RU2824194C2 - Methods for gene modification of hematopoietic cells - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: present invention relates to biotechnology and genetic engineering, particularly to methods for genetic modification of hematopoietic cells. Presented is the use of prostaglandin E2 (PGE2), poloxamer and protamine sulphate for enhancing transduction by a recombinant retroviral vector.

EFFECT: compositions and methods according to the present invention can be used in gene therapy, including treatment of monogenic genetic diseases and disorders.

54 cl, 18 dwg, 2 tbl, 5 ex

Description

RELATED APPLICATIONS

This application claims priority to U.S. Provisional Patent Application No. 62/712,146, filed July 30, 2018, the contents of which are incorporated herein in their entirety.

SEQUENCE LIST

This application is submitted electronically via EFS-Web and includes a sequence listing provided electronically in .txt format. The .txt file contains a sequence listing titled "ROPA_01001WO_SeqList_ST25.txt" generated on July 30, 2019, and is 57 kilobytes in size. The sequence listing contained in this .txt file is part of the disclosure and is incorporated herein by reference in its entirety.

AREA OF TECHNOLOGY

[0001] The present invention relates generally to methods for genetically modifying hematopoietic cells. In particular, the invention relates to the use of combinations of two or more transduction enhancers selected from prostaglandin E2 (PGE2), a fragment of recombinant fibronectin, poloxamer, and protamine sulfate, to enhance transduction by a recombinant retroviral vector.

LEVEL OF TECHNOLOGY

[0002] Indirect gene transfer ex vivo into target cells is a clinically used method of cell and gene therapy. Recombinant retroviral vectors (e.g., recombinant lentiviral vectors) can be used to deliver polynucleotides into cells (e.g., hematopoietic cells). Contacting the target hematopoietic cells with a recombinant retroviral (e.g., lentiviral) vector results in delivery of the gene(s) into said hematopoietic cells, a process known as transduction. Said hematopoietic cells can then be administered to a subject so that the hematopoietic cells engraft in the bone marrow of said subject.

[0003] Transduction efficiency of a retroviral (e.g., lentiviral) vector is often low and is often a major barrier to successful gene therapy. Accordingly, there remains an unmet need for compositions and methods suitable for use with hematopoietic cells in a clinical context. The present invention provides such compositions, methods, and other objects.

BRIEF DESCRIPTION OF THE INVENTION

[0004] The present invention relates generally to methods for genetically modifying hematopoietic cells. In particular, the invention relates to the use of a combination of two or more transduction enhancers, wherein at least two of the transduction enhancers of said combination are selected from prostaglandin E2 (PGE2), poloxamer, recombinant fibronectin fragment, and/or protamine sulfate, to enhance transduction by a recombinant retroviral vector. In certain embodiments, said combination comprises three or more transduction reagents, including prostaglandin E2 (PGE2), poloxamer, and protamine sulfate. In certain embodiments, said combination comprises four or more transduction reagents, including prostaglandin E2 (PGE2), poloxamer, recombinant fibronectin fragment, and protamine sulfate. The compositions and methods of the present invention are particularly suitable for use in gene therapy, including the treatment of monogenic genetic diseases and disorders. The methods of the invention have the advantage that they result in reduced toxicity (greater survival) of the transduced cell population compared to transduction without transduction enhancers.

[0005] In one aspect of the invention, a method for genetically modifying hematopoietic cells is provided, comprising: contacting hematopoietic cells with poloxamer; contacting said hematopoietic cells with prostaglandin E2 (PGE2) or a derivative thereof; and contacting said hematopoietic cells with a recombinant retroviral vector.

[0006] In one aspect of the invention, a method for genetically modifying hematopoietic cells is provided, comprising: providing hematopoietic cells; contacting said hematopoietic cells with poloxamer; contacting said hematopoietic cells with prostaglandin E2 (PGE2) or a derivative thereof; and contacting said hematopoietic cells with a recombinant retroviral vector.

[0007] In one embodiment, the recombinant retroviral vector is a recombinant lentiviral vector.

[0008] In one embodiment, the hematopoietic cells have been manipulated.

[0009] In one embodiment, the providing step comprises enriching with CD34+ cells.

[0010] In one embodiment, hematopoietic cells were cultured in vessels coated with a fragment of recombinant fibronectin.

[0011] In one embodiment, the poloxamer is selected from the group consisting of poloxamer 288, poloxamer 335, poloxamer 338, and poloxamer 407.

[0012] In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST).

[0013] In one embodiment, PGE2 or a derivative thereof is modified.

[0014] In one embodiment, PGE2 or a derivative thereof is 16,16-dimethyl-PGE2 (dmPGE2).

[0015] In one embodiment, PGE2 or a derivative thereof is not modified.

[0016] In one embodiment, the method further comprises contacting the hematopoietic cells with protamine sulfate and/or a recombinant fibronectin fragment. In some embodiments, the recombinant fibronectin fragment may be present in the culture in liquid medium or may be coated on a culture dish. In some embodiments, the cells may be pretreated by culturing on a dish containing recombinant fibronectin and/or the recombinant fibronectin fragment may be present in the liquid culture medium during transduction.

[0017] In one embodiment, the contacting steps are carried out simultaneously, or the timing of their implementation partially coincides.

[0018] In one embodiment, the concentration of PGE2 or a derivative thereof is 5-30 μg/mL.

[0019] In one embodiment, the concentration of PGE2 or a derivative thereof is about 10 μg/mL.

[0020] In one embodiment, the concentration of poloxamer is 200-1200 mcg/mL.

[0021] In one embodiment, the concentration of poloxamer is approximately 1000 mcg/mL.

[0022] In one embodiment, the concentration of protamine sulfate is 4-10 mcg/mL.

[0023] In one embodiment, the concentration of protamine sulfate is about 4 mcg/mL.

[0024] In one embodiment, the concentration of a recombinant fibronectin fragment, such as RetroNectin, is from about 5 to about 50 μg/mL when used in liquid culture.

[0025] In one embodiment, the concentration of a recombinant fibronectin fragment, such as RetroNectin, is approximately 20 μg/mL when used in liquid culture.

[0026] In a second aspect of the invention, there is provided a method for enhancing recombinant retroviral vector-mediated genetic modification of hematopoietic cells, comprising treating said hematopoietic cells or contacting them ex vivo with an effective amount of PGE2 or a derivative thereof and with an effective amount of a poloxamer; and exposing said hematopoietic cells to or contacting them with a recombinant retroviral vector comprising a polynucleotide comprising a gene of interest, wherein the efficiency of viral transduction of said recombinant retroviral vector is increased compared to transduction of hematopoietic cells by said recombinant retroviral vector in the absence of PGE2 and poloxamer.

[0027] In one embodiment, the method further comprises treating the hematopoietic cells or contacting them ex vivo with an effective amount of protamine sulfate and/or a fragment of recombinant fibronectin.

[0028] In one embodiment, the gene of interest complements a defect in a gene associated with a monogenic genetic disease or disorder.

[0029] In one embodiment, the gene of interest is selected from the group consisting of RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A, and OSTM1. In particular embodiments, the gene of interest encodes a protein encoded by any of these genes, or encodes a functional fragment or variant of any of these genes. In particular embodiments, the gene or protein is a human gene or protein.

[0030] In one embodiment, the method counteracts clinical complications or alleviates a monogenic genetic disease or disorder.

[0031] In one embodiment, the monogenetic disease or disorder is selected from the group consisting of Fanconi anemia (including any of the complementation groups), leukocyte adhesion deficiency type I, pyruvate kinase deficiency, and infantile malignant osteoporosis.

[0032] In one embodiment, the hematopoietic cells are CD34-enriched cells, optionally hematopoietic cells, bone marrow (BM)-derived cells, cord blood (CB)-derived cells, or mobilized peripheral blood (mPB) cells. In certain embodiments, the hematopoietic cells were obtained from a subject to be treated with recombinantly modified hematopoietic cells.

[0033] In a third aspect of the invention, there is provided a method for recombinant retroviral vector-mediated genetic modification of hematopoietic cells, comprising obtaining CD34-enriched cells from a biological sample (optionally peripheral blood) obtained from a subject treated with G-CSF (granulocyte colony-stimulating factor) or an analogue thereof (optionally filgrastim, sargramostim or pegfilgrastim) and/or plerixafor; and genetically modifying said CD34-enriched cells with a recombinant retroviral vector comprising a polynucleotide encoding a Fanconi anemia complementation group (FANC) gene, ITGB2, pyruvate kinase type R, OSTM1, TCIRG1, CLCN7, OSTM1, or a gene encoding a functional variant or fragment thereof, and a promoter sequence operably linked thereto that is active in eukaryotic cells; wherein the genetic modification step comprises contacting said CD34-enriched cells with said recombinant retroviral vector, PGE2 and poloxamer and, optionally, protamine sulfate and/or a recombinant fibronectin fragment.

[0034] The invention provides a method for genetically modifying hematopoietic cells in vitro mediated by a recombinant retroviral vector, comprising obtaining CD34-enriched cells from a biological sample (optionally peripheral blood) obtained from a subject treated with G-CSF or an analogue thereof (optionally filgrastim, sargramostim or pegfilgrastim) and/or plerixafor; and genetically modifying said CD34-enriched cells with a recombinant retroviral vector for a disease or disorder selected from Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency or infantile malignant osteoporosis; wherein said recombinant retroviral vector comprises a polynucleotide encoding a gene of the Fanconi anemia complementation group (FANC), ITGB2, pyruvate kinase type R, CLCN7, OSTM1, TCIRG1, TNFSF11, PLEKHM1, TNFRSF11A, or a gene encoding a functional variant or fragment thereof, and a sequence of a promoter functionally linked thereto that is active in eukaryotic cells; wherein the step of genetic modification comprises contacting said CD34-enriched cells with PGE2 and poloxamer and, optionally, with protamine sulfate.

[0035] The invention provides a method for treating a monogenic genetic disease or disorder in a subject in need thereof, comprising providing said subject with genetically modified hematopoietic cells expressing a polypeptide that is missing or mutated as a result of said monogenic genetic disease or disorder. In particular embodiments, CD34-enriched cells obtained from a biological sample (optionally peripheral blood) obtained from a subject following therapy with G-CSF or an analogue thereof (optionally filgrastim, sargramostim or pegfilgrastim) and/or plerixafor in said subject are genetically modified by contacting them with a recombinant retroviral vector comprising an expression cassette comprising a polynucleotide sequence encoding said polypeptide in the presence of at least two transduction enhancers selected from prostaglandin E2 (PGE2), poloxamer, recombinant fibronectin fragment and/or protamine sulfate, and the resulting genetically modified cells are provided to said subject. In particular embodiments, the disease or disorder is selected from Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency or infantile malignant osteoporosis; and the recombinant retroviral vector contains a polynucleotide containing the Fanconi anemia complementation group gene (FANC), ITGB2, pyruvate kinase type R, CLCN7, OSTM1, TCIRG1, TNFSF11, PLEKHM1, TNFRSF11A, or a gene encoding a functional variant or fragment thereof, and a sequence of a promoter active in eukaryotic cells functionally linked thereto.

[0036] In certain embodiments, the invention provides a method of treating Fanconi anemia in a subject in need thereof, comprising administering hematopoietic cells obtained by genetically modifying hematopoietic cells with a recombinant retroviral vector comprising a polynucleotide encoding a Fanconi anemia complementation group (FANC) gene or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[0037] In certain embodiments, the invention provides a method of treating leukocyte adhesion deficiency type I in a subject in need thereof, comprising administering hematopoietic cells obtained by genetically modifying hematopoietic cells with a recombinant retroviral vector comprising a polynucleotide encoding the ITGB2 gene or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[0038] In certain embodiments, the invention provides a method of treating pyruvate kinase deficiency in a subject in need thereof, comprising administering hematopoietic cells obtained by genetically modifying hematopoietic cells with a recombinant retroviral vector comprising a polynucleotide encoding a pyruvate kinase R gene or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[0039] In certain embodiments, the invention provides a method of treating infantile malignant osteoporosis in a subject in need thereof, comprising administering hematopoietic cells obtained by genetically modifying hematopoietic cells with a recombinant retroviral vector comprising a polynucleotide encoding a CLCN7, OSTM1, TCIRG1, TNFSF11, PLEKHM1, or TNFRSF11A gene, or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[0040] In a further related aspect of the invention, there is provided a method of producing a population of hematopoietic cells comprising at least 80% or at least 90% genetically modified hematopoietic cells, comprising: contacting the hematopoietic cells ex vivo with a recombinant retroviral vector (optionally a lentiviral vector) comprising a polynucleotide comprising a gene of interest or encoding a polypeptide of interest, wherein the contacting occurs in the presence of PGE2 or a derivative thereof, optionally human PGE2 or 16,16-dimethyl-PGE2 (dmPGE2), and a poloxamer, optionally poloxamer 338 (LentiBOOST™). The cells can be contacted with the retroviral vector under conditions and for a time sufficient to allow transduction of the cells with the retroviral vector, such as in a suitable culture medium for at least one hour, at least two hours, at least four hours, at least eight hours, at least twelve hours, at least 16 hours, or at least 24 hours. In some embodiments, the cells are transduced once or twice in succession, such as after prestimulation, with each transduction cycle lasting from 12 to 24 hours or from 16 to 18 hours. In some embodiments, the cells are contacted with the retroviral vector and transduction enhancers at the same time or for an overlapping period of time. Following transduction, the cells can be included in a freezing medium (e.g., CryoStor CS5, BioLife Solutions, Bothell, WA, USA) and cryopreserved for later use. In certain embodiments of this and other aspects, the poloxamer is selected from the group consisting of poloxamer 288, poloxamer 335, poloxamer 338, and poloxamer 407. In particular embodiments, the poloxamer is poloxamer 338 (LentiBOOST™). In particular embodiments, the PGE2 or derivative thereof is unmodified or modified, such as 16,16-dimethyl-PGE2 (dmPGE2). In particular embodiments, the method further comprises contacting the hematopoietic cells with protamine sulfate and/or a fragment of recombinant fibronectin. In some embodiments, the concentration of PGE2 or derivative thereof is 5-30 μg/mL, or about 10 μg/mL. In some embodiments, the concentration of the poloxamer is 200-1200 μg/mL, or about 1000 μg/mL. In some embodiments, the concentration of protamine sulfate is 4-10 μg/mL, or about 4 μg/mL. In some embodiments, the polynucleotide complements a defect in a gene associated with a monogenic genetic disease or disorder. In some embodiments, the polypeptide of interest is selected from the group consisting of RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A, and OSTM1. In some embodiments, the disease or disorder is a monogenic genetic disease or disorder, such as selected from the group consisting of Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency, and infantile malignant osteoporosis. In particular embodiments, the hematopoietic cells are CD34-enriched cells or CD34+ hematopoietic cells, optionally bone marrow (BM)-derived cells, cord blood (CB)-derived cells, or mobilized peripheral blood (mPB) cells. In some embodiments, the hematopoietic cell population has a VCN/cell of at least 1.0, at least 1.5, at least 2.0, or at least 2.5.

[0041] In a related aspect, the invention provides a population of hematopoietic cells comprising at least 80% or at least 90% genetically modified hematopoietic cells, wherein said population of cells was obtained by the disclosed method.

[0042] In another related aspect, the invention provides a method of treating a genetic disease or disorder in a subject in need thereof, comprising providing to said subject a population of hematopoietic cells comprising at least 80% or at least 90% genetically modified hematopoietic cells, wherein said population of cells was obtained by the disclosed method, wherein said hematopoietic cells were obtained from said subject prior to contacting them ex vivo with a retroviral vector, and wherein the gene of interest encodes a functional polypeptide that is mutated or missing in said subject due to said genetic disease or disorder. In some embodiments, the polypeptide of interest is selected from the group consisting of RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A, and OSTM1. In some embodiments, the disease or disorder is a monogenic genetic disease or disorder, such as one selected from the group consisting of Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency, and infantile malignant osteoporosis. In particular embodiments, the hematopoietic cells are CD34-enriched cells, optionally bone marrow (BM)-derived cells, cord blood (CB)-derived cells, or mobilized peripheral blood (mPB) cells.

[0043] In various embodiments of any of the aspects and embodiments disclosed herein, the cells are transduced on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™. In various embodiments of any of the aspects and embodiments disclosed herein, the cells are pretreated by culturing on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™, prior to and/or during transduction. In some embodiments, the cells are transduced in liquid medium containing Retro-Nectin. In some embodiments, the cells are pretreated by culturing on plates coated with a fragment of recombinant fibronectin and are transduced in liquid culture in the presence of a fragment of recombinant fibronectin and other UTs. Thus, in some embodiments, the cells are exposed to recombinant fibronectin prior to exposure to other UTs during transduction, and in some embodiments, the cells are exposed to recombinant fibronectin at the same time as exposure to other UTs or for a period of time that overlaps therewith.

[0044] In various embodiments of any of the aspects and embodiments disclosed herein, the cells are transduced in the presence of prostaglandin E2 (PGE2), a poloxamer (e.g., LentiBoost™), a fragment of recombinant fibronectin (e.g., RetroNectin™), and protamine sulfate.

[0045] Other features and advantages of the invention will be apparent from and encompassed by the following detailed description and claims.

BRIEF DESCRIPTION OF GRAPHIC MATERIALS

[0046] FIG. 1 shows an exemplary transduction protocol. The amounts or combinations of UTs may vary. Cryopreservation is optional. The cells may be used fresh or after frozen storage.

[0047] FIGS. 2A and 2B show the results of VCN determination for cells in liquid culture transduced in the presence of PGE2. For FIG. 2A, at each concentration shown, the left column refers to the results for cells transduced with 2.5 x 10 ⁷ TU/mL and the right column refers to the results for cells transduced with 5 x 10 ⁷ TU/mL of lentiviral vector.

[0048] FIGS. 3A-3C show the results of the COC assay (FIG. 3A), VCN determination (FIG. 3B), and percent (%) transduction (FIG. 3C) in the COC assay for cells transduced in the presence of PGE2.

[0049] FIG. 4 shows the results of VCN determination for cells in liquid culture transduced in the presence of LentiBOOST.

[0050] FIGS. 5A-5C show the results of VCN determination and percent (%) transduction in the COC assay for cells transduced using LentiBOOST.

[0051] FIG. 6 shows the results of VCN determination for cells in liquid culture transduced with one or more of LentiBOOST (LB), PGE2, and protamine sulfate (PS).

[0052] FIGS. 7A-7E show the results of the COC assay for cells transduced with one or more of LentiBOOST (LB), PGE2, and protamine sulfate (PS) (FIG. 7A), the determination of VCN (FIG. 7B), and the percent (%) transduction in the COC assay for cells transduced in the presence of PS alone or LB, PGE2, and PS (FIG. 7C). FIGS. 7D and 7E show the effect of LB, PGE2, and PS on the percent transduction (FIG. 7D) and VCN (FIG. 7E) of COCs obtained from various CD34+ sources, including cord blood (CB-CD34+) and mobilized peripheral blood (mPB-CD34+).

[0053] FIG. 8 shows the results of scaling up transduction with PS alone (“without UT”) or with PS and the transduction enhancers LB and PGE2 (“with UT”). VCN analysis is shown for cells after 14 days of culture in liquid medium.

[0054] FIGS. 9A-9C show the results of scaling up transduction with PS alone or PS with LB and PGE2 transduction enhancers. FIG. 9A shows the results of the COC assay. FIG. 9B shows the results for VCN in CFU. The results are shown for burst-forming units of the erythroid lineage (BFU-E), granulocyte-macrophage progenitors (CFU-GM), and myeloid progenitors (CFU-GM). FIG. 9C shows the transduction efficiency in COC.

[0055] FIGS. 10A and 10B show in vivo results for transduced CD34+ cells with PS alone or PS with LB and PGE2 transduction enhancers transplanted into NSG immunodeficient mice. The percentage (%) of human CD45-positive (hCD45 ⁺ ) cells (FIG. 10A) and VCN/cell (FIG. 10B) are shown. The result is shown at one (1), two (2), or three (3) months post transplantation (mpt).

[0056] FIG. 11 shows VCN in liquid culture for a GMP LV batch with (+UT) or without (-UT) LB and PGE2 transduction enhancers at an MOI of 20 or 50.

[0057] FIGS. 12A-12D show colony forming units (CFU) for total cells (FIG. 12A), BFU (FIG. 12B), GM (FIG. 12C), and mixed myeloid progenitors (FIG. 12D) for the LV GMP batch with (+UT) or without (-UT) LB and PGE2 transduction enhancers.

[0058] FIGS. 13A and 13B show VCN in CFU for the LV GMP batch with (+UT) or without (-UT) LB and PGE2 transduction enhancers for burst-forming units of the erythroid lineage (BFU-E), granulocyte-macrophage progenitors (CFU-GM), and myeloid progenitors (CFU-GM) at MOI 20 (FIG. 13A) and MOI 50 (FIG. 13B).

[0059] FIGS. 14A and 14B show VCN and transduction efficiency in CFU with (+UT) the transduction enhancers LB and PGE2 at MOI 20 (FIG. 14A) and MOI 50 (FIG. 14B), or without (-UT).

[0060] FIG. 15 is a schematic map of the pCCL-PGK-FANCAW-82-PRO transfer vector.

[0061] FIG. 16 is a schematic map of the pCCL-ChimhCD18W-82-RO transfer vector.

[0062] FIG. 17 is a schematic map of the pCCL-PGK-coRPKW-82-RO transfer vector.

[0063] FIG. 18 is a schematic map of the pRRL.PPT.EFS.tcirg1h.wpre transfer vector.

DETAILED DESCRIPTION OF THE INVENTION

[0064] The present invention relates to compositions and methods for genetically modifying hematopoietic cells. In particular, the invention relates to the use of a combination of two or more of prostaglandin E2 (PGE2), poloxamer, recombinant fibronectin fragment, and/or protamine sulfate to enhance transduction by a recombinant retroviral vector. The compositions and methods of the present invention are particularly suitable for use in gene therapy, including the treatment of monogenic diseases and disorders. The difficulties that have limited the success of gene therapy, including low transduction efficiency, are addressed by the compositions and methods provided herein.

A. Definitions

[0065] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present description, including definitions, controls. Furthermore, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting.

[0066] The various embodiments provided herein will employ, unless otherwise specifically indicated, conventional techniques in the fields of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, and cell biology, which are within the skill of the art, and many of such techniques are described below for illustrative purposes. Such techniques are fully described in the literature. See, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Transcription and Translation (B. Hames & S. Higgins, Eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998) Current Protocols in Immunology Q. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991); Annual Review of Immunology; and monographs in journals such as Advances in Immunology, each of which is expressly incorporated herein by reference.

[0067] As used herein, the term "approximately" or "about" refers to an amount, level, value, number, frequency, percentage, measurement, size, magnitude, mass, or length that varies by up to 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% of a reference amount, level, value, number, frequency, percentage, measurement, size, magnitude, mass, or length. In particular embodiments, the terms "approximately" or "about" preceding a numerical value mean the stated value plus or minus a range of 15%, 10%, 5%, or 1%.

[0068] "Transfection" refers to the process of introducing naked DNA into cells by non-viral methods.

[0069] "Infection" refers to the process of introducing foreign DNA into cells using a viral vector.

[0070] "Transduction" refers to the introduction of foreign DNA into the genome of a cell using a viral vector.

[0071] "Vector copy number" or "VCN" refers to the number of vector copies in a sample divided by the number of cells. Typically, vector copy number is determined by quantitative polymerase chain reaction (qPCR) using a probe to the Psi sequence of the inserted provirus, and cell number is determined by qPCR using a probe to a human housekeeping gene, for which there will be two copies per cell (one per chromosome).

[0072] "Transduction efficiency" refers to the percentage of cells that are transduced with at least one copy of the provirus. For example, if 1 x 10 ⁶ cells are exposed to a virus, and 0.5 x 10 ⁶ cells are determined to have at least one copy of the virus in their genome, then the transduction efficiency is 50%. An example of a method for determining transduction efficiency is flow cytometry.

[0073] As used herein, the term "retrovirus" or "retroviral" refers to an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded copy of DNA and then covalently inserts its genomic DNA into the host genome. Retroviral vectors are a common tool for gene delivery (Miller, 2000, Nature. 357: 455-460). Once the virus has integrated into the host genome, it is called a "provirus." The provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules encoded by the virus.

[0074] Illustrative retroviruses (family Retroviridae) include, but are not limited to: (1) the gammaretrovirus genus, such as Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), murine mammary cancer virus (MuMTV), gibbon leukemia virus (GaLV), and feline leukemia virus (FLV), (2) the spumavirus genus, such as simian foamy virus, (3) the lentivirus genus, such as human immunodeficiency virus-1 and simian immunodeficiency virus.

[0075] As used herein, the term "lentiviral" or "lentivirus" refers to a group (or genus) of complex retroviruses. Exemplary lentiviruses include, but are not limited to: HIV (human immunodeficiency virus); including HIV type 1 and HIV type 2; visna-maedi virus (VMV); caprine and ovine arthritis encephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immunodeficiency virus (BIV); and simian immunodeficiency virus (SIV). In one embodiment, HIV-based vector backbones (i.e., cis-acting elements of the HIV sequence) are preferred.

[0076] Retroviral vectors, and in particular lentiviral vectors, may be used in the practice of the present invention. Accordingly, the term "retroviral vector" as used herein is intended to include "lentiviral vector"; and the term "retrovirus" as used herein is intended to include "lentivirus".

[0077] The term "vector" as used herein refers to a nucleic acid molecule capable of transferring or transporting another nucleic acid molecule. The transferred nucleic acid is typically linked to, for example, integrated into, the nucleic acid molecule of the vector. The vector may include sequences that direct autonomous replication or reverse transcription in the cell, or may include sequences sufficient for integration into the DNA of the host cell. Suitable vectors include viral vectors. Suitable viral vectors include, for example, replication-defective retroviruses and lentiviruses.

[0078] The term "viral vector" may refer to either a vector, a vector particle capable of transferring a nucleic acid into a cell, or the nucleic acid being transferred itself. Viral vectors contain structural and/or functional genetic elements that are primarily derived from a virus. The term "retroviral vector" refers to a viral vector containing structural and functional genetic elements or portions thereof that are primarily derived from a retrovirus. The term "lentiviral vector" refers to a viral vector containing structural and functional genetic elements or portions thereof, including LTRs, that are primarily derived from a lentivirus. The term "hybrid" refers to a vector, LTR, or other nucleic acid containing both retroviral, such as lentiviral, sequences, and non-lentiviral viral sequences. In one embodiment, a hybrid vector refers to a vector or transfer plasmid containing retroviral, such as lentiviral, sequences for reverse transcription, replication, insertion and/or packaging.

[0079] In particular embodiments, the terms "lentiviral vector" and "lentiviral expression vector" may be used to refer to lentiviral transfer plasmids and/or infectious lentiviral particles. When reference is made herein to elements such as cloning sites, promoters, regulatory elements, heterologous nucleic acids, etc., it is understood that the sequences of these elements are present in the form of RNA in the lentiviral particles of the invention and are present in the form of DNA in the DNA plasmids of the invention.

