TH19446U - Oligonucleotides, or DNA aptamers, are used to detect Salmonella spp., E. coli, and Listeria monocytogenes (LM) based on the principle of specific binding to whole cells. - Google Patents

Abstract

Page 1 of 1. Summary of the Invention: An oligonucleotide or DNA aptamer with the nucleotide sequence GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC” or a DNA aptamer with 50-100% nucleotide homology compared to other DNA aptamers. This DNA aptamer is immobilized on the surface of gold nanoparticles (AuNP) or selected metal particles from silver, copper, and/or selected materials from glass, plastic, using disulfide bonds or other selected bonds. Covalent bonds are used to specifically detect whole cell contamination by Salmonella spp., E. coli, and Listeria monocytogenes (LM) in food and environmental samples. The development of an oligonucleotide or DNA aptamer for this detection, based on whole cell binding, results in color change within 1-45 minutes in the presence of magnesium sulfate at concentrations of 0.001-1.5 M. The color change is then visually observed.

Claims (4)

------29/11/2564------(OCR) 1. Oligonucleotide or DNA aptamer with nucleotide sequence (base sequence) (5' --> 3’) 1. GCTCGCGTGGCGAACTCAGCGTGGGCCATAGTTATGCGAG 2. CCCTGGGCCGTGCGGTTGTAACGGAAAGTTCTAGCCTCA 3. ACTGCCGAGCCTCGAACCCCCCAGTCTCACTGTCTATCGG 4. CACTTGACTAGTACATGACCACTTGACTAGTACATGACCAC 5. GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC 6. GCACACTCATATGTGGTCGCACCACGTAGTCTTGTAGAGG 7. GCTGCGGTGAAAAGATAACTCCACCCGTGTTAGGTTCAGC 8. GGCTTGCGGTTTGGAATCCGGTATGTTGCTTAGGGGTGCA 9. CACTTGACTAGTACATGACCACTTGATTAGTACATGACCAC or a DNA aptamer with a nucleotide sequence similarity percentage (homologous percentage or % nucleotide homology) of 50-100% when compared to this DNA aptamer, single and/or mixed/combined. 2. An oligonucleotide or DNA aptamer set consisting of an oligonucleotide or DNA aptamer according to claim 1, which is immobilized on the surface of gold particles (gold nanoparticles or Gold-nanoparticles or AuNP) or selected metal particles from silver, copper, or selected materials from glass and/or plastic, using disulfide bonds and/or selectable covalent bonds. 3. Oligonucleotides, or DNA aptamers, are used to detect Salmonella spp., E. coli, and Listeria monocytogenes (LM) based on the principle of specific binding to the cell body. (Whole cells) according to claim 1 or 2 for use in the detection of Salmonella species (Salmonella spp.), E. coli (E. coli) and Listeria monocytogenes (LM) by specific binding to whole cells. 4. Oligonucleotide or DNA aptamer for the detection of Salmonella species (Salmonella spp.), E. coli (E. coli) and Listeria monocytogenes (LM) by the principle of specific binding to whole cells according to one of claims 1-3 in the use of a magnesium sulfate solution at a certain concentration. Concentration in the range of 0.001 - 1.5 M ------------ ------22/01/2021------(OCR) 1. Oligonucleotide or DNA aptamer with nucleotide sequence (base sequence (5'--> 3')) 1. GCTCGCGTGGCGAACTCAGCGTGGGCCATAGTTATGCGAG 2. CCCTGGGCCGTGCGGTTGTAACGGAAAGTTCTAGCCTCA 3. ACTGCCGAGCCTCGAACCCCCCAGTCTCACTGTCTATCGG 4. CACTTGACTAGTACATGACCACTTGACTAGTACATGACCAC 5. GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC 6. GCACACTCATATGTGGTCGCACCACGTAGTCTTGTAGAGG 7. GCTGCGGTGAAAAGATAACTCCACCCGTGTTAGGTTCAGC 8. GGCTTGCGGTTTGGAATCCGGTATGTTGCTTAGGGGTGCA 9. CACTTGACTAGTACATGACCACTTGATTAGTACATGACCAC or a DNA aptamer with a nucleotide sequence similarity percentage (homologous percentage or % nucleotide homology) of 50-100% when compared to this DNA aptamer, single and/or mixed/combined. 2. An oligonucleotide or DNA aptamer set consisting of an oligonucleotide or DNA aptamer according to claim 1, which is immobilized on the surface of gold particles (gold nanoparticles or Gold-nanoparticles or AuNP) or selected metal particles from silver, copper, or selected materials from glass and/or plastic, using disulfide bonds and/or selectable covalent bonds. 3. Oligonucleotides, or DNA aptamers, are used to detect Salmonella spp., E. coli, and Listeria monocytogenes (LM) based on the principle of specific binding to whole cells according to either right or wrong (right 1 or 2). For use in the detection of Salmonella species (Salmonella spp.), E. coli, and Listeria monocytogenes (LM) by specific binding to whole cells, according to any one of the claims 1-3, in the use of a magnesium sulfate solution at a certain concentration. Concentration in the range of 0.001 - 1.5 M ------------ Page 1 of 1 page. Claim 1. Oligonucleotide or DNA aptamer with nucleotide sequence base sequence (5' --> 3') 1. GCTCGCGTGGCGAACTCAGCGTGGGCCATAGTTATGCGAG 2. CCCTGGGCCGTGCGGTTGTAACGGAAAGTTCTAGCCTCA 3. CCCTGGGCCGTGCGGTTGTAACGGAAAGTTCTAGCCTCA 4. ACTGCCGAGCCTCGAACCCCCCAGTCTCACTGTCTATCGG 5. CACTTGACTAGTACATGACCACTTGACTAGTACATGACCAC 6. GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC 7. GCACACTCATATGTGGTCGCACCACGTAGTCTTGTAGAGG 8. GCTGCGGTGAAAAGATAACTCCACCCGTGTTAGGTTCAGC 9. GGCTTGCGGTTTGGAATCCGGTATGTTGCTTAGGGGTGCA 10. CACTTGACTAGTACATGACCACTTGATTAGTACATGACCAC or DNA Aphtamers with 50-100% nucleotide sequence homology when compared to this DNA aphtamer, both single and/or mixed/combined. 2. An oligonucleotide or DNA aptamer assembly comprising an oligonucleotide or DNA aptamer as per claim 1, immobilized on the surface of gold nanoparticles (AuNP) or selected metal nanoparticles made of silver, copper, or selected materials from glass and/or plastic, using disulfide bonds and/or selected covalent bonds. 3. A test kit pursuant to claims 1 and 2, or either one, for the detection of Salmonella spp., E. coli, and Listeria monocytogenes (LM) through specific binding to whole cells. 4. The test kit pursuant to claims 1, 2, and 3, or any one of them, shall be used in the application of a magnesium sulfate salt solution at a concentration in the range of 0.001 - 1.5 M.