TW200526688A - Antibacterial amide macrocycles - Google Patents

Abstract

The invention relates to antibacterial amide macrocycles and process for their preparation, their use for the treatment and/or prophylaxis of diseases, and to their use for producing medicaments for the treatment and/or prophylaxis of diseases, especially of bacterial infections.

Description

200526688 IX. Description of the invention: [Technical field to which the invention belongs] The present invention relates to antibacterial amidine macrocycles and methods for making same, their use for treating and / or preventing diseases, and their use for preparing for treatment and / or Use of medicines for preventing diseases (especially bacterial infections). [Prior art] US 3,452,136, Paper by RU Meyer, Stuttgart University, Germany 1991, Paper by V. Leitenberger, Stuttgart University, 10 Germany 199, Synthesis (1992), (10), 1025-30, J. Chem. Soc, Perkin Trans. 1 (1992), (1), 123-130, J. Chem · Soc, Chem · Commun · (1991), (10), 744, Synthesis (1991), (5), 409-13 J. Chem. Soc ·, Chem. Commun · (1991), (5), 275-7, J. Antibiot · (1985) · 38 (11), 1462-8, J. Antibiot · (1985), 38 (11), 1453-61, revealed the natural product-15 biphenomycin B, which has antibacterial activity, and some steps of synthesizing bifidomycin B were disclosed in Synlett (2003) , 4, 522-526.

Chirality (1995) 7 (4), 181-292, J. Antibiot. (1991), 44 (6), 674-7, J. Am. Chem. Soc. (1989), 111 (19), 7323- 7. J. Am. Chem. Soc. (1989), 111 (19), 7328-33, J. Org. Chem. (1987), 52 (54), 5435-7, Anal. 20 Biochem. (1987) 165 (1), 108-13, J. Org. Chem. (1985), 50 (8), 1341-2, J. Antibiot. (1993), 46 (3), C-2, J. Antibiot. (1993), 46 (1), 135-40, Synthesis (1992), (12), 1248-54, Appl. Environ. Microbiol. (1992), 58 (12), 3879-8, J. Chem · Soc ·, Chem · Commun. (1992), (13), 951-3, reveals a product fenofromycin A whose structure is related to natural products, and 25 has a hydroxyl group substituent on the macrocycle. The nature of natural products will not fully comply with the requirements for antibacterial medicines. Although products with different structures with antibacterial activity are available from the market, the development of resistance is a 200526688 often possibility 'for getting good and more effective There is a need to find novel agents for therapies. [Summary of the Invention] One of the objectives of this month is therefore to provide novel and alternative compounds with the same or improved antibacterial effects for the treatment of bacterial diseases in humans and animals. It was surprisingly discovered that when certain derivatives of these natural products were substituted with amido groups containing a basic group, they were resistant to phenamycin. ⑽re-like strain (1 ^ 42203 and T17), which has antibacterial activity. In addition, this derivative exhibits an increased rate of autogenic resistance against wild-type strains that are similar to serotonin, and & strains that are resistant to fenofomycin (bafenormycin). The present invention relates to compounds of the formula 15

20wherein R7 is a base with the following chemical formula

-6- 200526688 where R1 is hydrogen or hydroxyl, * is the point of attachment to a carbon atom, R2 is hydrogen, methyl or ethyl, 5 R3 is a group of the formula 10 15

Where * is the point of attachment to the nitrogen atom, R4 is hydrogen or a radical, 20

R5 and R15 are each independently hydrogen, amidino or a base of the formula

Where * is the point of attachment to the nitrogen atom, R8 is hydrogen or *-(CH2) rNHR1Q, 25 200526688 where R10 is hydrogen or methyl, and f is the number of 1, 2 or 3, 5 R9 is hydrogen or methyl , D is the number of 1, 2 or 3, and e is the number of 1, 2 or 3, R6 is hydrogen or aminoethyl, 10 or R5 and R6 together with the nitrogen atom to which it is attached form a hexahydropyridine ring R12 and R14 are each independently a radical of the formula *-(CH2) zl-OH or *-(CH2) Z2-NHR13, where 15 * is the point of attachment to a carbon atom, and Z1 and Z2 are independently 1, The number of 2, 3 or 4, R13 is hydrogen or methyl, k and t are independently 0 or 1, 1, w and y are independently 1, 2, 3 or 4, 20 m, r, s and v is independently 1 or 2, η, ο, p and q are independently 0, 1 or 2, u is 0, 1 or 3, LJ w or y, and when w or y is 3, they may be respectively Independently carry a hydroxyl group on the middle carbon atom of the 25-membered chain, and its salts, its solvates and solvates of its salts. The compounds of the present invention are compounds of formula (I) and their salts, their solvates and their 200526688 solvates, and compounds of formula VII mentioned below as specific examples, ..., salts, their solvates and their salts Among the solvates, the compounds contained in formula (1) and the above-mentioned * are the solvates of the solvates and their salts. '5. The compound of the present invention, depending on its structure, may exist in a stereoisolion form (mirror or non-mirror), so the present invention is therefore related to its mirror or non-mirror and each of its: iL isomerically pure The morphological constituents can be separated from such mirror and / or non-mirror materials by known methods, for example, by chromatography on a chiral phase or by crystallization using chiral amines or chiral acids. 10 The present invention pertains to the structure of a compound and also relates to tautomers of the compound. For the purpose of the present invention, the relatives are preferably physiologically acceptable salts of the compounds of the present invention. 1 The physiologically acceptable salts of the compound of formula (I) include the addition salts of inorganic acids, carboxylic acids and sulfonic acids, such as the salts of the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, 15A ~ 1, B Dipic acid, toluene sulfonic acid, benzoic acid, naphthalene-dipic acid, acetic acid, propionic acid, ceramic acid, tartaric acid, malic acid, citric acid, fumaric acid, maleic acid, trifluoroacetic acid With benzoic acid. The physiologically acceptable salts of the compound of formula (I) include the salts of the alkalis, for example, alkali metals (for example, sodium and potassium salts), and salts of soil metals (for example, preferred), Contact with magnesium salts), ammonium salts derived from aqueous ammonia or organic amines having i to 16 carbon atoms, for example, and by way of example and preferably, ethylamine, diethylamine, monoethylamine , Ethyl diisopropylamine, monoethanolamine, diethanolamine, triethanolamine, hexylamine monomethylaminoethanol, procaine, diphenylmethylamine, ceramidine, dehydrorosin Methylamine, arginine, lysine, ethylenediamine and methylhexa 25hydropyridine. The gold plate is also for the purpose of the present invention, which refers to those in the solid or liquid state that form a complex between a compound and a solvent molecule through a coordination bond. Hydrate is a special type of a compound that dissolves 200526688. Bitization occurs with water. The # symbol on a carbon atom represents that the configuration on this carbon atom is a mirror image type. In the present invention, its optical purity (enantiomeric excess) is greater than 90% (> 90% ee). In the chemical formula, Among the groups that can be represented by R3, the * outside the line end in each case does not represent a carbon atom or a CH2 group but a part of the nitrogen atom bound to R3, so 'for example, when k = 0, 1 = 1 and r5 When = h, R3 is 2-aminoethyl, when k = 1, r4 = OH, 1 = 1 and R5 = H, R3 is 3-amino-2_hydroxypropyl, when q = 1 and r When == l, r3 is hexahydropyridin-4-ylmethyl or when q = 0 and r == i, R3 is hexahydropyridin-4-yl. In the chemical formula, among the groups that can be represented by R7, the * outside the line end in each case does not represent a carbon atom or a CH2 group but a part of a nitrogen atom to which R7 is bonded. The preferred compound of formula VII of the present invention is, wherein R7 is a group of the following chemical formula 15

20 where R1 is hydrogen or a radical, * is the point of attachment to a carbon atom, R2 is hydrogen, methyl or ethyl, and R3 is a radical having the formula

-10- 25 200526688

10 15 20 where R4 is hydrogen or hydroxyl, R5 is hydrogen or methyl, R6 is hydrogen, or R5 and R6 together form a hexahydropyridine ring with k and t independently of 0 or 1 , 1 is 1, 2, 3 or 4, m, r, s and v are independently 1 or 2, η, 0, p and q are independently 0, 1 or 2, and u is 0, BU 2 or 3, * is the point of attachment to the nitrogen atom, its salt, its solvate and its solvate. Preferred compounds of the present invention are also compounds having the formula

Where -11-25 200526688 R1 is hydrogen or hydroxyl, R2 is hydrogen or methyl, and R3 is a group of formula

10 where R4 is hydrogen or mesogen, R5 is hydrogen or methyl, and k is 0 or 1,

1, m and r are independently 1 or 2, 15 η, ο, p and q are independently 0, 1 or 2, respectively, * is the point of attachment to the nitrogen atom, and its salt, its solvate and its salt Similar solvates.

The preferred compound of the present invention is also a compound of formula (la), wherein R1 is hydrogen or hydroxyl, 20 R2 is hydrogen or methyl, and R3 is a group having the formula

-12- 200526688 R5 is hydrogen or methyl, k is 0 or 1, 1, m and r are independently 1 or 2, and η and q are independently 0, 1, or 2, 5 * is attached to nitrogen The point of the atom, its salts, its solvates and its salts. Preferred compounds of the present invention are also compounds of formula (la), wherein R1 is hydrogen or hydroxyl,

R2 is hydrogen or methyl, 10 R3 is a group of formula 15

or

OH

among them

* It is the point of attachment to the nitrogen atom, its salts, its solvates and its solvates. 20 The preferred compound of the present invention is also a compound of formula (I), wherein R7 is a group of the formula R1

Where R1 is hydrogen or hydroxyl, -13-25 200526688 * is the point of attachment to the carbon atom, R2 is hydrogen, methyl or ethyl, and R3 is a group of formula

Where * is the point of attachment to the nitrogen atom, 10 R15 is hydrogen, methyl or a group of the formula

15 where * is the point of attachment to the nitrogen atom, R8 is hydrogen or *-(CH2) rNHR1 (), where R1 () is hydrogen or methyl, and f is 1, 2 or 3, and R9 is hydrogen or methyl Base, d is 0, Bu 2 or 3, and e is 1, 2 or 3, and R12 and R14 are independently of the formula *-(CH2) zrOH or *-(CH2) Z2-NHR13 where -14- 25 200526688 * To attach to the point of a carbon atom, Z1 and Z2 are independently B2, 3, or 4, R13 is hydrogen or methyl, w and y are independently 1, 2, 3, or 4, 5 and their salts, Its solvates and solvates of its salts. Preferred compounds of the present invention are also compounds of formula (I) or formula (Ia), wherein R3 is 2-aminoethyl-1-yl, 3-aminopropanyl, 4-aminobut-1-yl, 5 -Aminopentyl-1-yl, 2- (methylamino) ethyl-1-yl, 3-amino-2-hydroxyprop-1-yl, 3-amino-2,2-dimethylpropane -1-yl, 2-amino-1- (aminomethyl) ethoxy, 3-amino-small (trimethyl) propanyl, 10 4-amino + (trimethyl) butyl Phenyl, 4-aminopyridylethyl) butanyl, 2,3-diaminopropanyl, 2,4-diaminobut-1-yl, 2,5-diaminopentan-1-yl 2,6-diaminohex-1-yl, 3-amino-4-mercaptobutanyl, 4-amino-5-mercaptopentyl, 4-amino each hex-1-yl '5-Amino-6-hydroxyhex-1-yl, 2- (aminoethylamino) ethyl small, 3- (3-aminopropyl small amino) propyl-1-yl, 3- (i , 3-Diaminopropyl-2-ylamino) propan-1-15 '' (diaminoethylamino) ethyl, 2- (hexahydrocyclopentyl-1-yl) ethyl-1- Phenyl, 3- (hexahydro ° Phen-1-yl) -2-ylpropan-1-yl, oxobiol-2-yl) methyl, hexahydropyridine 4-yl, (hexa Hydroxyridin-2-yl) methyl, (hexahydrou than pyridin-3-yl) methyl, (hexahydro Pyridin-4-yl) methyl, 2- (hexahydropyridin-2-yl) ethyl, yahhoo-2-yl) methyl, 2-aminocyclopropanyl, 2-aminocyclohex-1 -Yl, 3-aminocyclohexyl or (ι, 4-diazol-6-yl) methyl. 20 The particularly preferred compounds of the present invention are also compounds of formula (I) or formula (la), wherein R3 is 2-aminoethyl-1-yl, 3- (3-aminopropyl-1-ylamino) propane-丨-group, (diaminoethylamino) ethyl or 2,5-diaminopent-1-yl. Excellent compounds of the present invention are also compounds of formula (I) or formula (la), in which R3 is 2-aminoethyl-1-yl. 25 A particularly preferred compound is the following formula (8-parent 11 & 14 magic-14-aminoaminoethyl) -11-[(2Λ) -3-amino-2-hydroxypropyl] -5,17 -Dihydroxyaspartyl-10,13-diketo-9,12-diazatricyclo [14.3.1.1 · 2,6] pinane_1 (20), 2 (21), 3,5, 16,18-hexaene-8- V200526688 formamidine NH2 10

^ Its dihydrochloride and other salts thereof, its solvate and solvate of its salt, this trihydrochloride is described in Example i. Particularly preferred is (8 乂 11 乂 amino-Λκ2-aminoethylaminopropyl) -5,17-dihydroxy-i〇, i3-diketo-9,12-diazatricyclo [ 143112,6] pyrene-1 (20), 2 (21), 3,5,16,18-hexaene methylformamide compound 15

20 In addition to its trihydrochloride and other salts thereof, its solvate and solvate of its salt, this compound is described in Example 14 and its trihydrochloride is described in Example 6. 25 Especially preferred is (8 \ 11 * S, 14S) -14-amino_11- (3-aminopropyl) -7V- {3-[(3-aminopropyl) Amine] propyl} -5,17-dihydroxy_110,13-diketo-9,12-diazatricyclo [14.3.1.12,6] pyrane] (20), 2 (21) , 3,5,16,18-hexaene methyl-16- 200526688 compounds of amidine

10 15 A tetrahydrochloride salt of this compound is described in Example 42 together with its tetrahydrochloride salt and other salts thereof, its solvate and solvate salt thereof. Particularly preferred is also (8 \ 11 & 14) -14-amino-11- (3-aminopropyl)-#-{2- [bis (2-aminoethyl) amino ] Ethyl} -5,17-dihydroxy-10,13-diketo • 9,12-diazatricyclo [14.3.1.12,6] pinene-1 (20), 2 (21), 3 , 5,16,18-hexaene-8-methanamine compound

The tetrahydrochloride salt of this compound is described in Example 43 together with its tetrahydrochloride salt and other salts thereof, its solvate and solvate salt thereof. Especially preferred is (8 * S, 11 * S, 14S) -14-amino-11- (3-aminopropyl) -7 \ ^-{(25 ")-2,5 -Diaminofluorenyl) -5,17-dimeryl-10,13-difluorenyl-9,12-digas-17- 200526688 heterodifluorene [14.3.1.1,] pinane · 1 (20 ), 2 (21), 3,5,16,18_hexaene_8_ formamidine compounds

Rather than its four salts and other alkaloids, its solvates and other solvates, the tetrahydrochloride salt of this compound is described in Example 45. The present invention also relates to a method for producing a compound of formula (I) or its brain, a solvate thereof, or a salt of a solvate thereof. In the production method, [A] a compound of the following formula

Wherein R2 and R7 have the definitions as described above, and bQe represents the third-butoxy group, which is reacted in two steps, 'first in-a kind of financial age is below, and react with the following compounds H2NR3 (III) where R3 has as The above definition, followed by reaction with an acid, or • 18- (IV), 200526688 [B]

Or multiple reactions in which R2 and R7 have a sudden reaction, first defined in the formula, and 2 is benzyloxycarbonyl, which is reacted with the following compound in the presence of a dehydrating agent in two steps 15 20, which has an R3 as follows, The free base of the salt with the above-mentioned definition (III) can then be subjected to a hydrogenolysis reaction. Gradient, example by adding alkali: 'Chromatography on reversed-phase column' with acetonitrile / water C18 (2) column and using diethyl ether, by using RP18PhenomenexLuna About preparing formula according to item 1 of the scope of patent application 专利The method of a compound or a solvate thereof is to change φ /, γ to convert a salt of the compound or a solvate of the salt of the compound into a compound by adding a test chromatogram. It is said that it is located at R ±. During the reaction with the compound of formula ⑽, in order to properly, the first butyl_methyl group is protected, and it is eliminated in the second step reaction. 7 Formula (11 ), (111), (IV), (VI), (VII), (VIII), (IX), and R3 /, R in (χΙ) are reactive g energy groups, which have been added during the synthesis process. The protection is preferably an acid-sensitive protecting group (such as boc or Z). After the reaction generates a compound of formula VII, a deprotection reaction can be performed to remove the protecting group, which can be performed by standard methods of protecting group chemistry. Among them, it is preferable to perform a deprotection reaction under acidic conditions or by performing an ammonolysis reaction. -19- 200526688 The first-stage reaction of [A] and [B] is usually carried out in an inert solvent in the presence of a suitable base, preferably at a temperature between 0 ° C and 4CTC under atmospheric pressure. 10 15 20 Suitable dehydrating agents are, for example, W-diethyl-, dipropyl-, diisopropyl, W-dicyclohexylcarbodiamidine, (3-dimethylaminoisopropyl Monoethylcarbodiamidate hydrochloride (EDC), cyclohexylcarbodiamidate, propoxymethyl-polystyrene (PS-carbodiamidine), or several compounds such as weyl diamixal , Or 1,2 ^ sialyl compounds, such as 2-ethyl-5-phenyl-1,2-oxasalol-3,-lutein or 2-sulfanyl-5-methyl Isolate filter acid esters, or amidoamine compounds, such as 2-ethoxy- small ethoxyl-1,2-dihydropyridine, or propionic phosphoric anhydride, or isobutyl chloride f Acid, ester, or bis (2-keto-3-oxazolyl) phosphonium radical or benzotriazoloxytris (; f-based amino) phosphorus acid, or 0- ( Benzotriamethylene tetramethyl hexamethylene phosphate (HBTU), 2- (2-keto small (2H) 4 pyridyl) _1,13,3_tetramethylphosphonium tetrafluoroboron® (TPTU) or 0- (7-azabenzotrin-s--1-ylmethyl magnetic hexapneumatic scale (HATU), or 1-hydroxybenzotriazole (HOBt), or benzotriazole Small Base Oxytris (> Methyl-Amine) Phosphate Hexafluorophosphate (B0P) , Or a mixture thereof, or a mixture thereof with a base. The bases are, for example, alkali metal carbonates, such as sodium carbonate or potassium carbonate, into organic bases, such as trialkylamines, such as triethylamine, from Methyl molybdenum, 乂? Hexahydropyridine, 4-dimethylaminopyridine or diisopropylethylamine. The condensation reaction should be with HATU, in the presence of a base (especially diisopropylethylamine) Downward φ, or with HOBt and EDC. Solvent avoidance is, for example, 'fascinated hydrocarbons' such as dichloromethane or trigas methane; soot, such as benzene, or nitromethane, dioxane' di Methylformamide or acetonitrile can also be used as a mixture of these solvents. Particularly preferred is dimethylformamide. 7 The first-stage reaction of [A] and [B] should be at 0 ° C. The temperature is between 4 ° C and 5 ° C. The appropriate acids for this reaction are: hydrogen gasification in smoldering, hydrogen bromide in acetic acid or methane in digas. Trifluoroacetic acid. -20- 25 200526688

In the presence of ', it is preferably carried out at a temperature between 0 ° C and 40 ° C under atmospheric pressure. The solvent is, for example, an alcohol, such as a mixture of formazan with water and glacial acid, ethanol, such as methanol, ethanol, n-propanol, or isopropanol, and a mixture of ethanol, water, and glacial acid is Better. Compounds of formula (III) are known or can be prepared according to similar known methods. The compound of formula (II) is known or can be made from: let the compound of formula

Wherein R2 and R7 have the definitions as described above, and react with bis (third-butyl) dicarbonate in the presence of a base. This reaction is usually carried out in a solvent, preferably at a temperature between 0 ° C and 40 ° C, under atmospheric pressure. Bases are, for example, alkali metal hydroxides, such as sodium or potassium hydroxide, or alkali metal carbonates, such as cesium carbonate, sodium carbonate, or potassium carbonate, or other bases such as DBU, diethyl The amine or diisopropylethylamine is preferably sodium hydroxide or sodium carbonate as a% t. Solvents are, for example, hydrogenated hydrocarbons, such as dichloromethane or dichloroethane; alcohols, such as methanol, ethanol, or isopropanol; or water. The reaction is preferably carried out with sodium hydroxide in water or sodium carbonate in methanol. The compound of formula (V) is known or can be made from: let the compound of formula 200526688

5 wherein R2 and R7 have the definitions as described above, and R11 is benzyl, methyl or ethyl, and the reaction with the acid or the second-stage hydrogenolysis reaction as in step [B] above is performed, suitably, then React with base to hydrolyze methyl or ethyl. The progress of the hydrolysis reaction can be utilized, for example, a reaction as described in formula (VI) is described to prepare a compound of formula 10 (IV). Compounds of formula (iv) are known or can be obtained by hydrolyzing benzyl, methyl or ethyl esters of compounds of formula (VI). This reaction usually takes place in a solvent in the presence of a base, preferably between The temperature was between 400 and atmospheric pressure. Or potassium hydroxide, lithium hydroxide is preferred. The bases are, for example, alkali metal hydroxides, such as lithium hydroxide, sodium hydroxide, and the solvents are, for example, hydrogenated hydrocarbons, such as digas or trichloromethane; _, such as tetrahydrofuran or dioxane 'Or alcohols, such as methanol, ethanol, or isopropyl alcohol dimethylamidamine' It is also possible to use mixtures of these solvents or solvent mixtures 20 'using tetrahydrofuran or a mixture of methanol and water is Particularly good. . The compound of formula (VI) is known or can be made from: let the compound of formula

-22- 200526688 which has the definition as described above. In the first stage, the method disclosed in the second stage according to the legal system should be used in the second stage. 5 In the second stage, the reaction with the alkali is carried out, and it is suitable to carry out in the temperature range and atmospheric pressure. The bases are, for example, 'metal hydroxides, such as sodium hydroxide or ammonium hydroxide, or metal carbonates, such as carbonium, rhenium carbonate, such as hydrazine, triethylamine, or diisopropylethyl Amine, using triethyl ^ as the test surface, for example, tritiated hydrocarbons, such as dichloride or u-digas, tetrahydrofuran, or a mixture of these solvents, dichloroform or tetrahydrofuran Compounds of formula (VII) are known or can be made from ...

15 where R, R7 and R11 have the definitions as described above, = Fluoride in the presence of dehydrated tritium as described in the manufacturing method [Am [_ the first stage of 20] 20 is suitable for -40 This reaction is preferably with DMAP and EDC in the gas field 々 ° The reaction occurred during r 5 d〇Qr and rat bake, and it was carried out at ▲ degrees between -40 ° C and 40 ° C under atmospheric pressure. The compound of formula (VIII) is known or can be made from: let the compound of formula

-23- (IX), 25 200526688 wherein R2, R7 and R11 have the same definitions as above, and react with fluoride, especially with tetrabutylammonium fluoride. The atmospheric reaction is usually carried out in a solvent, preferably at a temperature in the range of 1C to 3 ° C. 5 Examples of inert solvents are, for example, tritiated hydrocarbons, such as digas, or smoke, such as benzene or toluene, Or, for example, tetrahydrofuran or m-dimethylformamide can be used in the same manner as a mixture of these solvents, and the preferred solvents are furan and dimethylformamide. 10 Compound of formula (IX) Is known or can be made from ...

Where R2 and R11 have the definitions as described above, and react with a compound of the formula boc

(XI),

20 wherein R7 has the definition as described above and reacts in the presence of a dehydrating agent as described in the first stage of the production processes [A] and [B]. Compounds of formula (X) are known or can be prepared in a similar manner as disclosed in the Examples section. Compounds of formula (XI) are known or can be prepared according to known methods. The compounds of the present invention have exhibited unprecedented ^^^ ^ ^ brothers extremely useful pharmacological and pharmacokinetic joy. -24- 25 200526688 They are therefore suitable as pharmaceuticals for the treatment and / or prevention of diseases in humans and animals. Due to its pharmaceutical properties, the compound of the present invention can be used alone or in combination with other active ingredients for therapeutic and / or predictive infection, especially bacterial infection. For example, it may be used to treat and / or prevent local and / or systemic diseases caused by the following pathogens or mixtures of the following pathogens: Gram-positive cocci, such as Staphylococcus (golden Staphylococcus, staphylococcus white epidermidis) and streptococcus (streptococcus agalactiae, streptococcus faecalis, streptococcus pneumoniae, streptococcus pyogenes); Gram-negative cocci, such as ^ Such as Gram-negative bacilli, such as enterobacteriaceae, that is, Escherichia coli (such as -0 / 〇, influenza bacillus ⑽⑽ 叩 / π · / ⑽mail fine tear), citric acid Bacillus (citrObacter) (C7 plus, CzYraft · Z / ver ^ sw), Shigella Salmonella 15 (Shigella); also includes Klebsiellas (pneumococcus, You / e. ), Enterobacteriaceae (_, _ · sigh / Nokia-like), Hafnia, Serratia (* Serr. Marcesce-like), Proteus (Singular Proteus, ρΓ · 心 吻 η ·, Proteus), providenCia, Yersinia, and acmetobact er); The scope of this antibacterial also includes Pseudomonas spp. (green bacillus, 20 melons) and "absolute and absolute anaerobic bacteria, such as crisp anaerobic bacteria (heart • fine / rag / fe) , Representative Peptococcus spp. (Peptocococcus spp.), Peptostreptococcus spp., And Clostridium spp .; also includes mycoplasmas {M. pneumoniae ^ M. hominis ^ M. urealyticum) ^ Mycobacteria, for example, tuberculosis (M >; C0 ~ 25 tuberculosis). The above pathogens are used for illustration only, and do not mean that they are limited to these pathogens. The mentioned diseases may be caused by the infection of the mentioned pathogens or mixed pathogens and -25-200526688 can be prevented, improved or cured by using the preparations of the present invention, and can be used by local users as a disease that infects humans For example, sepsis infections, bone and joint infections, skin infections, post-operative wound infections, abscesses, cellulitis, traumatic infections, infections5 burns, burns, infections of the oral area, infections after dental surgery, septic joints inflammation, Adenitis, tonsillitis, genital infections, and eye infections. In addition to humans, it can also be used to treat bacterial infections in other species. Examples that can be mentioned are: pigs: coli diarrhoea, enterotoxemia (enter 〇t〇xaemia), bacteria 10 sepsis, dysentery, salmonella, mastitis_mastitis_mastitis-mastitis-mastitis-mastitis-mastitis-mastitis-mastitis syndrome (tastitis); ruminants (bovine, sheep, goat ): Diarrhea, bacteremia, bronchopneumonia, salmonellosis, pasteurellosis, mycoplasmosis, genital infections; I5 horse bronchopneumonia, seizure disease, production And postpartum infections (puerperal and postpuerperal infections), salmonellosis; dogs and cats: bronchial pneumonia, diarrhea, dermatitis, otitis, urinary tract infections, prostatitis; poultry (chickens, turkeys, quails, pigeons) , Ornamental birds, and others): Mycoplasmosis, Enterobacter large 20 infection, Chronic tracheal disease, Salmonellosis, Pasteurella, Parrot disease. Similarly, it may be used to treat diseases of breeding and management of productive and ornamental fish. Among them, the antibacterial spectrum is far more than those mentioned above. For example, Pasteurella, Cloth Brucella, Campylobacter, Listeria, Erysipelothrix, Corynebacteria, Borrelia, Helicobacter Treponema), Nocardia, Rickettsia, -26- 200526688 Yersinia. The compounds are useful for the treatment and / or prevention of diseases, especially those with bacterial infections. The compounds are useful for treating and / or preventing diseases. The present invention also relates to the use of the present invention, which is suitable for treating bacterial diseases, and the present invention also relates to the use of the invention, which is particularly the above-mentioned diseases. ^ 发 料 本 发 _Chemicals for the purpose of hiding / or preventing diseases (especially the diseases mentioned above). 10 15 The present invention also relates to a method ' domain for treating and / or preventing diseases (especially the diseases described above) by using an antibacterially effective amount of a compound of the invention. The compounds of the invention may act on the whole body and / or local area, for which they can be administered in an appropriate manner, for example, via oral, parenteral, lung, nasal, =, tongue, buccal, rectal, skin , Penetrating the skin, joints or ear canals or implants or stents. The compounds of the present invention can be made into a form suitable for being administered via these routes of administration. The administration form is the same as the application form of the prior art, and the compound of the present invention can be delivered quickly and / or in a modified manner. Type, and it contains the present compound in crystalline and / or amorphous and / or dissolved form, for example, the bond ^ (Tianwei unpainted or coated lozenges, such as being coated to resist gastric juices Or coatings that are insoluble in gastric juice, or coatings that delay dissolution and control the release of the compounds of the present invention), lozenges that disintegrate rapidly in the mouth, or thin glutinous rice / glutinous rice paper, films / freeze-dried products, Capsules (such as hard or soft gelatin capsules), sugar-coated tablets, granules, pills, powdered di-emulsions, suspensions, aerosols or solutions. Parenteral administration eliminates the need for absorption (for example, intravenous, intraarterial, intracardiac, spinal or intramedullary) or includes absorption (for example, intramuscular, subcutaneous, intradermal, Dermal or intraperitoneal administration), suitable for parenteral administration, especially for injection and perfusion preparations, which appear as solutions, suspensions, milk ^ Erliang-27- 25 200526688 but dry or sterilized Powderer. Suitable for other routes of administration are, for example, inhaled pharmaceutical types (especially powder inhalers, nebulizers), nasal drops, solutions, sprays; keys for tongue, sublingual cheek administration, films / Glutinous rice paper or capsules, suppositories, ^ agent A capsules for ears or eyes, aqueous suspensions (eluents, shaking mixtures), lipophilic suspensions, oil-coated bones, emulsions, transdermal therapeutic systems ( (E.g. patches), milk, ointment, foam, dust, implants or stents. ㈢ / / 15 20 The compound of the present invention can be converted into the stated administration form, and conventional methods can be used to mix human inert, non-toxic, and pharmaceutically suitable excipients. These excipients include, in particular, Carriers (for example, microcrystalline cellulose, lactose, mannitol "= agents (for example, liquid polyethylene glycols), emulsifiers and dispersants or wettable agents (for example, sodium sulfonate, Polyoxy sorbitol oleic acid vinegar), spotting agents (such as polyethylene glycol), synthetic and natural polymers (such as albumin), stabilizers (such as f-oxygen agents, such as ascorbic acid) Colorants (e.g., inorganic pigments, e.g., species) and flavoring agents (correction of taste and / or odorant). The present invention also relates to the inclusion of at least one compound of the present invention (which is usually mixed with ~ or more inerts) , Non-toxic, pharmacologically suitable excipients), and more than two uses for the above purpose. "Kuotongwei has 6㈣ 'is more advantageous. To achieve effective results, the parenteral dialect is Kg of body weight, administered approximately 5 to 2 5 every 24 hours The amount of milligrams = 5 to Qin & gram per kilogram of body weight and 24 grams per dose when administered. U ^ • However, the above amount can still be changed appropriately, especially based on weight, route of administration Residual body reactivity to active ingredients, the nature of the preparation and the interval between administration of drugs, etc., so, in some cases, less than the minimum value mentioned above will have sufficient results, and sometimes it is necessary If it exceeds the upper limit, it can be recommended to use it in divided doses within -days. Number -28- 25 200526688 The data in the following tests and examples, unless otherwise stated, are expressed in weight percentages; parts Numbers are parts by weight. For liquid / liquid solutions, the solvent ratio, dilution ratio, and concentration data in each case are based on capacity. 5 [Embodiment] A. Abbreviations used in the examples: abs. Absolute aq. Aqueous solution 10 Bn benzyl boc third-butoxycarbonyl CDCls deuterated chloroform CH cyclohexane cone. 15 d electron pair in Ohnmr) dd double electron pair dHNMR) DCC dicyclohexylcarbodiamine DIC two Isopropylcarbodiamine DIEA Diisopropylethylamine (Htinig's test) 20 DMSO Dimethylphosphine DMAP 4-W-Dimethylaminopyridine DMF Dimethylformamide EA Ethyl acetate (acetic acid Ethyl ester) EDC AT- (S-dimethylaminopropyl) -N · ethylcarbodioxamine X HC1 25 ESI ionization ionization (in MS) HATU 0- (7-azabenzotris Azol-1-yltetramethylphosphonium hexafluorophosphate