[0080] In some particular embodiments, most or all of the backbone sequences of the viral vector are derived from a lentivirus, such as HIV-1. However, it will be appreciated that many different sources of lentiviral sequences may be used, and many substitutions and changes may be made in some of the lentiviral sequences without adversely affecting the ability of the transfer vector to perform the functions described herein. Moreover, many lentiviral vectors are known in the art, see Naldini et al., (1996a, 1996b, and 1998); Zufferey et al., (1997); Dull et al., 1998, U.S. Patent Nos. 6,013,516 and 5,994,136, many of which may be adapted to produce the viral vector or transfer plasmid of the present invention.

[0081] As used herein, the terms "polynucleotide" or "nucleic acid" generally refer to a biopolymer comprising nucleotide monomers covalently linked into a chain, such as DNA and RNA. In some embodiments, a polynucleotide refers to genomic DNA (gDNA), complementary DNA (cDNA), or DNA. Polynucleotides include single- and double-stranded polynucleotides, recombinant, synthetic, or isolated. In some embodiments, a polynucleotide refers to messenger RNA (mRNA), RNA, genomic RNA (gRNA), plus-strand RNA (RNA(+)), minus-strand RNA (RNA(-)). As used herein, the terms "polyribonucleotide" or "ribonucleic acid" also refer to messenger RNA (mRNA), RNA, genomic RNA (gRNA), plus-strand RNA (RNA(+)), minus-strand RNA (RNA(-)). Preferably, the polynucleotides of the invention include polynucleotides or variants having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any of the reference sequences described herein (see, e.g., the Sequence Listing), typically wherein the variant retains at least one biological activity of the reference sequence. In various exemplary embodiments, polynucleotide sequences of viral vectors and transfer plasmids, and compositions comprising them, are provided. In particular embodiments, polynucleotides encoding one or more therapeutic polypeptides and/or other genes of interest are provided. In particular embodiments, polynucleotides encoding a therapeutic polypeptide include, but are not limited to, the RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A, and OSTM1 genes. In some embodiments, the polynucleotides are codon-optimized versions of any of these genes. In some embodiments, the polynucleotides encode a human polypeptide or a functional fragment or variant thereof, such as, for example, a polypeptide encoded by any of the disclosed genes.

[0082] As used herein, a "pseudotyped" vector refers to a vector that has a recombinant capsid or coat protein that differs from the capsid or coat protein of the native vector. For example, a pseudotyped VSVG lentiviral vector is a vector that is created by coexpressing the VSVG viral coat protein with the RNA genome of the virus in a packaging cell line in a manner that ensures that the VSVG coat protein is included in viral particles containing the RNA genome. Pseudotyped vectors may have altered tropism and/or reduced immunogenicity, making them desirable for use in gene therapy. The creation of a pseudotyped vector, as well as altering the pseudotyping of a vector by creating viral particles in a different packaging cell line or by coexpressing the coat protein (or capsid protein) from a plasmid or other DNA encoding a different coat protein (or capsid protein), is within the skill of the art. Examples of methods are provided in Cronin et al. Curr. Gene Ther. 5:387-398 (2005). In some embodiments, the methods of the invention involve the use of pseudotyped recombinant retroviral vectors (e.g., lentiviral vectors). In some embodiments, the pseudotyped recombinant retroviral vectors are pseudotyped with VSVG.

[0083] By "enhance" or "promote" or "increase" or "expand" is generally meant the ability of the compositions and/or methods provided herein to induce, cause, or produce a greater number of transduced cells than the number of cells transduced with either a carrier or a control molecule/composition, or to induce, cause, or produce a higher VCN in a population of transduced cells. In one embodiment, a hematopoietic stem or progenitor cell transduced with the compositions and methods provided herein has an increase in the number of transduced cells than existing compositions and methods for transduction, or has an increase in VCN in a population of transduced cells. An increase in cell transduction can be determined using methods known in the art, such as, among others, reporter assays, real-time PCR, and cell surface protein expression. An "increased" or "enhanced" amount of transduction is typically a "statistically significant" amount and may include an increase of 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal values between and above 1, e.g., 1.5, 1.6, 1.7, 1.8, etc.) compared to the number of cells transduced by a vehicle, control composition, or other transduction method.

[0084] By “reduce” or “lower” or “reduce” or “reduce” or “attenuate” is generally meant compositions or methods that provide a comparatively smaller number of transduced cells compared to cells transduced using the compositions and/or methods of the present invention. A “reduced” or “decreased” transduction amount is typically a “statistically significant” amount and may include a decrease of 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal values between and above 1, e.g., 1.5, 1.6, 1.7, 1.8, etc.) compared to the number of transduced cells (reference response) obtained using the compositions and/or methods of the present invention.

[0085] By "maintain" or "preserve" or "maintain" or "no change" or "no significant change" or "no significant decrease" is generally meant a physiological response that is comparable to the response elicited by a carrier, a control molecule/composition, or a response in a particular cell. A comparable response is a response that is not substantially different or not different to a measurable extent from a reference response.

[0086] In the following description, certain specific details are set forth in order to provide a thorough understanding of the various illustrative embodiments of the invention provided herein. However, one skilled in the art will appreciate that certain illustrative embodiments may be practiced without these details. Furthermore, it should be understood that individual vectors or groups of vectors derived from various combinations of the structures and substituents described herein are disclosed herein to the same extent as if each vector or group of vectors were individually recited. Thus, the selection of particular vector structures or particular substituents is within the scope of the present invention.

[0087] As used herein, "X-VIVO 20" or "X-VIVO" refers to the chemically defined serum-free hematopoietic cell medium X-VIVO™ 20, available from Lonza®. Media other than X-VIVO 20 may be used, and those skilled in the art are able to select appropriate media for cell growth and transduction.

[0088] As used herein, "rhSCF" refers to recombinant human stem cell factor.

[0089] As used herein, "rhTPO" refers to recombinant human thrombopoietin.

[0090] As used herein, "rh-FLT3-L" refers to a recombinant human fms-like tyrosine kinase 3 ligand.

[0091] As used herein, "IL-3" or "rhIL-3" refers to recombinant human interleukin-3.

[0092] As used herein, “PGE2” refers to prostaglandin E2 (PGE2), also known as dinoprostone.

[0093] As used herein, "poloxamer" refers to nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)) on either side.

[0094] As used herein, a "recombinant fibronectin fragment" refers to any fragment of the fibronectin protein that enhances transduction efficiency. Without wishing to be bound by any particular theory, it is believed that a recombinant fibronectin fragment promotes colocalization of a lentivirus or retrovirus with target cells. An example of a recombinant fibronectin fragment is the CH296 fragment of human fibronectin, which has the trade name RetroNectin™.

[0095] The concentrations of PGE2 or its derivative, poloxamer or protamine sulfate given in the description and claims refer to the concentration of each agent in the medium in which the cells are cultured.

[0096] As used herein, "LB" or "LentiBoost" refers to the LentiBOOST™ transduction enhancer available from Sirion Biotech®. Synonyms include poloxamer 338, F108, and Kolliphor® P338.

[0097] As used herein, "HSA" refers to human serum albumin.

[0098] As used herein, "DMSO" refers to dimethyl sulfoxide.

[0099] As used herein, "CFC" refers to colony-forming cells. The colony-forming cell (CFC) assay is used to study the proliferation and differentiation patterns of hematopoietic progenitors by their ability to form colonies in a semi-solid medium. The number and morphology of colonies formed by a fixed number of initial cells provide preliminary information on the differentiation and proliferation capacity of the progenitors. Examples of assays are provided in Sarma et al. Colony forming cell (CFC) assay for human hematopoietic cells. J Vis Exp. 2010 Dec 18;(46).

[00100] In the context of this document, "LC" refers to "liquid culture".

[00101] As used herein, "CFU" refers to colony forming units. CFU is considered synonymous with COC, but is sometimes used to refer to CFU types that grow in semi-solid media.

[00102] As used herein, "TU" refers to transducing units. TU/mL is a commonly accepted measure of the functional titer of a retroviral (lentiviral) product.

[00103] As used herein, "PS" refers to protamine sulfate.

[00104] As used herein, "UT" refers to one or more transduction enhancers.

[00105] As used herein, "fresh CB cells" refers to fresh cord blood cells.

[00106] In the context of this document, "MOI" refers to multiplicity of infection.

[00107] As used herein, "BFU-E" refers to burst-forming units of the erythroid lineage (BFU-E), the earliest erythroid precursors.

[00108] As used herein, "CFU-GM" refers to colony-forming units of granulocyte-macrophage progenitors.

[00109] As used herein, "CFU-GEMM" refers to colony forming units of myeloid stem cells (granulocytes, erythrocytes, monocytes, megakaryocytes).

[00110] As used herein, "mPB" refers to mobilized peripheral blood cells.

[00111] As used herein, "SCGM" refers to the serum-free SCGM (stem cell growth medium) from CellGenix®.

[00112] The terms "administering" or "providing" as used herein refer to delivering a population of hematopoietic cells to a subject, such as by infusing said population of cells into the subject intra-arterially or intravenously. The population of hematopoietic cells may be administered in various solutions, such as saline. In some embodiments, the solution used will be isotonic with the blood of the subject and have a buffered pH.

[00113] A cell is typically said to be "transduced" after a viral vector or vector particle has introduced heterologous DNA (e.g., a vector or its expression cassette) into the genome of said cell.

[00114] The term "host cell" as used herein refers to a cell transduced with a viral vector or vector particle. It should be understood that the term "host cell" refers to the original transduced cell and its progeny.

[00115] The terms "treatment," "treat," and the like, as used herein, generally mean achieving a desired pharmacological and/or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof, such as reducing the likelihood that the disease or symptom thereof will occur in a subject, and/or may be therapeutic in terms of partially or completely curing the disease and/or an adverse event associated with the disease. "Treatment" as used herein encompasses any treatment of a disease in a mammal and includes: (a) preventing the onset of a disease in a subject that may be predisposed to developing it but has not yet been diagnosed with it; (b) suppressing the disease, i.e., stopping its progression; or (c) alleviating the disease, i.e., promoting regression of the disease. The therapeutic agent may be administered before, during, or after the onset of a disease or injury. Of particular interest is the treatment of the ongoing disease, in which the treatment stabilizes or reduces undesirable clinical symptoms in the patient. Such treatment is preferably carried out until complete loss of function in the affected tissues. It is desirable that the therapy in question be carried out during the symptomatic stage of the disease, and in some cases - after the symptomatic stage of the disease.

[00116] The terms "individual," "host," "subject," and "patient" are used interchangeably herein and refer to a mammal, including, but not limited to, humans and non-human primates, including monkeys and humans; mammalian sport animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian domestic animals (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

B. Implementation Options and Variations

[00117] Various compositions and methods are described below. Although particular embodiments of compositions and methods are exemplified herein, it is understood that any of a number of alternative compositions and methods are applicable and suitable for use in practicing the compositions and methods disclosed herein. It is also understood that evaluation of the expression constructs and methods disclosed herein can be performed using procedures that are standard in the art.

1. Transduction using combinations of transduction enhancers

[00118] The present invention provides advantageous methods for transducing hematopoietic cells with lentiviral vectors to produce a population of hematopoietic cells having a high percentage of cells transduced with the lentiviral vector. These methods are particularly advantageous for transducing hematopoietic cells with lentiviral gene therapy vectors to correct a genetic defect because they produce a large number of cells expressing a functional product of a corrected gene introduced by the lentiviral gene therapy vector.

[00119] Various transduction enhancers are known in the art, including polybrene, protamine sulfate, retronectin (a fragment of recombinant fibronectin), and DEAE-dextran. In some cases, polycationic agents such as polybrene have been used as transduction enhancers. Denning et al. Mol Biotechnol. 2013 Mar; 53(3): 308-314. In addition, rapamycin and cyclosporin A have been used as transduction enhancers. However, the present invention has discovered certain combinations of transduction enhancers that provide significantly higher levels of lentiviral transduction of hematopoietic cells compared to using each of such transduction enhancers alone.

[00120] In one aspect of the invention, there is provided a method for genetically modifying hematopoietic cells, comprising: contacting said hematopoietic cells with at least two transduction enhancers selected from prostaglandin E2 (PGE2) or a derivative thereof, poloxamer, protamine sulfate, and a fragment of recombinant fibronectin; and contacting said hematopoietic cells with a recombinant retroviral vector. The cells can be contacted with the retroviral vector under conditions and for a time sufficient to ensure transduction of the cells by the retroviral vector, such as in a suitable culture medium for at least one hour, at least two hours, at least four hours, at least eight hours, at least twelve hours, or at least 16 hours. In some embodiments, the cells are transduced once or twice consecutively, such as after prestimulation, with each transduction cycle being between 12 and 24 hours or between 16 and 18 hours. In some embodiments, the cells are contacted with the retroviral vector and the transduction enhancers at the same time or for an overlapping period of time. In some embodiments, the cells are contacted with the transduction enhancers and the recombinant retroviral vector at the same time or for an overlapping period of time. In certain embodiments, the two or more transduction enhancers comprise a poloxamer. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a poloxamer and PGE2 or a derivative thereof. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a poloxamer and a protamine sulfate. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a poloxamer, PGE2, and protamine sulfate. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a prostaglandin E2 (PGE2) or derivative thereof, a poloxamer, protamine sulfate, and a fragment of recombinant fibronectin. In various embodiments of any of the aspects and embodiments disclosed herein, the cells are transduced on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™. In various embodiments, the cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment, such as RetroNectin™, prior to and/or during transduction. In some embodiments, the method comprises prestimulating by culturing the cells on plates coated with about 2 μg/ ^cm2 RetroNectin™ (RN). In some embodiments, the cells are transduced in liquid medium containing Retro-Nectin™. In some embodiments, the cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment and are transduced in liquid culture in the presence of the recombinant fibronectin fragment and other UTs.

[00121] In one aspect, the invention provides a method of genetically modifying hematopoietic cells, comprising: providing hematopoietic cells; contacting the hematopoietic cells with at least two transduction enhancers selected from prostaglandin E2 (PGE2) or a derivative thereof, a poloxamer (e.g., poloxamer 338 (LentiBOOST™)), protamine sulfate, and a fragment of recombinant fibronectin; and contacting the hematopoietic cells with a recombinant retroviral vector. In particular embodiments, the cells are contacted with the transduction enhancers and the recombinant retroviral vector at the same time or for an overlapping period of time. In particular embodiments, the two or more transduction enhancers comprise a poloxamer. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise a poloxamer and PGE2 or a derivative thereof. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a poloxamer and protamine sulfate. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a poloxamer, PGE2, and protamine sulfate. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a prostaglandin E2 (PGE2) or a derivative thereof, a poloxamer, protamine sulfate, and a fragment of recombinant fibronectin. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In particular embodiments, the two or more transduction enhancers comprise or consist of prostaglandin E2 (PGE2) or a derivative thereof, a poloxamer, protamine sulfate, and a recombinant fibronectin fragment. In various embodiments of any of the aspects and embodiments disclosed herein, cells are transduced on plates coated with a recombinant fibronectin fragment, e.g., RetroNectin™. In various embodiments, cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment, e.g., RetroNectin™, prior to and/or during transduction. In particular embodiments, the method comprises prestimulating by culturing cells on plates coated with about 2 μg/ ^cm2 RetroNectin™ (RN). In some embodiments, the cells are transduced in a liquid medium containing Retro-Nectin™. In some embodiments, the cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment and are transduced in liquid culture in the presence of a recombinant fibronectin fragment and other UTs.

[00122] In various embodiments of the methods disclosed herein, a population of cells is cultured in the presence of a retroviral vector, one or more agents that stimulate the prostaglandin EP receptor signaling pathway, and a poloxamer having an average molecular weight of about 10,000 daltons. In some embodiments, the cells are contacted with the transduction enhancers and the recombinant retroviral vector at the same time or for an overlapping period of time.

[00123] In various embodiments of the methods disclosed herein, a population of cells is cultured in the presence of a retroviral vector, one or more agents that stimulate the prostaglandin EP receptor signaling pathway, and a poloxamer having an average molecular weight of polypropylene subunits greater than about 2250 daltons and comprising greater than about 40% polyethylene oxide. In some embodiments, the cells are contacted with the transduction enhancers and the recombinant retroviral vector at the same time or for an overlapping period of time.

[00124] In particular embodiments of the methods disclosed herein, the cells are transduced in a medium comprising a combination of three transduction enhancers: poloxamer 338 (LentiBOOST), PGE2, and protamine sulfate, such as in a liquid medium. The cells may be attached to a culture dish, or the cells may not be attached to a culture dish. In particular embodiments, the cells are contacted with the transduction enhancers and the recombinant retroviral vector at the same time or for an overlapping period of time. In particular embodiments, the method comprises prestimulating by culturing the cells on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™ (RN). In particular embodiments, the cells are transduced on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™. In various embodiments, the cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment, such as RetroNectin™, prior to and/or during transduction. In some embodiments, the method comprises prestimulating by culturing the cells on plates coated with about 2 μg/ ^cm2 RetroNectin™ (RN). In some embodiments, the cells are transduced in liquid medium containing Retro-Nectin™. In some embodiments, the cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment and are transduced in liquid culture in the presence of the recombinant fibronectin fragment and other UTs.

[00125] In a related aspect, the invention provides a method of enhancing recombinant retroviral vector-mediated genetic modification of hematopoietic cells, comprising treating hematopoietic cells or contacting them ex vivo with an effective amount of a combination of two or more transduction enhancers, wherein at least two of said transduction enhancers are selected from PGE2 or a derivative thereof, a poloxamer, protamine sulfate, and a recombinant fibronectin fragment. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In some embodiments, the cells are contacted with PGE2 or a derivative thereof and an effective amount of the poloxamer; and contacted with a recombinant retroviral vector comprising a polynucleotide comprising a gene of interest, wherein the efficiency of viral transduction of said retroviral vector is enhanced compared to transduction of hematopoietic cells by said recombinant retroviral vector in the absence of said combination of transduction enhancers, e.g., PGE2 and a poloxamer. In certain embodiments, the two or more transduction enhancers comprise a poloxamer and PGE2 or a derivative thereof. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). In certain embodiments, the two or more transduction enhancers comprise or consist of a poloxamer and protamine sulfate. In one embodiment, the method further comprises treating or contacting the hematopoietic cells ex vivo with an effective amount of protamine sulfate. In some embodiments, the two or more transduction enhancers comprise or consist of prostaglandin E2 (PGE2) or a derivative thereof, poloxamer, protamine sulfate, and a fragment of recombinant fibronectin. In various embodiments of any of the aspects and embodiments disclosed herein, the cells are transduced on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™. In various embodiments, the cells are pretreated by culturing on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™, prior to and/or during transduction. In some embodiments, the method comprises prestimulating by culturing the cells on plates coated with about 2 μg/ ^cm2 of RetroNectin™ (RN). In some embodiments, the cells are transduced in liquid medium containing Retro-Nectin™. In some embodiments, the cells are pretreated by culturing on plates coated with a recombinant fibronectin fragment and are transduced in liquid culture in the presence of the recombinant fibronectin fragment and other UTs.

[00126] In particular embodiments of any of the methods disclosed herein, the cells are contacted with a solution or culture medium comprising two or more transduction enhancers. The solution or culture medium may further comprise a recombinant retroviral vector, or the recombinant retroviral vector may be added after the cells are contacted with the solution or culture medium comprising the transduction enhancers. In particular embodiments, the cells are present in a culture dish comprising the solution or culture medium. In particular embodiments, the culture dish is coated with a recombinant fibronectin fragment. The cells may be contacted with the retroviral vector under conditions and for a time sufficient to allow transduction of the cells by the retroviral vector, such as in a suitable culture medium for at least one hour, at least two hours, at least four hours, at least eight hours, at least twelve hours, or at least 16 hours. In some embodiments, the cells are transduced once or twice in succession, such as after pre-stimulation, with each transduction cycle lasting from 12 to 24 hours or from 16 to 18 hours. In some embodiments, the cells are contacted with the retroviral vector and transduction enhancers at the same time or for an overlapping period of time.

[00127] In certain embodiments of any of the methods disclosed herein, the cells are contacted with a poloxamer. In one embodiment, the poloxamer is selected from the group consisting of poloxamer 288, poloxamer 335, poloxamer 338, and poloxamer 407. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). LentiBOOST™ can be used at a final concentration of from about 50 mcg/mL to about 1500 mcg/mL, from about 500 mcg/mL to about 1500 mcg/mL, from about 750 mcg/mL to about 1250 mcg/mL, about 900 mcg/mL, about 900 mcg/mL, about 950 mcg/mL, about 1000 mcg/mL, about 1050 mcg/mL, about 1100 mcg/mL, or about 1150 mcg/mL.

[00128] In some embodiments of any of the methods disclosed herein, the cells are contacted with PGE2 or a derivative thereof. In one embodiment, the PGE2 or derivative thereof is modified. In one embodiment, the PGE2 or derivative thereof is dimethylated PGE2. In one embodiment, the dimethylated PGE2 is 16,16-dimethylprostaglandin E2. 16,16-dimethylprostaglandin E2 has the following structure (represented as the "skeletal structure", which is also referred to as the "line-angle formula" or "simplified formula"):

Molecular formula: C ₂₂ H ₃₆ O ₅

[00129] In some embodiments, PGE2 or a derivative thereof is not modified.

[00130] In some embodiments, PGE2 or a derivative thereof may be used at a final concentration of from about 1 μM to about 200 μM, from about 10 μM to about 20 μM, from about 20 μM to about 40 μM, from about 40 μM to about 60 μM, from about 60 μM to about 80 μM, about 5 μM, about 10 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, or about 40 μM. PGE2 or a derivative thereof can be used at a final concentration of from about 0.3 μM to about 70 μg/mL, from about 3 μg/mL to about 7 μg/mL, from about 7 μg/mL to about 13 μg/mL, from about 13 μg/mL to about 20 μg/mL, from about 20 μg/mL to about 26 μg/mL, about 2 μg/mL, about 3 μg/mL, about 4 μg/mL, about 5 μg/mL, about 6 μg/mL, about 7 μg/mL, about 8 μg/mL, about 9 μg/mL, about 10 μg/mL, about 11 μg/mL, about 12 μg/mL, about 13 mcg/ml, approximately 14 mcg/ml, or approximately 15 mcg/ml.

[00131] In some embodiments of any of the methods disclosed herein, the method comprises contacting the hematopoietic cells with protamine sulfate. Protamine sulfate can be used at a final concentration of from about 4 μg/mL to about 15 μg/mL, from about 5 μg/mL to about 10 μg/mL, or about 5 μg/mL, about 6 μg/mL, about 7 μg/mL, about 8 μg/mL, about 9 μg/mL, about 10 μg/mL, about 11 μg/mL, about 12 μg/mL, about 13 μg/mL, about 14 μg/mL, or about 15 μg/mL, or more. In certain embodiments, protamine sulfate may be used at a final concentration of from about 1 μg/mL to about 5 μg/mL, from about 3 μg/mL to about 5 μg/mL, or about 1 μg/mL, about 2 μg/mL, about 3 μg/mL, about 4 μg/mL, or about 5 μg/mL.

[00132] In some embodiments of any of the methods disclosed herein, the cells are contacted with poloxamer 338 and PGE2 or a derivative thereof. In one embodiment, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 900 μg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 900 μg/mL and about 2 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 4 μg/mL, respectively, or about 900 μg/mL and about 5 μg/mL, respectively, or about 900 μg/mL and about 6 μg/mL, respectively, or about 900 μg/mL and about 7 μg/mL, respectively, or about 900 mcg/mL and about 8 mcg/mL, respectively, or about 900 mcg/mL and about 9 mcg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 mcg/mL to about 7 mcg/mL, from about 1 mcg/mL to about 5 mcg/mL, from about 3 mcg/mL to about 5 mcg/mL, or about 1 mcg/mL, about 2 mcg/mL, about 3 mcg/mL, about 4 mcg/mL, about 5 mcg/mL, or about 6 mcg/mL.

[00133] In some embodiments, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 950 μg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 900 μg/mL and about 2 μg/mL, respectively, or about 950 μg/mL and about 3 μg/mL, respectively, or about 950 μg/mL and about 3 μg/mL, respectively, or about 950 μg/mL and about 4 μg/mL, respectively, or about 950 μg/mL and about 5 μg/mL, respectively, or about 950 μg/mL and about 6 μg/mL, respectively, or about 950 μg/mL and about 7 μg/mL, respectively, or about 950 μg/mL and about 8 μg/mL, respectively, or about 950 μg/mL and about 9 μg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of about 3 μg/mL to about 7 μg/mL, about 1 μg/mL to about 5 μg/mL, about 3 μg/mL to about 5 μg/mL, or about 1 μg/mL, about 2 μg/mL, about 3 μg/mL, about 4 μg/mL, about 5 μg/mL, or about 6 μg/mL.

[00134] In some embodiments, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 1000 μg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 1000 μg/mL and about 2 μg/mL, respectively, or about 1000 μg/mL and about 3 μg/mL, respectively, or about 1000 μg/mL and about 3 μg/mL, respectively, or about 1000 μg/mL and about 4 μg/mL, respectively, or about 1000 μg/mL and about 5 μg/mL, respectively, or about 1000 μg/mL and about 6 μg/mL, respectively, or about 1000 μg/mL and about 7 mcg/mL, respectively, or about 1000 mcg/mL and about 8 mcg/mL, respectively, or about 1000 mcg/mL and about 9 mcg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 mcg/mL to about 7 mcg/mL, from about 1 mcg/mL to about 5 mcg/mL, from about 3 mcg/mL to about 5 mcg/mL, or about 1 mcg/mL, about 2 mcg/mL, about 3 mcg/mL, about 4 mcg/mL, about 5 mcg/mL, or about 6 mcg/mL.

[00135] In some embodiments, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 1050 μg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 1050 μg/mL and about 2 μg/mL, respectively, or about 1050 μg/mL and about 3 μg/mL, respectively, or about 1050 μg/mL and about 3 μg/mL, respectively, or about 1050 μg/mL and about 4 μg/mL, respectively, or about 1050 μg/mL and about 5 μg/mL, respectively, or about 1050 μg/mL and about 6 μg/mL, respectively, or about 1050 μg/mL and about 7 mcg/mL, respectively, or about 1050 mcg/mL and about 8 mcg/mL, respectively, or about 1050 mcg/mL and about 9 mcg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 mcg/mL to about 7 mcg/mL, from about 1 mcg/mL to about 5 mcg/mL, from about 3 mcg/mL to about 5 mcg/mL, or about 1 mcg/mL, about 2 mcg/mL, about 3 mcg/mL, about 4 mcg/mL, about 5 mcg/mL, or about 6 mcg/mL.

[00136] In some embodiments of any of the methods disclosed herein, the cells are contacted with poloxamer 338 and PGE2 or a derivative thereof. In one embodiment, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 0.5 mg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 0.5 mg/mL and about 2 μg/mL, respectively, or about 0.5 mg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or about 0.5 mg/mL and about 4 μg/mL, respectively, or about 0.5 mg/mL and about 5 μg/mL, respectively, or about 0.5 mg/mL and about 6 μg/mL, respectively, or about 0.5 mg/mL and about 7 μg/mL, respectively, or about 0.5 mg/mL and about 8 μg/mL, respectively, or about 0.5 mg/mL and about 9 μg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of about 3 μg/mL to about 7 μg/mL, about 1 μg/mL to about 5 μg/mL, about 3 μg/mL to about 5 μg/mL, or about 1 μg/mL, about 2 μg/mL, about 3 μg/mL, about 4 μg/mL, about 5 μg/mL, or about 6 μg/mL.

