TH20641Y - A kit for detecting the beta-thalassemia gene using the polymerase chain reaction (PCR) technique from blood samples. - Google Patents

Abstract

Page 1 of 1. Summary of the Invention: A reagent kit for detecting the beta-thalassemia gene (symbol: thalassemia) using the polymerase chain reaction (PCR) technique from blood samples. The blood sample is mixed with the anticoagulant EDTA (EDTA blood) and does not require DNA extraction. The kit includes reagents for blood sample preparation, a high pH buffer solution, dNTPs base, magnesium chloride (MgCl2) solution, betaine, dimethyl sulfoxide solution, sterile distilled water, and primers for detecting the beta-thalassemia gene. This kit will enable the detection of seven common beta-thalassemia mutations found in Thailand, which is of great benefit to genetic counselors providing guidance to couples planning to have children or diagnosing thalassemia, leading to more effective control and prevention of this severe form of thalassemia.

Claims (6)

------09/09/2564------(OCR) 1. Beta-thalassemia gene detection kit using polymerase chain reaction (PCR) technique from blood samples. Consists of: a. Blood sample preparation solution containing 0.005 M sodium hydroxide (NaOH), 0.1 M sodium chloride (NaCl), 1% w/v Triton X-100, and 5% w/v dimethyl sulfoxide. b. Buffer solution containing... The solution consists of: a. Tris-hydrochloric acid (Tris-HCl) with a pH of 9.0 at a concentration of 20 millimolar; potassium chloride (KCl) at a concentration of 50 millimolar; ammonium sulfate ((NH4)2SO4) at a concentration of 10 millimolar; and gelatin at a concentration of 0.1% by weight/volume. The components of the solution are: c. dNTPs base (composed of a combination of bases A, T, C, and G) at a concentration of 0.4 millimolar; d. Magnesium chloride (MgCl2) solution at a concentration of 2 millimolar; e. Betaine solution at a concentration of L005 molar; f. Dimethyl sulfoxide solution with a concentration of 4% by weight/volume; e. Sterile distilled water; e. Primers, which are grouped into three categories based on the mutation characteristics of the beta-thalassemia gene. The three primer groups, namely Group 1 (codons 41/42, 17, and nucleotide-28), consist of: - Forward primer S1 (1.5 picomoles), - Reverse primer S3 (0.9 picomoles), - Forward primer G148 (1.5 picomoles), - Reverse primer G18 (0.42 picomoles), - Reverse primer G31 (0.3 picomoles), and - Forward primer G163 (0.18 picomoles). The picomole-reverse primer H5 (0.18 picomoles concentration), group 2, codon 71/72, and intervening sequence 1-5 consist of: - Forward primer S1 (2.1 picomoles concentration) - Reverse primer G20 (2.1 picomoles concentration) - Forward primer G14 (0.6 picomoles concentration) - Reverse primer S3 (0.6 picomoles concentration) - Forward primer G161 (0.6 picomoles concentration) - Reverse primer H5. (reverse primer; H5) 0.6 picomoles concentration. Group 3 Intervening sequence l-1 and Intervening sequence II-654 consist of: - Forward primer S1 (SI) 0.3 picomoles concentration - Reverse primer G16R 0.3 picomoles concentration - Forward primer G12R 2.1 picomoles concentration - Reverse primer G8 2.1 picomoles concentration - Forward primer SF14 0.9 picomoles concentration - Reverse primer G10 (reverse primer; 1. A reagent kit for detecting the beta-thalassemia gene using the polymerase chain reaction (PCC) technique from a blood sample. (G10) Concentration: 0.9 picomoles. According to Paragraph 1, the Group 1 primers, codons 41/42, codon 17, and nucleotide -28 have the following base sequences: - Forward primer S1: 5’ TGTCATCACTTAGACCTCAC 3’ - Reverse primer S3: 5’ TCCCATAGACTCACCCTGAA 3’ - Forward primer G148: 5’ CCCTTGGACCCAGAGGTTG 3’ - Reverse primer G18: 5’ ACTTCATCCACGTTCACCTA 3’ - Reverse primer G31: 5’ GATGGCTCTCTGCCCTGACI I c 3’ - Forward primer G163 (forward primer; G163) 5; CCCTGGCCCACAAGTACTAC y - Reverse primer H5 (reverse primer; H5) 5! GCAGCCTCACCTTCTTTCAlGG 3 3. A reagent kit for detecting the beta-thalassemia gene using polymerase chain reaction (PCR) technique from blood samples, according to the patent claim. 