-29- 200526688 HBTU CK benzotriazol-1-yl) -tetramethylrust hexafluorophosphate HOBt 1-hydroxy-1H-benzotriazole X H 20 h HPLC high pressure, high performance liquid chromatography 5 LC -MS m coupled liquid chromatography-mass spectrometry multiple electron overlay dHNMR) min minutes MS mass spectrometry NMR nuclear magnetic resonance spectrum 10 MTBE methyl tert-butyl ether Pd / C q saturated / carbon quartet (4 NMR ) Rf retention index (in TLC) RP reversed phase (in HPLC) 15 RT room temperature Rt s retention time (in HPLC) single electron bond (singlet) (in 4 NMR) sat t saturated triplet (4 NMR) Middle) 20 TBS third-butyldimethylsilyl TFA trifluoroacetic acid THF tetrahydrofuran TLC thin layer chromatography TMSE 2- (trimethylsilyl) ethyl 25 TPTU 2- (2-keto-1 (2H ) -Laridinyl) -1,1,3,3, -tetramethylrust tetrafluoroborate Z benzyloxycarbonyl-30- 200526688 LC-MS HPLC method: method 1 (muscle c): instrument: HP i 100 with DA_: Tube Gui: KrOrn RP18, 60 mm x 2 mm, 3.5 μm: eluent A: 5 ml of perchloric acid / liter of water, eluate 5 liquid B: acetonitrile: gradient: 0 min 2 % B, 0.5% 2% B 90% B in 4.5 minutes, 90% B in 65 minutes: Flow rate: 0.75 ml / min: Chess box: 300c: Tested at 21 ° C. Method 2 (LC-MS): Instrument · Micromass Platform LCZ: Column · Symmetry C18, 50 mm X 2] mm, 3.5 microns: Temperature: 40 ° c: Flow rate: 0.05 milliliter / minute: Eluent A: acetonitrile + 0.1% formic acid, eluent B: water + 0.01% formic acid, gradient · 0.0 minutes 10% A 4 minutes 90% A — > 6 minutes 90% A. Method 3 (LC-MS): Instrument: Waters Alliance 2790 LC: column. Symmetry 15 C18, 50 mm x 2.1 mm, 3.5 μm. Dissolution solution A: Water + 〇1% formic acid, dissolution solution B: acetonitrile + 0.1% formic acid: Gradient: 0.0 minutes 5% B-50 minutes i〇% b-60 minutes 10% B: temperature: 50 ° C: flow rate: ΐml / min: uv Yan Zhen test: 21 nanometers. 20 Method 4 (LC-MS): ZMD Waters ·· column: Inertsil ODS3 50mm X 2.1mm, 3 microns: temperature: 40 ° C: flow rate: 0.5ml / min: eluent a: water + 0.05 % Formic acid, eluent B: acetonitrile + 0.05 / 0 formic acid, gradient: 5% B for 12 minutes-100% B for 12 minutes-100% B for 15 minutes. 25 Method 5 (LC-MS): MAT 900, Finnigan MAT, Bremen: column: x_terra 50 mm x 2.1 mm, 2.5 μm · temperature: 25.0: flow rate: 0.5 ml / min: -31 -200526688 Eluent A: water + 0.01% formic acid, eluent b: acetonitrile + 0.001% formic acid, gradient: 0 · minutes 10% B — 15 minutes 90% B — ► 30 minutes 90% B. Method 6 (LC_MS): TSQ 7000, Finnigan MAT, Bremen ··· column ·· hertsil 5 ODS3 50 mm x 2 · 1 mm, 3 µm: temperature: 25 ° C: flow rate · 0.5 ml / min: dissolution Liquid A ·· water + 0.05% formic acid, eluent β ·· acetonitrile + 005 / 〇 formic acid, gradient: 0. 0 minutes 15% B-15 minutes i00% b-30 minutes 100% B . Method 7 (LC-MS): 7 Tesla Apex II with external sprinkler ion source, Bmker 10 Daltnmics: column: X-terraC18 50 mm X 2 · 1 mm, 2 · 5 die meters: temperature: 25 ° C: flowing Rate: 0.5 ml / min: eluent a: water + 0.1% formic acid, eluent B: acetonitrile + 0.1% acetic acid, gradient ... 0 minutes 5 can-13 minutes 100% B- 100% B in 15 minutes. 15 Method 8 (LC-MS): MS Instrument Type: Micromass ZQ: HPLC Instrument Type:

Waters Alliance 2795: Column: Merck Chromolith SpeedROD RP-18e 50 x 4.6 mm: Eluent A: Water + 500 μl of 500 / 〇 曱 酸 / liter: Eluent B: Ethyl + 500 μl 50% gram g / liter: Gradient: 0. 0 min. 10% B — 2 0 min. M. — 4.0 min. 95% B: Oven: 35.0 C: Flow rate: 0. 0 min. 0 ml / min — 2.0 ml / min 3.0 ml / min—4.0 min 3.0 ml / min: UV detection: 210 nm. Method 9 (LC-MS): Apparatus: Micromass Platform LCZ with HPLC Agilent series 1100: Column: Gr0m_SIL12〇DS_4 HE, 50 mm x 2 mm, 3 microns: Eluent A: 1 liter of water + 丨 ml of 50% acetic acid, eluent B: liter of 25 acetonitrile + 1 ml of 50% formic acid: gradient: 〇minutes 100% A — 0.2 minutes 100% A — 2.9 minutes 30% Α—minute 10% Α 5 minutes 10% α: Oven: 55 ° C: Flow rate ··· 8 ml / min: vv Detection: 21 nm. -32- 200526688 Method 10 (LOMS) · MS instrument type: Micromass ZQ: HPLC instrument type:

Waters Alliance 2795: Tubular Merck Chr〇m〇lith SpeedRoD Rp_18e 5〇

x4.6 ^ m: eluent a: water + 500 microliters of 50% formic acid / liter: eluent B: B 5 + 500 microliters of 50% formic acid / liter: gradient: 0.0 minutes ι〇% Β-3.0 minutes 95% / 〇B-4.0% clock 95% B · Oven: 35 ° C: Flow rate · · · · 10 minutes 10 ml / minute-3.0 minutes 3.0 ml 1 minute / 4.0 minutes 3.0 ml / minute: UV detection: 21 nm. 10 Method 11 (LC-MS) · MS instrument type: Micromass ZQ: HPLC instrument type: _

Waters Alliance 2790: column: uptisphere C 18, 50 mm x 2.0 mm, 3.0 μm • Eluent B • Acetonitrile + 0.05% formic acid, Eluent A: Water + 0.05 / formic acid: Gradient • 0 0 minutes 50 / 〇Β-2.0 minutes 40% B-4.5 minutes 90% B-5.5 minutes 90% B · oven · 45 ° C · · flow rate: 0 · 0 minutes 0 75 ml / minute-4 5 Min. 15 0 · 75 ml / min—5.5 min. 1.25 ml / min: UV detection: 21 nm. Method 12 (LC-MS) · MS instrument type: Micromass ZQ: HPLC instrument type:

Waters Alliance 2795: Column: phenomenex Synergi 2μ Hydro_RP

Mercury 20x4 mm: Dissolve A: liter of water + 0.5 ml of 50% formic acid, Dissolve 20 B: 1 liter of acetonitrile + 0.5 ml of 50% formic acid: Gradient: 〇 · 〇minute 90〇 / 〇A (flow rate: 1 ml / min)-> 2.5 minutes 30% A (flow rate: 2 ml / min)-3.0 minutes 5% A (flow rate: 2 ml / min)-4.5 5% A per minute (flow rate: 2 ml / min): Oven: 50T: UV detection · 210 nm. 25 Method 13 (LC-MS): MS instrument type: Micromass ZQ: HPLC instrument type: HP 110 series: UV DAD: column: Grom-Sil 120 ODS-4 HE 50x2 mm, 3.0 micron: eluent A: Water + 500 microliters of 50% formic acid / liter, eluent B ·· B-33- 200526688 nitrile + 500 ounces of 50% formic acid / liter: Gradient: 0.0 minutes 70% b — 4.5 minutes 90 % B: Oven: 50QC, flow rate: 0.8 ml / min, UV detection: 210 nm. Method 14 (LC-MS): Apparatus: Micromass Quattro LCZ with HPLC 5 Agllent senes U〇〇: Column: Grom-SIL120 ODS-4 HE, 50 mm X 2.0 mm '3 microns: Eluent A: 1 reaction Water + 1 ml of 50% formic acid, eluent b: 1 liter of acetonitrile + 1 ml of 50% formic acid: gradient: 〇minutes 100% A-0.2 minutes 100% A-2.9 minutes 30 % Α 3 · 1 minute 10% Α — 4.5 minutes 10% A: Oven: 55 ° C: Flow rate: 0.8 ml / min: UV detection · 208-400 nm. 10 Method 15 (LC_MS): MS instrument type: Micromass ZQ: HPLC instrument type: Waters Alliance 2790 ·· column: Grom-Sil 120 ODS-4 HE 50x2 mm, 3.0 µm · Dissolve A: Water + 500 µl of 50% acetic acid / liter: eluent B: acetonitrile + 500 microliters of 50% formic acid / liter: gradient: 0. 0 minutes 50 / oB — 2.0 minutes 40% B — 4.5 15 minutes 90% B — 5 · 5 Minutes 90% B: Oven: 45 ° C: Flow rate: 0.0 minutes 0.75 ml / min—4.5 minutes 0.75 ml 5.5 minutes—5.5 minutes 1.25 ml: UV detection: 210 nm. Method 16 (HPLC): Instrument · HP 1100 with DA detection: Column: Kromasil 20 RP_18 '60 m² x 2 mm '3.5 µm: Dissolving solution A: 5 ml of peroxy acid / 1 liter of water Eluent B: Acetonitrile: Gradient: 0% 2% β, 0.5 minutes 2% B, 4.5 minutes 90% B, 15 minutes 90% B: Flow rate: 0.75 ml / min: Oven: 30 ° C: UV detection: 210 nm. 25 Method 17 (LC-MS): ⑽ Instrument Type: Micromass ZQ: HPLC Instrument Type:

HP 1100 series · UV DAD: Column: phenomenex Synergi 2μ Hydro-RP

Mercury 20¾m x 4mm: eluent a: water in reverse + 0.5 ml of 50% acetic acid, -34- 200526688 ♦ eluent B: 1 liter of acetonitrile + 0.5 ml of 50% formic acid : Gradient: 0 · minutes 90% α ~ 2 · = minutes 30% Α—3.0 minutes 5% eight 4-5 minutes 5% A: Flow rate ⑽minutes 1 liter / minute '2.5 minutes / 3.0 minutes / 4 · 5 minutes 2 ml / minute: oven UV detection: 210 nanometers. 5 Method 18 (LC-MS) InstrumentHPs with Micromass Platform LCZ

Agilent series 1100: column · phe_enex

Mercury 20 mm x 4 mm: Eluent A: 1 liter of water + 0.5 ml of 50% formic acid, Eluent B: 1 liter of acetonitrile + 0.5 ml of 50% formic acid: Gradient: 0 min. % a 10 — 2.5 minutes 30% A — 3.0 minutes 5% A — 4.5 minutes 5% A: Flow rate: 0.00 minutes 1 ml / minute, 2.5 minutes / 3.0 minutes / 4.5 minutes 2 ml / Minute: Oven: 500c: UV detection: 210 nm. Method 19 (LC-MS) · Instrument · Micromass Quattro LCZ with HPLC Agilent 15 senes 1 i〇〇: tube Ph Phenomenex Synergi 2μ Hydro_RP Mercury 20 mm x 4 mm: Eluent A: 1 liter of water + 5 ml of 50% formic acid, eluent B: i liter of acetonitrile + 0.5 ml of 50% formic acid: Gradient: 0.0 minutes 90% A —> 2.5 minutes 30% A — 3.0 minutes 5% Α — 4.5 minutes 5% A: Flow rate: 0.0 minutes 1 ml / ^ minute, 2.5 minutes / 3.0 minutes / 4.5 minutes 2 ml / minute: Oven: 50 ° C: UV detection: 20 208-400 nanometers Meter. Method 20 (LC-MS): Instrument: Micromass Platform LCZ with HPLC Agilent series 1100: Column: ThermoHypersil-KeystoneHyPurityAquastar, 50 mm x 2.1 mm, 3 μm, 3 μm: Eluent A: 1 liter of water + 1 Ml of 50% 25 formic acid, eluent B: 1 liter of acetonitrile + 1 ml of 50% formic acid: gradient: 0.00 minutes 100% A-0.2 minutes 100 ° / 〇Α-2.9 minutes 30% A — 3 · 1 minute 10% A — -35- 200526688 4 · 5 minutes 10% A: Oven: 55 ° C · · Flow rate · 8 ml / min · UV detection; 210 gray meters. Method 21 (Preparative HPLC / RP_HPLC): Column: RP18 Phenomenex Luna 5 C18 (2) (new column), 250 mm x 21.2 mm, 5 μm (f_ Phenomenex,

Aschaffenburg, Germany), eluent · acetonitrile-water gradient, with 0.2% diethylamine added. 1

Method 22 (HPLC): Apparatus: HP 1100 with DA detection: Tube Uncle · p M & Kromasil Win 10RP_18, 60 mm x 2 mm, 3.5 µm: Eluent A: 5 ml of peroxy acid / Per liter of water, eluent B ·· acetonitrile ·· Gradient: 0% 2% B, 0.5 minutes 2% B, 45 minutes 90% B, 9 minutes 90% B: Flow rate: 0.75 ml / min ··· Knife TT.7 / J = research phase · 30oC: UV detection · 21nm. 15 Synthetic starting compounds:

Synthesis of Substituted Phenylalanine Derivatives to ㈠-3- (2-benzylaminomethyl Magnetic Phenyl) _2 (Third-butoxyepiaminopropionic acid [(-)-6 A] For example soil "

20 -36- 25 200526688 Synthesis of a protected hydroxy ornithine derivative with 5-benzyloxycarbonylamino-2 (* S) -second-butoxyepiamino-4 (7?) -(Second-Butyl-Dimethyxyloxypentyl) valeric acid (14A) as an example

Synthesis of substituted phenylalanine derivatives, using methyl 2- (benzyloxy) -Λ4 (benzyloxy) carbonyl] -5-bromo-L-phenylalanine] (56A) as an example 15 ΒηΟ

Br Ο H OMe boc " N > Y ^ 〇 P (0) 0Me2

54A 20

56A

Synthesis of Protected Diphenyl-Diamino Acid with 2 (^-Trimethylsilylethyl 25 2S) -Benzyloxycarbonylamino-3- [4,4f-Diphenylphosphonium Oxide -3 '-(2OS) -benzyloxycarbonyl-2OS> Third-butoxycarbonylaminoethyl) diphenyl-3-yl] propionate (12A) as an example- 37- 200526688

CH, Household, A〇i B, CH, ㈠ * 6A O O

7A

〇 8A

CH,

12A 10 cyclized diphenyl-diamino acids

15 20

-38- 200526688 5

10 Starting compounds Example 1A 2-Ethyl-5-iodobenzyl

After 15 20 250 g (1.54 mol) of iodine chloride was dissolved in 600 ml of anhydrous digas methane, this solution was dropped in a nitrogen layer over a period of 2 hours to more soluble 188 g ( 1.54 mol) Salicylic acid Jijun, placed in a 1 liter solution of anhydrous dichloromethane in a heated and dried flask 'After stirring at room temperature for 3 days, add saturated sodium sulfite to the vigorous stirring to separate the organic The layer was washed once with water and a saturated sodium chloride solution, dried over sodium sulfate, the solvent was removed by evaporation, and recrystallized from ethyl acetate to obtain 216 g (57% of theory) of the product. LC-MS (ESI, method 4) · m / z = 246 (M-Η)-. iH-NMR (400 MHz, CDC13): δ = 6.7 (d, 1H), 7.77 (dd, 1H), 7.85 (d, 1H), 9.83 (s, 1H), 10.95 (s. 1H).

Example 2A 2-Phenyloxy-5-iodobenzaldehyde-39- 25 200526688 〇Βη Η 5 67.2 g (0.48 mol) of carbonic acid was added to dimethylmethamphetamine dissolved in liters Of 100 grams (0.40 mole) of 2-hydroxy-5-iodobenzaldehyde (Example 1A), after a few minutes, '51 liters (0.44 mole) of benzyl chloride was added, and i2 The reaction mixture was stirred under reflux at 〇t for 24 hours. After stirring for another 24 hours at room temperature, 1.5 liters of water was added to precipitate crystals. The precipitate was filtered under suction and dried under vacuum. Crystallize in 10 ethanol to obtain 122.9 g (90% of theory). LC-MS (ESI, method 4): m / z = 338 (Μ + Η), 'H-NMR (400 MHz, CDC13): δ = 5.18 (s, 2H)? 6.84 (d? 1H), 7.33- 7.45 (m, 5H), 7.78 (dd, 1H), 8.12 (d, 1H), 10.4 (s, 1H).

15 Example 3A (2-Benzyloxy-5-iodophenyl) methanol

20 | 100 liters> Gu Yu 1M diisobutyl hydrogenation solution was added to cold to 0C, mouth 9 solution of 33.98 grams (100.5 millimoles) in 200 ml digas roasting A solution of 2-phenylfluorenyloxy-5-pyroxybenzaldehyde (Example 2A) was stirred at 0 ° C for 2 hours, and while cooling, a saturated sodium potassium tartrate solution (for a highly exothermic reaction) was added to react the reaction. 25 The mixture was stirred for another 2 hours. After the layers were separated, the organic layer was washed twice with water, then washed with a saturated aqueous sodium gas solution, dried over sodium sulfate, and the solvent was evaporated under vacuum to obtain 31.8 g (93%). Theoretical value). 200526688

6.72 (d, 1H), 7.32-7.42 (m, 5H), 7.54 (dd, 1H), 7.63 (d, 1H)

Example 4A 5 1-Benzyloxy-2-bromomethyl-4-iodobenzene

M3 ml (35 mmol) of tri-desertification was added dropwise at 40 C to 35 g (103 mmol) of (2-benzyloxy-5-iodophenyl) methanol dissolved in 350 ml of toluene (Example 3A) solution, the temperature of the reaction mixture was raised to i0 (TC over a period of 15 minutes, and stirred at this temperature for another 15 minutes, after cooling, the layers were separated, and the organic layer was washed twice with distilled water and saturated chlorine The solution was washed once with sodium chloride aqueous solution, and the organic layer was dried over sodium sulfate and concentrated to yield 41 g (99% of theory). H-NMR (300 MHz, CDC13): δ = 4.45 (s, 2H), 5 · 06 (s, 2H), 7.30 (m, 8Η).

Example 5A 20 Diethyl 2- (2-benzyloxy-5-iodobenzyl) -2-tert-butoxycarbonylaminomalonate

-41-200526688 41 g (101 · 7 zemol) of 1-benzyloxy_2-bromomethyl-4-iodobenzene (Example 4A) was added to 28 g (101 · 7 millimoles) of diethyl 2H (third-butoxycarbonyl) amino] malonate and 7.9 ml (101.7 millimoles) of sodium ethoxide in the / valley solution, disturbed at room temperature Stir for 3 hours, suction and filter. After drying under vacuum5, 55 g (90% of theory) of the product can be isolated. H-NMR (400 MHz, CDC13): δ = 1.12 (t, 6Η), 1.46 (s, 9Η), 3.68 (s, 2Η), 3 · 8_3 · 9 (m, 2Η), 4.15-4.25 ( m, 2Η), 5.0 (s, 2Η), 5.7 (s, 1Η), 6.58 (d, 1H), 7.28-7 · 4 (m, 6H), 7.4 (dd, 1H).

10 Example 6A (+/-)-3- (2-Benzyloxy-5-iodophenyl) -2-third-butoxycarbonylaminopropionic acid Η

15 Add 400 ml of IN sodium hydroxide solution to 58 g (97 mmol) of diethyl 2- (2-phenylhydrazone) suspended in 800 ml of a solution of ethanol and water (7: 3) (Iso-5-iodobenzyl) -2-Second-butoxyepi-aminomalonate | A suspension of the purpose (Example 5A), heated at reflux for 3 hours and cooled to room temperature, then concentrated The pH of the reaction mixture was adjusted to pH 2 with hydrochloric acid. The reaction mixture was concentrated. The residue was placed in MTBE and water. The aqueous layer was extracted three times with MTBE. The combined organic layers were dried over sodium sulfate, filtered, concentrated, and under vacuum. Drying yielded 47 g (97% of theory) of the product. i-NMR (400 MHz, DMSO-d6) ·· δ = 1.32 (s, 9H), 2.68 (dd, 1H), 3.18 25 (dd, 1Η), 4.25 (m5 1Η), 5.15 (s5 2Η), 6.88 (d, 1Η), 7.08 (d, 1Η), 7.30-7.40 (m, 3H), 7.45-7.55 (m, 3H). -42- 200526688

Example (-)-6A 3- (2-Benzyloxy-5-iodophenyl) -2'-tertiary-butoxycarbonylaminopropionic acid

10 15Exclusion from Example 6A [(+/-)-3- (2-Benzyloxy-5-iodophenyl) -2OS) -Third-butoxycarbonylaminopropionic acid] The isomers were chiral fixed with poly (isobutenyl leucine dicyclopropylmethylamidamine) chiral fixed chromatographic chromatography, and the mixture of isohexane and ethyl acetate was used as the eluent. The dissociated mirror image (98.9% ee) is a dextral substance ([a] 21D: +3.0., C = 0.54, dichloromethane) in digas methane and is equivalent to (and) a mirror image example (+ ) -6A is measured by single-crystal X-ray structure analysis. The second type is a left-handed mirror image example ㈠-6A, which is a CD mirror image, which is 99% ee.

Example 7A benzyl 3- (2-benzyloxy-5-phenylene) _2

20 Under the turbulent gas layer, 1G (then millimoles) of (state 2-benzyloxy-5-5-phenylene)-^ tert-butoxyamidopropionic acid (example (_) _6α) acetic acid dissolved in 働 ml, add 246mg of pyrimidine and 4.16ml (40.22mmol) of this solution to this solution, and the mixture is cooled. To -KTC, add .g (.t mole) of EDC, let the temperature slowly reach room temperature and be mixed -43-25200526688 overnight, after about 16 hours, the mixture is concentrated under vacuum column chromatography Was purified (mobile phase: dichloromethane), yield: ', ^ retentate value through Shi Xijiao). 10.65 g (88% of theoretical HPLC (method I): Rt = 603 minutes · LC-MS (method MS (DCI): m / z = 605 (M + NH4,) + 4.70 knife clock 丨H-NMR (200 MHz, CDC13): δ = 1.38 (s, 9,), 2.97 (1Η), 4.50-4.70 (m, 1H), 5.00-5.10 (m, 4H), 5.22 ΓΗ, J?

7.28-7.36 (m, 7H), 7.37-7.52 (m, 5H) 〇 '6 · 64 (d' 1H), Example 8A =: == ::

10 to 20 g (52.60 mmol) of acetic acid was added to benzyl 3- (2_benzyloxy · 5 · mothyl) dissolved in 70 ml of DMSO = butoxyl) _liaodi A solution of acid 8 (Example 7A), argon, and the mixture was deoxygenated after 5 minutes, and then gram (6 mol) f 4 (ear) bis (diphenylphosphine) di Ferrocene peak) Chlorine, mixed with a mild rat gas, heated the Γ ° material to 8 (rc, cooled after 6 hours, after passing through the dream (mobile phase-gas nail burn) 'residue through stone The gel was purified by column chromatography (mobile phase: 4 1 cyclohexane: ethyl acetate). -44- 25 200526688 Yield: 8.15 g (79% of theory) HPLC (Method I): Rt = 6.26 minutes LC-MS (Method 2): Rt = 5.93 and 6.09 minutes MS (El): m / z = 588 (M + H) + 5 W-NMR (200 MHz, CDC13): δ = 1.26 (s , 6H), 1.33 (s, 9H), 1.36 (s, 6H), 2.91-3.10 (m, 1H), 3.12J.28 (m, 1H), 4.49-4.68 (m, 1H), 5. · 05 (dd, 2H), 5.11 (dd, 2H), 5.30 (d, 1H), 6.90 (d, 1H), 7.27-7.37 (m, 7H), 7.38-7.42 (m, 3H), 7.55-7.62 ( m, 1H), 7.67 (dd, 1H).

10 Example 9A 2OS) -Amino-3- (2-benzyloxy-5-iodophenyl) propionate

xHCI 15 12 g (24.13 mmol) 3- (2-benzyloxy-5-iodophenyl) -20S) -tertiary-butoxycarbonylamino-propionic acid (Example ㈠-6A ), Under an argon layer, was placed in 60 ml of a 4M hydrochloric acid solution dissolved in 20 dioxane and stirred at room temperature for 2 hours. The reaction solution was concentrated and dried under high vacuum. Yield: 10.47 g (100% of theory) HPLC (Method I): Rt = 4.10 minutes MS (El): m / z = 398 (M + H + HC1) + 25 W-NMR (200 MHz, CDC13): δ = 3.17-3.31 (m, 1H), 3.33-3.47 (m, 1H), 4.22 (t, 1H), 5.13 (s, 2H), 6.69 (d5 1H), 7.24-7.40 (m, 2H) , -45- 200526688 7.41-7.45 (m, 2H), 7.48 (d, 1H), 7.52 (d, 1H), 7.60 (d, 1H), 8.66 (br.s,

2H) 〇 Example 10A 5 2 (iS) -benzyloxyweilylamino-3- (2-phenylfluorenyl-5_mothyl) propanoic acid

9.25 ml (53.09 mole) of diisopropylethylamine was added to 10.46 g (24.13 mmol) of 20S) -amino-3- (2-benzyloxy- 5-iodophenyl) propionate (Example 9A), then 6.615 g (26.54 mmol 15 ears) of ΛK phenmethoxycarbonyl) succinimide (Z-OSuc) was added and the resulting solution After stirring overnight and concentrating under vacuum, the residue was placed in dichloromethane and extracted twice with 0.1N hydrochloric acid and a saturated aqueous solution of sodium gasification. The organic layer was dried, filtered, and concentrated. The mixture was placed in silica gel. The column was purified by chromatography (mobile phase: cyclohexane / diethyl ether 9: 1 to 8: 2). Yield: 8.30 g (65% of theory) HPLC (Method I): Rt = 5.01 min MS (El): m / z = 532 (M + H) +. ] H-NMR (200 MHz? DMSO-d6): δ-3.14-3.3 (m, 2H)? 4.25-4.45 (m? 1H), 4.97 (s, 2H), 5.14 (s, 2H), 6.88 (d , 1H), 7.20-7.56 (m, 12 H), 25 7.62 (d, 1H), 12.73 (br.s, 1H).

