SK7552001A3 - Controlled release formulation comprising gnrh-ii - Google Patents

Abstract

A pharmaceutical formulation for the controlled release of a therapeutic peptide or a salt thereof, which peptide has the sequence pyroGlu-His-Trp-Ser-Xaa<1>-Gly-Xaa<2>-Xaa<3>-Pro-Gly-NH2 wherein Xaa<1> is His or Tyr, Xaa<2> is Trp or Leu, and Xaa<3> is Tyr or Arg, provided that when Xaa<1> is Tyr and Xaa<2> is Leu, then Xaa<3> is not Arg, and which formulation further comprises a pharmaceutically acceptable biodegradable polymer. The formulation can be used for treating bone and prostate disorders.

Description

BACKGROUND OF THE INVENTION

Hypothalamic-pituitary (hypoalysis) axis-physiology studies have been concluded by finding that gonadotropin releasing hormone (GnRH, otherwise known as luteinizing hormone releasing hormone, LHRH) is a key regulatory hormone. GnRH is released by the hypothalamus and acts on the pituitary to stimulate the release of luteinizing hormone (LH) and follicle stimulating hormone (FSH). A peptide homologous to GnRH has recently been identified (White et al., Proc. Natl. Acad. Sci. USA 95, 305-309, 1998). This peptide was called GnRH-II. The sequences of both peptides are compared below.

GnRH pyroGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2 (SEQ ID NO: 5)

GnRH-II _{pyroGlu-His-Trp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH2} (SEQ ID No. 6)

The name GnRH-II is misleading in some sense. The new peptide is a separate gene product and clearly differs from GnRH in its tissue distribution. It appears unlikely that GnRH-II acts as an endogenous substance releasing LH and FSH. Since there was no clear evidence of the physiological role of GnRH-II, no attention was paid to the practical aspects of using this peptide as a therapeutic agent.

SUMMARY OF THE INVENTION

It has now been found that GnRH-II plays an important role in the functioning of a number of organs. For example, GnRH-II affects osteogenesis and modulates proliferation of the prostate gland epithelial cells. For this reason, we have contemplated a means by which this agent and its analogs could be conveniently delivered in clinical practice, and it is an object of the present invention to provide suitable means for achieving this goal. The compositions of the present invention rely on the use of a biodegradable polymer that maintains the peptide in the depot from which the peptide is then released into the bloodstream of the system at a controlled rate. These compositions include two key elements, a biologically active peptide and a biodegradable polymer. The biologically active peptide is a decapeptide that corresponds to the following sequence:

pyroGlu-His-Trp-Ser-Xaa ¹ -Gly-Xaa ² -Xaa ³ -Pro-Gly-NH2

(SEQ I. D. No.7) Xaa ¹ is a His or Tyr, Xaa ² is a Trp or Leu, a Xaa ³ is a Tyr or Arg,

which ensures that when Xaa ¹ is Tyr and Xaa ² is Leu, then Xaa ³ is not Arg. The polymer is any pharmaceutically acceptable biodegradable polymer, more preferably a glycolic and lactic acid copolymer. The present invention further encompasses the use of compositions for the treatment of human diseases.

Amino acid abbreviations used herein have their conventional meanings and refer to the natural L-isomer (except for the chiral amino acid of glycine).

At first glance, the present invention described herein includes a pharmaceutical composition that releases a therapeutic peptide at a controlled rate and over an extended period of time (i.e. at least one day, more preferably several days, and most preferably at least one week), particularly for treating bone and prostate gland diseases. The therapeutic peptide is a decapeptide according to the sequence:

pyroGlu-His-Trp-Ser-Xaa ¹ -Gly-Xaa ² -Xaa ³ -Pro-Gly-NH 2 (SEQ ID No.7) wherein Xaa ¹ is either His or Tyr, Xaa ² is either Trp or Leu and Xaa ³ is either Tyr or Arg, which ensures that when Xaa ¹ is His and Xaa ² is Leu, then Xaa ³ is not Arg. More preferably, Xaa ¹ is His, Xaa ² is Trp, and Xaa ³ is Tyr. It will be shown that such a peptide may form salts with acids (e.g., acetic acid, trifluoroacetic acid, benzoic acid, hydrochloric acid, phosphoric acid, and the like). In this sense, salts formed with pharmaceutically acceptable acids are included within the scope of the present invention. The second major component of the composition is a biodegradable, pharmaceutically acceptable polymer. These polymers are known in the art. They may be either homopolymers (ie, polymers formed by a single monomer) or copolymers (ie, polymers formed from two or more different monomers). Suitable monomers include amino and hydroxy derivatives of carboxylic acids. In a preferred part of the present invention, the polymer is composed of hydroxyacyl monomer units and more preferably α-hydroxyacyl units. Most preferably, the polymer is a polyglycolic acid, a polylactic acid, or a copolymer of glycolic acid and lactic acid. This polymer has the following chemical structure:

wherein R is hydrogen for polyglycolic acid, methyl for polylactic acid, and randomly hydrogen or methyl for copolymer.

Two complementary methods for preparing the composition of the present invention can be distinguished. The peptide may either be incorporated into the polymer matrix or more preferably may be encapsulated by the polymer. In the latter case, the encapsulated peptide may be in a solid or liquid state. The solid peptide is preferred.

The composition is useful in the treatment of human diseases, including bone growth disorders (including age-related osteoporosis and osteoporosis associated with postmenopausal hormone status, primary and secondary hyperparathyroidism, unused osteoporosis, glucose-related osteoporosis and osteoporosis-related osteoporosis) and osteoporosis including benign prostate hyperplasia and prostate cancer).

In a second aspect, the present invention described herein encompasses a method of treating an individual suffering from bone diseases or prostate gland growth, or contemplated for use at risk of these diseases. The method of treatment comprises administering to said individual a therapeutically effective amount of a composition comprising, as an active main ingredient, a peptide according to the following sequence:

pyroGlu-His-Trp-Ser-Xaa ¹ -Gly-Xaa ² -Xaa ³ -Pro-Gly-NH ₂ (SEQ ID No.7) or a pharmaceutically acceptable salt of this peptide, wherein Xaa ¹ , Xaa ² and Xaa ³ are defined above, and as a second component a pharmaceutically acceptable biodegradable polymer, the composition of which allows release of the peptide into the blood circulation system as the polymer is progressively disrupted. The method of treatment may include a single administration of the composition, but is more likely to include sequentially repeated doses. The frequency of administration may range from once daily to once per month. The amount of active peptide per dose will depend upon the dosage schedule and rate of administration. Generally, it will be between 1 milligram (1 mg) and one gram (1 g). The attending physician will determine the exact dose, depending on the parameters generally considered in the art, to be appropriate. The composition is administered by either intramuscular or subcutaneous injection.

Peptides that include the active agents in the compositions of the invention can be prepared by methods well known in the art. For example, peptides may be prepared by solid phase synthesis. This includes the sequential addition of amino acid residues to the resin-bound intermediate according to the following strategy.

1. Formation of the first resin bound intermediate:

PG-Aaa-OH + FG-Res-PG-Aaa-L-Res

Aaa = amino acid

PG = protecting group

FG = functional group Res = polymer resin L = binding group (-0- or -NH-)

2. Removing the protecting group

PG-Aaa-L-Res-H-Aaa-L-Res

3. String extension

PG-Bbb-OH-H-Aaa-L-Res

4. Repeat steps 2 and 3 if necessary

PG-Bbb-Aaa-L-Res - - - PG-Nnn -...-

5. Cleavage / removal of the protecting group

PG-Nnn -...- Bbb-Aaa-L-Res-H-Nnn -...- Bbb-Aaa-OH (or -NH ₂ )

In step 1, the protected amino acid is allowed to react with the resin to which the functional group is bound. The protecting group (PG) is most commonly tert-butyloxycarbonyl (Boe) or 9-fluoenylmethyloxycarbonyl (Fmoc). Typically, the functional group on the resin (FG) is a chloroalkyl group, a hydroxyl group, or an amino group. If FG is chloroalkyl or hydroxyl, then the linking group (L) is an oxygen atom (-O-). When FG is amino, L is -NH-.

In a second step, the protecting group (PG) is removed from the amino group. If PG is Boe, this can be accomplished by treating the resin with acids such as trifluoroacetic acid or hydrochloric acid in dichloromethane. If PG is Fmoc, deprotection can be accomplished by treating the resin with a base, e.g. piperidine.

In the third step, the peptide chain is extended by one amino acid residue. The protected amino acid is linked to the deprotected amino group in the second step. Many agents are known in the art to achieve this conversion. One combination is dicyclohexylcarbodiimide (DCC) and hydroxybenzotriazole (HOBt). The principle will also be necessary in general. Suitable bases include triethylamine and N, N-diisoropylethylamine. The solvent will usually be dichloromethane, dimethylformamide or mixtures thereof.

If the amino acid side chains (Aaa - Nnn) contain reactive groups (for example, amino groups, carboxylic acid groups, hydroxyl groups), it will be necessary to protect these groups. The protecting groups selected for side chains are generally those that are stable under the conditions required to remove the protecting group (PG) from the α-amino group. If PG is Fmoc, then the side chain protecting groups may suitably be based on tert-butyl chemistry. On the other hand, if PG is Boe, then the side chain protecting groups can be suitably based on fluorenylmethyl chemistry. Other protecting groups known in the art may also be used.

In step 4, the deprotection / chain elongation cycle is repeated until the desired peptide sequence is formed.

In the fifth step, the completed peptide is cleaved from the resin. The protecting groups are removed from the side chains before or after cleavage. When L is -NH-, the cleaved peptide is in the form of the C-terminal amide. When L is -O-, the cleaved peptide is often an acid without a C-terminus and a second step is required to form the C-terminal amide.

Peptides can also be prepared by solution phase synthesis, which may be more convenient for larger material needs.

The polymers required for the formulation are generally well known in the art, and the formulation can be obtained

As previously noted, the form of a simple dispersion of the peptide in the polymer matrix or may be coated with a micro-polymer coating. The dispersion can be prepared by mixing the peptide (as a solid) and the polymer to a homogeneous state, and then compressing the mixture to form a solid. Addition of a binding agent to the mixture may be necessary to achieve a suitable cohesive agent. The mass can then be milled to form particles suitable for suspension in a biocompatible liquid (such as water or isotonic sodium chloride solution) and injection.

Compositions coated with micro-coatings can be prepared either from a solid peptide (e.g., a powder) or from a solution, especially an aqueous solution of the peptide. First, the polymer is dissolved in a suitable organic solvent. The peptide is added to this solution and the mixture is actively mixed to disperse the peptide in the organic phase. A second organic solvent is then added. This second solvent is selected to reduce the solubility of the polymer in the organic phase. The polymer falls out of solution so as to form a coating around the solid peptide particles (or around the droplets dispersed in the aqueous solution). The resulting microcapsules are then washed to remove residual organic solvents. After this, the microcapsules are prepared to be suspended in a suitable liquid for administration.

The above general description is further elaborated in the examples below. The examples are intended to illustrate certain aspects of the present invention. However, they are not intended to limit the invention in any of the approaches.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the effect of increased doses of GnRH-II on serum calcium concentration in ovariectomized rats.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Synthesis of GnRH-II

A. Preparation of protected peptide bound to the pyroGlu-His (Bom) -Trp (CHO) -Ser (Bzi) -His (Bom) -Gly-Trp (CHO) Tyr (Bzl) -Pro-Gly-Ores resin

This peptide was prepared using standard solid phase methods starting with Boc-Glyesterified Merrifield resin (60 g, 1 mmol / g). Synthesis was performed on a manual synthesizer with a total volume of solvent and reagent of 300 ml for each operation. The standard protocol for deprotection / wash / coupling reaction is summarized in Table 1.

Table 1

step agent time (min) number of operations Boe Removal HC1 / DCM * 60 1 ablution DCM 2 to 4 3 neutralization 10% DIPEA / DCM 4 2 ablution DCM 2 to 4 1 coupling reaction activated ester 60 to 120 ** 1 to 2 ablution DCM 2 to 4 3 * Hydrogen chloride gas was bubbled through the resin slurry in DCM ** Completeness of reaction was determined by negative hydrazine assay

Benzotriazolyl esters were used as activated esters undergoing synthesis. They were prepared from the corresponding protected amino acids by reaction with 1-hydroxybenzotriazole (1 equivalent) and dicyclohexylcarbodiimide (1 equivalent). The amounts used (in relation to the resin substitution capacity) are shown in Table 2.

Table 2

cycle no. amino acid derivative molar excess 1 Boc-Pro-OH 1.8 2 Boc-Tyr (Bzl) -OH 1.8 3 Boc-Trp (CHO) -OH 1.8 4 Boc-Gly-OH 1.8 5 Boc-His (Bom) -OH 1.8 6 Boc-Ser (Bzl) -OH 2.0 7 Boc-Trp (CHO) -OH 2.0 8 Boc-His (Bom) -OH 2.0 9 PyroGlu-OH 2.0

The last coupling reaction was followed by washing the resin with dichloromethane (3x31) and drying under reduced pressure, at +40 ° C to constant weight.

Amino acid analysis: consistent with the predicted sequence

B. Cleavage and Deprotection of PyroGlu-His-Trp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH2 (SEQ ID NO: 6)

The peptide-resin prepared in Example 1A was placed in a pressure chamber in a canvas bag. The chamber was then charged with ammonia gas to a final pressure of 4 atmospheres. After 72 hours, excess ammonia was drained and the resin was extracted with acetic acid (3 x 100 mL) and ethanol (3 x 100 mL). Air was removed from the combined extracts with nitrogen, 10% palladium (on carbon) was added, and the mixture was stirred under a hydrogen atmosphere. After completion of the reaction (checked by HPLC), the mixture was filtered and the filtrate was evaporated. The residue was purified by reverse phase HPLC to give the title compound.

Example 2

Peptide coating of the peptide

Copolymers (D, L-lactic acid, glycolic acid) in a 50/50 ratio with lactic acid / glycolic acid were used. To a solution of this polymer (3.7 g) in dichloromethane (100 mL) in a reaction chamber equipped with a stirrer was added GnRH-II acetate (0.15 g, prepared by dissolving the peptide of Example 1 in acetic acid and solution). The mixture was stirred at

After 10 minutes, silicone was added by lyophilizing the resulting

500 rpm.

oil (Dow Corning 360 Medical then a thin stream introduced caprylic-capric (Miglyol® stirring, 1000 rpm) stirring continued for 1 hour separated by filtration, twice

Fluid®, 45 g). The mixture was into the triglyceride acid (812, 3.3L) at steady state

After the addition was complete and then the microcapsules were washed with isopropanol and finally dried.

Example 3

Analysis of the effects of GnRH-II and analogs on osteogenic cell populations in vitro

a) Human osteoblasts were isolated from bone affected by cancer by orthopedic surgery (Nilsson et al., 1995), by standard procedures known in the art. Bone samples were chopped into small bone grafts and then well washed in modified Eagle medium from Dulbecco (DMEM) / F12 (1: 1 Gibco, Paisley, U.K.). These cells, such as osteoblasts, murine osteoblastic MC3T3-E1 cells, and human clonal osteosarcoma cell lines MG-63 (non-mineralizing) and SaOS-2 (mineralizing osteosarcoma) were cultured in DMEM: F12, 1: 1 medium with the addition of 10% fetal calf serum. FCS, Gibco), fungizone (500 mg / L), gentamycin sulfate (50 mg / L), L-glutamine (2 mM) and I-ascorbic acid (100 mg / L) in a humidified CO2 chamber at 37 ° C.

b) Human bone marrow trees cells were isolated from bone fragments rinsed in phosphate buffered saline. Bone marrow cells were pooled and spun through a column from Ficol Hypaque (Kimble et al., J. Clin. Invest., 93, 1959-1967, 1994). Cells at the phase interface were collated, counted and seeded into 75 cm ² flasks. Cells were incubated in a humidified CO 2 chamber at 37 ° C and the medium was changed weekly. At confinement, cells were harvested using trypsin EDTA and replated in α-minimal essential medium (α-ΜΕΜ) to which 10% fetal calf serum (FCS, Gibco), penicillin (100 U / ml), streptomycin (100 mg / ml), fungizone and L-glutamine (2 mM).

c) All cells were serum starved for 48 hours prior to the addition of GnRH-I and GnRH-II. Cells were plated in DMEM medium without red phenol (avoiding the effects of red phenol similar to that of estrogen) containing 10% serum in 12-well plates for 48 hours. Dose-dependent effects of GnRH-I and GnRH-II and analogous peptides were studied after addition of peptides at final concentrations ranging from 10 ⁹ to 10 ^-6 . 1 mM dibutyryl cAMP was used as a control. The cells were incubated for 24, 48 and 96 hours, with the peptide being added again every 24 hours.

d) To determine the effects of peptides on cell proliferation, [ ³ H] thymidine was added at 1 mCi / ml for an additional 24 hours and the incorporation of [ ³ H] thymidine was determined. Radioisotope incorporation was determined using a scintillation counter and the results were calculated as cpm / mg total protein.

e) The expression of osteoblastic differentiation markers was also determined (Tintut Y. et al., J. Biol. Chem., 273, 7547-53, 1998). Total RNA was isolated at several stages, before the start of the experiment and at 24, 48, 72 and 96 hours after the addition of the peptides. Expression of procollagen type I, osteopontin and 28S RNA (used as internal control) was determined by Northern blot analysis. Alkaline phosphatase, GLA matrix protein, osteoclastin, and GAPDN (used as internal control) were determined by RT-PCR using specific primers generated for each gene.

The peptides of the present invention produced significant effects at concentrations below 100 μΜ.

Example 4

Analysis of the effects of GnRH-II and analogues on osteoclast populations in vitro

a) Human clonal osteoclastic precursor cell lines (FLG 29.1) were used as an in vitro model for osteoclastic differentiation (Gattei V. et al., Cell Growth Differ, 7, 753-63, 1996). In addition, co-cultures of FLG 29.1 and osteoblastic cells (Saos-2) were evaluated for migration, adhesion, cytochemical, morphological and biochemical changes. Dose-dependent effects of GnRH-I and GnRH-II and peptide analogs were studied after addition of final concentrations ranging from

10 ⁹ to ΙΟ “ ⁶ Μ, to FLG 29.1 cultures and to co-cultures. Parathyroid hormone was added as a control. The arrest (or inhibition) of differentiation of preosteoclasts (fusion into larger multinucleate elements) and a number of other factors have been measured (Orlandini et al., Cell Tissue Res., 281, 33-42,

1995). This includes:

1. Positive staining of tartrate-resistant acid phosphatase in FLG 29.1 cells.

2. Reduction of alkaline phosphatase activity expressed in Saos-2 cells.

3. Appearance of typical ultra-structural features in mature osteoclases in FLG 29.1 cells.

4. Release granulocyte macrophage stimulating factor into the culture medium.

5. To determine the effects of peptides on cell proliferation, [ ³ H] thymidine was added at 1 mCi / ml for an additional 24 hours and the incorporation of [ ³ H] thymidine was determined as described above.

b) Bone marrow cells obtained from human bone fragments were cultured with Vitamin D3 for 7 days in the presence of 10 nM 1,25- (OH) 2 / to generate multinucleated osteoclasts using standard techniques known in the art (Takahashi et al., Endocrinol 122, 1473-1482 (1988). Culture medium (α-MEM) was removed and replaced with fresh red phenol-free medium supplemented with antibiotics and 10% heat-inactivated FCS containing GnRH-I, GnRH-II or analogs and cultures were maintained for an additional 24 hours. Floating cells were pooled and osteoclasts stained to ensure expression of tartrate-resistant acid phosphatase (TRAP), a marker of osteoclast differentiation (Hughes et al., Nat. Med., 2, 1132-1135, 1996).

Cells were incubated in 0.2 M acetate buffer, pH 4.7-5.0, containing tartaric acid and 2% naphthol AS-BI phosphate (dissolved to a concentration of 20 mg / ml in ethylene glycol monoethyl ether) for 15 minutes, at Deň: 32 ° C. The cells were then transferred to a second solution consisting of the same buffer and a concentration of tartaric acid with 0.1% pararosaniline chloride (hexazotized by stirring with an equal volume of 4% sodium nitrate for 5 minutes at room temperature) for 10 minutes at 37 ° C. This treatment causes a red cytoplasmic color in cells expressing TRAP. Harris hematoxylin was used as the core counter-color.

2. Apoptotic multinucleated osteoclasts had a larger TRAP expression size larger than viable TRAP-positive cells. Confirmation of apoptosis was performed using acridine orange color. Viable osteoclasts were counted after fixation in 95% ethanol and TRAP hematoxylin staining and apoptotic osteoclasts were expressed as a percentage of the total amount of multinucleated osteoclasts (viable and apoptotic) in each culture well.

The peptides of the present invention caused significant effects at concentrations below 100 μΜ.

Example 5

Expression analysis of GnRH mRNA in osteogenic and osteoclast cell populations

Total RNA was extracted from cells cultured as described above:

1. cells as osteoblasts isolated from cancerous bone

2. mouse osteoblastic MC3T3-E1 cells

3. MG-63 (non-mineralizing)

4. SaOS-2 (mineralizing sarcoma)

5. Human cells of bone marrow trees

6. Human FLG 29.1 osteoclast precursor cells

7. multinucleated osteoclasts formed from bone marrow

GnRH-I and GnRH-II expression was determined by RT-PCR using the PCR primers outlined in SEQ I.D. No 1 to 4. The integrity generated by the cDNA was determined by determining the relative level of actin amplification.

Example 6

Effect of GnRH-II on bone mineral density in ovariectomized rats

a) Adult females (8 weeks old, 200-215 g) of Sprague Dawley rats were ovariectally removed (OVX). Animals were kept 4 weeks post-delivery prior to treatment. Pure rat diet (1.0% calcium, 0.61% phosphorus) and water were provided to taste. Each study consists of 6 weight paired groups (n = 8 / group).

b) Treatment started 4 weeks after OVX. After 4 weeks, the baseline OVX control group was sacrificed (group A). The remaining groups were injected once daily with vehicle (group B), 1 pg / kg body weight (group C), 10 pg / kg body weight (group D), 100 pg / kg body weight (group E) of GnRH-II and 80 pg / kg body weight (group F) of hPTH (1-34).

c) All rats were weighed daily and the doses were adjusted for a 50 g increase in group mean weight. The rats alternately received subcutaneous injections of calcein (30 mg / kg) or tetracycline (30 mg / kg) in a 2% solution of sodium carbonate and sodium chloride, in order of labeled mineralization surfaces at 10, 19 and 26 days, followed by drug treatment. Bone mineral density was determined by dual energy X-ray absorptometry (DEXA). On day 28, serum calcium levels were determined by a colorimetric assay using a commercial kit.

d) The success of OVX was determined in necropsy by loss of detectability of the ovarian tissue and observation of significant uterine horn atrophy. Both limbs were dislocated in the loins. The left tibia and femur were cleaned of excess muscle and soft tissue and placed in 70% ethanol. The previous ridge on the metaphysis of the right tibia was shaved with a brittle, barely exposing the bone marrow. Both the right femur and tibia were then placed for 10 hours in 10% phosphate buffered formalin and then transferred to 70% ethanol.

Ovarian-removed animals treated with 10 and 100 pg / kg GnRH-II and 80 pg / kg PTH for 28 days daily showed hypercalcemia. The results are shown in Figure 1.

Example 7

Cellular localization of GnRH-II in paraffin regions of normal rat bone and human bone

a) Frozen and / or paraffin-anchored human and rat bone regions were fixed for 3 to 36 hours, depending on size (3 to 5 hours at room temperature, then about 24 hours at 4 ° C) and then soaked in 0.1 M Tris + 5% EDTA (12.11 g + 50 g EDTA), pH 7.3 until calcium was removed from them.

b) Thereafter, the regions were subjected to antibody staining (rabbit polyclonal anti-GnRH-II antibodies) using standard techniques.

GnRH-II staining was observed on the plates, by megakatyocites on growth plates (especially proliferating chondrocytes). Some staining has also been observed in bone-forming cells, particularly in active osteoblasts as well as in the new osteoid.

Example 1 demonstrates the preparation of the peptides of the present invention, which can then be formulated as illustrative in Example 2. Examples 3 to 7 demonstrate the biological activity of the peptides of the present invention. However, the scope of the present invention is by no means limited to these examples. In addition, it will be appreciated that a variety of different controlled release formulations of these peptides can be prepared using different polymers and / or physical properties of the peptide-polymer combination. However, these variations permit compositions with equivalent biological properties and are considered to fall within the scope of the present invention as defined in the following claims.

SEQ I.D. No .: 1-4 referred to in Example 5 have the following sevence:

CTG CAG CTG CCT GAA GGA C (D GGG CGG GGC GGG GCT CTC G (2) ATT CTA CTG ACT TGG TGC GTG (3) GGA ATA ' TGT GCA ACT TGG TGT (4)

Sequence list:

(A) name: Ferring B.V. (B) Street : Marsstraat 9, P.O. (C) the city : Hoofddorp (D) State: any (E) the earth: Netherlands (F) ZIP code: 2130 KC

Box 3129

Name of the invention: Pharmaceutical composition, method of treatment of medical condition, use of peptide (i) number of sequences: 7 (ii) computer readable form:

(A) media type: floppy disk (B) computer: IBM PC compatible (C) operating system: PC-DOS / MS-DOS (D) software: PatentIn Release # 1.0, Version # 1.30 (EPO)

2) Information for SEQ ID NO. 1:

(i) sequence characteristics:

(A) length: 19 base pairs (B) type: nucleic acid (C) strand type: single-stranded (D) topology: linear (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO. 1:

CTGCAGCTGCCTGAAGGAG

2) Information for SEQ ID NO. 2:

(i) sequence characteristics:

(A) length: 19 base pairs w

(B) type: nucleic acid (C) fiber type: single-stranded (D) topology: linear (ii) molecule type: cDNA (xi) sequence description: SEQ ID No. 1; 2:

GGGCGGGGCGGGGCTCTCG

2) Information for SEQ ID NO. 3:

(i) sequence characteristics:

(A) length: 21 base pairs (B) type: nucleic acid (C) strand type: single-stranded (D) topology: linear (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO. 3:

ATTCTACTGACTTGGTGCGTG

2) Information for SEQ ID NO. 4:

(i) sequence characteristics:

(A) length: 21 base pairs (B) type: nucleic acid (C) strand type: single-stranded (D) topology: linear (ii) molecule type: cDNA (xi) sequence description: SEQ ID NO. 4:

GGAATATGTGCAACTTGGTGT

2) Information for SEQ ID NO. 5:

(i) sequence characteristics:

(A) length: 10 amino acids (B) type: amino acid (C) fiber type: single chain (D) topology: linear (ii) molecule type: peptide (ix) features:

(A) name / key: modified site (B) location: 1 (C) additional information: product = Glu at first position is pyroGLU (xi) sequence description: SEQ ID No. 1; 5:

Glu His Trp Ser

5 10

2) Information for SEQ ID NO. 6:

(i) sequence characteristics:

(A) length: 10 amino acids (B) type: amino acid (C) fiber type: single chain (D) topology: linear (ii) molecule type: peptide (ix) features :, (A) name / key: modified site (B ) location: 1 (C) additional information: product = Glu at first position is pyroGLU (xi) sequence description: SEQ ID No. 1; 6:

Glu His Trp Ser Gly Trp Tyr Pro Gly

5

2) Information for SEQ ID NO. 7:

(i) sequence characteristics:

(A) length: 10 amino acids (B) type: amino acid (C) fiber type: single chain (D) topology: linear (ii) molecule type: peptide (ix) features:

(A) name / key: modified site (B) location: 1 (C) additional information: product = Glu is pyroGlu (ix) features:

(A) name / key: modified site (B) location: 5 (C) additional information: product = Xaa is His or Tyr (ix) features:

(A) name / key: modified site (B) location: 7 (C) additional information: product = Xaa is Trp or Leu (ix) features:

(A) name / key: modified site (B) location: 8 (C) additional information: product = Xaa is Tyr or Arg (xi) sequence description: SEQ ID NO. 7:

Glu His Trp Ser Gly Xaa Gly Xaa Pro Gly

Claims (13)

PATENT CLAIMS A pharmaceutical composition for the controlled release of a therapeutic peptide or salts thereof, characterized in that the peptide has the sequence of: pyroGlu-His-Trp-Ser-Xaa ¹ -Gly-Xaa ² -Xaa ³ -Pro-Gly-NH ₂ where Xaa ¹ is His or Tyr, Xaa ² is Trp or Leu, and Xaa ³ is Tyr or Arg, which ensures that when Xaa ¹ is Tyr and Xaa ² is Leu, then Xaa ³ is not Arg, and wherein the composition further comprises a pharmaceutically acceptable, biodegradable polymer. Pharmaceutical composition according to claim 1, characterized in that the peptide is: pyroGlu-His-Trp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH ₂ 3. A pharmaceutical composition according to claim 1 wherein the polymer is a polymer of hydroxy derivatives of carboxylic acids or a copolymer of such derivatives. Pharmaceutical composition according to claim 3, characterized in that the polymer is a glycolic acid polymer, a lactic acid polymer or a lactic-glycolic acid copolymer. Pharmaceutical composition according to claim 1, characterized in that the peptide is coated with a micro-coat of the polymer. -Ž6- 6. A method of treating a human condition comprising administering to a person in need thereof a therapeutically effective amount of a controlled release composition of any of the preceding claims. Pharmaceutical composition according to any one of claims 1 to 5, characterized in that the composition is intended for the treatment or protection of bone growth disorders or prostate gland growth. Use of a peptide or salts thereof as defined in claims 1 or 2 together with a pharmaceutically acceptable, biodegradable polymer, characterized in that it is intended for the preparation of a controlled release medicament for the treatment or protection of bone growth or prostate gland disorders . Use according to claims 8 and 9, characterized in that said polymer is a polymer of hydroxy derivatives of carboxylic acids or a copolymer of these derivatives or is a polymer of glycolic acid, a polymer of lactic acid or a copolymer of lactic acid and glycolic acid. Use according to claims 8 and 9, characterized in that said disorders are selected from age-related osteoporosis, post-menopausal hormone-related osteoporosis, primary and secondary hyperparathyroidism, unused osteoporosis, diabetes-related osteoporosis, glucocorticoid-related osteoporosis) , benign prostate hyperplasia, and prostate cancer. Pharmaceutical composition according to claim 7, characterized in that it is intended for the treatment or protection against said disorders selected from age-related osteoporosis, osteoporosis related to post-menopausal hormone condition, primary and secondary hyperparathyroidism, unused osteoporosis, diabetes-related osteoporosis, glucocorticoid-related osteoporosis), benign prostate hyperplasia, and prostate cancer. A method of treating or protecting against human bone growth or prostate gland disorders, comprising the method of administering a therapeutically effective amount of a composition according to any one of claims 1 to 5 to a person in need of such treatment. The method of claim 12, wherein said disorders are selected from age-related osteoporosis, post-menopausal hormone-related osteoporosis, primary and secondary hyperparathyroidism, unused osteoporosis, diabetes-related osteoporosis, glucocorticoid-related osteoporosis). benign prostatic hyperplasia and prostate cancer. Effects of various doses of GnRH II on serum calcium levels