1. Where the primers in group 2, codon 71/72, and intervening sequence l-5 have the following base sequences: - Forward primer S1: 5’ TGTCATCACTTAGACCTCAC 3’ - Reverse primer G20: 5' CTGTCTTGTAACCTTGATAG 3’ - Forward primer G14: 5’ AAAGTGCTCGGTGCCTTTAA 3’ - Reverse primer S3: 5’ TCCCATAGACTCACCCTGAA 3’ - Forward primer G161: 5’ TGAGTCCAAGCTAGGCCCTT 3’ - Reverse primer H5: H5) 5’ GCAGCCTCACGl IGl I ICATGG 3’ 4. Beta-thalassemia gene detection kit using polymerase chain reaction (PCC) technique from blood samples. Under Claim 1, the Group 3 primers, Intervening Sequence 1-1 and Intervening Sequence II-654, have the following baselines: - Forward primer S1: 5’ TGTCATCAgI IAGACCTCAC 3’ - Reverse primer G16R: 5’ CTTGTAACCTTGATACC AAA 3’ - Forward primer G12R: 5’GTAATAATTTCTGGGTTAACGT 3’ - Reverse primer G8: 5’ CGAACCTGAGTCTTATTAG 3’ - Forward primer SF14: 5, TCCCTCA6AA4AGGATTCAA 3’ -Reverse primer G10 (reverse primer; G10) 5’ AG ACTAGCACTGCAGATTcc 3’ 5. Prepare a reagent for detecting the beta-thalassemia (3-thalassemia) gene using the polymerase chain reaction technique from a blood sample, according to one of the claims 1-4, with the following procedure: Step 1: Prepare the sample for testing by taking a blood sample mixed with the anticoagulant EDTA (EDTA blood) and mixing it with reagent A. The reagent used to prepare the blood sample. The beta-thalassemia gene detection kit uses the polymerase chain reaction (PCR) technique in a 1:5 ratio. One PCR reaction requires 1 microliter of the prepared blood sample. Step 2 involves mixing the PCR reagents from steps B-C thoroughly, selecting the appropriate primer group for each step. Step 3 involves adding the final PCR reagent. (polymerase chain reaction) into the test tube. For one polymerase chain reaction, add 46.0 microliters of polymerase chain reaction reagent. Step 4: Then add the DNA polymerase enzyme (which is not specified in the reagent kit) to the test tube containing the polymerase chain reaction reagent. (polymerase chain reaction) and mix well. In one polymerase chain reaction, using 46.6 microliters of polymerase chain reaction reagent, 0.4 microliters of DNA polymerase enzyme will be used. Step 5: Next, add the specified amount of prepared blood sample to the test tube containing the polymerase chain reaction reagent and DNA polymerase enzyme and mix well. Step 6: Amount the DNA fragment or polymerase chain reaction under the conditions of the allele-specific polymerase chain reaction (ASPCR) technique from the DNA template in the blood sample. In step 7, using a thermal cycle amplification machine, the amplified DNA fragments are separated using agarose gel electrophoresis with a 2% agarose gel concentration and then examined using a gel imaging device powered by an ultraviolet lamp. 6. A reagent kit is used to detect the beta-thalassemia (3-thalassemia) gene using the polymerase chain reaction (PCR) technique from a blood sample. According to claim 5, the thermal cycle DNA amplification machine is programmed with the following temperatures and settings: Step 1: 95°C for 15 minutes (for the first cycle only); Step 2: 95°C for 1 minute; Step 3: 58°C for 1 minute (for codons 41/42, 17, and nucleotide-28); 60°C for 1 minute (for codons 71/72 and intervening sequences 1-5); 53°C for 1 minute (for intervening sequences i-1 and ll-654); Step 4: ... The temperature is 72 degrees Celsius for 90 seconds. Steps 2-4 are repeated 36 times. Step 5 is at 72 degrees Celsius for 10 minutes (the final step only). After the reaction is complete, the temperature is maintained at 10 degrees Celsius until the amplified DNA fragments are ready for examination. ------------ Page 1 of 4. Claims. 