Example 11A -46- 200526688 (2-trisylsilyl) ethyl 2'-benzyloxycarbonylamino (2-benzyloxy-5-phenylphenyl) propionate ''

8.35 g (15.7 mol) of 2 (phenyl-benzyloxyquinylamino_3- (2_benzyloxy10 · 5_iodophenyl) propionic acid (Example 10A) was placed in 150 ml THF, and 2,14 g (18.07 mol) of bis-trimethylstilbene alcohol and 250 mg (2.04 mmol of 4. dimethylaminopyridine) were added, and the mixture was cooled to 0.0%. And 2.38 g (2.95 ml, 18.86 mmol) of ###-diisopropylcarbodiamine dissolved in 40 ml of THF was added, stirred at room temperature overnight, concentrated under vacuum, and the residue was placed in vacuo. Dichloromethane was added and extracted twice with 15.0N hydrochloric acid and a saturated aqueous sodium carbonate solution. The organic layer was dried, filtered, and concentrated. The mixture was chromatographed on a silica gel column (mobile phase: cyclohexane). Calcined / diethyl ether 9: 1 to 8: 2). Yield: 8.2 g (83% of theory) HPLC (Method I): Rt = 6.42 minutes 20 MS (El): m / z = 532 (M + H) +

iH-NMR (300 MHz, CDC13): δ = 0.01 (s, 9H), 0.88 (t, 2H), 2.96 (dd, 1H), 3.13 (dd, 1H), 4.04-4.17 (m, 2H), 4.51 -4.62 (m, 1H), 4.95-5.05 (m, 4H), 5.44 (d, 1H), 6.64 (d, 1H), 7.25-7.33 (m, 7H), 7.37 (dd, 4H), 7.45 (dd5 1H). Example 12A 25 200526688 2- (Trimethylsilyl) ethyl 2OS) -benzyloxycarbonylamino group_3_ [4,4f-diphenylbenzyloxybenzyloxycarbonyl-2-third_ Butoxycarbonylaminoethyl) diphenyl winteryl] propionate

10 Mix 45.8 mg (0.05 mg mol) of bis (diphenylphosphino) ferrocene palladium (II) gas (PdClXdppf)) with 0.325 g (1.0 mmol) of cesium carbonate in Add 0.316 g (0.5 mmol) of (2-trimethylsilyl) ethyl 2OS) -benzyloxyl dissolved in 2.5 ml of deaerated DMF at room temperature under argon. Carbonylamino group 3- (2-benzyloxy-5-iodophenyl) propionate (Example 11 A), the reaction mixture was heated to 400c, 15 after 30 minutes, 0.294 g (0.5 mol) of benzyl 3- [2-benzyloxy-5- (4,4,5,5-) dissolved in 2.5 ml of degassed A solution of tetramethyl- [1,3,2] dioxaboryl) phenyl] phenyl] _2⑻-tertiary-butoxyepiaminoaminopropionic acid (Example 8a), the reaction mixture was reacted at 40 ° C. Taught for 4 hours and then at 50. (2; Disperse for 2 hours, remove the solvent by evaporation, and put the residue in ethyl acetate. The organic layer is extracted 20 times with water, dried over sodium sulfate, concentrated, and the crude product is purified on silica gel. Methanol / ethyl acetate (30/1) was flow-washed to obtain 0.320 g (66% of theory) of the product. HPLC (Method I): Rt = 7.65 min. MS (El): m / z = 987 (M + Na) 5 965 (M + H) + ^ -NMR (200 MHz, CDC13): δ = 0.00 (s, 9H), 0.90 (t, 2H), i 37 (s, 25 9H), 3.02- 3.35 (m, 4H) 4.06-4.25 (m, 2H), 4.55-4.73 (m, 2¾ 4.98-5.18 (m, 8H), 5.40 (d, 1H), 5.63 (d, 1H), 6.88 -7 · 〇〇 (m, 2H), '7.19-7.39 (m, 20H), 7.42-7.53 (m, 4H). -48- 200526688

Example 13A Phenylmethyl ({(2-Four 4-Medium 4-[(Third-butoxycarbonyl) amino) -5__yltetrahydrofuran-2-yl} -methyl) carbamic acid

10 At room temperature, 7.60 g (π · 3 millimoles) of the third-butyl 5-benzyloxycarbonylamino-2S) -third-butoxycarbonylamino-4, Valproic acid s rg · shang ·, 2001, 3, 20, 3153-3155) dissolved in 516 ml of dichloromethane and 516 ml of di 15 20 triacetic acid, stirred for 2 hours, evaporated to remove the solvent, The remaining crude product was dissolved in 2.6 liters of anhydrous methanol, and at 0 ° C, 6.3 g (28 · 8 mmol) of di-third-butyl dicarbonate and 7.3 ml were added while stirring. (52.43 mmol) of triethylamine. After 15 hours, the reaction solution was concentrated, and the residue was placed in 1 liter of ethyl acetate. After the layers were separated, the organic layer was subjected to 5% sodium chloride. Extracted twice with acid solution, twice with water and once with saturated aqueous sodium vaporized solution, dried over sodium sulfate and concentrated. The crude product was purified by chromatography on silica gel, and dissolved in toluene / acetone (5/1). , 4.92 g (78 of% of theory) of the product can be obtained. LC-HR-FT_ICR-MS (Method 7): C18H28N3〇6 (M + NH4) + Calculated: 38.19726 Found: 382.19703 W-NMR (400 MHz, CDC13) ·· δ = 1.45 (s, 9H), 2.3 -2.4 (m, 1H), 2.45-2.55 (m, 1Η), 3 · 3-3 · 4 (m, 1Η), 3.5-3.6 (m, 1Η), 4.17-4.28 (m, 1H), 4.7- 4.8 (m, 1H), 5.0-5.15 (m, 4H), 7.3-7.4 (m, 5H). -49- 200526688

Example 14A 5-Benzyloxycarbonylamino-2OS) -Third-butoxycarbonylamino-4 (and)-(Third-butyldimethylsilyloxy) pentanoic acid 5 10

NH

Method A: 15 20

2 liters of a 1M mouse emulsified sodium solution was added at 0 ° C to a solution of 0.73 g (2 halo) of 13A dissolved in 50 ml of 1,4-dioxine, and this solution was added. After stirring for 2 hours, it was concentrated, and 50 ml of dichloroψane was placed. To this solution was added 112 ml (8 mmol) of triethylamine. After a short time, 138 ml (6 mmol) was added dropwise. ) Of the third-butyldimethylsilyl triflate, after stirring at room temperature for 3 hours, dilute with methane, the organic layer was washed with 1N sodium bicarbonate solution, dried with sulfuric acid steel and It was concentrated, and the crude product was dissolved in 7.4 ml of i, 4_di chew, and 36.2 ml of a 0.1N sodium hydroxide solution was added. After stirring at room temperature for 3 hours, the reaction solution was concentrated, and the residue was It was placed in water and ethyl acetate, the organic layer was extracted three times with ethyl acetate, and the combined organic layer was dried over sodium sulfate and concentrated to give the product (90% of theory). Dissolve 14.0 g (38 mmol) of benzyl 20S) -tertiary-butoxylamino-4 (io-meryl-) in 840 ml of ethanol / water (9/1) 5-Acid valeric acid, (Example 22a was mixed with 1.96 g of palladium / carbon (10%) and chlorinated at room temperature under atmospheric pressure for 24 hours. 147 grams of diisopropylacetoate was added to the mash, and then u. 4 grams (45 6 millimoles) of W benzyloxyquinol) was added. At room temperature, select 4 ″, main, +, and to stir for 4 hours. After the solution is concentrated, put it in dichloromethane and take it with 0.1N hydrochloric acid. After separating the _ knife layer, add 14.7 g (114 mol) of Diyu 5propylethylamine was tested. The solution was cooled to 0 ° C, and 30.1 g (114 mmol) of monomethyl-second-butyllithium was added. The mixture was stirred at room temperature for 2.5 hours. The organic layer was dried over sodium sulfate and concentrated. The residue was dissolved in 2 ml of diwei and mixed with 200 ml of 0.1N sodium hydroxide solution. , Stir for 3 hours at room temperature, and extract several times with ethyl acetate The organic layers were combined, dried over sodium sulfate 10 and concentrated under vacuum. The residue was subjected to silica gel chromatography (mobile phase: dioxane / ethanol 20/1, 9/1) to obtain 8.11 g (43%). Theoretical value). 'MS (ESI): m / z = 497 (M + H) + iH, NMR (300 MHz, DMSO-d6): δ = 0.000 (s, 6H), 0.99 (s, 9H), 1.33 ( s 9H), L59 (m, 1H), 1.80 (m, 1H), 2.75-3.15 (m, 2H), 3.81 (m, iH), 15 3.98 (m, 1H), 4.96 (m, 2H) , 7.04 (d, 1H), 7.19 (m, 1H), 7.30 (m, 5H),

12.37 (br. S, 1H). Example 15A 2- (trimethylsilyl) ethyl 3- [31_2fluoren-aminobenzyloxycarbonylethyl] -4,4, -diphenylmethoxyphenyl-3-yl] -2. S > benzyloxycarbonylaminopropionate hydrochloride

50 ml of a 4M hydrochloric acid / dioxane solution was added to -51-200526688 over a period of about 20 minutes. 2.65 g (2.75 mmol) of 2-65 dissolved in 50 ml was cooled to 0 ° C. (Trimethyllithium) ethyl 2 (S) -benzyloxycarbonylamino-3- [4,4, -diphenylmethoxy-3 '-(2〇S) -benzyloxycarbonyl A solution of the third-butoxycarbonylaminoethyl) diphenyl-3-yl] propanoic acid S (Example 12A). After stirring for 3 hours, the reaction solution was concentrated and concentrated under high vacuum. Yield: 100% of theoretical HPLC (Method I): Rt = 5.96 minutes MS (El): m / z = 865 (M + H) +

10 Example 16A

Benzyl 20S)-[5-benzyloxycarbonylamino-2OS) -third-butoxycarbonylamino-4 (and)-(third-butyldimethylsilyloxy (Pentyl) pentanylamino] _3_ {4,4, _diphenylmethoxy-3 '-[2 (benzyloxycarbonylamino-2- (2-trimethylsilylethoxycarbonyl) ) Ethyl] diphenyl-3-yl} propionate 15 20 0.219 g (0.58 mmol) of HATU and 0.082 g (0.63 mmol) of M diisopropylethylamine were added to the cooled solution. 0.52 g (0.58 mmol) of (2-trimethylsilyl) ethyl 3- [3,-(2〇S) -amino-2 dissolved in 7.3 ml of anhydrous DMF at 0 ° C -Benzyloxycarbonylethyl) -4,4'-dibenzyloxyphenyl-3-yl] -2 (5 > benzyloxy 25 carbonylaminopropionate hydrochloride (Example 15A) With 0.287 g (0.58 millimolar) of 5-benzyloxyalkylamino, tert.-butoxychiridylamino-4 (and)-(third-butyldifluorenylsilyloxy) pentyl A solution of the acid (Example 14A) was stirred at 0 ° C for 30 minutes, then -52- 200526688 was added and 0.164 g (1.26 mmol) of λγ, Λ / «diisopropylethylamine was added. Stirred at room temperature for 15 hours, then concentrated, the residue It was placed in ethyl acetate, and the organic layer was washed three times with water and once with saturated sodium chloride solution, dried over sodium sulfate and concentrated, and the crude product was purified by silica gel chromatography, and was diluted with methylene chloride / acetic acid. The ethyl ester was dissolved at 5 (gradient 30/1 — 20/1 — 1/10/1) to obtain 533 mg (66% of theory) of the product. LC-MS (ESI, method 6): m / z = 1342 (M + Η) +; 1365 (M + Na).

Example 17A 2OS) -benzyloxycarbonylamino-3- {4,4'-diphenylmethoxy-3,-[2OS > benzyloxycarbonyl 10 · 2_ (5_benzyl Oxycarbonylamino-2oS) -Third-butoxycarbonylamino_4⑻ · Ethylpentylamidoamino) ethyl] diphenyl-3-yl} propanoic acid

1.8 ml of 1N tetrabutylammonium fluoride dissolved in THF was added dropwise at room temperature 20 to 800 mg (0.6 mmol) of phenylhydrazine 20S dissolved in 26 ml of absolute DMF)- 〇 Benzyloxycarbonylamino-2 (5) -Third-butoxycarbonylamino-4 (i?)-(Third-butyldifluorenylsilyloxy) pentamidoamino group] _3_ {4,4, -diphenylmethoxy-3-[2 (ι5) -benzylmethoxyweilylamino-2- (2-trimethylpyridylethoxyquinyl) -ethyl] After a solution of diphenyl-3-yl} propionate (Example 16A) at room temperature for 25 minutes, cool 25 to 0 ° C and add a large amount of ice-water, and immediately add ethyl acetate and some 1N hydrochloric acid: The organic layer was dried over magnesium sulfate, concentrated and dried under high vacuum for 1 hour. The crude product was reacted without further purification. -53- 200526688 LC-MS (ESI, method 4): m / z = 1129 (M + H) + LC-HR-FT-ICR-MS: C65H69N4014 (M + H) + Calculated value 1129.48048 Measured value 1129.48123 5

Example 18A benzyl 20S> (5-benzyloxycarbonylamino group 2 (5> third-butoxycarbonylamino group 4))-meridylpentylamino group) 3- [4 , 4, -Diphenylmethoxy-3,-(2OS) -benzyloxycarbonylamino-2-pentafluorophenyloxycarbonylethyl) diphenyl] propionate 10

691 mg (crude mixture, about 0.6 millimoles) of 2 (Phenyl-benzyloxycarbonylamino-3- {4,4, -dibenzyloxy-3l [2H-benzyloxy Carbonyl-2- (5-benzyloxycarbonyl20 ylamino-to "-third-butoxycarbonylamino-4 (and) -hydroxypentamylamino) ethyl] diphenyl-3 -Yl} propionic acid (Example 17A), dissolved in 25 ml of dichloromethane, and 547.6 mg (2.98 mmol) of pentafluorophenol dissolved in 6 ml of dioxane were added. Milligrams (0.06 millimoles) of DMAP, cool the mixture to -25 ° C (ethanol / carbon dioxide bath), add 148 milligrams (0.774 millimoles) of EDC at -25 ° C, and let the 25 mixture slowly After warming to room temperature overnight, the reaction mixture was concentrated under vacuum and dried under high vacuum, and the crude product was reacted without further purification. LC-MS (ESI, method 5): m / z = 1317 (M + Na) + ， 1295 (M + H) + -54- 200526688 LC-HR-FT-ICR-MS: C71H68F5N4014 (M + H) + Calculated value 1295.46467 Measured value 1295.46430

5 Example 19A benzyl 5,17-diphenylmethoxy-14oS) -benzyloxycarbonylamino-11 (exo (3-benzyl ft_M ylamino-2 (7?)- Transylpropyl) -10,13-diketo-9,12-diazatricyclo [14.3.1.12,6] -Pentane-1 (19), 2,4,6 (21), 16 ( 20), 17-hexaene-8 (5 > carboxylic acid

Method A: 4 ml of a 4M hydrochloric acid solution in dioxane was added to 2.7 ml of 20,4-dioxane, 119.3 mg of benzyl 2 (5)-(5-benzyloxy) Carbonylamino_2 (phenyl_third_butoxycarbonyl-aminohydroxypentamylamino) -3- [4,4, -diphenylmethoxy-3 '-(2〇S) -benzene A solution of methoxy-carbonylamino-2-pentafluorophenyloxycarbonylethyl) diphenyl] propionate (Example 18A), after the reaction is completed, add 5 ml of 4M hydrochloric acid. After concentrating the reaction solution, it was distilled twice with chloroform. The crude product 25 (LC-HR-FT-ICR-MS, method 7: C66H60F5N4〇12 (Μ + Η) + calculated value 1195.41224, measured value 1955.14119 ) Dissolved in 100 ml of chloroform and dripped into 200 ml of aerosol and 100 ml of saturated sodium bicarbonate-55-200526688 sodium aqueous solution over 3 hours, and stirred vigorously for 2 hours, After the layers were separated, the aqueous layer was extracted with aerosol. The combined organic layers were washed with a 5% citric acid aqueous solution, dried over osmium sulfate and evaporated to dryness. The crude product was washed with acetonitrile and dried under high vacuum. Yield · 60.5 mg (65% of theory) LC-MS (ESI · Method 5) · m / z = 1011 (M + H) + Method B: 771 mg (0.595 mmol) of benzyl 2〇SK5-benzyloxycarbonylamino-2 (three-butoxycarbonylaminohydroxypentamylamino) _3_ [4,4, -diphenyl 10 methoxy-3H2OS> benzene Methoxycarbonylamino-2-pentafluorophenyloxycarbonylethyl) diphenyl-3-yl] propionate (Example 18A) was dissolved in 8 ml of dioxane, and then dripped at 0 ° C. 16 ml of 4N hydrochloric acid dissolved in dioxane was added, and after 45 minutes, 6 ml of 4N hydrochloric acid dissolved in dioxane was added, and after 15 minutes, 8 ml was added, and the mixture was stirred at 0 ° C. After 30 minutes, it was concentrated under mild conditions, distilled with chloroform 15 (two times) and quickly dried under high vacuum. The crude product (732 mg 0.59 mmol) was dissolved in 1,000 ml of chloroform. 6 ml of triethylamine dissolved in 50 ml of aerosol was added dropwise, and the mixture was stirred at room temperature overnight. The mixture was concentrated under mild vacuum. The residue was stirred into acetonitrile, filtered by suction, and filtered off. Crystallized to B After washing, and dried under high vacuum. 20 Yield: 360 mg (60% of theory) MS (El): m / z = 1011 (M + H) + HPLC (Method I): Rt = 5.59 minutes H-NMR (400 MHz? DMSO-d6): δ = 1.52-1.65 (m? 1H)? 1.73-1.84 (m 1H), 2.82-3.01 (m, 3H), 3.02-3.11 (m, ih), 3.46 (s, 1H), 3.57-3.68 ( m 25 1H)? 4.47-4.56 (m5 1H), 4.64-4.71 (m5 1H)? 4.73-4.85 (m5 2H) 4.88-5.00 (m, 4H), 5.09 (s, 2H), 5.14-5.20 (m, 4H), 6.29 (d, 1H) ', 200526688 7.00-7.Π (m, 4H), 7.21-7.40 (m, 2〇H), 7.41-7.48 (m, 9H), 8.77 (d,

1H), 8.87 (d, 1H) 〇 Example 20 A 5 14 amine group 11 (part t amino group · 2 anthyl propyl dimethenyl diketo-9, 12-㈣-% [14 · 3 · 1 · 12,6] Saute 4 ⑽, 2,46 ⑼, 16 ㈣, 17-Hexane-8⑻-carboxylic acid dihydrochloride (bafenormycin B)

15 200 mg (0.20 mmol) of benzyl 5,17-diphenyl, methoxy-14 (5) -phenylfluorenylcarbonylamino-110SH3-phenylfluorenylcarbonylamino_ 2 (and) _hydroxypropyl) -10,13- —fluorenyl-9,12-diazatricyclo [14 3 丨 12,6] pinane-1 (19), 2,4,6 (21 ), 16 (20), 17-hexaene-8 hydrazone (example j 9A) was placed in 220 ml of a mixture of acetic acid / water / ethanol (4: 1: 1) (ethanol can be replaced with THF ) 20 73 mg of 10% palladium / carbon was added, and then the hydrogenation reaction was performed at atmospheric pressure for 15 hours. The reaction mixture was prewashed through diatomaceous earth, the filtrate was concentrated under vacuum, and the residue was mixed into 4.95 ml of 0.1N hydrochloric acid. , Concentrated, the residue was stirred into 10 ml of diethyl ether, the supernatant was decanted, and the remaining solid was dried under high vacuum. Yield: 103 mg (95% of theory) 25 HPLC (Method 1): Rt = 3.04 minutes LC-MS (Method 2): Rt = 0.38 minutes MS (El): m / z = 473 (M + H ) + -57- 200526688 W-NMR (400 MHz, D20) · δ = 2.06-2.20 (m, 1H), 2.74-2 · 89 (m, 1H), 2.94-3.05 (m, 1H), 3.12 -3.25 (m, 2H), 3.53 (d, 1H), 3.61-3.72 (m, 1H), 3.97-4.07 (m, 1H), 4.53 (s, 1H), 4.61 (d, 1H), 4.76-4.91 (m, 12H), 7.01-7.05 (m, 2H), 7.07 (s, 1H), 7.40-7.45 (m, 2H), 7.51 (d, 1H).

Example 21A benzyl 2'-tertiary-butoxyepiamino group

At room temperature, 10 g (30.9 mmol) of 20 s) -tert-butoxycarbonylamino succinate and 5.27 g (32.5 mmol) of ι, ι, _carbonyldiimidazole was dissolved in 100 ml of tetrahydrofuran, and stirred for 5 hours to prepare solution A; at 0 t, 18.8 g (30.9 mol) of nitromethyl was added dropwise and dissolved in ml of tetrahydrofuran 3.2 grams (34.2 耄 Mor) of the second-potassium butyrate of Naruto was made into solution b, which was stirred and warmed to room temperature '. Solution A was dropped at room temperature, and at room temperature It was stirred for 16 hours and adjusted to pH 2 with 20% hydrochloric acid. The solvent was removed by evaporation. The residue was placed in ethyl acetate 20 / water. After layering, the organic layer was extracted with water, dried over sodium sulfate and concentrated to obtain 13 G (99% of theory) of product. MS (ESI): m / z = 334 (M + H) + iH-NMR (300 MHz, DMSO-d6): δ = 1.37 (s, 9H), 2.91 (m, 1H), 3 13 (m , 1H), 4.44 (m, 1H), 5.12 (s, 2H), 5.81 (m, 2H), 7.2-7.5 (m 5H). 25

Example 22 A Phenylhydrazine 2S) -Third-butoxycarbonylamino-4Hydroxy-5-nitropentanoic acid -58- 200526688 〇 I Ν OH ΗΝ " " boc 〇

〇Βη 〇5 10 The solution of this methyl methyl group, which is dissolved in 1h3g of 2m-tertyloxyamine group (1ml) of tetrahydrofuran, is cooled to C, dripping. 30.8 ml of human 'dissolved in tetrahydrofuran's solution and paste' in the paste (: Xia Lin 1 hour, after warming to room temperature, carefully and saturatedly ammonium chloride was added to dissolve, the reaction solution Concentrated, the residue was placed in water and ethyl acetate, the aqueous layer was extracted twice with ethyl acetate, and the combined organic layer was dried over sodium sulfate and concentrated.

The crude product was purified by silica gel 60 (mobile phase: cyclohexane / ethyl acetate 10/1). The collected fractions were concentrated and stirred into cyclohexane / ethyl acetate 5/1. The crystals were dried, and 2.34 g (21% of the theoretical value) of the desired non-mirrosome was obtained.

Lichrospher Diol was chromatographed on a 10 micron chromatographic separation of the mother liquor (mobile phase ·· ethanol / isohexane 5/95) to obtain 0.8 g (6.7% of theory) of the product. MS (ESI): m / z = 369 (M + H) + W-NMR (300 MHz, DMSO-d6): δ = 1.38 (s, 9H), 1.77 (m, 1H), 1.97 (m, 1H), 4.10-4.44 (m5 3H), 4.67 (m, 1H), 5.12 (m, 2H), 5.49 (d · 1H), 7.25-7.45 (m, 5H).

20

Example 23 A Benzyl 2OS)-[Isylbenzyloxycarbonylamino tertiary-butoxycarbonylaminopentanyl-amino] dong {4,4'-diphenylmethoxy-342⑻ -Benzyloxycarbonylamino-2- (2-trimethylsilylethoxycarbonyl) ethyl] diphenyl-3-yl} propionate-59- 200526688

According to a preparation method similar to that of Example 16A, 0.47 g (0.51 mmol) of the compound obtained from Example 15A and 0.19 g (0.51 mmol) of iV5-[(benzyloxy) carbonyl10] (sect. Tri-butoxycarbonyl) cardioguanine, with 0.19 g (0.51 mmol) of HATU and 0.35 ml (1.65 mmol) of AUV-diisopropylethylamine in 5.55 ml of dry Prepared in DMF. Yield: 0.58 g (92% of theory) LC-MS (Method 10): Rt = 3.46 minutes 15 MS (ESI): m / z = 1212 (M + H) +

Example 24 A 2〇S) -benzyloxycarbonylamino-3- {4,4 dibenzyloxy-3 '-[2〇S) -benzyloxycarbonyl_2- (5_benzyl Oxycarbonylamino) -2'-third-butoxycarbonylaminopentanylamine 20-based) -ethyl] diphenyl-3-yl} -propionic acid

-60- 200526688 Preparation of Example 17A from 0.82 g (0.68 mmol)

: Antimony D 'and 2 equivalents (1.3 ml) of tetrabutylammonium fluoride (1M in THF)' were prepared in 30 l of dry DMF. Closed · 772¾ g (M% of theory) 5 10 LC-MS (Method u): Rt = 1 minute

MS (ESI) · m / z = 1112 (M + H) + Example 25 A Benzyl, 2⑻ (5-benzylmethoxyweilylamino · 2⑻-tertiary-butoxyepiaminoamine Amino group) 3 [4,4_monobenzylmethoxy_3, detective benzyloxyquinylamino 1 pentafluoro-phenyloxycarbonylethyl) dibenzyl_3-yl] propionate

20 According to a preparation similar to that of Example 18A, 422 mg (0.38 mmol) of the compound obtained from Example 24A and 349 mg (1.9 mmol) of pentafluorophenol were mixed with 80 g (0.42 mg). : Mol) EDC and 4.63 mg (0.04 mmol) of DMAP were prepared in 4 ml of digas methane. Yield: 502 mg (95% of theory) 25 LC-MS (Method 11): Rt = 3.13 minutes MS (ESI): m / z = 1278 (M + H) + -61- 200526688 Example 26A Phenyl-2 〇S)-(5-phenylfluorenyloxycarbonylamino_2 (5 > aminopentamylamino)) each [4, di-benzyloxy-3L (2〇S) -phenylfluorenyloxycarbonyl Amine pentafluorophenyloxycarbonyl_ethyl) diphenyl-3-yl] propionate hydrochloride 10

Bn 15 20 5 ml of a 4N hydrogen chloride solution dissolved in dioxane was added to the compound obtained from 215 mg (0.17 mmol) of Example 25A while stirring on an ice bath, and the mixture was stirred for 1 hour. Concentrate to constant weight under vacuum. Yield: 200 mg (92% of theory) LC-MS (Method 11): & = 4.25 minutes MS (ESI): m / z = 1178 (M-HC1 + H) + Example 27 A benzyl 5, 17-diphenylmethoxy-14oS) -benzyloxycarbonylamino-n (5)-(3-benzyloxy-dailylaminopropyl) -10,13-diketo- 9,12-Diazatricyclo [14.3.1.12,6] Pentane-1 (19), 2,4,6 (21), 16 (20), 17-hexaene-8 (mesoate

-62- 200526688

The compound known from Example 26A (I.35 g. Of biemolol) was placed in 3 liters of 10 aerosol and stirred vigorously at room temperature for 20 minutes. 2.54 liters (18.2 mmol) of triethylamine was stirred overnight and evaporated to dryness under Shinji. The residue was mixed with 5 ml of ethyl acetate and filtered, and the residue was dried to constant weight. Yield: 890 mg (93% of theory) 15 LC-MS (Method 11): Rt = 5.10 minutes MS (ESI): m / z = 994 (M + H) +

Example 28 A (8 & 11 & 14S) -14-amino-11- (3-aminopropyl) -5,17-dihydroxy-10,13-diketo 20-9,12-diaza Tricyclic [14 · 3 · 1 · 12,6] pinane dihydrochloride

200526688 50 mg (0.05 mmol) of the compound from Example 27A, suspended in 50 ml of glacial acetic acid / water / ethanol (4/1/1), and added 30 mg of Pd / C (10%) catalyst After hydrogenation at room temperature for 20 hours, the catalyst was removed by filtration through celite, and the fermented liquid was concentrated to dryness under vacuum. To the stirring, 2.5 ml of 0.1N hydrochloric acid was added. The mixture was evaporated to dryness under vacuum and Constant weight. Yield: 17 mg (63% of theory) TLC (methanol / digas methane / 25% ammonia water = 5/3/2): 0.6 LC-MS produced by R (Method 3): Rt = 0.28 minutes MS (ESI): m / z = 457 (M-2HC1 + H) +

Example 29 A (8 & 11 & 14 points 14-[(Third-butoxycarbonyl) amino-11- [3-[(Third-butoxyquinyl) -amino] propyl] -5 , 17-Diacryl-10,13-di-yl-9,12-diazatricyclo [14.3.U2,6] Pentane-1 (20), 2 (21), 3,5,16, 18-hexaene-8-carbonic acid

600 mg (1.13 mmol) of the compound from Example 28A was dissolved in 6 ml (5.66 mmol) of a 1N sodium hydroxide solution, and dissolved at room temperature, dissolved in 5 ml of methanol Of 740.8 mg (3.39 mmol) of di-third-butyl dicarbonate, when the reaction is completed one hour later (detected by TLC, mobile phase: methane / methanol / ammonia gas = 80/20/2 ), Add 0.1N hydrochloric acid dropwise to adjust the pH to 3, extract three times with each 20 ml of acetic acid-64-200526688 ethyl ester and dry over sodium sulfate, then concentrate in vacuo to constant weight. Yield · 622 mg (84% of theory) LC-MS (Method 10): Rt = 1.96 minutes MS (ESI): m / z = 656 (M + H) + 5

Example 30 A 2- (Benzyllactyl) -7V- (Di-di-butoxygreen) -5-E-TV-methyl-Z / -phenylalanine 10

In an argon layer, 500 mg (1 mmol) of the compound 15 obtained from Example (-) · 6A was dissolved in 20 ml of THF, and 90.5 mg (3.02 mmol) of sodium hydride and 0.51 were added. Ml (1141.6 mg: 8.04 mmol) of methyl iodide (80% purity). The mixture was stirred at room temperature overnight. 25 ml of ethyl acetate and 25 ml of water were added to dilute and the mixture was diluted with 0.1N hydrochloric acid. Its pH was adjusted to 9, concentrated to a small volume under vacuum, 10 ml of ethyl acetate and 10 ml of water were added, the mixture was shaken vigorously for 20, the organic layer was separated, dried over sodium sulfate and concentrated under vacuum to prepare 140 mg of product (19% of theory) was obtained. The aqueous layer was acidified (pH = 3) and extracted three times with 20 mL of ethyl acetate each, concentrated under vacuum and dried to yield 351 mg of product (68% Theoretical value). LC-MS (Method 9): Rt 2 3.9 minutes 25 MS (El): m / z = 511 (M + H) +