[00137] In some embodiments of any of the methods disclosed herein, the cells are contacted with poloxamer 338 and PGE2 or a derivative thereof. In one embodiment, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 1 mg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 1 mg/mL and about 2 μg/mL, respectively, or about 1 mg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or about 1 mg/mL and about 4 μg/mL, respectively, or about 1 mg/mL and about 5 μg/mL, respectively, or about 1 mg/mL and about 6 μg/mL, respectively, or about 1 mg/mL and about 7 μg/mL, respectively, or about 1 mg/mL and about 8 μg/mL, respectively, or about 1 mg/mL and about 9 mcg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 mcg/mL to about 7 mcg/mL, from about 1 mcg/mL to about 5 mcg/mL, from about 3 mcg/mL to about 5 mcg/mL, or about 1 mcg/mL, about 2 mcg/mL, about 3 mcg/mL, about 4 mcg/mL, about 5 mcg/mL, or about 6 mcg/mL.

[00138] In some embodiments of any of the methods disclosed herein, the cells are contacted with poloxamer 338 and PGE2 or a derivative thereof. In one embodiment, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 2 mg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 2 mg/mL and about 2 μg/mL, respectively, or about 2 mg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or about 2 mg/mL and about 4 μg/mL, respectively, or about 2 mg/mL and about 5 μg/mL, respectively, or about 2 mg/mL and about 6 μg/mL, respectively, or about 2 mg/mL and about 7 μg/mL, respectively, or about 2 mg/mL and about 8 μg/mL, respectively, or about 2 mg/mL and about 9 mcg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 mcg/mL to about 7 mcg/mL, from about 1 mcg/mL to about 5 mcg/mL, from about 3 mcg/mL to about 5 mcg/mL, or about 1 mcg/mL, about 2 mcg/mL, about 3 mcg/mL, about 4 mcg/mL, about 5 mcg/mL, or about 6 mcg/mL.

[00139] In some embodiments of any of the methods disclosed herein, the cells are contacted with poloxamer 338 and PGE2 or a derivative thereof. In one embodiment, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of about 4 mg/mL and about 3 μg/mL to about 7 μg/mL, respectively, or about 4 mg/mL and about 2 μg/mL, respectively, or about 4 mg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or about 4 mg/mL and about 4 μg/mL, respectively, or about 4 mg/mL and about 5 μg/mL, respectively, or about 4 mg/mL and about 6 μg/mL, respectively, or about 4 mg/mL and about 7 μg/mL, respectively, or about 4 mg/mL and about 8 μg/mL, respectively, or about 4 mg/mL and about 9 mcg/mL, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 mcg/mL to about 7 mcg/mL, from about 1 mcg/mL to about 5 mcg/mL, from about 3 mcg/mL to about 5 mcg/mL, or about 1 mcg/mL, about 2 mcg/mL, about 3 mcg/mL, about 4 mcg/mL, about 5 mcg/mL, or about 6 mcg/mL.

[00140] In some embodiments of any of the methods disclosed herein, the cells are contacted with poloxamer 338 and PGE2 or a derivative thereof. In one embodiment, poloxamer 338 and PGE2 or a derivative thereof are used at final concentrations of from about 0.5 mg/mL to about 4 mg/mL and from about 3 μg/mL to about 7 μg/mL, respectively, or from about 0.5 mg/mL to about 4 mg/mL and about 2 μg/mL, respectively, or from about 0.5 mg/mL to about 4 mg/mL and about 3 μg/mL, respectively, or about 900 μg/mL and about 3 μg/mL, respectively, or from about 0.5 mg/mL to about 4 mg/mL and about 4 μg/mL, respectively, or from about 0.5 mg/mL to about 4 mg/mL and about 5 μg/mL, respectively, or from about 0.5 mg/mL to about 4 mg/mL and about 6 mcg/ml, respectively, or from about 0.5 mg/ml to about 4 mg/ml and about 7 mcg/ml, respectively, or from about 0.5 mg/ml to about 4 mg/ml and about 8 mcg/ml, respectively, or from about 0.5 mg/ml to about 4 mg/ml and about 9 mcg/ml, respectively. In any of the above embodiments, protamine sulfate may optionally be used at a final concentration of from about 3 μg/mL to about 7 μg/mL, from about 1 μg/mL to about 5 μg/mL, from about 3 μg/mL to about 5 μg/mL, or about 1 μg/mL, about 2 μg/mL, about 3 μg/mL, about 4 μg/mL, about 5 μg/mL, or about 6 μg/mL.

[00141] In preferred embodiments, the cells are transduced with a lentiviral vector in a medium comprising poloxamer 338 at a concentration of about 0.5 mg/mL to about 4 mg/mL; PGE2 at a concentration of about 10 μg/mL to about 50 μg/mL; and protamine sulfate at a concentration of about 1 μg/mL to about 10 μg/mL. In an attached embodiment, the substrate is optionally coated with a CH296 fragment of human fibronectin, tradenamed RetroNectin™, using a RetroNectin™ solution at a concentration of about 20 μg/mL to about 100 μg/mL.

[00142] In preferred embodiments, the cells are contacted with poloxamer 338 at a concentration of about 0.5 mg/mL to about 4 mg/mL; PGE2 at a concentration of about 10 μg/mL to about 50 μg/mL; and protamine sulfate at a concentration of about 1 μg/mL to about 10 μg/mL.

[00143] In preferred embodiments, the cells are transduced with a lentiviral vector in a medium comprising poloxamer 338 at a concentration of about 1 mg/mL; PGE2 at a concentration of about 10 μM; and protamine sulfate at a concentration of about 4 μg/mL. In an attached embodiment, the substrate is optionally coated with a fragment of human fibronectin CH296, trade name RetroNectin™, using a RetroNectin™ solution at a concentration of about 20 μg/mL. In certain embodiments, the culture dishes are coated with 2 μg/ ^cm2 RetroNectin™. In certain embodiments, the method comprises pre-stimulating by culturing the cells on plates coated with a fragment of recombinant fibronectin, such as RetroNectin™ (RN).

[00144] In preferred embodiments, the cells are contacted with poloxamer 338 at a concentration of about 1 mg/mL; PGE2 at a concentration of about 10 μM; and protamine sulfate at a concentration of about 4.

[00145] Additional exemplary embodiments are provided in Table 1 and Table 2. Any of the disclosed combinations and concentrations of transduction enhancers can be used in accordance with the disclosed methods as well as with other cell types. In addition, any of the disclosed combinations can be further used in combination with recombinant fibronectin, such as RetroNectin™, for example, when the culture dishes used for transduction are coated with RetroNectin™.

[00146] In some embodiments, the contacting steps are carried out simultaneously or at times that overlap.

[00147] In some embodiments, the concentration of PGE2 or a derivative thereof is 5-30 μg/mL.

[00148] In some embodiments, the concentration of PGE2 or a derivative thereof is about 10 μg/mL.

[00149] In some embodiments, the concentration of poloxamer is 200-1200 mcg/mL.

[00150] In some embodiments, the concentration of poloxamer is about 1000 mcg/mL.

[00151] In some embodiments, the concentration of protamine sulfate is 4-10 μg/mL.

[00152] In some embodiments, the concentration of protamine sulfate is about 4 μg/mL.

[00153] In some embodiments, the hematopoietic cells have been or are cultured in vessels coated with recombinant fibronectin or a fragment thereof that enhances transduction efficiency. The recombinant fibronectin fragment (e.g., the CH296 fragment of human fibronectin, which has the trade name RetroNectin™) promotes colocalization of the lentivirus or retrovirus with target cells and enhances transduction efficiency.

[00154] In some embodiments, the method comprises contacting hematopoietic cells with a recombinant fibronectin fragment, poloxamer, and PGE2.

[00155] In some embodiments, the method comprises contacting the hematopoietic cells with a fragment of recombinant fibronectin, poloxamer, and protamine sulfate. In some embodiments, the method comprises contacting the hematopoietic cells with a fragment of recombinant fibronectin, poloxamer, PGE2, and protamine sulfate.

[00156] In some embodiments, the method comprises contacting hematopoietic cells with a fragment of recombinant fibronectin, PGE2, and protamine sulfate.

[00157] In particular embodiments of any of the methods disclosed herein, the cells are contacted with transduction enhancers at the same time or for an overlapping period of time. In particular embodiments, the cells are also contacted with a recombinant retroviral vector, such as at the same time or for an overlapping period of time as contacting the cells with transduction enhancers. In particular embodiments, the cells are present in vessels containing a solution or culture medium, wherein the vessels and/or culture media contain transduction enhancers.

Prostaglandins

[00158] Prostaglandins generally refer to hormone-like molecules that are derivatives of fatty acids containing 20 carbon atoms, including a 5-carbon ring, as described herein and known in the art. Prostaglandin E2 (PGE2), also known as dinoprostone, is a natural prostaglandin used as a drug. PGE2 has the following structure (represented as a "skeletal structure", which is also called the "line-angle formula" or "simplified formula"):

Molecular formula of PGE2: C ₂₂ H ₃₆ O ₅

[00159] Prostaglandin E2 (PGE2) has been shown to enhance lentiviral delivery of transgenes in ex vivo cultured CD34+ cells. Heffner et al. Mol Ther. 2018 Jan 3;26(1):320-328.

[00160] Illustrative examples of "analogs" or "derivatives" of PGE2 include, but are not limited to, 16,16-dimethyl- _PGE2 ( _dmPGE2 ), para-(para-acetamidobenzamido)phenyl ether of 16-16-dimethyl- _PGE2 , 11-deoxy-16,16-dimethyl- _PGE2 , 9-deoxy-9-methylene-16,16-dimethyl- _PGE2 , 9-deoxy-9-methylene- _PGE2 , 9-ketofluprostenol, 5-trans- _PGE2 , 17-phenyl-omega-trinor- _PGE2 , _PGE2 -serinolamide, _PGE2 methyl ester, 16-phenyltetranor- _PGE2 , 15(S)-15-methyl-PGE ₂ , 15(R)-15-methyl-PGE ₂ , 8-iso-15-keto-PGE ₂ , isopropyl ester of 8-iso-PGE ₂ , 20-hydroxy-PGE ₂ , nocloprost, sulprostone, butaprost, 15-keto-PGE ₂ and 19(R)-hydroxy-PGE ₂ .

[00161] Also contemplated herein are prostaglandin analogs or derivatives having a similar structure to PGE2, substituted with a halogen at the 9-position (see, for example, WO 2001/12596, incorporated herein by reference in its entirety), as well as 2-decarboxy-2-phosphine derivatives of prostaglandin, such as those described in U.S. Patent Application Publication No. 2006/0247214, incorporated herein by reference in its entirety.

Poloxamers

[00162] Poloxamers are nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)) . Poloxamers are also known under the trade names Synperonics, ® Pluronics® and Kolliphor®. Because the length of the polymer blocks can be adjusted, many different poloxamers exist. Poloxamers are typically designated by the letter P (for poloxamer) followed by three digits: the first two digits, multiplied by 100, give the approximate molecular weight of the polyoxypropylene core, and the last digit, multiplied by 10, gives the percentage of polyoxyethylene (e.g. P407 = a poloxamer with a polyoxypropylene molecular weight of 4000 g/mol and a polyoxyethylene content of 70%).

[00163] In particular embodiments, the poloxamer has an average molecular weight of the polypropylene subunits of at least about 2750 daltons. In particular embodiments, the poloxamer has an average molecular weight of the polypropylene subunits of at least about 3250 daltons. In particular embodiments, the poloxamer has an average molecular weight of the polypropylene subunits of at least about 4000 daltons or at least about 10000 daltons.

[00164] In particular embodiments, the poloxamer comprises at least about 50% polyethylene oxide. In particular embodiments, the poloxamer comprises at least about 60% polyethylene oxide. In particular embodiments, the poloxamer comprises at least about 70% polyethylene oxide. In particular embodiments, the poloxamer comprises at least about 80% polyethylene oxide.

[00165] In particular embodiments, the poloxamer has an average molecular weight of the polypropylene subunits of at least about 2750 daltons, and the poloxamer comprises at least about 40% polyethylene oxide. In particular embodiments, the poloxamer has an average molecular weight of the polypropylene subunits of at least about 2750 daltons, and the poloxamer comprises at least about 50% polyethylene oxide. In particular embodiments, the poloxamer has an average molecular weight of the polypropylene subunits of at least about 3250 daltons, and the poloxamer comprises at least about 50% polyethylene oxide.

[00166] In certain embodiments, the poloxamer is selected from the group consisting of poloxamer 288, poloxamer 335, poloxamer 338, and poloxamer 407. In one embodiment, the poloxamer is poloxamer 288. In one embodiment, the poloxamer is poloxamer 335. In one embodiment, the poloxamer is poloxamer 338. In one embodiment, the poloxamer is poloxamer 407. In one embodiment, the recombinant retroviral vector is a recombinant lentiviral vector.

[00167] Poloxamer F108 has recently been shown to improve hematopoietic cell transduction. Hoefig et al. J Gene Med. 2012 Aug;14(8):549-60; US Patent No. 9,771,599. Incorporation of poloxamer into a standard hematopoietic stem cell (HSC) transduction protocol results in high transduction efficiencies while maintaining the ability of transduced HSCs to differentiate into various hematopoietic lineages. Hauber at al. Hum Gene Ther Methods. 2018 Apr;29(2):104-113.

Recombinant fibronectin fragment

[00168] The recombinant fibronectin fragment may be any fragment of the fibronectin protein, such as human fibronectin, that enhances transduction efficiency. Without being bound by any particular theory, it is believed that the recombinant fibronectin fragment promotes colocalization of the lentivirus or retrovirus with target cells. An example of a recombinant fibronectin fragment is the CH296 fragment of human fibronectin, which has the trade name RetroNectin™.

Hematopoietic cells

[00169] Hematopoietic cells that can be transduced according to the methods disclosed herein include any hematopoietic cells or population thereof. In certain embodiments, the hematopoietic cells are mammalian, e.g., human, hematopoietic cells obtained from a mammal. In certain embodiments, the hematopoietic cells are obtained from a human to be treated with the hematopoietic cells after transduction according to the method disclosed herein. In one embodiment, the hematopoietic cells have been enriched in CD34+ cells. In certain embodiments, the hematopoietic cells are CD34-enriched cell populations obtained from a biological sample obtained from a subject. In one embodiment, the biological sample is a bone marrow sample. In another embodiment, the biological sample is peripheral blood. In another embodiment, the biological sample is cord blood.

[00170] In particular embodiments, a biological sample, such as peripheral blood, is obtained from a subject after mobilization of hematopoietic stem cells (HSCs). In one embodiment, the HSCs and/or progenitor cells are mobilized by administering G-CSF or an analog thereof to the subject. The HSCs and progenitor cells (HSPCs) in the peripheral blood may be mobilized prior to collection of the biological sample. The peripheral blood HSCs and HSPCs may be mobilized by any method known in the art. The peripheral blood HSCs and HSPCs may be mobilized by administering to the subject therapy with any agent(s) described herein or known in the art that increases the number of HSPCs circulating in the subject's peripheral blood. For example, in particular embodiments, peripheral blood is mobilized by administering one or more cytokines or growth factors (e.g., G-CSF, kit ligand (KL), IL-I, IL-7, IL-8, IL-11, Flt3 ligand, SCF, thrombopoietin, or GM-CSF (granulocyte macrophage colony stimulating factor) (such as sargramostim)) to a subject. Various types of G-CSF that can be used in methods of mobilizing peripheral blood include filgrastim and extended-release G-CSF pegfilgrastim. In particular embodiments, peripheral blood is mobilized by administering to the subject one or more chemokines (e.g., macrophage inflammatory protein-1a (MIP1a/CCL3)), chemokine receptor ligands (e.g., chemokine receptor-2 ligands GRO13 and GR013M), chemokine receptor analogs (e.g., stromal cell derived factor-1a (SDF-1a) protein analogs such as CTCE-0021, CTCE-0214, or SDF-1a such as Met-SDF-113), or chemokine receptor antagonists (e.g., chemokine (C-X-C motif) receptor 4 (CXCR4) antagonists such as AMD3100). In particular embodiments, peripheral blood is mobilized by administering to the subject one or more agents against integrin signaling (e.g., a blocking antibody to very late antigen 4 (VLA-4) or an antibody to vascular endothelial cell adhesion molecule type 1 (VCAM-1)). In particular embodiments, peripheral blood is mobilized by administering to the subject one or more cytotoxic drugs, such as cyclophosphamide, etoposide, or paclitaxel. In particular embodiments, peripheral blood can be mobilized by administering to the subject one or more agents listed above over a period of time. For example, the subject may be treated with one or more agents (e.g., G-CSF) by injection (e.g., subcutaneous, intravenous, or intraperitoneal) once daily or twice daily 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to HSPC collection. In particular embodiments, HSPC are collected within 1, 2, 3, 4, 5, 6.7, 8, 12, 14, 16, 18, 20, or 24 hours after the last dose of the agent used to mobilize HSPC into the peripheral blood. In particular embodiments, HSCs and HSPCs are mobilized by administering to the subject therapy with two or more different types of agents described above or known in the art, such as a growth factor (e.g., G-CSF) and a chemokine receptor antagonist (e.g., a CXCR4 receptor antagonist such as AMD3100), or a growth factor (e.g., G-CSF or KL) and an anti-integrin agent (e.g., a VLA-4 blocking antibody). In one embodiment, HSCs and/or progenitor cells are mobilized by administering to the subject therapy with G-CSF or an analog thereof. In one embodiment, the G-CSF is filgrastim. In one embodiment, HSCs and/or progenitor cells are mobilized by administering to the subject therapy with plerixafor. In a particular embodiment, HSCs and/or progenitor cells are mobilized with a combination of filgrastim and plerixafor, filgrastim alone, or plerixafor alone. In particular embodiments, different types of mobilizing agents are administered simultaneously or sequentially. For further information regarding methods of mobilizing peripheral blood, see, e.g., Craddock et al., 1997, Blood 90(12):4779-4788; Jin et al., 2008, Journal of Translational Medicine 6:39; Pelus, 2008, Curr. Opin. Hematol. 15(4):285-292; Papayannopoulou et al., 1998, Blood 91(7):2231-2239; Tricot et al., 2008, Haematologica 93(11):1739-1742; and Weaver et al., 2001, Bone Marrow Transplantation 27(2):S23-S29).

[00171] In some embodiments, peripheral blood is obtained through a syringe or catheter inserted into a vein of the subject. For example, peripheral blood can be collected using an apheresis machine. Blood flows from a vein through a catheter into an apheresis machine, which separates white blood cells, including HSPC, from the rest of the blood, and then returns the remaining blood to the patient. Apheresis can be performed over several hours over several consecutive days (e.g., 1 to 5 days) until a sufficient number of HSPC are collected.

[00172] In certain embodiments, bone marrow is obtained from the posterior iliac crest of a subject by needle aspiration (see, e.g., Koda et al., 1984, J. Clin Invest. 73:1377-1384).

[00173] In some embodiments, the hematocrit level of a biological sample can be determined. The hematocrit level can be determined by centrifuging the sample in a processing chamber to form a layer of red blood cells of the sample so that the volume of sedimented red blood cells can be determined. It should be appreciated that the sample can be combined with an anticoagulant to facilitate the determination of the hematocrit level, and that such an anticoagulant can be added to the processing chamber before or during centrifugation. Alternatively, the hematocrit level can be determined by measuring the optical properties of the sample. For example, a spectrometer can be used to analyze the sample. It should be appreciated that any type of known spectroscopic methods for determining the hematocrit level can be used, such as, for example, Raman spectroscopy and/or light scattering methods.

[00174] In some embodiments, the biological sample is depleted of red blood cells, such as before obtaining one or more cell populations enriched in CD34+ cells from the biological sample. In some embodiments, the cells remaining after the depletion procedures are washed. In another embodiment, non-specific IgG is added to the washed cells. In some embodiments, the non-specific IgG is phlebogamma.

[00175] In some cases, two or more biological samples are mixed prior to CD34+ selection, including, for example, bone marrow samples collected at different times, such as 1, 2, 3, 4 or more days apart, or 1, 2 or 3 weeks apart, or 1, 2 or 3 months apart, or several years apart, including other time periods.

Enrichment of hematopoietic cells with CD34+ cells

[00176] In some embodiments, the hematopoietic cells are CD34-positive hematopoietic cells. Typically, CD34+ cells are obtained by enriching for CD34 under high stringency selection. Alternatively, or in addition to enriching under high stringency selection, enriching for CD34 under low stringency selection may be performed.

[00177] As used herein, "high stringency selection" or "high stringency conditions" refers to a method of enriching a cell population designed to achieve significant enrichment of cells expressing a particular biological marker, such as CD34. For example, enrichment of CD34 "under high stringency selection" when used in a clinical setting yields an average yield of 61.6% and a median yield of 65.7% of CD34 ⁺ cells, and an average relative purity of 88.5% and a median relative purity of 95.9% (N=166) (Clin Lab. 2016 Jul 1;62(7):1243-1248 (PMID: 28164638)). “High stringency gating” refers to a process designed to substantially enrich for a relatively rare cell type, CD34+, which typically constitutes 0.2-2% of a leukapheresis product with mobilization or a bone marrow sample. Enrichment of CD34+ cells with high stringency gating from a leukapheresis product with mobilization or a bone marrow sample is designed to achieve final percentages of CD34+ that are increased from 0.2-2% to >80%. This is accomplished by performing repeated buffer exchanges, referred to herein as “washes,” after the initial application of the biological sample to the capture matrix to remove cells that are weakly or non-specifically bound to the capture matrix. Typically, cells are removed from the capture matrix and re-applied for each wash cycle. Removal and re-application can be accomplished manually by aspirating solution from tubes using a pipette or automatically using a pump and tubing system. For example, when using MagCloudz® from Quad Technologies in combination with the Dynabeads® Magnetic Cell Separation System, cell-magnetic particle complexes are separated in tubes on a magnetic stand and washing is performed manually. When using the CliniMACS® system from Miltenyi Biotec, a pre-configured automated program loads cell-magnetic particle complexes onto a magnetic column via a set of tubes and washes/reloads are performed using a valve pump system. In some embodiments, high-stringency selection can be performed on a variety of instruments, including, but not limited to, the MACSQuant Tyto® from Miltenyi Biotec, the MagCloudz® from Quad Technologies, the Sepax® Cell Separation System from GE, the Elutra® Cell Separation System from Terumo, the COBE Spectra® Cell Separator, the SynGen LAB® or WASH® Systems, the Lovo® from Fresenius-Kabi, the CliniMACS® System from Miltenyi Biotec, or the CliniMACS Prodigy® System. Selection can be performed in the laboratory or at the point of care. Detailed methods for preparing and enriching cells and cell populations, including exemplary methods for selecting CD34+ cells under high stringency conditions, are described, for example, in International Publication No. WO 2016/118780. An illustrative selection method suitable for high stringency selection is provided in U.S. Patent No. 8,727,132. Additional illustrative selection methods are provided in international patent application PCT/US2019/027083, particularly in Example 1.

[00178] In a high stringency enrichment protocol, a biological sample containing CD34+ cells is labeled with a CD34 labeling reagent, such as directly conjugated immunomagnetic beads. The biological sample may be suspended in any suitable liquid, such as, but not limited to, phosphate buffered saline (PBS) with optionally ethylenediaminetetraacetic acid (EDTA) at a buffer pH and isotonicity compatible with cell viability. In some cases, the liquid used also contains human serum albumin at a suitable concentration, such as approximately 2.5%. Using magnetically activated cell sorting (MACS) technology, the biological sample, after labeling, is loaded onto a column containing a magnetically sensitive or ferromagnetic material. With the MACS system, a magnetically sensitive or ferromagnetic column material retains target cells without interfering with the ability of non-target cells to pass through and out of the column. Such magnetically sensitive or ferromagnetic materials include iron, steel, cobalt, nickel, and other ferromagnetic rare earth metals or alloys thereof. Those skilled in the art will appreciate that such materials can be readily magnetized and demagnetized. In some embodiments, the biological sample is repeatedly passed through the magnetically sensitive or ferromagnetic material one or more times. After loading the column, the bound cells are washed, eluted, and/or reloaded onto the column at a slow speed to improve the purity of the enriched fraction. Suitable wash buffers include PBS with (optional) EDTA and (optional) human serum albumin. Any component of the labeled biological sample that is removed during the wash steps is collected in a waste bag or "non-target" bag. After suitable washing steps, the enriched cells under high selection stringency are eluted into a target cell bag.

[00179] In a low stringency enrichment protocol, a biological sample containing CD34+ cells is labeled with a CD34 labeling reagent, such as directly conjugated immunomagnetic beads. Using magnetically activated cell sorting (MACS) technology, the labeled biological sample is loaded onto a column containing a magnetically sensitive or ferromagnetic material at a lower flow rate than for high stringency enrichment. As with high stringency enrichment, the magnetically sensitive or ferromagnetic column material retains target cells without interfering with the ability of non-target cells to pass through and out of the column. In some embodiments, the biological sample is recycled through the magnetically sensitive or ferromagnetic material one or more times. After loading the low stringency enrichment column, bound cells are washed at a lower stringency. Bound cells are then eluted into a collection bag.

[00180] In an exemplary embodiment, enrichment at low selection stringency is accomplished by modifying a standard operating procedure of the MACS system such that the system's "depletion mode" program, designed to achieve depletion at high selection stringency (i.e., removal of target cells), instead results in enrichment at low selection stringency. Operation of the MACS system in depletion mode causes binding of target cells in a biological sample to a magnetically sensitive or ferromagnetic material in a column using slow column loading and wash steps at a lower selection stringency than operation in enrichment mode. Non-target cells are washed out by the MACS system into a wash or so-called "target" pack. The depletion mode program then switches the outlet valve to direct fluid into the so-called "non-target" pack and then demagnetizes the column. Continued loading of liquid into the demagnetized column results in the elution of the enriched CD34+ cell population, which was enriched under low stringency conditions, into the so-called “non-target” bag, where the target cells are collected using this method.

[00181] Those skilled in the art will appreciate that the low stringency enrichment method can be performed on a variety of instruments, including, but not limited to, the MACSQuant Tyto® from Miltenyi Biotec, the MagCloudz® from Quad Technologies, the Sepax® Cell Separation System from GE, the Elutra® Cell Separation System from Terumo, the COBE Spectra® Cell Separator, the SynGen LAB® or WASH® Systems, the Lovo® from Fresenius-Kabi, the CliniMACS® System from Miltenyi Biotec, or the CliniMACS Prodigy® System. Without undue experimentation, one skilled in the art will be able to reprogram the software of such a MACS system such that the outlet valve directs the initial binding step flow to the waste or "off-target" bag (rather than the target bag) and directs the eluted low-stringency CD34-enriched population to the "target" bag. As a result, low-stringency enrichment is then carried out in a separation mode without the usual wash steps of conventional MACS programs.

[00182] As used herein, "low stringency selection" or "low stringency conditions" refers to a method of enriching a population of cells that is designed to achieve enrichment of cells expressing a particular biological marker, such as CD34, in a manner that maintains a higher yield of the enriched population of cells than that achieved with high stringency selection due to enrichment of cells expressing the biological marker relative to other cells in the biological sample, i.e., reduced enrichment. By definition, the fold enrichment under high stringency conditions is greater than the fold enrichment under low stringency conditions. The fold enrichment of cells, such as CD34+ cells, in the (CD34 or other marker)-enriched cell population under high selection stringency is, in some cases, 2-fold, 2.25-fold, 2.5-fold, 2.75-fold, 3-fold, 3.25-fold, 3.5-fold, 3.75-fold, or 4-fold greater than the fold enrichment of CD34+ cells in the (CD34 or other marker)-enriched cell population under low selection stringency. In one embodiment, the fold enrichment of cells, such as CD34+ cells, in the (CD34 or other marker)-enriched cell population under high selection stringency is 2-fold to 4-fold greater than the fold enrichment of CD34+ cells in the (CD34 or other marker)-enriched cell population under low selection stringency. In some embodiments, low-stringency selection can be performed on a variety of instruments, including, but not limited to, the MACSQuant Tyto® from Miltenyi Biotec, MagCloudz® from Quad Technologies, Sepax® Cell Separation System from GE, Elutra® Cell Separation System from Terumo, COBE Spectra® Cell Separator, SynGen LAB® or WASH® Systems, Lovo® from Fresenius-Kabi, CliniMACS® System from Miltenyi Biotec, or CliniMACS Prodigy® System. Selection can be performed in the laboratory or at the point of care. Exemplary methods for low-stringency cell enrichment are provided in International Patent Application PCT/US2019/027083, which is incorporated herein by reference in its entirety.

[00183] Populations of cells enriched in CD34+ cells can be obtained by selecting CD34+ cells under high stringency conditions and/or under low stringency conditions, thereby obtaining a CD34-enriched cell population under high stringency selection and/or a CD34-enriched cell population under low stringency selection. Methods for selecting CD34+ cells can be positive selection, negative selection, or a combination thereof. In certain embodiments, a biological sample obtained from a subject is divided into two samples, one of which is used to obtain a CD34-enriched cell population under high stringency selection and the other of which is used to obtain a CD34-enriched cell population under low stringency selection. In other embodiments, a biological sample obtained from a subject is first subjected to CD34+ selection at low stringency to obtain a CD34-enriched cell population at low stringency, and then a portion of said CD34-enriched cell population is subjected to CD34+ selection at high stringency to obtain a CD34-enriched cell population at high stringency. The selection may be applied sequentially, such that selection of CD34-enriched cells at low stringency may be applied first, followed by selection from the resulting population of additional CD34-enriched cells at high stringency. In other cases, selection of CD34-enriched cells at high stringency may be applied first, followed by selection from the residual population of CD34-enriched cells at low stringency. In some cases, cell populations may be divided such that low or high stringency selection is applied to a subset of cells previously subjected to high or low stringency selection. In some cases, a single biological sample is divided into two or more samples before selection of CD34-enriched cells under low or high stringency conditions.

[00184] In each case, high stringency or low stringency selection is contemplated before or after mixing or separating the biological samples or enriched cell populations in all possible combinations. In certain embodiments, the method comprises obtaining a CD34-enriched cell population at high stringency selection from a first biological sample obtained from a subject by selecting CD34 ⁺ cells under high stringency conditions; and obtaining a CD34-enriched cell population at low stringency selection from a second biological sample obtained from a subject by selecting CD34 ⁺ cells under low stringency conditions.

Transduced hematopoietic cells

[00185] As described in more detail in the examples section, populations of hematopoietic cells transduced in the presence of a combination of transduction enhancers disclosed herein, e.g., protamine sulfate, PGE2 or a derivative thereof, and a poloxamer (e.g., LentiBOOST), exhibit superior properties compared to hematopoietic cells transduced without the combination of transduction enhancers. In certain embodiments, the cells were also transduced in the presence of a recombinant fibronectin fragment, e.g., RetroNectin™. In particular embodiments, the transduced hematopoietic cells or population thereof have one or more of the following: an increased VCN, an increased VCN/cell, an increased percentage of gene-modified CFU, and an increased percentage of gene-modified COCs. In some embodiments, restoration of a gene of interest is enhanced. In particular embodiments, for patients with LAD-1, the percentage (%) of CD18 ⁺ cells is increased following transduction with a lentiviral vector containing the CD18 gene, compared to transduction without PGE2 or poloxamer, or compared to transduction without any transduction enhancer or with only one transduction enhancer.

[00186] In some embodiments of the disclosed methods, the percentage of hematopoietic cells genetically modified by the method is increased by at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, or at least 8-fold compared to the percentage of hematopoietic cells genetically modified with the same viral vector without treating the cells with PGE2 or poloxamer, or compared to the percentage of hematopoietic cells genetically modified with the same viral vector when the cells are treated with only one transduction enhancer.

[00187] In some embodiments, a method of transducing hematopoietic cells with a retroviral (e.g., lentiviral) vector provides a population of hematopoietic cells having a VCN/cell of at least 1.0, at least 1.5, at least 2.0, or at least 2.5. In some embodiments, a method of treating a subject comprises providing said subject with a population of transduced hematopoietic cells having a VCN/cell of at least 1.0, at least 1.5, at least 2.0, or at least 2.5.

[00188] In some embodiments, a method of transducing hematopoietic cells with a retroviral vector provides a population of hematopoietic cells having a transduction efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%. In some embodiments, a method of treating a subject comprises providing said subject with a population of transduced hematopoietic cells having a transduction efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[00189] In some embodiments, a method of transducing hematopoietic cells with a retroviral vector provides a population of hematopoietic cells having a percentage of transduced colony forming cells of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%. In some embodiments, a method of treating a subject comprises providing said subject with a population of transduced hematopoietic cells having a percentage of transduced colony forming cells of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[00190] In some embodiments, the invention provides a population of hematopoietic cells transduced with a recombinant retroviral vector (e.g., a lentiviral vector) having a VCN/cell of at least 1.0, at least 1.5, at least 2.0, or at least 2.5. In some embodiments, the invention provides a population of hematopoietic cells transduced with a recombinant retroviral vector (e.g., a lentiviral vector) having a transduction efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[00191] In some embodiments, the invention provides a method for producing a population of hematopoietic cells comprising at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% genetically modified hematopoietic cells, comprising: contacting hematopoietic cells ex vivo with a recombinant retroviral vector (optionally a lentiviral vector) comprising a polynucleotide comprising a gene of interest or encoding a polypeptide of interest, wherein the contacting occurs in the presence of PGE2 or a derivative thereof, optionally human PGE2 or 16,16-dimethyl-PGE2 (dmPGE2), and a poloxamer, optionally poloxamer 338 (LentiBOOST™). The cells may be contacted with the retroviral vector under conditions and for a time sufficient to allow transduction of the cells by the retroviral vector, such as in a suitable culture medium for at least one hour, at least two hours, at least four hours, at least eight hours, or at least twelve hours. In some embodiments, the cells are contacted with the retroviral vector and the transduction enhancers at the same time or for an overlapping period of time.

[00192] The methods of the invention have the advantage that they result in reduced toxicity (greater survival) of the transduced cell population compared to transduction without transduction enhancers. In some embodiments, the invention provides a method for producing a hematopoietic cell population wherein toxicity, compared to transduction without a transduction enhancer, is reduced by at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least at least 33%, at least 34%, or at least 35%.

Vectors and expression cassettes

[00193] Any suitable recombinant retroviral vector that finds use in delivering polynucleotide sequences into mammalian cells is encompassed by the recombinant retroviral vectors of the present invention. For example, a vector may comprise a single-stranded or double-stranded nucleic acid, such as single-stranded or double-stranded DNA. For example, a recombinant retroviral vector may be DNA. The vector may comprise single-stranded or double-stranded RNA, including modified forms of RNA. In another example, a recombinant retroviral vector may be RNA, such as mRNA or modified mRNA.

[00194] In particular embodiments, the recombinant retroviral vector can be a viral vector derived from a virus, such as an adenovirus, an adeno-associated virus, a lentivirus (LV), a herpes virus, an alphavirus, or a retrovirus, such as Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary cancer virus (MuMTV), gibbon leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, murine stem cell virus (MSCV), or Rous sarcoma virus (RSV). Although embodiments involving the use of LV are described in more detail below, it is expected that one skilled in the art will appreciate that similar knowledge and skill in the art can be applied to recombinant retroviral vectors other than LV. In some embodiments, the recombinant retroviral vector is a self-limited LV.

[00195] In particular embodiments, the viral vector is a lentiviral vector. In some embodiments, it is a pseudotyped lentiviral vector, such as a VSVG pseudotyped lentiviral vector.

[00196] In particular, certain methods disclosed herein relate to transducing two populations of stem cells or progenitor cells, e.g., hematopoietic stem cells (HSCs) or hematopoietic progenitor cells (also referred to herein as "hematopoietic progenitors"), with a recombinant retroviral vector encoding and/or expressing a therapeutic polypeptide, e.g., FANCA, wherein one population is obtained by selection under high stringency conditions and the other population is obtained by selection under low stringency conditions. In one embodiment, the cell populations are enriched for CD34+ cells. In one embodiment, the HSCs or hematopoietic progenitors are obtained from a subject with reduced or absent protein activity from one or more proteins encoded by FANCA. In one embodiment, the subject has FA-A. In one embodiment, the endogenous FANCA gene in the HSCs is deleted and/or mutated.

[00197] In one embodiment, transducing a cell with a recombinant retroviral vector results in the integration into the cellular genome of an expression cassette comprising a promoter operably linked to a polynucleotide sequence encoding a therapeutic agent in said recombinant retroviral vector. In some embodiments, transducing a cell with a recombinant retroviral vector results in expression of a therapeutic agent, such as a biologically active FANCA protein.

[00198] For example, a biologically active FANCA protein is part of an FA core complex. In some embodiments, the FANCA gene is delivered using a viral vector. In one embodiment, the FANCA gene is delivered using a lentiviral vector. In certain embodiments, the lentiviral vector is PGK-FANCA.WPRE*LV. It is contemplated that upon transduction of bone marrow (BM) cells or stem cells or progenitor cells from FA-A patients with a FANCA lentiviral vector (LV), the therapeutic vector is integrated into the genome of the cells. Once integrated, the therapeutic protein (e.g., human FANCA protein) is expressed by the cells. The transduced FA cells are genetically corrected and are thus capable of activating the FA pathway by monoubiquitinating FANCD2 and FANCI. These proteins will then be able to migrate to areas of DNA damage and, together with other DNA repair proteins, will promote DNA repair in these cells, as occurs in healthy cells.

[00199] As discussed herein, the subject methods and compositions find use in expressing a transgene, such as FANCA, in animal cells. For example, the subject compositions can be used in research, such as to determine the effect of a gene on cell viability and/or function. As another example, the subject compositions can be used in medicine, such as to treat a disorder such as FA.

[00200] In some embodiments, the subject methods provide a therapeutic effect, such as preventing the development of a disorder, stopping the progression of a disorder, reversing the progression of a disorder, etc. For example, in one embodiment, the disorder is Fanconi anemia (FA). In another embodiment, the disease or disorder is bone marrow failure (BMF). In one embodiment, the disorder is thrombocytopenia. In another embodiment, the disorder is leukopenia. In one embodiment, the disorder is pancytopenia. In one embodiment, the disorder is neutropenia. In another embodiment, the disorder is anemia. In some embodiments, the subject method includes the step of detecting the achievement of a therapeutic effect. One of skill in the art will recognize that such measures of therapeutic efficacy will be applicable to the particular disease being modifiable and will determine appropriate detection methods to be used to measure therapeutic efficacy.

[00201] Accordingly, the present invention provides methods for treating FA or one or more hematological manifestations of FA. In one embodiment, the hematological manifestation of FA is selected from one or more of bone marrow failure (BMF), thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia. In a particular embodiment, the hematological manifestation is BMF, which most patients with FA experience in childhood. In one embodiment, the hematological manifestation is thrombocytopenia. In another embodiment, the hematological manifestation is leukopenia. In one embodiment, the hematological manifestation is pancytopenia. In one embodiment, the hematological manifestation is neutropenia. In another embodiment, the hematological manifestation is anemia. In one embodiment, the hematological manifestation is a combination of two or more of BMF, thrombocytopenia, leukopenia, pancytopenia, neutropenia, and anemia.

[00202] Additional LV vectors that can be used in accordance with the methods disclosed herein include, but are not limited to, vectors produced using the transfer vectors disclosed below.

2. Application of transduced hematopoietic cells

[00203] In some embodiments, hematopoietic cells transduced according to the method disclosed herein are used in gene therapy. In particular embodiments, the hematopoietic cells are transduced with a vector comprising a gene of interest. The transduced cells can be provided to a subject in need thereof, for example, to treat a genetic disease or disorder in the subject. In particular embodiments, the gene of interest complements a defect in a gene associated with a monogenic genetic disease or disorder. In some embodiments, the subject has a mutation in an endogenous gene of interest. In some embodiments, the gene of interest provided to the subject is codon optimized, for example, to enhance expression in mammalian cells.

[00204] In one embodiment, the gene of interest is selected from the group consisting of Fanconi anemia complementation group A (FANCA), complementation group C (FANCC), and complementation group G (FANCG). In one embodiment, the gene of interest is erythrocyte pyruvate kinase (RPK). In one embodiment, the gene of interest is integrin beta-2 (ITGB2), and/or the gene of interest encodes a protein encoded by any of the genes disclosed herein, or a functional fragment or variant thereof.

[00205] In one embodiment, the method prevents or alleviates a monogenic genetic disease or disorder.

[00206] In one embodiment, the monogenetic disease or disorder is selected from the group consisting of Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency, and infantile malignant osteoporosis.

[00207] Thus, the invention provides methods for treating monogenic genetic diseases or disorders, including, but not limited to, Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency, and infantile malignant osteoporosis. In particular embodiments, the method comprises providing to a subject in need thereof hematopoietic cells transduced with a retroviral vector comprising a polynucleotide comprising a sequence encoding a therapeutic protein operably linked to a promoter sequence, wherein the cells have been transduced according to the method disclosed herein, such as in the presence of two or more transduction enhancers disclosed herein.

[00208] In certain embodiments, the present invention includes a cell comprising a gene expression cassette, a gene transfer cassette, or a recombinant retroviral vector, such as any of those disclosed herein. In related embodiments, the cell has been transduced with a recombinant retroviral vector comprising the expression cassette, or the expression cassette has been inserted into the genome of the cell, wherein the transduction has been carried out in accordance with the method disclosed herein. In certain embodiments, the cell is a cell used to produce a recombinant retroviral vector, such as a packaging cell.

[00209] In certain embodiments, the cell is a cell that is to be delivered to a subject to provide the subject with a gene product encoded by the expression cassette. Thus, in certain embodiments, the cell is autologous to the subject to be treated or was obtained from the subject to be treated. In other embodiments, the cell is allogeneic to the subject to be treated or was obtained from a donor other than the subject to be treated. In particular embodiments, the cell is a mammalian cell, such as a human cell. In certain embodiments, the cell is a blood cell, a red blood cell, a hematopoietic progenitor cell, a bone marrow cell, such as a lineage-naïve bone marrow cell, a hematopoietic stem cell (e.g., CD34+), or a committed hematopoietic erythroid progenitor cell. In particular embodiments, the cell is a CD34+ cell obtained from a subject to be treated with said cell after its transduction with a recombinant retroviral vector disclosed herein. In a particular embodiment, the cell is a CD34+ FA cell obtained from a subject diagnosed with FA. The present invention further includes populations of hematopoietic cells (optionally CD34-enriched cells) transduced according to the method disclosed herein.

[00210] In some embodiments, the methods disclosed herein provide a therapeutic effect, such as preventing the development of a disorder, stopping the progression of a disorder, reversing the progression of a disorder, etc. For example, in one embodiment, the disorder is BMF. In one embodiment, the disorder is thrombocytopenia. In another embodiment, the disorder is leukopenia. In one embodiment, the disorder is pancytopenia. In one embodiment, the disorder is neutropenia. In another embodiment, the disorder is anemia. In some embodiments, the subject method includes the step of detecting the achievement of a therapeutic effect. One of skill in the art will recognize that such measures of therapeutic efficacy will be applicable to the particular disease being modifiable and will determine appropriate detection methods to be used to measure therapeutic efficacy.

[00211] It is expected that the expression of the transgene using the subject transgene will be stable. Accordingly, in some cases, the expression of the transgene, for example, as determined by measuring the levels of the gene product, by measuring the therapeutic efficacy, etc., may be observed for two months or less after administration, for example, 4, 3, or 2 weeks or less after administration, for example, 1 week after administration of the subject composition. It is also expected that the expression of the transgene will be maintained over time. Accordingly, in some cases, the expression of the transgene, for example, as determined by measuring the levels of the gene product, by measuring the therapeutic efficacy, etc., may be observed for 2 months or more after administration of the subject composition, for example, 4, 6, 8, or 10 months or more, in some cases 1 year or more, for example, 2, 3, 4, or 5 years, in some cases more than 5 years.

[00212] In some embodiments, the method comprises the step of detecting expression of the transgene in cells or in the subject, wherein the expression is enhanced compared to expression from a polynucleotide cassette that does not contain one or more enhanced elements according to the present invention. Typically, the expression will be increased by 2-fold or more compared to expression from a reference, i.e., control polynucleotide cassette, for example, as known in the art, such as by 3-fold, 4-fold or 5-fold or more, in some cases by 10-fold, 20-fold or 50-fold or more, such as by 100-fold, as evidenced by, for example, earlier detection, higher levels of gene product, greater functional impact on cells, etc.

[00213] In some embodiments, the dose of cells that the patient receives by infusion will be the same as the dose obtained from the transduction process. In various preferred embodiments, at least about 1x10 ¹ , 1x10 ² , 1x10 ³ , 1x10 ⁴ , 1x10 ⁵ , 1x10 ⁶ , 1x10 ⁷ , 1x10 ⁸ or more CD34-enriched cells/kg of patient body weight are infused to the patient under high stringency selection. In various preferred embodiments, the patient is infused with at least about 1x10 ¹ , 1x10 ² , 1x10 ³ , 1x10 ⁴ , 1x10 ⁵ , 1x10 ⁶ , 1x10 ⁷ , 1x10 ⁸ or more low stringency CD34-enriched cells/kg patient body weight. In some embodiments, the patient is infused with 1x10 ⁶ to 4x10 ⁶ high stringency CD34-enriched cells/kg patient body weight. In other embodiments, the patient is infused with 3x10 ⁵ and 4x10 ⁶ high stringency CD34-enriched cells/kg patient body weight. In some embodiments, the patient is infused with 1x10 ⁶ to 4x10 ⁶ high stringency CD34-enriched cells/kg patient body weight. In other embodiments, the patient is infused with 3x10 ⁵ and 4x10 ⁶ high stringency CD34-enriched cells/kg patient body weight. In some embodiments, the cells are infused into the patient in a single dose. In other embodiments, the cells are infused into the patient in multiple doses (e.g., high and low stringency CD34-enriched cell populations are administered sequentially one or more times). The transduced cells can be infused immediately after the transduction process is complete. In particular embodiments, the transduced cells are stored or frozen prior to use, while in other embodiments, they are provided to the subject immediately or shortly after their transduction, such as within one hour, two hours, four hours, or eight hours.

[00214] Once incorporated, the therapeutic protein (e.g., human FANCA protein) is expressed by the cells. Transduced FA cells are genetically corrected and are thus able to activate the FA pathway by monoubiquitinating FANCD2 and FANCI. These proteins migrate to areas of DNA damage and, together with other DNA repair proteins, promote DNA repair in these cells as occurs in healthy cells.

[00215] As described in more detail in the examples section, preclinical in vitro data with bone marrow samples from people with FA have already demonstrated the effectiveness of LV FANCA in correcting the phenotype of these cells.

[00216] In one embodiment, at least 1 x 10 ⁵ to 4 x 10 ⁵ CD34 ⁺ corrected cells (e.g., FANCA-transduced HSCs) per kilogram of patient body weight are administered to restore hematopoiesis in a patient with FA without conditioning. In some embodiments, the transduced cells are infused or administered to the patient immediately after transduction. In other embodiments, the transduced cells are frozen prior to infusion or administration to the patient, with or without conditioning.

[00217] Genetic correction of HSCs from patients with FA followed by autologous transplantation of these cells (hematopoietic gene therapy) is a good alternative for patients with FA, especially those who do not have an HLA-identical relative for allogeneic transplantation. In one embodiment, hematopoietic gene therapy is the preferred treatment regimen for a patient who does not have an HLA-identical relative. In another embodiment, hematopoietic gene therapy is the preferred treatment regimen for a patient who has an HLA-identical relative.

[00218] Fanconi anemia (FA) is a disorder with an autosomal recessive pattern of inheritance (except for the FA-B complementation group, which is inherited as an X-linked disorder) and the median survival of patients is about 24 years (Butturini A, et al. (1994) Blood 84:1650-1655; Kutler DI, et al. (2003) Blood 101:1249-1256). At birth, the blood count in these patients is usually normal. Macrocytosis is often the first hematological abnormality detected in these patients. It usually progresses to thrombocytopenia, anemia, and pancytopenia. Bone marrow failure (BMF) is usually observed in these patients after 5-10 years, with the average age of onset of the hematological disorder being 7 years. Approximately 80% of patients with FA develop features of BMF during the first decade of life. Based on epidemiologic studies to date, unless malignant episodes occur before aplasia develops, virtually all patients with FA will develop BMF by age 40, which is the leading cause of mortality in these patients. Due to the complex clinical manifestations of FA, management of these patients is mainly aimed at improving the following clinical manifestations: bone marrow failure (BMF), myeloid leukemia, and solid tumors.

[00219] In certain embodiments, the invention provides a method of treating Fanconi anemia (FA) in a subject in need thereof, comprising administering hematopoietic cells transduced with a recombinant retroviral vector comprising a polynucleotide encoding a Fanconi anemia complementation group (FANC) gene or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein. In some embodiments, the gene encodes FANCA.

[00220] In some embodiments, the methods disclosed herein are used to transduce hematopoietic cells with a lentiviral vector produced using the pCCL-PGK-FANCAW-82-PRO transfer vector, such as to generate a population of cells for the treatment of FA. pCCL-PGK-FANCAW-82-PRO is a lentiviral vector based on the pCCL transfer plasmid used in third generation lentiviral vector systems. The pCCL transfer plasmid is a lentiviral vector comprising a chimeric CMV-HIV 5' LTR and a vector backbone that includes polyadenylation sequences and (minus the enhancer) simian virus 40 origin of replication downstream of the HIV 3' LTR, replacing most of the human sequence remaining from the HIV insertion site. In pCCL, the CMV enhancer and promoter (nucleotides -673 to -1 relative to the transcription start site; GenBank accession no. K03104) were fused to the HIV-1 R region. The vector utilizes the PGK promoter linked to a codon-optimized FANCA gene with RRE and cPPT/CTS elements located upstream and a wPRE element located downstream (FIG. 15).

[00221] The resulting lentiviral vector is used to transduce autologous CD34+ hematopoietic stem cells ("HSCs"), thereby compensating for the genetic defect. Briefly, HSCs are mobilized by administering G-CSF, plerixafor, or a combination of G-CSF and plerixafor to the patient. The HSCs are then collected from the patient's peripheral blood by apheresis. CD34+ cells are enriched using magnetic separation (e.g., the CliniMACs system from Miltenyi Biotec) and the CD34+ enriched cells are transduced ex vivo in accordance with the methods disclosed herein with lentiviral particles previously produced by transient transfection of a third-generation lentiviral vector system that includes the pCCL-PGK-FANCAW-82-RO transfer plasmid. In certain embodiments, the cells are transduced in the presence of PGE2 and a poloxamer. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). The transduced HSCs are then transplanted into the patient by infusion and the HSC niche population is repopulated with FANCA-expressing cells.

[00222] The sequence of the FANCA expression cassette in pCCL-PGK-FANCAW-82-PRO (5'-3') is as follows. The FANCA coding sequence is indicated by bold capital letters. The WPRE sequence is underlined.

attcgagcatcttaccgccatttattcccatatttgttctgtttttcttgatttgggtatacatttaaatgttaataaaacaaaatggtggggcaatcatttacatttttagggatatgtaattactagttcaggtgtattgccacaagacaaacatgttaagaaactttcccgttatttacgctctgttcctgttaatcaacctctggattacaaaatttgtgaaagattgactgatattcttaactatgttgctccttttacgctgtgtggatatgctgctttaatgcctctgtatcatgctattgcttcccgtacggctttcgttttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtccgtcaacgtggcgtggtgtgctctgtgtttgctgacgcaacccccactggctggggcattgccaccacctgtcaactcctttctgggactttcgctttccccctcccgatcgccacggcagaactcatcgccgcctgccttgcccgctgctggacaggggctaggttgctgggcactgataattccgtggtgttgtcggggaagggcc (SEQ ID NO: 1).

[00223] The FANCA protein sequence encoded by this polypeptide is set forth as SEQ ID NO: 2. FANCA expression vectors useful in the present invention include, but are not limited to, those disclosed in International Patent Application Publication No. WO 2018/049273, the contents of which are incorporated herein in their entirety.

[00224] Leukocyte adhesion deficiency-1 (LAD-1) is a rare autosomal recessive disorder caused by mutations in the ITGB2 gene, which encodes CD18, a protein present in several cell surface receptor complexes found on leukocytes, including lymphocyte function-associated antigen-1 (LFA-1), complement receptor 3 (CR-3), and complement receptor 4 (CR-4). LFA-1 deficiency results in neutrophils failing to adhere to and migrate from blood vessels, so their numbers may be high. It also impairs immune cell communication, immune recognition, and lymphocyte cell-killing functions.

[00225] In certain embodiments, the invention provides a method of treating leukocyte adhesion deficiency type I (LAD-1) in a subject in need thereof, comprising administering hematopoietic cells transduced with a recombinant retroviral vector comprising a polynucleotide encoding the ITGB2 gene or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[00226] In some embodiments, the methods disclosed herein are used to transduce hematopoietic cells with a lentiviral vector produced using the pCCL-ChimhCD18W-82-RO transfer vector, such as to generate a population of cells for the treatment of LAD-1. pCCL-ChimhCD18W-82-RO is a lentiviral transfer vector based on the pCCL transfer plasmid used in third generation lentiviral vector systems. The pCCL transfer plasmid is a lentiviral vector comprising a chimeric CMV-HIV 5' LTR and a vector backbone that includes polyadenylation sequences and (minus the enhancer) simian virus 40 origin of replication downstream of the HIV 3' LTR, replacing most of the human sequence remaining from the HIV insertion site. In pCCL, the CMV enhancer and promoter (nucleotides -673 to -1 relative to the transcription start site; GenBank accession no. K03104) were fused to the HIV-1 R region. The vector utilizes the Chim promoter linked to a codon-optimized ITGB2 gene with RRE and cPPT/CTS elements upstream and a wPRE element downstream (FIG. 16). The Chim promoter is a fusion of the c-Fes promoter and the minimal 5' flanking regions of CTSG (where the TATA box of the CTSG promoter is mutated to restrict transcription initiation to the minimal c-Fes promoter).

[00227] Lentiviral particles are produced by transient transfection of a third-generation lentiviral vector system that includes a LAD-1 transfer plasmid. The lentiviral particles are used to transduce autologous CD34+ hematopoietic stem cells (HSCs), thereby replenishing the genetic defect. Briefly, HSCs are mobilized by treating the patient with G-CSF, plerixafor, or a combination of G-CSF and plerixafor. The HSCs are then collected from the patient's peripheral blood by apheresis. CD34+ cells are enriched for using magnetic separation (e.g., Miltenyi Biotec's CliniMACs system), and the CD34+ enriched cells are transduced ex vivo with the lentiviral particles. The transduction process involves the use of transduction enhancers, specifically polyoxamers (Rocket has licensed LentiBOOST from Sirion Biotech GmbH for both clinical and commercial use) and PGE2 (commercially available from LGM Pharma). The transduced HSCs are then transplanted into the patient by infusion, and they repopulate the HSC niche with LAD-1-expressing cells.

[00228] The resulting lentiviral vector is used to transduce autologous CD34+ hematopoietic stem cells ("HSCs"), compensating for the genetic defect. Briefly, HSCs are mobilized by administering G-CSF, plerixafor, or a combination of G-CSF and plerixafor to the patient. The HSCs are then collected from the patient's peripheral blood by apheresis. CD34+ cells can be enriched by magnetic separation (e.g., the CliniMACs system from Miltenyi Biotec), and the CD34+ enriched cells are transduced ex vivo in accordance with the methods disclosed herein with lentiviral particles previously produced by transient transfection of a third-generation lentiviral vector system that includes the pCCL-ChimhCD18W-82-RO transfer plasmid. In certain embodiments, the cells are transduced in the presence of PGE2 and poloxamer. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). The transduced HSCs are then transplanted into the patient by infusion and the HSC niche population is repopulated with ITGB2-expressing cells.

[00229] The sequence of the ITGB2 expression cassette in pCCL-ChimhCD18W-82-RO (5'-3') is as follows. The coding sequence of ITGB, also known as CD18, is indicated in bold capital letters. The WPRE sequence is underlined.

attcgagcatcttaccgccatttattcccatatttgttctgtttttcttgatttgggtatacatttaaatgttaataaaacaaaatggtggggcaatcatttacatttttagggatatgtaattactagttcaggtgtattgccacaagacaaacatgttaagaaactttcccgttatttacgctctgttcctgttaatcaacctctggattacaaaatttgtgaaagattgactgatattcttaactatgttgctccttttacgctgtgtggatatgctgctttaatgcctctgtatcatgctattgcttcccgtacggctttcgttttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtccgtcaacgtggcgtggtgtgctctgtgtttgctgacgcaacccccactggctggggcattgccaccacctgtcaactcctttctgggactttcgctttccccctcccgatcgccacggcagaactcatcgccgcctgccttgcccgctgctggacaggggctaggttgctgggcactgataattccgtggtgttgtcggggaagggcc (SEQ ID NO: 3).

[00230] The human ITGB2 protein sequence is provided as SEQ ID NO: 4.

[00231] Pyruvate kinase deficiency (PKD) is a monogenic metabolic disorder caused by mutations in the PKLR gene that disrupt the energy balance of red blood cells, thereby causing hemolytic anemia that can vary greatly in severity and can be fatal in the neonatal period.

[00232] In certain embodiments, the invention provides a method of treating pyruvate kinase deficiency in a subject in need thereof, comprising administering hematopoietic cells transduced with a recombinant retroviral vector comprising a polynucleotide encoding a pyruvate kinase R gene or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[00233] In some embodiments, the methods disclosed herein are used to transduce hematopoietic cells with a lentiviral vector produced using the pCCL-PGK-coRPKW-82-RO transfer vector, such as to generate a population of cells for the treatment of IMO. pCCL-PGK-coRPKW-82-RO (PKD plasmid) is based on the pCCL transfer plasmid used in third-generation lentiviral vector systems. pCCL transfer plasmid is a lentiviral vector containing a chimeric CMV-HIV 5' LTR and a vector backbone that incorporates polyadenylation sequences and (minus the enhancer) simian virus 40 origin of replication downstream of the HIV 3' LTR, replacing most of the human sequence remaining from the HIV insertion site. In pCCL, the CMV enhancer and promoter (nucleotides -673 to -1 relative to the transcription start site; GenBank accession no. K03104) have been fused to the HIV-1 R region. PKD plasmid contains the PGK promoter linked to a codon-optimized PKLR gene with RRE and cPPT/CTS elements located upstream of transcription and with wPRE element located downstream of transcription (FIG. 1). Lentiviral vector particles are produced by transient transfection of a third generation lentiviral vector system that includes PKD plasmid (FIG. 17).

[00234] The lentiviral vector particles can then be used to transduce autologous CD34+ hematopoietic stem cells ("HSCs"), thereby replenishing the genetic defect. Briefly, HSCs are mobilized by administering G-CSF, plerixafor, or a combination of G-CSF and plerixafor to the patient. The HSCs are then collected from the patient's peripheral blood by apheresis. CD34+ cells can be enriched using magnetic separation (e.g., the CliniMACs system from Miltenyi Biotec), and the CD34+ enriched cells are transduced ex vivo with the lentiviral vector particles in accordance with the methods disclosed herein. In certain embodiments, the cells are transduced in the presence of PGE2 and a poloxamer. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). The transduced HSCs are then transplanted into the patient by infusion and the HSC niche population is repopulated with PKLR-expressing cells.

[00235] The sequence of the PKLR expression cassette in pCCL-PGK-coRPKW-82-RO (5'-3') is as follows. The PKLR coding sequence is indicated by bold capital letters. The PGK promoter is indicated by italics and the WPRE sequence is underlined.

attcgagcatcttaccgccatttattcccatatttgttctgtttttcttgatttgggtatacatttaaatgttaataaaacaaaatggtggggcaatcatttacatttttagggatatgtaattactagttcaggtgtattgccacaagacaaacatgttaagaaactttcccgttatttacgctctgttcctgttaatcaacctctggattacaaaatttgtgaaagattgactgatattcttaactatgttgctccttttacgctgtgtggatatgctgctttaatgcctctgtatcatgctattgcttcccgtacggctttcgttttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtccgtcaacgtggcgtggtgtgctctgtgtttgctgacgcaacccccactggctggggcattgccaccacctgtcaactcctttctgggactttcgctttccccctcccgatcgccacggcagaactcatcgccgcctgccttgcccgctgctggacaggggctaggttgctgggcactgataattccgtggtgttgtcggggaagggcc (SEQ ID NO: 5).

[00236] The PKLR protein sequence encoded by this polypeptide is set forth as SEQ ID NO: 6. Additional PKLR polynucleotide sequences useful in the present invention include SEQ ID NOs: 7-9. PKLR expression vectors useful in the present invention include, but are not limited to, those disclosed in International Patent Application PCT/US2019/041465, the contents of which are incorporated herein in their entirety.

[00237] Infantile malignant osteoporosis (IMO) is a rare disorder with a recessive mode of inheritance characterized by increased bone mass caused by impaired osteoclast function. The disease is most often caused by mutations in the TCIRG1 gene, which encodes a subunit of the V-ATPase involved in the bone resorbing ability of osteoclasts. Richter et al. showed that osteoclast function can be restored by lentiviral vector-mediated expression of TCIRG1, but the exact threshold for restoration of resorption as well as the cellular response to vector-mediated TCIRG1 expression are unknown.

[00238] In certain embodiments, the invention provides a method of treating infantile malignant osteoporosis in a subject in need thereof, comprising administering hematopoietic cells transduced with a recombinant retroviral vector comprising a polynucleotide encoding a gene for CLCN7, OSTM1, T cell immune regulator 1, V0 domain of H+-transporting ATPase a3 subunit (TCIRG1), TNFSF11, PLEKHM1, or TNFRSF11A, or a gene encoding a functional variant or fragment thereof, in accordance with the methods disclosed herein.

[00239] In some embodiments, the methods disclosed herein are used to transduce hematopoietic cells with a lentiviral vector produced using the pCCL.PPT.EFS.tcirg1h.wpre transfer vector, such as to generate a population of cells for the treatment of IMO. pCCL.PPT.EFS.tcirg1h.wpre is a lentiviral transfer vector based on the pCCL transfer plasmid used in third generation lentiviral vector systems. The pCCL transfer plasmid is a lentiviral vector comprising a chimeric CMV-HIV 5' LTR and a vector backbone that includes polyadenylation sequences and (minus the enhancer) simian virus 40 origins of replication downstream of the HIV 3' LTR, replacing most of the human sequence remaining from the HIV insertion site. In pCCL, the CMV enhancer and promoter (nucleotides -673 to -1 relative to the transcription start site; GenBank accession no. K03104) were fused to the HIV-1 R region. The vector utilizes the EFS promoter (a short, intronless form of the EF1-alpha promoter) linked to a codon-optimized TCIRG1 gene with RRE and cPPT/CTS elements located upstream and a wPRE element located downstream (FIG. 18).

[00240] The resulting lentiviral vector is used to transduce autologous CD34+ hematopoietic stem cells ("HSC"), thereby compensating for the genetic defect. In some embodiments, the HSC are mobilized by administering G-CSF, plerixafor, or a combination of G-CSF and plerixafor to the patient. The HSC are then collected from the patient's peripheral blood by apheresis. Enrichment of CD34+ cells can be accomplished by magnetic separation (e.g., the CliniMACs system from Miltenyi Biotec), and the CD34+ enriched cells can be transduced ex vivo in accordance with the methods disclosed herein with lentiviral particles previously produced by transient transfection of a lentiviral vector system that includes the pCCLL.PPT.EFS.tcirg1h.wpre transfer plasmid. In some embodiments, the cells are transduced in the presence of PGE2 and poloxamer. In one embodiment, the poloxamer is poloxamer 338 (LentiBOOST™). The transduced HSCs are then transplanted into the patient by infusion and generate osteoclasts expressing TCIRG1.

[00241] The sequence of the TCIRG1 expression cassette in pCCL.PPT.EFS.tcirg1h.wpre (5'-3') is as follows. The coding sequence of TCIRG1, also known as CD18, is indicated in bold capital letters. The WPRE sequence is underlined.

attcgagcatcttaccgccatttatacccatatttgttctgtttttcttgatttgggtatacatttaaatgttaataaaacaaaatggtggggcaatcatttacatttttagggatatgtaattactagttcaggtgtattgccacaagacaaacatgttaagaaactttcccgttatttacgctctgttcctgttaatcaacctctggattacaaaatttgtgaaagattgactgatattcttaactatgttgctccttttacgctgtgtggatatgctgctttaatgcctctgtatcatgctattgcttcccgtacggctttcgttttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtccgtcaacgtggcgtggtgtgctctgtgtttgctgacgcaacccccactggctggggcattgccaccacctgtcaactcctttctgggactttcgctttccccctcccgatcgccacggcagaactcatcgccgcctgccttgcccgctgctggacaggggctaggttgctgggcactgataattccgtggtgttgtcggggaagctgacgtcctttcg (SEQ ID NO: 10).

[00242] The TCIRG1 protein sequence encoded by this polypeptide is presented as SEQ ID NO: 11.

[00243] In some cases, the recombinant retroviral vector provides a transgene for a gene other than a gene associated with a disease or disorder, or restores such a gene. For example, but not limited to, the recombinant retroviral vector may up- or down-regulate immune effector genes, may alter cell surface markers, may provide alternative MHC molecules, or may encode immunoglobulin genes. In particular, it is contemplated that in some cases, the recombinant retroviral vector or vectors may enable the use of a transplant from an allogeneic or incompatible donor, such as by altering immune markers (e.g., HLA or MHC genes) or inducing the expression of immune effector genes.

[00244] The coding sequence to be expressed in the cells may be any polynucleotide sequence, such as a gene or cDNA, that encodes a gene product, such as a polypeptide or RNA therapeutic (siRNA, antisense, ribozyme, shRNA, etc.). The coding sequence may be heterologous to the promoter sequence to which it is operably linked, i.e., not operably linked to it in nature. Alternatively, the coding sequence may be endogenous to the promoter sequence to which it is operably linked, i.e., linked to the promoter in nature. The gene product may act within the mammalian cell or may act externally, such as by being secreted. For example, where the transgene is a therapeutic gene, the coding sequence may be any gene encoding the desired gene product or a functional fragment or variant thereof that can be used as a therapeutic agent for the treatment of a disease or disorder. In various embodiments, the transgene encodes human FANCA.

[00245] In some embodiments, the coding sequence of the transgene is modified or "codon optimized" to enhance expression by replacing underrepresented codons with more frequently represented codons. The coding sequence is the portion of the mRNA sequence that codes for amino acids for translation. During translation, each of the 61 trinucleotide codons is translated into one of 20 amino acids, resulting in degeneracy or redundancy of the genetic code. However, different cell types and different animal species use tRNAs (each carrying an anticodon) that code for the same amino acids at different frequencies. When a gene sequence contains codons that are underrepresented by the corresponding tRNA, the ribosome translation machinery can slow down, preventing efficient translation. Expression can be improved by species-specific "codon optimization," in which the coding sequence is altered to encode the same protein sequence but using codons that are widely represented and/or used by highly expressed human proteins (Cid-Arregui et al., 2003; J. Virol. 77: 4928). In one aspect of the present invention, the coding sequence of the transgene is modified to replace codons that are rarely expressed in mammals or primates with codons that are frequently expressed in primates. For example, in some embodiments, the coding sequence encoded by the transgene encodes a polypeptide that has at least 85% sequence identity to a polypeptide encoded by a sequence disclosed above or herein, such as at least 90% sequence identity, such as at least 95% sequence identity, at least 98% sequence identity, at least 99% sequence identity, wherein at least one codon of the coding sequence has a higher tRNA frequency in humans than the corresponding codon in the sequence disclosed above or herein.

[00246] In additional embodiments, the transgene coding sequence is modified to enhance expression by terminating or removing open reading frames (ORFs) that do not encode the desired transgene. An open reading frame (ORF) is a nucleic acid sequence that follows a start codon and does not contain a stop codon. ORFs can be in a forward or reverse orientation and can be "in frame" or "out of frame" relative to the gene of interest. Such open reading frames can potentially be expressed in an expression cassette along with the gene of interest and can lead to undesirable side effects. In one aspect of the present invention, the transgene coding sequence has been modified to remove open reading frames by further altering codon usage. This can be done by removing start codons (ATG) and introducing stop codons (TAG, TAA or TGA) into ORFs that are in the reverse orientation or out of frame, while maintaining the amino acid sequence and maintaining commonly used codons in the gene of interest (i.e., avoiding codons with a frequency of <20%). In the present invention, the coding sequence of the transgene can be optimized either by codon optimization and removing non-transgene ORFs, or by both methods. As will be apparent to those skilled in the art, after codon optimization, it is preferable to remove or minimize non-transgene ORFs in order to remove ORFs introduced during codon optimization.

[00247] Additionally, as will be appreciated by one of skill in the art, expression cassettes and recombinant retroviral vectors may optionally contain other elements, including, but not limited to, restriction sites to facilitate cloning and regulatory elements for the particular recombinant retroviral vector.

[00248] In some aspects of the present invention, the subject polynucleotide cassettes are used to deliver a gene to cells, such as to determine the effect of the gene on cell viability and/or function, to treat a cellular disease, etc. In various embodiments, delivery of a viral vector to cells by transduction may occur in vivo, ex vivo, or in vitro. Accordingly, in some aspects of the invention, a composition that provides for expression of a transgene in mammalian cells is a recombinant retroviral vector comprising a polynucleotide cassette, such as a gene transfer cassette, according to the present invention.

[00249] Recombinant retroviral vectors comprising the polynucleotide cassettes of the present invention can be prepared using standard techniques.

[00250] For example, in the case of LV virions, an LV expression vector of the invention can be introduced into a producer cell, followed by the introduction of an LV helper construct, wherein the helper construct comprises LV coding regions capable of expression in the producer cell and which supplement the LV helper functions missing from the LV vector. The helper virus and/or additional vectors are then introduced into the producer cell, wherein the helper virus and/or additional vectors provide auxiliary functions capable of supporting efficient LV production. The producer cells are then cultured to produce LV. These steps are performed using standard techniques. In particular embodiments, the plasmids depicted in FIGS. 38-41 are used to produce recombinant retroviral vectors.

Methods for obtaining viral vectors

[00251] Recombinant retroviral vectors comprising the polynucleotide cassettes of the present invention can be prepared using standard techniques.

[00252] For example, in the case of LV virions, an LV expression vector of the invention can be introduced into a producer cell, followed by the introduction of an LV helper construct, wherein the helper construct comprises LV coding regions capable of expression in the producer cell and which supplement the LV helper functions missing from the LV vector. The helper virus and/or additional vectors are then introduced into the producer cell, wherein the helper virus and/or additional vectors provide auxiliary functions capable of supporting efficient LV production. The producer cells are then cultured to produce LV. These steps are performed using standard techniques. In particular embodiments, the plasmids depicted in FIGS. 38-41 are used to produce recombinant retroviral vectors.

[00253] Any suitable method for producing viral vectors for delivery of the subject polynucleotide cassettes may be used, including, but not limited to, the methods described in the following examples. Any concentration of infectious viral vector suitable for efficient transduction of mammalian cells may be prepared for contact with mammalian cells in vitro or in vivo. For example, viral particles may be prepared at a concentration of 10 ⁸ infectious units per ml or more, such as 1 x 10 ⁸ infectious units per ml; 5 x 10 ⁸ infectious units per ml; 10 ⁹ infectious units per ml; 5 x 10 ⁹ infectious units per ml, 10 ¹⁰ infectious units per ml, 5 x 10 ¹⁰ infectious units per ml; 10 ¹¹ infectious units per ml; 5 x 10 ¹¹ infectious units per ml; 10 ¹² infectious units per ml; ^5x1012 infectious units per ml; ¹⁰¹³ infectious units per ml; ^1.5x1013 infectious units per ml; ^3x1013 infectious units per ml; ^5x1013 infectious units per ml; ^7.5x1013 infectious units per ml; 9x1013 infectious units per ml; ^{1x1014 infectious} units per ml, ^5x1014 infectious units per ml or more, but usually not more than ^1x1015 infectious units per ml.

[00254] In producing the subject recombinant LV retroviral vectors, any host cells for producing LV virions can be used, including, for example, mammalian cells (e.g., HEK 293T cells). The host cells can also be packaging cells in which the LV gag/pol and Rev genes are stably maintained in the host cell, or producer cells in which the LV vector genome is stably maintained and packaged. The LV vectors are purified and formulated using standard techniques known in the art.

Pharmaceutical compositions and preparations

[00255] The present invention includes pharmaceutical compositions and preparations comprising cell populations as described herein and a pharmaceutically acceptable carrier, diluent, or excipient. The subject cell populations can be combined with pharmaceutically acceptable carriers, diluents, and reagents suitable for preparing a preparation that is generally safe, non-toxic, and suitable, and includes excipients acceptable for use in primates. Examples of such excipients, carriers, or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Additional active compounds can also be included in the preparations. Solutions or suspensions used in the preparations can include a sterile diluent such as water for injection, saline, dimethyl sulfoxide (DMSO), fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial compounds such as benzyl alcohol or methylparabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates; detergents such as Tween 20 to prevent aggregation; and compounds for adjusting tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. In particular embodiments, the preparations are sterile.

[00256] In some embodiments, the cell populations are manufactured in accordance with current Good Manufacturing Practices. Manufactured in accordance with current Good Manufacturing Practices means that the drug prepared for administration is safe enough to be administered to a human subject in accordance with regulatory provisions and governmental approvals. Typically, regulatory provisions and approvals dictate that the drug must meet pre-established acceptance criteria for identity, potency, quality, and purity. Acceptance criteria include quantitative limits, ranges, or other suitable test result measures used to determine whether the drug complies with current Good Manufacturing Practices. The regulations establish analytical procedures that are used to verify compliance with the acceptance criteria. Drugs may be evaluated in batches. A batch is a specified amount of drug tested for compliance with the acceptance criteria.

[00257] The preparations may be included in a container, package, or dispenser, such as a syringe, such as a pre-filled syringe, along with instructions for administration.

[00258] If necessary or appropriate, the preparations may include a local anesthetic such as lidocaine to relieve pain at the injection site.

[00259] Therapeutically effective amounts of cells in the preparations can be greater than ¹⁰² cells, greater than ¹⁰³ cells, greater than ¹⁰⁴ cells, greater than ¹⁰⁵ cells, greater than ¹⁰⁶ cells, greater than ¹⁰⁷ cells, greater than ¹⁰⁸ cells, greater than ¹⁰⁹ cells, greater than ¹⁰¹⁰ cells, or greater than ¹⁰¹¹ . Therapeutically effective amounts of cells in the preparations can be less than ¹⁰³ cells, less than ¹⁰⁴ cells, less than ¹⁰⁵ cells, less than ¹⁰⁶ cells, less than ¹⁰⁷ cells, less than ¹⁰⁸ cells, less than ¹⁰⁹ cells, less than ¹⁰¹⁰ cells, less than ¹⁰¹¹ cells, or less than ¹⁰¹² . Therapeutically effective amounts of cells in the preparations may range from ¹⁰³ cells to ¹⁰¹² cells, from ¹⁰⁴ cells to ¹⁰¹¹ cells, from ¹⁰⁵ cells to ¹⁰¹⁰ cells, from ¹⁰⁸ cells to ¹⁰¹² cells, from ¹⁰⁹ cells to ¹⁰¹² cells, from ¹⁰⁸ cells to ¹⁰¹⁰ cells, or from ¹⁰⁹ cells to ¹⁰¹¹ cells.

[00260] In the preparations disclosed herein, the cells are typically contained in a volume of a liter or less, 500 ml or less, 250 ml or less, or 100 ml or less. Therefore, the density of the cells administered is typically greater than 104 cells/ml, ¹⁰⁷ cells/ml, or ¹⁰⁸ cells/ml.

[00261] The formulations described herein can be prepared for administration, for example, by injection, infusion, perfusion, or lavage. Therapeutically effective amounts for administration can include greater than 10 ² cells, greater than 10 ³ cells, greater than 10 ⁴ cells, greater than 10 ⁵ cells, greater than 10 ⁶ cells, greater than 10 ⁷ cells, greater than 10 ⁸ cells, greater than 10 ⁹ cells, greater than 10 ¹⁰ cells, or greater than 10 ¹¹ . In particular embodiments, the minimum dose is 2 x 10 ⁶ cells/kg of subject body weight. Therapeutically effective amounts for administration can include less than 10 ³ cells, less than 10 ⁴ cells, less than 10 ⁵ cells, less than 10 ⁶ cells, less than 10 ⁷ cells, less than 10 ⁸ cells, less than 10 ⁹ cells, less than 10 ¹⁰ cells, less than 10 ¹¹ cells, or less than 10 ¹² . In particular embodiments, the maximum dose is 2 x 10 ¹² cells/kg of subject body weight. Therapeutically effective amounts for administration can be from 10 ³ cells to 10 ¹² cells, from 10 ⁴ cells to 10 ¹¹ cells, from 10 ⁵ cells to 10 ¹⁰ cells, from 10 ⁸ cells to 10 ¹² cells, from 10 ⁹ cells to 10 ¹² cells, from 10 ⁸ cells to 10 ¹⁰ cells, or from 10 ⁹ cells to 10 ¹¹ cells.

[00262] In some embodiments, the pharmaceutical composition provided herein comprises a therapeutically effective amount of a cell population as disclosed herein in admixture with a pharmaceutically acceptable carrier and/or excipient, such as saline, sodium phosphate buffer, phosphate and amino acids, polymers, polyhydric alcohols, sugar, buffers, preservatives, and other proteins. Examples of amino acids, polymers, sugars and the like are octylphenoxypolyethoxyethanol compounds, polyethyleneglycol monostearate compounds, polyoxyethylene sorbitan fatty acid esters, sucrose, fructose, dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol, galactitol, xylitol, lactose, trehalose, bovine serum albumin or human serum albumin, citrate, acetate, Ringer's and Hank's solutions, cysteine, arginine, carnitine, alanine, glycine, lysine, valine, leucine, polyvinylpyrrolidone, polyethylene and glycol. Preferably, said preparation is stable for at least six months at 4°C. In one embodiment, the cell population is freshly prepared from an in vivo source. In one embodiment, the cell population is frozen for storage prior to or after incorporation into a pharmaceutical composition.

[00263] In some embodiments, the pharmaceutical composition provided herein comprises a buffer, such as sodium phosphate buffer (PBS) or sodium phosphate/sodium sulfate, Tris buffer, glycine buffer, sterile water, and other buffers known to those skilled in the art, such as those described in Good et al. (1966) Biochemistry 5:467. The pH of the buffer in which the pharmaceutical composition comprising a tumor suppressor gene contained in an adenoviral vector delivery system is contained can range from 6.5 to 7.75, preferably from 7 to 7.5, and most preferably from 7.2 to 7.4.

[00264] All publications mentioned in this document are herein incorporated by reference for the disclosure and description of the methods and/or materials in connection with which the publications are cited. The present disclosure is intended to supersede any disclosure of an incorporated publication to the extent of a conflict.

[00265] It should also be noted that the claims may be drafted to exclude any optional element. In this regard, this statement is intended to serve as a basis for the use of such exclusive terminology as "solely", "only", etc. in connection with the listing of elements of the claims, or the use of a "negative" feature.

[00266] The publications discussed herein are cited solely with respect to the information contained therein that was published prior to the filing date of this application. In addition, the publication dates stated may differ from the actual publication dates, which may require separate confirmation.

[00267] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Examples

Example 1

Transduction of hematopoietic cells using protamine sulfate and PGE2

[00268] Transduction of hematopoietic cells with retroviral vectors for clinical use remains challenging. In particular, it is unclear from the literature which transduction enhancers or combinations of them are likely to be most effective, or the magnitude of the effect that can be achieved. In this example, a combination of protamine sulfate and PGE2 was found to increase transduction efficiency.

[00269] An exemplary protocol for transducing hematopoietic cells with lentiviral vectors, as performed in the following examples, is shown in FIG. 1, however, in various experiments described in the examples, the transduction medium did not include UT, included a single UT, or included various combinations of UTs. Pre-stimulation involved culturing the cells on plates coated with 2 μg/ ^cm2 RetroNectin™ (RN). The transduction medium included the contents of the pre-stimulation medium (X-VIVO™ 20 medium plus 100 ng/ml rhSCF, 100 ng/ml rhTPO, 100 ng/ml rh-FLT3-L, and 20 ng/ml IL-3) and 4 μg/ml protamine sulfate.

[00270] In one experiment, hematopoietic cells were transduced with pseudotyped VSVG LV expressing a GFP (green fluorescent protein) transgene reporter. Cells were transduced with 2.5x10 ⁷ TU/ml or 5x10 ⁷ TU/ml lentiviral vector in liquid culture in the presence of PGE2 at various concentrations and assayed for VCN after 14 days of liquid culture (FIG. 2A). The results show that increasing concentrations of PGE2 (10 μg/ml, 30 μg/ml, or 50 μg/ml) increased transduction efficiency as measured by the number of vector copies per cell.

[00273] In another experiment, cells were transduced with 1x10 ⁷ TU/mL or 1x10 ⁸ TU/mL lentiviral vector in liquid culture in the presence of PGE2 and assayed for VCN after 14 days of liquid culture (FIG. 2B). At both vector concentrations, PGE2 increased transduction efficiency as measured by VCN/cell. Colony forming unit (CFU) assays were performed on transduced cells (FIG. 3A, CFCs) and VCN and percent (%) transduction were assayed on individual colonies (FIGS. 3B and 3C). At the highest PGE2 concentration tested, up to approximately 75% of the cells were transduced (FIG. 3C).

Example 2

Transduction of hematopoietic cells using protamine sulfate and poloxamer F108

[00272] In this example, protamine sulfate and poloxamer F108 (also known as poloxamer 338) were found to increase transduction efficiency. Testing was performed in liquid culture using poloxamer F108 (LentiBOOST™), according to the general protocol shown in FIG. 1. The results are shown in FIG. 4 for VCN in liquid culture and FIGS. 5A-5C for the CFU assay results (FIG. 5A) and VCN in isolated single CFU (FIGS. 5B and 5C). At concentrations of 0.5 mg/mL, 1 mg/mL, 2 mg/mL, and 4 mg/mL, LentiBOOST™ increased the transduction efficiency of pseudotyped VSVG LV expressing a GFP transgene reporter. As with PGE2, at the highest concentration of PGE2 tested it was possible to transduce up to approximately 75% of the cells (FIG. 5C).

Example 3

Transduction of hematopoietic cells using protamine sulfate, Pge2 and poloxamer F108

[00273] In this example, it was found that the combination of protamine sulfate, PGE2, and LentiBOOST™ unexpectedly increased transduction efficiency beyond the results observed with PGE2 or LentiBOOST™ alone. The protocol shown in FIG. 1 was tested and used to compare protamine sulfate (PS), LentiBOOST™ (LB), LB plus PGE2, PS plus LB, or PS plus LB plus PGE2. LB was used at a concentration of 1 mg/mL, PGE2 was used at a concentration of 10 μg/mL, and PS was used at a concentration of 4 μg/mL. The results obtained for VCN in transduced cells after 14 days of culture in liquid medium are shown in FIG. 6. FIG. 7A shows the CFU analysis of CB- and mPB-derived transduced cells. Also shown is VCN in isolated colonies in the presence of LB plus PGE2 plus PS (FIG. 7B, FIG. 7E) and transduction efficiency is shown (FIG. 7C, FIG. 7D). As shown in FIG. 7C, more than 80% of the cells were transduced with the vector under these conditions.

Example 4

Scaling and testing methods to enhance transduction in vivo

[00274] This example demonstrates that the protocols established in Examples 1-3 can be transferred to a therapeutic vector and scaled up to produce sufficient vector for clinical trials using cord blood as a starting material. Scale-up of the transduction procedure was performed using CD34-enriched cord blood (CB) cells and LV derived from pCCL-PGK-FANCAW-82-PRO without transduction enhancers (except PS, which was used in all experiments) or with transduction enhancers (+UT), specifically LB, PGE2, and PS. LB was used at a concentration of 1 mg/mL, PGE2 was used at a concentration of 10 μg/mL, and PS was used at a concentration of 4 μg/mL. VCN after 14 days of culture in liquid medium is shown in FIG. 8. The results of the CFU assay (FIG. 9A), VCN in isolated single CFU (FIG. 9B), and transduction efficiency in CFU (FIG. 9C) are shown in the transduced cells in vitro before transplantation in FIGS. 9A-9C. The results are shown for burst-forming units of the erythroid lineage (BFU-E), granulocyte-macrophage progenitors (CFU-GM), and myeloid progenitors (CFU-GM) in FIG. 9B. FIGS. 10A and 10B show the in vivo results. Cord blood CD34 ⁺ cells were transduced in the presence or absence of transduction enhancers (TE: LB plus PGE2 plus PS) with therapeutic LV overnight at a multiplicity of infection (MOI) of 50. LB was used at a concentration of 1 mg/mL, PGE2 was used at a concentration of 10 μg/mL, and PS was used at a concentration of 4 μg/mL. The collected transduced cells were then washed and suspended at a density of 1-2.5× ¹⁰⁶ cells/mL. A range of 1.3-1.6× ¹⁰⁵ transduced cells were intravenously transplanted into 1.5 Gy irradiated immunodeficient NSG mice as a xenogeneic model of human hematopoiesis. The percentage (%) of human CD45-positive (hCD45 ⁺ ) cells (FIG. 10A) and VCN/cell (FIG. 10B) were assessed at one (1), two (2), or three (3) months post transplantation (mpt) in bone marrow cells collected from transplanted animals.

Example 5

LV production under GMP conditions and mPB transduction

[00275] This example demonstrates that the protocols established in Examples 1-4 can be transferred to a therapeutic vector and scaled up to produce sufficient vector for clinical trials using mobilized peripheral blood as a starting material. LV production was performed under GMP and used in the following series of experiments conducted using CD34+ hematopoietic stem cells purified from mobilized peripheral blood (mPB) from a healthy donor. The LV vector was a VSVG pseudotyped LV expressing the FANCA transgene that was generated using the pCCL-PGK-FANCAW-82-PRO transfer vector. FIG. 11 shows the VCN/cell in transduced cells after 14 days of culture in liquid medium with (+UT) the transduction enhancers PS, LB, and PGE2 and at two different MOIs, or without (-UT). LB was used at a concentration of 1 mg/mL, PGE2 was used at a concentration of 10 μg/mL, and PS was used at a concentration of 4 μg/mL. FIGS. 12A-12D show the results of colony forming unit (CFU) assays for total cells, BFU, GM, and mixed myeloid progenitors for GMP003 with (+UT) the transduction enhancers PS, LB, and PGE2 at two different MOIs, or without (-UT). FIGS. 13A and 13B show VCN in isolated single CFUs for GMP003 with (+UT) the transduction enhancers PS, LB, and PGE2 at 20 or 50 MOIs, or without (-UT). The results are shown for burst forming units of the erythroid lineage (BFU-E), granulocyte-macrophage progenitors (CFU-GM), and myeloid progenitors (CFU-GM). FIG. 14A and 14B show transduction efficiency and VCN in CFU with (+UT) or without (-UT) the transduction enhancers PS, LB and PGE2 for burst-forming units of the erythroid lineage (BFU-E), granulocyte-macrophage progenitors (GM) and myeloid progenitors (mixed).

--->

List of sequences

<110> CENTRO DE INVESTIGACIONES ENERGETICAS, MEDIOAMBIENTALES Y

TECNOLOGICAS, O.A., M.P.

CONSORCIO CENTRO DE INVESTIGACION BIOMEDICA EN RED, M.P.

FUNDACION INSTITUTO DE INVESTIGACION SANITARIA FUNDACION

JIMENEZ DIAZ

ROCKET PHARMACEUTICALS, LTD.

<120> METHODS FOR GENE MODIFICATION OF HEMATOPOIETIC CELLS

<130> ROPA-010/01WO 329592-2074

<150> US 62/712,146

<151> 2018-07-30

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 5554

<212> DNA

<213> Artificial Sequence

<220>

<223> pCCL-PGK-FANCAW-82-PRO vector sequence

<400> 1

ggggttgggg ttgcgccttt tccaaggcag ccctgggttt gcgcagggac gcggctgctc 60

tgggcgtggt tccgggaaac gcagcggcgc cgaccctggg tctcgcacat tcttcacgtc 120

cgttcgcagc gtcacccgga tcttcgccgc tacccttgtg ggccccccgg cgacgcttcc 180

tgctccgccc ctaagtcggg aaggttcctt gcggttcgcg gcgtgccgga cgtgacaaac 240

ggaagccgca cgtctcacta gtaccctcgc agacggacag cgccagggag caatggcagc 300

gcgccgaccg cgatgggctg tggccaatag cggctgctca gcagggcgcg ccgagagcag 360

cggccgggaa ggggcggtgc gggaggcggg gtgtggggcg gtagtgtggg ccctgttcct 420

gcccgcgcgg tgttccgcat tctgcaagcc tccggagcgc acgtcggcag tcggctccct 480

cgttgaccga atcaccgacc tctctcccca gggggatccc ccgggctgca ggaattcatg 540

tccgactcgt gggtcccgaa ctccgcctcg ggccaggacc caggggggccg ccggagggcc 600

tgggccgagc tgctggcggg aagggtcaag agggaaaaat ataatcctga aagggcacag 660

aaattaaagg aatcagctgt gcgcctcctg cgaagccatc aggacctgaa tgcccttttg 720

cttgaggtag aaggtccact gtgtaaaaaa ttgtctctca gcaaagtgat tgactgtgac 780

agttctgagg cctatgctaa tcattctagt tcatttatag gctctgcttt gcaggatcaa 840

gcctcaaggc tgggggttcc cgtgggtatt ctctcagccg ggatggttgc ctctagcgtg 900

ggacagatct gcacggctcc agcggagacc agtcaccctg tgctgctgac tgtggagcag 960

agaaagaagc tgtcttccct gttagagttt gctcagtatt tattggcaca cagtatgttc 1020

tcccgtcttt ccttctgtca agaattatgg aaaatacaga gttctttgtt gcttgaagcg 1080

gtgtggcatc ttcacgtaca aggcattgtg agcctgcaag agctgctgga aagccatccc 1140

gacatgcatg ctgtgggatc gtggctcttc aggaatctgt gctgcctttg tgaacagatg 1200

gaagcatcct gccagcatgc tgacgtcgcc agggccatgc tttctgattt tgttcaaatg 1260

tttgttttga ggggatttca gaaaaactca gatctgagaa gaactgtgga gcctgaaaaa 1320

atgccgcagg tcacggttga tgtactgcag agaatgctga tttttgcact tgacgctttg 1380

gctgctggag tacaggagga gtcctccact cacaagatcg tgaggtgctg gttcggagtg 1440

ttcagtggac acacgcttgg cagtgtaatt tccacagatc ctctgaagag gttcttcagt 1500

cataccctga ctcagatact cactcacagc cctgtgctga aagcatctga tgctgttcag 1560

atgcagagag agtggagctt tgcgcggaca caccctctgc tcacctcact gtaccgcagg 1620

ctctttgtga tgctgagtgc agaggagttg gttggccatt tgcaagaagt tctggaaacg 1680

caggaggttc actggcagag agtgctctcc tttgtgtctg ccctggttgt ctgctttcca 1740

gaagcgcagc agctgcttga agactgggtg gcgcgtttga tggcccaggc attcgagagc 1800

tgccagctgg acagcatggt cactgcgttc ctggttgtgc gccaggcagc actggagggc 1860

ccctctgcgt tcctgtcata tgcagactgg ttcaaggcct cctttgggag cacacgaggc 1920

taccatggct gcagcaagaa ggccctggtc ttcctgttta cgttcttgtc agaactcgtg 1980

ccttttgagt ctccccggta cctgcaggtg cacattctcc acccacccct ggttcccagc 2040

aagtaccgct ccctcctcac agactacatc tcattggcca agacacggct ggccgacctc 2100

aaggtttcta tagaaaacat gggactctac gaggatttgt catcagctgg ggacattact 2160

gagccccaca gccaagctct tcaggatgtt gaaaaggcca tcatggtgtt tgagcatacg 2220

gggaacatcc cagtcaccgt catggaggcc agcatattca ggaggcctta ctacgtgtcc 2280

cacttcctcc ccgccctgct cacacctcga gtgctcccca aagtccctga ctcccgtgtg 2340

gcgtttatag agtctctgaa gagagcagat aaaatccccc catctctgta ctccacctac 2400

tgccaggcct gctctgctgc tgaagagaag ccagaagatg cagccctggg agtgagggca 2460

gaacccaact ctgctgagga gcccctggga cagctcacag ctgcactggg agagctgaga 2520

gcctccatga cagaccccag ccagcgtgat gttatatcgg cacaggtggc agtgatttct 2580

gaaagactga gggctgtcct gggccacaat gaggatgaca gcagcgttga gatatcaaag 2640

attcagctca gcatcaacac gccgagactg gagccacggg aacacattgc tgtggacctc 2700

ctgctgacgt ctttctgtca gaacctgatg gctgcctcca gtgtcgctcc cccggagagg 2760

cagggtccct gggctgccct cttcgtgagg accatgtgtg gacgtgtgct ccctgcagtg 2820

ctcacccggc tctgccagct gctccgtcac cagggcccga gcctgagtgc cccacatgtg 2880

ctggggttgg ctgccctggc cgtgcacctg ggtgagtcca ggtctgcgct cccagaggtg 2940

gatgtgggtc ctcctgcacc tggtgctggc cttcctgtcc ctgcgctctt tgacagcctc 3000

ctgacctgta ggacgaggga ttccttgttc ttctgcctga aattttgtac agcagcaatt 3060

tcttactctc tctgcaagtt ttcttcccag tcacgagata ctttgtgcag ctgcttatct 3120

ccaggcctta ttaaaaagtt tcagttcctc atgttcagat tgttctcaga ggcccgacag 3180

cctctttctg aggaggacgt agccagcctt tcctggagac ccttgcacct tccttctgca 3240

gactggcaga gagctgccct ctctctctgg acacacagaa ccttccgaga ggtgttgaaa 3300

gaggaagatg ttcacttaac ttaccaagac tggttacacc tggagctgga aattcaacct 3360

gaagctgatg ctctttcaga tactgaacgg caggacttcc accagtgggc gatccatgag 3420

cactttctcc ctgagtcctc ggcttcaggg ggctgtgacg gagacctgca ggctgcgtgt 3480

accattcttg tcaacgcact gatggatttc caccaaagct caaggagtta tgaccactca 3540

gaaaattctg atttggtctt tggtggccgc acaggaaatg aggatattat ttccagattg 3600

caggagatgg tagctgacct ggagctgcag caagacctca tagtgcctct cggccacacc 3660

ccttcccagg agcacttcct ctttgagatt ttccgcagac ggctccaggc tctgacaagc 3720

gggtggagcg tggctgccag ccttcagaga cagagggagc tgctaatgta caaacggatc 3780

ctcctccgcc tgccttcgtc tgtcctctgc ggcagcagct tccaggcaga acagcccatc 3840

actgccagat gcgagcagtt cttccacttg gtcaactctg agatgagaaa cttctgctcc 3900

cacggaggtg ccctgacaca ggacatcact gcccacttct tcaggggcct cctgaacgcc 3960

tgtctgcgga gcagagaccc ctccctgatg gtcgacttca tactggccaa gtgccagacg 4020

aaatgcccct taattttgac ctctgctctg gtgtggtggc cgagcctgga gcctgtgctg 4080

ctctgccggt ggaggagaca ctgccagagc ccgctgcccc gggaactgca gaagctacaa 4140

gaaggccggc agtttgccag cgatttcctc tcccctgagg ctgcctcccc agcacccaac 4200

ccggactggc tctcagctgc tgcactgcac tttgcgattc aacaagtcag ggaagaaaac 4260

atcaggaagc agctaaagaa gctggactgc gagagagagg agctattggt tttccttttc 4320

ttcttctcct tgatgggcct gctgtcgtca catctgacct caaatagcac cacagacctg 4380

ccaaaggctt tccacgtttg tgcagcaatc ctcgagtgtt tagagaagag gaagatatcc 4440

tggctggcac tctttcagtt gacagagagt gacctcaggc tggggcggct cctcctccgt 4500

gtggccccgg atcagcacac caggctgctg cctttcgctt tttacagtct tctctcctac 4560

ttccatgaag acgcggccat cagggaagag gccttcctgc atgttgctgt ggacatgtac 4620

ttgaagctgg tccagctctt cgtggctggg gatacaagca cagtttcacc tccagctggc 4680

aggagcctgg agctcaaggg tcagggcaac cccgtggaac tgataacaaa agctcgtctt 4740

tttctgctgc agttaatacc tcggtgcccg aaaaagagct tctcacacgt ggcagagctg 4800

ctggctgatc gtggggactg cgacccagag gtgagcgccg ccctccagag cagacagcag 4860

gctgcccctg acgctgacct gtcccaggag cctcatctct tctgatgaga attcgatatc 4920

aagcttatcg ataccgtcga atcccccggg ctgcaggaat tcgagcatct taccgccatt 4980

tattcccata tttgttctgt ttttcttgat ttgggtatac atttaaatgt taataaaaca 5040

aaatggtggg gcaatcattt acatttttag ggatatgtaa ttactagttc aggtgtattg 5100

ccacaagaca aacatgttaa gaaactttcc cgttatttac gctctgttcc tgttaatcaa 5160

cctctggatt acaaaatttg tgaaagattg actgatattc ttaactatgt tgctcctttt 5220

acgctgtgtg gatatgctgc tttaatgcct ctgtatcatg ctattgcttc ccgtacggct 5280

ttcgttttct cctccttgta taaatcctgg ttgctgtctc tttatgagga gttgtggccc 5340

gttgtccgtc aacgtggcgt ggtgtgctct gtgtttgctg acgcaacccc cactggctgg 5400

ggcattgcca ccacctgtca actcctttct gggactttcg ctttccccct cccgatcgcc 5460

acggcagaac tcatcgccgc ctgccttgcc cgctgctgga caggggctag gttgctgggc 5520

actgataatt ccgtggtgtt gtcggggaag ggcc 5554

<210> 2

<211> 1455

<212> PRT

<213> Homo sapiens

<400> 2

Met Ser Asp Ser Trp Val Pro Asn Ser Ala Ser Gly Gln Asp Pro Gly

1 5 10 15

Gly Arg Arg Arg Ala Trp Ala Glu Leu Leu Ala Gly Arg Val Lys Arg

20 25 30

Glu Lys Tyr Asn Pro Glu Arg Ala Gln Lys Leu Lys Glu Ser Ala Val

35 40 45

Arg Leu Leu Arg Ser His Gln Asp Leu Asn Ala Leu Leu Leu Glu Val

50 55 60

Glu Gly Pro Leu Cys Lys Lys Leu Ser Leu Ser Lys Val Ile Asp Cys

65 70 75 80

Asp Ser Ser Glu Ala Tyr Ala Asn His Ser Ser Ser Phe Ile Gly Ser

85 90 95

Ala Leu Gln Asp Gln Ala Ser Arg Leu Gly Val Pro Val Gly Ile Leu

100 105 110

Ser Ala Gly Met Val Ala Ser Ser Val Gly Gln Ile Cys Thr Ala Pro

115 120 125

Ala Glu Thr Ser His Pro Val Leu Leu Thr Val Glu Gln Arg Lys Lys

130 135 140

Leu Ser Ser Leu Leu Glu Phe Ala Gln Tyr Leu Leu Ala His Ser Met

145 150 155 160

Phe Ser Arg Leu Ser Phe Cys Gln Glu Leu Trp Lys Ile Gln Ser Ser

165 170 175

Leu Leu Leu Glu Ala Val Trp His Leu His Val Gln Gly Ile Val Ser

180 185 190

Leu Gln Glu Leu Leu Glu Ser His Pro Asp Met His Ala Val Gly Ser

195 200 205

Trp Leu Phe Arg Asn Leu Cys Cys Leu Cys Glu Gln Met Glu Ala Ser

210 215 220

Cys Gln His Ala Asp Val Ala Arg Ala Met Leu Ser Asp Phe Val Gln

225 230 235 240

Met Phe Val Leu Arg Gly Phe Gln Lys Asn Ser Asp Leu Arg Arg Thr

245 250 255

Val Glu Pro Glu Lys Met Pro Gln Val Thr Val Asp Val Leu Gln Arg

260 265 270

Met Leu Ile Phe Ala Leu Asp Ala Leu Ala Ala Gly Val Gln Glu Glu

275 280 285

Ser Ser Thr His Lys Ile Val Arg Cys Trp Phe Gly Val Phe Ser Gly

290 295 300

His Thr Leu Gly Ser Val Ile Ser Thr Asp Pro Leu Lys Arg Phe Phe

305 310 315 320

Ser His Thr Leu Thr Gln Ile Leu Thr His Ser Pro Val Leu Lys Ala

325 330 335

Ser Asp Ala Val Gln Met Gln Arg Glu Trp Ser Phe Ala Arg Thr His

340 345 350

Pro Leu Leu Thr Ser Leu Tyr Arg Arg Leu Phe Val Met Leu Ser Ala

355 360 365

Glu Glu Leu Val Gly His Leu Gln Glu Val Leu Glu Thr Gln Glu Val

370 375 380

His Trp Gln Arg Val Leu Ser Phe Val Ser Ala Leu Val Val Cys Phe

385 390 395 400

Pro Glu Ala Gln Gln Leu Leu Glu Asp Trp Val Ala Arg Leu Met Ala

405 410 415

Gln Ala Phe Glu Ser Cys Gln Leu Asp Ser Met Val Thr Ala Phe Leu

420 425 430

Val Val Arg Gln Ala Ala Leu Glu Gly Pro Ser Ala Phe Leu Ser Tyr

435 440 445

Ala Asp Trp Phe Lys Ala Ser Phe Gly Ser Thr Arg Gly Tyr His Gly

450 455 460

Cys Ser Lys Lys Ala Leu Val Phe Leu Phe Thr Phe Leu Ser Glu Leu

465 470 475 480

Val Pro Phe Glu Ser Pro Arg Tyr Leu Gln Val His Ile Leu His Pro

485 490 495

Pro Leu Val Pro Ser Lys Tyr Arg Ser Leu Leu Thr Asp Tyr Ile Ser

500 505 510

Leu Ala Lys Thr Arg Leu Ala Asp Leu Lys Val Ser Ile Glu Asn Met

515 520 525

Gly Leu Tyr Glu Asp Leu Ser Ser Ala Gly Asp Ile Thr Glu Pro His

530 535 540

Ser Gln Ala Leu Gln Asp Val Glu Lys Ala Ile Met Val Phe Glu His

545 550 555 560

Thr Gly Asn Ile Pro Val Thr Val Met Glu Ala Ser Ile Phe Arg Arg

565 570 575

Pro Tyr Tyr Val Ser His Phe Leu Pro Ala Leu Leu Thr Pro Arg Val

580 585 590

Leu Pro Lys Val Pro Asp Ser Arg Val Ala Phe Ile Glu Ser Leu Lys

595 600 605

Arg Ala Asp Lys Ile Pro Pro Ser Leu Tyr Ser Thr Tyr Cys Gln Ala

610 615 620

Cys Ser Ala Ala Glu Glu Lys Pro Glu Asp Ala Ala Leu Gly Val Arg

625 630 635 640

Ala Glu Pro Asn Ser Ala Glu Glu Pro Leu Gly Gln Leu Thr Ala Ala

645 650 655

Leu Gly Glu Leu Arg Ala Ser Met Thr Asp Pro Ser Gln Arg Asp Val

660 665 670

Ile Ser Ala Gln Val Ala Val Ile Ser Glu Arg Leu Arg Ala Val Leu

675 680 685

Gly His Asn Glu Asp Asp Ser Ser Val Glu Ile Ser Lys Ile Gln Leu

690 695 700

Ser Ile Asn Thr Pro Arg Leu Glu Pro Arg Glu His Ile Ala Val Asp

705 710 715 720

Leu Leu Leu Thr Ser Phe Cys Gln Asn Leu Met Ala Ala Ser Ser Val

725 730 735

Ala Pro Pro Glu Arg Gln Gly Pro Trp Ala Ala Leu Phe Val Arg Thr

740 745 750

Met Cys Gly Arg Val Leu Pro Ala Val Leu Thr Arg Leu Cys Gln Leu

755 760 765

Leu Arg His Gln Gly Pro Ser Leu Ser Ala Pro His Val Leu Gly Leu

770 775 780

Ala Ala Leu Ala Val His Leu Gly Glu Ser Arg Ser Ala Leu Pro Glu

785 790 795 800

Val Asp Val Gly Pro Pro Ala Pro Gly Ala Gly Leu Pro Val Pro Ala

805 810 815

Leu Phe Asp Ser Leu Leu Thr Cys Arg Thr Arg Asp Ser Leu Phe Phe

820 825 830

Cys Leu Lys Phe Cys Thr Ala Ala Ile Ser Tyr Ser Leu Cys Lys Phe

835 840 845

Ser Ser Gln Ser Arg Asp Thr Leu Cys Ser Cys Leu Ser Pro Gly Leu

850 855 860

Ile Lys Lys Phe Gln Phe Leu Met Phe Arg Leu Phe Ser Glu Ala Arg

865 870 875 880

Gln Pro Leu Ser Glu Glu Asp Val Ala Ser Leu Ser Trp Arg Pro Leu

885 890 895

His Leu Pro Ser Ala Asp Trp Gln Arg Ala Ala Leu Ser Leu Trp Thr

900 905 910

His Arg Thr Phe Arg Glu Val Leu Lys Glu Glu Asp Val His Leu Thr

915 920 925

Tyr Gln Asp Trp Leu His Leu Glu Leu Glu Ile Gln Pro Glu Ala Asp

930 935 940

Ala Leu Ser Asp Thr Glu Arg Gln Asp Phe His Gln Trp Ala Ile His

945 950 955 960

Glu His Phe Leu Pro Glu Ser Ser Ala Ser Gly Gly Cys Asp Gly Asp

965 970 975

Leu Gln Ala Ala Cys Thr Ile Leu Val Asn Ala Leu Met Asp Phe His

980 985 990

Gln Ser Ser Arg Ser Tyr Asp His Ser Glu Asn Ser Asp Leu Val Phe

995 1000 1005

Gly Gly Arg Thr Gly Asn Glu Asp Ile Ile Ser Arg Leu Gln Glu

1010 1015 1020

Met Val Ala Asp Leu Glu Leu Gln Gln Asp Leu Ile Val Pro Leu

1025 1030 1035

Gly His Thr Pro Ser Gln Glu His Phe Leu Phe Glu Ile Phe Arg

1040 1045 1050

Arg Arg Leu Gln Ala Leu Thr Ser Gly Trp Ser Val Ala Ala Ser

1055 1060 1065

Leu Gln Arg Gln Arg Glu Leu Leu Met Tyr Lys Arg Ile Leu Leu

1070 1075 1080

Arg Leu Pro Ser Ser Val Leu Cys Gly Ser Ser Phe Gln Ala Glu

1085 1090 1095

Gln Pro Ile Thr Ala Arg Cys Glu Gln Phe Phe His Leu Val Asn

1100 1105 1110

Ser Glu Met Arg Asn Phe Cys Ser His Gly Gly Ala Leu Thr Gln

1115 1120 1125

Asp Ile Thr Ala His Phe Phe Arg Gly Leu Leu Asn Ala Cys Leu

1130 1135 1140

Arg Ser Arg Asp Pro Ser Leu Met Val Asp Phe Ile Leu Ala Lys

1145 1150 1155

Cys Gln Thr Lys Cys Pro Leu Ile Leu Thr Ser Ala Leu Val Trp

1160 1165 1170

Trp Pro Ser Leu Glu Pro Val Leu Leu Cys Arg Trp Arg Arg His

1175 1180 1185

Cys Gln Ser Pro Leu Pro Arg Glu Leu Gln Lys Leu Gln Glu Gly

1190 1195 1200

Arg Gln Phe Ala Ser Asp Phe Leu Ser Pro Glu Ala Ala Ser Pro

1205 1210 1215

Ala Pro Asn Pro Asp Trp Leu Ser Ala Ala Ala Leu His Phe Ala

1220 1225 1230

Ile Gln Gln Val Arg Glu Glu Asn Ile Arg Lys Gln Leu Lys Lys

1235 1240 1245

Leu Asp Cys Glu Arg Glu Glu Leu Leu Val Phe Leu Phe Phe Phe

1250 1255 1260

Ser Leu Met Gly Leu Leu Ser Ser His Leu Thr Ser Asn Ser Thr

1265 1270 1275

Thr Asp Leu Pro Lys Ala Phe His Val Cys Ala Ala Ile Leu Glu

1280 1285 1290

Cys Leu Glu Lys Arg Lys Ile Ser Trp Leu Ala Leu Phe Gln Leu

1295 1300 1305

Thr Glu Ser Asp Leu Arg Leu Gly Arg Leu Leu Leu Arg Val Ala

1310 1315 1320

Pro Asp Gln His Thr Arg Leu Leu Pro Phe Ala Phe Tyr Ser Leu

1325 1330 1335

Leu Ser Tyr Phe His Glu Asp Ala Ala Ile Arg Glu Glu Ala Phe

1340 1345 1350

Leu His Val Ala Val Asp Met Tyr Leu Lys Leu Val Gln Leu Phe

1355 1360 1365

Val Ala Gly Asp Thr Ser Thr Val Ser Pro Pro Ala Gly Arg Ser

1370 1375 1380

Leu Glu Leu Lys Gly Gln Gly Asn Pro Val Glu Leu Ile Thr Lys

1385 1390 1395

Ala Arg Leu Phe Leu Leu Gln Leu Ile Pro Arg Cys Pro Lys Lys

1400 1405 1410

Ser Phe Ser His Val Ala Glu Leu Leu Ala Asp Arg Gly Asp Cys

1415 1420 1425

Asp Pro Glu Val Ser Ala Ala Leu Gln Ser Arg Gln Gln Ala Ala

1430 1435 1440

Pro Asp Ala Asp Leu Ser Gln Glu Pro His Leu Phe

1445 1450 1455

<210> 3

<211> 3903

<212> DNA

<213> Artificial Sequence

<220>

<223> pCCL-ChimhCD18W-82-RO vector sequence

<400> 3

cgcgtctgcc agctttcttg ctttgctgga gtattctgga atttgatggg ttgagggttc 60

tggacacaat gccccaagcc ccttccttgt tgtgctgggt tcctatttct gctctcggca 120

ctgacttagc agctgctcaa gagctcacca tgttggcttg gattacacgg tctcacccac 180

atctccggca gtttgtgggc aaacttcctg agcagccttg ggtgatgaaa cctttcatgg 240

tagcaggaga atgggactgt gaattctcaa tcccctgtcc ccaccccttc cttcctctct 300

cagggccttg ctgtctagga ggagggagca cagcagcaac tgactgggca gcctttcagg 360

aaaggctagc ccgggctcga tcgagaagct tgataattcc gtgaggtggg gagggctggg 420

accagggttc cctctttctc ttctgcggtg gccctggcct ggtgctagga ctgcgcgcct 480

cccctcagta cccgcggaca ccctgggctt ccctgggccc agcatctgcc tggggcctcg 540

ccctgggctc cccctcctga cccccacctt gcgccccttc ccggtgttcc cggggcgctg 600

ccgggccctg gggcctgcgg ggcgcgggcg gctcttggct gggccattct ttcccggccc 660

cctcctccct tccgtttccg tggccgtgcg gccggctaga ggctgcggcc cagcgcggag 720

caggggggct ggcaggcgtc ggggcggtcg ggccggtccc gcccgcccct tcccctccac 780

aggcccgccc cggggcctgg gccaactgaa accgcgggag gaggaagcgc ggaatcagga 840

actggccggg gtccgcaccg ggcctgagtc ggtccgaggc cgtcccagga gcagctgccc 900

gaagggcgaa ttgggggatc ccccggggcta atgccaactt tgtacaaaaa agcaggctcc 960

accatgctgg gcctgcgccc cccacttctc gccctggtgg ggctgctctc cctcgggtgc 1020

gtcctctctc aggagtgcac gaagttcaag gtcagcagct gccgggaatg catcgagtcg 1080

gggcccggct gcacctggtg ccagaagctg aacttcacag ggccggggga tcctgactcc 1140

attcgctgcg acacccggcc acagctgctc atgaggggct gtgcggctga cgacatcatg 1200

gaccccacaa gcctcgctga aacccaggaa gaccacaatg ggggccagaa gcagctgtcc 1260

ccacaaaaag tgacgcttta cctgcgacca ggccaggcag cagcgttcaa cgtgaccttc 1320

cggcgggcca agggctaccc catcgacctg tactatctga tggacctctc ctactccatg 1380

cttgatgacc tcaggaatgt caagaagcta ggtggcgacc tgctccgggc cctcaacgag 1440

atcaccgagt ccggccgcat tggcttcggg tccttcgtgg acaagaccgt gctgccgttc 1500

gtgaacacgc accctgataa gctgcgaaac ccatgcccca acaaggagaa agagtgccag 1560

cccccgtttg ccttcaggca cgtgctgaag ctgaccaaca actccaacca gtttcagacc 1620

gaggtcggga agcagctgat ttccggaaac ctggatgcac ccgaggtgg gctggacgcc 1680

atgatgcagg tcgccgcctg cccggaggaa atcggctggc gcaacgtcac gcggctgctg 1740

gtgtttgcca ctgatgacgg cttccatttc gcgggcgacg ggaagctggg cgccatcctg 1800

acccccaacg acggccgctg tcacctggag gacaacttgt acaagaggag caacgaattc 1860

gactacccat cggtgggcca gctggcgcac aagctggctg aaaacaacat ccagcccatc 1920

ttcgcggtga ccagtaggat ggtgaagacc tacgagaaac tcaccgagat catccccaag 1980

tcagccgtgg gggagctgtc tgaggactcc agcaatgtgg tccatctcat taagaatgct 2040

tacaataaac tctcctccag ggtattcctg gatcacaacg ccctccccga caccctgaaa 2100

gtcacctacg actccttctg cagcaatgga gtgacgcaca ggaaccagcc cagaggtgac 2160

tgtgatggcg tgcagatcaa tgtcccgatc accttccagg tgaaggtcac ggccacagag 2220

tgcatccagg agcagtcgtt tgtcatccgg gcgctgggct tcacggacat agtgaccgtg 2280

caggtccttc cccagtgtga gtgccggtgc cgggaccaga gcagagaccg cagcctctgc 2340

catggcaagg gcttcttgga gtgcggcatc tgcaggtgtg acactggcta cattgggaaa 2400

aactgtgagt gccagacaca gggccggagc agccaggagc tggaaggaag ctgccggaag 2460

gacaacaact ccatcatctg ctcagggctg ggggactgtg tctgcgggca gtgcctgtgc 2520

cacaccagcg acgtccccgg caagctgata tacgggcagt actgcgagtg tgacaccatc 2580

aactgtgagc gctacaacgg ccaggtctgc ggcggcccgg ggagggggct ctgcttctgc 2640

gggaagtgcc gctgccaccc gggctttgag ggctcagcgt gccagtgcga gaggaccact 2700

gagggctgcc tgaacccgcg gcgtgttgag tgtagtggtc gtggccggtg ccgctgcaac 2760

gtatgcgagt gccattcagg ctaccagctg cctctgtgcc aggagtgccc cggctgcccc 2820

tcaccctgtg gcaagtacat ctcctgcgcc gagtgcctga agttcgaaaa gggccccttt 2880

gggaagaact gcagcgcggc gtgtccgggc ctgcagctgt cgaacaaccc cgtgaagggc 2940

aggacctgca aggagaggga ctcagagggc tgctgggtgg cctacacgct ggagcagcag 3000

gacgggatgg accgctacct catctatgtg gatgagagcc gagagtgtgt ggcaggcccc 3060

aacatcgccg ccatcgtcgg gggcaccgtg gcaggcatcg tgctgatcgg cattctcctg 3120

ctggtcatct ggaaggctct gatccacctg agcgacctcc gggagtacag gcgctttgag 3180

aaggagaagc tcaagtccca gtggaacaat gataatcccc ttttcaagag cgccaccacg 3240

acggtcatga accccaagtt tgctgagagt taggacccag ctttcttgta caaagttggc 3300

attaggaatt cgagcatctt accgccattt attcccatat ttgttctgtt tttcttgatt 3360

tgggtataca tttaaatgtt aataaaacaa aatggtgggg caatcattta catttttagg 3420

gatatgtaat tactagttca ggtgtattgc cacaagacaa acatgttaag aaactttccc 3480

gttatttacg ctctgttcct gttaatcaac ctctggatta caaaatttgt gaaagattga 3540

ctgatattct taactatgtt gctcctttta cgctgtgtgg atatgctgct ttaatgcctc 3600

tgtatcatgc tattgcttcc cgtacggctt tcgttttctc ctccttgtat aaatcctggt 3660

tgctgtctct ttatgaggag ttgtggcccg ttgtccgtca acgtggcgtg gtgtgctctg 3720

tgtttgctga cgcaaccccc actggctggg gcattgccac cacctgtcaa ctcctttctg 3780

ggactttcgc tttccccctc ccgatcgcca cggcagaact catcgccgcc tgccttgccc 3840

gctgctggac aggggctagg ttgctgggca ctgataattc cgtggtgttg tcggggaagg 3900

gcc 3903

<210> 4

<211> 769

<212> PRT

<213> Homo sapiens

<400> 4

Met Leu Gly Leu Arg Pro Pro Leu Leu Ala Leu Val Gly Leu Leu Ser

1 5 10 15

Leu Gly Cys Val Leu Ser Gln Glu Cys Thr Lys Phe Lys Val Ser Ser

20 25 30

Cys Arg Glu Cys Ile Glu Ser Gly Pro Gly Cys Thr Trp Cys Gln Lys

35 40 45

Leu Asn Phe Thr Gly Pro Gly Asp Pro Asp Ser Ile Arg Cys Asp Thr

50 55 60

Arg Pro Gln Leu Leu Met Arg Gly Cys Ala Ala Asp Asp Ile Met Asp

65 70 75 80

Pro Thr Ser Leu Ala Glu Thr Gln Glu Asp His Asn Gly Gly Gln Lys

85 90 95

Gln Leu Ser Pro Gln Lys Val Thr Leu Tyr Leu Arg Pro Gly Gln Ala

100 105 110

Ala Ala Phe Asn Val Thr Phe Arg Arg Ala Lys Gly Tyr Pro Ile Asp

115 120 125

Leu Tyr Tyr Leu Met Asp Leu Ser Tyr Ser Met Leu Asp Asp Leu Arg

130 135 140

Asn Val Lys Lys Leu Gly Gly Asp Leu Leu Arg Ala Leu Asn Glu Ile

145 150 155 160

Thr Glu Ser Gly Arg Ile Gly Phe Gly Ser Phe Val Asp Lys Thr Val

165 170 175

Leu Pro Phe Val Asn Thr His Pro Asp Lys Leu Arg Asn Pro Cys Pro

180 185 190

Asn Lys Glu Lys Glu Cys Gln Pro Pro Phe Ala Phe Arg His Val Leu

195 200 205

Lys Leu Thr Asn Asn Ser Asn Gln Phe Gln Thr Glu Val Gly Lys Gln

210 215 220

Leu Ile Ser Gly Asn Leu Asp Ala Pro Glu Gly Gly Leu Asp Ala Met

225 230 235 240

Met Gln Val Ala Ala Cys Pro Glu Glu Ile Gly Trp Arg Asn Val Thr

245 250 255

Arg Leu Leu Val Phe Ala Thr Asp Asp Gly Phe His Phe Ala Gly Asp

260 265 270

Gly Lys Leu Gly Ala Ile Leu Thr Pro Asn Asp Gly Arg Cys His Leu

275 280 285

Glu Asp Asn Leu Tyr Lys Arg Ser Asn Glu Phe Asp Tyr Pro Ser Val

290 295 300

Gly Gln Leu Ala His Lys Leu Ala Glu Asn Asn Ile Gln Pro Ile Phe

305 310 315 320

Ala Val Thr Ser Arg Met Val Lys Thr Tyr Glu Lys Leu Thr Glu Ile

325 330 335

Ile Pro Lys Ser Ala Val Gly Glu Leu Ser Glu Asp Ser Ser Asn Val

340 345 350

Val His Leu Ile Lys Asn Ala Tyr Asn Lys Leu Ser Ser Arg Val Phe

355 360 365

Leu Asp His Asn Ala Leu Pro Asp Thr Leu Lys Val Thr Tyr Asp Ser

370 375 380

Phe Cys Ser Asn Gly Val Thr His Arg Asn Gln Pro Arg Gly Asp Cys

385 390 395 400

Asp Gly Val Gln Ile Asn Val Pro Ile Thr Phe Gln Val Lys Val Thr

405 410 415

Ala Thr Glu Cys Ile Gln Glu Gln Ser Phe Val Ile Arg Ala Leu Gly

420 425 430

Phe Thr Asp Ile Val Thr Val Gln Val Leu Pro Gln Cys Glu Cys Arg

435 440 445

Cys Arg Asp Gln Ser Arg Asp Arg Ser Leu Cys His Gly Lys Gly Phe

450 455 460

Leu Glu Cys Gly Ile Cys Arg Cys Asp Thr Gly Tyr Ile Gly Lys Asn

465 470 475 480

Cys Glu Cys Gln Thr Gln Gly Arg Ser Ser Gln Glu Leu Glu Gly Ser

485 490 495

Cys Arg Lys Asp Asn Asn Ser Ile Ile Cys Ser Gly Leu Gly Asp Cys

500 505 510

Val Cys Gly Gln Cys Leu Cys His Thr Ser Asp Val Pro Gly Lys Leu

515 520 525

Ile Tyr Gly Gln Tyr Cys Glu Cys Asp Thr Ile Asn Cys Glu Arg Tyr

530 535 540

Asn Gly Gln Val Cys Gly Gly Pro Gly Arg Gly Leu Cys Phe Cys Gly

545 550 555 560

Lys Cys Arg Cys His Pro Gly Phe Glu Gly Ser Ala Cys Gln Cys Glu

565 570 575

Arg Thr Thr Glu Gly Cys Leu Asn Pro Arg Arg Val Glu Cys Ser Gly

580 585 590

Arg Gly Arg Cys Arg Cys Asn Val Cys Glu Cys His Ser Gly Tyr Gln

595 600 605

Leu Pro Leu Cys Gln Glu Cys Pro Gly Cys Pro Ser Pro Cys Gly Lys

610 615 620

Tyr Ile Ser Cys Ala Glu Cys Leu Lys Phe Glu Lys Gly Pro Phe Gly

625 630 635 640

Lys Asn Cys Ser Ala Ala Cys Pro Gly Leu Gln Leu Ser Asn Asn Pro

645 650 655

Val Lys Gly Arg Thr Cys Lys Glu Arg Asp Ser Glu Gly Cys Trp Val

660 665 670

Ala Tyr Thr Leu Glu Gln Gln Asp Gly Met Asp Arg Tyr Leu Ile Tyr

675 680 685

Val Asp Glu Ser Arg Glu Cys Val Ala Gly Pro Asn Ile Ala Ala Ile

690 695 700

Val Gly Gly Thr Val Ala Gly Ile Val Leu Ile Gly Ile Leu Leu Leu

705 710 715 720

Val Ile Trp Lys Ala Leu Ile His Leu Ser Asp Leu Arg Glu Tyr Arg

725 730 735

Arg Phe Glu Lys Glu Lys Leu Lys Ser Gln Trp Asn Asn Asp Asn Pro

740 745 750

Leu Phe Lys Ser Ala Thr Thr Thr Val Met Asn Pro Lys Phe Ala Glu

755 760 765

Ser

<210> 5

<211> 2890

<212> DNA

<213> Artificial Sequence

<220>

<223> pCCL-PGK-coRPKW-82-RO vector sequence

<400> 5

ggggttgggg ttgcgccttt tccaaggcag ccctgggttt gcgcagggac gcggctgctc 60

tgggcgtggt tccgggaaac gcagcggcgc cgaccctggg tctcgcacat tcttcacgtc 120

cgttcgcagc gtcacccgga tcttcgccgc tacccttgtg ggccccccgg cgacgcttcc 180

tgctccgccc ctaagtcggg aaggttcctt gcggttcgcg gcgtgccgga cgtgacaaac 240

ggaagccgca cgtctcacta gtaccctcgc agacggacag cgccagggag caatggcagc 300

gcgccgaccg cgatgggctg tggccaatag cggctgctca gcagggcgcg ccgagagcag 360

cggccgggaa ggggcggtgc gggaggcggg gtgtggggcg gtagtgtggg ccctgttcct 420

gcccgcgcgg tgttccgcat tctgcaagcc tccggagcgc acgtcggcag tcggctccct 480

cgttgaccga atcaccgacc tctctcccca gggggatccg tcgacaccgg tgccaccatg 540

agcatccagg aaaatatcag ctctctgcag ctgcggtcct gggtgtccaa gagccagaga 600

gacctggcca agagcatcct gatcggagcc cctggcggac cagccggata cctgagaagg 660

gctagcgtgg cccagctgac ccadgaactg ggcaccgcct ttttccagca gcagcagctg 720

ccagccgcca tggccgacac ctttctggaa cacctgtgcc tgctggacat cgactctgag 780

cccgtggccg ccagaagcac cagcatcatt gccaccatcg gccctgccag cagaagcgtg 840

gagcggctga aagagatgat caaggccggc atgaatatcg cccggctgaa cttctcccac 900

ggcagccacg agtaccacgc agagagcatt gccaacgtcc gggaggccgt ggagagcttt 960

gccggcagcc ccctgagcta cagacccgtg gccattgccc tggacaccaa gggccccgag 1020

atcagaacag gaattctgca gggagggcct gagagcgagg tggagctggt gaagggcagc 1080

caagtgctgg tgaccgtgga ccccgccttc agaaccagag gcaacgccaa cacagtgtgg 1140

gtggactacc ccaacatcgt gcgggtggtg cctgtgggcg gcagaatcta catcgacgac 1200

ggcctgatca gcctggtggt gcagaagatc ggacctgagg gcctggtgac ccaggtcgag 1260

aatggcggcg tgctgggcag cagaaagggc gtgaatctgc caggcgccca ggtggacctg 1320

cctggcctgt ctgagcagga cgtgagagac ctgagatttg gcgtggagca cggcgtggac 1380

atcgtgttcg ccagcttcgt gcggaaggcc tctgatgtgg ccgccgtgag agccgctctg 1440

ggccctgaag gccacggcat caagatcatc agcaagatcg agaaccacga gggcgtgaag 1500

cggttcgacg agatcctgga agtgtccgac ggcatcatgg tggccagagg cgacctgggc 1560

atcgagatcc ccgccgagaa ggtgttcctg gcccagaaaa tgatgatcgg acggtgcaac 1620

ctggccggca aacctgtggt gtgcgccacc cagatgctgg aaagcatgat caccaagccc 1680

agacccacca gagccgagac aagcgacgtg gccaacgccg tgctggatgg cgctgactgc 1740

atcatgctgt ccggcgagac agccaagggc aacttccccg tggaggccgt gaagatgcag 1800

cacgccattg ccagagaagc cgaggccgcc gtgtaccacc ggcagctgtt cgaggaactg 1860

cggagagccg cccctctgag cagagatccc accgaagtga ccgccatcgg agccgtggaa 1920

gccgccttca agtgctgcgc cgctgcaatc atcgtgctga ccaccacagg cagaagcgcc 1980

cagctgctgt ccagatacag acccagagcc gccgtgatcg ccgtgacaag atccgcccag 2040

gccgctagac aggtccacct gtgcagaggc gtgttccccc tgctgtaccg ggagcctccc 2100

gaggccatct gggccgacga cgtggacaga cgggtgcagt tcggcatcga gagcggcaag 2160

ctgcggggct tcctgagagt gggcgacctg gtgatcgtgg tgacaggctg gcggcctggc 2220

agcggctaca ccaacatcat gagggtgctg tccatcagct gaccgcggtc tagaggatcc 2280

cccggggctgc aggaattcga gcatcttacc gccatttatt cccatatttg ttctgttttt 2340

cttgatttgg gtatacattt aaatgttaat aaaacaaaat ggtggggcaa tcatttacat 2400

ttttagggat atgtaattac tagttcaggt gtattgccac aagacaaaca tgttaagaaa 2460

ctttcccgtt atttacgctc tgttcctgtt aatcaacctc tggattacaa aatttgtgaa 2520

agattgactg atattcttaa ctatgttgct ccttttacgc tgtgtggata tgctgcttta 2580

atgcctctgt atcatgctat tgcttcccgt acggctttcg ttttctcctc cttgtataaa 2640

tcctggttgc tgtctcttta tgaggagttg tggcccgttg tccgtcaacg tggcgtggtg 2700

tgctctgtgt ttgctgacgc aacccccact ggctggggca ttgccaccac ctgtcaactc 2760

