SK284609B6 - Detergent composition comprises subtilase BLS309 variant - Google Patents

Abstract

Detergent composition comprises subtilase BLS309 variant, wherein amino acid residue situated in position 170 has been substituted by more hydrophobic amino acid residue than the original residue, whereby subtilase variant is R170L or R170I.

Description

Technical field

The invention relates to a detergent composition comprising a subtilase BLS309 variant, wherein the amino acid residue at position 170 is substituted with a more hydrophobic amino acid residue.

BACKGROUND OF THE INVENTION

In the detergent industry, enzymes have been incorporated into laundry formulations for over 30 years. Enzymes used in such formulations include proteases, lipases, amylases, cellulases, as well as other enzymes or mixtures thereof. Proteases are the most important commercially.

Although proteases have been used in the detergent industry for more than 30 years, much remains unknown regarding the details of the interaction of these enzymes with substrates and / or other substances present, for example, in detergent compositions. Some factors related to specific residues and affecting certain properties, such as oxidation properties and thermal stability, have generally been clarified, but much remains to be ascertained. It is also not yet known exactly which physical or chemical characteristics are responsible for the good washing performance or protease capability of a particular detergent composition. Most of the currently used proteases have been obtained by isolating proteases from nature and testing them in detergent formulations.

proteases

Enzymes that cleave amide bonds in protein substrates are classified as proteases or (interchangeable peptidases (see Walsh, Enzymatic Reaction Mechanisms, WH Freeman and Company, San Francisco 1979, Chapter 3).). , and an alkaline protease which is functionally a serine endopeptidase and is commonly referred to as subtilisin, and the secretion of these proteases is associated with a bacterial growth cycle with the highest protease expression during the stationary phase when sporulation also occurs Joliffe et al., J. Bacteriol. , 1199-1208, 1980 suggested that Bacillus proteases act to transform the cell wall.

subtilases

A serine protease is an enzyme that catalyzes the hydrolysis of peptide bonds and in which the serine residue is essentially at the active site (White, Handier and Smith, "Principles of Biochemistry", 5th edition, McGraw-Hill Company, NY 1973, pp. 271-272). ).

Bacterial serine proteases have molecular weights ranging from 20,000 to 45,000. They are inhibited by diisopropyl fluorophosphate. They hydrolyze single terminal esters and are similar in action to eukaryotic chymotrypsin, also a serine protease. The narrower term, alkaline protease, covering one subgroup, reflects the high pH optimum of some of the serine proteases, from pH 9.0 to 11.0 (reviewed in Priest, Bacteriological Rev. 41, 711-753, 1977).

A subset of serine proteases, tentatively designated as subtilases, have been proposed by Siezen et al., Protein Engng. 4: 719-737 (1991). It is defined by homologous analysis of more than 40 amino acid sequences of serine proteases, previously referred to as subtilisin-like proteases. Subtilisin was originally defined as a serine protease produced by Gram-positive bacteria or fungi, and now, according to Siezen et al. it is a subset of subtilases. A large number of subtilisins have been identified and the amino acid sequence of several subtilisins determined. These include more than six subtilisins from the Bacillus strain, namely subtilisin 168, subtilisin BPN ¹ , subtilisin Carlsberg, subtilisin Y, subtilisin amylosacchariticus and mesentericopeptidase (Kurihara et al., J. Biol. Chem. 247, 5629-5631, 1972; et al., Nucleic Acids Res. U, 7911-7925, 1983; Stahl and Ferrari, J. Bacteriol., 159, 811-819, 1984; Jacobs et al., Nuclear Acids Res., 13, 8913-8926, 1985; Hoppe-Seyler 366, 421-430 (1985), Svendsen et al., FEBS Lett. 196, 228-232, 1986, one actinomycetal subtilisin, Thermoactinomyces vulgaris thermitase (Meloun et al. FEBS Lett. 198: 195-200 (1985) and one fungal subtilisin, proteinase K from Tritirachium album (Jany and Mayer, Biol. Chem. HoppeSeyler 366: 584-592, 1985). For further reference, Table I of Siezen et al. Is further reproduced.

Subtilisins are well characterized both physically and chemically. In addition to knowing the primary structure (amino acid sequence) of these enzymes, more than 50 subtilisin structures have been determined by high-resolution X-ray structural analysis that outline substrate binding, transition state, products, at least three different protease inhibitors, and determine structural consequences for natural changes (Kraut, Ann) Rev. Biochem. 46, 331-358, 1977).

In the context of this application, a substrate should be interpreted in its broadest form as comprising a compound comprising at least one peptide bond susceptible to hydrolysis by a subtilisin protease.

Also, the term "product" should be interpreted in the context of the present invention as including the products of a hydrolytic reaction in which a subtilisin protease is involved. The product may be a substrate in a subsequent hydrolysis reaction.

One subset of subtilases, I-S1, includes "classical" subtilisins such as subtilisin 168, subtilisin BPN ', subtilisin Carlsberg (ALCALASE ®, NOVO NORDISK A / S) and subtilisin DY.

Siezen et al. (supra) recognized another subset of subtilase, I-S2. Proteases subgroup I-S2 are described as highly alkaline subtilisins and comprise enzymes such as subtilisin PB92 (Maxacal ^R, Gist-Brocades NV), subtilisin 309 (SAVINASE ^R, Novo Nordisk A / S), subtilisin 147 (ESPERASE ^R, NOVO NORDISK A / S) and alkaline elastase YaB.

In the context of the present invention, a subtilase variant or mutated subtilase means a subtilase produced by an organism that expresses a mutant gene derived from a parental microorganism that owns the parent or parental gene and that produces the corresponding parental enzyme, wherein the parental gene has been mutated to create the mutant gene from which said mutated subtilisin protease is produced when expressed in a suitable host.

Random and site-directed mutations of the subtilase gene arose from knowledge of the physical and chemical properties of this enzyme and yielded information regarding the catalytic activity of the subtilase, substrate specificity, tertiary structure, etc. (Wells et al., Proc. Natl. Acad. Sci. USA 84: 1219-1222, 1987; Wells et al., Phil. Trans. R. Soc. Lond. A 317. 415-423, 1986; Hwang and Warshel Biochem., 26, 2669-2673 (1987); Rao et al., Nature 328: 551-554 (1987).

More recent publications covering this area are Carter et al., Proteins 6, 240-248, 1989, relating to the design of variants that cleave a specific target sequence in a substrate (positions 24 and 64); Graycar et al., Annals of the New York Academy of Sciences 672, 71-79 (1992), which deals with several previously published results; and Takagi, Int. J. Biochem. 25, 307-312, 1993, also summarizing the previous results.

In particular, site-specific mutagenesis of subtilisin genes has attracted a lot of attention and various mutations are described in the following patent applications and patents: EP-A-130 756 (GENENTECH) (corresponding to US newly published patent No. 34 606 (GENENCOR)) concerning site-specific or random generated mutations in 'carbonyl hydrolase' and subsequent screening of the mutated enzymes for various properties, such as kca / Km ratio, pH activity profile and oxidation stability. This publication states that a site-specific mutation is feasible and that a mutation of subtilisin BPN 'at certain positions, ie,' Tyr, ³² Asp, ¹⁵⁵ Asn, ¹⁰⁴ Tyr, ²²² Met ', Gly, ⁶⁴ His, ¹⁶⁹ Gly, ¹⁸⁹ Phe, ³³ Ser, ^22I Ser, ²¹⁷ Tyr, ¹⁵⁶ Glu or ¹⁵² Ala, provides enzymes having altered properties. Since all of these positions except -1 have been known to be involved in enzyme function prior to filing this application and therefore obviously had to be selected, this application does not contribute much to the problem of deciding where to introduce mutations to enzymes having the desired properties were obtained.

EP-A-214 435 (HENKEL) concerning the cloning and expression of subtilisin Carlsberg and its two mutants. There is no reason for mutation ¹⁵⁸ Asp to ¹⁵⁸ Ser and ¹⁶ Ser to ¹⁶¹ Asp in this application.

International Patent Publication WO-A-87/04461 (AMGEN) proposes to reduce the number of Asn-Gly sequences present in the parent enzyme in order to obtain mutated enzymes having improved pH and thermal stability, while the application emphasizes removal, mutating or modifying ¹⁰⁹ Asn and ²¹⁸ Asn residues in subtilisin BPN '. No examples are given to remove or modify Gly residues.

WO-A-87/05050 (GENEX) describes a random mutation and subsequent screening of a large number of subtilisin BPN 'mutants for improved properties. Mutations at positions ²¹⁸ Asn, ¹³¹ Gly, ²⁵⁴ Thr, Gly, ¹¹⁶ Ala, ¹⁸⁸⁸ Ser ^{, 26} Leu and ⁵³ Ser are described in this application. EP-A-251 446 (GENENCOR) describes how homology considerations at the primary and tertiary structure levels can be used to identify equivalent amino acid residues, whether or not they are retained. This information, along with the inventors 'knowledge of the tertiary structure of subtilisin BPN', led the inventors to select multiple mutation-prone positions, one could expect to obtain mutants with altered properties. The positions so identified are: ¹²⁴ Met, ²²² Met, ¹⁰⁴ Tyr, ¹⁵² Ala, ¹⁵⁶ Glu, ^16S Gly, ¹⁶⁹ Gly, ¹⁸⁹ Phe, ²¹⁷ Tyr. And position ¹⁵⁵ is Asn, ^2l Tyr, ²² Thr, ²⁴ Ser, ³² Asp, ³³ Ser, ³⁶ Asp, ⁴⁶ Gly, ⁴⁸ Ala, ⁴⁹ Ser, ⁵⁰ Met, ⁷⁷ Asn, ⁸⁷ Ser, ⁹⁴ Lys, ⁹⁵ Val, ⁹⁶ Leu, ^T07 Ile, Gly ^{ll0, "70} Lys, Tyr ^{17 liters,} to ^{172, 97} Asp, ¹⁹⁹ Met, ²⁰⁴ Ser, ²¹³ Lys, and ^22, Ser identified per se, of which it can be expected to influence various properties of the enzyme. Examples of several mutations to support these proposals are also given. In addition to the individual mutations at these positions, the inventors have also made multiple multiple mutations. Furthermore, the inventors have identified ²¹⁵ Gly, ⁶⁷ His, ¹²⁶ Leu, ¹³⁵ Leu and amino acid residues in segments 97-103, 126-129, 213-215, and 152-172 as interesting, but examples of mutations in any of these positions are not listed.