Example 31A -65- 200526688 benzyl 2- (phenylfluorenyloxy) -A ^ (third-butoxycarbonyl) -5-moth-TV-methyl cardiac phenylalanine

According to a preparation method similar to Example 7A, 350 mg (0.68 mmol) of the compound obtained from Example 30A, 8.29 mg (0.07 mmol) of DMAP, 148 mg (1.37 φ 10 mmol) of benzene Methanol was prepared by dissolving 157.46 mg (0.82 mmol) of EDC in 3 ml of acetonitrile. Yield · 382 mg (93% of theory) LC-MS (Method 9): Rt = 4.8 minutes MS (El): m / z = 601 (M + H) + Example 32 A Benzyl 2- (benzene (Methoxy) -ΛΚ tert-butoxycarbonylmethyl 5_ (4,4,5,5-tetramethyl-1,3,2 · dioxaborane-2-yl) -L-amphetamine Acid ester

20 Using a preparation method similar to that of Example 8A, 380 mg (0.63 mmol) of the compound from Example 31A was placed in 4 ml of DMF (which was placed in a heat-dried flask) at room temperature. Under stirring, I84 · 5 mg (.73 mmol) of 66-200526688 4,4,4'.4 \ 5,5,5 ', 5 dagger methyl-2,2'- Di-1,3,2-dioxaborane, 186 mg (1.9 mmol) of potassium acetate and 23.15 mg (0.03 mmol) of bis (diphenylphosphino) diocene Iron palladium (II) chloride was reacted at 80 ° C. for 4 hours, and the obtained product was purified by chromatography (silica gel 60, mobile phase · cyclohexane / ethyl acetate = 4/1). Yield: 196 mg LC-MS (Method 9): Gen = 4.9 minutes MS (El): m / z = 601 (M + H) +

Example 33 A 10 2- (trimethylsilyl) ethyl 2⑻-benzyloxycarbonylamino-3 · [4,4'-diphenythoxy-3 '-(2〇S) -benzyl Oxycarbonyl- (2-third-butoxycarbonyl-2-methyl) aminoethyl) diphenyl-3-yl] propanoate

According to a preparation method similar to that of Example 12A, the compound from Example 32A was obtained from 190 mg (0.32 mmol), and the compound 20 from Example 11A was obtained from 195 mg (0.32 mmol). Milligrams (0.63 millimoles) of carbonic acid and 23.15 milligrams (0.03 millimoles) of di (monophenylphosphino) dipentyl iron (II) gas at 1.5 milligrams The DMF was reacted in an argon layer. Yield: 212 mg (66% of theory) LC-MS (Method 13): Rt = 4.86 minutes 25 MS (El): rn / z = 978 (M + H) +

Example 34 A -67 > 200526688

-3 '-(2〇S > benzyloxyweiyl-2-methylaminoethyldiphenyl-3-yl)

Following a preparation method similar to that of Example 15A, 93.0 mg of 10 (0.95 mmol) obtained from Example 33A was reacted with 22.14 ml of 4M hydrogen gas in 15 ml of dioxane. Yield: 915 mg (78% of theory) LC-MS (Method 13): Rt = 2.53 minutes MS (El): m / z = 878 (M-HC1 + H) + 15

Example 35 A benzyl 20OH methyl- [5-phenylfluorenyloxycarbonylamino-20S) -third-butoxycarbonylamino (third-butyldimethylsilylalkyl) ) Pentamyl] amino group 3- {4,4, -diphenylmethoxy-3f_ [20S> Phenyloxycarbonylamino group 2- (2-trimethylsilylethoxycarbonyl group) Ethyl 20-yl] diphenyl-3-yl} propionate

200526688 According to a preparation similar to that of Example 16A, from the compound of Example 922 (1.01 mmol) obtained in Example 34A, 0.5 g (1.01 mmol) of the compound of Example 14A, 421 mg (ΐ · ιιmmol) Ear) of HATU and 0.7 ml (518 mg; 3.27 mmol) of DIEA were prepared in 4.2 ml of DMF. 5 Yield: 703 mg (51% of theory) LC-MS (Method 8) Rt = 3.17 minutes MS (El): m / z-1356 (M + H) +

Example 36A 10 benzyloxycarbonylamino-3- {4,4 dibenzophenoxy-3 '-[2〇S) -benzyloxycarbonyl_2_ {methyl- (5_benzyloxy Carbonylamino 3rd-butoxycarbonylamino-4 ^ > hydroxypentyl) amino} ethyl} diphenyl-3-yl} propanoic acid

According to a preparation method similar to that of Example 17A, 360 mg (0.27 mmol) of the compound obtained from Example 35A and 0.8 ml (3 eq) of a 1 M tetrabutylammonium fluoride solution (THF) in 20 ml Reaction in DMF. Yield: 159 mg (53% of theory) 25 LC-MS (Method 12): Rt = 3.19 minutes MS (EI): m / z = 1142 (M + H) + 200526688

Example 37 A benzyl 20S)-[methyl- (5-benzyloxycarbonylamino) -2'-tert-butoxycarbonylamino-4 (7?)-Hydroxypentyl] Amino-3- [4,4, -diphenylmethoxy-3,-(2OS) -benzylidene_epiaminoamino-2-pentafluorobenzyl-chitylethyl) diphenyl Propyl-3-yl] propionate 5

The preparation method was similar to that of Example 18A, from 330 mg (0.29 mmol) of the compound obtained from Example 36A, 265.6 mg (1.44 mmol) of pentafluorobenzene 15 phenol, 3.53 mg (〇 · (033 mol) of DMAP and 60.87 mg (0.32 mol) of EDC in 10 ml of dioxane. Yield: 271 mg (69% of theory) LC-MS (Method 12): Rt = 3.38 minutes MS (El): m / z-1308 (M + H) + 20

Example 38 A Phenylfluorenyl 20S)-[methyl- (5-benzyloxycarbonylamino) -2OS) -aminohydroxy-pentamyl] amino-3- [4,4f- Diphenylmethoxy-3 '-(2'-benzyloxycarbonylamino-2-pentafluorophenoxycarbonylethyl) diphenyl-3-yl] propionate hydrochloride 200526688

130 mg (0.1 millimolar) of the compound from Example 37A was dissolved in 0.5 ml of diσ smolder, and then carefully, in an ice bath, 5 ml was added, and 4N dissolved in glutamate was evaporated. After 30 minutes in a hydrogen solution, the reaction was maintained at room temperature for another 2 hours. The reaction mixture was concentrated to dryness under vacuum and dried to constant weight under high vacuum. Yield: 130 mg (70% of theory) LC-MS (Method 15): Rt = 2.68 minutes MS (El): m / z = 1208 (M-HC1 + H) + 15

Example 39 A Benzyl (8 & 11 & 14H-5,17-bis (benzyloxy) -14-{[(benzylmethoxy) carbonyl] amino} -11-((27〇-3 -{[(Benzyloxy) carbonyl] amino} -2-hydroxypropylembryl-10,13- φdione-9,12-diazatricyclo [14.3.1.12,6] 廿Alkane-1 (20), 2 (21), 3,5,16,18-hexa-20ene-8-carboxylic acid ester

-71-200526688 130 mg (0.1 mmol) of the compound from Example 38A was placed in 220 ml of dry chloroform, and stirred at room temperature for 20 minutes. 23 ml (20 equivalents) of triethylamine in methane, the mixture was stirred overnight, evaporated to dryness under vacuum, stirred into acetonitrile, and dried to obtain 44 mg of 5 product, which can be obtained from the mother liquor by RP-HPLC An additional 30 mg of product was obtained. Yield: 74 mg (69% of theory) LC-MS (Method 15): Rt = 3.13 minutes MS (El): m / z = 1024 (M + H) +

10 Example 40 A (8 * 5,1-yl-1 l-[(2i?) _ 3-Amino-2-merylpropyl] _5,17_diarceryl-10,13-dione -9,12-diazatricyclo [14 · 3 · 1 · 12,6] Teriyaki-1 (20), 2 (21), 3,5,16,18-Hexa-8-Weiweidi (Three gas acetate)

33 mg (0.032 mmol) of the compound obtained from Example 39 was carefully treated with dilute trifluoroacetic acid, and the resulting clear solution was freeze-dried. Yield: 23 mg (quantitative) 25 LC-MS (Method 15) · Rt = 0.92 minutes MS (El): m / z = 486 (M-2CF3C02H + H) + -72- 200526688

Example 41A (8 & 11 \ 14S > 5,17-bis (benzyloxy) -14-{[benzyloxycarbonyl] amino} -11- (27?)-3-{[benzyloxy Carbonyl] amino group 2-hydroxypropyl-9-methyl-10,13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinane-1 (20), 2 ( 21), 3,5,16,18-hexaene-8-carboxylic acid 10 15

Bn〇 一} /-^ ^ —〇Bn

s ::: xc / Η Dissolve 37 mg (0.04 mmol) of the compound from Example 39A into 2 ml of THF, add 0.14 ml of a 1 N lithium hydroxide solution, stir at room temperature for 3 hours, and then add 1 N The hydrochloric acid was acidified and evaporated to dryness under high vacuum. Yield: 33 mg (71% of theory) LC-MS (Method 12): Rt = 2.90 minutes MS (El): m / z-934 (M + H) + listed in the following table for Examples 42A to 48A Compounds are prepared from appropriate starting compounds according to similar methods detailed above:

-73- 200526688 Example number structure preparation method is similar to analysis data 42A Z, N ^ \ ^ 0 H, C, N ^ V " 〇Bn 16A and #-[(Benzyloxy) -carbonyl]-# 2- ( ▲ LC-MS (Method 12): Rt = 4.85 minutes H Lse γ tri-butoxycarbonyl) -Z- MS (El): m / z = 1226 Ί 1 boc / NH z ornithine (M + H ) + 43A BnO-^^ ^ \ OBn ΗΝ ^ γ ° ^ NA ^ 〇Bn 1 〇H 〇 = / 8 HZ 17A LC-MS (Method 13): Rt = 2.04 minutes MS (El): m / z = 1126 (M + H) + 44A BnO— / J ~ ^ OBn FY ^ F /.·,·^^N, z; 9C 'F 18A LC-MS (Method 13): Rt = 3.79 minutes MS (El): m / z = 1292 (M + H) + 45A BnO ^ ~ (^ ~~ OBn 26A LC-MS (Method 13): 々, crVBn Rt = 3.72 minutes water \ F MS (El): m / z = 1192 M-HC1 + H) + 46A BnO— ^ '27A LC-MS (Method 13): ^ = 4.39 minutes z 0 g 0h3. vlS (El): m / z = 1008 zV M + H) +

-74- 200526688

Example 49 A 2- (trimethylsilyl) ethyl (2Z) -3- [2- (benzyloxy) -5-bromophenyl] -2-{[(benzyloxy) -jiyl ] Amine} Acrylic Acid Formula 5

10 Put 7.5 grams (25.8 millimoles) of 2- (benzyloxy) -5-bromobenzaldehyde (valuable price ~ 1992, / 0, 1025-30) and 11.8 grams (28.3 millimoles) of 2- (trimethylcarboxanyl) ethyl {[(benzyloxy) carbonyl] amino} (dimethoxyphosphonium) acetate (7 ^ rMMr⑽, 1999, 55, 10527-36) was introduced into 50 ml of THF and at -780C, under the cold part of Cgang / Dry Ice, 3.26 g (28.3 mmol) of U, 3,3-tetramethyl was added Glycoguanidine, Μ Mouth: slowly return to room temperature, stir at room temperature for another 12 hours, put the crude product in ethyl acetate, saturated sodium bicarbonate solution -75- 200526688 and a saturated sodium gas solution were washed once. The organic layer was dried over magnesium sulfate, filtered, and concentrated to dryness under vacuum. The crude product precipitated crystals from ethyl acetate / cyclohexyl acetate (1:20). Yield: 13 g (88% of theory) HPLC (Method 16): Rt = 6.06 minutes MS (DCI (NH3)): m / z = 599 (M + NH4) +

Example 50A (Team 11 and 145 > 5, Π-bis (benzyloxy H4-{[(benzylmethoxy) carbonyl] amino) 11- (3-{[(benzyloxy) quinyl] amine Group} propyl) _1〇, 13_diketo-9,12-diaza 10 tricyclic [14 · 3 · 1 · 12,6] -oxane-1 (20), 2 (21), 3 , 5,16,18-hexaene carboxylic acids

200 mg (0.2 mmol) of the compound from Example 27A was placed in 8 ml of THF and 4 ml of DMF and, while stirring, 0.8 ml of a 1 M aqueous solution of lithium nitroxide in lithium oxychloride ( 4 equivalent), after stirring at room temperature for 2 hours, a gel was formed, 0.8 ml of 1N hydrochloric acid and a small amount of water were added, and the mixture was evaporated to dryness under vacuum, stirred into water, and filtered to precipitate and dry. Yield: 140 mg (77% of theory) LC-MS (Method 10): Rt = 2.83 minutes 25 MS (El): m / z-〇4 (M + H) +

Example 51A -76- 200526688 (8 and 11 fork 14S) -14-[(Third-butoxycarbonyl) amino] -11- {3-[(Third-butoxyepi) amino]- Propyl} -5,17-diademyl-9-methyl-10,13-diketo-9,12-diazabicyclo [14.3.1.12,6] -pinane-1 (20), 2 (21), 3,5,16,18-hexadecenoic acid

10 11 mg (.02 mmol) of the compound from Example 47A was dissolved in 0 ml of water, 12.27 mg (0.08 mmol) of sodium carbonate was added, and the mixture was cooled on an ice bath and stirred. To the solution, add 13.25 mg (0.015 15 mmol) of di-tertiary-butyl dicarbonate dissolved in 0.2 ml of methanol, stir at room temperature overnight, stir to dryness under vacuum, dissolve It was acidified in 0.5 ml of water and 1N hydrochloric acid to pH = 2, and the resulting suspension was extracted with ethyl acetate. After drying over sodium sulfate, it was evaporated to almost dryness under vacuum. Yield: 10 mg (51% of theory) 2 LC-MS (Method 12): Rt = 1.92 minutes MS (El): m / z = 670 (M + H) +

Example 52A (Team 11 & 145) -14-[(Third-butoxycarbonyl) amino] -11-{(27?)-3 _ [(Third-butoxy25-carbonyl) -amino]- 2-Hydroxypropylbenzene 5,17-dihydroxyaspartyl_10,13_diketonyl • 9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinane-1 (20 ), 2 (21), 3,5,16,18-hexadi-8-acid-77- 200526688

90 mg (0.16 mmol) of the compound from Example 40A was dissolved in 2.5 ml of water, 85.3 mg (0.8 mmol) of sodium carbonate was added, and the solution was cooled on an ice bath. 105.3 mg (0.48 mmol) of di- (third-butyl) dicarbonate dissolved in 1.2 ml of methanol, stirred overnight at room temperature, concentrated under vacuum to a small volume and treated with 1N hydrochloric acid Acidified to pH = 2 and the resulting precipitate was filtered and dried. Yield: 89 mg (73% of theory) LC-MS (Method 12): Rt = 1.8 minutes 15 MS (El): m / z = 686 (M + H) +

Example 53 A 2- (Trimethylsilyl) ethyl 2- (phenylfluorenyloxy) (benzyloxy) carbonyl] -5-bromoxin Phenylalanine

930 mg (1.6 mmol) of OTMSE The compound from Example 49A was dissolved in 100 ml of ethanol and 10 mmol of dioxane in an argon layer, and 20 mg of (+)-1 was added. 2- 25 200526688 Bis ((2 peach) -2,5-diethylphosphino) benzene (cyclooctane dilute) recorded (1) trifluoromethane acid vinegar, 15 minutes with a supersonic ship 'woven in 3 The hydrogenation reaction was carried out under a hydrogen pressure of 100 MPa, filtered through celite, and the mixture was washed with ethanol in parallel, and concentrated in Zhenlin solution, and the crude product was dried under high vacuum. 5 Yield: 900 mg (96% of the theoretical value) ee = 98.8% (determined by analytical HPLC: Cachu 〇⑴⑴ also eluent: isohexane and ethanol (5/1 vol / vol), plus 0.02% Diethylamine by volume HPLC (Method 16): Rt = 6.08 minutes MS (DCI (NH3)): m / z = 601 (M + NH4) +

Example 54 A Methyl (2ZH- [2- (benzyloxy A, molyl [(benzyloxy) hexyl] amino) acrylate acrylate 15

20 According to a preparation similar to that of Example 49A, 7.5 g (25.8 mmol) of 2- (benzyloxy) -5-bromobenzaldehyde and 8.4 g (28.3 mmol) of 2- (trimole) Methylsilyl) ethyl {[benzyloxy] carbonyl} amino} (dimethoxyphosphonium) acetate (乂 2000, 736-44) and 3.3 grams (28.3 耄 mol) Ι, ι, 3,3-tetramethylguanidine was prepared in i50 ml of THF. 25 Yield: 10 g (87% of theory) HPLC (Method 16): Rt = 5.42 minutes MS (DCI (NH3)): m / z = 479 (M + NH4) + -79- 200526688 Example 55A Methyl 2 -(Benzyloxy) -N-[(benzyloxy) carbonyl] -5-bromo-L-phenylalanine 5

10 15 20 Following a preparation similar to that of Example 53A, 1.96 g (4.2 mmol) of the compound obtained from Example 54A and 15 mg of (+)-1,2-bis ((2S, 5 * S) -2 , 5-Diethylphosphino) benzene (cyclooctadiene) rhodium rhenium triflate, prepared in 100 ml of ethene and 20 ml of dioxane. Yield: 1.96 g (99% of theoretical value) ee = 97.6% (determined by analytical HPLC: Chiralcel OD (Daicel); eluent: isohexane and ethanol (5/1 volume / volume), plus 0.2% volume Diethylamine) LC-MS (Method 17): R, = 3.05 minutes MS (DCI (NH3)): m / z = 481 (M + NH4) + W-NMR (300 MHz, DMSO-d6): δ = 1.32 (s, 9H), 2.72 (mc, 1H), 3.17 (mc, 1H), 3.60 (s, 3H), 4.32 (mc, 1H), 5.13 (s, 2H), 7.01 (mc, 1H ), 7.22 (mc, 1H), 7.28-7.58 (mc, 6H). Example 56 A fluorenyl 2- (benzyloxy) -AK tertiary-butoxycarbonyl) -5- (4,4,5,5-tetramethyl-1,3,2-di 25 oxalone 2-2-yl) -Z / -phenylalanine 6-80- 200526688

Add 0.23 g (2.31 mmol) of potassium acetate and 4 mg (0.08 mmol) of potassium argon oxide to 0.36 g (0.777 mmol) of 5 ml of DMF obtained from In a solution of the compound of Example 55a, the mixture was degassed with argon and vigorous agitation for 10 minutes and then 0.25 g (1.0 mmol) of 4,4,4,4, , 5,5,5,, 5, -octamethyl_2,2 '· di-1,3,2-dioxaborane with 0.023 g (0.03 millimolar, 0 · (04 equivalents) of bis (dibenzylphosphino) ferrocene palladium (π) gas, the mixture was heated to 60C under a gentle argon stream and stirred at this temperature for 15 hours, then at 8080C Stir the knife and cool to a dish, evaporate and remove the solvent under vacuum. The crude product is placed in ethyl acetate, twice with a saturated sodium chloride solution, and the organic layer is dried over magnesium sulfate, filtered and Concentrated to dryness in true 2 and the residue was purified by chromatography (Rp_HpLc in ethyl water). Yield: 0.219 g (56% of theory). MS (El): m / z = 512 (M + H) + 20 ^ H-NMR (400 MHz, DMS〇.d6): δ = 1.27 (mc5 12H)? 1.29 (s5 9H) 5 2.75 (mc, 1H), 3.19 (mc, 1H ), 3.57 (s, 3H), 4.30 (mc, 1H), 5.19 (mc 2H), 7.04 (mc, 1H), 7.24 (me, 1 H), 7.28-7.58 (m, 6H).

Example 57 A 2- (trimethylsilyl) ethyl 2- (benzyloxy) (benzyloxy) carbonyl] -5- (4,4,5,5-tetramethyl-1,3, 2-dioxaboran-2-yl) fluorene-phenylalanine 25 200526688

CH, -CH -CH; " CH, 10 15 20 According to a preparation method similar to that of Example 8A, 2.0 g (3.17 mmol) of the compound from Example 11A, 0.924 g (3.64 mmol) 4,4,4 ', 4', 5,5,5 ', 5'-octamethyl_2,2'_di-1,3,2-dioxaborane, 0.932 g (9.50 mmol Ear) potassium acetate and 0.116 g (0.160 mmol, 0.05 equivalent) of bis (diphenylphosphino) -ferrocene palladium (II) gas were prepared in 30 ml of disulfoxide. Yield ·· M2 g (56% of theory) LC_MS (Method 13): Rt 4 · 50 minutes MS (El): m / z = 632 (M + H) + b-NMR (200 MHz, CDC13): δ = 0.92 (dd, 2H), 1.31 (s, 12H), 2.95-3.95 (m, 2H), 4.11 (mc, 2H), 4.55 (11 (mc, 1H), 4.99 (s, 2H), 5.08 (s, 2H), 5.53 (d, 1H), 6.90 (d, 1H), 7.15-7.47 (m, 10 H), 7.58 (d, 1H), 7.67 (dd, 1H).

Example 58 A 2- (trimethylsilyl) ethyl (2-2--2-[[(benzyloxy) carbonyl] amino}}-3- (4,4 bis (benzyloxy) · 3 · -{(25 > 2-[(Third-butoxycarbonyl) amino] -3-methoxy-3-ketopropyl} diphenyl-3-yl) propionate

200526688 Method A: According to a preparation similar to that of Example 12A, from the compound obtained from 0.46 g (0.79 mmol) of Example 53A and from the compound from Example 56A (0.41 g (0.79 mmol)) 0.52 g (1.58 mmol) of cesium carbonate and 0.023 g (0032 mmol, 0.005 equivalent) of bis (diphenylphosphino) ferrocene palladium (II) chloride, Prepared in 12 ml of DMF. Yield: 0.34 g (48% of theory) Method B: According to a preparation method similar to that of Example 53A, 059 g of 10 (0.67 mmol) obtained from Example 78A was used with 100 ml of ethanol And 10 milligrams of osmium-:: ^-gallium ^^^^-glyphthyldioctadienyl trifluoromethanesulfonate in 30 ml of dioxane. Yield: 0.60 g (99% of theoretical value) ee = 99.5% (determined by analytical HPLC: using a poly (N-isobutylammonyl_L_white 15 amino acid 1-methylphosphonium amine as Master chiral silicone selection filler KBD 8361 (250 mm x 4.6 (s meters); temperature: 23 ° C; flow rate · ml / min; eluent · isohexane and ethyl acetate (2 / 1 v / v)) 幵 卩 1 ^ (Method 16): & = 6.54 minutes MS (El): m / z = 890 (M + H) + 20) H-NMR (400 MHz, DMSO-d6): δ = 0.00 (s, 9H), 0.83 (mc, 2H)? 1.31 (s, 9H), 2.86 (m, 2H), 3.25 (m, M), 3.62 (s, 3H), 4.09 (m, 2H), 4.41 (mc, 1H), 4.98 (me, 2H), 5.22 (m, 4H), 7.12 (m, 2H), 7.29 (m, 2H), 7.33-7.59 (m, 20H), 7.78 (d, 1H). 25 The compounds of Examples 59A to 64A listed in the following table are prepared from the appropriate starting compounds according to the method described above. -83- 200526688

Example number structure preparation method is similar to analysis data 59A BnO— ~ 15A LC-MS (Method 12): Z ^ \\ Y ° h ^ n ff ° " CH3 OTMSE O 1 xHCI Rt = 2.50 minutes MS (El): m / z = 789 (M-HC1 + H) + 60A BnO— ^ OBn 16A LC-MS (Method 13): Zxs r ° OTMSE Y 0 Rt = 3.51 minutes MS (El): m / z = 1137 Ηϊ \ boc / NH 2 (M + H) + 61A BnO- > ^ \ ~ C ^ 〇Bn 17A LC-MS (Method 13): z 〇H 〇 = ^ _ 〇P Rt = 3.20 minutes MS (El): m / z = 1037 H (M + H) +

-84- 200526688 Example number structure preparation method is similar to analysis data 62A ΒηΟ — / " Λ ~ b〇c F 18Α LC-MS (Method 19): Rt = 3.43 minutes MS (El): m / z = 1203 (M + H) + 63A Βη〇 ~ 0 ^ 0 ~ 〇Βη ί χΗ〇26Α LC-MS (Method 12): Rt = 2.83 minutes MS (El): m / z = 1103 (M-HC1 + H) + 64A Βη 〇— 一 《^ ~~ 〇Βη 2 2 / 39Α LC-MS (Method 12): Private = 3.10 minutes MS (El): m / z = 919 (M + H) + Example 65 A · (8 & 11 & 14 -14-[(Third-butoxycarbonyl) amino] -11-{(2 and) -3-[(Third-butoxycarbonyl) amino] -2-hydroxypropyl} -5 , 17-dihydroxy-10,13-diketo-9,12-diaza-5 tricyclic [14.3.1.12,6] pinane-1 (20), 2 (21), 3,5,16, 18-hexaene-8-carboxylic acid

-85- 200526688 50 mg (0.09 mmol) of the compound obtained from Example 20A was placed in 8 ml of a methanol / water (9: 1) mixture, 1 ml of a 1N sodium hydrogen carbonate solution was added, and then dissolved in 2 ml of methanol / water (9 ·· 1) of 80 mg (0.37 mmol) of di-third-butyl dicarbonate, stirred at room temperature overnight, added 60 ml of ethyl acetate and 30 ml of 5 Of water, the organic layer was washed once with 0.1 N hydrochloric acid, dried and concentrated under vacuum. Yield: 49 mg (79% of theory) LC-MS (Method 3): Rt = 2.56 minutes MS (El): m / z = 673 (M + H) + LC-HR-FT-ICR-MS: C33H44N4On (M + H) + 10 Calculated 673.3079 Found 673.3082

Example 66 A Benzyl (8 & 11 & 14S) -5,17-bis (benzyloxy) -14-{[(phenylphenyloxy) carbonyl] amine 15 group} -11-((2 and) -3-{[(Benzyloxy) carbonyl] amino tertiary-butyl (dimethyl) greenalkyl] oxy} propyl) -10,13-diketo-9,12-diaza Tricyclic [14 · 3 · 1 · 12,6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene-8-carboxylic acid ester

25 200 mg (0.20 mmol) of the compound from Example 19A was dissolved in 50 ml of absolute DMF and 210 mg (0.79 mmol) of tertiary-butyldimethylsilane was added at 0 ° C. Trifluoromethanesulfonate, 0.11 ml (0.79 mmol) of triethyl-86-200526688 and 20 mg (0.20 mmol) of DMAP, the mixture was stirred at room temperature for 2 days, and after adding 20 After ml of dichloromethane, the solution was carefully washed with 10 ml of a saturated sodium bicarbonate solution and 10 ml of water. The organic layer was concentrated to almost dryness, and the residue was dried under high vacuum. Yield: 215 mg (96% of theory) LC-MS (Method 12): Rt = 3.43 minutes MS (El): m / z = 1125 (M + H) +

Example 67 A 10 (8 & 11 \ 14β-5,17-bis (benzyloxy) -14-{[(benzyloxy) carbonyl] amino group 1 l-((2i?)-3- { [(Benzyloxy) carbonyl] amino} -2-{[Third-butyl (dimethyl) silyl] oxy} propyl) -10,13 · diketo-9,12-di Azatricyclo [14.3.1.12,6] pinene-1 (20), 2 (21), 3,5,16,18-hexaene-8 · carboxylic acid

15 20 Dissolve 210 mg (0.19 mmol) of the compound obtained in Example 66A in 2 ml of THF, add 1 ml of water and methanol, and then add 13 mg (0.56 mmol) of lithium hydroxide. Stir for 12 hours at room temperature, then add 30 ml of water to dilute and add 1N hydrochloric acid to adjust the solution to pH = 3, filter the precipitate, and dry under high vacuum. Yield: 192 mg (99% of theory) 200526688 LC-MS (Method 12): Rt = 3.24 minutes MS (El): m / z = 1135 (M + H) +

Example 68 A Third-butyl {(2 outer 3-[(8 & 11 & 1) -14-[(third-butoxycarbonyl) amino] -8-[({2-[(third -Butoxycarbonyl) amino] ethyl} amino) amido] '5,17-dihydroxyaspartyl-10,13 · diketo-9,12-diazatricyclo [14.3. 1.12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-1byl] -2-Ethylpropyl} carbamate

10 15 65 mg (0.09 mmol) of the compound from Example 52A and 18.2 mg (0.11 mmol) of tertiary-butyl (2.aminoethyl) dissolved in 2 ml of absolute DMF The carbamate was cooled in an ice bath, and was tested with the addition of 43.19 mg (0.00 mmol) of 20 HATU and 16.31 mg (0.13 mmol) of Htinigfs. The mixture was stirred at room temperature for 30 minutes. Then, 36.62 mg (0.26 mmol) of Htinig, s base was added, and stirring was continued overnight. The mixture was evaporated to dryness under vacuum, and the residue was chromatographed by RP-HPLC (Yueyenfen). Yield: 42 mg (54% of theory) 25 LC_MS (Method 17): Rt = 2.31 minutes MS (El): m / z = 828 (M + H) + -88-200526688