1. The kit for detecting the beta-thalassemia gene (symbol -thalassemia) using the polymerase chain reaction (PCR) technique from blood samples consists of: a. Solutions for preparing blood samples, containing 0.005 M sodium hydroxide (NaOH), 0.1 M sodium chloride (NaCl), 1% Triton X-100, and 5% dimethyl sulfoxide. b. Buffer solutions containing... The solution consists of: a. Tris-hydrochloric acid (Tris-HCl) with a pH of 9.0 at a concentration of 20 millimolar; potassium chloride (KCl) at a concentration of 50 millimolar; ammonium sulfate ((NH4)2SO4) at a concentration of 10 millimolar; and gelatin at a concentration of 0.1%. a. dNTPs base (composed of a combination of bases A, T, C, and G) at a concentration of 0.4 millimolar; d. Magnesium chloride solution (MgCl2) at a concentration of 2 millimolar; e. Betaine solution at a concentration of 1.005 molar; f. Dimethyl sulfoxide solution at a concentration of 4%; g. Sterile distilled water; h. Primers, which are grouped into 3 groups according to the mutation characteristics of the beta-thalassemia gene. The 3 primer groups are: Group 1 codon... Codons 41/42, codon 17, and nucleotide -28 consist of: - Forward primer S1 at a concentration of 1.5 picomoles - Reverse primer S3 at a concentration of 0.9 picomoles - Forward primer G148 at a concentration of 1.5 picomoles - Reverse primer G18 at a concentration of 0.42 picomoles - Reverse primer G31 at a concentration of 0.3 picomoles - Forward primer G163 at a concentration of 0.18 picomoles - Reverse primer H5 (H5) Primer (H5) with a concentration of 0.18 picomoles. Group 2, codon 71/72 and intervening sequence I-5, consists of: - Forward primer S1 with a concentration of 2.1 picomoles - Reverse primer G20 with a concentration of 2.1 picomoles - Forward primer G14 with a concentration of 0.6 picomoles - Reverse primer S3 with a concentration of 0.6 picomoles - Forward primer G161 with a concentration of 0.6 picomoles - Reverse primer H5 with a concentration of... (Page 2 of 4) 0.6 picomoles. Group 3, Intervening Sequence I-1 and Intervening Sequence II-654, consists of: - Forward primer S1, concentration 0.3 picomoles - Reverse primer G16R, concentration 0.3 picomoles - Forward primer G12R, concentration 2.1 picomoles - Reverse primer G8, concentration 2.1 picomoles - Forward primer SF14, concentration 0.9 picomoles - Reverse primer G10, concentration 0.9 picomoles picomoles 2. A kit for detecting the beta-thalassemia gene (symbol: -thalassemia) using the polymerase chain reaction (PCR) technique in blood samples. According to claim 1, the Group 1 primers, codons 41/42, codon 17, and nucleotide -28 have the following base sequences: - Forward primer S1: 5’ TGTCATCACTTAGACCTCAC 3’ - Reverse primer S3: 5’ TCCCATAGACTCACCCTGAA 3’ - Forward primer G148: 5’ CCCTTGGACCCAGAGGTTG 3’ - Reverse primer G18: 5’ ACTTCATCCACGTTCACCTA 3’ - Reverse primer G31: 5’ GATGGCTCTCTGCCCTGACTTC 3’ - Forward primer G163 5’ CCCTGGCCCACAAGTACTAC 3’ - Reverse primer H5 5’ GCAGCCTCACCTTCTTTCATGG 3’ 3. A kit for detecting the beta-thalassemia gene (symbol: -thalassemia) using the polymerase chain reaction (PCC) technique in blood samples. According to claim 1, the Group 2 primers, codon 71/72 and intervening sequence I-5 have the following base sequences: - Forward primer S1: 5’ TGTCATCACTTAGACCTCAC 3’ - Reverse primer G20: 5’ CTGTCTTGTAACCTTGATAG 3’ - Forward primer G14: 5’ AAAGTGCTCGGTGCCTTTAA 3’ - Reverse primer S3: 5’ TCCCATAGACTCACCCTGAA 3’ - Forward primer G161: 5’ TGAGTCCAAGCTAGGCCCTT 3’ (Page 3 of 4) Page - Reverse primer H5 5’ GCAGCCTCACCTTCTTTCATGG 3’ 4. A kit for detecting the beta-thalassemia gene (symbol: -thalassemia) using the polymerase chain reaction (PCC) technique in blood samples. According to claim 1, the Group 3 primers, intervening sequence I-1 and intervening sequence II-654, have the following base sequences: - Forward primer S1: 5’ TGTCATCACTTAGACCTCAC 3’ - Reverse primer G16R: 5’ CTTGTAACCTTGATACCAAA 3’ - Forward primer G12R: 5’GTAATAATTTCTGGGTTAACGT 3’ - Reverse primer G8: 5’ CGAACCTGAGTCTTATTAG 3’ - Forward primer SF14: 5’ TCCCTCAGAAAAGGATTCAA 3’ - Reverse primer G10 5’ AGACTAGCACTGCAGATTCC 3’ 5. A reagent kit for detecting the beta-thalassemia gene (symbol: -thalassemia) using the polymerase chain reaction (PCR) technique from blood samples, according to any one of claims 1-4, with the following usage procedure: a. Prepare the sample for testing by taking a blood sample mixed with the EDTA anticoagulant (EDTA blood) and mixing it with the reagent used in the beta-thalassemia gene detection kit using the polymerase chain reaction technique in a ratio of 1:5. One µl of the prepared blood sample is used in one PCR reaction. b. Then, mix the reagents for the PCR reaction, consisting of the substances from steps b-c, thoroughly until well combined. Step 1. Select and mix the reagents according to the desired primer group (c). Then, add the polymerase chain reaction (PCR) reagent to the test tube. One PCR reaction requires 46.6 µl of reagent. Step 2. Next, add the DNA polymerase enzyme (which is not specified in the reagent kit) to the test tube containing the PCR reagent and mix thoroughly. For one PCR reaction using 46.6 µl of PCR reagent (as shown on page 4 of 4), 0.4 µl of DNA polymerase enzyme will be needed. Step 3. Next, add the prepared blood sample in the specified quantities to a test tube containing the polymerase chain reaction (PCR) reagent and DNA polymerase enzyme. Mix thoroughly. Then, amplify the DNA fragments or polymerase chain reaction (PCR) technique using allergic specific polymerase chain reaction (ASPCR) from the DNA template in the blood sample using a thermal cycle amplification device. Finally, separate the amplified DNA fragments using agarose gel electrophoresis with a 2% agarose gel and analyze them using an ultraviolet gel imaging device. 6. Use of a reagent kit for detecting the beta-thalassemia gene (symbol -thalassemia) using the polymerase chain reaction technique from blood samples, as per claim 5, where the amplification device... Genetic material processing using a thermal cycle is programmed with the following temperatures and settings: Step 1: 95°C for 15 minutes (for the first cycle only). Step 2: 95°C for 1 minute. Step 3: 58°C for 1 minute (for codons 41/42, 17, and nucleotide -28); 60°C for 1 minute (for codons 71/72 and intervening sequences I-5); 53°C for 1 minute (for intervening sequences 1-1 and II-654). Step 4: 72°C for... Steps 2-4 are repeated for 90 seconds each, for a total of 36 cycles. Step 5 takes place at 72°C for 10 minutes (for the final cycle only). Once the reaction is complete, the temperature is maintained at 10°C until the amplified DNA fragments are ready for examination.