Of particular interest for the purposes of the present invention, the inventors of EP-A-251 446 propose to substitute ¹⁷⁰ Lys (in subtilisin BPN ', type I-S1), specifically to introduce Glu or Arg instead of the original Lys. It is reported that the Glu variant was made and found to be highly susceptible to autolytic degradation (see pages 48, 121, 123 (Table XXI includes an obvious error but indicates a reduction in autolysis half-life from 86 to 13 minutes) and Figure 32. ).

EP-A-260 105 (GENENCOR) describes the modification of certain properties of enzymes containing a catalytic triad by selecting an amino acid residue at a distance of about 15 A from the catalytic triad and replacing the selected amino acid residue with another residue. The enzymes of the subtilase type described in this specification are specifically listed as belonging to the class of enzymes containing the catalytic triad. In subtilisins, positions 222 and 217 are indicated as preferred exchange positions.

Thomas, Russell and Fersht, Nature 318. 375-376, 1985, have shown that the exchange of Asp for Ser in subtilisin BPN 'alters the pH dependence of the enzyme.

In the following article in J. Mol. Biol. 193. 803-813, 1987, the same authors also report substitution of ¹⁵⁶ Ser instead of ¹⁵⁶ Glu. Both of these mutations are at a distance of about 15 A from the active ⁶⁴ His.

In Nature 328, 496-500, 1987, Russell and Fersht report the results of their experiments and set out the rules for changing the pH-activity profiles by mutating the enzyme to achieve surface charge changes.

WO-A-88/08028 (Genex) and WO-A-88/08033 (Amgen) relate to modifications of the amino acid residues at the calcium-binding sites of subtilisin BPN '. It has been reported that the enzyme is stabilized by substituting the more negatively charged residues for the original ones.

In WO-A-89/06279 (NOVO NORDISK A / S), position 170 is indicated as interesting and it is proposed to replace the existing residue with a Tyr residue. However, no information is given regarding such a variant. In WO-A-91/00345 (NOVO NORDISK A / S) the same is proposed and it is shown that the Tyr variant of position 170 in subtilisin 309 (type I-S2) has improved washing performance in detergents at a pH of about 8 (variant S003). in Tables III, IV, V, VI, VIII, X). The same substitution in combination with other substitutions at other positions also suggests improved wash performance (S004, SO 11 to SO 14, SO22 to SO24, SO19, SO20, S203, S225, S227 in the same table and in Table VII), fully consistent with the generic concept of that application.

EP-A-525 610 (SOLVAY) proposes to improve the stability of an enzyme (subtilase type I-S2, closely related subtilisin PB92) against ionic surfactants by reducing hydrophobicity in certain surface areas thereof. As a result, it is proposed to replace Gln with Arg at position 164 (170 if BPN 'numbering is used). No variants are described in the application, including this substitution.

WO-A-94/02618 (GIST-BROCADES N.V.) discloses several variants at position 164 (170, if BPN 'numbering is used) of subtilisin PB92 type I-S2. Examples are substituted with Met, Val, Tyr, Ile for the original Arg. Testing the washing performance of powdered detergents from these variants suggests a slight improvement. In particular, cocoa washing performance tests for variant clays indicate an improvement of about 20 to 30%. No stability data are given.

Industrial use of subtilases

Proteases, such as subtilisins, have found widespread use in industry, particularly in detergent formulations, as they are useful in removing protein stains.

It is now known that at least the following proteases are commercially available and many of them are sold in large quantities in many countries of the world:

Subtilisin BPN 'or Novo, available, for example, from SIGMA, St. Louis, U.S.A ..

Subtilisin Carlsberg, sold by NOVO NORDISK A / S (Denmark) as ALCALASE ^R and IBIS (Netherlands) as MAXATASE ^R. Both belong to the subtilase subgroup I-S1.

Among subtilas of subgroup I-S2, the following are known to be marketed:

Subtilisin from Bacillus lentus, subtilisin 309, sold by NOVO NORDISK A / S (Denmark) as SAVINASE ^R. The engineered protein variant of this enzyme is marketed as DURAZYM ^r .

Enzymes very similar to SAVINASE ^R , such as subtilisin PB92, MAXACAL ^r , sold by Gist-Brocades NV (an artificially developed protein variant of this enzyme is sold as MAXAPEM ^r ), OPTICLEAN ^R , sold by SOLVAY et Cie., And PURAFECT ^r , sold by GENENCOR Intemational.

Subtilisin from Bacillus lentus, subtilisin 147, sold by NOVO NORDISK A / S (Denmark) as ESPERASE ^R. However, to be effective, such enzymes must not only have efficacy under washing conditions, but must also be compatible with other detergent ingredients during detergent production and storage.

For example, subtilisins may be used in combination with other enzymes active against other substrates, and the selected subtilisin should be stable against such enzymes, and the selected subtilisin should preferably not catalyze the degradation of other enzymes. The selected subtilisin should also be resistant to the action of other ingredients in the detergent formulation, such as bleaching agents, oxidizing agents, etc., wherein the enzyme used in the detergent formulation should in particular be stable with respect to oxidative power, calcium binding properties and pH conditions , kept by the non-enzymatic components in the detergent during storage and in the wash solution during the wash.

The ability of an enzyme to catalyze the degradation of various naturally occurring substrates present on articles to be cleaned, for example during laundering, is often referred to as its laundering, laundering, detergent or laundering efficacy. In this application, the term laundering effectiveness will be used to include this property.

The ability of the enzyme to remain active in the presence of other components of the detergent composition prior to use (normally by adding water in the laundry process) is commonly referred to as shelf life or shelf life. It is often measured as the half-life t _t / ₂ . In this application we will use the term shelf life for this property to include this property.

Naturally occurring subtilisins have been found to have properties that vary strongly in relation to washing performance or ability to change parameters such as pH. Indeed, some of the detergent proteases marketed above have higher efficacy than those sold 20 years ago, but for optimal efficacy, each enzyme has its own specific formulation and wash conditions such as pH, temperature, ionic strength (=

I), active system (surfactants, surfactants, bleach, etc.), fillers, etc ..

As a result, it has been found that an enzyme having desirable properties at low pH and low I may be less interesting under more basic conditions and high I, or an enzyme having excellent properties at high pH and high I may be less interesting under conditions low pH and low 1.

It has also been found that shelf life varies between enzymes, but further it has been found that a specific enzyme has large shifts in shelf life due to various detergent formulations depending on a number of parameters such as pH, pl, bleaching system, surfactants etc., and the physical state of the detergent compositions, which may be in powder, powder or liquid form. Further, it may be concentrated or diluted.

The discovery and development of recombinant DNA technologies have had a major impact in the field of protein chemistry.

By applying this technology, it is now possible to construct enzymes with the desired amino acid sequences and, as indicated, considerable research capacity has been devoted to designing subtilisins with altered properties.

Among these proposals, a method for producing and screening a large number of mutant enzymes, as described in EP-A130 756 (GENENTECH) (US newly-issued Patent No. 34,606 (GENENCOR)) and International Patent Publication No. 5,960,549. WO-A-87/05050 (GENEX) corresponds largely to the classical method of isolating natural enzymes, subjecting them to classical mutagenesis programs (using radiation or chemical mutagens) and screening them for their properties. The difference is that these methods are more effective due to the knowledge of the presence of a large number of variant enzymes substituted at a specific position.

The subtilisin enzyme typically contains about 275 amino acid residues. Each residue may be one of the 20 possible naturally occurring amino acids. Therefore, one very serious disadvantage of this approach is the very large number of mutations generated that need to be submitted for several preliminary screenings to determine their properties.

As a result, the procedure described in these patent applications will be little better than the traditional random mutation procedures that have been known for a long time.

Other known methods relate to changing specific properties such as oxidation stability, thermal stability, Ca-stability, transesterification and hydrolysis rate (EP-A-260 105 (GENENCOR)), pH activity profile (Thomas, Russell and Fersht, supra ) and substrate specificity (WO-A-88/07578 (GENENTECH)). None of these documents relates to a change in either the washing efficiency of the enzymes or their shelf life.

In International patent application no. PCT / DK 88/00002 (NOVO NORDISK A / S) proposes to use the concept of homologous comparison to determine which amino acid positions should be selected for mutation and which amino acids should be substituted in these positions in order to obtain the desired change in washing performance .

Using such a procedure drastically reduces the role of the screening since the number of mutants generated is much smaller, but by this procedure it can only be assumed that enzymes having combined useful properties of the parent enzyme and the enzyme used for comparison can be obtained.

Thus, as we have indicated, so far no relationship has been found between the well-defined properties of the enzyme as mentioned and the washing efficiency and shelf life of the enzyme in various detergent compositions.

The problem seems to be that, although much research has focused on elucidating the mechanism of enzyme activity, little is known about the factors in the structure and combination of amino acid residues that determine the properties of enzymes, such as the shelf-life of detergents, relative to most of them. characteristics, especially when the enzymes are present in complex mixtures.

Consequently, there is still a need for further enhancement and tailor-made enzymes for detergent systems, as well as a better understanding of the mechanism of action and degradation of proteases in the practical use of detergent or detergent compositions. Such an understanding could result in rules that can be applied to the selection of mutations that, with a reasonable degree of probability, will result in an enzyme having improved shelf life and / or efficacy under specific conditions in the detergent composition.

SUMMARY OF THE INVENTION

The present invention provides a detergent composition comprising a subtilase BLS309 variant wherein the amino acid residue at position 170 is substituted with a more hydrophobic amino acid residue as compared to the original, wherein the substilase variant is R170L or R170I.

The present invention therefore also relates to BLS309 enzyme variants having improved stability and / or laundering performance in detergents, particularly liquid detergents, especially concentrated liquid detergents, and in soap bars.

Abbreviations Amino acids A = Ala = alanine

V = Val = valine L = Leu = leucine

I = white = isoleucine P = Pro = proline F = Phe = phenylalanine W = Trp = tryptophan M = Met = mctionin G = Gly = glycine S = Ser = serine T = Thr = threonine C = Cys = cysteine

Y = Tyr = tyrosine

N = Asn = asparagine Q = Gln = glutamine D = Asp = aspartic acid E = Glu = glutamic acid K = Lys = lysine R = Arg = arginine H = His = histidine

Nucleic acid bases

A = adenine

G = guanine

C = cytosine

T = thymine (DNA only) U = uracil (DNA only)

variants

In describing the various enzyme variants prepared or to be prepared according to the present invention, the following nomenclature has been adopted for simple labeling: Original amino acid (s) - position (s) - substituted amino acid (s).