Example 69 A Third-butyl 4-({[⑽, m, 14S> 14-[(third-butoxycarbonyl) amino] -ll-{(2i?)-3-[(third- Butoxycarbonyl) amino] -2-Arylpropyl5,17-diacetylabenyl-10,13_diketo-9,12_diazatricyclic P4 · 3 ″ P, 6] Hepta-dipyridine ^: ^: ^-Hexene alkoxy group 丨 amino monohydropyridine citric acid 70

Following a preparation method similar to that of Example 68A, 20 mg (0.03 millimoles) of the compound from Example 52A and 7 mg (0.03 millimoles) of the third- Prepared with butyl 4-aminohexahydrohex-1-acidate and a total of 50.0 mg 15 (0.12 mmol) of Hiinig's base and 13.29 mg (0.03 mmol) of HATU. Yield: 14 mg (55% of theory) LC-MS (Method l2): Rt = 2.24 minutes MS (El): m / z = 868 (M + H) + _ 20

Example 70A Third-butyl {3-[(Team 1 145) -14 _ [(Third-butoxyl-yl) amino] -8-[({2- (Third-butoxy- Carbonyl) amino} ethyl) amino] carbonyl] -5,17-dicyclohex-9-fluorenyl-10,13-diketo-9,12-diazatricyclo- [14.3.U,廿 Di 25 -1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} carbamate-89- 200526688

Following a preparation method similar to that of Example 68A, a compound obtained from 10 mg (0.001 mol) of Example 51A and 2.87 mg of 10 (0.02 mol) dissolved in 1 ml of absolute DMF was prepared. Tertiary-butyl- (2-aminoethyl) carbamate, with a total of 7.71

Preparation of mg (0.06 mmol) of Htinig, s-base and 4.43 mg (0.013 mmol) of HATU. Yield ·· 3.5 mg (29% of theory) LC-MS (Method 17): Rt == 2.37 minutes 15 MS (El): m / z = 812 (M + H) +

Example 71A Methyl (2Z) -3- [2- (benzyloxy) -5- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl ) Phenyl] -2 _ [(third_butoxycarbonyl) amino] acrylic acid vinegar

According to a preparation method similar to that of Example 8A, from the compound obtained in Example 54A, L0 g (2.16 200526688 mmol), 0.63 g (2.5 mmol) of 4,4,4 \ 4 ', 5, 5,5 ', 5'-octamethyl-2,2'-di-1,3,2-dioxaborane, 0.64 g (6.50 mmol) of potassium acetate and 0.063 g (0.087 mmol) (0.04 equivalents) of bis (diphenylphosphino) ferrocene palladium (II) gas was prepared in 14 ml of dimethyl sulfoxide. 5 Yield: 0.832 g (76% of theory) LC-MS (Method 12): Rt = 2.96 minutes MS (El): m / z = 510 (M + H) +

Example 72 A 10 Third-butyl 4-[({[((8 & 11 & 145 > 14-[(third-butoxycarbonyl) amino)]-11- {3-[(third-butoxy Carbonyl) amino] propyl} -5,17-dihydroxy-10,13-diketo-9,12-diazatricyclo- [14 · 3 · 1 · 12,6] pinene-1 (20), 2 (21), 3,5,16,18_hexaene-8-yl] carbonyl} amino) methyl] -hexahydropyridine-1-carboxylic acid ester

Following a preparation similar to that of Example 68A, 15 mg (0.002 mmol) of the compound obtained from Example 29A and 5.87 mg (0.03 mmol) of tert-butyl 4- (aminomethyl) Hexahydropyridine small carboxylic acid ester was prepared in 1 ml of absolute DMF with a total of 10.33 mg (0.01 ml; 0.08 mmol) of HUnig's base and 10.42 mg (0.03 mmol of 25 ears) of HATU. Yield: 8 mg (38% of theory) LC-MS (Method 12): Rt = 2.27 minutes 200526688 MS (El): m / z = 852 (M + H) +

Example 73 A Third-butyl 4-({[((8 & 11 & 14) -14-[(third-butoxycarbonyl) amine 5 group] -11- {3-[(third-butoxy Prosthetic group) amine] propyl 5,17-dihydroxy-10,13-diketo-9,12-diazatricyclo [14 · 3 · 1.12,6] -pinane_1 (2 〇), 2 (21), 3,5,16,18-hexaene-8-yl] quinyl} amino) hexahydro

\ / \ N / oc C bo According to a preparation similar to that of Example 68A, 15 mg (0.02 mmol) of the compound obtained from Example 29A and 5.49 mg (0.03 mmol) dissolved in 1 ml of absolute DMF ) Tert-butyl-4-aminohexahydropyridine-1-carboxylic acid ester, and a total of 10.33 mg (0.01 ml; 0.08 mmol) of Htinig, s base and 10.42 Preparation of milligrams (0.03 mmol) of HATU. Yield: 12 mg (56% of theory) LC-MS (Method 18): Rt = 2.40 minutes MS (El): m / z = 838 (M + H) +

Example 74 A Third-butyl {3-[(8 & 11 & 14) 14-[(third-butoxycarbonyl) amino H-[({2-[(thirdbutoxy cytyl) Amine] ethyl} amino) amido] _5,17_dihydroxy-92- 200526688 -10,13-diketo-9,12-diazatricyclo [14.3.1.12'6] 1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} aminophosphonate 5 10

620 mg (0.9 mmol) of the compound from Example 29A and 244.3 mg (1.52 mmol) of tertiary-butyl (2-aminoethyl) dissolved in 10.5 ml absolute DMF ) Urethane, under cooling in an ice bath, add 292.3 mg (152 mmol 15 mol) of EDC and 40 mg (0.3 mmol) of HOBt while stirring, and allow the reaction mixture to warm to room temperature After 2 hours, the product was precipitated by adding 200 ml of water under vigorous stirring. After stirring for 30 minutes, the precipitate was filtered off, and the product was dried under high vacuum. Yield: 675 mg (85% of theory) LC-MS (Method! 2): Rt = 2.12 minutes 20 MS (El): m / z = 798 (M + H) +

Example 75 A Third-butyl {3 _ [(Team third-butoxycarbonyl) amino] -8-[({3 _ [(third-butoxy-carbonyl) amino] _2-hydroxypropyl丨 Amine) carbonyl] -5,17_25 monohydroxy] 0,13_diketo-9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} aminophosphonate-93- 200526688

'boc boc According to a preparation similar to that of Example 68A, 15 mg (0.02 mmol) was obtained from 10 of the compound of Example 29A and 3.21 mg (0.03 mmol) of a third dissolved in 1 ml of absolute DMF. -Butyl (3-amino-2-hydroxypropyl) carbamate, with a total of 10-33 mg (0.01 ml; 0.08 mmol) of Hiinig, s base and 10 · Preparation of 42 mg (0.03 mmol) of HATU. Yield ·· 10 mg (53% of theory) 15 LC-MS (Method 19): Rt = 2.23 minutes MS (El): m / z = 828 (M + H) +

Example 76A Third-butyl {3-[(8 and 11 & 14 out of 14-[(third-butoxycarbonyl) amine 20-yl] -8-[({3-[(third-butoxy -A-kilyl) amino] propyl] amino}]-5,17-diazonyl-10,13-diketo-9,12-diazatricyclo [14.3.1 · I2,6 ] Heptane-1 (20), 2 (21), 3,5,16,18-Hexane-11-yl] propyl] aminoformate-94- 200526688

/ NH boc was prepared in a similar manner to Example 68A, and was obtained from 15 mg (0.02 mmol) of the compound from Example 29A and 4.78 mg (0.03 mmol) of tertiary-butane in 1 ml of absolute DMF. (3-Aminopropyl) carbamate, and a total of 10.33 mg (0.01 ml; 0.08 mmol) of Htinig's base and 10.42 mg (0.03 mmol) of HATU. Yield: 7.2 mg (37% of theory) 15 LC-MS (Method 12): Rt = 2.16 minutes MS (El): m / z = 812 (M + H) +

Example 77 A Third-butyl [2-({[((8 & 11 and 14S) -14 _ [(third-butoxycarbonyl) amine 20 group] -ll- {3-[(third-butoxy -Carbonyl) amino] propyl} · 5,17 · dihydroxy-10,13-diketo-9,12-diazatricyclo [14.3.1. I2,6] -pinane-1 ( 20), 2 (21), 3,5,16,18-hexaene-8-yl] carbonyl} amino) ethyl] methylaminophosphonate-95- 200526688

Prepared in a similar manner to Example 68A from 15 mg (0.02 mmol) of the compound from Example 29A and 4.78 mg (0.03 mmol) of tertiary-butyl (3 -Aminopropyl) methylcarbamate, and a total of 10.33 mg (0.01 ml; 0.08 mmol) of Htinig's base reacted with 10.42 mg (0.03 mmol) of HATU. Yield: 5.5 mg (29% of theory) 15 LC-MS (Method 12): Rt = 2.18 minutes MS (El): m / z = 812 (M + H) +

Example 78 A 2- (trimethylsilyl) ethyl (2Z) -2- {[(benzyloxy) carbonyl] amino group 3- (4,4'-di20 (benzyl-oxy) -3 '-{(1Z) -2-[(Third-butoxycarbonyl) amino] -3-methoxy-3-keto-1-enyl} diphenyl-3 -yl) Acrylate

-96- 200526688 Prepared by a method similar to Example 12A, from 0.42 g (0.82 mol) of the compound obtained from Example 71A, 0.48 g (0.82 mmol) from the compound of Example 49A, 0.54 g (1.65 mmol) of carbonate shavings and 0.024 g (0.033 mmol, 0.04 equivalent) of bis (diphenylphosphino) ferrocene palladium (11) gas, at 12 It was obtained by reacting 5 ml of DMF. Yield: 0.47 g (64% of theory) HPLC (Method 16): Rt = 6.57 minutes MS (El): m / z = 886 (M + H) + 10 15 benzyl ((2i?)- 3-[(8S, 1 1 parent 14S) -5,17-bis (benzyloxy) -14-{[(benzyloxy) carbonyl] -amino group 8-[({3-[( Tri-butoxycarbonyl) amino] -2-hydroxypropyl} amino) carbonyl] _10,13_diketo-9,12-diazatricyclo [14.3.1.12,6] pinene] (20 ), 2 (21), 3,5,16,18-hexaene-11-yl] -2 _ {[Third-butyl (dimethyl) suprylyl] oxy} propyl) aminocarboxylic acid ester

20 According to a preparation similar to that of Example 68A, 60 mg (0.06 mmol) of the compound obtained from Example 67A and 2 mg of (0.06 mmol) dissolved in 4 ml of absolute DMF Tri-butyl (3-aminohydroxypropyl) carbamate, and a total of 600 grams (0.08 ml; 0.46 mmol) of Htinig, s test and 27 6 mg (〇07 mmol) Mol) HATU preparation. -97- 25 200526688 Yield: 69 mg (98% of theory) LC-MS (Method 17): Rt = 3.43 minutes MS (El): m / z = 1207 (M + H) + 5

Example 80A

Third-butyl [3-({[(8 & 11 & 14) -14-14-amino-11-((27?)-3-amino-2-{[third-butyl (dimethyl ) -Silyl] oxy} propyl) -5,17-dihydroxy-10,13-diketo-9,12_diazatricyclo [14.3.1.12,6] · Heptane_1 (20) , 2 (21), 3,5,16,18-hexaene-8-yl] carbonyl} amino) -2-hydroxypropyl] carbamate diacetate

10 15 20 69 mg (0.06 mmol) of the compound from Example 79A was dissolved in glacial acetic acid / water / ethanol (4/1/1), and then 20 mg of Pd / C (10%) catalyst was added. A hydrogenation reaction was performed at room temperature with hydrogen. After filtering off the catalyst, the filtrate was evaporated to dryness under vacuum. Yield: 50 mg (quantitative) LC-MS (Method 17): Rt = 1.58 minutes MS (El): m / z = 879 (M + H) +

25 Example 81A Tertiary butyl {(2 /?)-3-[(8 & 11 \ 145 >> 14-[(third-butoxycarbonyl) amino] each [({2-[(third -Butoxycarbonyl) amino] ethyl} amino) carbonyl] -5,17-dihydroxy-98-200526688 -10,13-monoketo-9,12_diazatricyclo [14 3 " "2,6] Arabu-1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] -2-Ethylpropyl} carbamate 10

boc According to a preparation similar to that of Example 68A, the compound from Example 65A obtained from 35 mg (0.03 mmol) and the third-16 mg (0.01 mmol) dissolved in 3 ml of absolute DMF Butyl (2-aminoethyl) carbamate, with a total of 15.3 mg (0.02 ml; 0.12 mmol) of Htinig, s base and 19.3 mg (0.05 mmol) HATU is prepared. Yield: 8 mg (29% of theory) LC-MS (Method 18): R, = 3.05 minutes MS (El): m / z = 1015 (M + H) +

15

20 Example 82A Third-butyl 2- [2-({[((8 & 11 & 14 Office 5,17-bis (benzyloxy) -14-{[(benzyloxy) carbonyl] -amino } -11- (3-{[(benzyloxy) carbonyl] amino} propyl) -9-methyl-10,13-diketo-9,12-diazatricyclo [14.3.1.12 , 6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene-8-yl] carbo} amino) ethyl] hexahydrosigma Purpose 25 -99- 200526688

10 According to a preparation similar to that of Example 68A, 45 mg (0.05 mmol) of the compound obtained from Example 48A and dissolved in 5 ml of absolute 1)] ^]? Of 12.3 mg (0.05 mmol) ) Of the second-butyl 2- (2-aminoethyl) hexafluorene small carboxylic acid ester, and a total of 50.6 mg (0.39 mmol) of Htinig, s base and 23 3 mg (〇〇 6 mmol) of HATU. 15 Yield: 46 mg (83% of theory) LC-MS (Method 12); Rt = 3.26 minutes MS (El): m / z = 1129 (M + H) +

Example 83A 20 Third-butyl 2-[({[((8 & 11 & 14S) -5,17-bis (phenylfluorenyloxy) -14 _ {[(benzyloxy) carbonyl] -amino}}- 11- (3-{[(Benzyloxy) carbonyl] amino} propyl) -9-methyl-10,13-diketo-9,12-diazatricyclo [14 · 3 · 1 · 12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-8-yl] carbonyl} amino) methyl] hexahydropyridine-1 -carboxylic acid Ester-100- 200526688

According to a preparation method similar to Example 68A, 45 mg of 10 (0.05 mmol) from the compound of Example 48A and 11.5 mg (0.05 mmol) of tertiary-butane dissolved in 5 ml of absolute DMF Was prepared from a group of 2 · (aminomethyl) hexahydropyridine carboxylate with 50.6 mg (0.39 mmol) of Hiinig's base and 23.3 mg (0.06 mmol) of HATU. Yield: 48 mg (88% of theory) 15 LC-MS (Method 12); Rt = 3.22 minutes MS (El): m / z = 1115 (M + H) +

Example 84 A 2- (Benzyloxy) (third-butoxycarbonyl) -5-iodo-pentylethyl_Z-phenylalanine

25 In an argon layer, 1.0 g (2.01 mmol) of the compound obtained from Example (_) 6A was dissolved in 40 ml of THF, and 241 mg (6.03 mmol) of sodium hydride (60% of Suspension of mineral oil), 1.0 g (6.03 mmol) of sodium iodide and 1.29 ml (2509 -101-200526688 mg; 16.1 mmol) of ethyl iodide, stirred at room temperature overnight, under vacuum The mixture was concentrated under reduced pressure, the crude product was placed in ethyl acetate, the organic layer was washed several times with water, dried over sodium sulfate, concentrated and concentrated under vacuum, and the crude product was purified by RP-HPLC chromatography ). Yield: 470 mg (44% of theory) LC-MS (Method 12): Rt = 2.79 minutes MS (El): m / z = 526 (M + H) +

Example 85A 10 benzyl 2- (benzyloxy) benzene (third-butoxycarbonyl) _5_ moth

15 According to a preparation similar to that of Example 7A, 420 mg (0.68 mmol) of the compound obtained from Example 84A, 9.77 mg (0.08 mmol) of dMAP, 173 g (1.6 mmol) Stupid methanol and 184 mg (0.96 mmol) of edC were prepared in 8 ml of Ethyl® 20. Yield · 375 mg (76% of theory) LC-MS (Method 12): Rt = 3.26 minutes MS (EI): m / z = 616 (M + H) + b-NMR (300 MHz, CDC13 "δ = 0.80 (mc, 3H), 4 (mc, 9H) 2 75 (call, 25 1H), 3.07 (mc, 1H), 3.22 (mc, 1H). 3.47 (mc, 1H), 4.23 (mc, 1H), 5.06 (s, 2H), 5.15 (mc, 2H), 6.65 (d, 1H), 7.25-7.5 (m, 12H). -102- 200526688

Example 86A 2- (Trimethylsilyl) ethyl 2OS) -phenoxycarbonylaminoamino [4,4l diphenylmethoxy-3 '-(2〇S) -benzyloxycarbonyl -(2-Third-butoxycarbonyl-2-ethyl) aminoethyl) dibenzyl-3-yl] -propionate

According to a preparation similar to Example 12A, 343 mg (0.54 mmol) of the compound obtained from Example 57A, 334 mg (0.54 mmol) of the compound obtained from Example 85A, 354 mg (1.09 mmol) Ear) was prepared by reacting cesium carbonate with 40 mg (0.05 mol) of mono (diphenylphosphino) ferrocene palladium (II) gas in 8 ml of DMF under a nitrogen layer. Yield · 216 mg (40% of theory) LC-MS (Method 12): Rt = 3.54 minutes MS (El): m / z = 893 (M-boc + H) + # 20

Example 87A 2- (Trimethylsulphanyl) ethyl 2OS) -benzyloxy-aminoamino-3. [4,4'-diphenylmethoxy-3 '-(2OS)- Benzyloxycarbamoyl-2-ethylaminoethenyldiphenyl) propionic acid® hydrochloride

-103-25 200526688

According to a preparation method similar to that of Example ISA 1j 15A, 210 mg (0.211 mmol) of the compound of Example 86A was used to detoxify / dissolve in 15 ml of 4N hydrogen chloride / dichloromethane in 4 ml of dioxane. Preparation of oxane solution. Yield: Quantitative 5 LC-MS (Method 12): Rt = 3.01 minutes MS (El): m / z = 893 (M-HC1 + H) + The compounds listed in the examples 88A to 92A in the table below are similar In the method described above, it was prepared from an appropriate starting compound: 10 Example number structure Γ —————— The preparation method is similar to the analysis data 88A OTMSE γ 0 Zhouren 1 1 ^ / NH 16Α 和 # 5- [(Benzyloxy) _kiszyl] -Λ ^-(Third-butoxychixyl ornithine LC-MS (Method 17): Rt = 3.63 minutes MS (El): m / z = 1241 ( M + H) + 89A Βη〇-〇-〇 ~ 〇βη z / OH 0 H b〇c, 17A ------- LC-MS (Method π): Rt = 3.38 minutes MS ( El): m / z = 1149 (M + H) + 90A νζ. Private 'F 18A LC-MS (Method 17): Rt = 3.58 minutes MS (El): m / z = 1315 (M + H) +

-104- 200526688 Example number structure preparation method is similar to analytical data 91Α 1 ΧΗσ 26Α 92Α BnO— / S— ~ ^ QBn V / Heartridge 39Α LC-MS (Method 17): Rt = 3.39 minutes MS (El): m / z = 931 (M + H) +

Example 93A Benzyl {3-[(8S, 11S, 14S) each {[(2-aminoethyl) amino] carbonyl} -5,17-bis (phenylfluorenyloxy) -14 _ {[(benzene (Methoxy) carbonyl] amino} -9-ethyl-10, 13-diketo-9, 12 · 2 5 azatricyclo [14 · 3 · 1 · 12,6] pinane-1 ( 20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} carbamate

15 Dissolve 16.5 mg (0.02 mmol) of the compound from Example 92A in 270 μl of diethylamine, add 0.1 mg (10 mol%) of cyanide and remove at room temperature- 105- 200526688 Scattered 36 hours, and then add ethyl acetate. The Greek layer was washed with saturated sodium bicarbonate solution and water, dried with sodium sulfate, and concentrated under vacuum. Yield: 17.5 mg (88% of theory) LC-MS (Method 17): Rt = 2.33 minutes 5 MS (El): m / z = 975 (M + H) + Examples listed in the table below 94A to The compound of 108A was prepared from an appropriate starting compound by a method similar to that detailed above. Example Number

94A

95A

96A

97A structure

OBn

〇Βπ

Τ'— The preparation method is similar to the analysis data 16A and Λ 5-[(benzyloxy) -carbonyl (third, butoxycarbonyl lysine LC-MS (Method 17) · Rt = 3.63 minutes MS ( El): m / z = 1241 (M + H) + 17A LC-MS (Method 19): Rt = 3.40 minutes MS (El): m / z = 1141 (M + H) + 18A LC-MS (Method 12 ): Rt = 3.42 minutes MS (El): m / z = 1307 (M + H) + 26A -1〇06 · 200526688

Example No.Ma structure preparation method is similar to the analysis data 98A βπ〇 ^ Ο ~ ^^ 0βπ Z 〇I CH3 0 39A LC-MS (Method 12): Rt = 3.27 minutes MS (El): m / z = 1023 (M + H) + 99A h〇--〇 ^^ V〇h Xwyoh 〇 = CH ^ ° l 2xHa 28A LC-MS (Method 20): Rt = 2.43 minutes MS (El): m / z = 485 (M-2HC1 + H) + 100 A h〇-〇 ^ Q ~ oh XvsV boc OJ CH3 ° rh 29A LC-MS (Method 20): Rt = 3.26 minutes MS (El): m / z = 685 (M + H) + 101A BnO — ~ 《》 〇Bn ζΥ ^ Υ ,, ^ Γ〇Βη OTMSE γ O HH \ \ z 16A and (2 ^)-4-{[(Benzyloxy) -carbonyl] amino group} -2-[( Tertiary-butoxycarbonyl) -amino] butyric acid LC-MS (Method 17): Rt = 3.65 minutes MS (El): m / z = 1213 (M + H) + -107- 200526688

-108- 200526688

Example 109A tertiary butyl [2-({[((8 & 11 & 14) -14 ([third-butoxycarbonyl) amino] -11- {4-[(third-butoxy Weilyl) amino] butyl} -5,17-diazonyl-9-methyl 5 -10,13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinane · 1 (20), 2 (21), 3,5,16,18-hexaene-8-yl] carbonyl} amino) ethyl] carbamate

30 mg (0.04 mmol) of the compound from Example 100A and 11.9 mg of 15 (0.07 mmol) of tertiary-butyl (2-aminoethyl) carbamate under an argon layer Dissolved in 2 ml of dimethylformamide, and then added 14.3 mg of -109- 200526688 (0.007 mmol) EDC and 2 mg (0.001 mmol) at 0 ° C (ice bath). Horn), the mixture is slowly returned to the dish until it is 'stirred' at room temperature for 12 hours. After concentrating under vacuum, the residue is stirred into water, which is retained under suction to concentrate and concentrated under high vacuum. . Yield: 3U mg (64% of theory) LC-MS (Method 20): R, = 3.55 minutes MS (El): m / z-827 (M + H) + Examples listed in the table below 110A to 119 The compound was prepared from a suitable starting compound in a manner similar to that detailed above: 10

-110. 200526688

Example Number Structure The preparation method is similar to the analysis data 114A. 〆 ην 丨 boc boc, 〆 109 A LC-MS (Method 20): Rt = 2.17 minutes MS (El): m / z = 827 (M + H) + 115A 〆 b. 109 A LC-MS (Method 19): Rt = 2.43 minutes MS (El): m / z = 841 (M + H) + 116A I / NH-109 A LC-MS (Method 19): Rt = 2.46 minutes MS (El): m / z = 853 (M + H) + 117A, / \ '109A LC-MS (Method 20): Rt = 2.12 minutes MS (El): m / z = 948 (M + H) + 118A 109 A LC-MS (Method 12): Rt = 2.33 minutes MS (El): m / z = 839 (M + H) + 119A h〇'-0 ~ O ~ 0H LH 109 A < LC-MS ( Method 19): Rt = 1.95 minutes MS (El): m / z = 898 (M + H) + -Ill-200526688

Example 120A Third-butyl {3-[(8 & 11 and 14 and 14 magic-14-[(third-butoxycarbonyl) amino] -8-[(l, 4-diaphen-6-5 Amino group) alkynyl] -5,17-diademyl-10,13 · diS homoyl-9,12-diamobibi 5 ring [14.3.1.12,6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} carbamate dihydrochloride

19.9 mg (0.021 mmol) of the compound from Example 117A was suspended in 4 15 ml of acetic acid / ethanol / water (4: 1: 1), mixed with 10 mg of Pd / C catalyst (10%) and placed in a chamber. The hydrogenation reaction was carried out at warm and atmospheric pressure for 1 hour. The catalyst was filtered off through a membrane filter, the filtrate was evaporated to dryness under vacuum, 1 ml of 0.1N hydrochloric acid was added, and then concentrated to dryness. Yield: 12 mg (68% of theory) 20 LC-MS (Method 12): Rt = 1.31 minutes MS (El): m / z = 767 (M-2HC1 + H) +

Example 121A Third-butyl {3-[(Zhao, 11 \ 1 仏) -8-({[((1foot 27〇_2-aminocyclohexyl) amino} carbonyl 25 group) -14-[( Third, butoxycarbonyl) amino] -5,17-dihydroxy-10,13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinene-1 (20) , 2 (21), 3,5,16,18-hexaene-11-yl] propyl} carbamate-112- 200526688

40 mg (0.060 mmol) of the compound from Example 29A was dissolved in 5 mmol of dimethylformamide, cooled to 0 ° C, and 34 mg (0.13 mmol) of 2- -1,3-Dimethyl-2-imidazolium hexafluorophosphate with 14 mg ⑴ · ΐ 2 mmol, trans-1,2-diaminocyclohexane, 30 minutes later, add 4 MG03 mg of ΜΑΡ with 0.050 ml (40 mg, 0.30 mmol) of diisopropylethylamine) The mixture was incubated at 0 ° C for one hour, followed by vacuum The crude solution was concentrated and the residue was purified by HPLC (mobile phase: acetonitrile water gradient). Yield: 2 mg (4% of theory) 1 ^ >] ^ (Method 20): This 1 = 3.27 minutes MS (El): m / z = 753 (M + H) + 20 is listed in the table below The compound of Example 122A and IMA was prepared from a suitable starting compound according to a method similar to that detailed above: -113. 200526688 Example Number Structure Preparation Method Similar to Analytical Data 122A / boc boc, s 109 A LC- MS (Method 12): 1 ^ = 2.36 minutes MS (El): m / z = 928 (M + H) + 123Α 109 A LC-MS (Method π): Rt = 2.34 minutes MS (El): m / z = 811 (M + H) +

Example 124A 5

Benzyl {3-[(2-[(third-butoxycarbonyl) amino] -1 · {[(third-butoxycarbonyl) amino] -methyl} ethyl) amino] Propyl} carbamate

10 Combine 310 mg (1.07 mmol) of di-tertiary-butyl (2-aminopropane_, 3-diyl) dicarbamate with 222 mg (1.07 mmol) The benzyl (3-ketopropyl) aminophosphonate was dissolved in 15 ml of dioxane, and 334 mg (ΐ · 5 mmol) of sodium triacetate borohydride was added at room temperature. After stirring overnight, after concentration, the residue was purified by preparative HPLC. Yield: 168 mg (38% of theory) -114- 15 200526688 LC-MS (Method 12): Rt = 1.76 minutes MS (El): m / z = 481 (M + H) +

Example 125A Benzyl {3 _ [(third-butoxycarbonyl) (-2-[(third, butoxycarbonyl) amino] small {[(third-butoxy-quinyl) amine Group] methyl} ethyl) amino] propyl) carbamate

10 15 20 0.55 ml of a 10% strength triethylamine solution in acetonitrile and 154 mg (0.70 mmol) of di-tertiary-butyl dicarbonate were added to dissolve in 168 mg (0.35 mol) of benzyl {3-[(2-[(third-butoxycarbonyl) amino group tertiary-butoxycarbonyl) amino group) methyl group in 2 ml of acetonitrile } Ethyl) amino] propyl urethane (Example 124A). The mixture was stirred at 60 ° C for 6 hours and concentrated. The crude product was reacted without purification. Yield: Quantitative LC-MS (Method i7): Rt = 2 87 minutes MS (El): m / z = 580 (M + H) +

Example 126A Mono-second-butyl {2 _ [(3-aminopropyl) (third · butoxycarbonyl) amino] propane-1,3- ^ monoyl} monocarbamic acid -200526688

L / NH HN. B〇c boc For benzyl {3-[(Third-butoxy) 190 mg (0.327 mol) in 50 ml glacial acetic acid / water / ethanol (4 / 1Λ) Carbonyl) (_ 2 _ [(Third-butoxycarbonyl) amino}) [(third-butoxycarbonyl) amino] methyl} ethyl) amino] propyl} carbamic acid acetic acid (Example 125A) After adding 20 mg of palladium / activated carbon (10%), the hydrogenation reaction was performed at atmospheric pressure and 10 15 room temperature for 12 hours. After the mixture was filtered through celite, the residue was washed with ethanol, and the filtrate was filtered under vacuum. Evaporate to dryness and the product reacts without purification. Yield: Quantitative LC-MS (method i7): Rt = i.71 minutes MS (El): m / z = 447 (M + H) + The compounds listed in Example 127A in the table below are similar to those detailed Prepared from the appropriate starting compound by the method of Example 93A above:

Example number Example analysis data for the structure of the precursors 127A 27A and #-(3-aminoen0--〇 ~ ^ iy ~ OBn HPLC (method υ: propyl) -propane-1,3-Rt = 4.97 minutes Amine 〇 〇 × 〇ζ MS (El): m / z = i〇i8 (M) + The compounds listed in Examples 128A to 134A in the table below are similar to the methods detailed in Example 109A described above by appropriate methods. Preparation of starting compounds: -116- 200526688 Example number Example precursor structure analysis data 128A 29A H0 ^ y ^ ry〇H boc 0 1 boc LC-MS (Method 12): Rt = 2.42 min MS (El): m / z = 867 (M + H) + 129A 29A h〇 ^ 〇-〇-〇h ^ YyVVs ^ boc 0, boc, NH boc LC-MS (Method 17): Rt = 2.49 minutes MS (El): m / z = 841 (M + H) + 130A 29A H〇- {y ^ y〇H ^ yVyS ° x; a boc LC-MS (Method 17): Rt = 1.84 minutes MS (El): m / z = 767 (M + H) + 131A 29A ^ NH O, boc LC-MS (Method 19): Rt = 2.01 minutes MS (El): m / z = 867 (M + H) + 132A 29A bovQs ^ V \ Sh ^ N, b 〇c boc-LC-MS (Method 19): Rt = 2.46 minutes MS (El): m / z = 851 (M + H) +

-117- 200526688 Example No. Precursor of Example Structure Analysis Data 133A 29A. \. > b〇c 1 LC-MS (Method π): Rt = 1.84 minutes MS (El): m / z = 876 (M + H) + 134A 29A and 126A boc boc —. LC-MS (Method 19) Rt = 2.72 minutes MS (El): m / z = 1085 (M + H) +

The compound of Example 135A listed in the table below was prepared from a suitable starting compound in a similar manner to Example 120A detailed above: Example Number Precursor of Example Structure Analysis Data 135A 135A. '. > X2HCI ψ 〆 boc nh2 LC-MS (Method 12) Rt = 1.37 minutes MS (El): m / z = 741 (M-2HC1 + H) +

Example 136A benzyl {3-[(8aS, 1 l * S, 14iS) -5, 17 --- (benzyloxy) -14-{[(benzyloxy) amino] amino (2-aminoethyl) amino] ethyl} amino) carbonyldione-118- 200526688 -9,12-diazatricyclo [14.3.1. I2,6] pinane-1 (20 ), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} aminophosphonate

20 mg (0.02 mmol) of benzyl 5,17-diphenylmethoxy-14oS) -benzyloxychiridylamino-11 (5)-(3-phenylfluorenyloxy A few aminoaminopropyl) -1,13-di--9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinane-1 (19), 2,4,6 (21), 16 (20), 17-hexaene-80S) -carboxylic acid ester (Example 27A) was dissolved in 489 mg (3.34 mmol) of tris (2-aminomethyl) amine, and added 0.2 mg of potassium cyanide, the resulting suspension was dissolved by adding a few drops of dimethylformamide, the mixture was stirred at room temperature overnight, 10 ml of water was added, the precipitate was filtered off, and the residue was dried under vacuum to prepare Get crude products. Yield: 10 mg (48% of theory) LOMS (Method 17): Rt = 2.11 minutes MS (El): m / z = 1034 (M + H) + _ 10 15 20

Example 137A Tertiary-butyl [(1-amino-4- (tertiary-butoxycarbonyl) amino] -1-(hydroxymethyl) butyl] carbamate

-119- 200526688 91 mg (0.90 mmol) of 4-methylmorpholine and 98 g (0.90 ethyl chloroformate) were added to dissolve at 10 ° C. Ml tetrahydrofuran mol) mg (0.90 mmol) ❹ 5 • bis (third. Butoxy-jiki) heart bird t 300 mix for 30 minutes, at this temperature, slowly drop 1.81 ml (1.81 mmol) Moore's, 1M lithium aluminum hydride solution in hydrogen furan, the reaction mixture was slowly warmed = stirred at room temperature for 12 hours, and then, on the one hand, under ice cooling, at room temperature, heartily Add 0.1 ml of water and 015 ml of 45% strength tritium sodium carbonate. Noodles are stirred at room temperature for another 3 hours, filtered, and the filtrate is concentrated under vacuum. The solution is dissolved in ethyl acetate. It was washed with water, dried over magnesium sulfate, and then left to dryness under vacuum? The product was subjected to the next reaction without further purification. Yield on evaporation: 239 mg (83% of theory)

MS (ESI): m / z = 319 (M + H) +; 341 (M + Na) + Example 138A (2p 2,5-bis [(third-butoxycarbonyl) amino) pentylmethyl Sulfonate

Dissolve 240 mg (0.75 mmol) of tertiary-butyl [(Cetra-4-[(tertiary-butoxyisopropyl) amino] small (hydroxymethyl) butyl) dissolved in 20 ml of digas methane ] Aminophosphonate (Example 137A) solution was mixed with 103 mg (0.90 mmol) of methanesulfonium and 0.21 ml (1.5 mmol) of triethylamine and stirred at room temperature After 16 hours, dichloromethane was added and diluted, washed twice with 0.1N hydrochloric acid, and the organic layer was dried over magnesium sulfate and evaporated to dryness under vacuum, and the product was no longer refined and reacted. Yield: 218 mg (73%) Theoretical value) MS (ESI): m / z = 419 (M + Na) + 200526688 Example 13% First butyl ^ {(45) -5 · Isyl I [(Third-butoxyepiyl) amine Yl] pentyl} amino

boc will be dissolved in 15 ml of 218 mg (0.55 mmol) of dimethylformamide. 10 之 2,5-[(second-butoxy · carbonyl) amino] pentylsulfonic acid The solution of the ester (Example 138A) was mixed with 36 mg (0.55 mmol) of sodium azide and stirred at 70 ° C. for 12 hours. After removing most of the solvent by evaporation under vacuum, the residue was passed through Diluted with ethyl acetate, washed several times with saturated sodium bicarbonate solution, dried over magnesium sulfate and evaporated to dryness under vacuum. The product was used in the next reaction without further purification. 15 Yield: 188 mg (99% of theory) MS (ESI): m / z = 344 (M + H) +

Example 140A Third-butyl {(4 ^)-5-amino-4-[(third-butoxycarbonyl) amino] pentyl} aminomethyl 20 acid

boc 25 will dissolve 188 mg (0.55 mmol) of tertiary-butyl {(4-fluoro_5-azido-4-[(third-butoxycarbonyl) amino) pentyl After adding 20 mg palladium / activated carbon (10%), hydrogenated at room temperature and atmospheric pressure • 121 · 200526688 for 12 hours, the mixture was filtered through celite The residue was washed with ethanol, and the filtrate was concentrated to dryness under vacuum, and the product was reacted without further purification. Yield: 102 mg (59% of theory)

MS (ESI): m / z = 318 (M + H) +; 340 (M + Na) + Example 141A benzyl [(LS > 4-[(third-butoxycarbonyl) amino]] small ( Carboxymethyl) butyl] carbamate

HO

Η Ν 'boc

A preparation method similar to that of Example 137A was used, and 570 mg (1.56 mmol) of Y · [(benzyloxy) jiki] (third butoxycarbonyl) -L_bird was dissolved in 10 ml of tetrahydrofuran. Amino acid with 157 mg (1.56 mmol) of 4-methylmorpholine, 169 mg (1.56 mmol) of ethyl formate and 3.11 ml (3.11 mmol) of 1M dissolved in tetrahydrofuran Lithium aluminum hydride solution was prepared, and the product was purified by preparative RP-HPLC (mobile phase: water / acetonitrile gradient: 90 ·· 10-5:95). Yield: 170 mg (31% of theory) Lu LC-MS (Method 12): Rt = 1.88 minutes MS (El): m / z = 353 (M + H) +

Example 142 A tertiary butyl [(45 > 4.amino-5-hydroxypentyl] carbamate ΗΟ

• 122 · 25 200526688 169 mg (〇.48 mmol) of benzyl [⑽ 冰 [(third butyloxy) amino] -1_ (hydroxymethyl) butyl] aminocarboxylic acid The ester (Example 141 A) was dissolved in 50 ml of ethanol, and after adding 17 mg of palladium / activated carbon (10%), a hydrogenation reaction was performed at room temperature and atmospheric pressure for 4 hours. The mixture was filtered through celite, The residue was washed with ethanol, and the filtrate was concentrated to dryness under vacuum, and the product was reacted without further purification. Yield: 104 mg (99% of theory) MS (DCI): m / z = 219 (M + H) +

Example 143 A 10 Benzyl [(1H-H (third-butoxycarbonyl) amino] small (Cyclomethyl) propyl] amino group

boc

15 Using a preparation method similar to that of Example 137A, from 300 mg (0.85 mmol) of (2-2-{[(benzyloxy) hexyl] amino})-4-[(third-butoxy Carbonyl) amino] butane-carboxylic acid dissolved in 10 ml of tetrahydrofuran, 86 mg (0.85 mmol) of 4-amidomorpholine 92 mg (0.85 mmol) of ethyl pirate and 1.7 ml (1 · 70 mmol), # 2〇 was prepared by dissolving 1M lithium aluminum hydride solution in tetrahydrofuran, and the product was reacted without further purification. Yield: 229 mg (80% of theory) LC-MS (Method 12) : Rt = 1.83 minutes

MS (El): m / z = 339 (M + H) +; 239 (M-C5H802 + H) + Example 144A Third-butyl [(35) -3-amino-4-hydroxybutyl] amine Carbamate Hydrochloride-123- 25 200526688 xHCl

boc was prepared by a method similar to that of Example 142A, * 229 mg_mmol) of benzyl [⑽-3-[(Third-butoxysulfanyl) phenylmethyl] propyl] amine The acetic acid vinegar (example ⑷A) was dissolved in 5G acetone 4, and after adding 23 mg of rhenium / activated carbon (10%), the crude product was introduced into 1 ml of W iN hydrochloric acid and concentrated under vacuum, and then under high vacuum Dry to constant weight. Yield: 183 mg (90% of theory)

MS (ESI): m / z = 205 (M-HC1 + H) + Example 145A 15 Tertiary-butyl-Η (Third. Butane-amino) Aminobutyl) Carbamate

/ boc 20 was prepared using a garment similar to that of Example 137A, and was made of 300 mg (0_60 mmol) of 2,4 · [[second-butoxyquinyl] amino] butyric acid cyclohexyl ring Hexylamine hydrazone, in U) ml of tetrahydromethane, with 61 mg (060 mmol) of morphine, 65 mg (0.4 mmol) of formic acid and 12 ml (1 mmol) The 1M solution was prepared in tetrahydrofuran, and the product was reacted without further purification. Yield: 174 mg (95% of theory) MS (ESI): m / z = 305 (M + H) + _ 124 · 25 200526688

Example 146A (2S) -2,4-([(Second-butoxycarbonyl) amino] butylformate)

Using a preparation method similar to that of Example 138A, 250 mg (0.81 mmol) of tertiary-butyl {(3 homo_3 _ [(tertiary-butoxycarbonyl) amino) 4-hydroxybutyl } Carbamate (Example 145A), dissolved in 20 ml of digas methane, with 0 mg (0.997 mmol 10 mol) of sulfonylsulfenyl chloride and 0.23 ml (1.6 mmol) Triethylamine reaction, the product _ is no longer refined and reacted. Yield: 200 mg (64% of theory) MS (ESI): m / z = 383 (M + H) +; 400 (M + Na) +

15 Example 147A Third-butyl {(35) -4-azido-3-[(third-butoxycarbonyl) amino] butyl} carbamate

20 Using a preparation method similar to that of Example 139A, 200 mg (0.52 mmol) of (25> 2,4-di [(third-butoxycarbonyl) amino] butyl methanesulfonate (Example 46A ) Dissolved in 15 ml of dimethylamidamine and 34 mg (0.52 mmol) of 25 sodium deaerated, the product is no longer refined and reacted. Yield: 171 mg (99% of theory)- 125- 200526688

Example 148A Third-butyl {(35) -4-amino_3-[(third-butoxycarbonyl) amino] butyl} carbamate

Using a preparation method similar to that of Example 140A, 171 mg (0.52 mmol) of tertiary-butyl {(3Q-4-azido_3-[(tertiary-butoxycarbonyl) amino) ] Butyl} amino 10 formate (Example 147A) was dissolved in 10 ml of ethanol and prepared by adding 20 mg of palladium / living carbon (10%). The product was reacted without further purification. : 117 mg (75% of theory) MS (ESI): m / z = 304 (M + H) +; 326 (M + Na) +

15 Example 149A (35) -3-{[(Benzyloxy) amino] amino} · 6 [[(third-butoxycarbonyl) amino] hexylfluorenylcarbonate

Z 2 g (5.26 mmol) of (3 minutes 3-{[(phenylphenyloxy) carbonyl] amino group 6-[(third-butoxycarbonyl) -amino group] hexanoic acid and 0. 56 g (5.73 mmol) of triethylamine was dissolved in 30 ml of THF in an argon layer and cooled to 0 ° C. 0.59 g (5.73 mmol of 25 mol) of formic acid was added Methyl ester, stirred at 0 ° C for 3 hours, the mixture was filtered through diatomaceous earth, and the filtrate was used directly. -126- 200526688

Example 150A Benzyl [(1-Hydroxy · 4-[(Third-butoxycarbonyl) amino] -1- (2-Ethylethyl) butyl] carbamate boc ^

NH

OH

The filtrate of (35 > 3-{[(phenylphenyloxy) carbonyl] amino group) each [(third-butoxycarbonyl) -amino] hexylmethylcarbonate (Example 149A) was placed in C. Add dropwise into a suspension of 0.49 g (13.14 mmol) of sodium borohydride dissolved in 0.6 10 ml of water. Allow the mixture to slowly warm to room temperature and stir overnight. The reaction solution is in vacuum. It was concentrated, and the residue was mixed with ethyl acetate and water for operation. The organic layer was dried over magnesium sulfate, concentrated in vacuo and dried under high vacuum, and the product was reacted without further purification. Yield: 570 mg (30% theory Value) 15 LC-MS (Method 19): Rt = 2.09 minutes MS (El): m / z = 367 (M + H) +

Example 151A tert-butyl [(45) -4-amino · 6-hydroxyhexyl] carbamate

νη2 was prepared by a method similar to that of Example 142A, and was composed of 62.0 mg (169 mmol) of 25 phenylfluorenyl groups [⑽ · 4 _ [(second * butoxyquinyl) amino] small (2- Ethyl) butyl] carbamic acid vinegar (Example MOA), scale was added to 60 ml of ethanol, and the amount of activated carbon / activated carbon (10%) was added to react, and the product was reacted without further purification. 200526688 Yield: 370 mg (95% of theory) WNMR (400 MHz, D20): δ = 1.2-1.6 (m, 6H), 1.4 (s, 9H), 2.6-3.0 (m, 1Η), 3.0-3.2 (m, 2Η), 3 · 7-3 · 9 (m, 2Η), 4 · 6 (br.s, 1Η).

5 Example 152A Second-butyl {3-[(8 * ^, 11 & 14 $)-14-[(third-butoxy-terminated) amino] -8-({[(1 外 4- [(Third butoxycarbonyl) amino] small (hydroxymethyl) butyl] amino} carbonyl) -5,17-dihydroxy · 10,13-diketo-9,12-diaza Tricyclic [14.3 · 1 · 12,6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} carbamate

50 mg (0.076 mmol) of the compound from Example 29A and 22 mg (0.10 mmol) of tertiary-butyl [(4iS) _aspartyl-5_hydroxypentyl] aminocarboxylic acid Ester (Example 142A), dissolved in 10 ml of dimethylformamide in an argon layer, and then added 19 mg (0.10 mmol) of EDC at 200 = (ice bath) With 3 "mg (0.023 millimoles) of HOBt, let the mixture slowly warm to room temperature and let it stand for 12 hours at room temperature. The solution was concentrated in vacuo, the residue was stirred in human water, and the mixture was sucked. Residual solid was purified by Shijiao chromatography (mobile phase: Digasmethane / isopropanol). Yield: 30 mg (47% of theory) 25 LC-MS (Method 12): Rt = 2 .09 minutes MS (El): m / z = 857 (M + H) + 200526688

Example 153A Tertiary-butyl {3-[(8 & ll & 14S) _8-[(((2H-2,5_di [(Third-butoxycarbonyl) amine 5-yl) pentyl} Amine) carbonyl] -14-[(Third-butoxycarbonyl) amino] · 5,17-Diacryl-10,13-diketo-9,12-diazatricyclo [14 · 3 · 1 · 12,6] Smoke · 1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propyl} aminophosphonate 10

15 20

50 mg (0.076 mmol) of the compound from Example 29A and 32 mg (0.10 mmol) of tert-butylamino-4-[(third-butoxycarbonyl) amino] pentyl } Carbamate (Example 140A) was dissolved in 17 ml of dimethylformamide in an argon layer, and then 19 mg (〇1 () mmol) was added at 0 ° C (ice bath). , EDC and 3.1 mg (0.023 mmol) of HOBt, let the mixture slowly return>: ear) at room temperature and stirred at room temperature for 12 hours, the solution was concentrated in vacuo, the residue two, into water Residual solid under suction was filtered and purified by silica gel chromatography (mobile phase · two stirred alkane / isopropanol 30: 1 to 10: 1). Yiyijia Yield: 22 mg (30% of theory) HPLC (Method 12): Rt = 2.36 minutes MS (El): m / z = 956 (M + H) +

25 Example 154A -129- 200526688 (8aS, 1 1 $, 14α ^)-14-amino-11- (3-aminopropyl) -9-ethyl-5,17-dipyryl-10,13 -Diketo-9,12-diazatricyclo [l4 · 3 · l·l2,6] pinene-1 (20), 2 (21), 3,5,16,18-hexaene-8 -Carboxylic acid dihydrochloride 10

930 mg (0.91 mmol) of the compound obtained from Example 92A was suspended into 260 ml of glacial acetic acid / water / ethanol (4/1/1), and 270 mg of activated carbon / activated carbon (10%) was added. 15 The mixture was subjected to a hydrogenation reaction at room temperature and atmospheric pressure for 24 hours, filtered through celite to remove the catalyst, and then the filtrate was concentrated to dryness under vacuum and stirred while adding 36.5 ml of 0.1N The hydrochloric acid was concentrated in vacuo and the mixture was concentrated to dryness and dried to constant weight. Yield: 500 mg (98% of theory) LC-MS (Method 20): Rt = 2.45 minutes MS (ESI): m / z = 485 (M-2HC1 + H) + Φ 20

Example 155A (8 & 11 & 14) 14-[(Third-butoxycarbonyl) amino] _11- {3-[(Third-butoxyquinyl) -amino] propyl} -9- Ethyl-5,17-diademyl-10,13-di-yl-9,12-diazatricyclo [14 · 3 · 1 · 12,6] -pyrane-1 (20), 2 ( 21), 3,5,16,18-hexaene carboxylic acids-130-25 200526688

710 mg (1.27 mmol) of the compound from Example 154A was dissolved in 15 ml of water and 6.5 ml (6.5 mmol) of a 1N sodium hydroxide solution, and stirred at room temperature for 10 minutes while adding to dissolve in 5.5 ml of methanol, 834 mg (3.82 mmol) of di-tri-butyl dicarbonate, after one hour, after the reaction is completed (detected by analytical RP-HPLC, mobile phase: acetonitrile / water), Add 0.1N hydrochloric acid dropwise to adjust the pH of the solution to 3, extract three times with each 20 ml of ethyl acetate, dry over sodium sulfate, and concentrate to constant weight under vacuum. 15 Yield: 770 mg (88 ° /. Theoretical value) HPLC (Method 19): Rt = 2.16 minutes MS (ESI): m / z = 685 (M + H) + Examples listed in the table below 156A to 162A The compound was prepared from the appropriate starting compound using the method detailed in Example® 20 137A: -131- 200526688 Example Number Structure Starting Compound Analysis Data 156A ^ boc HN 3-{[(Benzyloxy) -Carbonyl] amino}-, (Third-butoxy-Epiyl) alanine LC-MS (Method 12): Rt = 1.79 min MS (El): m / z = 685 (M + H) + 157 A / boc HN ΛΓ5-[(phenylphenoxy) -carbonyl] -iV2- (third-butoxycarbonyl) 4- ornithine LC-MS (Method 12): Rt = 1.84 minutes MS (El): m / z = 353 (M + H) + 158A / boc HN H0 \ ^ s ^^ n / z H (2 ^)-4-{[(benzyloxy) -carbonyl] amino} -2- ( Tertiary-butoxy-alkyl) -amine] Butane-carboxylic acid LC-MS (Method 12): Rt = 1.83 min MS (El): m / z = 339 (M + H) + 159A / boc HN z, n ″ H #-{[(Benzyloxy) -carbonyl] -iV2- (Third-butoxyepiyl) · Ί-Iminoacid LC-MS (Method 12): Rt = 1.94 minutes MS (El): m / z = 367 (M + H) + 160A / boc HN boc, NJ H iV2, je-di (third-butoxycarbonyl)- 1-lysine MS (El): m / z = 333 (M + H) + 163A / hoc HN 0 0 Example 161A MS (ESI): m / z = 369 (M + H) +

-132- 200526688 Example Number Structure Initial Compound Analysis Data 164A HN-bOC H3C, S〆Η Example 160A MS (ESI): m / z = 428 (M + NH4) + Examples 165A and 165A listed in the table below The compound of 166A was prepared from the appropriate starting compound using the method detailed in Example 139A: Example number Structure starting compound analysis data 165 A ^ boc Τη Example 163A MS (ESI): m / z = 338 (M + Na) + 166 A / b0c Example 164A MS (ESI): m / z = b〇C, Nj H 358 (M + H) +

The compounds of Examples 167A and 168A listed in the table below were prepared from the appropriate starting compounds using the method detailed in Example 140A: -133- 200526688 Example Number Structure Starting Compound Analysis Data 167 A / boc HN H2N ^ A ^ N ^ b〇c Example 165 A MS (ESI): m / z = 290 (M + H) + 168 A / boc HN b〇c, NJ H Example 166A MS (ESI): m / z = 332 (M + H) +

The compounds of Examples 169A and 173A listed in the table below were prepared from the appropriate starting compounds using the method detailed in Example 142A: Example number Structure starting compound analysis data 169 A / boc HN h〇v1 ^ nh2 Example 156A MS (DCI): m / z = 191 (M + H) + 170 A / boc HN Example 157A MS (DCI): m / z = 219 (M + H) + 171A / boc HN HO. ^ Nh2 Example 158A MS (DCI): m / z = 205 (M + H) + -134- 200526688

The compounds of Examples P4A to 185A listed in the table below were prepared from the appropriate starting compounds using the method detailed in Example 152A: Example No. Precursor Structure Analysis Data for Examples 174 A 29A and 169A, IJIH boc LC -MS (Method 17): Rt = 2.22 minutes MS (El): m / z = 829 (M + H) + 175 A 29A and 170A H boc 0 \ 0 boc LC-MS (Method 17): Rt = 2.21 minutes MS (El): m / z = 857 (M + H) + 176A 29A and 171A-«WA ^ r- \ boc ^ NH boc LC-MS (Method 12): Rt = 1.99 minutes MS (El ): m / z = 843 (M + H) + -135- 200526688 Instance number Example precursor structure analysis data 177 A 29A and 172A HQ—QH \ boc LC-MS (Method 17) · Rt = 2.25 minutes MS (El): m / z = 871 (M + H) + 178 A 29A and 144A wide boc 〇 = η. '\ boc LC-MS (Method 12): Rt = 2.04 minutes MS (El): m / z = 843 (M + H) + 179 A 29A and 173A h〇 ^ 0 ^ 0 ~ 〇h twc LC-MS ( Method 12): Rt = 2.03 minutes MS (El): m / z = 829 (M + H) + 180 A 29A and 148A ho ^ _Q-oh ^ boc, NH boc LC-MS (Method 19): Rt = 2.50 MS (El): m / z = 942 (M + H) + 181A 29A and 167A \ boc LC-MS (Method 12): Rt = 2.37 MS (El): m / z = 928 (M + H) +

-136- 200526688 Example No. Example of the precursor structure analysis data 182A 29A and 168A \ Z boc LC-MS (Method 12): Rt = 2.59 minutes MS (El): m / z = 970 (M + H) + 183A 155A With 171A HO—, \ 〇Η3 boc LC-MS (Method 12): Rt = 2.09 minutes MS (El): m / z = 871 (M + H) + 184A 29A and 151A ^ NH ^ NH boc 1) 00 LC -MS (Method 17): Rt = 2.25 minutes MS (El): m / z = 871 (M + H) + 185A 29A and 191A boc 〇1 0, 0H 乂 NH boc LC-MS (Method 19): Rt = 2.24 minutes MS (El): m / z = 905 (M + H) +

The compound of Example 186A listed in the following table was prepared from the appropriate starting compound using the method detailed in Example 120A: -137- 200526688 Example No. Example Precursor Structure Analysis Data 186A 185A H0 ~ O ^ O ~ 0H ^ ΝΗ boc 2 2 A OH LC-MS (Method 19): Rt = 1.71 minutes MS (El): m / z = 771 (M + H) + The compounds listed in Examples 187A to 191A in the table below are Prepared from the appropriate starting compound using the method detailed above: Reference Example Structure Analysis Data Prepared by Example Number 187A 137A / boc HN MS (ESI): m / z = 319 (M + H) + 188A 138A up Example 187A HN-b〇C § Η〆々 Η〆々 MS (DCI): m / z = 414 (m + nh4) + 189A 139A Example 188A / boc ΗN MS (DCI): m / z = 361 ( m + nh4) + 190A 140A Starting example 189A / boc, Η H2N ^^^ \ / N, b0C MS (ESI): m / z = 318 (M + H) + 191A 15A Starting example 150A ΗΝ LC-MS (Method 19): Rt = 1.06 minutes MS (El): m / z = 267 (M-HC1 + H) + 200526688 The compound of Example 192A listed in the table below was prepared using the method detailed in Example 152A, as appropriate. Prepared by: Code analysis of the precursor structure data 192A 29A and 190 A r boc LC-MS (Method 17): Rt = 2.58 minutes MS (El): m / z = 956 (M + H) + 5 Examples can be synthesized starting from partially protected fenofomycin derivatives (eg, Example 29 A).

