SI9200069A - Light regulated gene expression in the transgenic plants - Google Patents

Abstract

A genetic system utilizing the light-regulated expression of the Arabidopsis thaliana chalcone synthase (CHS) gene is described. Two elements within the CHS control region have been identified which are capable of promoting the expression of an operably linked gene, in a plant, in response to stimulation by light. Using these sequences it is possible to create transgenic and chimeric plants which contain one or more exogenously supplied gene whose expression can be inducted by blue, UV or high intensity light.

Description

Light-regulated gene expression in transgenic plants

FIELD OF THE INVENTION

The present invention relates to transgenic and chimeric plants. In particular, the invention relates to DNA sequences capable of promoting the expression of a functionally coupled heterologous gene in a plant in response to stimulation by light. The present invention also relates to a screening system for light-sensitive mutants of these sequences.

The present invention provides chimeric plasmids containing the 1975 or 523 bp chalkon synthase (CHS) promoter from A.thalian. Heterologous genes functionally linked to the 1975 or 523 bp promoter sequence are expressed in the plant in response to blue light of a specific wavelength. The present invention also provides a chimeric plasmid containing 186 bp of the CHS promoter. Heterologous genes functionally bound to the 186 bp promoter fragment are expressed in the plant in response to high-intensity light.

BACKGROUND OF THE INVENTION

I. Chimera plants

Recent advances in recombinant DNA and genetic technologies have enabled the introduction and expression of the desired gene sequence in the recipient plant. Using such methods, they control plants containing gene sequences that are not normally or naturally present in the unaltered plant. Additionally, they use these techniques to produce plants that show altered expression of naturally occurring gene sequences.

Plants made using such methods are known as chimeras or transgenic plants. In a chimera plant, only some of the plant cells contain and express the introduced gene sequence, while other cells remain unchanged. The ability of a plant chimera to transmit an introduced gene sequence to its offspring depends on whether the introduced gene sequences are present in the plant's germ cells. So only certain nods of plants can transmit the desired gene sequence to their offspring.

In contrast, all cells of a transgenic plant contain an introduced gene sequence. Thus, the transgenic plant is capable of transmitting the introduced gene sequence to its offspring.

Transgenic plants are generally produced from a transformed single plant cell. Many genera of plants are produced from a single cell. (Friedt, W. et al. Prog. Botany 49: 192-215 (1987); Brunold, C. et al., Molech, Gen. Genet. 208: 469-473 (1987); Durand, J. et al. , Plant Sci 62: 263-272 (1989), and these references are incorporated herein by reference.

They can use different procedures to deliver and express a foreign gene to a plant cell. The most widely used procedure uses the cloning of the desired gene sequence in the Ti plasmid of the soil bacterium A. tumefaciens (Komari, T. et al., J. Bacteriol. 166: 88-94 (1986); Czako, M. et al., Plant Mol. Biol 6: 101-109 (1986); Jones, JDG et al., EMBO J. 4: 2411-2418 (1985).

The second process of transmitting a gene sequence to a plant uses a constructed plant virus. Plant viruses as cauliflower mosaic virus (Brisson, N. et al., Nature 310: 511514 (1984)) are particularly useful for transgenic plants (Shah, D.M. et al., Science 233: 478-481 (1986)); Shevvmaker, C.K. et al., Virol. 140: 281-288 (1985). RNA viruses are also engineered to deliver DNA to a plant (French, R. et al., Science 231: 1294-1297 (1986)).

The third process used to transmit gene sequences into plant cells is microinjection (Crossway, A et al., Mol. Gen. Gen. 202: 179-185 (1986); Potiykus, I. et al., Mol. Gen. Genet. 199: 169-177 (1985).

Finally, the fourth commonly used process is the transfer of a DNA sequence to a plant, electroporation (Fromm, ME et al., Nature 319: 791-793 (1986); Morikawa, H. et al., Gene 41: 121-124 (1986)). .

II. Light-inducible promoters

Light is a key environmental signal that is important in almost every aspect of plant growth and development. A large number of nuclear and chloroplast encoded photoregulated genes have been identified in plants. However, with the exception of photorecepto red light, the phytochrome components of the signal transduction pathways responsible for the photoregulation of gene expression remain largely unknown.

The chalcone synthase gene (CHS) encodes the first enzyme unique to flavonoid biosynthesis. Light induces flavone and flavonol production in tissue cells of parsley culture and accumulation of anthocyanin pigments in many plant species (Wellmann, E., Planta 101: 283-2886 (1971); Beggs et al., Photochem. Photobiol. 41: 481-486 ( 1985); Wellmann, E., FEBS Lett 51: 105-107 (1975); Oelmuller et al., Proc Natl. Acad. Sci. USA 82: 6124-6128 (1985); Rabino et al., Plant Physiol 81 : 922-924 (1986); Sponga et al., Plant Physiol 82: 952-955 (1986). In the various plants studied so far, photoregulated flavonoid production is at least partly due to transcriptional induction of CHS (Chappell et al., Nature 311: 76-78 (1984); Feinbaum et al., Mol. Whole Biol. 8: 1985-1992 (1988); van Tunen et al., EMBO J 7: 1257-1263 (1988); Taylor et al., Plant Celi. 2: 115-127 (1990). Research on CHS expression in tissue cells of parsley culture suggests that UV-B light receptor, blue light receptor and phytochrome may also play important roles in light-induced CHS expression (Bruns et al., Plant 169: 393-398 (1986) Ohl et al., Plant 177: 228-236 (1989). The predominant sensitivity of CHS expression to UV and blue light distinguishes it from other commonly studied photoregulated genes, such as e.g. chlorophyll a / s binding protein gene (CAB), which are highly sensitive to red light (Kaufman et al., Science 226: 1447-1449 (1984); Karlin-Neumann et al., Plant Physiol 88: 1323-1331 (1988 )).

Although little is known about trans-acting regulators of factors that control light-regulated CHS expression, in vitro binding experiments and in vivo fingerprinting experiments define a hexamer sequence (CACGTG) located in the promoter regions of A. majus and CHS genes, which is bound by a nuclear factor, which may be important in light-regulated control of CHS expression (Lipphardt et al., EMBO J 7: 4027-4033 (1988); Schulze-Lefert et al., EMBO J. 8: 651-656 (1989b Staiger et al., Proc Natl. Acad. Sci. USA 86: 6930-6934 (1989). The hexamem motifs defined in the five-pointed and A. majus CHS promoters belong to a class of plant sequences called G boxes, which have been found in the promoter of many plant genes regulated by light and voltage (Staiger et al., Natl. Acad. Sci USA 86: 6930-6934 (1989). It is interesting to note that the central G box hexamer corresponds to the consensus sequence E of the CANNTG box, defined from mammalian systems that are located in the promoters of many tissue-specific genes and in some cases are known to be required for tissue-specific gene expression (for evaluation, see Kingston, RE, Curr. Opin. Full Biol. 1: 1081-1087 (1989). Proteins found to bind to E boxes in mammalian and Drosophila cells share a potential DNA-binding / dimerization helix-loop-helical (HLH) structure.

Isolation of mutants having deviating pigmentation patterns allows the identification of multiple loci that affect flavonoid production. At least two of these, the R locus in maize and the det-1 gene in A.thaliana, are important in photoregulated CHS expression. Maize seedlings lacking a functional R gene accumulate 25% less ČHS MRNA after exposure to light (Taylor et al., Plant Celi. 2: 115-127 (1990). Interestingly, proteins encoded by the R gene family contain the HLH motif found in regulators of the factors that recognize the E box sequence. (Ludwig et al., read. Natl. Acad. Sci. USA 86: 7092-7096 (1989). In contrast to the Z. mays R locus, the A.thaliana det-1 gene is required for repression of CHS expression in dark growing A.thaliana seedlings (Chory et al. Celi 58: 991-999 (1989)) In the absence of light det-1 mutant plants exhibit leaf and chloroplast development and accumulate increased levels of light-regulated mRNAs, including CHS.

Analysis of the specificity of the wavelength of CHS expression in A. thaliana seedlings shows that blue and UV light are more effective than red light in inducing CHS MRNA accumulation. In parsley cells, maximal induction of CHS expression requires exposure to UV-B light (Wellmann, 1971; Wellmann, 1975; Bruns et al., 1986; Ohl et al., 1989).

III. Conclusions

The application of transgenic and chimeric planting technologies gives the opportunity to produce plants that cannot be produced using classical genetics. E.g. chimeras and transgenic plants have essential uses as probes of natural gene expression. When used in food crops, technologies have the ability to produce improved food, fiber, etc.

When creating a chimera or transgenic plant, it is desirable that it is capable of regulating the expression of introduced gene sequences. One such induction signal is light. Light-inducible promotions have been investigated in many plants. The chalcone synthase promoter directs the expression of chalcone synthase in response to light or external voltage.

The present invention combines techniques for the production of chimeric transgenic plants with novel DNA sequences capable of promoting the expression of a heterologous gene in a plant in response to stimulation by light-specific wavelengths.

Summary of the Invention

The present invention is based on the surprising discovery of two elements in the promoter of the CHS A. thaliana that promote transcription of a functionally coupled gene in response to stimulation by light. One of these elements is capable of promoting transcription in response to blue or UV light. Another element is capable of promoting transcription in response to high-intensity light.

Using this discovery, it is now possible to:

1) create recombinant DNA molecules capable of promoting the expression of a heterologous gene in a plant such that gene expression is induced by blue or UV light;

2) create recombinant DNA molecules capable of promoting the expression of a heterologous gene in a plant such that gene expression is induced by high-intensity light;

3) to create a transgenic or nodding plant containing one or more exogenously supplied genes whose expression is induced by blue or UV light;

4) to create a transgenic or nodding plant containing one or more exogenously delivered genes whose expression is induced by high-intensity light;

5) use the DNA sequence of light-responsive elements to purify and label the regulatory proteins that bind to control sequences;

6) use an induction system of blue light or high-intensity light to screen and isolate susceptible mutants for light; and

7) use light-sensitive elements in A. thaliana to further elucidate the mechanisms involved in the light-regulated promotion of gene expression in plants.

Short description of the pictures

Figure IA and B. CHS1975-GUS MRNA accumulation in response to high-intensity light. Northern RNA brews isolated from mature in the greenhouse of adult A. thaliana plants treated with high intensity light continuously for 0, 6,16, 24, 48 or 72 hours. The control plants (0 h time point) remain in the greenhouse and are harvested at a time point that coincides with 24 h high intensity light treatment. Two identical filters are hybridized with probes that detect CHS or. CHS-GUS mRNA. Both filters are removed and re-hybridized with the rRNA probe, but only the CHS1975-GUS mRNA digest is shown here. B GUS case extension analysis of mRNAs from untransformed Nossen (No) and CHS1975-GUS plants. GUS extensional products have never been detected for mRNA isolated from untransformed plants. The numbers on the left of the image indicate the size (bp) of the MspIpBR322 tagged fragments.

Figure 2. Accumulation of CHS1975-GUS mRNA in response to light-varying wavelengths. Northern RNA quilts isolated from 9 days old in dark grown CHS1975-GUS seedlings or from those treated 24 hours in red, blue, white and UV light. Two identical filters are hybridized with probes that detect CHS mRNAs. CHS1975-GUS mRNA. Both filters were removed and re-hybridized with the rRNA probe (CHS1975-GUS mRNA transcript shown here). The same pattern of mRNA accumulation is seen in two separate experiments.

Figure 3. CHS mRNA accumulation in response to blue light pulse in wild-type A. thaliana seedlings. Northern RNA isolate isolated from 9 days old, dark grown, grown in red light and grown in red light / pulsed with blue light by Columbia seedlings. The seedlings exposed for a 15 minute pulse of blue light were returned to the red light for 3 or 16 hours before RNA extraction. The filter is hybridized first with a probe that detects CHS mRNA and then is collected and re-hybridized with a rRNA probe. ).

Figure 4A-D. Accumulation of CHS523-GUS, CHS186-GUS, and CHS17-GUS mRNA and GUS activities in response to high-intensity and blue light. A) Northern RNA blank isolated from mature greenhouse grown plants treated with high intensity light for 0 and 16 hours. The filter is hybridized with a GUS probe and then the CHS probe is removed and hybridized. Finally, hybridization with the rRNA probe indicates that equal amounts of RNA were present in each species (data not shown). B) GUS activity in plants treated with high-intensity light for 0, 16 and 48 hours. The graph represents the average of three independent experiments. Multiple inductions between 0 and 48 hours are given above the lines for each transgenic species. C) Northern RNA quilts isolated from control seedlings grown in the dark and seedlings treated for 24 hours with blue light. Filters are treated as described above. D) GUS activity in control and blue light seedlings. The graph again represents the average of three independent experiments and multiple inductions between control plants and plants treated with blue light are given above the lines for each transgenic species. The multiple induction for CHS186-GUS, type 2, is significantly lower than 5.0-fold because GUS activity levels are barely above the base of both control and blue light treated plants.

Brief description of preferred embodiments

DNA sequences in the chalcone synthase promoter are capable of promoting the expression of functionally coupled heterologous genes in a plant in response to light. The present inventions show a first sequence in a CHS promoter that gives susceptibility to blue or UV light and a sequence that gives susceptibility to high intensity light. These DNA sequences can be used to create a chimera or transgenic plant containing one or more exogenously delivered genes that are expressed in response to light. The present invention describes a work made in A. thaliana. However, the invention can be implemented equally well on other plants.

I. DNA sequences capable of promoting the expression of a heterologous gene in a plant in response to blue or UV light

In one embodiment of the invention, a DNA sequence is described which is capable of promoting the expression of a functionally coupled heterologous gene in a plant in response to stimulation by blue or UV light. As used herein, functionally bound is defined by the ability of a DNA sequence to be transcribed so that translation occurs in the desired reading frame by linking a 3 'site to a given sequence. As used herein, a sequence is defined as promoting expression if the sequence is capable of inducing transcription and translation of a functionally coupled coding sequence.

In detail, a DNA sequence may be a DNA sequence located between; -1975 and 0, -523 and 0, or -523 and -186 of the CHS promoter (Sequence ID No. 1), or a functional derivative thereof. If this sequence is functionally linked at site 5 'to a gene e.g. GUS, is a gene expressed in a kimema or transgenic plant in response to stimulation by blue light.

As used herein, the term functional derivative is used to define any DNA sequence derived from the original DNA sequence and capable of similar biological activity. The functional derivative may be the insertion, deletion or substitution of one or more bases in the original DNA sequence.

Functional Derivatives Sequences ID no. 1 having a modified nucleic acid sequence can be prepared by mutagenesis of DNA. This can be refined using one of the mutagenesis methods known in the art.

Preparation of Functional Derivatives Sequences ID no. 1 is preferably performed by position-directed mutagenesis. Position-directed mutagenesis permits the production of functional derivatives Sequences ID no. 1 using a specific oligonucleotide containing the desired mutant DNA sequences.

The process of position-directed mutagenesis is well known in the art as exemplified by publications such as e.g. Adelman et al., DNA 2: 183 (1983), the disclosure of which is incorporated herein by reference.

Position-directed mutagenesis typically uses a phage vector that exists in both single-stranded and double-stranded form. Typical vectors useful in position-directed mutagenesis include vectors such as e.g. M13 phage, as shown by Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, published by A. Walton, Elsevier, Amsterdam (1981), the representation of which is incorporated herein by reference. These phages are commercially available and their use is generally well known in the art. Alternatively, plasmid vectors containing a single-stranded phage separation source (Veira et al., Meth. Enzymol. 153: 3 (1987)) can be used to obtain single-stranded DNA.

Generally, site-directed mutagenesis is accordingly carried out first by obtaining a single-stranded vector that includes in its sequence the DNA sequence to be altered. An oligonucleotide primer bearing the desired mutated sequence is prepared generally synthetically, e.g. by the procedure of Crea et al. Natl. Acad. Sci (USA) 75: 5765 (1978). The primer is then anelated with a single stranded vector containing the sequence to be altered and the generated vector incubated with a DNA polymerizing enzyme such as e.g. Klenow polymerase I fragments of E.coli into the appropriate reaction butter. The polymerase refines the synthesis of the mutation-bearing chain. So the second strand contains the desired mutation. This heteroduplex vector is then used to transform the corresponding cells, e.g. JM101 cells and select clones containing recombinant vectors that carry the mutated sequence.

While the position for introducing sequence variation is predetermined, mutations per se need not be determined in advance. For example, to optimize the execution of a mutation at a given position, random mutagenesis in the target region can be conducted, and newly produced sequences can be screened for the optimal combination of the desired activity.

Functional derivatives generated in this manner may exhibit the same qualitative biological activity as the naturally occurring sequence when functionally linked to a heterologous gene. However, the derivative may differ significantly in such properties as e.g. the degree of induction in response to light.

It is difficult to predict the exact effect of substitution, deletion or insertion in advance on such behavior. One skilled in the art will appreciate that derivative functionality can be determined by routine screening experiments. E.g. a functional derivative made by positionally directed mutagenesis may be functionally linked to a reporter gene, such as e.g. GUS, and the chymem gene can then be quantitatively screened for light susceptibility in chimeric or transgenic plants or in a temporary expression system.

II. DNA sequences capable of inducing the expression of a heterologous gene in plants in response to high-intensity light

Another embodiment of the invention describes a DNA sequence that is capable of promoting the expression of a functionally coupled heterologous gene in a plant in response to stimulation with high intensity light.

In detail, the DNA sequence can be a sequence located between -186 and 0 of the CHS promoter (Sequence ID # 2), or a functional derivative thereof. If this sequence is functionally linked at site 5 'to a gene e.g. GUS is a gene expressed in a feed or transgenic plant in response to high-intensity light.

III. Transgenic or chimeric plants containing genes the transcript of which is induced by blue or UV light

In a third embodiment of the invention, a method is provided for creating a chimeric or transgenic plant in which the plant contains one or more exogenously delivered genes that are expressed in response to stimulation by blue or UV light. In detail, we create a chimera or transgenic plant containing one of the DNA sequences described in section I of preferred embodiments functionally linked to an exogenously delivered gene. The chimeric or transgenic plant of the invention is preferably produced by regeneration of a plant cell that has received the DNA molecule shown herein. This can be accomplished using one of the processes discussed in the background of the invention or similar methods known in the art.

All plants from which protoplasts can be isolated or cultured to obtain fully regenerated plants can be altered by the DNA sequences shown in the present invention. Some suitable plants include, but are not limited to, species of the genera Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manicot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura , Hyoscyamus, Lycopersion, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Cichorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhin, Hemerocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecisium, Salpisum, Cinepulus, Salpis, Glucum, Salpis, Glucum , Zea, Triticum, Sorghum, Ipomoea, Passiflora, Cyclamen, Malus, Prunus, Rosa, Rubus, Populus, Santalum, Allium, Lilium, Narcisus, Pineapple, Arachis, Phaseolus, Pisum and Datura.

It is evident that virtually all plants can be regenerated from cultured cells or tissues, which include, but are not limited to, all major cereal crops, sugar cane, sugar beet, cotton, fruit and other trees, legumes and vegetables. Plant regeneration from protoplast cultures is described in Evans et al., Protoplast Isolation and Culture, in Handbook of Plant Whole Culture 1: 124-176 (MacMillan Publishing Co., New York, 1983); M.R. Davey, Recent Developments in the Culture and Regeneration of Plant Protoplasts, Protoplasts, 1983 - Lecture Proceedings, p. 19-29 (Birkhause, Basel, 1983); P.J. Dale, Protoplast Culture and Plant Regeneration11 tion of Cereals and Other Recalcitrant Crops, in Protoplasts 1983 - Lecture Proceedings, p. 31-41 (Brikhauser, Basel, 1983); and H. Binding, Regeneration of Plants, in Plant Protoplasts, p. 21-37 (CRC Press, Boca Raton, 1985).

Regeneration varies from species to species of plants. Usually a plant is regenerated from a suspension of altered protoplasts where some cells contain the introduced gene sequence. Embryo formation can then be induced from protoplastic suspensions to the degree of maturation and sprouting as natural embryos. The culture medium typically contains various amino acids and hormones such as e.g. auxin and cytokines. It is also advantageous to add glutamic acid and proline to the medium especially for species such as maize and alphaalfa. The shoots and roots develop normally simultaneously. The effect of regeneration depends on the medium, genotype, and cultural history. If these three variables are controlled, then regeneration is completely reproducible and reproducible.

Mature plants grown from transformed plant cells can be isolated to produce a seed plant. A seed plant produces a seed that contains an introduced gene sequence. These seeds can grow to produce plants that express introduced gene sequences.

Parts obtained from a regenerated plant, e.g. flowers, seeds, leaves, branches, fruits and the like are encompassed by the present invention. Descendants and variants and mutants of regenerated plants are also included within the scope of the present invention.

As used herein, the variant describes phenotypic changes that are stable and inherited, including inherited variation that is sexually transmitted to offspring of plants.

IV. Transgenic or chimeric plants containing genes whose IW transcription is induced by high intensity light

A fourth embodiment of the present invention describes a method of creating a chimera or transgenic plant in which the plant contains one or more exogenously supplied genes that are expressed in response to high intensity light.

A more detailed nod or transgenic plant is produced such that the plant contains one of the DNA sequences described in section II of the preferred embodiments, functionally linked to an exogenously delivered gene. Chimeras or transgenic plants of the invention are preferably made by regenerating a plant cell that has received the DNA molecule shown herein. This can be accomplished by using one of the methods described in Section III of the preferred embodiments, or by a similar method known in the art.

V. A system for the study of light-regulated gene expression in plants

A fifth embodiment of the present invention provides a method for identifying the molecular interaction responsible for the phytochromic and non-phytochromic induction of a CHS promoter.

In more detail, it is possible to isolate proteins that bind to these sequences using the sequences of sections I and II shown in the preferred embodiments. This is done using one of the purification processes of a protein that binds to a specific DNA sequence. Such procedures are well known in the art. Preferably, a protein bound to a specific DNA sequence can be purified using affinity chromatography. Specific sequence ID no. 1 or 2 are immobilized on a suitable matrix, such as e.g. Sepharose and used as an affinity matrix for purification of proteins that are bound to a specific sequence (Arcangioli B., et al., Eur. J. Biochem. 179: 359-364 (1989)).

Preferably, the DNA binding protein is extracted from light-induced seedlings. The protein extract obtained from plant tissue is applied to a column containing the immobilized DNA sequence of interest. Proteins incapable of binding to the DNA sequence are washed from the column. Proteins that bind to the DNA sequence are removed from the column using a salt gradient. Proteins eluted from such a column are enriched with proteins that bind to specific DNA sequences mobilized on the matrix. The DNA binding protein can then be further purified by methods known in the art, e.g. by ion exchange chromatography, HPLC and size exclusion chromatography.

During purification of the binding protein, the DNA protein can be tested by gel retardation experiment (Gamer, MM et al., Nucl. Acid Res. 9: 3047 (1981) and Fried, M. et al., Nucl. Acid. Res. 9: 6506 (1981 )).

Once the DNA binding protein is purified, a partial acid sequence can be obtained from the N-terminal of the protein. Alternatively, the protein can be tryptically mapped and the amino acid sequence on one of the fragments can be determined by one of the methods known in the art.

The derived amino acid sequence can be used to produce an oligonucleotide probe. The coding sequence may be based on codons known to be more commonly used by the organism. Alternatively, the probe may consist of a mixture of all possible codon combinations capable of encoding the polypeptide.

A probe complementary to amino acid sequences can be used to screen either a CDNA or genomic library for genomic sequences encoding a DNA binding protein. When a gene encoding a DNA binding protein is obtained, the DNA sequence can be determined, the gene can be used to obtain large amounts of protein from the recombinant host, or the sequence can be used in mutation analysis to further define functional areas in a DNA interacting protein.

Alternatively, the proteins that bind to Sequence ID no. 1 or Sequence ID no. 2 can be isolated by identifying a protein-expressing clone using the Southwestem breeding technique (Sharp, ZD et al., Biochim Biophys Acta, 1048: 306-309 (1990), Gunther, CV et al., Genes Dev. 4: 667 -679 (1990), and Walker, MD et al., Nucleic Acids Res. 18: 1159-1166 (1990).

In the Southwestern brew, the labeled DNA sequence is used to screen the cDNA expression library whose expressed proteins were immobilized on the filter by colony or plaque transmission. Labeled DNA sequences bind to colonies or plaques that express a protein capable of binding to a specific DNA sequence. Clones expressing a protein that binds to a labeled DNA sequence can be purified, and the insert cDNA encoding the DNA binding protein can be isolated and sequenced. Isolated DNA can be used to express larger amounts of protein for further purification and study, which can be used to isolate genomic sequences corresponding to cDNA or used to produce a functional derivative of a binding protein.

The present invention also includes functional derivatives of DNA binding proteins that can bind to Sequence ID no. 1 or 2. The term functional derivative is used to define any protein that develops biological activity (whether functional or structural) that is substantially similar to the biological activity of the parent protein. The term is intended to include fragments or variants of the parent protein.

A protein is said to be essentially similar to another protein if both molecules share a similar biological structure or if both proteins have similar biological activity. A fragment is any polypeptide subset of a parent molecule. The variant is a protein substantially similar in structure and function to a parent molecule or fragment thereof. Functional derivatives of the present invention can be obtained: by natural processes (such as inducing animals, plants, fungi, bacteria, etc. to produce a DNA binding protein derivative); by chemically synthesizing a functional derivative polypeptide; or by recombinant technology (such as to produce a functional derivative in a variety of hosts (eg yeast, bacteria, fungi, cultured mammalian cells, etc.). The choice of the process to use depends on factors such as suitability, desired gain etc. It is not necessary to use only one of the processes, processes or technologies described above to produce a specific functional derivative; the processes, processes and technologies described above can be combined to produce a specific derivative.

Functional DNA binding protein derivatives having up to about 100 residues can be advantageously prepared by in vitro synthesis. If desired, such fragments can be modified by the reaction of whole amino acid residues of the purified or crude product with an organic derivative capable of reaction with selected side chains or terminal residues. The resulting covalent derivatives can be used to identify residues important for biological activity.

Examples of modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or teonyl residues, methylation of α-amino groups of lysine, arginine and histidine side chains (TE Creighton, Proteins: Stracture and Molecule prperties, WH Freeman & Co., San Francisco, p. 79-86 (1983)), acetylation of the N-terminal amine and in some cases the amidation of C-terminal carboxyl groups.

Functional DNA binding protein derivatives having altered amino acid sequences can also be prepared by mutations encoded by DNA. Such variants include e.g. deletions, insertions, or substitutions of residues in the amino acid sequence of a DNA binding protein. Any combination of deletion, insertion and substitution can be used in the manufacture of the finished structure, provided that the final construction has the desired activity. Obviously, mutations that will be made in a DNA-encoded variant should not place the sequence outside the reading frame and, preferably, will not create complementary regions that could produce a secondary mRNA structure that could potentially block translation. At the genetic stage, these functional derivatives are usually prepared by positionally directed nucleotide mutagenesis, which encodes a DNA binding protein. The procedures for position-directed mutagenesis are described in section I of preferred embodiments.

When a derivative is obtained after encoding the sequence, the mutated protein region can be removed and placed in a suitable vector for the production of the protein, usually an expression vector of the type that can be used to transform the corresponding host.

Functional derivatives include deletion, insertions and amino acid substitutions in the coding region.

Deletions of amino acid sequences typically comprise from about 1 to 30 residues, more preferably 1 to 10 residues, and are typically adjacent.

Inserts include amines and / or carboxyl terminal fusions between a DNA binding protein and another polypeptide. A polypeptide that fuses with a DNA binding protein can be unlimited in length. An example of terminal insertion involves fusion of a signal sequence either heterologous or homologous to a host cell at the N-terminus of a molecule to facilitate the secretion of a DNA binding protein derivative from recombinant hosts. The fusions also involve intrassequent insertions of single or multiple amino acid residues. Intrassequential insertions (eg insertions in the binding protein sequence of complete DNA) can generally comprise from about 1 to 10 residues, more preferably 1 to 5.

A third group of functional derivatives is one in which at least one amino acid residue is in a DNA binding protein molecule and preferably only one is removed and another residue is incorporated in its place. Such substitutions are preferably made according to the following table, if desired, to finally modulate the characteristics of the DNA binding protein.

TABLE 1 Original scrap Substitutions given by example Ala Arg Asn Asp Cys Gin Glu Gly His De Leu Lys Met Phe Sir Thr Trp Tyr Val gly; ser lys gin; his glu sir asn asp ala; pro asn; gin leu; val ile; val arg; gin; glu leu; tyr; ile met; leu; tyr thr sir tyr trp; phe ile; leu

Substantial changes in functional identity are made by selecting substitutions that are less conservative than those in Table 1, i.e. selection of residues that differ significantly in their effect on the maintenance of (a) the structure of the polypeptide framework and in the field of substitution, e.g. as a straight or helical conformation, (b) the charge or hydrophobicity of the molecule at the target position, or (c) the circumference of the side chain. The substitutions that generally give these results are those in which (a) glycine and / or proline is substituted with another amino acid ah 'omitted or incorporated; (b) a hydrophilic residue, e.g. seryl or threolyl is substituted for (or z) a hydrophobic residue, e.g. leucine, isoleucine, phenylalanil, valyl or alanyl; (c) the cystene residue is substituted for (or by) any other residue; (d) electropositive side chain residue, e.g. lysyl, arginyl or histidyl are substituted for (or z) by electronegative charge, e.g. glutamyl or aspartyl; or (e) a residue having a large side chain, e.g. phenylalanil is substituted for (or with) one which does not have such a side chain, e.g. glycyl.

Most deletions and insertions, especially substitutions, are not expected to make radical changes in the characteristics of the DNA binding protein. However, if it is difficult to predict the exact effect of substitution, deletion, or insertion in advance on such behavior, the expert will evaluate that the effect is determined by routine screening experiments. For example, a functional derivative made by a site-directed mutagenesis of a DNA sequence encoding a natural DNA binding protein is expressed in a recombinant cell and the derivative is purified from cell culture, e.g. by immune affinity adsorption on antibody columns for the anti-DNA binding protein (to absorb the functional derivative by binding it to at least the remaining epitope).

The activity of the cell lysate or purified functional derivative thus obtained is screened in a suitable screening experiment for the desired characteristics. E.g. the change in the specificity or affinity of the DNA sequence for a specific DNA sequence of a functional derivative is measured by a competitive binding assay. Modifications of such protein properties as redox or thermal stability, hydrophobicity or susceptibility to proteolytic degradation are tested by methods well known to those of ordinary skill in the art.

EXAMPLES

Construction of fusion plasmids

Level clones are derived according to the protocols of Ausubel et al., (Current Protocols and Molecular Biologists, (1989)). To produce, CHS1975-GUS, pCHS3.9 (Feinbaum et al., Mol. Whole Biol. 8: 1985-1992 (1988)) was linearized in the CHS coding region and then digested with Bal31 to 13 bp at the 5 'CHS ATG site, and 13 bp downstream of the alleged CHS stop codon. After ligating the BamHI members at the omitted ends, the final fragments at sites 5 'and 3' are removed by degradation with Hindlll and BamHI and then ligated together at the Hindlll position pUC12 to produce pCHS5'3 '. The E. coli j3-glucuronidase (GUS) gene is derived from pRAJ260 (Jefferson, R.A., Plant Mol.Biol. Rep. 5: 387-405 (1987)) by converting the Hindlll position located at the 3 'position of the GUS coding region to the BamHI position. We clone this BamHI GUS coding region cassette into pCHS5′3 ′ cut with BamHI to produce pCHS1975-GUS. The sequence of the CHSH-GUS fusion junction at site 5 'from the start of the CHS transcript to the GUS start codon is as follows:

CCAAATACACCTAACTTGTTTAGTACACAACAGCAACATCAA ACTCAATATACCCAAGTTGGTCggatccgagcttggctgcagctcagtcccccttatg (Sequence ID # 3). The entire CHS1975-GUS fusion was then removed from pUC12 and ligated into the HindIII position of the pBIN19 binary vector to obtain pBINCHS1975GUS (Bevan, M., Nuc. Acids Res. 12: 8711-8721 (1984)). CHS523-GUS, CHS186GUS and CHS17-GUS are derived from pBINCHS1975-GUS. The pBINCHS1975-GUS was linearized with KpnI and Xbal, treated with ΕχοΙΠ nuclease and then re-alloyed. We lower the plasmids downstream to identify new 5 'ends of the chyme genes.

Transformation of A. Thalian

LBA4404 is the host strain of A tumefaciens used in all transformation experiments (Ooms et al., Plasmid 7: 15-29 (1982)). pBINCHS-GUS plasmids are introduced into LBA4404 by tri-parental crossing from E. coli or by direct DNA transformation (An, G. Enzyme 153: 292-305 (1987)). Nossen (No) A. thaliana tissue is used in all transformation experiments since it has been shown that this ecotype regenerates more rapidly and at a higher frequency than other A.thaliana species (Keith Davis, personal communication; Chaudhury et al., Plant Whole Rep. 8: 368-369 (1989). Sterile tissue for transformation of the leaf and root bits is obtained by treating the seeds in% bleach, 0.1% triton Χ-100 and then aseptic plant growth. Leaf tissue harvested from A.thaliana plants grown in MS medium in petri dishes and root tissue harvested from plants grown in sucrose medium B-5 (Gamborg, OL in: Vasil 1 K (ed) Whole Culture and Somatic Whole Genetics of Plants (1984) ). Plants growing in liquid culture were given fresh medium once a week and maintained on a rotating plate shaken at 100 rpm at 25 ° C to maintain growth. The CHS1975-GUS transgenic species is produced using the leaf disc cocultivation process (Horsch et al., Science 227: 1229-1231 (1985)). However, there is a high incidence of polyploidy in the transformants produced by this process. Therefore, transgenic plants bearing the three constructions of the promoter deletion are produced using the co-cultivation process of a piece of root (Valvekens et al. Proc. Natl. Acad. Sci. USA 85: 5536-5540 (1988)).

High intensity light treatment

The mature plants grown in the greenhouse are treated with high intensity light as previously described (Feinbaum et al., Mol. Celi. Biol. 8: 1985-1992 (1988)). However, in these experiments, the plants grew on 14x14 cm surfaces. Harvest between 20-50 plants at a time point with freezing in liquid nitrogen. The frozen plants in each sample are crushed and mixed together so that tissue aliquots used in mRNA extraction and GUS enzyme experiments represent the population.

Treatment with light of different wavelengths

The effect of different wavelengths of light on gene expression is investigated in 8-9 day old seedlings grown in the dark. The seeds were sterilized in 30% bleach, 0.1% triton Χ-100, resuspended in 0.15% agarose and spread to MS plates containing 2% sucrose. Dry the plates thoroughly and then cover with a transpore membrane strip. Nossen (No) seeds do not germinate well in the dark, so some seeds are soaked at 4 ° C for 24 hours, and all seeds are soaked in light at 23 ° C for 12-16 hours before growing in the dark. Absorption on light does not induce expression of CHS or other light-regulated genes. The seedlings grow either in 7 or 8 days in the dark, treated for 24 or 48 hours with light and then immediately frozen in liquid nitrogen.

Extensional analysis compares

Extension primer comparisons were performed using 50 / xg total RNA and oligonucleotide complementary bp 49-79, counting the first ATG nucleotide as 1) in the GUS gene (Ausubel et al. 1989). Extension products obtained are proven to be specific and dependent on RNA concentration (data not shown). Mspl tagged pBR322 fragments were used as a size marker.

Try GUS

GUS activity is measured by the production of the fluorescent compound 4-methylubeliferone, using procedures for a standard experiment with minor changes (Jefferson 1987). Low molecular weight compounds that interfere with the experiment were removed from the plant extract prior to centrifugation experiments through a medium grade column (1 ml) of Sephadex G-25 at 2000 x g for 3 min. 10-30 / rg of protein (as measured by BioRad protein assays) was used in each GUS assay. The production of 4-methylumbeliferone was quantified on the basis of fluoroscence (365 nm excitation, 455 nm emission) measured on a Beckmann fluorimeter.

EXAMPLES

Transgenic species of A. thaliana bearing the CHS1975-GUS fusion

To test the effects of different light qualities on CHS expression, transgenic A. thaliana species were produced containing a transcript fusion between the CHS promoter and the GUS marker gene (CHS1975-GUS). CHS1975-GUS consists of a 1975 bp lateral sequence at site 5 'of the CHS gene of A.thaliana plus 65 bp of CHS untranslated region at location 5' fused with 31 bp of the E. coli / 3-glucuronidase (GUS) coding region at location 5 ', and 500 bp CHS flanking sequence at position 3 'fused downstream of GUS termination codon. Plants of the Nossen (No) A.thaliana ecotype were transformed with CHS1975-GUS and expression of this construct was investigated in four independently obtained transgenic plants to minimize any effects of chromosomal position. We regulate CHS1975-GUS identically in all four species (data not shown). The data presented here are from a single transgenic species that is diploid and homozygous for CHS1975-GUS at a single locus in the plant genome.

A. CHS1975-GUS response to high-intensity light

Mature, greenhouse-grown CHS1975-GUS plants are treated with high-intensity light for 6, 16, 24, 48 and 72 hours. Analysis of Northern mRNA digestion isolated from these plants shows that the accumulation of CHS1975-GUS mRNA is parallel to that of the endogenous CHS gene. In the typical experiment shown in Figure IA, the steady state rate of both CHS1975-GUS and CHS mRNA increased dramatically (approximately 20-fold) for the first 6-24 hours of irradiation and then remained constant or decreased.

The 5 'end of the CHS1975-GUS information induced by high-intensity light is mapped by appropriate extension analysis to determine if the accumulation of the chimeric CHS-GUS mRNA reflects the exact expression from the CHS promoter. The three major extension products between 170 and 175 bp in length are detected as shown in FIG. IB. The same three products can also be detected at very low rates for mRNAs from untreated CHS1975-GUS populations (data not shown), and the size and pattern intensity of the strip indicate that these three extensor products correspond to the initiation at the same two C and T most commonly used in the endogenous CHS gene (Feinbaum and Ausubel 1988).

The response of the CHS1975-GUS chimeric gene to high-intensity light is also tested by altering GUS enzyme activity. An increase in GUS enzyme activity was consistently detected in transgenic plants carrying CHS1975-GUS after treatment with high intensity light, whereas GUS activity was never detected in untransformed plants (data not shown). The magnitude of induction of the CHS1975-GUS chimeric gene as measured by GUS activity (approximately 4-fold) is always lower than that determined at the mRNA level. It is possible that this is due to the relatively high basal levels of GUS activity in transformed plants, which results from the inherent stability of the β-glucuronidase enzyme.

B. Induction of CHS1975-GUS with blue and UV light

The response of the CHS1975-GUS chimeric gene to red, blue, white, and UV light is compared with that of the endogenous CHS gene. 8 and 9 day old seedlings grown in the wild type and transgenic A.thaliana seedlings are exposed for 24 or 48 h by continuous irradiation with red, blue, UV or white light and then reaped. The red light is predominantly K320-450 nm. Seedlings grow in petri dishes in defined media to ensure constant environmental conditions.

The Northern Quail analysis (Figure 2) shows that CHS1975 and the endogenous CHS gene are susceptible to light of the same wavelength. Blue, white and UV light are most effective in inducing CHS1975-GUS accumulation and accumulation of endogenous CHS mRNA in transgenic seedlings. Preferential accumulation of CHS mRNA in response to blue and UV light was also observed in untransformed seedlings (data not shown). The relative efficiency of blue, white, and UV light in inducing the accumulation of CHS1975-GUS and CHS mRNA differs between experiments (data not shown). However, red light is always significantly less effective in inducing the accumulation of these mRNAs; plants treated with red light accumulate only 15-20% of the levels of CHS1975-GUS and CHS mRNAs found in plants treated with blue light. This is in contrast to the accumulation of mRNA encoding for chlorophyll a / b binding protein (CAB), which is approximately the same across all light regimes (data not shown).

CHS1975-GUS response to red, blue, white and UV light was also measured by GUS enzyme experiments. GUS activity is increased 2 to 5 times in transgenic CHS1975GUS seedlings grown in the dark for 24 or 48 hours with blue, white or UV light. Exposed red light seedlings show either little or no induction in GUS activity (maximum induction is 1.2-fold) at rates grown in the dark (data not shown).

C. Role of blue light receptor in the regulation of CHS expression

Induction of CHS1975-GUS and the endogenous CHS gene by blue light indicates that photoregulated expression of CHS in A.thaliana is at least partially mediated by a specific blue light receptor. Because phytochrome can also be activated by blue light, we investigate the role of blue light receptors independently of phytochrome. Wild-type seedlings (Columbia ecotype) grow under conditions of continuous red light, which causes phytochrome saturation, and are then tested for their ability to respond to blue light (Marrs and Kaufman 1989). Seedlings growing under these conditions (continuous red light (4 μΕ / ηΑ) followed by a 15 min pulse of blue light (50 μΕ / πΛ)] show a greater increase than twofold in CHS and mRNA levels (Fig. 3). and mRNA is temporary; 16 h after the blue light pulse, CHS mRNA levels return to the level found for plants grown in red light, but at least part of the induction of CHS expression in response to blue light is not due to phytochrome and probably represents activation of the receptor distinct pathway blue light.

EXAMPLE 2

CHS promoter sequences required for light regulation

The expression of the CHS1975-GUS chimeric gene is parallel to that of the endogenous CHS gene in response to high-intensity light and specific wavelength light. Therefore, CHS1975-GUS contains most, if not all, of the cis-acting sequence regulators that control the light-regulated expression of the CHS gene A. thaliana. To delineate the cis-acting sequences that control CHS gene expression, we produce transgenic species carrying the 523, 186, and 17 bp promoter sequences of CHS fused to GUS (CHS523GUS, CHS186-GUS, and CHS17-GUS). The expression of the deleted kimem genes is investigated in two independent transgenic species for each deletion construct. These species are shown to be homozygous for the deletion CHS-GUS chimeric genes and to contain these chimeric genes at a single locus based on segregation of the co-introduced marker NOS-NPTII conferring kanamycin resistance. The response of the deletion kimem genes to high-intensity light and blue light is monitored by Northern quail analysis and GUS activity assay (Figure 4). The expression of CHS-GUS chimeric genes in A.thaliana is dependent on the presence of CHS promoter sequences at site 5 'of -17. Transgenic species carrying CHS17-GUS do not produce detectable CHSGUS mRNAs and do not have GUS activity under high intensity or blue light control conditions. The CHS523GUS kimem gene appears to function identically to CHS1975-GUS in response to both high intensity and blue light. 16H treatment with high-intensity light gave a dramatic increase (approximately 10-fold) in the rate of CHS523-GUS mRNA, which is parallel to the response of CHS1975-GUS and the indogenous CHS gene (Fig. 4A). A 3- to 4-fold increase in GUS activity level was detected in species containing CHS523-GUS after exposure to high-intensity light for 48 hours (Figure 4B). Seedlings grown in the dark treated for 24 hours with blue light also show an increase (8-fold) in the rate of CHS523-GUS mRNA similar to the increase seen for CHS1975-GUS and the endogenous CHS gene (Fig. 4C). An additional 3- to 5-fold increase in the GUS activity level as detected in CHS523-GUS plants after irradiation with blue light (Figure 4D). The absolute rates of uninduced and induced CHS-GUS mRNA and GUS activity in these species are comparable to those in plants containing CHS1975-GUS.

While the CHS186-GUS chimeric gene has distinctly reduced expression rates under all conditions, CHS186-GUS gene expression is still induced when treated with high-intensity light. In transgenic species 1 of CHS186-GUS, the GUS mRNA level is induced by high-intensity light about 50% of that found in species containing CHS523-GUS and CHS1975-GUS. The GUS mRNA level in type 2 CHS186-GUS induced by high-intensity light is less than the induced level in type 1, but type 2 CHS186-GUS shows an overall lower rate of chimeric gene expression. Interestingly, even the induction of the endogenous CHS gene is down-regulated in species 2. High-intensity light-treated CHS186-GUS species exhibit multiple induction (9 to 12 times 3 to 4 times) in GUS activity than CHS523GUS and CHS1975-GUS species is compared with untreated controls. This is probably due to the low basal level of GUS activity in CHS186-GUS species.

Both CHS186-GUS transgenic species show only low levels detectable on overexposed CHS186-GUS mRNA accumulations in response to blue light. The amount of CHS186-GUS mRNA accumulated in transgenic species 1 upon induction by blue light is less than 5% of that of CHS523-GUS or CHS1975GUS. Low levels of GUS activity are also consistently detected in CHS 186GUS plants in response to blue light. The magnitude of CHS186-GUS induction (alternated with mRNA accumulation and GUS activity) is proportionally lower in blue light than in high-intensity light, when compared to CHS523-GUS induction, noting that CHS186-GUS is less susceptible to blue than to high-intensity light.

EXAMPLE 3

Use of a CHS control element for screening mutants in susceptibility to light

Screening for mutant plants with abnormally high or low levels of GUS activity can easily be performed in microtiter sources. CHS186GUS species 2 is known to exhibit reduced expression of both endogenous CHS genes and CHS186-GUS genes when compared with the wild type and other transformed species. This species may acquire a mutation in a gene that directly or indirectly controls CHS expression.

(i) Sequence characteristics:

(A) Length: 2040 base pairs (B) Type: Nucleic acid (C) Chain: Double (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID No: l:

AAGCTTGACA TTCTTTCTCT GATGCCATTT GGTTTGCAAT TTCCGGTATA ACACCACCAC 60 GAGCCTGGAA GCTACTCTCA ACATCACTCA AAATTTGATC AGCTTCAACC CAAAAATCAA 120 TCTCATCCAT AACATCACAA CTAGGAATCA TCTCAACATC TTCCCACTTG AAGAATCCAC 180 AAGCTCCAAA TCCCTAACAC AATTTCTTAA AACAATGTTA ACCAGAATTA TCAACTATGA 240 GCTTTAAACT TGCGAACGAG TCAAAACCTT TTTGATGCAG CATATCAGGT AAGCTCTACC 300 GGAAACGTCT TTAACTCTCC GGCAAGGTCC AGCACCGCAG GAACAAATCG GGATGGTGAA 360 GGCAGGACGG AATTTGATAT CTTCGTCGGT TACTTTGTCA CACCATTTGA AGAAACAGCA 420 ATTCTGAGCC TGCGAATTTC AAATGTCGTC AGTAACAAAT TCAAATTTCC TCGCGAATTT 480 TGCAGGAGAT GAAGAATCAG TAAAGAAAGC GAGTACGAAC CGTTGGACAC TTGTAGAACT 540

TCCTTCCGGG ATTTTCTCGA GTATTCGCGA CCTTGATTTC ACAGAAACCT CCGCCGCATG 600

GGCATTGGAT CGCCGGTGGA GGATCATCGG TGTAGGATTT GAGAGGACAA TCGTTGATCC 660

AGTGGCCAGC CTGACGGCAT CGGAAGCAAT TTCCGGTCTG CATTGTGCCG TTAAGCATTC 720

GTCGAACATT CTCCTTCTCG GGATGTTAAT ATGGGCCAGG TCATCTTTTT TAAGCCCACA 780

TAATTTATTT TTAGCTATGA CTAAACAAAA CATGCTGAAT ATGGGACGGG CTTAATGGGC 840

CTGAAGACTT TAAGCAGATT AACGAAACAA GTGTGTTGTG TATAATATGA GAACCATGTC 900

GTTCTGATCG GTTAAAAACT ACAGCTGACC AAATAACACC TATAGGCTTC TGCGGATATG 960

ACTCTACGGC GTCTACGCCT CGCATGCCTA TCATATTTAA CCGTCAATAA TGGATTTGGC 1020

GGTTTTGGTA GGCCGGGTCA ACCGGATTAA AAGAAAACGG TTTGGAGTCC TTCCTTGCAA 1080

TTGAATTTTC ACGCATCGGG TTTTGTGATT TCTCTGTCAT AATGGGCCCG GCACATATGG 1140

TTCATAACCC ATGTGGGCCT ATGGTATAAT TTTTCCAATT AAAACTATTG TTAGGTCGAT 1200

AAAACAAAAA ACAATAAAAA CGAGTGGAAT ACACATACCA AAAAGAATGT GATGAACATT 1260

AGTAATTTTA TTTTGATGGT TAATGAAAAA CAAAATAATG CATCTTGACA TCTTCCGTTG 1320

GAAAGCGCAA ATAGGGCAGA TTTTCAGACA GATATCACTA TGATGGGGGG TGGGAGAAAG 1380

AAAACGAGGC GTACCTAATG TAACACTACT TAATTAGTCG TTAGTTATAG GACTTTTTTT 1440

TTGTTTGGGC CTAGTTATAG GATCATAAGG TAAAAATGAA GAATGAATAT TAGATTAGTA 1500

GGAGCTAATG ATGGAGTTAA GTAGTATGCA CGTGTAAGAA CTGGGAAGTG AAACCTCCTG 1560

TATGGTGAAG AAACTATACA ACAAAGCCCT TTGTTGGTGT ATACGTATTA ATTTTTATTC 1620

TTTTATCACA AGCGATACGT ATCTTAAGAC ATAATAAATA TATATCTTAC TCATAATAAA 1680

TATCTTAAGA TATATATACA GTATACACCT GTATATATAT AATAAATAGG CATATAGTAG 1740

AAATTAATAT GAGTTGTTGT TGTTGCAAAT ATATAAATCA ATCAAAAGAA TTAAAACCCA 1800

CCATTCCAAT CTTGGTAAGT AACGAAAAAA CAGGGAAGCA AGAAGAACCA CAGAAAAGGG 1860

GGCTAACAAC TAGACACGTA GATCTTCATC TGCCCGTCCA TCTAACCTAC CACACTCTCA 1920

TCTTCTTTTT CCCGTGTCAG TTTGTTATAT AAGCTCTCAC TCTCCGGTAT ATTTCCAAAT 1980

ACACCTAACT TGTTTAGTAC ACAACAGCAA CATCAAACTC TAATATACCC AAGTTGGTGT 2040 (2) SEQ ID no. 2:

(i) Sequence characteristics:

(A) Length: 587 base pairs (B) Type: Nucleic acid (C) Chain: Double (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID no. 2

GTTATAGGAT CATAAGGTAA AAATGAAGAA TGAATATTAG ATTAGTAGGA GCTAATGATG 60 GAGTTAAGTA GTATGCACGT GTAAGAACTG GGAAGTGAAA CCTCCTGTAT GGTGAAGAAA 120 CTATACAACA AAGCCCTTTG TTGGTGTATA CGTATTAATT TTTATTCTTT TATCACAAGC 180 GATACGTATC TTAAGACATA ATAAATATAT ATCTTACTCA TAATAAATAT CTTAAGATAT 240 ATATACAGTA TACACCTGTA TATATATAAT AAATAGGCAT ATAGTAGAAA TTAATATGAG 300 TTGTTGTTGT TGCAAATATA TAAATCAATC AAAAGAATTA AAACCCACCA TTCCAATCTT 360 GGTAAGTAAC GAAAAAACAG GGAAGCAAGA AGAACCACAG AAAAGGGGGC TAACAACTAG 420 ACACGTAGAT CTTCATCTGC CCGTCCATCT AACCTACCAC ACTCTCATCT TCTTTTTCCC 480 GTGTCAGTTT GTTATATAAG CTCTCACTCT CCGGTATATT TCCAAATACA CCTAACTTGT 540 TTAGTACACA ACAGCAACAT CAAACTCTAA TATACCCAAG TTGGTGT 587

(3) Information for SEQ ID No 3:

(i) Sequence characteristics:

(A) Length: 100 base pairs (B) Type: Nucleic acid (C) Chain: Double (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID no. 3

CCAAATACAC CTAACTTGTT TAGTACACAA CAGCAACATC AAACTCAATA TACCCAAGTT 60

GGTCGGATCC GAGCTTGGCT GCAGCTCAGT CCCCCTTATG 100

For

The General Hospital Corporation:

Claims (10)

A DNA sequence capable of promoting transcription in a plant of a functionally coupled heterologous gene in response to stimulation by blue or UV light. 2. A DNA sequence capable of promoting transcription in a plant of a functionally coupled heterologous gene in response to stimulation by high-intensity light. A method for expressing a heterologous gene in a plant whose transcription is stimulated by blue or UV light, characterized in that said method comprises transforming a plant with a chimeric plasmid containing a DNA sequence capable of promoting transcription of a functionally coupled heterologous gene in response to blue light. A method for expressing a heterologous gene in a plant, said expression stimulated by high-intensity light, characterized in that said method comprises transforming the plant with a chimeric plasmid containing a DNA sequence capable of directing the expression of the heterologous gene in response to high intensity light. The DNA sequence of claims 1 and 3, characterized in that said sequence is Sequence ID no. 1 or a functional derivative thereof. The DNA sequence of claims 2 and 4, characterized in that said sequence is Sequence ID no. 2 or its functional derivative. A transgenic plant comprising an exogenously supplied copy of Sequence ID no. 1. 8. A transgenic plant comprising an exogenously supplied copy of Sequence ID no. 2. 9. Kimema plant, characterized in that it contains an exogenously supplied copy of Sequence ID no. 1. 10. Kimema plant, characterized in that it contains an exogenously supplied copy of Sequence ID no. 2.