ctttctggga ctttcgcttt ccccctcccg atcgccacgg cagaactcat cgccgcctgc 2820

cttgcccgct gctggacagg ggctaggttg ctgggcactg ataattccgt ggtgttgtcg 2880

gggaagggcc 2890

<210> 6

<211> 574

<212> PRT

<213> Homo sapiens

<400> 6

Met Ser Ile Gln Glu Asn Ile Ser Ser Leu Gln Leu Arg Ser Trp Val

1 5 10 15

Ser Lys Ser Gln Arg Asp Leu Ala Lys Ser Ile Leu Ile Gly Ala Pro

20 25 30

Gly Gly Pro Ala Gly Tyr Leu Arg Arg Ala Ser Val Ala Gln Leu Thr

35 40 45

Gln Glu Leu Gly Thr Ala Phe Phe Gln Gln Gln Gln Leu Pro Ala Ala

50 55 60

Met Ala Asp Thr Phe Leu Glu His Leu Cys Leu Leu Asp Ile Asp Ser

65 70 75 80

Glu Pro Val Ala Ala Arg Ser Thr Ser Ile Ile Ala Thr Ile Gly Pro

85 90 95

Ala Ser Arg Ser Val Glu Arg Leu Lys Glu Met Ile Lys Ala Gly Met

100 105 110

Asn Ile Ala Arg Leu Asn Phe Ser His Gly Ser His Glu Tyr His Ala

115 120 125

Glu Ser Ile Ala Asn Val Arg Glu Ala Val Glu Ser Phe Ala Gly Ser

130 135 140

Pro Leu Ser Tyr Arg Pro Val Ala Ile Ala Leu Asp Thr Lys Gly Pro

145 150 155 160

Glu Ile Arg Thr Gly Ile Leu Gln Gly Gly Pro Glu Ser Glu Val Glu

165 170 175

Leu Val Lys Gly Ser Gln Val Leu Val Thr Val Asp Pro Ala Phe Arg

180 185 190

Thr Arg Gly Asn Ala Asn Thr Val Trp Val Asp Tyr Pro Asn Ile Val

195 200 205

Arg Val Val Pro Val Gly Gly Arg Ile Tyr Ile Asp Asp Gly Leu Ile

210 215 220

Ser Leu Val Val Gln Lys Ile Gly Pro Glu Gly Leu Val Thr Gln Val

225 230 235 240

Glu Asn Gly Gly Val Leu Gly Ser Arg Lys Gly Val Asn Leu Pro Gly

245 250 255

Ala Gln Val Asp Leu Pro Gly Leu Ser Glu Gln Asp Val Arg Asp Leu

260 265 270

Arg Phe Gly Val Glu His Gly Val Asp Ile Val Phe Ala Ser Phe Val

275 280 285

Arg Lys Ala Ser Asp Val Ala Ala Val Arg Ala Ala Leu Gly Pro Glu

290 295 300

Gly His Gly Ile Lys Ile Ile Ser Lys Ile Glu Asn His Glu Gly Val

305 310 315 320

Lys Arg Phe Asp Glu Ile Leu Glu Val Ser Asp Gly Ile Met Val Ala

325 330 335

Arg Gly Asp Leu Gly Ile Glu Ile Pro Ala Glu Lys Val Phe Leu Ala

340 345 350

Gln Lys Met Met Ile Gly Arg Cys Asn Leu Ala Gly Lys Pro Val Val

355 360 365

Cys Ala Thr Gln Met Leu Glu Ser Met Ile Thr Lys Pro Arg Pro Thr

370 375 380

Arg Ala Glu Thr Ser Asp Val Ala Asn Ala Val Leu Asp Gly Ala Asp

385 390 395 400

Cys Ile Met Leu Ser Gly Glu Thr Ala Lys Gly Asn Phe Pro Val Glu

405 410 415

Ala Val Lys Met Gln His Ala Ile Ala Arg Glu Ala Glu Ala Ala Val

420 425 430

Tyr His Arg Gln Leu Phe Glu Glu Leu Arg Arg Ala Ala Pro Leu Ser

435 440 445

Arg Asp Pro Thr Glu Val Thr Ala Ile Gly Ala Val Glu Ala Ala Phe

450 455 460

Lys Cys Cys Ala Ala Ala Ile Ile Val Leu Thr Thr Thr Gly Arg Ser

465 470 475 480

Ala Gln Leu Leu Ser Arg Tyr Arg Pro Arg Ala Ala Val Ile Ala Val

485 490 495

Thr Arg Ser Ala Gln Ala Ala Arg Gln Val His Leu Cys Arg Gly Val

500 505 510

Phe Pro Leu Leu Tyr Arg Glu Pro Pro Glu Ala Ile Trp Ala Asp Asp

515 520 525

Val Asp Arg Arg Val Gln Phe Gly Ile Glu Ser Gly Lys Leu Arg Gly

530 535 540

Phe Leu Arg Val Gly Asp Leu Val Ile Val Val Thr Gly Trp Arg Pro

545 550 555 560

Gly Ser Gly Tyr Thr Asn Ile Met Arg Val Leu Ser Ile Ser

565 570

<210> 7

<211> 1233

<212> DNA

<213> Artificial Sequence

<220>

<223> PKLR polynucloetide seqeunce

<400> 7

atggtctgct tcagactgtt ccctgtccct ggatctggtc tggtgcttgt gtgcttggtg 60

ctgggtgctg tgagatccta tgcccttgag ctgaacctga ctgactcaga aaatgccact 120

tgcctgtatg ccaagtggca gatgaacttc actgtgagat atgagactac caacaagacc 180

tacaagactg tgaccatctc agaccatggc actngtcacct acaatggatc aatctgtggt 240

gatgatcaga atggcccaaa gatagcagtg cagtttgggc ccggtttttc ctggattgct 300

aacttcacca aggcagcctc cacctacagc attgactcag tcagcttcag ctacaacact 360

ggggataaca ccaccttccc tgacgcagag gacaagggaa tccttactgt ggacgaactc 420

ctggcaatca gaatccccct taacgacctg ttcagatgca actccctttc aacccttgaa 480

aagaatgatg tggtgcaaca ctattgggac gtcctggtgc aagcctttgt gcagaatggg 540

acagtgagta ccaacgagtt cctctgtgac aaggacaaga ccagcactgt ggcccccact 600

atccacacca ctgtgcccag ccctaccact acccccaccc ctaaagagaa gccagaagct 660

ggaacctact cagtcaacaa tggaaatgac acatgcctcc ttgccaccat gggactgcag 720

ctgaacatca ctcaggacaa ggtggcctca gtgattaaca tcaaccctaa caccactcat 780

agcactggga gctgcagatc acatacagct ctgctgaggc tcaactcctc caccatcaag 840

tacctggact ttgtgtttgc tgtgaagaat gagaacaggt tctacctcaa ggaagtgaac 900

atttccatgt acctggtcaa tggttcagtg ttctctattg ccaacaacaa tctgagctac 960

tgggatgcac ccctgggatc ctcctacatg tgcaacaagg agcagactgt gagtgtgtca 1020

ggtgcttttc agatcaacac ttttgacctg agggtgcagc ccttcaatgt gactcaggga 1080

aagtactcca ctgcacaaga gtgttccttg gatgatgaca ctatcctcat ccccattatt 1140

gtgggagctg gactgtcagg attgattata gtgattgtga ttgcttatgt gattggaagg 1200

agaaagagct atgctggcta ccagaccctg taa 1233

<210> 8

<211> 1233

<212> DNA

<213> Artificial Sequence

<220>

<223> PKLR polynucloetide seqeunce

<400> 8

atggtgtgct ttagactgtt tcctgtgcct ggttcagggc tggtcctggt ctgtctggtg 60

ctggggggctg tcagaagcta tgccttggag ctgaacctca ctgatagtga aaatgccact 120

tgtctgtatg ctaagtggca gatgaacttc actngtgagat atgaaaccac caacaagact 180

tacaaaacag tgaccatctc agatcatgga actgtgacct acaacggcag catttgtgga 240

gacgaccaga acggaccaaa aatcgctgtc caatttgggc ctggattctc ctggattgcc 300

aatttcacta aagctgcctc cacatattca attgactcag tgtccttctc ctacaacact 360

ggggacaaca ctactttccc tgatgctgaa gataagggaa tcttgacagt ggatgagctg 420

ctggctatca ggatcccttt gaatgacctg tttaggtgta attcactgag cactctggag 480

aagaacgacg tggtgcagca ctactgggac gtgctggtgc aggcctttgt gcagaacggc 540

actgtgtcca ccaacgaatt cctgtgtgat aaggacaaaa cttccactgt ggcacctaca 600

attcacacta ctgtgccttc acctaccacc actccaactc caaaggaaaa gcctgaagca 660

ggaacctact ctgtgaacaa tggcaatgat acctgtctgt tggccaccat gggcctccaa 720

ctgaacatta ctcaggacaa ggtggcctca gtgattaaca ttaaccccaa cactacccac 780

tccactggca gctgtagatc acacacagcc ttgctcagac tgaatagcag caccatcaag 840

tatttggatt ttgtgtttgc agtgaagaat gaaaacaggt tctacctgaa ggaagtcaac 900

atctcaatgt acctggtgaa cggctcagtg ttcagcattg ccaacaacaa cctctcctat 960

tgggacgctc cactggggag cagctacatg tgtaacaagg aacagactgt gtcagtgtca 1020

ggagccttcc agattaacac ctttgatctg agggtccaac cctttaatgt cactcaagga 1080

aagtatagca ctgcccagga gtgctccctg gatgatgaca ccattctgat tccaatcatt 1140

gtgggtgcag gactttctgg gcttattatt gtgattgtga ttgcctatgt gattggcaga 1200

aggaaatcct atgcagggta ccaaactctg taa 1233

<210> 9

<211> 1233

<212> DNA

<213> Artificial Sequence

<220>

<223> PKLR polynucloetide seqeunce

<400> 9

atggtctgtt ttaggctgtt ccctgtccct ggttcaggac tggtcttagt gtgtctggtg 60

cttggagctg tcagaagcta tgccctggag ctgaacctga ctgactcaga aaatgccact 120

tgcctgtatg ccaagtggca gatgaacttc actgtcagat atgaaaccac caacaagacc 180

tataagactg tgaccatctc agaccatggc actgtgactt acaatgggtc aatttgtgga 240

gatgaccaga atggccctaa gatagctgtc cagtttggtc caggattcag ctggattgcc 300

aacttcacca aggcagccag cacctacagc attgactctg tgtccttctc ctacaacaca 360

ggagacaaca ccactttccc tgatgcagag gacaaaggta tcctgactgt ggatgagttg 420

ctggcaatca ggatcccact gaacgatctg ttcaggtgca actcactgtc cactctggaa 480

aagaatgatg tggtgcagca ctattgggat gtgctagtcc aggcctttgt ccagaatggg 540

actgtgtcaa ctaatgagtt cctgtgtgac aaggacaaga caagcactgt agcccccact 600

atccatacca cagtacctag ccccaccact actccaaccc ccaaggagaa gcctgaggct 660

ggcacctact cagtgaacaa tgggaatgac acctgtttgc tggccactat gggactccaa 720

ctgaacatca cccaggacaa agtggcctct gtgatcaata tcaatcccaa caccacccac 780

agcactgggt cctgcagaag cccacactgcc ctcctgaggc tcaactcatc aactatcaag 840

tacttggatt ttgtgtttgc agtgaagaat gagaacagat tctacctcaa agaggtcaac 900

atttcaatgt acctggtgaa tgggagtgtg ttctccatg ctaacaacaa cctgagctac 960

tgggatgccc ctctgggctc ctcatacatg tgcaacaagg aacagactgt gagtgtgtca 1020

ggggccttcc agatcaacac ttttgacctg agagtgcagc cctttaatgt gacacaggga 1080

aagtacagca ctgctcagga gtgcagcctg gatgatgaca ctatcctgat ccctatcatt 1140

gtggggggcag gcctgtctgg actcattatt gtgattgtga ttgcctatgt gatagggaga 1200

aggaagtctt atgctggata ccagaccctg taa 1233

<210> 10

<211> 3384

<212> DNA

<213> Artificial Sequence

<220>

<223> pRRL.PPT.EFS.tcirg1h.wpre vector sequence

<400> 10

ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60

ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120

gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180

gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtgtcgtga 240

cgcgggatcc gccaccatgg gctccatgtt tcggagcgag gaggtggccc tggtccagct 300

ctttctgccc acagcggctg cctacacctg cgtgagtcgg ctgggcgagc tgggcctcgt 360

ggagttcaga gacctcaacg cctcggtgag cgccttccag agacgctttg tggttgatgt 420

tcggcgctgt gaggagctgg agaagacctt caccttcctg caggaggagg tgcggcgggc 480

tgggctggtc ctgcccccgc caaaggggag gctgccggca cccccacccc gggacctgct 540

gcgcatccag gaggacgg agcgcctggc ccaggagctg cgggatgtgc ggggcaacca 600

gcaggccctg cgggcccagc tgcaccagct gcagctccac gccgccgtgc tacgccaggg 660

ccatgaacct cagctggcag ccgcccacac agatggggcc tcagagagga cgcccctgct 720

ccaggccccc ggggggccgc accaggacct gagggtcaac tttgtggcag gtgccgtgga 780

gccccacaag gcccctgccc tagagcgcct gctctggagg gcctgcagag gcttcctcat 840

tgccagcttc agggagctgg agcagccgct ggagcacccc gtgacgggcg agccagccac 900

gtggatgacc ttcctcatct cctactgggg tgagcagatc ggacagaaga tccgcaagat 960

cacggactgc ttccactgcc acgtcttccc gtttctgcag caggaggagg cccgcctcgg 1020

ggccctgcag cagctgcaac agcagagcca ggagctgcag gaggtcctcg ggggacaga 1080

gcggttcctg agccaggtgc taggccgggt gctgcagctg ctgccgccag ggcaggtgca 1140

ggtccacaag atgaaggccg tgtacctggc cctgaaccag tgcagcgtga gcaccacgca 1200

caagtgcctc attgccgagg cctggtgctc tgtgcgagac ctgcccgccc tgcaggaggc 1260

cctgcgggac agctcgatgg aggagggagt gagtgccgtg gctcaccgca tcccctgccg 1320

ggacatgccc cccacactca tccgcaccaa ccgcttcacg gccagcttcc agggcatcgt 1380

ggatgcctac ggcgtgggcc gctaccagga ggtcaacccc gctccctaca ccatcatcac 1440

cttccccttc ctgtttgctg tgatgttcgg ggatgtgggc cacgggctgc tcatgttcct 1500

cttcgccctg gccatggtcc ttgcggagaa ccgaccggct gtgaaggccg cgcagaacga 1560

gatctggcag actttcttca ggggccgcta cctgctcctg cttatgggcc tgttctccat 1620

ctacaccggc ttcatctaca acgagtgctt cagtcgcgcc accagcatct tcccctcggg 1680

ctggagtgtg gccgccatgg ccaaccagtc tggctggagt gatgcattcc tggcccagca 1740

cacgatgctt accctggacc ccaacgtcac cggtgtcttc ctgggaccct acccctttgg 1800

catcgatcct atttggagcc tggctgccaa ccacttgagc ttcctcaact ccttcaagat 1860

gaagatgtcc gtcatcctgg gcgtcgtgca catggccttt ggggtggtcc tcggagtctt 1920

caaccacgtg cactttggcc agaggcaccg gctgctgctg gagacgctgc cggagctcac 1980

cttcctgctg ggactcttcg gttacctcgt gttcctagtc atctacaagt ggctgtgtgt 2040

ctgggctgcc agggccgcct cggcccccag catcctcatc cacttcatca acatgttcct 2100

cttctcccac agccccagca acaggctgct ctacccccgg caggaggtgg tccaggccac 2160

gctggtggtc ctggccttgg ccatggtgcc catcctgctg cttggcacac ccctgcacct 2220

gctgcaccgc caccgccgcc gcctgcggag gaggcccgct gaccgacagg aggaaaacaa 2280

ggccgggttg ctggacctgc ctgacgcatc tgtgaatggc tggagctccg atgaggaaaa 2340

ggcaggggggc ctggatgatg aagaggaggc cgagctcgtc ccctccgagg tgctcatgca 2400

ccaggccatc cacaccatcg agttctgcct gggctgcgtc tccaacaccg cctcctacct 2460

gcgcctgtgg gccctgagcc tggcccacgc ccagctgtcc gaggttctgt gggccatggt 2520

gatgcgcata ggcctgggcc tgggccggga ggtgggcgtg gcggctgtgg tgctggtccc 2580

catctttgcc gcctttgccg tgatgaccgt ggctatcctg ctggtgatgg agggactctc 2640

agccttcctg cacgccctgc ggctgcactg ggtggaattc cagaacaagt tctactcagg 2700

cacgggctac aagctgagtc ccttcacctt cgctgccaca gatgactagt aagtcgacgg 2760

atcccccggg ctgcaggaat tcgagcatct taccgccatt tatacccata tttgttctgt 2820

ttttcttgat ttgggtatac atttaaatgt taataaaaca aaatggtggg gcaatcattt 2880

acatttttag ggatatgtaa ttactagttc aggtgtattg ccacaagaca aacatgttaa 2940

gaaactttcc cgttatttac gctctgttcc tgttaatcaa cctctggatt acaaaatttg 3000

tgaaagattg actgatattc ttaactatgt tgctcctttt acgctgtgtg gatatgctgc 3060

tttaatgcct ctgtatcatg ctattgcttc ccgtacggct ttcgttttct cctccttgta 3120

taaatcctgg ttgctgtctc tttatgagga gttgtggccc gttgtccgtc aacgtggcgt 3180

ggtgtgctct gtgtttgctg acgcaacccc cactggctgg ggcattgcca ccacctgtca 3240

actcctttct gggactttcg ctttccccct cccgatcgcc acggcagaac tcatcgccgc 3300

ctgccttgcc cgctgctgga caggggctag gttgctgggc actgataatt ccgtggtgtt 3360

gtcggggaag ctgacgtcct ttcg 3384

<210> 11

<211> 830

<212> PRT

<213> Homo sapiens

<400> 11

Met Gly Ser Met Phe Arg Ser Glu Glu Val Ala Leu Val Gln Leu Phe

1 5 10 15

Leu Pro Thr Ala Ala Ala Tyr Thr Cys Val Ser Arg Leu Gly Glu Leu

20 25 30

Gly Leu Val Glu Phe Arg Asp Leu Asn Ala Ser Val Ser Ala Phe Gln

35 40 45

Arg Arg Phe Val Val Asp Val Arg Arg Cys Glu Glu Leu Glu Lys Thr

50 55 60

Phe Thr Phe Leu Gln Glu Glu Val Arg Arg Ala Gly Leu Val Leu Pro

65 70 75 80

Pro Pro Lys Gly Arg Leu Pro Ala Pro Pro Pro Arg Asp Leu Leu Arg

85 90 95

Ile Gln Glu Glu Thr Glu Arg Leu Ala Gln Glu Leu Arg Asp Val Arg

100 105 110

Gly Asn Gln Gln Ala Leu Arg Ala Gln Leu His Gln Leu Gln Leu His

115 120 125

Ala Ala Val Leu Arg Gln Gly His Glu Pro Gln Leu Ala Ala Ala His

130 135 140

Thr Asp Gly Ala Ser Glu Arg Thr Pro Leu Leu Gln Ala Pro Gly Gly

145 150 155 160

Pro His Gln Asp Leu Arg Val Asn Phe Val Ala Gly Ala Val Glu Pro

165 170 175

His Lys Ala Pro Ala Leu Glu Arg Leu Leu Trp Arg Ala Cys Arg Gly

180 185 190

Phe Leu Ile Ala Ser Phe Arg Glu Leu Glu Gln Pro Leu Glu His Pro

195 200 205

Val Thr Gly Glu Pro Ala Thr Trp Met Thr Phe Leu Ile Ser Tyr Trp

210 215 220

Gly Glu Gln Ile Gly Gln Lys Ile Arg Lys Ile Thr Asp Cys Phe His

225 230 235 240

Cys His Val Phe Pro Phe Leu Gln Gln Glu Glu Ala Arg Leu Gly Ala

245 250 255

Leu Gln Gln Leu Gln Gln Gln Ser Gln Glu Leu Gln Glu Val Leu Gly

260 265 270

Glu Thr Glu Arg Phe Leu Ser Gln Val Leu Gly Arg Val Leu Gln Leu

275 280 285

Leu Pro Pro Gly Gln Val Gln Val His Lys Met Lys Ala Val Tyr Leu

290 295 300

Ala Leu Asn Gln Cys Ser Val Ser Thr Thr His Lys Cys Leu Ile Ala

305 310 315 320

Glu Ala Trp Cys Ser Val Arg Asp Leu Pro Ala Leu Gln Glu Ala Leu

325 330 335

Arg Asp Ser Ser Met Glu Glu Gly Val Ser Ala Val Ala His Arg Ile

340 345 350

Pro Cys Arg Asp Met Pro Pro Thr Leu Ile Arg Thr Asn Arg Phe Thr

355 360 365

Ala Ser Phe Gln Gly Ile Val Asp Ala Tyr Gly Val Gly Arg Tyr Gln

370 375 380

Glu Val Asn Pro Ala Pro Tyr Thr Ile Ile Thr Phe Pro Phe Leu Phe

385 390 395 400

Ala Val Met Phe Gly Asp Val Gly His Gly Leu Leu Met Phe Leu Phe

405 410 415

Ala Leu Ala Met Val Leu Ala Glu Asn Arg Pro Ala Val Lys Ala Ala

420 425 430

Gln Asn Glu Ile Trp Gln Thr Phe Phe Arg Gly Arg Tyr Leu Leu Leu

435 440 445

Leu Met Gly Leu Phe Ser Ile Tyr Thr Gly Phe Ile Tyr Asn Glu Cys

450 455 460

Phe Ser Arg Ala Thr Ser Ile Phe Pro Ser Gly Trp Ser Val Ala Ala

465 470 475 480

Met Ala Asn Gln Ser Gly Trp Ser Asp Ala Phe Leu Ala Gln His Thr

485 490 495

Met Leu Thr Leu Asp Pro Asn Val Thr Gly Val Phe Leu Gly Pro Tyr

500 505 510

Pro Phe Gly Ile Asp Pro Ile Trp Ser Leu Ala Ala Asn His Leu Ser

515 520 525

Phe Leu Asn Ser Phe Lys Met Lys Met Ser Val Ile Leu Gly Val Val

530 535 540

His Met Ala Phe Gly Val Val Leu Gly Val Phe Asn His Val His Phe

545 550 555 560

Gly Gln Arg His Arg Leu Leu Leu Glu Thr Leu Pro Glu Leu Thr Phe

565 570 575

Leu Leu Gly Leu Phe Gly Tyr Leu Val Phe Leu Val Ile Tyr Lys Trp

580 585 590

Leu Cys Val Trp Ala Ala Arg Ala Ala Ser Ala Pro Ser Ile Leu Ile

595 600 605

His Phe Ile Asn Met Phe Leu Phe Ser His Ser Pro Ser Asn Arg Leu

610 615 620

Leu Tyr Pro Arg Gln Glu Val Val Gln Ala Thr Leu Val Val Leu Ala

625 630 635 640

Leu Ala Met Val Pro Ile Leu Leu Leu Gly Thr Pro Leu His Leu Leu

645 650 655

His Arg His Arg Arg Arg Leu Arg Arg Arg Pro Ala Asp Arg Gln Glu

660 665 670

Glu Asn Lys Ala Gly Leu Leu Asp Leu Pro Asp Ala Ser Val Asn Gly

675 680 685

Trp Ser Ser Asp Glu Glu Lys Ala Gly Gly Leu Asp Asp Glu Glu Glu

690 695 700

Ala Glu Leu Val Pro Ser Glu Val Leu Met His Gln Ala Ile His Thr

705 710 715 720

Ile Glu Phe Cys Leu Gly Cys Val Ser Asn Thr Ala Ser Tyr Leu Arg

725 730 735

Leu Trp Ala Leu Ser Leu Ala His Ala Gln Leu Ser Glu Val Leu Trp

740 745 750

Ala Met Val Met Arg Ile Gly Leu Gly Leu Gly Arg Glu Val Gly Val

755 760 765

Ala Ala Val Val Leu Val Pro Ile Phe Ala Ala Phe Ala Val Met Thr

770 775 780

Val Ala Ile Leu Leu Val Met Glu Gly Leu Ser Ala Phe Leu His Ala

785 790 795 800

Leu Arg Leu His Trp Val Glu Phe Gln Asn Lys Phe Tyr Ser Gly Thr

805 810 815

Gly Tyr Lys Leu Ser Pro Phe Thr Phe Ala Ala Thr Asp Asp

820 825 830

<---

Claims (69)

1. A method for genetic modification of hematopoietic cells, including: (a) provision of hematopoietic cells; (b) contacting said hematopoietic cells with poloxamer; (c) contacting said hematopoietic cells with prostaglandin E2 (PGE2) or a derivative thereof; (d) contacting said hematopoietic cells with a fragment of recombinant fibronectin; and (e) contacting said hematopoietic cells with a recombinant retroviral vector. 2. The method according to claim 1, wherein the recombinant retroviral vector is a recombinant lentiviral vector. 3. The method according to claim 1, wherein the hematopoietic cells have been manipulated. 4. The method according to claim 3, wherein the hematopoietic cells are CD34-enriched cells. 5. The method according to claim 1, wherein the poloxamer is selected from the group consisting of poloxamer 288, poloxamer 335, poloxamer 338 and poloxamer 407. 6. The method of claim 5, wherein the poloxamer is poloxamer 338. 7. The method according to claim 1, wherein PGE2 or its derivative is modified. 8. The method of claim 7, wherein PGE2 or a derivative thereof is 16,16-dimethyl-PGE2 (dmPGE2). 9. The method according to claim 1, wherein PGE2 or its derivative is not modified. 10. The method of any one of the preceding claims, wherein the recombinant fibronectin fragment is RetroNectin™. 11. The method according to claim 1, wherein the stages of bringing into contact are carried out at the same time, or the time of their implementation partially coincides. 12. The method according to any one of claims 1-11, wherein the concentration of PGE2 or its derivative is 5-30 μg/ml. 13. The method of claim 12, wherein the concentration of PGE2 or its derivative is approximately 10 μg/ml. 14. The method according to any one of claims 1-13, wherein the concentration of poloxamer is 200-1200 μg/ml. 15. The method of claim 14, wherein the concentration of poloxamer is approximately 1000 μg/mL. 16. The method according to any one of claims 10-15, wherein the concentration of protamine sulfate is 4-10 μg/ml. 17. The method of claim 16, wherein the concentration of protamine sulfate is approximately 4 μg/mL. 18. A method for enhancing recombinant retroviral vector-mediated genetic modification of hematopoietic cells, comprising: (a) contacting hematopoietic cells ex vivo with an effective amount of PGE2 or a derivative thereof, an effective amount of poloxamer, and an effective amount of a recombinant fibronectin fragment; and (b) contacting said hematopoietic cells with a recombinant retroviral vector containing a polynucleotide containing a gene of interest or encoding a polypeptide of interest, wherein the efficiency of viral transduction of said recombinant retroviral vector is increased compared to transduction of hematopoietic cells by said recombinant retroviral vector in the absence of said PGE2 or its derivative, said poloxamer and a fragment of recombinant fibronectin. 19. The method of claim 18, further comprising contacting the hematopoietic cells ex vivo with an effective amount of protamine sulfate. 20. The method of claim 18, wherein the gene of interest compensates for a defect in a gene associated with a monogenic genetic disease or disorder. 21. The method according to claim 19, wherein the gene of interest or polypeptide of interest is selected from the group consisting of RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A and OSTM1. 22. The method of claim 18, wherein the method prevents or alleviates a monogenic genetic disease or disorder. 23. The method of claim 22, wherein the monogenetic disease or disorder is selected from the group consisting of Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency, and infantile malignant osteoporosis. 24. The method of claim 18, wherein the hematopoietic cells are CD34-enriched cells, optionally hematopoietic cells, bone marrow (BM)-derived cells, cord blood (CB)-derived cells, or mobilized peripheral blood (mPB) cells. 25. A method for recombinant retroviral vector-mediated genetic modification of hematopoietic cells, comprising: (a) obtaining CD34-enriched cells from a biological sample obtained from a subject treated with G-CSF (granulocyte colony-stimulating factor) or its analogue and/or plerixafor; and (b) genetic modification of said CD34-enriched cells with a recombinant retroviral vector containing a polynucleotide encoding the Fanconi anemia complementation group (FANC) gene, ITGB2, pyruvate kinase type R, OSTM1, TCIRG1, or a gene encoding a functional variant or fragment thereof, and a sequence of a promoter active in eukaryotic cells functionally linked thereto; wherein the genetic modification step comprises contacting said CD34-enriched cells with said recombinant retroviral vector, PGE2, poloxamer, and recombinant fibronectin polypeptide or variant thereof. 26. The method according to claim 25, wherein the biological sample is peripheral blood. 27. The method according to claim 25 or 26, wherein the G-CSF analogue is filgrastim, sargramostim or pegfilgrastim. 28. The method according to any one of claims 25-27, wherein the CD34-enriched cells are selected from the group consisting of hematopoietic cells, bone marrow (BM)-derived cells, cord blood (CB)-derived cells or mobilized peripheral blood (mPB) cells. 29. A method for transducing a hematopoietic cell with a lentiviral vector, comprising culturing said cell in a liquid medium containing the lentiviral vector, wherein said liquid medium contains a poloxamer, prostaglandin E2 (PGE2) or a derivative thereof, and a fragment of recombinant fibronectin. 30. The method according to claim 29, wherein the liquid medium contains protamine sulfate. 31. A method for transducing a hematopoietic cell with a lentiviral vector, comprising: (a) providing a lentiviral vector in a solution containing a poloxamer, prostaglandin E2 (PGE2) or a derivative thereof, and a fragment of recombinant fibronectin; (b) providing hematopoietic cells in a liquid culture medium; and (c) adding said solution to said liquid culture medium. 32. The method according to claim 31, wherein the liquid medium contains protamine sulfate. 33. The method according to any one of claims 25-32, wherein the lentiviral vector is a recombinant lentiviral vector. 34. The method according to any one of claims 25-33, wherein the hematopoietic cells have been manipulated. 35. The method according to any one of claims 25-34, wherein the hematopoietic cells are CD34-enriched cells. 36. The method according to any one of claims 25-35, wherein the poloxamer is selected from the group consisting of poloxamer 288, poloxamer 335, poloxamer 338 and poloxamer 407. 37. The method according to any one of claims 25-35, wherein the poloxamer is poloxamer 338. 38. The method according to any one of claims 25-37, wherein PGE2 or its derivative is modified. 39. The method according to any one of claims 25-38, wherein PGE2 or a derivative thereof is 16,16-dimethyl-PGE2 (dmPGE2). 40. The method according to any one of claims 25-39, wherein PGE2 or its derivative is not modified. 41. The method according to any one of claims 25-40, wherein the concentration of PGE2 or its derivative is 5-30 μg/ml. 42. The method according to any one of claims 25-41, wherein the concentration of PGE2 or a derivative thereof is approximately 10 μg/ml. 43. The method according to any one of claims 25-42, wherein the concentration of poloxamer is 200-1200 μg/ml. 44. The method according to any one of claims 25-43, wherein the concentration of poloxamer is approximately 1000 mcg/mL. 45. The method according to any one of claims 25-44, wherein the concentration of protamine sulfate is 4-10 μg/ml. 46. The method according to any one of claims 25-45, wherein the concentration of protamine sulfate is approximately 4 μg/mL. 47. The method according to any one of claims 25-46, wherein the lentiviral vector comprises a sequence encoding a polypeptide of interest selected from the group consisting of RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A and OSTM1. 48. The method according to any one of claims 25-47, wherein the hematopoietic cells are hematopoietic cells, cells derived from bone marrow (BM), cells derived from cord blood (CB) or mobilized peripheral blood (mPB) cells. 49. A population of CD34-enriched hematopoietic cells for use in the treatment of a monogenic genetic disease or disorder selected from the group consisting of Fanconi anemia, leukocyte adhesion deficiency type I, pyruvate kinase deficiency and infantile malignant osteoporosis, comprising at least 80% genetically modified hematopoietic cells, wherein said population of cells was obtained by the method of any one of claims 29 to 32 and wherein the genetically modified cells comprise a sequence encoding RPK, ITGB2, FANCA, FANCC, FANCG, TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A or OSTM1, wherein the sequence fills a defect in a gene associated with a single-gene genetic disease or disorder. 50. The CD34-enriched hematopoietic cell population of claim 49, wherein the hematopoietic cells comprise bone marrow (BM)-derived cells, cord blood (CB)-derived cells, or mobilized peripheral blood (mPB) cells. 51. A population of CD34-enriched hematopoietic cells according to claim 49 or 50 for use in the treatment of pyruvate kinase deficiency, wherein the genetically modified hematopoietic cells comprise a sequence encoding RPK. 52. A population of CD34-enriched hematopoietic cells according to claim 49 or 50 for use in the treatment of leukocyte adhesion deficiency type I, wherein the genetically modified hematopoietic cells comprise a sequence encoding ITGB2. 53. A population of CD34-enriched hematopoietic cells according to claim 49 or 50 for use in the treatment of Fanconi anemia, wherein the genetically modified hematopoietic cells comprise a sequence encoding FANCA, FANCC or FANCG. 54. A population of CD34-enriched hematopoietic cells according to claim 49 or 50 for use in the treatment of infantile malignant osteoporosis, wherein the genetically modified hematopoietic cells comprise a sequence encoding TCIRG1, CLCN7, TNFSF11, PLEKHM1, TNFRSF11A or OSTM1.