SU1759873A1 - Deoxyribonucleic acid fragment coding promotor of sp6 rna-polymerase - Google Patents

Abstract

Uses: molecular biologists, genetic engineers and biotechnologists. Summary of the Invention: Using chemical synthesis, a DNA fragment encoding the SP6 promoter of the RNA polymerase was obtained.

Description

The invention relates to molecular biology, genetic engineering, and biotechnology, and can be used in these areas of science to produce RNA as a substrate for studying and modeling basic biological processes occurring in a cell, and functional RNA and oligoribonucleotides are also essential for solving the whole a number of tasks of an applied nature, such as medical diagnostics and artificial protein synthesis.

Natural promoters for RNA polymerase SP6 are known with the following structure:

-15 -10-5-1 +1

ATTTAGGTGACACTATAGAAGGG, o.ftaa

where a is adenine; T - thymine; G - guanine: C - cytidine, a, g, d, c - possible substitutions found in the SP6 promoters. Synthesis of RNA. Starting from the +1 position of the transcription initiation site.

One of the natural promoters (SP6 4) was used to create a vector that provides efficient transcription in the in vitro system. For this fragment

The phage SP6 DNA containing the promoter was cloned into a high-copy plasmid (Figure 12 or Figure 13), which contains a polylinker recognized by a number of restriction endonucleases. The resulting vectors are called pSP6 4 and pSP6 5. The scheme for obtaining RNA using these vectors consists in cloning a given DNA fragment along a polylinker, splitting the plasmid with a restriction enzyme to ensure termination of transcription and RNA synthesis in the presence of SP6 RNA polymerase.

The disadvantages of the prototype are that during the synthesis of RNA, it is impossible to obtain a molecule that strictly corresponds to a given structure, since it will always contain from 5 to 10 excess nucleotides at the 5-terminus. This is due to the fact that the cloning of the DNA template occurs along the polylinker removed from the promoter initiation site. Therefore, the +1 + 6 promoter fragment is transcribed and the sequence of the restriction site along which it was inserted.

The purpose of the invention is to obtain a deoxyribonucleic acid fragment. coding promoter SP6, which is

with

Xj

the next

00 VI

with

it would be possible to embed a DNA fragment directly to the transcription initiation site, to synthesize RNA that does not contain an excess sequence at the 5-terminus, which would make it possible to obtain a molecule that strictly corresponds to a given structure, while maintaining a high promoter activity.

Properties that achieve the goal could have an oligodeoxy nucleotide containing a restriction site that allows DNA to be cleaved to form a blunt end just before the site of transcription initiation. It is obvious that RNA synthesized under such a promoter will strictly comply with the DNA template, i.e. will not contain excess 5-nucleotide residues.

The synthesized oligodeoxynucleotide (artificial promoter), where N is nucleotide residues, was chosen so that restriction with the formation of a blunt end in the immediate vicinity of the initiation site was made, with simultaneous high transcription activity of the oligodeoxynucleotide Synthesized double-stranded oligodeoxy nucleotides :

and

AATTCGATTTAGOTGACACTAT

(EcoRI) GCTAAATCCACTGTGATA

G (Barn H I) CCTAG-5,

where the brackets indicate the sticky ends for the cloning of the oligonucleotide at the indicated restriction sites, and the recognition site for the restriction enzyme Alul, which gives a blunt end when cleaved:, EcTCfGA

If one compares the synthesized oligonucleotide with the structure of the natural SP6-motor, it is clear that in order to obtain the Alul site, it is necessary to introduce substitutions in +2 and +3 positions. To prove that such a modified oligonucleotide retains promoter activity, a chemically synthesized oligonucleotide was inserted into the plasmid pTTQ 19 no EcoR 1 - Bam H (-sites. The resulting plasmid was named pTTQ 19-SP6 and tested for the ability to initiate RNA synthesis in the in vitro system in the presence of SP6 RNA polymerase. The efficiency was compared with the transcription efficiency on the natural promoter in plasmid pSP6 A.

Example. Obtaining 8P6-lomotor containing Alu 1-site in -1 + 2 positions and checking its promoter activity.

The synthesis of oligodeoxyribonucleotides was carried out on the serial domestic synthesizer Victory-5M production

0

SKTB special electronics and analytical instrumentation of the Siberian Branch of the USSR Academy of Sciences using the phosphitamide method according to standard programs. To the reactor

the synthesizer was placed 30 mg of the polymer CPG-500, Fluca, with the first unit, 5-dimethoxytrityl nucleoside, attached via the succinic acid residue. The dimethoxytrityl group was removed with 1.5% trifluoroacetic acid in abs. CHaCIa for 30 s. After washing the reactor with absolute acetonitrile, a mixture of monomer, 5 -0-dimethoxytrityl-M-acyl-deoxynucleoside-3 (R-methyl, diisopropyl lamido) phosphite (200 μl of a 0.1 M solution in absolute acetonitrile) and an activating agent, was introduced into the reactor. tetrazole (200 μl of a 0.45 M solution in absolute acetonitrile). The condensation time is 80 s. The residue of unreacted hydrocomponent was acylated for 2 min with a mixture of acetic anhydride-triethylam and nN-methyl and azol-aceto nitrile (4.5: 4.5: 1: 30). Then, the phosphide group was oxidized with 0.1 M iodine in a mixture: pyridine-AC5 succinic acid (9: 1) and the polymer was washed with acetonitrile.

After completion of the synthesis, oligonucleotides attached to the polymer carrier were treated with a mixture of dioxane-triethylamine thiophenol (2: 1: 1) for 1 h to remove the internucleotide methyl groups, then with concentrated ammonia for 1 h at 20 ° C for removing the nucleotide material from the polymer and

5 for 15-16 hours at 50 ° C to unlock the heterocyclic bases. The ammonia solution was evaporated, the residue was dissolved in 0.1 M Tris buffer (pH 9.0), and an oligonucleotide with a 5-terminal dimethoxytrityl group was isolated, reverse phase chromatography on a column with Lichrosorb RP-18 (Meg. HGF) in a gradient concentrations of acetonitrile 0-30% in 0.05 M LI.-CI04. The desired peak, eluted at 12-15% aceto5 nitrile, was collected, evaporated, the dimethoxytrityl group was removed with 80% acetic acid (15 min at 20 ° C), the solution was evaporated and the residue was rechromatographed on the same column under the above conditions.

Cloning of a double-stranded oligonucleotide into pTTQ 19. This plasmid vector contains unique sites for the restriction of BamHI and EcoRI. 10 mg of plasmid in

55 500 μl of 10 mM Tris-HCl buffer (pH 7.5) containing 10 mM MgCl, 10 mMD-mercaptoethanol and 50 mM NaCl (buffer A) were treated with 10 units. Act. BamHI and EcoRI for 1 h at 37 ° C. A larger BamHI and EcoRI fragment was isolated by preparative gel electrophoresis in 4% polyacrylamide (PAAG) in tris-borate buffer (pH 8.3) at a voltage of 100 V. A fragment of the gel was removed by electroelution.

2 µg of the obtained vector was mixed with 100 pmol of chemically synthesized oligodeoxynucleotides, precipitated with ethanol, dissolved in 25 µl of 10 M Tris-H buffer pH 7.5-1 mM EDTA (TE buffer), 3 µl of 10-fold buffer A and 3 5 items Act. T4 DNA ligase. Incubated for 12-14 hours at 10 ° C. The reaction mixture was precipitated with ethanol, dissolved in sterile TE buffer and transformed into EcoLIC600. The presence of the in-clones in the grown clones was confirmed by restriction analysis. DNA was isolated by alkaline lysis.

The primary structure of the cloned promoter was analyzed by the Max-Gilbert method. From the analysis of the five clones, it is clear that the 2nd and 5th clones have the desired primary structure

-15 Yu & f

AATTCG ATTAGGGGACACTATAGCTG 6 A.

Checking promoter activity (RNA synthesis in the In vitro system). 0.2 μg of the plasmid containing the promoter were incubated in 50 μl of the reaction mixture containing 40 mM Tris-HCl, pH 7.5, 6 mM MgClz, 2 mM spermidine, 10 mM dithiotreptol. 0.4mM VTP, GTP and PAGE 0.4 mm 3H-ATP (t KU / mmol) at 37 ° C in the presence of 1-2 units. Act. RNA polymerase SP6. Synthesized RNA was determined in 10 µl of the mixture according to

radioactive acid-insoluble product on the counter MAGK-MG.

The results of the synthesis on the natural and synthesized promoter are shown in the drawing, where the dependence of the incorporation of radioactive mononucleotides into the lot-insoluble product on time is given. It is seen that the initial speeds are the same. This indicates the equal efficiency of both promoters (in natural

initial speed 100% ± 10%, with artificial 105 ± 10%).

Thus, the synthesized olme-deoxynucleotide meets the goal: it contains a restriction site for Aful,

Claims (1)

is a true promoter whose activity is comparable to that of natural. Claims of deoxyribonucleic acid encoding the SP6 promoter of the RNA polymerase with a nucleotide sequence thirty 5 -AATTCGATTTAGGTGACACTATAGCTGGA-3. obtained by chemical synthesis. I cp / nxfO -J four