regulatory sequence comprising SEQ ID NO: 2, ΝΌ · 3, SEQ ID NO: 4 or SEQ ID NO: 5 and ^ 200533759

DNA constructs of vectors. An example of a vector used to prepare the DNA construct is a pGL3-basic vector, which contains a firefly cold light enzyme gene. The present invention further provides a transfected cell, which is a DNA construct having a nucleic acid regulatory sequence in a host cell, such as a human cell, and preferably a human cancer cell, such as a human lung adenocarcinoma Cell or human rectal cancer cell. i In addition, the present invention provides a method for increasing the expression amount of a CRMP-1 gene and / or an exogenous gene in a host cell. The method includes transfecting a host cell with a DNA construct containing the transcription unit. Preferred host cells are human cells. Finally, the present invention provides a method for inhibiting human cancer cell metastasis. The method comprises transfecting a host cell with a DNA construct containing the transcription unit. [Embodiment] In order to clearly describe the present invention, the following specific terms are used in the text. However, the invention is not limited to these specific terms. It should be understood that each specific element contains all technical equivalents, which can be used for similar purposes by similar means. The term "nucleic acid sequence" here means a DNA, cDNA or RNA molecule, and also an isolated fragment or part of a molecule of a large polynucleotide construct. 10 200533759 The term “gene” here means a nucleotides polymer, which encodes an amino acid composed of a directional linear peptide (such as an enzyme) . The "gene" can be single-stranded (such as RNA) or double-stranded (such as DNA). For example, cDNA can be cDNA obtained by reverse transcription of messenger RNA (mRNA) with enzyme, genomic DNA from chromosome, or chemically synthesized DNA. The term "nucleic acid regulatory sequence" is used herein to mean a DNA, cDNA, or RNA fragment upstream of the 5 'end adjacent region that can affect gene transcription and expression. Such nucleic acid regulatory sequences may include a promoter region for regulating transcription of a gene's transcription region, an enhancer that affects the promoter region, and other regulatory factor binding sites (such as TATA Box, CCAAT Box, APl, Spl, or NF-κΒ binding sites (such as transcription factor binding sites) and introns (intron) or similar regions. The direct link between the nucleic acid regulatory sequence and the gene is optional. The term "promoter" means a DNA sequence that can bind to an RNA polymerase to initiate gene transcription. Promoters may be linked to their naturally associated genes, or they may be functionally linked to an exogenous gene. As used herein, "exogenous gene" refers to a nucleic acid sequence that encodes a gene product, but the product is not naturally derived from this promoter sequence. 200533759 The term "operatively linked" means that the nucleic acid regulatory sequence is functionally linked to the gene. For example, the nucleic acid regulatory sequence can regulate the expression of the gene. The "reporter gene" can be used as an indicator of gene expression activity in molecular biology. The reporter gene is generally a gene transformed into a host cell or organism, and the enzyme activity encoded by this gene does not exist in the host cell or organism. By measuring or detecting _ enzyme activity, it can be used as an indicator or "report" of the presence of newly introduced genes. Reporter genes can be placed with regulatory sequences that affect gene performance, such as promoter elements. The successful performance of the reported gene product can be used as an indicator of the activity of the regulatory element. The present invention illustrates a novel nucleic acid regulatory sequence that affects the expression of a gene encoding human brain failure protein response mediator protein-1 (CRMP-1). Part of the CRMP-1 genomic sequence, including the sequence at the 5 end of the CRMP-1 genomic sequence, is designated as SEQ ID NO: 1 in the text. SEQ ID NO: 1_ contains a nucleic acid sequence of the CRMP · 1 gene from -1920 to +189. This nucleic acid sequence has the entire promoter region, several regulatory factor binding sites and the exon sequence 1 (exon 1) of the CRMP-1 gene (which is located in the +1 to +189 sequence of the CRMP-1 gene). The translation “thionine” starts with the start codon ATG (which is located at +151 to +153 of SEQ ID NO: 1). The nucleic acid sequence located in the -1920 to +50 sequence upstream of the CRMP-1 gene is identified herein as SEQ ID NO: 2. This nucleic acid sequence contains the entire promoter region 200533759

ATG domain, several difficult factor binding sites and partial sequence of CRMp_i gene exon sequence ι (_!). However, the nucleic acid sequence which does not contain the start codon of the CRMP-1 gene is located upstream of the __1 gene and the sequence of _18 to +50 is designated herein as SEQ ID NO: 3. The nucleic acid sequence includes a core promoter region and regulatory factor binding sites. It is located on the CRMIM gene from 80 to 10 = SEQ ID_ in the text. The nucleic acid sequence includes a minimal promoter region and regulatory factor binding sites. The nucleic acid sequence of the 耜 -133 to -122 sequence located on the L_ soil of CRMP-1 is designated as SEQ τη χτα ^ D NO: 5 in the text. The nucleic acid sequence includes a -regulatory factor binding site having a GGGAGGAG nucleic acid sequence. The nucleic acid sequence located at CRMP-1 and its ra L "on the soil _115 to -100 sequence is in the text U SEQ ID NO: 6. This nucleic acid and the second regulatory factor binding site of the CTCCTCCC nucleic acid phase j GGGAGGAG nuclear sequence 々 ^, the section is the inverted sequence of the regulatory site of the regulatory factor binding site. The expression of the CRMP-1 gene of the nucleic acid regulatory sequence of SEQ ID NO: i-6, which is described in detail. It can also be used to control foreign genes that are linked to the nucleic acid regulatory sequence. The foreign gene can be a reporter gene. Examples of reporter genes include the fireworm cold light enzyme (lu-valence gene and green light) Protein (GFP) gene. 200533759 The firefly luciferase gene is currently known and commonly reported. The firefly Ayra / low-temperature light-enzyme-encoding olivine (coding sequence) was selected for sale by prOmega. From the pGLl cold light enzyme reporter of sequence ϋ. This reporter gene can provide a basis for the quantitative analysis of regulatory factors. In the PGL3 cold light enzyme reporter substrate (also known as the pGL3 basic vector), the firefly cold light enzyme group Cause =

The coding region has been designed to monitor transcription, linguality in transfected eukaryotic cells. The analysis of this reporter gene is fast, sensitive and quantifiable. The green and fluorescent protein (GFP) genes are

Another commonly used reporter gene. GFP is a protein produced by jellyfish, and its fluorescence appears green at a short wavelength of visible light. The GFP gene has been isolated, and has become a expressed protein by constructing a chimeric gene structure composed of the target protein gene and green and differently colored fluorescent protein genes linked to the target protein gene. Effective tool for rendering fluorescence. Because it is a fluorescent protein in animals, it can be used in other living systems. GFP has several different color variants. This GFP and its color variant vector for gene selection and constructs are from Clontech. The reporter gene can be operatively linked to the nucleic acid control sequence of the present invention via a vector to form a DNA or a performance construct, and then transfected into a host cell. Specific vectors that can be used to form DNA constructs, and are well known to those skilled in the art, include plasma or virus carriers. When the firefly cold light enzyme gene is used as the reporter gene, 200533759 is the pGL3 cold light enzyme reporter vector of Promega. When using the green light protein gene as the reporter gene, the pGpp vector of Clontech is preferred. When designing a DNA construct, it is not necessary to include the entire promoter of the CRMPq gene and all the nucleic acid regulatory sequences of other regulatory regions (SEQ ID NO: 2 at -1920 to +50). The core promoter region (SEQ ID NO: 3 at -18 to +50) or the smallest promoter region (SEQ ID NO: 4 at _ι⑽ to ⑻ φ) has been shown to have on CRMP-1 or reporter protein products Significant regulatory effect. In addition, the nucleic acid sequence of SEQ ID NO: 5 (located at -133 to -122) includes a regulatory factor binding site having 5'-GGGAGGAG-3, a nucleic acid sequence, and is preferably contained in a DNA construct. The regulatory factor binding site may include a transcription factor binding site, such as the binding site of the transcription factor Spl. Spl transcriptional regulatory sequences have been found in many viral and cellular promoters, including the human immunodeficiency virus long terminal repeat sequence 歹 'J (HIV long terminal repeat). The Spl transcription factor contains contiguous zinc finger motif for specific DNA binding activity. The Spl transcription factor can stimulate the basic activity of the smallest promoter via a mechanism that maintains different activities. In Examples 6 and 7 described later, such as electrophoretic mobility shift assay (EMSA), competition mobility shift assay, antibody supershift assay, and reverse transcription-polymerase chain reaction The reverse transcription-polymerase chain reaction (RT-PCR) method 200533759 shows that the nucleic acid regulatory sequence of the present invention has the ability to bind a variety of proteins. Binding to a protein will affect the regulatory capacity of the nucleic acid regulatory sequence, which may in turn affect the performance of the CRMP-1 gene. The following examples are provided as examples, but do not limit the scope of the present invention. For all those who have the knowledge of J: or, they can make reasonable changes to this without departing from the spirit and scope of the present invention. Wei _ For example, Example 1 Construction of the CRMP-1 basal domain and the construction of recombinant plastids pCRMP-U_1920 / + 189_l Signed to obtain a segment containing the human brain failure protein response mediator protein-l (hCRMP-1) gene 5 ' 2.1_kb DNA fragment of the adjacent region (sequence -1920 to +189 of the hcRMP-1 gene, [SEQ ID NO: 1]), here is the polymerase chain reaction (PCR) method, using the following two paragraphs Primer (R0Che GC-rich PCR system) was copied to obtain: • ⑴ 5'_CCGCTCGAGGCTTTGTACCGGCGAAATCT-3, (complementary sequence is located at -1920 to -1901, 5 'end is attached with a cut point of the artificial nucleic acid restriction enzyme Xhol [SEQ ID NO: 7]); and (2) 5'-CCCAAGCTTCGTGATTGTGCGGGATGCTCT-3, (located at +170 to +189, the 5 'end is attached with a cut point of the artificial nucleic acid restriction enzyme Hind III, [SEQ ID NO :8]). A human BAC selection strain RP11-69D13 (produced by Invitrogen) was used as a DNA template. This replicated fragment was blocked by two nucleic acid restriction enzymes 16 200533759

After Xhol and Hindlll were processed, they were inserted at the position of Xhol / Hindlll on the upstream side of the cold light enzyme gene of pGL3-basic vector (progema). The structure was designed as pCRMP-1 (-1920 / + 189), and the sequence fragments were tolerated by sequence analysis. PCRMP-U-1920 / + 50) Construction of the 5f-terminal vicinity of the hCRMP-1 gene (located in the sequence of hCRMP-1 gene -1920 to +50, [SEQIDNO: 2]) was replicated with the following two PCR primers :, ( 1) 5? -CGCTAATTACGCCAGCCCAAG-3r (located at 5023 to 5042 of the pGL3_ base vector, [SEQ ID NO: 9]) and (2) 5, -CCCAAGCTTCCGGGAGGGATAGAGACAC-3, (located at +32 to +50, 5 'end attached There is a cut point position of the artificial nucleic acid restriction enzyme Xhol, [SEQ ID NO: 10]). A plastid pCRMP-1 (-1920 / + 189) was used as a DNA template. This copied DNA fragment was treated with the nucleic acid restriction enzymes Notl and Hindlll, and then inserted into the Notl / Hindlll position of the pGL3-basic vector (progema). This construct was designed as pCRMP-1 (-1920 / + 50), and the duplicated sequence was confirmed by sequence analysis. Multi-site transient transfection and reporter gene cold light enzyme analysis. Prior to transfection, human lung adenocarcinoma cells (CLu) were implanted into a 6-well plate at a cell density of 1 x 105 cells per well and contained in 10% fetal calf. Serum 17 200533759 (FBS; manufactured by Invitrogen) was cultured in RPMI 1640 medium (manufactured by PRMI) for 24 hours. Dissolve 1 pg of pCRMP-l (-1920 / + 50) DNA and 1 pg of intrinsic control histone plastid DNA (pSV-P-galactosidase) in serum-free RPMI 1640 medium and 10 μΐ of transfection reagent Lipofectamine (manufactured by Invitrogen). The DNA / liposome complex was allowed to stand at room temperature for 45 minutes before being inserted into CLu cells. Cells were co-transfected with the complex for 6 hours in a 37 ° C incubator containing 5% carbon dioxide. After removing the culture medium and washing the cells twice with PBS buffer, 2 ml of RPMI 1640 medium containing 10% fetal bovine serum was added to the cells and cultured in a 37 ° C incubator containing 5% carbon dioxide. After culturing for 36 hours, the cells were recovered, and a cell extract was obtained with 250 μl of a dissolution reagent (manufactured by Tropix) per well. Human rectal cancer cells are cultured according to procedures well known to those skilled in the art. According to the above procedure, cells were transfected with pCRMP-1 containing the full length of the CRMP-1 promoter (-1920 / + 50) and recovered. Φ To measure the activity of cold light enzymes and β-galactosidase, 20 μ1 of cell extracts were used. This analysis was performed on a cold light analyzer (BERTHOLD Detection Systems Type Sirius 2C? Pforzheim, Germany) with a cold light enzyme analysis kit (Luciferase assay kit, manufactured by Tropix) and a galactosidase analysis kit (Galacto_Light Plus ™ system, manufactured by Tropix). Perform analysis. 18 200533759 The cold-light enzyme activity mentioned below has been corrected for β-galactosidase activity. Cold light enzyme activity is used as an indicator of gene expression in cells containing indicative reporter DNA constructs. Example 3 Analysis of the Nucleic Acid Regulatory Sequence of the CRMP-1 Gene CRMP-1 Some mutant lines of the 5′-terminal regulatory sequence of the CRMP-1 gene due to the long-distance reading truncation of the adjacent 5 ′ end upstream region The following method was used To construct and test the function of hCRMP-1 regulatory elements. All steps were performed according to the Exo Mung Bean Detection Kit (manufactured by Stratagene) with some modifications. Briefly, pCRMP-1 (-1920 / + 50) was first hydrolyzed with the nucleic acid restriction enzyme Xhol. The linearized plastids were then reacted with exonuclease III at 37 ° C for different days t. After extraction with organic solvent phenol-chloroform, from the position of -1920, 9 plastid fragments of different sizes can be obtained. After inactivation with exonuclease III at 68.0 for 15 minutes, these broken shellfish fragments were reacted with mung bean nuclease at 37 ° C for 30 minutes. The plastid fragments obtained by Shen Dian were subjected to a ligation reaction with τ4 DNA ligase. Each truncated construct entered CLk cells in a transient transfection manner, and its associated cold-light enzyme activity was measured by the method of Example 2. Results of the re-examination: Preparation of transcription activities with different truncated regulatory sequences 19 200533759 These different constructs and their associated cold-light enzyme activity in transfected cells are not as shown in Figure 1. Cold light enzyme activity was first corrected for galactase activity. Take the control of histoplasmic PGL3-basal plastid-transfected cells as the baseline. Compared to plastid pCRMP-1 (-1920 / + 50) in CL10 cells, the deletion of nucleotides -1920 to -180 did not significantly alter transcriptional activity. The -1880 to +50 fragment showed promoter activity. Compared with cells containing the pGL3_ basic vector and control group, cells transfected with the reporter gene and DNA and constructs located in the _99 to _180 regulatory region have been shown to increase their transcriptional activity by 30 to 60 times. Specifically, the transcriptional activity of pCRMP-1 (-180 / + 50), which contains a DNA containing DNA located at -99 to -180 nucleotides, is five-fold greater than that of pCRMP-1 (-99 / + 50). Example 4 Identification of Regulatory Factor Binding Sites The major sequence analysis of the 5'-end vicinity of the CRMP-1 gene revealed that it is a promoter that does not contain TATA. A Transcription Element Search System TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess7RQ-WELCOM E) can be used to predict certain regulation in the range -180 to -99 Factor binding sites, such as Spl binding sites. Two regulatory factor binding sites containing GGGAGGAG-sequence fragments were identified. This sequence fragment is a phylogenetic footprinting using a computer (see Blanchette, M. and Tompa, M. (2002): Discovery of requlatory elements by a computational method for phylogenetic footprinting. Genome 20 200533759

Research; http: //www.gen0me.0rg/cgi/d0i/l 0.110 l / gr.69 (2)) List putative regulatory sequence fragments. The first regulatory factor binding site is an interval located at -133 $-122 (5'-GGGAGGAGCTGT-3 ,, SEQ ID NO: 5). The second regulatory factor binding site is an interval from -115 to q〇〇 (5, -CCCCCTCCTCCCGCC-3 ', SEQ ID NO: 6), which contains a reverse sequence of the opposite sequence of GGGAGGAG 歹 U, this sequence and other The putative Spl binding sites overlap. Results of the test \ Deletion of regulatory factor binding sites Two constructs with missing DNA, pCRMP-l (-116 / + 50) and pCRMP-l (-99 / + 50), were designed to remove the first regulation Factor binding site and two regulatory factor binding sites. As shown in Table 1, deletion of a fragment between -180 and -117 containing the first regulatory factor binding site results in a relative cold photoenzyme activity decrease of almost 60% (pCRMP-1 (-l 16 / + 50)). As shown in Table 1, after removing the two regulatory factor binding sites, pCRMP-1 (-99 / + 50), its cold light enzyme activity will be further reduced to 75%. These results show that these two regulatory factor binding sites are necessary for the basic transcriptional activity of the CRMP-1 gene promoter. 200533759 Restore the Hanlu active DNA construct pCRMP-l-M12 by adding an artificial repeat sequence containing the first regulatory factor binding site to the DNA construct containing the original nucleic acid regulatory sequences located at -99 to +50, and two located at Repeated sequence of additional artificial first regulators from -133 to -122 upstream of CRMP-1 gene. A synthetic short-chain oligonucleotide with the Xhol nucleic acid restriction sequence (5, -ccgctcgag | gggaggagctgt | [gggaggagctgt CTCGAGCGG-3, SEQ ID N0: 11) and its reverse sequence were formed by a synthetic chemistry method to form a short Double-stranded DNA. The modified DNA construct (ie, PCRMP-1-M12) was hydrolyzed by a double-stranded oligonucleotide with an endonuclease xh〇I, and then ligated to the linear DNA construct pCRMP-1 (-99 / + 50) (also hydrolyzed with endonuclease Xhol). Compared to the wild-type DNA construct, the relative cold-light enzyme activity of this mutant DNA construct was 114% (Tea Table 1). This result clearly shows that the addition of the two first regulatory factors not only restores the activity, but also actually increases the performance activity of pCRMP-1 (-99 / + 50) to the wild-type DNA construct pCRMP_l (-180 / + 50) The performance of the activity. (See Table 1.) The pCRMP-1 (-99 / + 50) DNA construct without the first regulatory factor binding site showed only 24% relative cold light enzyme activity and served as a negative control group, while the wild-type DNA construct pCRMP-1 (-180 / + 50) was used as the positive control group (ie, the cold light enzyme activity of pCRMP-1 (-180 / + 50) was shown as Table 1 as 100% h). This result further suggests that the first regulatory factor binding site is important for the transcription and expression of CRMP-1 gene 200533759. More specifically, the two artificial repeats at the binding site of the first regulatory factor can replace the region of the original sequence without any effect on the relative photoenzyme activity. Furthermore, the transcription and expression activity of the first regulatory factor binding site is not significantly related to the transcription initiation position of the CRMP-1 gene (ie, the ATG start codon of exon-1 of the CRMP-1 gene). . Example 5 Function of hCRMP-1 promoter using site-directed mutagenesis • Sister, it is possible to apply the site-directed mutagenesis method to the nucleic acid regulatory sequence -180 to -100 upstream of the CRMP-1 gene ( Or presumed) further study of binding sites. Methodology The methods for making mutant DNA constructs are shown in the description below, and the results of these mutant DNA constructs and their relative cold photoenzyme activity are listed in Table 2. The first tuned Mino-cobalt-forming ridge (located at -133 to -122) was designed based on the wild-type DNA construct pCRMP-1 (-180 / + 50) to design five mutant DNA constructs containing a reporter gene for cold light enzymes. They are pCRMP-1 M3, m3-2, m3_3, m3-4, and m3-5. As shown in Table 2, except that each proposed mutant has a point mutation or a nucleic acid between -133 and -122. Except for the transformation, they all have the 5 'end CRMP-1 promoter of the same length as the DNA construct pCRMP-1 (-180 / + 50). As shown in Table 23, 200533759 II, compared with m3-4 and the wild-type DNA construct pCRMP-1 (-180 / + 50), the relative cold-light enzyme activity was significantly reduced by about half. In addition, mutants m3-2 and m3-3 showed reductions in their transcription and expression activities to approximately 70% and 60%, respectively (see Table 2). Furthermore, although the mutant construct Mil, which has the same mutation as pCRMP-1 M3, has a complete 1.9 kb upstream regulatory sequence in its DNA construct, the relative cold light enzyme activity is significantly impaired (50%). Mutation of the second regulatory factor binding site (located at -115 to -100) The second regulatory factor binding site contains a GGGAGGAG reverse sequence. When the sequence structure located in the region -115 to -100 (that is, pCRMP-1 DNA constructs M4 and M5) was disrupted, there was no significant effect on transcriptional activity (see Table 2). Mutants other than the two regulatory factor binding sites were compared to the wild-type DNA construct pCRMP-1 (-180 / + 50), and the mutant construct pCRMP-1 Ml (- AG to GA), and its transcriptional activity was reduced to 60% (see Table 2). When GC was converted to AT at positions -119 and -118, only a small amount (ie, about 20%) of the transcriptional activity was lost (see Table 2). In addition, when the mutations are at positions -146 and -145 (ie, CT is converted to TC) (see M2 in Table 2), positions -135 and -134 (ie, CC are converted to TT) (see Table 2 M3-6) and the positions of -121 and -120 (ie, convert CT to TC) (see m3-5 in Table 2) did not affect the transcriptional activity of the CRMP-1 gene. 24 200533759 In summary, the results of the point mutation experiment confirmed that the first regulatory factor binding site at -133 to -122 (5'-GGGAGGAGCTGT-3 ', SEQ ID NO: 5) is responsible for the transcription and / Or regulation of performance is necessary. Example 6 Analysis of DNA Binding Proteins of CRMP-1 Gene Nucleic Acid Regulatory Fragments, Materials and Methods To identify specific binding protein complexes in the nucleic acid extract of crm / 7-i regulatory fragments, the main technique used is electrophoretic shift analysis (electrophoretic mobility shift assay, EMSA). A related method, antibody supershift assay will further confirm the binding proteins (ie, proteins in the formation of DNA-protein complexes) contained in the CRMP-1 gene nucleic acid regulatory sequence. Electrophoretic shift analysis (EMSA) or gel shift assay • Provides a simple method for detecting DNA-binding proteins such as transcription factors (Buratowskiet al ·, Current Protocols in Molecular Biology, (1996): 12 · 2 · 1-12.2.11). This analysis is based on the observation that when moving on a non-denaturing polyacrylamide gel, the speed of DNA-protein complexes is faster than free DNA fragments or double-stranded oligosaccharides. Oligonucleotides come slowly. Gel shift assay is the reaction of purified protein or a complex mixture of proteins (such as extracts from the nucleus) with a DNA fragment containing regulatory 25 200533759 factor binding sites and 32P calibration. The specificity of the DNA-binding protein used for the regulatory factor binding site was confirmed by a competitive experiment using a DNA fragment that has not been calibrated to 32P or an oligonucleotide containing the regulatory factor binding site of the CRMP-1 gene. Or other unrelated DNA sequences. Preparation of nucleic acid extracts This analysis used two different nuclear extracts from He] ^ a (promega, USA) and CLu, two human cancer cell lines. The preparation method is based on the method of Dignam et al. (1983) (Dignamet al., Nuclei. Acids Res., (1983), 11, 1475-1489). DNA probe and radioactive element calibration Three double-stranded DNA probes are specifically designed for motility shift assays. 0 ^ AJUtA contains a repeat of the first regulatory factor binding site sequence (5 ^ GGGAGGAGCTGTGGGAGGAGCTGT-3T. SEQ ID NO: 0 ^ AJUtA using chemical synthesis and complementary oligonucleotides). 12) 〇DN.A slow pair B is a fragment located at -117 to -100 and contains a GGGAGGAG ^^ reverse sequence (5, -AGCCCCCTCCTCCCGCCC-3 ,, SEQ ID NO: 13) 〇26 200533759 DNA probe C is The fragment at -137 to -100, (5, -CGCCGGGAGGAGCTGTCTGCAGCCCCCTCCTCCCGCCC-3, SEQ ID NO: 14). The radioactive element calibration of the DNA probe was prepared according to Gel Shift Assay Systems (Technical Bulletin No. 110) manufactured by Promega Corporation (USA). The experimental procedure of DNA-protein binding reaction and electrophoresis is based on Gel Shift Assay Systems (Technical Bulletin No. 110) manufactured by Promega (R) Corporation (USA), and is partially modified. The standard DNA-protein binding reaction is to use 1 to 20 pg of HeLa or CLi-o nuclear extract in a buffer solution (4% glycerol, ImM MgCl2, 0.5mM EDTA, 0.5mM DTT, 50mM). NaCl, 10 mM Tris-HCl (pH 7.5), 0.05 mg / ml poly (dI-dC) * poly (dI-dC)), and reacted at room temperature for 10 minutes. Then, each reaction mixture was mixed with a 32p calibration probe, and the reaction was continued at room temperature for 20 minutes. A 10-fold volume of gel filling buffer containing φ 250 mM Tris-HCl (pH 7.5), 0.2% bromophenol blue, and 40% glycerol was added to each reaction mixture. The test object was electrophoresed in 1x TBE buffer and 4% polypropylene gel (PAGE gel), and then electrophoretic analysis was performed at 4 ° C at 100 volts. Competition mobility shift assay. A competitive binding assay can be used to evaluate nucleic acid sequence interactions between proteins and DNA. J specificity (Carthewet al., Cell (1985), 27 200533759 =: 439-448). Unlabeled DNA probes and nuclear extracts used for competitive analysis were cultured in the binding reaction buffer, and then DNA spikes labeled with 疋 P were added. In this analysis, in addition to adding three DNA probes (ie DNA probes A, B and c) for standard binding reactions, an additional mutant DNA probe was also used in competition analysis to confirm the DNA-protein complex. Specificity. The sequence of this mutant DNA probe is 5f-AAAGGGGACTACAAAGGGGACTAC ^ 3T (SEQ ID NO: I 15), which contains several substituted nucleotides of DNA probe A. Antibody supershift assav A variant of shifted DNA-binding analysis is the use of antibodies to identify proteins that appear in protein-DNA complexes (Kristieet al., Proc. Natl · Acad · Sci · USA (1986), 83: 3218-3222) 〇 A specific antibody is added to the binding reaction to determine whether the protein is a predicted protein, such as whether transcription factors are involved in the formation of DNA-protein complexes in colloidal displacement studies. When the protein recognized by the antibody has nothing to do with the formation of the complex, it is considered to have no effect. There are two different situations that can be foreseen. Either the formation of the complex is inhibited or an antibody-protein-DNA complex is formed. The latter will result in a further reduction in the movement of the protein-DNA complex (ie supershift). Purified recombinant Spl protein was purchased from Promega Corporation (USA). Spl antibody (purchased from Santa Cruz Biotechnology) was reacted with nuclear extracts and DNA probes for 30 minutes. f Test results 28 200533759 Figures 3A to 3D show the binding of a specific DNA-protein complex in the CRMP-1 promoter region. This study was performed using the electrophoretic mobility shift assay (EMSA), competition mobility shift assay, and antibody supershift assay in Example 6. Three double-stranded DNA probes are designed for displacement analysis. DNA probe A contains a repeat sequence of the first putative binding site • (5, -GGGAGGAGCTGTGGGAGGAGC TGT_3, SEQ ID NO: 12). The underlined sequence is labeled as the first putative binding sequence 歹 ij. DNA probe B contains a fragment of -117 to -100 (5, -AGCCCCCTCCTCCCGCGCCC-3, SEQ ID NO: 13), which contains the reverse sequence 歹 ij of GGGAGGAG. DNA probe C contains a fragment of -137 to -100 (5, -CGCCGGGAGGAGCTGTCTGCAGCCCCCTCCT CCCGCCC-3f, SEQ ID NO: 14). All DNA probes used for standard binding reactions were calibrated at 32p. Shift analysis of DNA probe A in HeLa cell nuclear extracts. DNA probe A containing a repeat sequence of the first regulatory factor binding site was used to confirm specific DNA-protein complexes (PI, P2, and P3). (Figure 3A first block). However, in a competition mobility shift assay, these DNA-protein complexes disappeared when 50-fold excess and 100-fold unlabeled DNA probe A were added to the competition (Figure 3A, 2nd) , 3 columns). The DNA-protein complex P3 can also be suppressed by DNA probe B containing the reverse sequence of GGGAGGAG without 29 200533759 J2P calibration (Figures 6 and 7). As expected, mutated DNA probes that were not identified by "P" did not exhibit competitive inhibition (columns 4 and 5 in Figure 3A). Since DNA probe a and DNA probe B contain the same sequence, the results of this analysis indicate that the protein formed in complex p3 may be specific to the GGGAGGAG sequence. In CLu nuclear extracts, two specific DNA-protein complexes were found. They may be the same as the complexes P1 & P3 (Fig. 3, column 9 φ) or their approximations, and they are consistent with the binding reaction using HeLa nuclear extracts; because they exhibit similar movement responses on electrophoretic colloids. Displacement analysis of DNA probe B. Using a 32P-calibrated DNA probe 8, a major DNA-protein complex p4 can be detected in HeLa * CLi0 nuclear extracts (respectively in column 3 of FIG. 3B). After using the same non-32p-calibrated DNA fragment to compete with a 50-fold excess and a 100-fold competition analysis, the colloidal shift analysis showed no specificity for this DNA-protein complex (shown in columns 2 and 3 of Figure 3B, respectively) ). This DNA-protein complex disappeared when 50-fold excess and 100-fold excess of the non-32p-calibrated DNA probe A were added (see columns 4 and 5 in Figure 3B, respectively). The binding reaction of an excess and mutated DNA probe was used as a negative control group, which could not compete with the specific DNA binding protein (in columns 6 and 7 of Figure 3B, respectively). Colloidal shift analysis further confirms that DNA probe A and DNA probe B have the same competitiveness because they both contain the same sequence (GGGAGGAG). More specifically, the compound P3 and the material may be composed of the same ingredients. 30 200533759 Μ A displacement analysis of lotus body c

After the interaction between HeLa nuclear extract and 32P-labeled ONA probe c, four DN winter protein complexes P5, P6, P7, and P8 with decreasing molecular weight were presented (Figure 3C, first column). Three of them (p5, p6, and P7) were specific because they (P5, P6, and P7) were unable to use 100 times and 200 times the same amount of uncalibrated DNA. Probe C failed. Measured (in columns 2 and 3 of Figure 3C). Competitive analysis with excess mutant DNA probes revealed that it had the same DNA-protein complex pattern as the standard binding analysis (Figures 3C, columns 6 and 7). The DNA-protein complexes P5 and P6 are subject to specific competition from 100-fold and 200-fold excess DNA probe A containing the repeating sequence of the first regulatory element, (columns 4 and 5 of Figure 3C), while DNA probe b No (columns 8 and 9 in Figure 3C). Because the DNA_protein complex P7 disappeared from the competition analysis results, it can be inferred that it is specific for DNA needle B (Figures 3C, columns 8 and 9). There may be other proteins or transcription factors specific for the first regulatory factor binding site. # In CLi-O nuclear extract, there are three DNA-protein complexes that can bind to DNA probe c. It has very similar results to the complexes P5, P6 and p8 in the HeLa nuclear extract (Figure 3C, column 11). For full-body gold deposition, the addition of anti-Sp 丨 antibodies to the binding reaction will make the DNA-protein complex P1 move the slowest (Figure 3A, Block 8). The same effect was observed in the binding reaction containing DNA probe c (Figure 3C, column 10). The slowest-moving hysteresis effect of the DNA-protein complex was confirmed by reacting the nuclear extract of CLU0 31 200533759 with DNA probe A and DNA probe C (results not shown). Displacement analysis with extra Spl fruit whitening Using protein shift analysis with Sp 1 added, further studies were performed to confirm the presence of the Spl protein-forming complex (SP1 protein_fommj complex). The Spl protein of 5 P 檩 was added to the nuclear extract of HeU cells and η DNA probe A or DNA probe C, respectively, and a binding reaction was performed. At the colloidal position of 50 ng heavy probe A and probe C due to the DNA. Protein complex, the obvious shift lag of ice a (as shown in the third column of Figure 3, respectively, because if no nuclear extract is present Therefore, there is no need for butterfly and 心 4 to make the SP1 protein j to the signal sharpness and the factor binding site by the association with other factors (Figure 3D, Nos. 7 and 8). ，,,, and ° are combined in the regulation due to the above The results show that by making it possible to prevent the formation of a specific Spl protein: the anti- ¥ formation can be further-and the following conclusions can be obtained-the regulation of the transcriptional activity of the proton complex, at least the right CRMp, ... In the evening, there are two other specific h 1 starter complexes necessary. 疋, light noodles at the protein seam and crevices ^ Anti-transcriptional modulation materials and methods 32 200533759 report _DNA constructs and Spl protein performance_ The transient co-transfection of the constructs increased the expression of Spl protein in the cells. pSG5-Spl was transiently co-transfected. The DNA construct pSG5 in CLu cells served as a negative control group. Two DNA constructs pSG5-S pl and pSG5 were donated by Dr. Robert Tjian. Reverse Transcription-Polymerase Reaction (RT-PCR) CLu cells were collected and cultured for 24 hours, and RNA was isolated using a commercially available RNA-Bee ™ reagent kit. Reverse transcription reaction was performed with the total RNA of lpg, and then 1/25 of the reverse transcription reaction product was taken for polymerase chain reaction (PCR) (Invitrogen). Three pairs were designed for hCRMP-; l, Sp- I and ¾ specific primers for similar gene expression studies, the sequence of the primers is as follows: hCRMP-1 primer pair: synonymous strand primer 5, -ATGCCCTGAGCAGACCTGAAGAGC-3, (SEQ ID NO: 16) and antisense strand primer 5f-AGTAATGGGTGCCATCGGTCCGCAG -3? (SEQ ID NO: 17)

Sp-1 primer pair: Synonymous strand primer 5, -GAGAGTGGCTCACAGCCTGTC-3 '(SEQ ID NO: 18) and 33 200533759 Antisense strand primer 5, -GTTCAGAGCATCAGACCCCTG_3, (SEQ ID No. 19) Similar primer pairs (Shanet al ·, Mol. Cell · Biol · (1992) 12, 5620-5631): Synonymous strand primer 5'-GTATGGAACCTGGCTAACTG-3, (SEQ ID NO: 20) and _Antisense strand primer 5? -TACTGATAACTTCTTGCTTC-3f (SEQ ID NO: 21) In order to control the quality of RNA, the expression of similar genes was used as an internal & control group. All results were observed after staining with ethidium bromide. The SPl protein negatively regulates the crmp- / promoter. Relative cold light ginseng enzyme's tongue is used as an indicator of the effect of the over-expressed Spl protein on the effect of regulating activity. Compared to cells with no overexpressed Spl protein, overexpressed Spl protein was co-transfected with the reporter construct pcrmp-ig180 / + 50), and its relative cold-light active enzyme was reduced by nearly 50%. As expected, since the reported SP1 binding site was not included in the reported DNA construct, there was no particular effect on cells transfected with pCRMP-1 (-99 / + 50), regardless of the presence of overexpressed Spl protein. . Alpha reverse transcription-polymerase chain reaction (RT-PCR) is used to evaluate the amount of RNA of RMP-i, Spl, and G々-like genes. When the spi protein is overexpressed in 34 200533759 cells, the amount of CRMP-1 RNA is significantly reduced (Figure 4). Q-like genes (house keeping genes are used here as experimental control groups) present similar amounts of RNA (Figure 4). As expected, the amount of RNA in Spl was significantly higher in cells transfected with DNA constructs overexpressed by Spl. These results confirm that the Spl protein may be a negative regulator of CRMP-1 expression. The present invention has been described by way of examples and preferred embodiments, and it should be understood that the present invention is not limited to the embodiments disclosed herein. On the contrary, the invention is intended to cover various modifications that will be apparent to those skilled in the art. Therefore, the scope of patent application should conform to the broad interpretation to include all similar modifications.

35 200533759 [Schematic description] Figure 1 shows that a DNA construct containing specific nucleic acid regulatory sequences upstream of the human CRMP-1 (brain failure response response protein-1) gene was transfected into lung adenocarcinoma branches. Relative luciferase activity caused by deletion of a series of nucleotides in the 5 * flanking region of the CRMP-1 gene after the CLu cell line. This relative cold light enzyme activity was corrected for galactosidase hydrolysis enzyme activity (10,000-galactosidase), and this value was sequentially compared with the control plastid (ie, only the pGL3-basic vector and no CRMP-1 upstream nucleic acid regulatory sequence) ) After comparing the average values to determine the percentage of performance relative to the control group. Figure 2 shows a part of the nucleotide sequence representing the human CRMP-1 gene 5, a nearby region. Some exons of the human CRMP-1 gene! (Ex〇nl) _ is shown in the box. The potential transcription factor (Spl) binding site is indicated by the underlined sequence. "*" Represents 4 nucleotides GAGC. Figure 3A: In column 1, the standard binding analysis of HeLa cell nuclear extract with 32p-calibrated DNA probe A was performed; for the second and third steps, before adding 22 ° C to DNA probe A calibrated with P, 5 was added separately. Competitive analysis of DNA probe A that has not been calibrated by 32P and 100 times; For the 4th and 5th, before adding DNA probe a that is calibrated by 32p, 50 times and 100 times of the Competitive analysis of 32p-calibrated mutant probes (including the repeat sequence AAAGGGGACTAC, SEQ Id No. 15); Blocks 6 and 7, before adding DNA probe A that was determined by 32p 榡 36 200533759, 50 times and loo, respectively Competitive analysis of DNA probe B response without the 32P calibration; Block 8 for antibody binding substitution analysis with 0.8 pg of Spl antibody; Block 9 for standard binding analysis using CLuO nuclear extract. Figure 3B: In column 1, the standard binding reaction between HeLa nuclear extract and DNA probe b, blocks 2 and 3, before adding DNA probe B calibrated with 32P, add 50 times and 100 times of Competitive binding analysis of 32p-calibrated DNA probe B; For the fourth and fifth blocks, before adding 32P-calibrated DNA probe B, add 50-fold and 100-fold competitive binding of DNA probe A without 32P-calibration, respectively. Analysis; columns 6 and 7, before adding 32P-calibrated DNA probe B, competition with 50-fold and 100-fold non-32p-calibrated mutant probes (containing the repeat sequence AAAGGGGACTAΓ SEQ ID NO: 15), respectively Analysis; column 8, standard binding analysis with CLw cell nuclear extracts. Figure 3C: Standard Binding Reaction of HeLa Cell Nuclear Extraction in Section 1; Sections 2 and 3, before adding DNA probe c calibrated with 32p, add 100 times and 200 times DNA probe without 32P calibration, respectively. Competitive binding analysis of the effects of C and HeLa cell nuclear extracts; Blocks 4 and 5, before adding the DNA probe c calibrated with 32p, add 100 times and 200 times the unlabeled DNA probe A and HeLa cell nucleus, respectively. Competitive binding analysis of extract action 37 200533759; in columns 6 and 7, before adding 32P-calibrated DNA probe C, 100 times and 200-fold mutations without 32P calibration were used before the needle and HeLa cell nuclear extract, respectively. Competitive analysis of the effects, column 8 and column 9, 100 times and 200 times of the unlabeled DNA probe B and HeLa cell nuclear extract competition analysis; column 10, 0.8 pg Spl antibody antibody Binding substitution analysis; Column 11: Standard binding analysis with CLm nuclear extracts. • Figure 3D: Colloidal shift analysis using different concentrations of recombinant Spl protein. Each binding reaction mixture contains a 32P-calibrated DNA plate needle (shown below), HeLa cell nuclear extract, and additional recombinant Spl protein. In columns 1 to 3, 32P-labeled DNA probe A is mixed with 0, 5ng, and 50 ng recombinant Spl proteins; in columns 4 to 6, 32P-labeled DNA probe C is mixed with 0, 5ng, and 50 ng, respectively. Recombinant Spl protein mix; Columns 7 and 8, binding reaction mixtures without HeLa nuclear extract. • Figure 4 shows that the Spl protein inhibits CRMP-1 gene transcription in CL ^ o cell lines. The two DNA constructs pSG5 (control group) and pSG5-Spl (which can overexpress the Spl protein) can be co-transfected (co_transfection) into CLi-o cells, and this cell CLk contains the pCRMP-1 DNA construct ( This construct contains a reported cold light enzyme gene and a CRMP-1 regulatory sequence located at -180 to +50 (J). Left shelf: Agarose gel electrophoresis indirectly proves that in CLi_O cells co-transfected with pSG5 and pCRMP-1 38 200533759, the amounts of DNA corresponding to CRMP-1, Spl, and Gs-like proteins were corresponding. For semi-quantitative analysis, 1 pg of total RNA was taken for reverse transcription (RT) during the first reaction, and then 1/25 of the volume of the first reaction was taken for PCR. Right column: In CLk cells co-transfected with pSG5 and pCRMP-1, the amount of mRNA corresponding to CRMP-1, Spl and < 3 no similar proteins. All results were obtained by ethidiumbromide staining.

39 200533759 Table 1: Deletion and modification of DNA constructs containing reporter genes containing cold light enzymes and their relative cold light enzyme activity The reported constructs show the relative cold light enzyme activity ratio (%) pCRMP-1 (-180 / + 50) in mutation experiments The main functional sequence of the wild type DNA construct 100 pCRMP-1 (-99 / + 50) with a core promoter sequence identified as "core promoter sequence" was deleted. 24 1010 pCRMP-U-116 / + 50) There is a fragment deletion between -180 and -117 (including the first regulatory factor binding site). 42 3 pCRMP-l-M12 is added at the 5 'end of the pCRMP-1 (-99 / + 50) DNA construct. Repetitive sequence of the first regulatory factor binding site 114 ± 4 Remarks · Rel · A (luc) = Reiative Luciferase Activity 〇41 200533759 Table 2: Function of hCMRP-1 basic promoter by point mutation method The results of sexual analysis are relatively cold photoenzyme live f2 * 2 DNA construct "(luc) mutation position to replace the test base Wt 100 * * Ml 65 soil 6 -171, -170 AG II GA M2 115 J 7 -146, -145 CT = > TC M3 43 soil 2 -127, -126 AG = &GA; GA m3-2 73 people 10 -131, -1 30 GA = > AG m3-3 63 Taxi 4 -123, -122 GT = > AC m3-4 49 Soil 7 -133, -132 GG = &AA; AA m3-5 103 ± 38 -121, -120 CT = &TC; TC m3-6 108 soil 23 -135, -134 CC = > TT m3-7 80 ± 10 -119, -118 GC = > AT M4 85 ± 22 -113, -111, -109 C = > T, C = > T, C = > T M5 107 soil 19 -105, -103, -101 C = > T, G = > T, C = &T; T Mil 51 ± 7 -127 , -126 ag = > ga ": Abbreviation for" mutation reporter DNA construct ". Except that Mil is based on pCRMP-1 (-1920 / + 50), the rest are based on point mutation experiments with the wild-type DNA construct pCRMP-1 (-180 / + 50). * 2: Represents "relative cold light enzyme activity" expressed as a percentage (%). Except for Mil, which was determined as 100% with the wild-type DNA construct pCRMP-1 (-1920 / + 50), all other DNA mutant constructs were determined with the wild-type DNA construct pCRMP-1 (-180 / + 50) as 100. %Calculation. *** represents no point mutation and no base substitution. 42 200533759 Sequence Listing < 11 ο > Yifa Technology Co., Ltd. < 12〇 > CRMP-1 (Collapsin Response Mediator Protein-I) Transcription Regulatory Nucleic Acid Sequence < 130 > AD7040862001 < 150 > US 60 / 544,682 < 151 > 2004-02-17 < 160 > 22 < 170 > Patentln version 3.3 < 210 > 1 < 211 > 2109 < 212 > DNA < 213 > Homo sapiens (Modern Homo sapiens) < 400 > 1

gctttgtacc ggcgaaatct gcttgggagc agcgatctgt ttggccagtg gcaggcggat 60 gctcctcccc ctgatacgca cgtggtcttg tcccttgctg taggggcttt ctgctcagat 120 ctccagactg acccagggaa acgccctggt acggggaacc taggacttaa caactccaag 180 gaagggagtg taggagttgg ggagggacag tgtccccatc tgcaatttcc ggtcattgac 240 agggatttta ggccccgctg agagccaggg atgcatgaat * gcgtggaggg aaatgagttg 300 taaacagagt gtaggggaac ctggcatctc catgctgctt tgctgcagct aatatgtttt 360 gcacccgggg tacatcattt tacctctgta agcctcaatt tcctgtctgt aaaa ' tgggaa 420 aattatgcct agtgttcctg ggatactgag ctggcttctc tgtgaagcta aaacctcacc 480 200533759 tctattttaa ggcccaggtg tctctggcct cctgccctgg attaggggac tggcccctgg ggtggtgaag gtcagggccc cagcccccaa ccacagtgct gggggagctg taccaagcct aggccaccct cgctctggat ggcaacttga aagcagaaaa gatgagtagt ttcataggac ctgtggggtt ggatttcgca tgcagaaaat gaacaacgaa gtggtggaca aggttggtgt tttattctgc ctgggaactt ggggcacctg tccagtgagg ttggggcttg ctggggctcc cccttttcct ccatcttctt tcatcttttc ccctctgctg ttacggacct tgtcaagctg

tgacctggct tcctgcccac ctccctctgg agcaacatct ggatcatgga ctccggggct ggtgtccaca gtgctgggag gcaggagcac cctagtcctc ctcctgaccc ccagcttgtc cccagggctg ggtgccagtg gcccagccct ccaaacacct gctgtcttgg aggcaattct gtggggtgac ctggtggccc cagtgtcagg ctgctgtgtg atgagggagc tgctgttgga gtagaacagg tcagcattaa ttaaggccgt ccctgctgtt ccctctgcca gttagggggc tccaccttag aggcccccag ggagggctgg ttcaatgcta tggagacctt acccttctgt

ggatggagag ggtggcaggg agaggcttcg tggtggggaa ggcattggag atgggtctag gggagtggac aggcttttgt ctggggtaga ctattcaggg agagggtaca gcgtgaataa aggcttgggg tccgagatgg aaaaagtgct tggtgcattc agggagaggc actcgggaag gataaacgga ggctatggaa ggagaggcaa gaggggagcg ^ gtccttgggc gcgatcctgg agggacaaga acgttcccag cagcttgggc cgatccttgg cccccgtccc acactccctc cccccacacc cccgcagatg ttccggggag gcctccagac gcgcggccac acacctgtgg 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 cgccgcccgc gggccctgac cgcgccgtct ttttctttta aaggagccct gaaaaccata 1620 200533759 ctctctggat cgcgagagcg aggccagggc ccgccaaggg cgtgtgcgca gggcgggggt cggcggggct gggcgggtgg ggggcggggg gcggggtggg agatcggaag ggaagcgctt cctggttcga gccgagaggg gcgaatccgg cttcgctccg cgccgccggg aggagctgtc tgcagccccc tcctcccgcc ctcgcctctc cctcctcctt ctcccgccct cctcgccgat ccgggcggtg ctggcagccg gagcggcggc gggcgggccg agcagccggg gcagccgcgc gtgggcatcc acgggcgccg agcctccgtc cgtgtctcta tccctcccgg gcctttgtca

gcgcgcccgc tgggagcggg gccgagagcg ccggttccag tcagacagcc ccgcaggtca gcggccgggc cgagggcgcc & agagggggcc atgtcgtacc agggcaagaa gagcatc &&; 210 &210; 210 &212; 210 < 210 < 210

≪ 400 > 2 gctttgtacc ggcgaaatct gcttgggagc agcgatctgt ttggccagtg gcaggcggat gctcctcccc ctgatacgca cgtggtcttg tcccttgctg taggggcttt ctgctcagat ctccagactg acccagggaa acgccctggt acggggaacc taggacttaa caactccaag gaagggagtg taggagttgg ggagggacag tgtccccatc tgcaatttcc ggtcattgac agggatttta ggccccgctg agagccaggg atgcatgaat gcgtggaggg aaatgagttg 60 120 180 240 300 taaacagagt gtaggggaac ctggcatctc catgctgctt tgctgcagct aatatgtttt 360 200533759 gcacccgggg tacatcattt tacctctgta agcctcaatt tcctgtctgt aaaatgggaa aattatgcct agtgttcctg ggatactgag ctggcttctc tgtgaagcta aaacctcacc tctattttaa ggcccaggtg tctctggcct cctgccctgg attaggggac tggcccctgg ggtggtgaag gtcagggccc cagcccccaa ccacagtgct gggggagctg taccaagcct aggccaccct cgctctggat ggcaacttga aagcagaaaa gatgagtagt ttcataggac ctgtggggtt ggatttcgca tgcagaaaat gaacaacgaa gtggtggaca aggttggtgt

tttattctgc ctgggaactt ggggcacctg tccagtgagg ttggggcttg ctggggctcc cccttttcct ccatcttctt tcatcttttc ccctctgctg ttacggacct tgtcaagctg tgacctggct tcctgcccac ctccctctgg agcaacatct ggatcatgga ctccggggct ggtgtccaca gtgctgggag gcaggagcac cctagtcctc ctcctgaccc ccagcttgtc cccagggctg tggagacctt ggtgccagtg gcccagccct ccaaacacct gctgtcttgg aggcaattct gtggggtgac ctggtggccc cagtgtcagg ctgctgtgtg atgagggagc tgctgttgga gtagaacagg tcagcattaa ttaaggccgt acccttctgt ccctgctgtt

ccctctgcca gttagggggc tccaccttag aggcccccag ggagggctgg ttcaatgcta ggatggagag ggtggcaggg agaggcttcg tggtggggaa ggcattggag atgggtctag gggagtggac aggcttttgt ctggggtaga ctattcaggg agagggtaca gcgtgaataa aggcttgggg tccgagatgg aaaaagtgct tggtgcattc agggagaggc actcgggaag gataaacgga ggctatggaa ggagaggcaa gaggggagcg gtccttgggc gcgatcctgg 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 agggacaaga acgttcccag cagcttgggc cgatccttgg cccccgtccc acactccctc 1500 200533759 cccccacacc cccgcagatg ttccggggag gcctccagac gcgcggccac acacctgtgg cgccgcccgc gggccctgac cgcgccgtct ttttctttta aaggagccct gaaaaccata ctctctggat cgcgagagcg aggccagggc ccgccaaggg cgtgtgcgca gggcgggggt cggcggggct gggcgggtgg ggggcggqgg gcggggtggg agatcggaag ggaagcgctt cctggttcga gccgagaggg gcgaatccgg cttcgctccg cgccgccggg aggagctgtc tgcagccccc tcctcccgcc ctcgcctctc cctcctcctt ctcccgccct cctcgccgat

ccgggcggtg ctggcagccg gagcggcggc gggcgggccg agcagccggg gcagccgcgc gtgggcatcc acgggcgccg agcctccgtc cgtgtctcta tccctcccgg 1560 1620 1680 1740 1800 1860 1920 1970 < 210>

< 212 > DNA < 213 > Homo sapiens (modern Homo sapiens) < 400 > 3 cctggttcga gccgagaggg gcgaatccgg cttcgctccg cgccgccggg aggagctgtc

60 120 180 tgcagccccc tcctcccgcc ctcgcctctc cctcctcctt ctcccgccct cctcgccgat ccgggcggtg ctggcagccg gagcggcggcgggcgggccg agcagccggggcagccgccgc cgtgggctccccacg

< 211 > 81 < 212 > DNA < 213 > Homo sapiens (Hyundai Homo sapiens) 4 < 4〇〇 > 230 81 200533759 cctggttcga gccgagaggg gcgaatccgg cttcgctccg cgccgccgcc < tgcagccccc > tcc

< 211 > 12 < 212 > DNA < 213 > Homo sapiens (Modern Homo sapiens) 12 16 < 4〇〇〉 5 gggaggagct gt

\

< 210> 6 < 211 > 16 < 212 > DNA < 213 > Homo sapiens (Modern Homo Sapiens) < 4〇〇 > 6 ccccctcctc ccgccc < 210 > 7 < 211 > 29 < 212 > DNA < 213 > Artificial Sequence < 22〇 > < 223> pCRMP-1 (-192 0 / + 189) Bow 1 < 4〇〇 > 7 ccgctcgagg ctttgtaccg gcgaaatct < 210> 8 < 211 > 30

< 212 > DNA 29 200533759 < 213 > Artificial sequence < 22〇 > < 223 > Bow of pCRMP-1 (-1920 / + 189> | Child < 40〇 > 8 cccaagcttc gtgattgtgc gggatgctct

< 210 > 9 < 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220> < 223 > pCRMP-1 (-1920 / + 50) Bow 1 < 400 > 9 cgctaattac gccagcccaa g < 210 > 10 < 211 > 28 < 212 > DNA < 213 > artificial sequence < 22〇 > < 223 > pCRMP-1 (-1920 / + 50) bow 1 < 4 〇〇 > 10 cccaagcttc cgggagggat agagacac < 210〉 11 < 211〉 42 < 212 > DNA < 213 > artificial sequence

200533759 < 22〇 > < 22 3 > Oligonucleotide adjacent to Xhol nucleic acid restriction enzyme sequence < 400 > 11 ccgctcgagg ggaggagctg tgggaggagc tgtctcgagc gg < 210 > 12 < 211 > 24 < 212 > DNA < 213> artificial sequence < 22〇 > < 223> DNA probe A \ < 400 > 12 gggaggagct gtgggaggag ctgt < 210> 13 < 211 > 18 < 212 > DNA < 213> artificial sequence <; 220 > < 223> DNA Probe B < 4〇〇 > 13 agccccctcc tcccgccc < 21〇 > 14 < 211〉 38 < 212 > DNA < 213> Artificial Sequence < 220 >

< 223 > DNA probe C 38 200533759 < 400 > 14 cgccgggagg agctgtctgc agccccctcc tcccgccc

< 210 > 15 < 211 > 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223〉 Mutant DNA probe < 4〇0 > 15 aaaggggact acaaagggga ctac < 210> 16 < 211> 24 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Synonymous strand primer of hCRMP-1 < 4〇〇 > 16 atgccctgag cagacctgaa gage < 210 > 17 < 211 > 25 < 212 > DNA < 213> Artificial sequence < 220 > < 223 > Antisense strand primer of hCRMP-1 < 4〇〇 > 17 24 24 200533759 agtaatgggt gccatcggtc cccag < 210 > 18 < 211 > 21 < 212 > DNA < 213 > Artificial sequence < 22〇 > < 223 > Sp-1 synonymous primers < 4〇0 > 18 gagagtggct cacagcctgt c < 210 > 19 < 211 > 21 < 212 > DNA < 213 > Artificial sequence < 22〇 > < 223 > Sp-1 antisense strand primer < 4〇〇 > 19 gttcagagca tcagacccct g < 210 > 20 < 211 > 20 <; 212 > DNA < 213 > Artificial sequence < 22〇 > < 223 > Gp analogue synonymous primer < 4 〇 > 20 gtatggaacc tggctaactg 200533759 < 210 > 21 < 211 > 20 < 212 > DNA < 213 > Artificial sequence < 220 > < 223> Antisense strand primer of Gp analogue < 40〇 > 21 tactgataac ttcttgcttc

Claims (1)

200533759 10. Scope of patent application: 1. A transcription unit comprising a nucleic acid regulatory sequence isolated upstream of a gene encoding brain failure protein response mediator protein-1 (CRMP-1), wherein the characteristics of the nucleic acid regulatory queue are: It has the ability to regulate the expression of the CRMP-1 gene and / or an exogenous gene linked to the nucleic acid regulatory sequence upon manipulation. 2. The transcription unit according to item 1 of the scope of patent application, wherein the CRMP-1 gene is a human CRMP-1 gene. 3. The transcription unit according to item 1 of the patent application, wherein the CRMP-1 gene comprises a nucleic acid sequence containing an ATG codon. 4. The transcription unit according to item 1 of the patent application, wherein the nucleic acid regulatory sequence comprises the nucleic acid sequence of SEQ ID NO: 2. 5. The transcription unit according to item 1 of the patent application, wherein the nucleic acid regulatory sequence comprises the nucleic acid sequence of SEQ ID NO: 3. 6. The transcription unit according to item 1 of the scope of patent application, wherein the nucleic acid regulatory sequence comprises the nucleic acid sequence of SEQ ID NO: 4. 7. The transcription unit according to item 1 of the scope of patent application, wherein the nucleic acid regulatory sequence comprises the nucleic acid sequence of SEQ ID NO. · 5. 43 200533759 8. The transcription unit described in item 7 of the scope of patent application, wherein a mutation in the nucleic acid regulatory sequence reduces the performance of the CRMP-1 gene and / or the exogenous gene. 9. The transcription unit according to item 1 of the scope of patent application, wherein the nucleic acid regulatory factor binding site comprises a nucleic acid sequence of GGGAGGAG. 10. The transcription unit according to item 1 of the scope of patent application, wherein the nuclear and acid regulatory sequence comprises the nucleic acid sequence of SEQ ID NO: 6. 11. The transcription unit according to item 1 of the scope of patent application, wherein the exogenous gene is a reporter gene. 12. The transcription unit according to item 11 in the scope of the patent application, wherein the reporter gene is a gene encoding a firefly cold light enzyme. 13. A DNA construct comprising a transcription unit as described in item 1 of the patent application scope and a vector. 14. The DNA construct according to item 13 of the scope of patent application, wherein the vector is a pGL3-basic vector. 15. A transfected cell comprising a DNA construct as described in claim 13 of a patent application in a host cell. 44 200533759 16. The transfected cell according to item 15 of the scope of patent application, wherein the cell is a human cell. Π. The transfected cell according to item 16 of the scope of the patent application, wherein the human cell is a human cancer cell. 18. As described in item 17 of the scope of the patent application, wherein the human cancer cell is a human lung adenocarcinoma cell or a human rectal cancer cell. 19. A method for promoting the expression of the CRMP-1 gene in a host cell, # comprising transfecting the host fetus with a DNA construct containing the transcription unit as described in item 13 of the patent application; 20.2 Please use it in a host cell as described in item 19 of the patent A method for promoting the expression of the CRMP-1 gene. The cell is a human cell. = 于 在 # Host cell towel promotes the expression of exogenous genes, J, which includes transfecting the host cell with a ship construct containing the transcription unit as described in item 13 of the scope of the patent application. ;, +, ^ The method described in item 2 for promoting the expression of exogenous λ® in a host cell, wherein the exogenous base is the —firefly_cold light enzyme gene. 45 22. 200533759 23. A method for inhibiting metastasis of human cancer cells, comprising transfecting the human cancer cells with a DNA construct comprising the transcription unit as described in item 13 of the scope of the patent application. 46