139- 200526688 Example 1 (8 \ 11 & 14S) -14-amino-AK2-aminoethyl) -11-[(2i?)-3-amino-2-hydroxypropyl] -5,17 -Dihydroxy-9-methyl · 10,13-diketo-9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene-8-amidamine trihydrochloride

10 15 20 1 ml of 4N hydrogen chloride / dioxane solution was cooled on an ice bath, and stirred, 15 mg (0.02 mmol) of the compound obtained from Example 68A was added. After a short time, the ice bath was removed and the The mixture was stirred at room temperature for 1 hour and concentrated to dryness under vacuum to give the product. Yield: 11 mg (94% of theory) LC-MS (Method 17): Rt = 0.24 minutes MS (El): m / z = 528 (M-3HC1 + H) + iH-NMR (400MHz, D20): δ = 1.97 (me, 2H), 2.85 (me, 1H), 2.90 (s, 3H), 2.96-3.32 (m, 6H), 3.41-3.60 (m, 3H), 3.65 (mc, 1H), 3.73 (mc, 1H), 3,94 (mc, 1H), 4.42 (mc, 1H), 5.08 (mc, 1H), 5.62 (mc, 1H), 6.88 (mc, 2H), 6.95 ( s, 1H), 7.04 (s, 1H), 7.40 (mc, 1H), 7.48 (mc, 1H). Example 2 (8 & 11 & 145) -14-amino-11-[(27?)-3-amino-2-hydroxypropyl] -5,17-dihydroxy-9-methyl-10,13 -Diketohexahydropyridin-4-yl-9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinane · 1 (20), 2 (21), 3,5,16 , 18-hexaene-8-formamidine trihydrochloride 200526688

5 10 Prepared according to the method of Example 1 from 14 mg (0.02 mmol) of the compound from Example 69A and 1 ml of a 4N hydrogenated hydrogen / dioxane solution. Yield: 10 mg (92% of theory) LC-MS (Method 17): Rt = 0.28 minutes MS (El): m / z = 568 (M-3HC1 + H) + 15 Example 3 (8 & 11 & 14 14-aminoaminoethyl) -11- (3-aminopropyl) -5,17-dihydroxy-9-methyl-10,13-diketo-9,12-diaza Tricyclo [14 · 3 · 1 · 12,6] Heptane-1 (20), 2 (21), 3,5,16,18-hexaene-8-methaneamine trihydrochloride

1 ml of ice-cold 4N hydrogenated hydrogen / dioxane solution was poured into 4 mg (0.005 mmol) of the compound obtained from Example 70A, and stirred for 1 hour, during which the temperature gradually rose to 141-200526688 to The mixture was concentrated under vacuum to constant weight at room temperature. Yield: 3 mg (98% of theory) LC-MS (Method 17): Rt = 0.28 minutes MS (El): m / z = 512 (M-3HC1 + H) + Example 4 (8 &115; 14 ^ ) -14-Amino-11- (3-aminopropyl) -5,17 · dihydroxy-10,13-diketo-AK hexahydropyridine-small fluorenyl) -9,12-diaza Heterotricyclo [14 · 3 · 1 · 12,6] Heptane-1 (20), 2 (21), 3,5,16,18_hexaene-8-methaneamine trihydrochloride

νη2 was prepared according to a preparation similar to that of Example 1 from 8 mg (0.01 mmol) of the compound obtained from Example 72A and 1 ml of a 4N hydrogenated gas / dioxane solution. Yield: 5 mg (73% of theory) 20 LC-MS (Method 12): Rt = 0.22 minutes MS (El): m / z = 838 (M-3HC1 + H) + Example 5 (8 & 115 ^ 145 ) -14-Amino-11- (3-aminopropyl) -5,17 · dihydroxy-10,13-diketo 25-pentahydropyridin-4-yl-9,12-diaza Tricyclo [14.3.1.12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-8-fluorenamine trihydrochloride-142- 200526688

According to a preparation method similar to that in Example 1, 11 mg (0.01 mmol) of the compound obtained from Example 73A and 1 ml of a 4N hydrochloric acid / dioxane solution were prepared. Yield: 8.4 mg (99% of theory) LC-MS (Method 19): Rt = 0.24 minutes MS (El): m / z = 538 (M-3HC1 + H) + 15 Example 6 (8 * S, 11 & 14S) -14-aminoaminoethylethyl) -11- (3-aminopropyl) -5,17-dihydroxy-10,13-diketo-9,12-diazatricyclo [14.3 .1.12,6] Heptane-1 (20), 2 (21), 3,5,16,18-hexaene-8-methylamine trihydrochloride

36.8 mg (0.05 mmol) of the compound from Example 74A was added to 2 ml of an ice-cold 4N hydrogenated hydrogen / dioxane solution, stirred at room temperature for 1 hour, and then -143- 200526688 allowed the mixture under vacuum Concentrate to dryness and place in dry JIEL (using phosphorus pentoxide as desiccant) to dry to weight. Yield: 29 mg (98% of theory) LC-MS (Method 20): Rt = 2.01 minutes MS (El): m / z = 499 (M-3HC1 + H) + h-NMR (400MHz, D20): δ = 1.52-1.92 (m, 4H), 2.85 (me, 1H), 2.93 (mc, 2H), 3.03 (mc, 1H), 3.11 (mc, 2H), 3.23 (mc, 1H), 3.42-3.62 (m, 3H), 4.42 (mc, 1H), 4.7 (m, 1H, in D20), 4.77 (mc, 1H), 6.88 (mc, 2H), 6.97 (s, 1H), 7.23 (s, 1H), 7.34 (mc, 1H), 7.42 (mc, 1H). 10 Example 7 (8 & 11 & 14S) -14-amino-exhaust (3-amino-2-hydroxypropyl) -11- (3-aminopropyl) -5,17-dihydroxy-10, 13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinane-1 (20), 2 (21), 3,5,16,18-hexaene_8-formamidine Amine trihydrochloride

15 20 According to a preparation similar to that in Example 1, 10 mg (0.01 mmol) of the compound obtained from Example 75A and 1.05 ml of a 4N hydrogen chloride / dioxane solution were prepared. Yield: 8 mg (quantitative) LC-MS (Method 12): Rt = 0.23 minutes MS (El): m / z = 528 (M-3HC1 + H) + -144- 25 200526688 Example 8 (8 夂 11 \ 14S > 14-amino-AU1-bis (3-aminopropyl) -5,17-dihydroxy-10,13-diketo-9,12_diazatricyclo [14 · 3 · 1 · 12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-8-formamidine trihydrochloride

10 According to a preparation method similar to that in Example 1, 7.5 mg (0.01 mmol) of the compound obtained from Example 76A and 1 ml of a 4N hydrogenated hydrogen / dioxane solution were used. Yield: 5.8 mg (quantitative) 15 20 LOMS (Method 12): Rt = 0.22 minutes MS (El): m / z = 512 (M-3HC1 + H). Example 9 (8 & 11 & 145) _14_Amino-11- (3-aminopropyl) · 5,17-dihydroxy-Λ42- (methylamine · ethyl) ethyl] -10,13-diketo-9,12-diaza Heterotricyclo [14.3.1.12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-8-methanamine trihydrochloride

-145- 200526688 According to a preparation method similar to that of Example 1, 6 mg (0.01 mmol) of the compound obtained from Example 77A and 1 ml of a 4N solution of a gaseous thallium / dioxane were prepared. Yield · 5 mg (quantitative) LC-MS (Method 12): Rt = 0.22 minutes 5 MS (El): m / z = 512 (M-3HC1 + H) + Example 10 (8 & 11 & 14) -14-amino-11-[(2 and) -3-amino-2-hydroxypropyl]-, (3-amino-2-hydroxypropyl) -5,17-dihydroxy-10,13 -Diketo-9,12-diazatricyclo [14.3.1.12,6] fluorene-10 alkane-1 (20), 2 (21), 3,5,16,18-hexaene-8-formamidine Amine trihydrochloride

According to a preparation method similar to that of Example 1, 50 mg (0.057 mmol) of the compound obtained from Example 80A and 1 ml of a 4N hydrogenated hydrogen / dioxane solution were prepared. 20 Yield: 38 mg (99% of theory) LC-MS (Method 17): Rt = 0.22 minutes MS (El): m / z = 545 (M-3HC1 + H) + Example 11 25 (8 \ 11 & amp 145) -14-amino-ΛΚ2-aminoethyl) -11-[(2 and) -3-amino-2-hydroxypropyl] -5,17-dihydroxy-10,13-dione -9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinene-1 (20), 2 (21), 3,5,16,18-hexaene-8-fluorene Amine Trihydrochloride-146- 200526688

NH2 Put 4.1 mg (0.005 mol) of the compound obtained in Example 81A into an ice-cold 4N hydrogenated hydrogen / dioxolane solution, and stir at room temperature for 1 liter and 10 for removal. The solvent was then placed in a drying dish (with a helmet of pentoxide, and under constant weight under vacuum to obtain a colorless residue. One * is a desiccant) dried to the yield: 3.5 mg (99% of the theoretical value) ) LC-MS (Method 12): Rt = 〇.22 minutes MS (El): m / z = 515 (M-3HC1 + h) + 15 Example 12 20 Diketyl · ΛΚ2 · Hexane_2_yl Ethyl); ^ diaza -_ = 9 · methyl_1〇, n

3HBr dissolved 46 mg (0.04 mmol) of the compound from Example 82A to

-147- 25 200526688 liters of a 33% strength hydrobromic acid solution in acetic acid and stirred at room temperature for 45 minutes, the solvent was removed under vacuum, the crude product was stirred into methanol, and the solvent was removed again under vacuum. Yield: 33 mg (98% of theory) LC-MS (Method 12): Rt = 0.27 minutes 5 MS (El): m / z = 581 (M-3HBr + H) + ^ -NMR (400MHz, D20) : δ = 1.05-1_95 (m, 12H), 2.75-3.45 (m, 13H)? 3.55 (mc? 1H), 4.45 (mC5 1H)? 4.92 (mc? 1H)? 5.60 (mc, 1H ), 6.88 (mc, 2H), 6.95 (mc, 1H). 7.04 (mc, 1H), 7.38 (mc, 1H), 7.48 (mc, 1H). 10 Example 13 (8 & 11 * S, 14S) -14-amino-11- (3-aminopropyl) -5,17-dihydroxy-9-methyl-10,13-diketo-Λκhexa Hydropyridin-2-ylmethyl) -9,12-diazatricyclo [14.3.1.12,6] pinene-1 (20), 2 (21), 3,5,16,18-hexaene_ 8-formamidine tribromide

20 According to a preparation similar to that in Example 14, 48 mg (0.043 mmol) of the compound obtained from Example 83A and 1 ml of a 33% strength hydrobromic acid solution in acetic acid were used. Yield: 30 mg (86% of theory) 25 LC-MS (Method 12): Rt = 0.27 minutes MS (El): m / z-= 567 (M-3HBr + H) + -148- 200526688 ^ -NMR (400MHz? D20): δ = 1.35-1.95 (m? 10H)? 2.86 (s? 3H)? 2.8 ^ 3.5 (m, 10H), 3.55 (mc, 1H), 4.47 (mc, 1H), 4.90 (mc, 1H), 5.65 (mc, 1H), 6.88 (mc, 2H), 6.94 (s, 1H), 7.04 (s, 1H), 7.40 (mc, 1H), 7.48 (mc, 1H). Example 14 (8 & 11 and 14S) -14-amino-Λκ2-aminoethyl) -11- (3-aminopropyl) -5,17-dihydroxy-10,13-diketo-9 , 12-Diazatricyclo [14.3.1.12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-8-methanamine

nh2 10 15 55 mg (0.09 mmol) of the compound from Example 6 was dissolved in 1 ml of water and 0.1 ml of diethylamine and converted to the free base using preparative HPLC (Method 21). 20 Yield: 28 mg (62% of theory) LC-MS (Method 20): Rt = 2.01 minutes MS (El): m / z = 499 (M + H) + NMR (400MHz, D20): δ = 1.52 -1.92 (m, 4H), 2.85 (mc, 1H), 2.93 (mc, 2H), 3.03 (mc, 1H), 3.11 (mc, 2H), 3.23 (mc, 1H), 3.42-3.62 (m, 25 3H), 4.42 (mc, 1H), 4.7 (m, 1H), 4.77 (mc, 1H), 6.88 (mc, 2H), 6.97 (s, 1H), 7.23 (s, 1H), 7.34 (mc , 1H), 7.42 (mc, 1H). -149- 200526688 Example 15 (8 & 11 \ 14 magic-14-amino-#-(2-aminoethyl) -11- (3-aminopropyl) -5,17-dihydroxy-10, 13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinene-1 (20), 2 (21), 3,5,16,18-hexaene-8-formamidine Amine tris (trifluoroacetate)

14 mg (0.03 mmol) of the compound from Example 14 was dissolved in 0.5 ml of dioxane, mixed with 11 μl (0.14 mmol) of trifluoroacetic acid, and stirred at room temperature for 15 and 20 After 15 minutes, the solvent was removed under vacuum, the crude product was stirred into dioxane, and the solvent was removed under vacuum. Yield: 18 mg (62% of theory) LC-MS (Method 20): Rt = 1.89 minutes MS (El): m / z = 499 (M-3TFA + H) + 20 Example 16 (8 & 11 \ 14β -14-Amino-AU1-bis (2-aminoethyl) -5,17-dihydroxy-9-fluorenyl-10,13-diketo-9,12-diazatricyclo [14.3. 1.12,6] Teriyaki-1 (20), 2 (21), 3,5,16,18-hexaene-8-methylamine tris (trifluoroacetate) -150- 200526688

According to a preparation method similar to that of Example 3, 28 mg (0.047 mmol) of the compound obtained from Example 108A and 2 ml of a 4N dioxane / hydrogenated hydrogen gas solution were prepared. The crude 10 products were purified by HPLC (KromasillOOCIS , Mobile phase: acetonitrile 02% trifluoroacetic acid aqueous solution 1: 3). Yield: 12 mg (30% of theory) LC-MS (Method 20): Rt = 1.92 minutes MS (El): m / z = 499 (M-3TFA + H) + 15 b-NMR (400 MHz, D20 ): δ = 2.13 (me, 1H), 2.27 (me, 1H), 3.01 (s, 3H), 3.1-3.33 (m, 6H), 3.43 (mc, 1H), 3.6-3.75 (m , 3H), 4.58 (mc. 1H), 5.13 (mc, 1H), 5.78 (mc, 1H), 7.03 (mc, 2H), 7.08 (s, 1H), 7.16 (s, 1H ), 7.55 (d, 1H), 7.63 (d, 1H). 20 The compounds of Examples Π to 28 listed in the table below were prepared from appropriate starting compounds according to methods similar to those detailed above: -151- 200526688 Example Number Structure Reference Example Analysis Data 17 J NH, HNH X3HCI 3 Starting Example 116A LC-MS (Method 20): Rt = 2.01 minutes MS (El): m / z = 553 (M-3HC_ + 18 丄 NH 1 χ4Ηα HjN〆3 Starting Example 120A LC-MS (Method 20》 Rt = 1.02 minutes MS (El): m / z = 554 (M-4HC1 + H) + 19 Η〇 ^}-^^ 〇Η ^ yVvt ^ J X3HCI H ^ N evening 3 Starting example 118A LC -MS (Method 20): Rt = 2.20 minutes MS (El): m / z = 539 (M-3HC1 + H) + 20 h / — B 3 Starting example 119A LC-MS (Method 20): Rt = 2.03 MS (El): m / z = 598 (M-3HC1 + H) + 21 η〇 ~ 〇 ~ ^ 0 ^ οη Yiyi ^ 〇nh: " 'J X3HQ 3 Starting Example 112A LC-MS (Method 20): Rt = 2.16 minutes MS (El): m / z = 555 (M-3HC1 + H) + 22 〇 / CH, J x3Ha H / i 3 Starting example: 113A I LC-MS (Method 20) · Rt = 2.11 minutes MS (El): m / z = 553 (M-3HC1 + H) +

-152- 200526688 Example Number Structure Reference Example Analysis Data 23

16 Initial Example 110A LC-MS (Method 20): Rt 2.19 minutes MS (El): m / z = 555 (M-3TFA + H) + H-NMR (400MHz, D20): 6 = L4 (mc? 2H ), 1.5-1.7 (mc? 7H)? 1.78 (mC5 1H), 2.7- 3.35 (m, 13H)? 3.55 (m (1H), 4.43 (mc, 1H), 4.88 (mc. 1H), 5.6 (mc , 1H), 6.88 (mc, 2H), 6.97 (s, 1H), 7.05 (s, 1H), 7.41 (d, 1H), 7.48 (d, 1H) ·

twenty four

16 Initial Example 111A LC-MS (Method 20): Rt 2.18 minutes MS (El): m / z = 557 (M-3TFA + H) + 1H-NMR (400MHz5 D20): 6 = 1.4 (mc? Hi) , 1.5-1.7 (mC5 3H), 1.78 (mc, 1H), 2.75- 3.45 (m5 12H), 3.55 (mc, 1H), 3.95 (mc, 1H), 4.43 (mc. 1H), 4.88 (mc, 1H ), 5.65 (mc? 1H), 6.88 (mc, 2H), 6.96 (s, 1H), 7.05 (s, 1H), 7.42 (d, 1H), 7.48 (d, 1H) ·

-153- 200526688 Example No. Structure Preparation Reference Example Analysis Data 25 AvCVk 0; k. 1 X3TFA 16 Start example 109 A LC-MS (Method 20): Rt = 2.13 minutes MS (El): m / z = 527 (M-3TFA + H) + 1H-NMR (400MHz5 D20): 6 = 1.27 ( mC5 2H)? 1.4-1.6 (mC5 3H)? 1.7 (mc? 1H)? 2.7- 3.05 (m, 9H), 3.17 (mc, 1H), 3.3-3.5 (mc? 3H), 4.30 (mc. 1H) , 4.75 (mc, 1H), 5.52 (mc, 1H), 6.67 (m, 2H), 6.83 (s, 1H), 6.92 (s, 1H), 7.28 (d, 1H), 7.37 (d, 1H) ) 26 hc> -O ~ ^ C ^ 0h 16 LC-MS (Method 20): Rt = 2.09 minutes. 1 X3TFA Starting Example 114A MS (El): m / z = 527 (M-3TFA + H) + ^ -NMR (400 MHz, D20): δ = 1.45-1.85 (mC5 8H), 2.8-3.07 (m, 6H), 3.15 (mc, 2H), 3.28 (mc, 1H), 3.55 (mc, 1H ), 4.42 (mc, 1H), 4.7-4.8 (m, 2H D20 signal), 6.89 (mc, 2H), 6.96 (s, 1H), 7.25 (s, 1H), 7.35 (d, 1H), 7.43 (d, 1H) · 27 3 [LC-MS (Method 20): Rt = 2.16 minutes. χ3Η〇ΝΗϊ Starting Example 115A MS (El): m / z = 541 (M-3HC_ + 28 3 LC-MS ( Method 20): Rt = 2.19min J x3HO H2N Starting example 121A clockMS (El): m / z = 553 (M-3HC1 + H) +

-154- 200526688 Example 29 (8S, 11 & 145 > 14-amino U1-bis (3-aminopropyl) -5,17-dihydroxy-10 13_-keto-9,12-diaza Tricyclo [M ^ U2,6] Pentane-1 (20), 2 (21), 3,5,16,18_hexamine • 8-formamidine tris (trifluoroacetate)

The conversion of 16.3 mg (0.03 mmol) of the compound from Example 8 into tris (trifluoroacetate) was achieved by preparative HPLC (Kromasill 00C18, mobile phase: acetonitrile / 0.2% trifluoroacetic acid in water 1: 3). 15 Yield: 10.4 mg (45 ° /. Theoretical value) LC-MS (Method 20): Rt = L93 minutes MS (El): m / z = 513 (M-3TFA + H) + iH_NMR (400 MHz, D20 ): δ = 1.5-1.9 (mc, 6H), 2.7-3.1 (m, 6H), 3.15-3.26 (m, 2H), 3.35 (mc, 1H), 3.55 (mc, 1H), 4.42 (me, ih ), · 20 4.7-4.8 (m, 2H D20 signal), 6.89 (mc, 2H), 6.96 (s, 1H), 7.25 (s, 1H), 7.35 (d, 1H), 7.43 (d, 1H). The compounds of Examples 30 and 31 listed in the table below were prepared from appropriate starting compounds according to methods similar to those detailed above: -155- 200526688 Example Number Structure Reference Example Analytical Data 30 H, VvVr ^? 29 Start example 22 LC-MS (Method 20): Rt = 2.25 minutes MS (El): m / z = 553 (M-3TFA + H) + h2n '' x3TFA ^ -NMR (400 MHz, D20): δ = 1.6-1.75 (m, 4H), 1.8-2.1 (m, 3H), 2.15 (mc, 1H), 2.88 (s, 3H), 2.95 (mc, 2H), 3.07 (mc, 2H), 3.2- 3.35 (m, 3H), 3.43-3.6 (m? 3H), 3.72 (mc, 1H), 4.45 (mc, 1H), 4.92 (mc, 1H), 5.65 (mc, 1H), 6.88 (mc, 2H) , 6.96 (s? 1H), 7.04 (s, 1H), 7.42 (d · 1H), 7.49 (d, 1H) · 31 Η-ρ-〇- 29 Starting Example 21 LC-MS (Method 20) ·· Rt = 2,35 minutes MS (El): m / z = 555 (M-3TFA + H) + y X3TFA Η, ^ -NMR (400 MHz, DaO): δ = 0.94 (s, 6H). 1.6-1.75 (m, 3H), 1.85 (mc, 1H), 2.75 (mc, 2H), 2.9 (s, 3H), 2.93 (mc, 2H), 3.0-3.17 (m, 3H), 3.2-3.35 (m , 2H), 3.56 (mc, 1H), 4.45 (mc, 1H), 4.92 (mc, 1H), 5.67 (mc, 1H), 6.9 (mc, 2H), 6.96 (s, 1H), 7.05 (s, 1H), 7.42 (d, 1H), 7.49 (d, 1H).

Example 32 (8 \ 11 and 14S) -14-amino · ΛM > aminoethyl) -11- (3-aminopropyl) -9-ethyl 5 -5,17-dihydroxy-10,13 -Diketo-9,12-diazatricyclo [14 · 3 · 1 · 12,6] Sauna-1 (20), 2 (21), 3,5,16,18-hexaene-8 -Amine Tris (trifluoroacetate) -156- 200526688 10 15 20

^^ 47 / ί / ίϊ ^ ί (ίι ^ 1 5 At room temperature, mix 1 mg of activated carbon (10%) in milligrams, and allow the hydrogenation reaction to proceed for one day. After removing the catalyst through a thin film ^, work The filtrate was concentrated, and the crude product was purified by Ban > 1 (Kromasin〇〇ci8, color mobile phase: acetonitrile / 0.2% trifluoroacetic acid aqueous solution 1: 3). Yield: 6 mg (39% of theoretical value) ) LC-MS (Method 20): Rt = 2.0 minutes MS (El): m / z = 527 (M-3TFA + H) + The compounds of Examples 33 and 34 listed in the table below are similar to those detailed in The method above was prepared from a suitable starting compound: Example structure Preparation of reference example Analytical data 33 ho '^ D ~ hC ^ 〇h Η〆 * 4Ηα 3 Starting example 122 A LC-MS (Method 20): Rt = 0.56 minutes MS (El): m / z = 528 (M-4HC_ + 34 Η-ρ-Ο-^ — 3 Starting example 123A LC-MS (Method 20): Rt = 2.14 minutes MS (El): m / z = 511 (M-3HC1 + H) +

-157- 200526688 The compounds of Examples 35 to 41 listed in the table below were prepared according to a method similar to that of Example 6 or 15 from the appropriate starting compounds:

Example number Analytical data of the precursor of the structure of the structure 35 DH 3Ηα 129Α LC-MS (Method 20): Rt = 2.08 minutes MS (ESI): m / z = 541 (M-3HC1 + H) + ^ νη2 ^ -NMR (400 MHz, D20): δ = 0.94 (s, 6H) · 1.5-1 · 85 (m, 4H), 2.74 (s, 2H), 2.8-3.05 (m, 5H), 3.1-3.25 (m , 2H), 3.52 (mc, 1H), 4.41 (mc, 1H), 4.6 (m, 1H, under D2O), 4.77 (mc, 1H), 6.83-6.9 (m, 2H), 6.96 (s, 1H) , 7.23 (s, 1H), 7.33 (d, 1H), 7.4 (d, 1H). 36 private Λ1 V; Η 3TFA 128Α LC-MS (Method 20): Rt = 2.15 minutes MS (ESI): m / z = 567 (M-3TFA + H) + 37 \ c) Η Γ \ ΝΗ 135Α LC-MS (Method 20): Rt = 1.31 minutes MS (El): m / z = 542 (M-4HC1 + H) +, νη2 χ4Ηα νη2 • 158- 200526688 Example number analysis data of the precursor number structure 38 3xHCJ 130A LC-MS (Method 20): Rt = 2.26 minutes MS (El): m / z = 567 (M-3HC1 + H) + 39 C ^ ° H AsYVr \. \ 〇H 4xHQ NHj 131A LC-MS (Method 13): Rt = 3.79 minutes MS (El): m / z = 568 (M-4HC1 + H) — 40 3XHD ^ NH2 kJ * H 132A LC-MS (Method 20 ): Rt = 2.00 minutes MS (El): m / z = 552 (M-4HC1 + H). 41 x5HQ 134A LC-MS (Method 20): Rt = 1.75 minutes MS (El): m / z = 585 ( M-5HC1 + H) + ^ -NMR (400 MHz, D20): δ = L5-1.7 (m, 8H). 2.70-3.65 (m, 20H), 4.43 (m, 1H), 6.89 (d, 2H) , 6.97 (s, 1H), 7.26 (s, 1H), 7.36 (d, 1H), 7.43 (d, 1H), 7.83 (s, 1H).

The compounds of Example 42 listed in the table below were prepared according to methods similar to those detailed in Example 32 159-200526688 10

Example 43 (8S, 11S, 14S) 14-Amino-11- (3-aminopropyl) san {2_ [bis (2-aminoethyl) amino] 5 ethyl} -5,17-di Hydroxyl · 10,13-diketo-9,12-diazatricyclo [143112,6] pinene-1 (20), 2 (21), 3,5,16,18-hexaene_8 _ Formamidine tetrahydrochloride

9 mg (0.01 mmol) of the compound from Example 136A was suspended in 8 ml of 15 glacial acetic acid / ethanol / water (4/1/1), and 5 mg of palladium / activated carbon (10%) was added, The hydrogenation reaction was carried out at atmospheric pressure overnight. The mixture was cut into red thieves, the mother liquor was concentrated under vacuum, and the residue was killed, and then dried under vacuum to obtain the desired title compound. y Yield: 6.6 mg (100% of theory) 20 LOMS (Method 20): Rt = 1.36 minutes MS (El): m / z = 585 (M-4HC1 + H) + -160 · 200526688 Example 44 ( 8 & 11 * S, 14S) -14-amino-Aq (15 > 4-amino-1- (hydroxyfluorenyl) butyl) -11- (3-aminopropyl) -5,17-di Hydroxy-10,13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinane 5 -1 (20), 2 (21), 3,5,16,18_hexaene -8-formamidine tris (trifluoroacetate)

10 68 mg (0.079 mmol) of tert-butyl {3-[(8 & 11S, 14S) -14-[(third-butoxycarbonyl) amino] -8-({[( lio-4-[(third-butoxycarbonyl) amino] small (hydroxy 15-methyl) butyl] amino} carbonyl) -5,17-dihydroxy-10,13-diketo- 9,12-Diazatricyclo [14.3.1.12,6] Pentane-1 (20), 2 (21), 3,5,16,18-hexaene-11-yl] propylbranylmethyl The acid ester (Example 152A) was placed under ice cooling in 0.7 ml of a 4N hydrochloric acid / dioxane solution. After removing the ice bath, the mixture was stirred at room temperature for 2 hours. The solvent was evaporated under vacuum and remained The solid was converted to tris (trifluoroacetate) using preparative HPLC 20 (Reprosil ODS-A, mobile phase: acetamidine / 0.2% trifluoroacetic acid aqueous solution 5:95-95: 5). Yield: 3.4 Milligram (5% of theory) LC-MS (Method 20): Rt = L95 minutes MS (El): m / z = 557 (M-3TFA + H) + Example 45 -161- 25 200526688 (8) 11 乂 146 ) -14-Amino group] 丨 -Aminoaminopropyl) K (25 > 2,5-diaminopentyl] -5,17-dihydroxy] 〇, 13_diketo-9,12-di Azatricyclo [14.3.1.12,6] Pentane-1 (20), 2 (21), 3,5,16,18-Hexadecane Tetrahydrochloride

10 Add 95 mg (0.10 mmol) of tertiary-butyl {3-[(8 & 115,14) each [({(25) -2,5-di [(third-butoxycarbonyl) Amine] pentyl} amino) chino] -14-[(third-butoxycarbonyl) amino] -5,17-dihydroxy-1 10,13-diketo · 9,12-di Azatricyclo [14 · 31 ”pinane-1 (2〇) 2 (21) 35,16,18-hexaene-11-15yl] propyl} aminophosphonate (Example 153A) was placed 12 ml, ice-cold 4N gasified hydrogen / dioxane solution, after removing the ice bath, the mixture was stirred at room temperature for 1 hour, and then dried under vacuum until constant weight. Yield: 61 mg (88% theory Values) LC-MS (Method 20): Rt = 0.85 minutes 2MS (El): m / z = 556 (M-4HC1 + H) + W-NMR (400 MHz, D20): δ = 1.55-1.95 ( m, 8H), 2.82-3.08 (m, 6H), 3.22 (mc, 1H), 3.35-3.75 (m, 4H), 4.33 (mc, 1H), 4.42 (mc, 1H), 4.78 (mc, 1H), 6.83-6.90 (m, 2H) · 6.95 (s, 1H), 7.23 (s, 1H), 7.32 (d, 1H), 7.40 (d, 1H). Listed in Examples 46 to 58 below The compound was prepared according to a method similar to that of Example 6 or 16 from the appropriate starting compound: 25 200526688

Instance Number Structure Instance Number of the Pioneer Analyze Data 46 〇. HO '' ^ NH, X3TFA 176A LC-MS (Method 20): Rt = 2.09 minutes MS (ESI): m / z = 543 (M-3TFA + H) + ^ -NMR (400 MHz, D20): δ = 1.5 -1.9 (m, 6H), 2.85 (mc, 1H), 2.93 (t, 2H), 3.03 (mc, 1H), 3.17 (mc, 1H), 3.2-3.4 (m, 3H), 3.5-3.65 (m , 2H), 3.77 (mc, 1H), 4.42 (mc, 1H), 4.6-4.8 (m, 2H, under D2O), 6.85-6.91 (m, 2H), 6.96 (s, 1H), 7.25 ( s, 1H), 7.34 (d, 1H), 7.43 (d, 1H) ·

-163- 200526688

Instance number structure precursor Instance number analysis data 47 X3TFA NH * 177A LC-MS (Method 20): Rt = 2.04 minutes MS (ESI): m / z = 571 (M-3TFA + H) + ^ -NMR (400 MHz, D20): δ = 1.45 (mc, 2H), 1.5- 1.9 (m, 8H), 2.85 (mc, 1H), 2.94 (t, 2H), 3.03 (mc, 1H), 3.13 (mc, 1H) , 3.18-3.33 (m, 3H), 3.5- 3.65 (m, 2H), 3.77 (mc, 1H), 4.4 (me, 1H), 4.6- 4.8 (m, 2H, under D20), 6.85-6.91 (m , 2H), 6.96 (s, 1H), 7.25 (s, 1H), 7.34 (d, 1H), 7.42 (d, 1H). 48, NH2 X3TFA 178Α LC-MS (Method 20): Rt = 2.08 minutes MS (ESI): m / z = 543 (M-3TFA + H) + 49 hc > ~ ^^ 〇 ~ oh Ο V ox 4 Ηα 181Α MS (ESI): m / z = 528 (M-4HC1 + H) + ^ -NMR (400 MHz, D20): δ = 1.55-1.9 (m, 4H), 2.8-3.1 (m, 4H), 3.2-3.4 (m, 3H), 3.5-3.75 (m, 4H), 4.42 ( mc, 1H), 4.6 (m, 1H, under D2O), 4.81 (mc, 1H), 6.83-6.92 (m, 2H), 6.97 (s, 1H), 7.25 (s, 1H), 7.36 (d , 1H), 7.43 (d, 1H). -164- 200526688 Example number analysis data of the precursor of the instance number structure 50 〇 " \ ο kNHj "Ηα 1 180A MS (ESI): m / z = 542 (M-4HC1 + H) + ^ -NMR (400 MHz? D20): δ = 1.55-1.9 (m, 4H), 1.92-2.04 (m, 2H), 2.82-3.15 (m, 6H), 3.22 ( mc, 1H), 3.45-3.75 (m, 4H), 4.42 (mc? 1H), 4.68 (m, 1H, under D2O), 4.79 (mC5 1H) 5 6.83-6.92 (m, 2H), 6.97 (s, 1H), 7.25 (s, 1H), 7.36 (d, 1H), 7.43 (d, 1H). 51! H〇 ~ O ^^ V〇h "HCI 1 182 A MS (ESI): m / z = 570 (M-4 HC_ + ^ -NMR (400 MHz, D20): δ = 1.45-1.9 (m, 10H), 2.82-3.15 (m, 6H), 3.22 (mc, 1H), 3.45-3.75 (m, 4H ), 4.42 (mc, 1H), 4.68 (m, 1H, under D2O), 4.77 (mc, 1H), 6.83-6.92 (m, 2H), 6.97 (s, 1H), 7.25 (s, 1H), 7.36 (d, 1H), 7.43 (d, 1H).

