SE523727C2 - Method for selecting most sensitive nucleic acid probes for diagnostic purposes - Google Patents

Abstract

Method for selection of hybridization probes (I), consisting of sequence recognition part (SID) and reporter group (RG) and able to bind to different parts of a target sequence (II), by providing at least 10, best at least 1000, different (I) on a solid matrix, then detecting signal from RG in presence and/or absence of hybridization to (II), is new. Independent claims are also included for the following: (a) preparation of (I), complementary to different parts of (II), by attaching oligoribonucleic acids or nucleic acid analogs to a solid matrix; and (b) a matrix to which (I) are attached.

Description

vlsan sara: 10 15 20 25 30 7523 727 u o II sun 2 To detect a specific mutation, the selection is more limited, as the sequence of the probe must overlap the presumptive mutation, but there are still alternatives.

In PCT / SE97 / 00953 it is proposed to select the sequence of SID based on the known properties of RG, and for asymmetric cyanine dyes it is proposed SIDs whose tenninal bases are preferably mixed pyrimidines (-TT or -CT). This strategy has fl your limitations. On the one hand, detailed studies of the properties of the dye are required, which moreover cannot be trivially extrapolated to the properties of the probes, p. G.a. differences in experimental conditions, etc., and the sequence requirements are generally met by an uncomfortably large number of sequences (1/8 of all sequences, eg ending with either -TT or -CT). Finally, no account is taken of the sequence adjacent to the MS.

The present invention solves these problems. It is basically a method for examining which of a large number of potential probes for a particular nucleic acid has the lowest background signal and which of these receives the strongest signal during hybridization.

The difference in determinations is the signal increase obtained with the different probes.

Description of figures Figure 1. Principle of homogeneous testing.

Figure 2. Homogeneous testing probe consisting of a sequence recognition part (SID) and a reporter group (RG).

Figure 3. Principle showing how the most sensitive probe for a particular nucleic acid can be identified.

A: Examples of probes that all recognize the same nucleic acid.

B: These probes are synthesized on a solid matrix.

C: The fluorescence of probes is measured in both fi single and hybridized state. Those that give rise to the largest signal increase are the most suitable.

Figure 4 shows different probes and their different fluorescence intensities before hybridization Figure 5 illustrates a probe construction described in exemplary embodiments together with sequence modification for the different probes, the intensity of which is shown in Figure 4.

Description of the Invention Deoxyribonucleic acids and several nucleic acid analogs, such as e.g. peptide nucleic acids (PNA), are usually synthesized by solid phase synthesis, which i.a. a. allows the synthesis of large numbers of fragments with different sequences and also different lengths of a matrix (Khrapko et al., FEBS Lett. 256, 118. 1989; Southern, E., et al., Genomics 13, 1008, 1992; Caviani -Pease, et al., Proc. Natt. Acad. Sci., 91, 5022, 1994; Weiler et al., Nucl. Acids Res. 25, 2792, 1997).

The fragments on this matrix can be hybridized with labeled nucleic acid, e.g. with or oresent or radioactive groups, and the degree of hybridization can be determined from the nucleic acid signal. This technology has many applications, and is often referred to as DNA chip technology.

In the present invention, DNA chip technology is used to determine which of a large number of probes, all of which, with sufficient specificity, recognize certain nucleic acid, which is best suited for nucleic acid hybridization, and then preferably in homogeneous solution. Probes, ie oligodeoxyribonucleic acids or nucleic acid analogues equipped with reporter groups (RGs), all of which are sufficiently complementary and specific for a particular nucleic acid, are synthesized on a matrix (Figure 3). The signal, preferably the uorescence, which they give rise to, ie the background signal is registered. Then some nucleic acid is added and the orescence, this time from hybridized probes, is recorded. The difference in signal in these measurements is the signal increase obtained with the different probes. The ones that show the greatest signal difference are the ones that are most suitable in terms of sensitivity.

Various matrix materials can be used, such as cellulose substrates, metal substrates and polymer substrates. When using metal substrates, the metal is usually first coated with an amino acid layer to facilitate adhesion. When using cellulose substrates, a first nucleotide is often applied to the substrate, after which additional nucleotides are synthesized on top of the first applied until the desired, appropriate nucleotide sequence is obtained.

The present solid probes can be used for the analysis of nucleic acid (s) in the form of mRNA, DNA, PNA, PNA-PNA complex, or DNA-PNA complex.

Signal change during hybridization can occur either by the probe changing its properties, the signal change non-hybridized state versus hybridized state, or by hybridizing to a labeled nucleic acid with another reporter group, RG °, wherein -uann Iløan 10 15 20 25 30 525'727 The signal change is obtained when the RG group in the probe and the RG1 group in the target DNA come in close proximity. RG and RG 'may be the same or different. In systems containing pyrene, the fl uorescence properties change markedly when two pieces of pyrene come into contact, whereby excimer fl uoroscence is obtained. Examples of two different RG, RG 'are energy transfer pairs such as fl uoroscein / tetramethylrhodamine or fl uorophore / quencher pair.

The invention will be described below with reference to an example which illustrates the invention without, however, being limited thereto.

Example Fifteen 10-base long PNA-thiazolorange probes, complementary to different segments of the sequence GTCAGATGAGGAAGAGGCTCTTGT, and a probe, complementary in parallel orientation to the central polypurine region, were synthesized on a Perseptive-PP-NHZ membrane (separated from the P-500 membrane by 500 -Glu-Lys-caproic acid link) using an ABIMED ASP 222 Automated SPOT Robot (Weiler, J. et al., Nucleic Acids Res., 25, 2792, (1997), Figure 1). The PNA monomers were applied as described by Weiler, J. et al., Supra. In the final step, the thiazole orange dye substituted with a carboxylic acid alkyl larch was activated and reacted in the same manner as the Fmoc-PNA monomers. One synthesis was eliminated from the PNA oligomers side chain protecting groups by treatment with 90% TFA! 5% water / 5% triethylsilane for 1 hour (TFA = triacetic acid).

The membrane was then moistened in a 10 mM borate buffer at pH 8.5 containing an addition of 100 mM NaCl for 2 hours and illuminated with a standard UV lamp with Ämax = 312 nm, and photographed with a CCD camera (Figure 4). The background fluorescence of the probes has been expressed relative to probe 16 (CCTCTTCCTC-TO), which shows the weakest intensity before hybridization, and which is thus expected to give the largest signal change after hybridization.

Claims (5)

10 15 20 25 30: e <= .e f i i I 5. ._ v vw o p e f n- - 1 n n na a oo o u | . '' I 0 Ir ro: men: se PATENTKRAV Ö Selecting probes for nucleic acid detection by hybridization, which probes consist of a sequence recognition moiety, SID, and a reporter group, RG, wherein the detectable properties of the probe change upon hybridization to a nucleic acid, the sequence of SID being selected by comparing the RG signal in free and hybridized state of at least 10, preferably at least 100 and, more preferably at least 1000 probes, which hybridize to different parts of certain nucleic acid, the probes being synthesized to a solid matrix and their signal being determined in the absence of certain nucleic acid, and their signal being determined in the presence of certain nucleic acid. Selection according to claim 1, wherein hybridization takes place in homogeneous solution. Selection according to one or more of Claims 1 to 2, characterized in that the probe, comprising SID and RG, is designed to change its properties during hybridization to a target sequence. Selection according to one or more of claims 1-3, characterized in that the probe, comprising SID and RG, is designed to give a signal change through its RG upon hybridization to a target sequence. Selection according to one or more of claims 1-4, characterized in that the probe comprising SID and RG is designed to hybridize to a labeled target sequence containing a reporter group RG 'which is equal to or different from RG in the probe, wherein a signal change are arranged to occur when RG and RG 'come in close proximity to each other during hybridization.