Accordingly, the substitution of glutamic acid for glycine at position 195 is designated as: Gly 195 Glu or G195E, the removal of glycine at the same position is: Gly 195 * or G195 *, and the insertion of an additional amino acid residue such as lysine is: Gly 195 GlyLys or G195GK.

Where removal is indicated, insertion at such position is indicated by: * 36 Asp or * 36D to insert aspartic acid at position 36.

Multiple mutations are separated by a plus (+), i.e., Arg

170 Tyr + Gly 195 Glu or R170Y + G195E which represents mutations at positions 170 and 195 substituting tyrosine and glutamic acid for arginine and glycine.

DETAILED DESCRIPTION OF THE INVENTION

Surprisingly, it has been found that the shelf life and / or efficacy of the subtilias in detergents is improved when the amino acid residues located around the hydrophobic region of subtilisin 309 are replaced by a more hydrophobic residue.

Fig. 2 shows the hydrophobic region in subtilisin 309 and residues around it, several of which are to be substituted to increase the hydrophobicity of the region. This can be achieved by substituting the hydrophobic residues for the non-hydrophobic residues and / or by substituting the residues to become even more hydrophobic than in the parent enzyme.

Residues in and around the hydrophobic area BLS309:

Hydrophobic Area: Rest

129P

131P

165i

167Y

171Y

Surrounding the hydrophobic area

136E

159g

164S

170R

194A

195g

variants

In accordance with the invention, BLS309 variants of R170L or R170I may be combined with other substitutions, insertions or deletions at any other position, with preferred positions being positions 36, 57, 76, 218, 222 and 224.

In a preferred embodiment, the additional change is selected from the group consisting of * 36D, S57P, N76D, N218S, M222S, M222A and T224S.

Preferred BLS309 variants of the invention include:

(a) S57P + R170L; and ´) S57P + R170I

(b) R170L + N218S; b ') R170I + N218S

c) S57P + R170L + N218S

(c) S57P + V104Y + R170L + N218S. c ') S57P + V104Y + R170I + N218S.

d) R170L + N218S + M222A (d) R170L + N218S + M222A (d) R170I + N218S + M222A (d) R170I + N218S + M222S

(e) S57P + R170L + S188P + A194P (e) S57P + R170I + S188P + A194P

f) Y167L + R170L f ”) Y167L + R170I

g) Y167I + R170L g ') Y167I + R170I

h) N76D + R170L + N218S

(i) S57P + N76D + R170L + N218S i ') S57P + N76D + R170I + N218S

j) N76D + R170L + N218S + M222A j ') N76D + R170I + N218S + M222S j' ') N76D + R170L + N218S + M222A j') N76D + R170L + N218S + M222S

(k) S57P + R170I + S188P + A194P + N218S k ') S57P + R170I + S188P + A194P + N218S

L) * 36D + N76D + H 120D + R170L + G195E + K23 5L 1 ') * 36D + N76D + H 120D + R170I + G195E + K235L

(m) N76D + H120D + R170L + G195E + K235L m ') N76D + H120D + R170I + G195E + K235L

n) * 36D + G97N + V 104Y + H120D + R170L + A194P + G195E + K235L

ï) * 36D + G97N + V104Y + H120D + R170I + A194P + G195 E + + K235L

o) S57P + R170L + Q206E

p) R170L + Q206E. p ') R170I + Q206E

q) Y167I + R170L + Q206E q ´) Y167I + R170I + Q206E

r) Y167F + R170L r ¹⁾ Y167F + R170I

t) Y167I + R170L + A194P »Y167I + R170I + A194P

u) Y167I + R170I + N218S u ') Y167I + R170I + N218S

(v) Y167I + R170L + A194P + N218S v ') Y167I + R170I + A194P + N218S

(x) R170L + P131V (x ') R170I + P131V

y) * 36D + Y168I + R170L y ') * 36D + Y168I + R170I

z) Y167I + Y171I aa) Y167V + R170L aa ') Y167V + R170I

Detergent compositions containing mutated enzymes

The invention also encompasses the use of the mutated enzymes of the invention in detergent and detergent compositions, and such compositions comprising the mutated BLS309 enzymes. Such cleaning and detergent compositions may in principle be in any physical form, but the subtilase variants are preferably incorporated into liquid detergent compositions or detergent compositions in the form of pieces, tablets, sticks and the like for direct use in which they have improved enzyme stability.

Among the detergent compositions of the present invention are, in particular, liquid detergents, in particular aqueous liquid detergents having, for example, a homogeneous physical nature, e.g. they may consist of a micelle solution of surfactants in a continuous aqueous phase, the so-called isotropic liquids.

Alternatively and preferably, they may have a heterogeneous physical phase and may be structured, for example consisting of a dispersion of lamellar droplets in a continuous aqueous phase, for example comprising a deflocculating polymer with a hydrophilic backbone and at least one side hydrophobic chain as described in EP-A-346 995 (Unilever) (incorporated herein by reference). These latter liquids are heterogeneous and may contain suspended solid particles such as filler material particles, for example of the following types.

The liquid cleaning and detergent compositions of the present invention should preferably have a high electrolyte concentration as described in EP-A-328 177, EP-A-359 308, EPA-328 176, EP-A-346 995 (all Unilever) .

Such compositions comprise, in addition to any one or more variants of the subtilisin enzymes according to any of the foregoing aspects of the invention, alone or in combination, any of the customary ingredients included in such compositions, which are well known to those skilled in the art.

Such components include fillers such as phosphate or zeolite fillers, surfactants such as anionic, cationic, nonionic or zwitterionic type surfactants, polymers such as acrylic or equivalent polymers, bleaching systems such as perborates or amino-containing bleach precursors or activators , structuring agents such as silicate structuring agents, a base or acid for adjusting the pH, wetting agents and / or neutral inorganic salts.

In addition, several optional ingredients are normally present in the composition of the invention, such as:

A. Optional surface-active co-agents

B. Tartrate succinate fillers

C. Neutralization system

D. Suds suppressant

E. Other enzymes

F. Other optional ingredients.

The weight ratio of synthetic anionic surfactant to ethoxylated nonionic surfactant is from 1: 1 to 5: 1. solution in water at 20 ° C pH 7.0 to 9.0, critical micelle concentration less than or equal to 200 ppm and air / water interfacial tension at critical micelle concentration less than or equal to 32 dynes / cm at 35 ° C in distilled water water. The compositions are preferably clear, homogeneous and phase stable and have good washing performance and enzyme stability.

Various components:

Synthetic anionic surfactant

The liquid detergent compositions of the present invention comprise from about 10 wt. % to about 50 wt.%, preferably from about 15 wt. % to about 50 wt.%, more preferably from about 20 wt. % to 40 wt. % and most preferably from 20 wt. % to about 30 wt. a natural or synthetic surfactant. Suitable natural or synthetic anionic surfactants are e.g. soaps and those described in US-A-4,285,841 and US-A-3,929,678.

Useful anionic surfactants include water-soluble salts, especially alkali metals, ammonium and alkylammonium (e.g., monoethanolammonium or triethanolammonium) salts of organic sulfur reaction products having an alkyl group containing from about 10 to about 20 carbon atoms and an ester group in their molecular structure. sulfonic or sulfuric acid (the alkyl portion of the aryl groups is included in the term alkyl). Examples of this class of synthetic surfactants are alkyl sulfates, especially those obtained by sulfating higher alcohols (C ₈ -C ₁₈ carbon atoms), such as those formed by reducing the glycerides of tallow or coconut oil; and alkylbenzenesulfonates in which the alkyl group contains from about 9 to about 15 carbon atoms in a linear or branched chain configuration, for example of the type described in U.S. Patents 2,220,099 and 2,477,383. Of particular interest are linear chain alkylbenzenesulfonates in which the average the number of carbon atoms in the alkyl group is from about 11 to 14.

Other anionic surfactants are the water-soluble salts herein: paraffin sulfonates containing from 8 to about 24 (preferably about 12 to 18) carbon atoms; alkyl glyceryl ether sulfonates, especially those ethers of C ₈ -C ₁₈ alcohols (e.g., derived from tallow and coconut oil); alkylphenolethylene oxide ether sulfates containing from 1 to about 4 ethylene oxide units per molecule and from 8 to 12 carbon atoms in the alkyl group; and alkylethylene oxide ether sulfates containing 1 to 4 ethylene oxide units per molecule and from 10 to 20 carbon atoms in the alkyl group.

Other useful anionic surfactants include the water-soluble salts of esters of α-sulfonated fatty acids containing from 6 to 20 carbon atoms in the fatty acid group and from 1 to 10 carbon atoms in the ester group; water-soluble salts of 2-acyloxy-alkane-1-sulfonic acids containing from 2 to 9 carbon atoms in the acyl group and from 9 to 23 carbon atoms in the alkane moiety; water-soluble salts of olefin sulfonates containing from 12 to 24 carbon atoms; and β-alkyloxyalkanesulfonates containing from 1 to 3 carbon atoms in the alkyl group and from 8 to 20 carbon atoms in the alkane moiety.

Preferred anionic surfactants are C 10 -C ₁₈ alkyl sulfates and alkyl ethoxy sulfates containing on average up to 4 ethylene oxide units per mole of alkyl sulfate, C 11 -C ₁₃ linear alkyl benzene sulfonates, and mixtures thereof.

2. Ethoxylated nonionic surfactant

The second optional additive is from 2 wt. % to 14 wt.%, preferably from 2 wt. % to 8 wt.%, most preferably from 3 wt. % to 5 wt. an ethoxylated nonionic surfactant. The weight ratio of synthetic anionic surfactant (acid-based) to nonionic surfactant is from 1: 1 to 5: 1, preferably from 2: 1 to 5: 1, most preferably from 3: 1 to 4: 1. and adsorption of hard enough surfactants at the air / water interface to ensure good removal of greasy / oily contaminants.

The ethoxylated nonionic surfactant is of the formula ^R1 (OC2H4) nOH wherein ^R1 is a _Ci0-C16 alkyl group or a _C8-I2 alkyl phenyl group, n is from 3 to 9, and said nonionic surfactant has an HLB (hydrophilic-a lipophilic ratio These surfactants are described in more detail in US-A-4,285,841 and US-A-4,284,532. Particularly preferred are C ₁₂ -C ₁₁ condensation products. ₅ alcohols with 3 to 8 moles of ethylene oxide per mole of alcohol, e.g. C ₁₂ -C ₁₃ alcohol, condensed with about 6.5 moles of ethylene oxide per mole of alcohol. Other nonionic surfactants to be mentioned are APG, EGE and glucamide surfactants. ³

3. Detergent fillers

Among the typical detergent ingredients that may be present in the usual amounts in the detergent compositions of the present invention are the following: The compositions may be filled or unfilled and may be of the zero-P type (i.e., not containing phosphorus-containing fillers). Thus, the composition may contain, for example, from 1 to 50 wt% in the aggregate, for example at least about 5 wt%. and often up to about 35 to 40 wt. % of one or more organic and / or inorganic fillers. Typical examples of fillers include those already mentioned and broadly include alkali metal ortho-, pyro- and tripolyphosphates, alkali metal carbonates, either alone or with admixture of calcite, alkali metal citrates, alkali metal nitrilotriacetates, carboxymethyloxysuccinates, zeolites, polyacetal carboxylates etc.

More specifically, the compositions herein comprise from 5 to 20 wt%, preferably from 10 to 15 wt%. a detergent filler which may be a fatty acid containing from 10 to 18 carbon atoms and / or a polycarboxylate, zeolite, polyphosphonate and / or polyphosphate filler. 0 to 10 wt. % (more preferably from 3 to 10% by weight) of saturated fatty acids containing from 12 to 14 carbon atoms, together with from 0 to 10% by weight, more preferably from 2 to 8% by weight, most preferably from 2 to 5% by weight. a polycarboxylate filler, most preferably citric acid, in a weight ratio of from 1: 1 to 3: 1.

Since the proteolytic enzymes used herein provide optimal storage stability advantages over other enzymes when the ratio of filler to water hardness is close to one, the compositions preferably contain sufficient filler to mask from 2 to 10, preferably from 3 to 8 degrees of hardness to 4, 5 1 (gallon) of water.

Suitable saturated fatty acids may be obtained from natural sources such as vegetable or animal esters (e.g. palm kernel oil, palm oil and coconut oil) or may be synthetically prepared (e.g., by oxidation of oil or hydrogenation of carbon monoxide by the Fisher-Tropsch process). Examples of saturated fatty acids suitable for use in the compositions of this invention include capric, lauric, myristic, coconut and palm kernel fatty acids. Saturated coconut fatty acids are preferred; mixtures with a weight ratio of from 5: 1 to 1: 1 (preferably about 3: 1) of lauric and myristic acid; said mixtures with small amounts (e.g. 1 to 30% by weight of the total amount of fatty acids) of oleic acid; and palm kernel fatty acid.

The compositions used herein preferably also contain the polycarboxylate, polyphosphonate and polyphosphate fillers described in US-A-4,284,532. From this group, water-soluble polycarboxylate fillers, especially citrates, are preferred. Suitable polycarboxylate fillers include various aminopolycarboxylates, cycloalkane polycarboxylates, ether polycarboxylates, alkyl polycarboxylates, epoxy polycarboxylates, tetrahydrofuran polycarboxylates, benzene polycarboxylates, and polyacetal polycarboxylates.

Examples of such polycarboxylate builders are sodium and potassium ethylenediaminetetraacetate; sodium and potassium nitrilotriacetate; water-soluble salts of phytic acid, for example sodium and potassium phytate, described in US-A-1 739 942, polycarboxylate materials described in US-A-3 364 103; and the water-soluble salts of polycarboxylate polymers and copolymers described in US-A-3 308 067.

Other useful detergent builders include the water-soluble salts of polymeric aliphatic polycarboxylic acids with the following structural and physical characteristics: (a) a minimum molecular weight of about 350, calculated for the acid form; (b) a weight equivalent of 50 to 80, calculated for the acid form; (c) at least 45 mole percent of the monomeric form has at least two carboxyl radicals separated by no more than two carbon atoms; (d) the point of attachment of the polymer chain of any carboxyl-containing radical is separated by no more than three carbon atoms along the polymer chain from the point of attachment of the next carboxyl-containing radical. Particular examples of such fillers are polymers and copolymers of itaconic acid, aconitic acid, maleic acid, mesaconic acid, fumaric acid, methylene malonic acid and citraconic acid.

Other suitable polycarboxylate builders include water-soluble salts, especially sodium and potassium salts, mellitic acid, citric acid, pyromellitic acid, benzenepentacarboxylic acid, oxydiacetic acid, carboxymethyloxysuccinic acid, carboxymethyloxymalonic acid, cis-cyclohexanecarboxylic acid, cis-cyclohexanecarboxylic acid, cis-cyclohexanecarboxylic acid.

Other polycarboxylates are the polyacetal carboxylates described in US-A-4 144 226 and US-A-4 146 495.

Other detergent builders include zeolites such as the aluminosilicate ion exchange material described in US-A-4 405 483.

Other preferred fillers are those having the general formula R-CH (COOH) CH ₂ (COOH), i.e. succinic acid derivatives, wherein R is C ₁₀ -C ₂₀ alkyl or alkenyl, preferably C ₁ -C ₂₀ alkyl or alkenyl. _{2- C16} , or wherein R may be substituted with hydroxyl, sulfo, sulfoxy or sultane substituents. These succinate fillers are preferably used in the form of their water-soluble salts, including sodium, potassium and alkanolammonium salts. Specific examples of succinate fillers include: laurylsuccinate, myristylsuccinate, palmitylsuccinate, 2-dodecenylsuccinate and the like.

4. Proteolytic enzyme

The enzymes of the invention may be used in well-known standard amounts in detergent compositions. These amounts may vary over a very wide range, for example about 0.0002 to 0.1, for example about 0.005 to 0.05 Anson units per gram of detergent composition. Expressed in alternative units, the protease may be included in the compositions in amounts of the order of from about 0.1 to 100 GU / mg (for example 1 to 50, especially 5 to 20 GU / mg) of the detergent formulation, or in any amount over a wide range. the mean is about 0.01 to 4, for example 0.1 to 0.4 KNPU per g detergent formulation.

For example, it may be appropriate to use these enzymes in an amount of about 0.25 mg of enzyme protein per liter of wash solution, corresponding to an enzyme activity of the order of 0.08 KNPU per liter. Corresponding detergent formulations may contain enzymes in an amount of, for example, the order of 0.1 to 0.4 KNPU / g.

In other words, the compositions of the present invention contain from about 0.01 wt. % to about 5 wt.%, preferably from about 0.1 wt. % to about 2 wt. proteolytic enzymes of the invention.

The proteolytic enzyme described is preferably included in an amount sufficient to provide activity from 0.05 to about 1.0, more preferably from about 0.1 to 0.75, most preferably from about 0.125 to about 0.5 mg of active enzyme per gram of the composition.

5. Enzymes stabilizing system

Liquid detergents according to the invention may contain an enzyme-stabilizing system including calcium ion, boric acid, propylene glycol and / or short-chain carboxylic acids. The enzyme stabilizing system comprises from about 0.5 wt. up to about 15% by weight of the composition.

The composition preferably comprises from about 0.01 to about 50, preferably from about 0.1 to about 30, more preferably from about 1 to 20 millimoles of calcium ion per liter. The calcium ion level should be selected such that there will always be a certain minimum level available for the enzyme after allowing complexation with the fillers, etc., in the mixture. Any water-soluble calcium salt, including calcium chloride, calcium formate and calcium acetate, may be used as the source of calcium ion. A small amount of calcium ion, generally from about 0.05 to 0.4 millimoles per liter, is often also present in the mixture due to the presence of calcium in the enzyme susceptibility and formula water. Preferably, from about 0.03 wt. % to about 0.6 wt. calcium formate.

A second preferred enzyme stabilizer is polyols containing only carbon, hydrogen and oxygen atoms. Preferably, they contain from 2 to 6 carbon atoms and from 2 to 6 hydroxy groups. Examples include propylene glycol (especially 1,2-propanediol, which is preferred), ethylene glycol, glycerol, sorbitol, mannitol, and glucose. Polyol generally represents from about 0.5 wt. % to 15 wt.%, preferably from about 1.5 wt. to about 8% by weight of the composition. The weight ratio of polyol to optionally added boric acid is preferably at least 1, more preferably at least 1.3.

The compositions also preferably contain the water-soluble short chain carboxylates described in US-A-4,318,818. Formates are preferred and can be used at levels of from about 0.05 wt% to about 5 wt%, preferably from about 0 wt%. 2 wt.% To about 2 wt.%, Most preferably from 0.4 wt. to 1.5% by weight of the composition. Sodium formate is preferred.

The compositions herein also optionally comprise from about 0.25 wt. % to about 5 wt.%, most preferably from about 0.5 wt. % to about 3 wt. boric acid. Boric acid can form, but preferably does not form, a compound capable of forming boric acid in the mixture. Boric acid is preferred, although other compounds such as boron oxide, borax and other alkali metal borates (e.g., ortho-, meta-sodium pyroborate and sodium pentaborate) are also suitable. Substituted boric acids (e.g. phenylboronic acid, butaneboric acid and p-bromophenylboronic acid) may also be used in place of boric acid.

6. Water

The liquid detergent compositions of the present invention may be aqueous solutions or non-aqueous solutions. If they are aqueous solutions, they comprise from about 15% by weight to about 60% by weight, preferably from about 25% by weight. to about 45% by weight of water.

Other optional components

A. Optional surface-active co-agents

Optional surfactant co-agents for use with said ethoxylated nonionic surfactants include amides of the formula

OR ²

I

R ¹ -CNR ³ wherein R ¹ is an alkyl, hydroxyalkyl or alkenyl radical containing from 8 to 20 carbon atoms and R ² and R ³ are selected from the group consisting of hydrogen, methyl, ethyl, propyl, isopropyl, hydroxyethyl, 2-hydroxypropyl, 3-hydroxypropyl, and said radicals additionally containing up to 5 ethylene oxide units, provided that at least one of R ² and R ³ a hydroxy group.

Preferred amides are C ₈ -C ₂₀ fatty acid alkylolamides in which each alkyl group contains from 1 to 3 carbon atoms and can additionally contain up to 2 ethylene oxide units. Particularly preferred are C12- _C16 fatty acid monoethanol and diethanolamides.

If used, the amides are preferably present at a level such that said ethoxylated nonionic surfactant and amide surfactant are in a weight ratio of from 4: 1 to 1: 4, preferably from 3: 1 to 1: 3.

Preferred and optional surfactants are used in an amount of from 0.15 wt. Quaternary ammonium, amine and amine oxide surfactants are disclosed in US-A-4,507,219.

Of these, C ₁₀ -C ₁₄ alkyltrimethylammonium salts are preferred, for example decyltrimethylammonium methyl sulfate, lauryltrimethylammonium chloride, myristyltrimethylammonium bromide, and coconut trimethylammonium chloride and methyl sulfate. Preferably, from 0.2 wt. % to 0.8 wt. monoalkyltrimetylamóniumchloridu.

B. Tartrate-succinate fillers

The compositions used herein preferably comprise from 0 to about 10 wt%, preferably from 0 to about 6 wt%, based on an acid, tartrate succinate filler material selected from the group consisting of:

i) HOCH - CH 0 - CH - CH ₂

Wherein X is a salt-forming cation;

ii) CH ₂ -CH-O-CH-CH-O-CH-CH ₂

COOX COOX COOX COOX COOX COOX wherein X is a salt-forming cation; and iii) mixtures thereof.

The tartrate succinate compounds used herein are described in US-A-4,663,071.

C. Neutralization system

The compositions of the invention may also optionally contain from about 0 to about 0.04 mol, preferably from about 0.01 to 0.035 mol, more preferably from about 0.015 to about 0.03 mol, per 100 grams of an alkanolamine mixture selected from the group consisting of monoethanolamine, diethanolamine, triethanolamine and mixtures thereof. Low levels of alkanolamines, especially monoethanolamine, are advantageous to increase product stability, wash performance and odor. However, the amount of alkanolamine should be minimized for best compatibility with the chlorine bleach.

In addition, the compositions contain sodium ions and preferably potassium ions, at a level sufficient to neutralize the anionic groups and provide the desired pH of the product.

D. Foaming suppressant

Another optional component for use in the liquid detergents of the present invention is from 0 to about 1.5 wt%, preferably from about 0.5 wt%. % to about 1.0 wt. silicone-based suds suppressors.

Silicones are widely known and are recommended for use as high performance suds control agents. For example, US-A-3,455,839 relates to compositions and processes for defoaming aqueous solutions by incorporating small amounts of polydimethylsiloxane liquids therein.

Useful silicones for controlling foaming are mixtures of silicone and silanized silica, as described, for example, in German Patent Application DE-A-2 124 526.

Silicone antifoams and suds control agents have been successfully incorporated into granular detergent compositions by protecting them from detergent surfactants, as in U.S. Patents 3,933,672 and 4,652,392.

A preferred silicone-based suds suppressor for use in the present invention is a suds suppressing amount of a suds control agent consisting essentially of:

(i) a polydimethylsiloxane liquid having a viscosity of from about 20 cs to about 1500 cs at 25 ° C;

(ii) from about 5 to about 50 parts per 100 parts by weight of (i) a siloxane resin consisting of (CH ₃ ) ₃ SiO _1/2 units and SiO ₂ units in a ratio of (CH ₃ ) ₃ SiO _1/2 units to SiO ₂ units from about 0.6: 1 to about 1.2: 1;

(iii) from about 1 to about 20 parts per 100 parts by weight of (i) solid silica gel.

By "soap suppressant" is meant that the formulator can select an amount of this suds control agent that will control the suds to the desired extent. The amount of suds control agent will vary with the detergent surfactant selected. For example, relatively more suds control agents are used with high sudsing surfactants to achieve the desired suds control than with low suds surfactants.

E. Other enzymes

The detergent compositions of the present invention may also contain other enzymes.

For example, the lipase may conveniently be added in the form of a granular mixture (alternative solution) or a lipolytic enzyme suspension with a carrier material (e.g. as in EP-A-258 068 (Novo Nordisk A / S)).

The amount of lipase added may be selected within wide limits, for example 50 to 30,000 LU / g of surfactant or detergent composition system, for example often at least 100 LU / g, very usefully at least 500 LU / g, sometimes preferably above 1000, above 2000 LU / g or above 4000 LU / g or more, very often in the range 50 to 4000 LU / g and preferably in the range 200 to 1000 LU / g. In this specification, lipase units are defined as defined in EP-A-258 068.

The lipolytic enzyme can be selected from a wide variety of lipases. In particular, lipases, as described, for example, in the following patent descriptions: EP-A-214 761 (Novo Nordisk A / S), EP-A-258 068, and in particular lipases having immunological cross-reactivity with antisera arising from lipase from Thermomyces lanuginosus ATCC 22070, EP-A-205 208 and EP-A-206 390, and in particular lipases having immunological cross-reactivity with an antiserum raised against a lipase from Chromobacter viscosum var lipolyticum NRRL B-3673 or against a lipase from Alcaligenes PL-679, ATCC 31371 and FERM-P 3783, also lipases, described in WO 87/00859 (Gist-Brocades) and EP-A-204 284 (Sapporo Breweries). Particularly suitable are, for example, the following commercially available lipase preparations: Lipolase ™ Novo Nordisk A / S, Amano lipases CE, P, B, AP, M-AP, AML and CES, and Meito lipases MY-30, OF and PL, also Esterase ^R MM, Lipozyme, SP225, SP285 (all Novo Nordisk), Saiken Lipase, Enzeco Lipase, Toyo Joza Lipase and Diosynth Lipase (Trademarks), Lumafast ^R (Genencor Inc.), Lipomax ^R (Gist-Brocades NV), and Lipases , described in WO-A-94/03578 (Unilever).

For example, if desired, amylase may be used in an amount ranging from about 1 to about 100 MU (maltose units) per gram of detergent composition (or 0.014 to 1.4, for example 0.07 to 0.7 KNU / g (Novo). units)). Suitable amylases are, for example, Termamyl ^R and BAN (Novo Nordisk A / S). For example, cellulase can be used, for example, in an amount ranging from about 0.3 to about 35 CEVUs per gram of detergent composition. Suitable celluloses are, for example, Celluzyme ^R and Carezyme ^R (Novo Nordisk A / S).

Other enzymes contemplated for use in the present invention are oxidases and peroxidases.

F. Other optional components

Other optional ingredients for use in the liquid detergents of the present invention include soil removal agents, soil release polymers, anti-settling agents such as tetraethylenepentamine ethoxylate (from about 0.5 wt% to 3 wt%, preferably from about 1 wt%). foaming regulators, hydrotropes such as sodium cumenesulfonate, opacifying agents, antioxidants, bactericides, dyes, perfumes, and brighteners known in the art. Such optional components generally represent less than about 15 wt%, preferably from about 0.5 wt%. % to 10 wt.%, more preferably from about 1 wt. % to about 10 wt. mixture.

The compositions may contain from 0 wt. % to about 8 wt.%, preferably from 0 wt. % to about 5 wt. C12-C14 alkenylsuccinic acid or a salt thereof. These materials have the general formula R-CH (COOX) CH ₂ (COOX), wherein R is a C 12 -C 14 alkenyl group and each X is H or a suitable cation such as sodium, potassium, ammonium or alkanolammonium (e.g. mono-, di- or trictanolammonium). Specific examples are 2-dodecenylsuccinate (preferred) and 2-tetradecenylsuccinate.

The compositions herein optionally comprise from about 0.1 wt. % to about 1 wt.%, preferably from about 0.2 wt. % to about 0.6 wt. water-soluble salts of ethylenediaminetetramethylenephosphonic acid, diethylenetriaminepentamethylenephosphonic acid, ethylenediaminetetraacetic acid (preferred) or diethylenetriaminepentaacetic acid (most preferably) to enhance the cleaning performance of the fabric pretreatment.

In addition, detergent compositions may contain from 1 to 35 wt. a bleaching agent or a bleaching precursor or a system consisting of a bleaching agent and / or a precursor with its activator.

Other optional ingredients are suds boosters, anti-corrosion agents, soil-suspending agents, masking agents, soil-repellent agents, and so on.

The compositions used herein preferably contain up to 10 wt. ethanol.

G. Other characteristics

The instantly soluble mixture typically has a pH in 10 wt. % solution in water at 20 ° C from about 7.0 to 9.0, preferably from about 8.0 to about 8.5.

The instantly soluble compositions may also have a critical micelle concentration (CMC) of less than or equal to 200 parts per million (ppm) and an air / water interfacial tension above CMC of less than or equal to 32, preferably less than or equal to 30 dynes per centimeter at 35 ° C in distilled water. These measurements are described in "Measurement of Interfacial Tension and Surface Tension - General Review for Practical Man" by C. Weser, GIT Fachzeitschrift fiir das Laboratories 24, 642-648 and 734-742, 1980, FIT Verlag Emst Giebeler, Darmstadt, and Interfacial Phenomena - Equilibrium and Dynamic Effects ”, CA. Miller and P. Neogi, Chapter 1, p. 29-36, Marcel Dekker, Inc., New York 1985.

The compositions of the present invention can be used to wash textile materials, in particular, but not limited to, cotton and polyester fabrics and mixtures thereof. For example, washing processes performed at temperatures of about 60 to 65 ° C or below, for example about 30 to 35 ° C or below, are particularly suitable. It may be very convenient to use these compositions in an amount sufficient to provide, for example, about 0.4 to 0.8 g / L of surfactant in the wash solution, although lower or higher concentrations may, of course, be used if desired. For example, without limitation, an amount of from about 1 to 10 g / L, for example from about 3 to 6 g / L, of a detergent formulation is suitable for use when the formulations are substantially as set forth in the Examples. .

In this regard, the invention relates in particular to:

(a) A detergent composition, formulated as an aqueous detergent liquid, comprising an anionic surfactant, a naionic surfactant, a wetting agent, an organic acid, a caustic alkali, at a pH adjusted to between 9 and 10.

b) A detergent composition formulated as a non-aqueous detergent liquid comprising a liquid, non-ionic surfactant consisting essentially of a linear alkoxylated primary alcohol, triacetin, sodium triphosphate, caustic alkali, a bleach precursor of perborate monohydrate and a bleach activator of tertiary, tertiary set to between about 9 and 10.

c) An enzymatic liquid detergent composition formulated to provide a pH of the wash solution of 9 or less when used in an amount corresponding to 0.4 to 0.8 g / L of surfactant.

d) An enzymatic liquid detergent composition formulated to provide a pH of the wash solution of 8.5 or more when used in an amount corresponding to 0.4 to 0.8 g / L of surfactant.

e) An enzymatic liquid detergent composition formulated to provide a wash solution ionic strength of 0.03 or less, for example 0.02 or less, when used in an amount corresponding to 0.4 to 0.8 g / l of surfactant.

f) An enzymatic liquid detergent composition formulated to provide an ionic strength of the wash solution of 0.01 or more, for example 0.02 or more, when used in an amount corresponding to 0.4 to 0.8 g / L of surfactant.

It has been found that the subtilase variants of the invention may also usefully be incorporated into detergent compositions in the form of pieces, tablets, sticks and the like for direct application to textiles, hard surfaces or any other surface. In particular, they can be incorporated into soap or soap / synthetic compositions in unit form, where they have remarkable enzyme stability.

Detergent compositions in the form of pieces, tablets, sticks and the like for direct application are described, for example, in South African Patent 93/7274, which is incorporated herein by reference. Accordingly, the preferred pieces according to the invention contain, in addition to the subtilase variant:

i) 25 to 80 wt.%, most preferably 25 to 70 wt. a detergent active which is a soap or a mixture of soap and a synthetic detergent active which we consider to be anhydrous;

ii) 0 to 50 wt.%, most preferably 10 to 30 wt. water;

iii) 0 to 35 wt.%, most preferably 0.1 to 30 wt. filler.

In general, the amount of subtilase variant to be incorporated into such compositions of the invention is such that it corresponds to a proteolytic activity of 0.1 to 100 GU / mg based on the composition, preferably 0.5 to 20 GU / mg, most preferably 1, 0 to 10 GU / mg, wherein GU / mg is a glycine unit per milligram.

Method for generating mutations in subtilase genes

Many methods for introducing mutations into genes are known in the art. After a brief discussion of the cloning of the subtilase genes, we will describe methods for generating mutations both at random sites and at specific sites in the subtilase gene.

Cloning of the subtilase gene

The gene encoding the subtilase can be cloned from the source organism by a variety of methods well known in the art. First, a genomic and / or cDNA library of DNA must be constructed using chromosomal DNA or mediator RNA from the organism that produces the subtilase to be studied. Then, if the amino acid sequence of the subtilase is known, homologous, labeled oligonucleotide samples can be synthesized and used to identify subtilisin-encoding clones from a bacterial DNA genomic library or from a cDNA library. Alternatively, a labeled oligonucleotide sample containing sequences homologous to a subtilase from another strain of bacteria or organisms could be used as a sample to identify subtilase-encoding clones, using less stringent hybridization and wash conditions. Yet another method of identifying subtilase-producing clones would include introducing genomic DNA fragments into an expression vector, such as a plasmid, transforming a protease-negative bacterium with the resulting genomic DNA library, and then grafting the transformed bacteria onto agar containing a substrate for subtilase such as skim milk. Those bacteria that contain the plasmid-bearing subtilase form colonies surrounded by a ring of pure agar due to the digestion of the skimmed milk by the secreted subtilase.

Generation of random mutations in the subtilase gene

Once the subtilase gene has been cloned into a suitable vector, such as a plasmid, several methods can be used to introduce random mutations into this gene.

One method would be to incorporate the cloned subtilase gene as part of a recoverable vector into a mutant strain of Escherichia coli.

Another method would involve generating a single chain form of the subtilase gene, and then consolidating this DNA fragment containing the subtilase gene with another DNA fragment so that part of the subtilase gene remains single stranded. This discrete single chain region could then be exposed to any of a number of mutagens, including but not limited to sodium bisulfite, hydroxylamine, nitrous acid or hydralazine. A specific example of this method of generating random mutations has been described by Shortle and Nathans (Proc. Natl. Acad. Sci. U.S.A. 75, 2170-2174, 1978). According to the Shortle and Nathans method, a plasmid carrying a subtilase gene would be cleaved by a restriction enzyme that cleaves within the gene. This cleavage would be widened into the gap using the exonuclease activity of DNA polymerase I. The resulting single chain gap would then be altered by one of the mutagens mentioned.

Alternatively, the subtilisin gene from Bacillus species, including the natural promoter and other control sequences, could be cloned into a plasmid vector containing replicons for both E. coli and B. subtilis, an optional phenotypic marker, and an M13 origin of replication to generate a single-stranded DNA plasmid in superinfection with helper phage IR1. The single-stranded DNA plasmid containing the cloned subtilisin gene is isolated and solidified with a DNA fragment containing vector sequences but not the coding region of the subtilisin, resulting in a double molecule with a gap. The mutations are introduced into the subtilisin gene either by sodium sulfite, nitrous acid or formic acid, or by replication in an E. coli mutant strain as described above. Since sodium bisulfite reacts exclusively with cytosine in single-stranded DNA, mutations generated by this mutagen are limited to the coding regions. The reaction time and bisulfite concentration are varied in individual experiments such that, on average, from one to five mutations per subtilisin gene are generated. Incubation of 10 µg of double DNA with a gap in 4 M Na-bisulfite, pH 6.0, for 9 minutes at 37 ° C in a reaction volume of 400 µl deaminates about 1% of the single-stranded cytosines. The coding region of mature subtilisin contains about 200 cytosines depending on the DNA strand. Preferably, the reaction time varies from about 4 minutes (to generate a mutation frequency of about one to 200) to about 20 minutes (about 5 to 200).

After mutagenesis, gap molecules are treated in vitro with DNA polymerase I (Klenow fragment) to form fully double-stranded molecules and mutations are fixed. Competent E. coli are then transformed with the mutated DNA to generate an amplified library of mutated subtilisins. Amplified mutant libraries can also be generated by growing a DNA plasmid in a Mut D strain of E. coli, which increases the extent of mutations due to its DNA polymerase with a tendency to errors.

Nitrous acid and formic acid mutagens can also be used to generate mutant libraries. Since these chemicals are not as specific for single stranded DNA as sodium bisulfite, the mutagenic reactions are performed according to the following procedure. The coding portion of the subtilisin gene is cloned in the M13 phage by standard methods and single-stranded phage DNA is prepared. The single-stranded DNA is then reacted with 1 M nitrous acid, pH 4.3.15 to 60 minutes at 23 ° C, or with 2.4 M formic acid for 1 to 5 minutes at 23 ° C. These reaction time ranges generate a mutation frequency from 1 to 1000 to 5 to 1000. After mutagenesis, the universal primer is ligated to M13 DNA and double DNA is synthesized using mutated single-stranded DNA as a matrix so that the coding portion of the subtilisin gene becomes completely double-stranded. At this point, the coding portion can be cleaved from the M13 vector by restriction enzymes and ligated into an unmutated expression vector such that mutations occur only in the restriction fragment (Myers et al., Science 229,242-257, 1985).

Generation of site directed mutations in the subtilase gene

Once the subtilase gene has been cloned and the desired mutation sites identified and the residue to be substituted for the original has been determined, these mutations can be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences located laterally to the desired mutation sites; mutant nucleotides are inserted during oligonucleotide synthesis. In a preferred method, a single stranded DNA gap is created, bridging the subtilase gene, in a vector carrying the subtilase gene. Then, the synthetic nucleotide carrying the desired mutation is ligated to the homologous portion of the single-stranded DNA. The remaining gap is then filled with DNA polymerase I (Klenow fragment) and this structure is ligated using T4 ligase. A specific example of this method has been described by Morinaga et al. (Biotechnology 2, 646-639, 1984). According to Morinag et al. the fragment is removed from the gene using a restriction endonuclease. The vector / gene that now contains the gap is then denatured and hybridized to a vector / gene that, instead of containing the gap, was cleaved by another restriction endonuclease at a site outside the region included in the gap. The single-stranded region of the gene is then available for hybridization with mutated oligonucleotides, the remaining gap is filled with Klenow fragment of DNA polymerase I, insertions are bound with T4 DNA

The ligase and after one round of replication generate a double-stranded plasmid carrying the desired mutation. The Morinag method eliminates the additional manipulation of the construction of new restriction sites and therefore facilitates the generation of mutations at multiple sites. U. U.S. Pat. 34606 by Estella et al., Issued May 10, 1994, is capable of introducing multiple mutations carried by oligonucleotides by making small cassette changes, but even a larger number of mutations can be introduced at any time by the Morinag method since a large number of oligonucleotides of different lengths can be introduced.

Expression of subtilase mutants

According to the invention, it is possible to express the mutated subtilase gene generated by the described methods or by any alternative methods known in the art in enzyme form using an expression vector. An expression vector generally falls within the definition of a cloning vector because the expression vector usually comprises components of a typical cloning vector, namely, an element that allows autonomous replication of the vector in a microorganism, independently of the genome of that microorganism, and one or more phenotypic markers for selection. The expression vector includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and optionally a repressor gene or various activator genes. To allow secretion of an expression protein, nucleotides encoding a " signal sequence " may be inserted before the coding sequence of the gene. For expression under the control of the control sequences, the target gene to be treated according to the invention is operably linked to the control sequences in the appropriate reading structure. Promoter sequences that can be incorporated into plasmid vectors and that can promote transcription of the mutated subtilase gene include, but are not limited to, the prokaryotic β-lactamase promoter (Villa-Kamaroff et al., Proc. Natl. Acad. Sci. USA 75, 3727-3731 (1978) and the TAC promoter (DeBoer et al., Proc. Natl. Acad. Sci. USA 80: 21-25, 1983). Further references can also be found in Useful proteins by recombinant bacteria in Scientific American 242: 74-94 (1980).

In one embodiment, B. subtilis is transformed with an expression vector carrying the mutated DNA. If expression is to be performed in a secreting microorganism such as B. subtilis, the signal sequence may follow the translation initiation signal and precede the actual DNA sequence. The signal sequence causes transport of the expression product to the cell wall, where it is cleaved from the product upon secretion. The term "control sequences" as defined is intended to include a signal sequence, if present.

Other host systems known to the skilled artisan for the expression and production of protease variants of the invention are also contemplated. Such host systems include fungal cells, including filamentous fungi, plants, birds and mammals, as well as others.

Materials and methods

strains:

B. subtilis 309 is a Bacillus lentus variant deposited in NCIB with NCIB accession number 10309 and described in US-A-3 723 250, incorporated herein by reference.

E. coli MC 1000 (MJ Casadaban and SN Cohen, J. Mol. Biol. 138, 179-207, 1980) was prepared by r, m ⁺ by conventional methods and is also described in US patent application no. 039 298.

Proteolytic activity

In the context of this application, proteolytic activity is expressed in Kilo NOVO protease units (KNPU). The activity is determined relative to the enzyme standard (SAVINASE) and the determination is based on the digestion of a dimethyl casein solution (DMC) by a proteolytic enzyme under standard conditions, i.e. 50 ° C, pH 8.3, 9 min. reaction time, 3 min. measurement time. The AF 220/1 prospectus is available on request from Novo Nordisk A / S, Denmark, and is incorporated herein by reference.

GU is a glycine unit, defined as the activity of a proteolytic enzyme, which under standard conditions during a 15-minute incubation at 40 ° C with N-acetyl casein as a substrate produces an amount of NH ₂ -groups equivalent to 1 pmole of glycine.

Enzyme activity can also be measured using a PNA study by reaction with a soluble substrate of succinylalanine-alanine-proline-phenyl-alanine-paranitrophenol, as described in Joumal of the American Oil Chemists Society, Rothgeb, T.M., Goodlander, B.D., Garrison, P.H. and Smith, L. A., 1988.

BRIEF DESCRIPTION OF THE DRAWINGS

In the drawings of FIG. 2 is a 3-dimensional representation of subtilisin 309 showing the position of the hydrophobic region and some of the amino acid residues in its vicinity to be substituted according to the invention.

DETAILED DESCRIPTION OF THE INVENTION

To produce the enzyme variants of the invention, the same materials and methods as described in o. i. WO-A-89/06279 (Novo Nordisk A / S), EP-A-130,756 (Genentech), EP-A-479,870 (Novo Nordisk A / S), EP-A-214,435 (Henkel), WO -A-87/04461 (Amgen), WO-A-87/05050 (Genex), EP application no. 87303761 (Genentech), EP-A-260,105 (Genencor), WO-A-88/06624 (GistBrocades, NV), WO-A-88/07578 (Genentech), WO-A-88/08028 (Genex), WO -A-88/08033 (Amgen), WO-A88 / 08164 (Genex), Thomas et al., Nature 318,375-376, 1985; Thomas et al., J. Mol. Biol. 193. 803-813, 1987; Russel and Fersht, Nature 328, 496-500, 1987. Other methods well known in the art may also be used.

Example 1

Construction and expression of enzyme variants

A vector suitable for encoding the synthetic subtilase 309 gene and its mutants was prepared. It is essentially the plasmid pUC19 (Yanish-Perron and Messing, Gene 33, 103-119, 1985), in which the multiple cloning site has been replaced by a linker containing the restriction sites used to separate the five gene-forming subfragments. This new linker was inserted into cut EcoRI HindIII pUC19 to destroy these sites. Details of this construction are described in WO 92/19729 on pages 25-26 and in FIG. 1 (sheets 1/7 to 7/7), the contents of which are incorporated herein by reference.

Each subfragment was made from 6 to 12 oligonucleotides. These oligonucleotides were synthesized on an automated DNA synthesizer using phosphoramidite chemistry on a controlled glass substrate (Beaucage and Carruthers, Tetrahedron Letters 22, 1859-1869, 1981).

SK 284609 Β6

The five subfragments were isolated on a 2% agarose gel and inserted into pSX191. The sequence was verified by dideoxynucleotide sequencing. Fragments A through E were isolated and pooled using punched Kpn1BamHI pSX191. The pooled mixtures were used to transform competent E. coli MC 1000 r, m ⁺ by selection into ampicillin resistance. The 850 bp KnpI-BamHI fragment, which forms part of the subtilisin 309 gene code for the mature part of the enzyme, was then used to replace the wild-type gene on pSX212, resulting in pSX222, which was then transformed into a competent strain of B. subtilis. After fermentation of the transformed strain and purification of the enzyme, it turned out that the product was indistinguishable from the wild-type product.

Protease variants derived from a synthetic gene are generated using oligonucleotides with the altered sequence at the site (s) where the mutation is desired (e.g., with the sequences as shown below) and mixed with the remainder of the oligonucleotides relevant to the synthetic gene. The assembly of the variant gene is performed with the variant materials in a manner that is otherwise analogous to that described above. Additional information on synthetic genes is generally available in Agarval et al., Nature 227, 27-34 (1970).

The knpl site was introduced at the beginning of the synthetic subtilase 309 gene, encoding the mature part of the enzyme. The method used is called oligonucleotide controlled intermittent double-stranded repair mutagenesis and is described by Mandecki, Proc. Nat. Acad. Sci. USA 83, 7177-7181, 1986. pSX172 is opened with NcoI at the beginning of the mature portion of subtilase 309 gene and mixed with oligonucleotide NOR 789 (see WO-A-92/19729), heated to 100 ° C, cooled to 100 ° C. 0 ° C and transformed into E. coli. After retransformation, the recombinants can be screened by colony hybridization using 32-P-labeled NOR 789. Recombinants that proved positive during screening had a KpnI site introduced just before the NcoI change of the two bases without altering the amino acid sequence. pSX172 is described in EP patent no. The thus generated KpnI site is inserted into pSX120 on the 400 bp PvuI-NheI fragment, resulting in pSX212. pSX120 is also described in EP-A-405 901.

The synthetic gene is inserted between KpnI and BamHI on pSX212, resulting in pSX222.

Examples of mutations and corresponding oligonucleotide sequences are as follows:

R170L (fragment D1)

S ¹ - AATTCAGGTGCAGGCTCAATCAGCTATCCGGCGCTCTAT - 3 'IIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIDIIII.

¹ - GTCCACGTCCGAGTTAGTCGATAGGCCGCGAGATACGCTTG - 3 '

R1701 (fragment D1)

5 '- AATTCAGGTGCAGGCTCAATCAGCTATCCGGCGATCTAT - 3' IIIIIIHIIIIIIIIIIIIIIHIIIIDUIII ¹ - GTCCACGTCCGAGTTAGTCGATAGGCCGCTAGATACGCTTG - 3 ¹

S57P (BI fragment) '- AGCTTTGTACCAGGGGAACCGCCGACTCÄAGATGGG - 3' lllillllllillHlPIIIIIIIIIIIIII '- AACATGGTCCCCTTGGCGGCTGAGTTCTACCCTTACCC - S'

These nucleotides were combined with the remainder of the nucleotides from the synthetic gene that had not been altered.

Example 2

Purification of enzyme variants

This procedure relates to the purification of a 10-liter fermentation of the subtilisin 147 enzyme, the subtilisin 309 enzyme, or mutants thereof.

Approximately 8 liters of the fermentation broth solution were centrifuged at 5000 rpm for 35 minutes in 1-liter flasks. The supernatants were adjusted to pH 6.5 using 10% acetic acid and filtered on Seitz Supra S100 filter plates.

The filtrates were concentrated to approximately 400 mL using an Amicon CH2A UF unit equipped with an Amicon S1Y10 UF cartridge. The UF concentrate was centrifuged and filtered prior to absorption at room temperature on a bacitracin affinity column at pH 7. The protease was eluted from the bacitracin column at room temperature using 25% 2-propanol and 1 M sodium chloride in buffer solution with 0.01 M acid dimethylglutaric acid, 0.1 M boric acid and 0.002 M calcium chloride, adjusted to pH 7.

Protease fractions from the bacitracin purification step were pooled and applied to a 750 ml Sephadex G25 column (5 cm diameter) equilibrated with a buffer containing 0.01 M dimethylglutaric acid, 0.2 M boric acid and 0.002 M calcium chloride, adjusted to to pH 6.5.

Fractions with proteolytic activity from the Sephadex G25 column were pooled and loaded onto a 150 ml CM Sepharose CL 6B cation exchange column (5 cm diameter) equilibrated with a buffer containing 0.01 M dimethylglutaric acid, 0.2 M boric acid and 0.002 M chloride Calcium, adjusted to pH 6.5.

The protease was eluted using a linear gradient of 0 to 0.1 M sodium chloride in 2 liters of the same buffer (0 to 0.2 M sodium chloride for subtilisin 147).

In the final purification step, the fractions from the CM Sepharose column containing the protease were pooled and concentrated in an Amicon ultrafiltration cell equipped with a GR81PP membrane (from Danish Sugar Factories Inc.).

Using the methods of Example 1 for the preparation and said isolation procedure, the following subtilisin 309 variants were generated and isolated:

A: G159I

B: S164I

C: Y1671

D: R170I

E: R170L

F: R170M

G: R170F

H: G195F

I: S57P + R170L

J: R170L + N218S

K: S57P + R170L + N218S

L: R170L + N218S + M222A

M: S57P + R170L + S188P + A194P

N: Y167I + R170L

S: S57P + R170L + Q206E

P: R170L + Q206E

Q: Y167I + R170L + Q206E R: Y167I + R170L + A194P S: Y167I + R170L + N218S T: Y167I + R170L + A194P + N218S U: Y167I + Y171I

V: R170G

W: R170C

Example 3

Detergent compositions containing enzyme variants

Example D1 (Isotropic) Aqueous Detergent Liquid according to an embodiment of the present invention is formulated to include:

additive % NaLAS 8.0 Neodol 25-9 8.0 AES 25-3S 14.0 On-citrát.2HjO 5.0 propylene 5.0 sorbitol 4.5 F-dye Tinopal UNPA-GX 1.15 Lytron 614fuel 0.03 Kathon, Cons. prostr. 0.0003 Acid Blue 0.00117 Acid Violet 0.0033 Savinase 16L 0.25 Lipolase 100L 0.70 aroma 0.15 Water ad 100.0

The pH is adjusted to 7.1.

Table III

Residual enzyme activity (in percent of initial activity) after storage at 37 ° C for Example D1, containing BLS309 variant S57P + R170L + N218S.

Storage time (days) Wild type S57P + R170L + N218S

0 100 100 3 44 74 7 11 50 10 5 36 14 7 27

III is

The table shows that the variant

S57P + R170L + N218S has remarkably improved stability in this type of detergent. In addition, variant S57P + R170L + N218S has excellent lipase compatibility.

Table IV

Residual lipase activity (in percent of initial activity) after storage at 37 ° C for Example D1, containing BLS309 variants S57P + R170L + N218S and Lipolase (TM).

Storage time (days) Lipolase plus: Wild type S57P + R170L + N218S 0 100 100 3 38 67 7 24 44 10 22 33 14 21 27

It is clear from Table IV that, in addition to protease stability, protease compatibility against Lipolase has also been improved.

Example D2

A non-aqueous detergent liquid according to one embodiment of the present invention is formulated using 38.5% C13-C15 linear primary alcohol alkoxylated with 4.9 mol / mol ethylene oxide and 2.7 mol / mol propylene oxide, 5% triacetin, 30% sodium triphosphate, 4 % anhydrous soda,

15.5% sodium perborate monohydrate containing a small proportion of oxoborate, 4% TAED, 0.25% EDTA, of which 0.1% as phosphonic acid, Aerosil 0.6%, SCMC 1% and 0.6% protease. The pH is adjusted to between 9 and 10, e.g. to about 9.8.

Example D3

For example, structured liquid detergents may contain, in addition to the protease as described herein, 2 to 15% nonionic surfactant, 5 to 40% total surfactant, including nonionic and optionally anionic surfactant, 5 to 35% filler, whether or not containing phosphate, 0 2 to 0.8% of a polymeric thickener, for example a cross-linked acrylic polymer having a molecular weight above 10 ⁶ , at least 10% of sodium silicate, for example as a neutral water glass, alkali (e.g. potassium-containing alkali) to adjust the desired pH, preferably 10 or higher, for example above pH 11, with a cationic sodium to silicate anion ratio (such as free silica, weight ratio) of less than 0.7: 1 and a viscosity of 0.3 to 30 Pas (at 20 ° C and 20 ^s - 1). ).

Suitable examples include about 5% of a nonionic surfactant C13-C15 alcohol alkoxylated with about 5 EO groups per mole and about 2.7 PO groups per mole, 15 to 23% neutral water glass by weight ratio

3.5 between silica and sodium oxide, 13-19% KOH, 8-23% STPP, 0-11% sodium carbonate, 0.5% Carbopol 941 (TM).

The protease may be incorporated in an amount of, for example, 0.5%.

Example D4 (Dismounting polymer liquid) Priolene 6907 4.5 KOH 10 Ethoxylated alcohol.7EO (Synperonic A7) 4.5 Ethoxylated alcohol.3EO (Synperonic A3) 4.5 Zeolite 4A 15 Fluorescent Tinopal CBS-X 0.08 Narlex DC1 1 Citric acid 8.23 Anti-foam silicone DB100 0.3 LAS acid 16.5 perfume 0.5 Water to 100%

Table V

Residual enzyme activity (in percent of initial activity) after storage at 37 ° C for Example D4 containing the R170L variant BLS309.

Storage time (days) R170L Wild type 0 100 100 2 98 73 4 96 66 10 94 46 33 87 8 81 78 2.1 101 71 0

It can be seen from Table V that the R170L variant has remarkably improved stability in this type of detergent.

Example D5 (Polymeric Liquid)

Priolene 69074,5

KOH10

Ethoxylated alcohol.7EO (Synperonic A7) 4.5

Ethoxylated alcohol.3EO (Synperonic Α3) 4,5

Zeolit4A15

Fluorescent Tinopal CBS-X0.08

Narlex DC11

Citric acid8,23

Anti-foam silicone DB1000,3

LAS acid16.5

Lipolase 100L0,6

Parfum0,5

Water up to 100%

Table VI

Residual enzyme activity (in percent of initial activity) after storage at 37 ° C for Example D5, containing BLS309 variant S57P + R170L + N218S.

Example D7

Soap pieces containing 63.88 wt. 80/20 tallow / coconut soap, 1 wt. % coconut fatty acids, 25.1 wt. % water, 10 wt. % sodium citrate and 0.021 wt. proteases. Laundry soap pieces were stored at 37 ° C and after some time intervals samples were taken and their protease activity measured.

Stability data:

storage W. T. R170L + N218S + S57P 0 100 100 10 90.1 14 81.5 16 10 20 0 91.4 31 72.8 35 79 45 78

Time of warehouse, (days) Residual protease activity Residual lipase activity S57P + R170L + + N218S Wild type Wild type S57P + R170L + N218S 0 100 100 100 100 2 - 75 41 94 5 97 50 15 76 8 87 30 7 71 12 91 20 12 78 28 100 18 12 70

It is apparent from Table VIII that the subtilase variant R170L + N218S + S57P has remarkably improved stability in this type of detergent.

Example 4

The performance of detergent compositions containing enzyme variants works

The following examples provide the results of several wash tests that have been performed under the above conditions.

Table IX: Experimental conditions for evaluation of subtilisin 309 variants.

It can be seen from Table VI that variant S57P + R170L + N218S has remarkably improved stability in this type of detergent. In addition, variant S57P + R170L + N218S has excellent lipase compatibility.

Example D6

Soap pieces containing 49.7 wt. 80/20 tallow / coconut soap, 49.0 wt. % water, 20 wt. % sodium citrate, 1.0 wt. % citric acid and 0.031 wt. proteases. After preparing the soap pieces, they were stored at ambient temperature and after some time intervals the samples were taken and their protease activity measured. The stability data are given in Table VII below:

Table VII

Storage (days) W. T. R170L R170L + N218S + S57P R170L + Y167I 0 100 100 100 100 1 50 100 97 94 2 25 91 100 83 3 100 94 80 6 98 89 90 10 0 100 94 71 17 93 80 73 27 95 86 70

detergent Protease model detergent '95 Detergent dose 3 g / l pH 9.5 Washing time 15 min. temperature Low: 14 ° C Water hardness 9 dH - 1.61 mM Ca ²⁺ / Mg ²⁺ enzymes Subtilisin 309 variants listed below Conc. enzyme 0, 0.1, 0.2, 0.3, 0.4, 0.5, 1.0, 2.0, 3.0 mg / L Test method Miniwash (SOP DEF-SM-0026.01 / 01) Sample / v 5 samples (2.5 cm) / 50 ml Test material Cotton grass (washed in water); * DF-9417718 *

Said model detergent is a simple detergent formulation. The most characteristic features are that STP is used as a filler and the surfactant (LAS) content is considerably high. Furthermore, the pH is adjusted to 9.5, which is low for the detergent powder.

It is evident from Table VII that subtilase variants

R170L, R170L + N218S + S57P and R170L + Y167I have remarkably improved stability in this type of detergent.

The composition of the model detergent is as follows: Table X% STP (NajPjOw)% Na ₂ SO ₄ % Na ₂ CO ₃ % LAS (Nansa 80S)% nonionic (Dobanol 25-7)% Na ₂ Si ₂ O ₅

0,5% carboxymethylcellulose (CMC)

9.5% water dose: 3 g / l pH is adjusted to 9.5

Measurement of remission (R) on test material was performed at 460 nm using an Elrepho 2000 photometer (without UV). The measured values were approximated by:

a.deltaR ^ .c delta R = ---------------------- deltaR max + a.c

The improvement factor is calculated using the start and slope of the curve:

and

IF = ----- Αεί deltaR is the enzyme washing effect in remission units, and is the initial slope of the approximated curve (c -> 0), aref is the initial slope for the reference enzyme, c is the enzyme concentration in mg / l, deltaRmax is the theoretical maximum enzyme washing effect in remission units (c -> oo).

Table XI: Variants and improvement factors for subtilisin 309.

mark variant IF S003 ' R170 2.8 S004 ' R170-G195 2.6 S012 ' R170 + G195-K251 1.6 G R170F 3.3 E R170L 3.8 F R170M 2.4 D R1701 4.1 I S57P + R170L 3.9 J R170L + N218S 1.6 The S57P + R170L + N218S 2.3 N Y167I + R170L 6.2 P R170L + Q206 2.6 IN R170G 2.0 w R170C 3.4 0 S57P + R170L + Q206 2.9 Q Y167I + R170L + Q206 2.4

* Described in WO-A-91/00345

As can be seen from Table XI, all subtilisin 309 variants of the present invention have improved wash performance.

Claims (8)

PATENT CLAIMS A detergent composition comprising a subtilase BLS309 variant wherein the amino acid residue at position 170 is substituted with a more hydrophobic amino acid residue compared to the original, wherein the subtilase variant is R170L or R170I. The composition of claim 1, wherein said substitution is combined with substitutions, insertions, or deletions at any other position. Composition according to claim 2, characterized in that said variant is combined with further substitutions, deletions and / or insertions at any one or more of the positions: 36, 57, 76, 218, 222 and 224. The composition of claim 3, wherein the further change is selected from the group consisting of 36D, S57P, N76D, N218S, M222S, M222A and T224S. 5. A composition according to claim 3, wherein the variant is selected from the group consisting of variants e) S57P + R170L and 'S57P + R170I f) R170L + N218S; b) R170I + N218S (g) S57P + R170L + N218S (c) S57P + V104Y + R170L + N218S. c ') S57P + V104Y + R170I + N218S. (h) R170L + N218S + M222A (d) R170I + N218S + M222A (d) R170L + N218S + M222A (d) R170I + N218S + M222S (e) S57P + R170L + S188P + A194P (e) S57P + R170I + S188P + A194P s) Y167L + R170L f) Y167L + R170I t) Y167I + R170L g ') Y167I + R170I (u) N76D + R170L + N218S h ') N76D + R170I + N218S (v) S57P + N76D + R170L + N218S. »S57P + N76D + R170I + N218S. w) N76D + R170L + N218S + M222A j ') N76D + R170L + N218S + M222S j' ') N76D + R170L + N218S + M222A j') N76D + R170L + N218 S + M222S (x) S57P + R170I + S188P + A194P + N218S k ') S57P + R170I + S188P + A194P + N218S y) * 36D + N76D + H120D + R170L + G195E + K235L l) * 36D + N76D + H120D + R170I + G195E + K235L z) N76D + H120D + R170L + G195E + K235L m ') N76D + H120D + R170I + G195E + K235L aa) * 36D + G97N + V 104Y + H120D + R119L + A194P + + G195E + K235L n') * 36D + G97N V 104Y + H120D + R170I + A194P + G195 E + + K235L bb) S57P + R170L + Q206E o ') S57P + R170I + Q206E c') R170L + Q206E p ') R170I + Q206E dd) Y167I + R170L + Q206E') + R170I + Q206E ee) Y167F + R170L «Y167F + R170I t) Y167I + R170L + A194P »Y167I + R170I + A194P u) Y167I + R170I + N218S u ') Y167I + R170I + N218S (v) Y167I + R1701 + A194P + N218S v ') Y167I + R1701 + A194P + N218S (x) R170L + P131V (x ') R170I + P131V y) * 36D + Y165I + R17OL y ') * 36D + Y165I + R170I (z) Y167I + Y171I (aa) Y167V + R170L aa ') Y167V + R170I A composition according to claims 1 to 5, wherein the composition is a liquid detergent composition. 7. A composition according to claim 6 comprising a deflocculating polymer. The composition of claim 7, wherein the subtilase variant is S57P + + V104Y + R170L + N218S or S57P + V104Y + R170I + + N218S.