-165- 200526688

Example number structure analysis example number of the pioneer 52 ° ^ Η〇 X37FA [179A LC-MS (Method 20): Rt = 2.01 minutes MS (ESI): m / z = 529 (M-3TFA + H) +, νη2 ^ -NMR (400 MHz, D20): δ = 1.5-1.9 (m, 4H), 2.8-3.3 (m, 7H), 3.4-3.75 (m, 3H), 4.18 (mc, 1H), 4.41 (mc, 1H ), 4.6 (m, 1H, under D2O), 4.78 (mc, 1H), 6.83-6.9 (m, 2H), 6.96 (s, 1H), 7.25 (s, 1H), 7.34 (d, 1H), 7.42 (d, 1H). 53 -ρ-Ο-οΗ 183A < LC-MS (Method 20): Rt = 2.33 minutes MS (ESI): m / z = 571 (M-3 HC_ + I χ3Ηα ^ * NHj ^ -NMR (400 MHz, D20): δ = 0.96 (t? 3H), 1.75-2.1 (m, 6H), 3.06 (t, 2H), 3.1-3.9 (m, 11H), 4.52 (mc, 1H), 5.05 (mc, 1H), 5.76 (mc, 1H), 6.95-7.03 (m, 2H), 7.14 (s, 1H), 7.28 (s, 1H), 7.54 (d, 1H), 7.6 (d, 1H) · -166- 200526688 instance number 54 55 real_example number analysis data of structure pioneer

184A LC-MS (Method 20): Rt = 1.96 minutes MS (El): m / z = 571 (M-3HC_ + H-NMR (400 MHz, D20): i = 1.7-1.90 (m, 10H), 2.94 -3.14 (m, 6H), 3.32 (m, 1H), 3.60-3.84 (m, 5H), 3.99 (m, 1H) 5 4.51 (m, 1H), 6.99 (d, 2H), 7.07 (s, 1H ), 7.37 (s, 1H), 7.46 (d, 1H), 7.53 (d, 1H),

186A LC-MS (Method 20): Rt = 2.23 minutes MS (ESI): m / z = 571 (M-3HC1 + H). H-NMR (400 MHz, D20): i = 1.4-1.9 (m, 12H ), 2.70-3.7 (m, 14H), 4.44 m, 1H), 6.90 (d, 2H), 6.98 (s, 1H), 7.28 (s, 1H), 7.36 (s, 1H), 7.44 (d , 1H), 7.44 (s, 1H) ._

-167- 200526688 Instance number structure pioneer instance number analysis data 56 192 A MS (ESI): m / z = 556 (M-4 HC1 + H) + " νΎ vs 1 x brick HO ^ NH, ^ -NMR (400 MHz, D2〇): δ = 1.55-1.95 (m, 8H), 2.82-3.08 (m, 6H), 3.22 (mc, 1H), 3.35-3, 85 (m, 4H)? 4.41 (mC5 1H ), 4.7 (m, 1H under D2O), 4.78 (mC5 1H), 6.83-6.90 (m, 2Η), 6.95 (s, 1H), 7.23 (s, 1H), 7.32 (d, 1H) , 7.40 (d, 1H) · 57 ° = \ 〇174 A LC-MS (Method 20): Rt = 2.14 minutes MS (ESI): m / z = 529 (M-3TFA + H) +, nh2 x3TFA ^ • NMR (400 MHz, D20): δ = 1.5-1.8 (m, 4H), 2.75-3.0 (m, 4H), 3.17 (mc, 1H), 3.35-3.85 (m, 6H), 4.43 (mc, 1H) , 4.55 (mc, 1H), 4.7 (m, 1H under D20), 6.80 (m, 2H), 6.89 (s, 1H), 7.18 (s, 1H), 7.28 (d, 1H), 7.35 (d, 1H) ).

-168- 200526688 Example number analysis data of the precursor number structure example 58 〇0 1 * 3TFA νη, 175Α LC-MS (Method 20): Rt = 1.95 minutes MS (ESI): m / z = 557 (M_3TFA + H) + ^ -NMR (400 MHz, D2〇): δ = 1.5-1.85 (m, 8H), 2.78-3.08 (m, 4H), 3.1-3.33 (m, 4H), 3.48-3 · 85 (m , 3H), 4.41 (mc, 1H), 4 · 6_4 · 7 (m, 2H under D2O), 6.83-6.90 (m, 2H), 6.94 (s, 1H), 7.23 (s, 1H), 7.32 (d , 1H), 7.40 (d, 1H) ·

Evaluation of Si physiological activity 5 Definition of abbreviations: AMP adenosine monophosphate ATP adenosine triphosphate BHI mediator brain heart immersion media CoA Coenzyme A 10 DMSO dimethylarsine DTT dithiothreitol EDTA ethylenediamine tetraacetate KC1 Potassium chloride kh2po4 Potassium dihydrogen acid 15 MgS04 Sulfuric acid meter MIC Minimum inhibitory concentration MTP Microtiter plate -169- 200526688

NaCl vaporized sodium Na2HP04 disodium hydrogen phosphate NH4C1 vaporized ammonium NTP nucleoside triphosphate PBS phosphate buffered saline PCR polymerase chain reaction PEG polyethylene glycol PEP phosphoenolpyruvate Tris tris [hydroxymethyl] aminomethane 10 The effects of the compounds of the present invention in vivo can be demonstrated by the following analysis: Acanthodontic effect of the trials with j: · extracts-Acanthodontic effects 15 The preparation of S30 extracts is collected for logarithmic growth (Escherichia coli) MRE 600 (M. Muller; Freiburg University) j Revealed Transcription Effect-Translation Effect Analysis Method Washing and Application of Test Tubes (Muller, M. and Blobel, G. Proc Natl Acad Sci USA (1984) 81, pp 7421-7425) 〇20 Add 1 μl of cAMP (11.25 mg per 50 μl of the reaction mixture)

/ Ml) into the reaction mixture for analysis of the transcription-translation effect of the test tube; the total amount of the analysis mixture was 105 microliters, and 5 microliters of the test substance was placed in 5% strength DMSO, 1 microgram / 100 Microliters of the plasmid pBESTluc mixture (Piromega, Germany) was used as a transcription template. After incubation at 30 ° C for 60 minutes, 50 microliters of 25 liters of luciferin solution (20 mM tricine, 2.67 mM MgS04, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 μM CoA, 470 μM luciferin, 530 μM ATP), and measured the biological cold light produced in the luminometer for one minute. IC50 represents 200526688 and can inhibit 50% of firefly luciferin The inhibitory concentration of translation. Transcriptional effect of & extracts in test camps_ 袢 拜 作 同 5 Construction of S. luciferase reporter and: can be used for in vitro transcription-translation analysis of ⑽a⑽ The communication plasmid was constructed using the plasmid pBESTluc (Promega Corporation, USA). The ugly promoter that appeared in front of the firefly luciferin in the plasmid was replaced with a suitable Shine-Dalgamo sequence from &; 叩 "/ starter 10 'The primer used for this purpose is CAPFor φ

5f-CGGCCAAGCTTACTCGGAT-CCAGAGTTTGCAAAATATACAG

GGGATTATATATAATGGAAAACAAGAAAGGAAAATAGGAGGTT TATATGGAAGACGCCA-3 'and CAPrev 5 -GTCATCGTCGGGAAGACCTG-3'. Primer CAPFor contains capj / Kai 15 motif, ribose binding site and the 5 region of the luciferase gene. It is possible to isolate after PCR using pBESTluc as template A PCR product containing a firefly luciferase gene with a fused promoter attached was generated after restriction degradation of cial and Hindlll and was ligated into a vector pBESTluc that was also digested by Clal and Hindlli. The plasmid pia can be replicated in May and used as a template within -20 μ⑽, for in vitro transcription-translation analysis. The S30 extract from & aurgnsM was cultured in 6 liters of Betaine medium with 250 ml of a sense strain culture for 25 overnight and allowed to grow at 37 ° C until the OD600 nm reached 2-4. The cells were collected by centrifugation and subjected to 500 Wash with ml of cold buffer A (10 mM Tris acetate, pH 8.0, 14 mM magnesium acetate, 1 mMDTT, 1 MKC1), centrifuge again, and wash the cells into 250 • 171- 200526688 pen liters of 50 mM KC1 250 ml of cold buffer A, the resulting pellets were _ 6G minutes at -2 ° C, and dissolved in ice in the dark within 3 minutes, put in a total volume of " ml of buffer B (1 〇mM Tris acetate, pH 8.0, 20 mM magnesium acetate, 111 〇〇11; 50 〇 ^^ €: 1); dissolved in buffer] 6 of 15 ml of 5 y 1Staphm (0 · 8 mg / ml) was placed in 3 pre-chilled centrifuge cups, each of which was mixed with 33 ml of cell suspension. The samples were incubated at 3rt. Shake occasionally before adding 150 μl of 0.5MDTT solution. After 45 to 60 minutes, the lysed cells were centrifuged at 30 x xg for 3G minutes, and the cell pellets were placed in buffer B, and again under the same conditions The heart was closed, and the clear solution was closed. After centrifugation, 10 and 0.25 volumes of buffer c (67 mM Tris acetate, pH 8.0, 20 mM acetic acid, 7 mM anolenol pyruvate trina, 7 mM were added. dTT, 5 5 mM ATP, 70 μM amino acids (completely from Promega), 75 μg of pyruvate, (Sigma, Germany) / ml and added to the upper part of the clear solution 2/3, the sample at 37 After incubation for 30 minutes, the supernatant was placed in a dialysis tube with a cutoff range of 3500 Da, and 2 liters of dialysis buffer (10 mMTris acetate, pH 8.0, 14 mM acetate, lmMDTT) 60 mM potassium acetate) was dialyzed overnight, and the dialysate was concentrated to a protein concentration of about 10 mg / ml. The dialysis tube was covered with cold PEG 8000 powder (Sigma, German > 0 at 4QC). -7CTC is stored in fractions. 20 Regulations ^ · Test tube transcription-translation effect ICg ^ Compound inhibition of protein biosynthesis can be demonstrated in test tube transcription _ translation effect analysis, this analysis is based on the use of communication Plasmid pla as template with cell-free extract of S30 from & aw% ⑽ For firefly luciferase 'cell-free transcription and translation derived role, resulting luciferase apos luminescent activity measured 25 may be utilized to detect the amount manner. The amount of S30 extract or plasmid pla used must be determined again for each preparation in order to ensure that the most appropriate concentration is used in the analysis. 3 microliters will be tested -172- 200526688 Dissolve in 5% DMSO, add to MTP, then add 10 μl of appropriately concentrated plasmid p a plasmid solution, and then add 46 μl of the following mixture · 23 μl of the premix (500 mM potassium acetate, 87 · 5 mM Tris acetate, pH 8.0, 67.5 mM ammonium acetate, 5 mM DTT, 50 micrograms of folic acid / ml, 87.5 mg of PEG 8000/5 ml, 5 mM ATP, 1.25 mM each NTP, 20 μM each amino acid, 50 mM PEP (Na3 salt), 2.5 mM cAMP, 250 pg each (5 · m // tRNA / ml) and 23 microliters of the appropriate amount of & ⑽rew S30 extract, mixed, at 30 ° C After 60 minutes of incubation, add 50 μl of luciferin solution (20 mM tricine, 2.67 mM MgS04, 0_1 mM EDTA, 33.3 mM DTT pH 7.8, 270 μΜ CoA, 470 μΜ 10 luciferin, 530 μΜ ATP ), Using a cold light meter to measure the biological cold light emitted, after i _ minutes, IC% represents that it can cause firefly luciferin 'translation 50% inhibitory concentration of inhibitor role.

Determine the minimum inhibitory concentration (MIO 15 minimum inhibitory concentration (MIC) refers to the minimum concentration of antibiotics that can inhibit the growth of the tested microorganisms for 18-24 hours. The concentration of inhibitors in these cases can be determined by standard microorganisms (Methods for reference, for example, National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial 20 susceptibility tests for bacteria that grow aerobically; approved standard-fifth edition. NCCLS document M7-A5 [ISBN 1-56238-394-9] , NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2000), the MIC of the compound of the present invention was measured in a 96-well microtiter plate scale using a liquid dilution test, and Culture in basic medium (18.5 mM Na2HP04, 5.7 mM K2P04, 9.3 mM NH4C1, 2 · 8 mM MgS04, 17.1 mM NaCl, 0.033 μg / ml thiamine hydrochloride, 1.2 μg / Ml nicotinic acid, 0.003 μg / ml biotin, -173- 200526688 1% glucose, 25 μg / ml each amino acid-producing protein, benzene Except for amino acid; [Η · ΡΡ Kroll; has not been published]), and add 0.4% bh gravy (test medium); like / from c / face L4001, add heated deactivated fetal bovine serum (FCS; GibcoBRL, Germany) to the test medium so that the final concentration of 10% of the overnight culture of the test microorganism is diluted in fresh test medium to an OD578 of 0.001 (such as enterococci, diluted to 0. 〇1), with the test substrate (in the U dilution factorial) at a dilution ratio of 1 ·· 1, cultivated together in the test medium (the final volume is 200 microliters), and placed under 37 for 18-24 hours; Strains are performed in the presence of 5% CO2. In each case, the lowest substance concentration when bacterial growth is no longer seen is defined as its MIC. By the way, in the table below, some of the test microorganisms are listed. The MIC value (expressed in micromolar concentration) of the compound of the present invention shows that the compound has a graded antibacterial effect against most of the test microorganisms. Disk_4 (Comparative Example 20A (Befenomycin B)) Example Number MIC S, aureus 133 MIC S · aureus T17 MIC E. faecium L4001 ic50, & awrews 13 3 Translation 1 1 · 3.1 3.1 12.5 0.1 2 1.6 6.3 25 0.2 3 1.6 3.1 25 0.35 6 3.1 3.1 > 50 0.5 20A 0.1 > 25 > 25 1.5 All concentration units are micromolar concentrations (μΜ). Graded Minimum Inhibitory Concentration (MIC) The minimum inhibitory concentration (MIC) is the minimum concentration of antibiotic that can inhibit the growth of the tested microorganism for 200526688 18-24 hours. The concentration of the inhibitor can be determined by standard microbiology. Method, using modified medium in the agaric dilution test (reference, for example, 'the National Committee for Clinical Laboratory Standards · methods for dilution antimicrobial susceptibility tests for bacteria that 5 grow aerobically; approved standard-fifth edition. NCCLS document M7 -A5 [ISBN 1-56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2000), this bacterial microorganism was cultured at 20% defibrinated ( defibrinated) Horse blood of 1.5% agar dishes. The microorganisms tested were cultured overnight in Columbia blood agar plate 10 (Becton-Dickinson), diluted in PBS, and the amount of microorganisms was adjusted to about 5 X 105 microorganisms / ml. And a drop (1-3 microliters) is placed on the test plate, and this test substance contains various dilutions of the test substance (12 Release class), were cultured at 37 ° C, 5% C02 in the presence of 18-24 hours. When no longer see the lowest concentration of a substance of bacterial growth, which is defined as the MIC, 15 and expressed in g / ml.

Table B (Comparative Example 20A (Benofenomycin B)) Example Number MIC S. aureus 133 MIC S. aureus TV MIC E.faecium L4001 MIC 'S. aureus 1 4 4 16 0.1 ^ ~ 3 2 4 16 0.35 6 0.5 2 8 T5 ~ 42 1 2 4 0.4 ^ 43 1 2 16 45 0.5 2 2 20Α < 0,03 > 32 0.5 T5 ~ Concentration data: MIC (μg / ml); IC50 (Μμ) • 175- 200526688 & ⑽MUS 133 Systemic Infection The applicability of the compounds of the present invention for the treatment of bacterial infections can be demonstrated in a wide variety of animal models. For this reason, usually animals are appropriately infected with infectious microorganisms 5 ' The compound to be tested is then treated, and the compound is formulated into a formulation suitable for this particular therapy mode. The applicability of the compound of the present invention for the treatment of bacterial infections, especially can occur after treatment of & awre⑽ infection Bacterial infection of the rat sepsis model was demonstrated. For this purpose, the cells of & ⑽rews 133 were cultured overnight in BH gravy (0x〇id, 10 Germany), and the overnight culture was diluted at l100 in fresh bh ginseng gravy and allowed to develop for 3 hours. After that, the bacteria growing in logarithmic phase were centrifuged and washed twice with buffered physiological saline, and then the cell suspension in the saline solution was adjusted to 50 units of absorbance in a photometer (Dr Lange LP2W). The dilution step (1 : 15), mix this suspension with a 10% strength mucine suspension at a ratio of 1: 1. 15 Infuse this infection solution by intraperitoneal administration, and inject 0.2 ml per 20 grams of mouse The solution is equivalent to putting about 1-2 × 106 microorganisms / rats into each other rat, and then performing iv · treatment 30 minutes after infection. Female CFW1 mice were used for infection test. Surviving animals were recorded for 6 days, and the animal model was adjusted. It makes it possible for untreated animals to die within 24 hours of infection, and it is possible to prove that in this mode, the compound ED100 20 of Example 2 has a therapeutic effect of 1.25 mg / kg. Determination of the rate of spontaneous resistance against & spontaneous resistance of the compounds of the present invention is as follows: 25 bacterial microbiota are cultured in 30 ml of basic medium (18.5 mM NazHPO4, 5.7 mM KH2P04, 9 · 3 mM NH4C1, 2.8 mM MgS04, 17.1 Mm NaCl, 0.033 μg / ml vitamin D hydrochloride, 1.2 μg / ml nicotinic acid, 0.003 μg / ml -176- 200526688 biotin, 1% glucose, 25 micrograms of each protein-producing amino acid, supplemented with 0.4% BH gravy), overnight at 37 ° C, centrifuged at 6000xg for 10 minutes, and resuspended in 2 ml of phosphate buffered A physiological salt solution (approximately 2 x 109 microorganisms / ml), 100 microliters of this cell suspension, and 1:10 and 1: 100 dilutions were spread on a pre-dried agar plate (1.5% agar, 20% defibrinated horse blood, or 1.5% agar gelatin, 20% in 1/10 Mtiller-Hinton medium, bovine serum diluted with PBS), which contains The compound of the present invention to be tested has a concentration equivalent to 5XMIC or IOxMIC, and is cultured at 37 ° C for 48 hours, and the number of colonies (cuf) is calculated.Ratio of spontaneous resistance of the compound of the present invention (Comparative Example 20A (Befenomycin B)) Example Number (Concentration) (5 x MIC) (10 x MIC) (10 x MIC) (10 x MIC) S , aureus 133 < 8 x 1 (T9 * < 8 x 10 * 9 < 4 x 10'8 1.7 x 10.6 S. aureus ΤΙ7 nd · nd < 4 x 10. · nd S. aureus RN4220 < 6 x 10 · 9 * < 6 x 10 * 9 < 6 x ΙΟ'8 nd S. aureus RN4220BiR < 8 xl〇'9 * < 4 x ΚΓ9 < 6 x ΙΟ-8 nd S. pneumoniae G9a < 4 xl〇 · 8 * ndndnd E.faecalis ICB 27159 < 4 x ur10 * nd 4.1 x 10-6 E. faecium L4001 4 x 1 (T8 < 4 X ΚΓ9 nd 1 nd * Isolated colonies with increased MIC (4-8-fold); nd • Not determined

Isolation of Charcoal-resistant cocoon strain RN422ftBiR and T17 from r. Strain S. RN4220BiR was isolated in a test tube by using 100 microliters. The isolated & ⑽re⑽ strain RN4220 cell suspension (approximately L2xi0cfu / ml) was placed on an antibiotic-free agar plate (18 5mM Na2Hp04, 57 mM KH2PQ ^ -177- 200526688 9.3 mM NH4C1, 2.8 mM MgS04, 17.1 mM NaCl, 0.033 μg / ml thiamine hydrochloride, 1.2 μg / ml nicotinic acid, 2003 μg / ml biotin, 1% glucose, 25 μg / ¾ liters of each protein-producing amino acid was added with 0.4% BH gravy and 1% agarose) and spread on an agar plate containing 2 micrograms / ml of bfenamicin 5 B (10xMIC). Incubate overnight at 37 ° C, where about 1 × 107 cells grow on plates without antibiotics, and about 100 colonies grow on plates with antibiotics 'equivalent to a resistance rate of 1x10' Some colonies on the antibiotic-containing plate were tested for fenofromycin B MIC. One colony with MIC > 50 μM was selected for further use. This strain was classified as RN4220BiR. 10 Strain T17 was isolated in vivo by infecting each CFW1 mouse with 4 X 107 & 133 cells intraperitoneally. 0.5 hours after infection, the animals were injected intravenously with 50%. Mg / kg of biphenomycin b (biphenomycin B) was treated. Three days after infection, 15 kidneys were removed from surviving animals, and after organs were homogenized, they were spread on antibiotic-free methods as described above for screening RN4220BiR. Inoculated with antibiotic-containing agar plates and incubated at 37 ° C overnight, about half of the colonies isolated from the kidneys appeared to grow on the antibody-containing plates (2.2x10 colonies), which proved that there were Phenofomycin B-resistant ^ -like cell aggregates, about 20 such colonies were tested for bufomycin b MIC, and one colony with 20 MIC > 50 μM was selected for further culture This strain is classified as T17. D-A man's composition is yours. Ja > Example The compound of the present invention can be formulated into a pharmaceutical preparation according to the following method: Into the public's soluble Erhai Lake. 200526688 Composition: Diols 400 and 250 One gram of water was formulated with 1 mg of the compound of Example 1 and 15 grams of polyethylene to make a solution for injection. Formulation i Dissolve the compound of the present invention and polyethylene glycol in water with stirring. The solution is filtered to remove i (pore size is 0.22 micrometers) and is distributed to a heat-sterilized perfusion bottle under sterile conditions. Seal it with an infusion stopper and a corrugated cap. 10

-179-

Claims (1)

200526688 10. Scope of patent application: 1. Compounds with the following formula (D, 10 15 where R7 is a radical of the formula: 〆NH, NH0 R1 or ΝΗ0 where R1 is hydrogen or hydroxyl, 20 * is the point of attachment to a carbon atom, R2 is hydrogen, methyl or ethyl, R3 is a base with the formula [γΓ-ι R4 F _ 1 «Π _ 25 15 200526688 NH where 5 * is the point of attachment to the nitrogen atom, R4 is hydrogen or hydroxyl, and R5 and R15 are each independently hydrogen, methyl, or a group of the formula Where * is the point of attachment to the nitrogen atom, R8 is hydrogen or *-(CH2) rNHR1 () where 15 R1 () is hydrogen or methyl, and f is a number of 1, 2 or 3 R9 is hydrogen or fluorenyl , D is the number of 1, 2 or 3, 20 and e is the number of 1, 2 or 3, R6 is hydrogen or aminoethyl, or R5 and R6 together with the nitrogen atom to which they are attached form a hexahydropyridine ring , 25 R12 and R14 are each independently a radical of the formula *-(CH2) zrOH or *-(CH2) Z2-NHR13, where 200526688 * is the point of attachment to a carbon atom, and Z1 and Z2 are independently 1, 2 , 3 or 4, R13 is hydrogen or methyl, k and t are independently 0 or 1, 1, w and y are independently 1, 2, 3 or 4, m, r, s and v are respectively Independently 1 or 2, η, ο, p and q are independently 0, 1 or 2, u is 0, 1 or 3, 10 or y, and when w or y is 3, they may be independently at The middle carbon atom located on the three-membered chain carries a hydroxyl group, or a salt, a solvate thereof, or a solvate of a salt thereof. 2. The compound according to item 1 of the scope of patent application, wherein R7 is a group of the following chemical formula 15 20 where R1 is hydrogen or hydroxyl, * is the point of attachment to a carbon atom, R2 is hydrogen, fluorenyl or ethyl, and R3 is a group of the formula -182- 200526688 10 15 20 R4 is hydrogen or hydroxyl, R5 is hydrogen or methyl, R6 is hydrogen, or R5 and R6 together form a hexahydropyridine ring k and t which are independently 0 or 1, 1 is Bu 2, 3 or 4, m, r, s and v are independently 1 or 2, η, ο, p and q are independently 0, 1 or 2, u is 0, and Bu 2 or 3, * Is the point of attachment to a nitrogen atom, or a salt thereof, a solvate thereof, or a solvate of a salt thereof. 3. The compound according to item 1 or 2 of the scope of patent application, characterized by a compound of the following formula -183- 25 200526688 where R1 is nitrogen or a backup group ’R2 is hydrogen or methyl, and R3 is a group having the formula 10 where R4 is hydrogen or hydroxyl, R5 is hydrogen or methyl, k is 0 or 1, 1, m and r are independently 1 or 2, 15 η, ο, and p and q are independently 0, 1, or 2, * is the point of attachment to a nitrogen atom, or a salt thereof, a solvate thereof, or a solvate of a salt thereof. 4. The compound according to claims 1 to 3 of the scope of patent application, characterized in that R1 is a nitrogen or a radical ′ 20 R2 is a hydrogen or a methyl group, and R3 is a base having the formula 25 where R4 is hydrogen or hydroxyl, R5 is hydrogen or methyl, 200526688 k is 0 or 1, 1, m and r are independently 1 or 2, and η and q are independently 0, 1 or 2, * is The point of attachment to the nitrogen atom, 5. The compound according to items 1 to 4 of the scope of patent application, characterized in that R1 is hydrogen or hydroxyl, R2 is hydrogen or methyl, and R3 is a base having the formula 10 Where * is the point of attachment to the nitrogen atom, 15 6. (8 $, 115 >, 14 * ^)-14-amino-7 \ / ^ (2-aminoethyl) -11- [(27?)-(3-Amino-2-hydroxy-propyl) -5,17-dihydroxy-9-methyl-10,13-diketo-9,12_diazatricyclo [14 · 3 · 1 · 1 · 2,6] Heptane-1 (20), 2 (21), 3,5,16,18-hexaene-8-methanamine 20 or its trihydrochloride, their other salts, their solvates or their solvates. -185- 200526688 7. With the following formula (8 $, 11 * ^, 145) -14-amino- (2-aminoethyl) _ιιι_ (3-aminopropyl) -5,17- Diacyl-10,13-diketo-9,12-diazatricyclo [14.3.1.12,6] pinane-1 (20), 2 (21), 3,5,16,18-six Ene-8-methanamine 10 or its trihydrochloride, its additional salt, its solvate or its solvate. 15 8 · (8aS, 1 15,14 $)-14_amino_11- (3-aminopropyl) -all {3-[(3-aminopropyl) amino] propyl Gib 5,17-Diacyl-10,13-di-yl-9,12-diazatricyclo [14.3.1.12,6] Pentane-1 (20), 2 (21), 3,5 Methylamine 20 or its tetrahydrochloride, its additional salt, its solvate, or its solvate. 25 9 with the following formula (Team 11 Magic 4 Magic-14-Amine_11- (3-Aminopropyl) ## {2- [bis (2-Aminoethyl) Amine] ethyl} -5 , 17-Diacryl-1O, 13-Di_yl_9,12_Diazatricyclo [14 · 3 · 1 · 12,6] Pentane-1 (20), 2 (21), 3 , 5,16,18_Hexene methylformamide-186- 200526688 Or its tetrahydrochloride, their other salts, their solvates, and their solvates. 10. With the formula (8 and 11 & 14Θ-14-amino-11- (3-aminopropyl) 10 diaminopentyl] -5,17-dihydroxy-10,13-diketo -9,12-diazatricyclo [14 · 3 · 1 · 12,6] pinene_1 (20), 2 (21), 3,5,16,18-hexaene-8-methanamine 15 or its tetrahydrochloride, their other salts, their solvates and their solvates. 20 11. A method for preparing a compound of formula (I), or a salt, a solvate, or a solvate of a salt thereof according to item 1 of the scope of the patent application, characterized in that [A] is a compound of the formula -187- 25 200526688 where R2 and R7 have the same meaning as defined in item 1 of the scope of the patent application, and boc represents the third-butoxycarbonyl group, which is reacted in two steps, first in the presence of one or more dehydrating agents, and The compound is reacted with H2NR3 (III) wherein R3 has the meaning as defined in item 丨 of the patent application range, and then reacts with an acid, or a compound of the formula [B] 15 wherein R2 and R7 have the same meanings as defined in item 1 of the scope of the patent application, and Z is a benzyloxycarbonyl group, which is reacted in two steps. First, in the presence of one or more dehydrating agents, react with the following compound H2NR3 ( III) wherein R3 has the definition as defined in item 1 of the scope of the patent application, and then reacts with an acid or performs a hydrogenolysis reaction. 12. The method for preparing a compound of formula (I) or a solvate thereof according to item 1 of the scope of the patent application, characterized in that chromatography of a salt of a compound or a solvate of a salt of a compound is converted into a compound by performing chromatography using an added base. 13. Use of a compound according to any one of claims 1 to 10 for the treatment and / or prevention of a disease. 200526688 14. Use of a compound according to any one of claims 1 to 10 for the manufacture of a pharmaceutical for treating and / or preventing a disease. 15. Use of a compound according to any one of claims 1 to 10 for the manufacture of a pharmaceutical for the treatment and / or prevention of a bacterial disease. 5 16. A pharmaceutical product comprising at least one compound according to any one of claims 1 to 10 and applying at least one inert, non-toxic, and pharmaceutically suitable excipient. 17. A pharmaceutical product according to claim 16 of the scope of patent application for use in the treatment and / or prevention of bacterial infections. 10 18. —A method for controlling bacterial infections in humans and animals by administering to a subject® at least one compound according to any one of claims 1 to 10 with an antibacterially effective amount or according to a patent Pharmaceutical products in scope 16 or 17. -189- 200526688 VII. Designated Representative Map: (1) The designated representative map in this case is the () map. (None) (b) Brief description of the component symbols in this representative figure: None 8. If there is a chemical formula in this case, please disclose the chemical formula that best shows the characteristics of the invention: