RU2820481C2 - Biomarkers and applications in treating viral infections, inflammations or cancer - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is the use of a variant of HIV splicing with SEQ ID NO 1 as a biomarker of HIV infection or the effectiveness of therapeutic treatment of HIV infection, as a biomarker for assessing the biological effect of a compound in treating HIV infection or a biomarker for screening a compound or a vaccine in preventing and/or treating HIV infection. Described is a corresponding method of treating HIV infection, which uses a variant of HIV splicing with SEQ ID NO 1 as a biomarker of HIV infection or therapeutic effectiveness.

EFFECT: obefazimod ABX464 alters viral RNA splicing, but not cellular splicing, and induces splicing of long non-coding RNA in locus miR-124, which leads to intensified regulation of anti-inflammatory miR124.

19 cl, 9 dwg, 9 tbl

Description

Prior Art

[001] The quinoline derivative, 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine (also known as "ABX464") binds to the cap binding complex (CBC), a complex at the 5' end pre-mRNA transcript that facilitates initial interaction with transcription and processing machinery. CBC recruits several factors to m7G-modified transcripts to mediate processing events and is required for efficient splicing of cellular and viral pre-mRNA. Interaction of CBC with U1 snRNP at the 5' splice site of the first intron in the transcript and direct interaction of CBC with proteins in U4/U5/U6 particles enhances the formation of spliced mRNAs. Although CBC is not essential for the viability of yeast or humans, its deletion results in decreased recruitment of several splicing factors to the nascent transcript, resulting in inhibition of co-transcriptional spliceosome assembly. The CBC complex has also been shown to influence microRNA (miRNA) biogenesis. miRNAs are transcribed by RNA polymerase II as primary (pri)-microRNAs (pri-miRNAs), which carry an m7G cap. During nuclear and cytoplasmic processing events, the pri-miRNA loses the m7G cap, and the mature miRNA, 21–23 nucleotides long, is incorporated into the RNA-induced silencing complex (RNA-induced silencing complex) to control RNA silencing. Since most miRNA genes are located in introns, the CBC complex may participate in the interaction between the processing of intronic pre-miRNAs and pre-mRNAs, inhibiting viral replication by influencing the biogenesis of viral RNA, but its effect on the biogenesis of cellular and viral RNAs has not been analyzed in detail. ABX464 will act on viral replication only after proviral DNA has been integrated into cellular DNA. This is important because the viral genome, once integrated into infected cells, requires both activation and inhibition of precursor mRNA splicing. Successful infection and production of new infectious particles by HIV (human immunodeficiency virus) requires the balanced expression of seven viral proteins (Rev, Tat, Nef, Vif, Vpr, Vpu and Env), which are produced by splicing of the primary 9 kilobase (kb) HIV transcript. 1; among them, the Tat and Rev factors are important for the expression of viral genes at transcriptional and post-transcriptional levels in infected cells. The primary HIV-1 transcript serves not only as genomic RNA for the progeny virus, but also as mRNA encoding the viral Gag and Gag-Pol proteins. While most cellular unspliced RNAs remain in the nucleus where they are degraded, nuclear export of unspliced viral RNAs is facilitated by the Rev protein through binding to the Rev response element (RRE) and interaction with the CRM1-dependent export machinery. Therefore, inefficient alternative splicing is required to maintain the balance between HIV gene expression and virus production. This balance is thought to be mediated by the HIV long terminal repeat (LTR) and the presence of suboptimal viral 5' and 3' splice sites (5' and 3' ss), which are positively regulated by regulatory sequences and their recognition by cognate trans-acting cellular factors. By binding to the CBC complex, ABX464 has been shown to interfere with Rev-mediated export of unspliced RNA. However, the underlying mechanisms underlying the modulation of viral and cellular splicing and/or miRNA biogenesis by ABX464 binding to CBC are currently unknown.

[002] ABX464 demonstrated potent anti-inflammatory effects in the DSS model of inflammatory bowel disease (IBD) and an effect in preventing HIV virus replication. ABX464 also demonstrated safety and efficacy in a proof-of-concept Phase 2a clinical trial in patients with ulcerative colitis. However, the effect of ABX464 on viral and cellular RNA biogenesis has not been quantified.

The essence of the invention

[003] ABX464 has now been found to alter viral RNA splicing, but not cellular splicing, and induces long non-coding RNA splicing at the miR-124 locus, leading to up-regulation of the anti-inflammatory miR124. By "miR-124 locus" is meant any of the miR-124 loci, which includes the miR-124-1 locus, the miR-124-2 locus, the miR-124-3 locus. Therefore, the methods and applications involving miR-124 or one of its loci as a biomarker that are disclosed herein can also or additionally be applied to any of the specific loci known to those skilled in the art.

[004] Accordingly, in one aspect, the present invention provides the in vitro or ex vivo use of a viral RNA splice variant as a biomarker of a viral infection or the effectiveness of a therapeutic treatment of said viral infection. In some embodiments, the present invention provides a method of using a viral RNA splice variant as a biomarker of a viral infection or the effectiveness of a therapeutic treatment for said viral infection, which includes measuring the presence or expression level of the viral RNA splice variant in a biological sample. In some embodiments, treatment of a viral infection includes administration of a compound or a pharmaceutically acceptable salt thereof, as described herein.

[005] In another aspect, the present invention provides in vitro or ex vivo use of a spliced long non-coding RNA at the miR-124 locus as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment for said inflammatory disease, disorder or condition or said cancer. In some embodiments, the present invention provides a method of using a spliced long non-coding RNA at the miR-124 locus as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment for said inflammatory disease, disorder or condition or said cancer, which includes measuring the presence or level of expression of spliced long non-coding RNA at the miR-124 locus in a biological sample. In some embodiments, treatment of an inflammatory disease, disorder or condition or cancer comprises administering a compound or a pharmaceutically acceptable salt thereof, as described herein.

[006] In one aspect, the invention relates to the in vitro or ex vivo use of an HIV splice variant with SEQ. ID. NO. 1 as a biomarker of HIV infection or the effectiveness of therapeutic treatment for HIV infection.

[007] In one aspect, the invention relates to the in vitro or ex vivo use of an HIV splice variant with SEQ. ID. NO. 1 as a biomarker to evaluate the biological effect of a compound in the treatment of HIV infection.

[008] In one aspect, the invention relates to the in vitro or ex vivo use of an HIV splice variant with a SEQ. ID. NO. 1 as a biomarker for screening a compound or vaccine for the prevention and/or treatment of HIV infection.

[009] In one aspect, the invention relates to the in vitro or ex vivo use of lncRNA splice variant (lncRNA) 0599-205 at the miR-124-1 locus as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition or cancer.

[0010] In one aspect, the invention relates to the in vitro or ex vivo use of the lncRNA splice variant 0599-205 at the miR-124-1 locus as a biomarker for assessing the biological effect of a compound or medical device in the treatment of an inflammatory disease, disorder or condition, or cancer.

[0011] In one aspect, the invention relates to the in vitro or ex vivo use of lncRNA splice variant 0599-205 at the miR-124-1 locus as a biomarker for patient selection for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer.

[0012] In one aspect, the invention relates to the in vitro or ex vivo use of miR-124 as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment.

[0013] In one aspect, the invention relates to the in vitro or ex vivo use of miR-124 as a biomarker for selecting a patient for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer.

[0014] In one aspect of in vitro or ex vivo applications, as defined above, the therapeutic treatment includes administration of a compound of formula I, Ia, Ib, Ib', Ic, Id, or IV, IVa, IVb, IVb', IVc, IVd, IV; such as ABX464, or a pharmaceutically acceptable salt thereof.

[0015] In one aspect of in vitro or ex vivo applications, as defined above, the compound has formula I, Ia, Ib, Ib', Ic, Id or IV, IVa, IVb, IVb', IVc, IV; such as ABX464, or a pharmaceutically acceptable salt thereof.

[0016] In one aspect of in vitro or ex vivo applications, as defined above, the measured level of expression of the specified HIV splice variant of SEQ. ID. NO. 1, or the specified lncRNA splicing variant 0599-205 in the miR-124-1 locus, or the specified miR-124 in the isolated biological sample is compared with the control reference value.

Brief description of drawings

[0017] Figure 1 shows HIV splicing analysis following treatment with ABX464. A. Organization of the HIV-1 genome and various mRNA splice products. Labeled 5'cc (D1-D4) and 3'cc (A1-A7). The ORFs (open reading frame) of the coding exons of each mRNA product are designated by a different color code representing the corresponding encoded proteins of the HIV genome. Non-coding exons are highlighted in gray. B. Inhibition of HIV-1 replication measured by p24 production in PBMC (peripheral blood mononuclear cell) from six donors. C. Quantification of HIV splicing events using CaptureSeq RNA in PBMCs from six different donors that were infected and untreated (DMSO) or treated with ABX464 for 6 days ( 464 ). The number of spliced and unspliced contigs is shown. The various splice products are colored as in A. D. Sequence of the new viral RNA resulting from splicing.

[0018] Figure 2 shows that ABX464 does not have a global effect on cellular splicing. A. The effect of ABX464 on infected and uninfected CD4+ T cells was tested using a high-throughput RNA sequencing approach. Sixteen libraries were constructed using 4 conditions: uninfected (DMSO_NI), uninfected, ABX464-treated (ABX464_NI), infected (DMSO_I), and infected, ABX464-treated (464_I), corresponding to 4 donors. Approximately 38 million reads (more than 50% of the total raw reads) were mapped to exons of the human genome sequence in each sample. B. Multidimensional scaling (MDS) analysis was used to interpret major trends in the data. C. Alternative splicing (AS) events of cellular genes were divided into five main groups (left panel): alternative 5' splice site (A5SS, orange), alternative 3' splice site (A3SS, blue), skipping exon (SE, gray) , mutually exclusive exons (MXE, gray) and a conserved exon (RI, yellow). Number of AS events when comparing infected vs. uninfected samples (DMSO_I vs. DMSO_NI), uninfected vs. uninfected, ABX464-treated (DMSO_NI vs. 464_NI), infected vs. infected, ABX464-treated (DMSO_I vs. 464_I), and after 50% CBC depletion in IPS (CBC IPS depletion by 50%) (right panel). D. By comparing read coverage readings of the common highly expressed gene (B2M) exons under ABX464 and DMSO conditions in 4 donors, we confirmed that ABX464 does not increase the number of splicing events in B2M. E. Volcano chart of DMSO_I vs. DMSO_NI (top panel), DMSO_NI vs. 464_NI (middle panel), DMSO_I vs. 464_I (bottom panel). Gene expression variation induced by ABX464 treatment was very low in infected (6 down-regulated genes) and uninfected (6 down-regulated genes) samples.

[0019] Figure 3 shows that ABX464 activates one microRNA, the anti-inflammatory miR-124. A. Microarray analysis of small RNAs from PBMCs from 6 donors. PBMCs were infected with strain YU-2 (I) or uninfected (NI) and treated with ABX464 or not (DMSO). Volcano plots show that infection leads to large variations in small noncoding RNAs (left panel), whereas ABX464 induces reproducible activation of one microRNA, miR-124, in infected and uninfected cells (right and middle panels, respectively). B. Quantification of miR-124 expression using TaqMan Low Density Array technology in CD4+ T cells under the same conditions as in A. C. miR-124 expression measured by qPCR in PBMC, purified CD4+ and CD8 T cells, and macrophages treated with ABX464 compared to untreated cells (DMSO, fold change). D. Expression of miR-124 in PBMCs treated with antiretrovirals ABX464, ABX530, maraviroc, efavirenz, darunavir, and AZT compared with untreated cells (DMSO, fold change). E. Quantification of miR-124 in rectal biopsies from healthy participants (n = 10) and HIV patients receiving ART (antiretroviral therapy) on days 1 and 28 of treatment with ABX464 (n = 9). Individual graphs show the results for each patient compared to the results for healthy participants.

[0020] Figure 4 shows that activation of miR-124 by ABX464 occurs as a result of splicing of a long non-coding RNA at the miR-124-1 locus. A. There are three genes encoding miR-124, miR-124-1, miR-124-2 and miR-124-3 located on chromosomes (Chr) 8 and 20 in the human genome. B. We used targeted RNA capture and sequencing strategy to determine which gene was induced by ABX464. In both infected and uninfected cells, treatment with ABX464 resulted in activation of miR-124 from the miR.124.1 locus, whereas the control miR-429 locus was unaffected. C. The miR-124-1 locus includes a long non-coding RNA (dnRKN 0599-205), the splicing of which is stimulated by ABX464. D. Read counts at splice junctions (J1, J2, J3 and J4), exon-exon (J5 and J6) and miR-124 75 bp region. (bp - base pairs) (miR-124) quantified by RNA CaptureSeq in ABX464-treated PBMCs.

[0021] Figure 5 shows that splicing of lncRNA 0599-205 is required for the production of miR-124. A. Schematic representation of lncRNA 0599-205 precursor and primers used to amplify various RNA derivatives. B. Quantification of spliced and unspliced lncRNAs 0599-205 in the presence or absence of ABX464. C. Quantification of miR-124 expression following transfection of wild-type (WT) and splice mutant (mut) lncRNA0599-205 plasmids in HeLa cells in the presence or absence of ABX464. D. Quantification of total lncRNA 0599-205 wild type and splicing mutants in the presence or absence of ABX464.

[0022] Figure 6 depicts: A. processing steps and B. RNA sequencing processing protocol.

[0023] Figure 7 shows a representation of the assembled contigs from two untreated samples (D5_DMSO and D8_DMSO) and three ABX464-treated samples (D4_464, D5_464 and D8_464).

[0024] Figure 8 shows FACS analysis using surface markers CD45, CCR7, CCR3 and CCR6 in PBMC (2 donors) and CD4 (4 donors), both untreated (red) and treated with ABX464 (blue).

[0025] Figure 9 shows an analysis of the effect of ABX464 treatment on miRNA expression. A. MicroRNA expression profiles in PBMCs from 6 donors using TaqMan Low Density Array (TLDA). Volcano plots show differential miRNA expression in PBMCs treated versus untreated with ABX464 (left panel) and infected versus uninfected (right panel). B. Comparison of miR-124 expression in macrophages from 6 donors using TaqMan PCR. C. Quantification of miR-124 in biopsies from healthy volunteers (normal tissue), HIV-infected patients receiving ART after 28 days of ABX464 treatment (HIV plus day 1) and 28 days later (HIV plus day 28). D. Quantification of miR-124 in biopsies from HIV patients receiving ART on day 1 (D1) and day 28 (D28) of treatment and 28 days after stopping treatment (D56).

Detailed Description of Certain Embodiments

1. Exemplary embodiments of biomarkers and their applications:

[0026] It has now been discovered that the effect of ABX464 in the treatment of HIV infection and IBD is mediated by the same mechanism, that is, increased pre-mRNA splicing. ABX464 was found to not only enhance pre-mRNA splicing of HIV viral RNA to block HIV replication, but also trigger the splicing of a long non-coding RNA that harbors one of the anti-inflammatory miR-124 loci, thereby increasing the expression of the anti-inflammatory microRNA miR-124. In addition, ABX464 was found to have no effect on pre-mRNA splicing of cellular genes. While ABX464 does not affect pre-mRNA splicing of cellular genes, depletion of the CBC complex by RNAi results in the accumulation of intron-retaining transcripts. These results imply that ABX464 does not suppress CBC splicing function, but rather enhances it under pathological conditions such as inflammation and HIV infection.

Viral infections

[0027] In some embodiments, the present invention provides a method of using a viral RNA splice variant as a biomarker of a viral infection or the effectiveness of a therapeutic treatment for said viral infection, which includes measuring the presence or level of expression of the viral RNA splice variant in a biological sample.

[0028] In some embodiments, the present invention provides a method for assessing the biological effect of a compound in treating a viral infection, which includes measuring the presence or expression level of a viral RNA splice variant as a biomarker of the viral infection.

[0029] In some embodiments, the present invention provides a method for screening a compound or vaccine for the prevention and/or treatment of a viral infection, which includes measuring the presence or expression level of a viral RNA splice variant as a biomarker of the viral infection.

[0030] In some embodiments, the present invention provides a method of treating a viral infection that includes measuring and/or monitoring the presence and/or expression level of a viral RNA splice variant as a biomarker of the viral infection.

[0031] In some embodiments, the viral infection is a viral infection that requires RNA splicing. In some embodiments, the viral infection requiring RNA splicing is a retroviral infection. In some embodiments, the retroviral infection is an infection of oncoviruses, lentiviruses, and/or spumaviruses.

[0032] As used herein, the term “oncoviruses” is associated with cancer and malignant infections. In some embodiments, the oncovirus is selected from leukemogenic viruses (such as avian leukemia virus (ALV), murine leukemia virus (MULV), also called Moloney virus, feline leukemia virus (FELV), human leukemia viruses such as HTLV1 and HTLV2, simian virus leukemia or STLV, bovine leukemia virus or BLV, primate oncoviruses type D, oncoviruses type B, which are inducers of mammary tumors, and oncoviruses that cause rapid cancer development (for example, Rous sarcoma virus or RSV).

[0033] The "spumaviruses" as used herein exhibit rather low specificity for a given cell type or species, and they are sometimes associated with immunosuppressive effects. In some embodiments, the spumavirus is a simian foamy virus (or SFV).

[0034] The “lentiviruses” used herein are responsible for slowly progressive pathological conditions that are very often associated with immunosuppressive phenomena, including AIDS (acquired immune deficiency syndrome).

[0035] In some embodiments, the retroviral infection is a condition associated with HIV and AIDS. In some embodiments, the HIV and AIDS-related condition is an AIDS-related or AIDS-concomitant inflammatory disorder or condition.

[0036] In some embodiments, the presence or expression level of a viral RNA splice variant is measured using RNA and/or DNA amplification, sequencing, isotopes, fluorescence, chromogenic enzymes, spectroscopy, spectrometry, immunoassay, or enzyme-linked immunosorbent assay.

[0037] As described herein, ABX464 was found to generate a novel HIV splice variant in HIV-infected cells (Figure 1D):

GGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAA

GGAAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAG

CGCGCACGGCAAGAGGCGAGGGGGCGGCGACTGGAAGAAGCGGAG

ACAGGCGACGAAGACCTCCTCAGGACAGTCAGACTCATCAAAGTTCTC

TATCAAAGCA (SEQ. ID. NO. 1).

[0038] Accordingly, in some embodiments, the viral RNA splice variant is an HIV splice variant as a biomarker of HIV infection. In some embodiments, the HIV splice variant has a SEQ. ID. NO. 1.

[0039] In some embodiments, the present invention provides a method of using an HIV splice variant with a SEQ. ID. NO. 1 as a biomarker of HIV infection or the effectiveness of therapeutic treatment for HIV infection, which includes measuring the presence or level of expression of an HIV splice variant with SEQ. ID. NO. 1 in a biological sample.

[0040] In some embodiments, the presence of an HIV splice variant with SEQ. ID. NO. 1 in the isolated biological sample indicates the effectiveness of therapeutic treatment of HIV infection.

[0041] In some embodiments, the measured expression level of the HIV splice variant of SEQ. ID. NO. 1 in the isolated biological sample is compared with the measured expression level of the HIV splice variant of SEQ. ID. NO. 1 in a previously isolated biological sample, and wherein the expression level of an HIV splice variant with SEQ is increased. ID. NO. 1 indicates the effectiveness of therapeutic treatment of HIV infection.

[0042] In some embodiments, the present invention provides a method for assessing the biological effect of a compound in treating HIV infection, which includes measuring the presence or level of expression of an HIV splice variant of the SEQ. ID. NO. 1 as a biomarker of HIV infection.

[0043] In some embodiments, the present invention provides a method for screening a compound or vaccine for the prevention and/or treatment of HIV infection, which includes measuring the presence or expression level of an HIV splice variant of the SEQ. ID. NO. 1 as a biomarker of HIV infection.

[0044] In some embodiments, the present invention provides an HIV splice variant comprising SEQ. ID. NO. 1. In some embodiments, the present invention provides a composition comprising an HIV splice variant that includes SEQ. ID. NO. 1. In some embodiments, the present invention provides a biological sample comprising an HIV splice variant that includes SEQ. ID. NO. 1.

[0045] In some embodiments, the present invention provides an HIV splice variant that is an HIV splice variant with SEQ. ID. NO. 1. In some embodiments, the present invention provides a composition comprising an HIV splice variant of SEQ. ID. NO. 1. In some embodiments, the present invention provides a biological sample comprising an HIV splice variant of SEQ. ID. NO. 1.

[0046] In some embodiments, the present invention provides a method of treating HIV infection that includes measuring and/or monitoring the presence and/or expression level of an HIV splice variant with SEQ. ID. NO. 1 in a patient. In some embodiments, the presence and/or level of expression of an HIV splice variant with SEQ. ID. NO. 1 is measured in a biological sample from a patient. In some embodiments, the patient's biological sample is a blood sample. In some embodiments, the patient's biological sample is a tissue sample. In some embodiments, a method of the present invention for treating HIV infection further comprises measuring and/or monitoring the presence and/or expression level of an HIV splice variant of the SEQ. ID. NO. 1 in a patient before administration of the compound or a pharmaceutically acceptable salt or composition thereof as described herein. In some embodiments, a method of the present invention for treating HIV infection further comprises measuring and/or monitoring the presence and/or expression level of an HIV splice variant of the SEQ. ID. NO. 1 in a patient during a course of treatment with a compound, or a pharmaceutically acceptable salt or composition thereof, as described herein. In some embodiments, a method of the present invention for treating HIV infection further comprises selecting a patient for treatment with a compound or a pharmaceutically acceptable salt or composition thereof, as described herein, by measuring and/or monitoring the presence and/or expression level of an HIV splice variant of SEQ . ID. NO. 1 in a patient. In some embodiments, a method of the present invention for treating HIV infection further comprises excluding a patient from treatment with a compound or a pharmaceutically acceptable salt or composition thereof, as described herein, by measuring and/or monitoring the presence and/or level of expression of an HIV splice variant of SEQ . ID. NO. 1 in a patient. In some embodiments, a method of the present invention for treating HIV infection further includes adjusting (e.g., increasing or decreasing) a dosage regimen (e.g., dosage amount and/or dosing schedule) of the compound or a pharmaceutically acceptable salt or composition thereof, as described herein application, for administration to a patient, by measuring and/or monitoring the presence and/or expression level of an HIV splice variant with SEQ. ID. NO. 1 in a patient. In some embodiments, a method of the present invention for treating HIV infection further comprises withholding and/or discontinuing administration of the compound or a pharmaceutically acceptable salt or composition thereof, as described herein, after the presence and/or level of expression of the HIV splice variant has been measured. with SEQ. ID. NO. 1 reaches a level indicating that treatment can be paused and/or discontinued (eg, when the expression level of the HIV splice variant reaches a plateau).

[0047] In some embodiments, a method of the present invention for treating HIV infection includes comparing the measured expression level of an HIV splice variant to a SEQ. ID. NO. 1 in a patient with previously measured expression levels of the HIV splice variant SEQ. ID. NO. 1 in a patient.

[0048] In some embodiments, a method of the present invention for treating HIV infection includes measuring and/or monitoring the presence and/or expression level of an HIV splice variant with SEQ. ID. NO. 1 in a patient to administer dosage or monitor response to treatment.

[0049] In some embodiments, a method of the present invention for treating HIV infection includes measuring and/or monitoring an HIV splice variant of the SEQ. ID. NO. 1 per patient to monitor therapy.

[0050] In some embodiments, the method of the present invention further includes measuring the pre-mRNA splicing of cellular genes in a patient or biological sample, wherein the pre-mRNA splicing of the cellular genes does not change compared to a control sample. The control sample can be taken from various sources. In some embodiments, the control sample is collected from the patient before treatment or before the onset of disease (eg, a historical blood sample or tissue sample). In some embodiments, the control sample is taken from a set of normal, healthy members of the population. In some embodiments, a control sample is collected from a patient prior to treatment with a compound or a pharmaceutically acceptable salt or composition thereof, as described herein. In some embodiments, the cellular assay may be performed on a biological sample.

Inflammatory diseases, disorders and conditions and cancer

[0051] In some embodiments, the present invention provides a method of using the miR-124 locus as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment for said inflammatory disease, disorder or condition or said cancer, which includes measuring the presence or expression level of miRs -124 in a biological sample.

[0052] In some embodiments, the present invention provides a method of assessing the biological effect of a compound or medical device in treating an inflammatory disease, disorder or condition or cancer, which includes measuring the presence or expression level of miR-124 as a biomarker of said inflammatory disease, disorder or condition or the specified cancer.

[0053] In some embodiments, the present invention provides a method of screening a compound or medical device for the treatment of an inflammatory disease, disorder or condition or cancer, which includes measuring the presence or expression level of miR-124 as a biomarker of said inflammatory disease, disorder or condition or said cancer .

[0054] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder or condition or cancer, which includes measuring and/or monitoring the presence and/or expression level of miR-124 as a biomarker of said inflammatory disease, disorder or condition or said cancer .

[0055] In some embodiments, the present invention provides a method of using a spliced long non-coding RNA at the miR-124 locus as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment of said inflammatory disease, disorder or condition or said cancer, which includes measuring the presence or level of expression of spliced long non-coding RNA at the miR-124 locus in a biological sample.

[0056] In some embodiments, the present invention provides a method for assessing the biological effect of a compound or medical device in treating an inflammatory disease, disorder or condition, or cancer, which includes measuring the presence or expression level of a spliced long non-coding RNA at the miR-124 locus as a biomarker of said inflammatory disease, disorder or condition or said cancer.

[0057] In some embodiments, the present invention provides a method of screening a compound or medical device for the treatment of an inflammatory disease, disorder or condition, or cancer, which includes measuring the presence or expression level of a spliced long non-coding RNA at the miR-124 locus as a biomarker of said inflammatory disease, disorder or condition or specified cancer.

[0058] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder or condition, or cancer, which includes measuring and/or monitoring the presence and/or expression level of spliced long non-coding RNA at the miR-124 locus as a biomarker of said inflammatory disease, disorder or condition or specified cancer.

[0059] In some embodiments, the spliced long non-coding RNA at the miR-124 locus is within the miR-124-1 locus. In some embodiments, the spliced long noncoding RNA at the miR-124 locus is within the miR-124-2 locus. In some embodiments, the spliced long non-coding RNA at the miR-124 locus is within the miR-124-3 locus.

[0060] In some embodiments, the presence or expression level of spliced long non-coding RNA at the miR-124 locus is measured using RNA and/or DNA amplification, sequencing, isotopes, fluorescence, chromogenic enzymes, spectroscopy, spectrometry, immunoassay or enzyme-linked immunosorbent assay.

[0061] As described herein, ABX464 was found to induce a long non-coding RNA (lncRNA 0599-205) at the miR-124-1 locus (Figure 4 A and C). The long non-coding RNA, referred to herein and throughout the specification as "lncRNA0599-205" or "LINC00599-205", has its origin in the region of the miR-124-1 locus in the range from position 9903000 to position 9904500 of chromosome 8, including the specified miR-124-1 locus ( Figure 4 A and C); specifically, from position 9903107 to position 9904210. By way of reference, the sequence region including the lncRNA transcript 0599-205 is hereinafter referred to as SEQ. ID. NO. 15. The sequence of three exons corresponding to the lncRNA0599-205 transcript, from 5' to 3', is hereinafter referred to herein as SEQ, respectively. ID. NO. 16 as SEQ. ID. NO. 17 and as SEQ. ID. NO. 18. The transcript sequence of lncRNA 0599-205 is additionally registered in the ENSEMBL database as: ENST00000521863.1.

[0062] Accordingly, in some embodiments, the spliced long non-coding RNA at the miR-124 locus is lncRNA 0599-205 at the miR-124-1 locus as a biomarker for an inflammatory disease, disorder or condition, or cancer.

[0063] In some embodiments, the present invention provides a method of using lncRNA 0599-205 at the miR-124-1 locus as a biomarker of an inflammatory disease, disorder or condition, or cancer, or to determine the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer, which involves measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus in a biological sample.

[0064] In some embodiments, the presence of lncRNA 0599-205 at the miR-124-1 locus in an isolated biological sample indicates the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer.

[0065] In some embodiments, the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in the isolated biological sample is compared with the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in the previously isolated biological sample, and where the increase The expression level of lncRNA 0599-205 at the miR-124-1 locus indicates the effectiveness of therapeutic treatment of an inflammatory disease, disorder or condition or cancer.

[0066] In some embodiments, the present invention provides a method for assessing the biological effect of a compound in treating an inflammatory disease, disorder or condition, or cancer, which includes measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker of the inflammatory disease , disorder or condition or cancer.

[0067] In some embodiments, the present invention provides a method of screening a compound for the treatment of an inflammatory disease, disorder or condition or cancer, which includes measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker of the inflammatory disease, disorder or condition condition or cancer.

[0068] In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises measuring and/or monitoring the presence and/or level of lncRNA 0599-205 at the miR-124-1 locus in a patient. In some embodiments, the presence and/or level of lncRNA 0599-205 at the miR-124-1 locus is measured in a biological sample from the patient. In some embodiments, the patient's biological sample is a blood sample. In some embodiments, the patient's biological sample is a tissue sample. In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises measuring and/or monitoring the presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient before administering the compound or pharmaceutically an acceptable salt or composition as described herein. In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises measuring and/or monitoring the presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient during a course of treatment with the compound or a pharmaceutically acceptable salt or composition thereof as described herein. In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises selecting a patient for treatment with a compound or a pharmaceutically acceptable salt or composition thereof, as described herein, by measuring and/or monitoring the presence and/or level of expression lncRNA 0599-205 in the miR-124-1 locus in the patient. In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises excluding the patient from treatment with the compound or a pharmaceutically acceptable salt or composition thereof, as described herein, by measuring and/or monitoring the presence and/or level of expression lncRNA 0599-205 in the miR-124-1 locus in the patient. In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further includes adjusting (e.g., increasing or decreasing) a dosage regimen (e.g., dosage amount and/or dosing schedule) of the compound or a pharmaceutically acceptable salt or composition thereof , as described herein, for administration to a patient by measuring and/or monitoring the presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.

[0069] In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer comprises comparing the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient with a control reference value. The control reference value that will be used to compare the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient is obtained from the control sample. The control sample can be obtained from various sources. In some embodiments, the control sample is collected from the patient before treatment or before the onset of disease (eg, a historical blood sample or tissue sample). In some embodiments, the control sample is taken from a set of normal, healthy members of the population. In some embodiments, a control sample is collected from a patient prior to treatment with a compound or a pharmaceutically acceptable salt or composition thereof, as described herein. In some embodiments, the cellular assay may be performed on a biological sample.

[0070] In some embodiments, the modulated presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient compared to a control reference value is indicative of an inflammatory disease, disorder or condition, or cancer. In some embodiments, the modulated presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient compared to a control reference value indicates the effectiveness of treatment with a compound or pharmaceutically acceptable salt or composition described herein that is administered to the patient . The terms “modulation” or “modulated presence and/or level of expression” mean the presence or level of expression of a biomarker, for example, lncRNA 0599-205 at the miR-124-1 locus, that is induced or increased, or alternatively, suppressed or decreased.

[0071] In some embodiments, the measured decreased or suppressed presence or decreased expression level of lncRNA 0599-205 at the miR-124-1 locus relative to a control reference value is indicative of an inflammatory disease, disorder or condition, or cancer. In some embodiments, the measured induced or increased presence or increased expression level of lncRNA 0599-205 at the miR-124-1 locus relative to a control reference value indicates the effectiveness of the compound or a pharmaceutically acceptable salt or composition thereof as described herein. In some embodiments, the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient receiving the compound or a pharmaceutically acceptable salt or composition thereof as described herein is a two-fold, fourfold, sixfold, eightfold, or tenfold increase in compared with the control reference value.

[0072] In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition or cancer comprises measuring and/or monitoring the presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient to guide dosage or monitor response to treatment.

[0073] In some embodiments, a method of the present invention for treating an inflammatory disease, disorder or condition, or cancer includes measuring and/or monitoring lncRNA 0599-205 at the miR-124-1 locus in a patient to guide therapy.

[0074] In some embodiments, the present invention provides an algorithm that combines the level of lncRNA 0599-205 at the miR-124-1 locus and the level of a cytokine or other biomarker to monitor the severity of an inflammatory disease, disorder or condition or cancer and/or to monitor the effectiveness of a treatment , including, but not limited to, treatment as described herein. In some embodiments, a method of treatment described herein includes the use of an algorithm that combines the level of lncRNA 0599-205 at the miR-124-1 locus and the level of a cytokine or other biomarker to monitor the severity of an inflammatory disease, disorder or condition or cancer and/or to monitor the effectiveness of treatment.

2. Definitions:

[0075] The compounds of the invention may exist in the form of free bases or addition salts with pharmaceutically acceptable acids. Suitable physiologically acceptable acid addition salts of the compounds of the present invention include sulfate, hydrobromide, citrate, trifluoroacetate, ascorbate, hydrochloride, tartrate, triflate, maleate, mesylate, formate, acetate, fumarate and sulfonate, in particular alkyl sulfonate or arylsulfonate and more preferably mesylate, triflate, edisylate, besylate and tosylate.

[0076] The compounds of the present invention and/or salts thereof may form solvates or hydrates, and the invention includes all such solvates and hydrates. The terms "hydrates" and "solvates" simply mean that the compounds of the invention may be in the form of a hydrate or solvate, that is, combined or associated with one or more molecules of water or solvent. This is only a chemical characterization of such compounds, which applies to all organic compounds of this type.

[0077] The compounds of the present invention may include one or more asymmetric carbon atoms. Thus, they may exist in the form of enantiomers or diastereoisomers. These enantiomers, diastereoisomers and mixtures thereof, including racemic mixtures, are within the scope of the present invention.

[0078] In the context of the present invention, the term:

- “halogen” means chlorine, fluorine, bromine or iodine and preferably means chlorine, fluorine or bromine,

- “(C ₁ -C ₅ )alkyl” as used herein respectively refers to a C ₁ -C ₅ normal, secondary or tertiary saturated hydrocarbon. Examples include, but are not limited to, methyl, ethyl, 1-propyl, 2-propyl, butyl, pentyl,

- “(C ₃ -C ₆ )cycloalkyl” as used in this application appropriately refers to a cyclic saturated hydrocarbon. Examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl,

- “(C ₁ -C ₄ )alkoxy” as used herein respectively refers to an O-(C ₁ -C ₄ )alkyl moiety, where alkyl is as defined above. Examples include, but are not limited to, methoxy, ethoxy, 1-propoxy, 2-propoxy, butoxy,

- “fluoroalkyl group” and “fluoroalkoxy group” refer respectively to an alkyl group and an alkoxy group as defined above, said groups being substituted by at least one fluorine atom. Examples are perfluoroalkyl groups such as trifluoromethyl or perfluoropropyl,

- “saturated 5- or 6-membered heterocycle” in the context of this application respectively refers to a saturated ring containing at least one heteroatom. Examples include, but are not limited to, morpholine, piperazine, thiomorpholine, piperidine, pyrrolidine.

[0079] As used herein, the term "pharmaceutically acceptable salt" refers to those salts which, within reasonable medical judgment, are suitable for use in contact with tissues of humans and lower animals without undue toxicity, irritation, allergic reaction, or the like, and are proportionate reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of the present invention include salts derived from suitable inorganic and organic acids and bases.

[0080] Pharmaceutically acceptable salts of the compounds of the present invention include salts derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are amino salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid. acid, citric acid, succinic acid or malonic acid, or using other methods known in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbat, aspartate, benzophulus, benzoate, bosulfate, borat, butyrate, campfind, campfordfonet, citrate, cyclopentanepropionate, diglukonate, pre -de -sulfate, ethangent, format, fumarat, glucogheptoonate, glitz Rofosphate, Glukanate, Hemysufate, Heptanoate , hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalene sulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate , pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts and the like.

[0081] Salts derived from corresponding bases include alkali metal, alkaline earth metal, ammonium and N ⁺ (C _1-4 alkyl) ₄ salts. Typical alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium and the like. Additional pharmaceutically acceptable salts include, as appropriate, non-toxic ammonium, quaternary ammonium and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and arylsulfonate.

[0082] Unless otherwise indicated, structures depicted herein also include all isomeric (eg, enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, the Z and E double bond isomers, and the Z and E conformational isomers. Therefore, individual stereochemical isomers, as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are included within the scope of the invention. In addition, unless otherwise indicated, the structures depicted herein also include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the structure presented, involving the replacement of hydrogen with deuterium or tritium, or the replacement of carbon with carbon enriched in ¹³ C or ¹⁴ C, are within the scope of the present invention. Such compounds are suitable, for example, as analytical tools, probes in biological assays or as therapeutic agents in accordance with the present invention.

3. Examples of treatment options:

[0083] In one aspect, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (I):

(I)

or a pharmaceutically acceptable salt thereof, wherein:

Z represents C or N;

V represents C or N;

means an aromatic ring where V is C or N, and when V is N, V is in the ortho, meta or para position relative to Z;

each R independently represents hydrogen, halogen, -CN, hydroxyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, (C ₃ -C ₆ )cycloalkyl, -NO ₂ , -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy, phenoxy, - NR ₁ -SO ₂ -NR ₁ R ₂ , -NR ₁ -SO ₂ -R ₁ , -NR ₁ -C(=O)-R ₁ , -NR ₁ -C(=O)-NR ₁ R ₂ , -SO ₂ -NR ₁ R ₂ , -SO ₃ H, -O-SO ₂ -OR ₃ , -OP(=O)-(OR ₃ )(OR ₄ ) , -O-CH ₂ -COOR ₃ , (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group, or a group of formula (IIa):

, or a group of formula (IIIa): ;

Q is N or O, with the proviso that R'' is absent when Q is O;

each of R ₁ and R ₂ independently represents hydrogen or (C ₁ -C ₃ )alkyl;

R ₃ and R ₄ are each independently hydrogen, Li ⁺ , Na ⁺ , K ⁺ , N ⁺ (Ra) ₄ or benzyl;

n is 1, 2 or 3;

n' is 1, 2 or 3;

each R' independently represents hydrogen, (C ₁ -C ₃ )alkyl, hydroxyl, halogen, -NO ₂ , -NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ )alkoxy, -OP(=O)-(OR ₃ )(OR ₄ ), -CN, group of formula (IIa): or a group of formula (IIIa): ;

A represents a covalent bond, oxygen or NH;

B represents a covalent bond or NH;

m is equal to 1, 2, 3, 4 or 5;

p is 1, 2 or 3;

Ra and Rb are each independently hydrogen, (C ₁ -C ₅ )alkyl or (C ₃ -C ₆ )cycloalkyl, or

Ra and Rb together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle, said heterocycle optionally being substituted by one or more Ra, provided that when R' represents a group (IIa) or (IIIa ), n' can be equal to 2 or 3 only if the other groups R' are different from the specified group (IIa) or (IIIa); And

R'' represents hydrogen, (C ₁ -C ₄ )alkyl or a group of formula (IIa) as defined above.

[0084] As generally defined above, Z is C or N.

[0085] In some embodiments, Z is C. In some embodiments, Z is N.

[0086] In some embodiments, Z is selected from those shown in Tables 1-3 below.

[0087] As generally defined above, V is C or N.

[0088] In some embodiments, V is C. In some embodiments, V is N.

[0089] In some embodiments, V is selected from those shown in Tables 1-3 below.

[0090] As generally defined above, means an aromatic ring where V is C or N, and when V is N, V is in the ortho, meta or para position relative to Z.

[0091] In some embodiments means an aromatic ring where V represents C.

[0092] In some embodiments means an aromatic ring wherein V is N and V is in the ortho, meta, or para position with respect to Z. In some embodiments, V is N and V is in the ortho position with respect to Z. In some embodiments, V is N and V is in a meta position relative to Z. In some embodiments, V is N and V is in a para position relative to Z.

[0093] In some embodiments is phenyl. In some embodiments is pyridine. In some embodiments is a pyridazine. In some embodiments is a pyrimidine. In some embodiments is a pyrazine.

[0094] In some embodiments selected from those presented in Tables 1-3 below.

[0095] As generally described above, each R independently represents hydrogen, halogen, -CN, hydroxyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, (C ₃ -C ₆ )cycloalkyl, -NO ₂ , -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy, phenoxy, -NR ₁ -SO ₂ -NR ₁ R ₂ , -NR ₁ -SO ₂ -R ₁ , -NR ₁ -C(= O)-R ₁ , -NR ₁ -C(=O)-NR ₁ R ₂ , -SO ₂ -NR ₁ R ₂ , -SO ₃ H, -O-SO ₂ -OR ₃ , -OP(=O) -(OR ₃ )(OR ₄ ), -O-CH ₂ -COOR ₃ or (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group.

[0096] In some embodiments, R is hydrogen. In some embodiments, R is halogen. In some embodiments, R is -CN. In some embodiments, R is hydroxyl. In some embodiments, R is (C ₁ -C ₃ )fluoroalkyl, wherein said alkyl is optionally mono- or di-substituted with hydroxyl. In some embodiments, R is (C ₁ -C ₃ )fluoroalkoxy. In some embodiments, R is (C ₃ -C ₆ )cycloalkyl. In some embodiments, R is -NO ₂ . In some embodiments, R is -NR ₁ R ₂ . In some embodiments, R is (C ₁ -C ₄ )alkoxy. In some embodiments, R is phenoxy. In some embodiments, R is -NR ₁ -SO ₂ -NR ₁ R ₂ . In some embodiments, R is -NR ₁ -SO ₂ -R ₁ . In some embodiments, R is -NR ₁ -C(=O)-R ₁ . In some embodiments, R is -NR ₁ -C(=O)-NR ₁ R ₂ . In some embodiments, R is -SO ₂ -NR ₁ R ₂ . In some embodiments, R is -SO ₃ H. In some embodiments, R is -O-SO ₂ -OR ₃ . In some embodiments, R is -OP(=O)-(OR ₃ )(OR ₄ ). In some embodiments, R is -O-CH ₂ -COOR ₃ . In some embodiments, R is (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with hydroxyl.

[0097] In some embodiments, each R is independently halogen, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy, or (C ₁ -C ₃ )alkyl.

[0098] In some embodiments, each R is independently hydrogen, methyl, methoxy, trifluoromethyl, trifluoromethoxy, amino, halogen, or -OP(=O)-(OR ₃ )(OR ₄ ). In some embodiments, R is methyl. In some embodiments, R is methoxy. In some embodiments, R is trifluoromethyl. In some embodiments, R is trifluoromethoxy. In some embodiments, R is amino. In some embodiments, R is -OP(=O)-(OR ₃ )(OR ₄ ).

[0099] In some embodiments, each R is independently methyl, methoxy, trifluoromethyl, halogen, trifluoromethoxy, or amine.

[00100] In some embodiments, R is selected from those shown in Tables 1-3 below.

[00101] As generally described above, Q is N or O, with the proviso that R″ is absent when Q is O.

[00102] In some embodiments, Q is N. In some embodiments, Q is O and R″ is absent.

[00103] In some embodiments, Q is selected from those shown in Tables 1-3 below.

[00104] As generally described above, R ₁ and R ₂ are each independently hydrogen or (C ₁ -C ₃ )alkyl.

[00105] In some embodiments, R ₁ is hydrogen. In some embodiments, R ₁ is (C ₁ -C ₃ )alkyl. In some embodiments, R ₂ is hydrogen. In some embodiments, R ₂ is (C ₁ -C ₃ )alkyl.

[00106] In some embodiments, each of R ₁ and R ₂ is independently selected from those shown in Tables 1-3 below.

[00107] As generally described above, R ₃ and R ₄ are each independently hydrogen, Li ⁺ , Na ⁺ , K ⁺ , N ⁺ (Ra) ₄ or benzyl.

[00108] In some embodiments, R ₃ is hydrogen. In some embodiments, R ₃ is Li ⁺ . In some embodiments, R ₃ is Na ⁺ . In some embodiments, R ₃ is K ⁺ . In some embodiments, R ₃ is N ⁺ (Ra) ₄ . In some embodiments, R ₃ is benzyl. In some embodiments, R ₄ is hydrogen. In some embodiments, R ₄ is Li ⁺ . In some embodiments, R ₄ is Na ⁺ . In some embodiments, R ₄ is K ⁺ . In some embodiments, R ₄ is N ⁺ (Ra) ₄ . In some embodiments, R ₄ is benzyl.

[00109] In some embodiments, each of R ₃ and R ₄ is independently selected from those shown in Tables 1-3 below.

[00110] As generally described above, n is 1, 2, or 3.

[00111] In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.

[00112] In some embodiments, n is selected from those shown in Tables 1-3 below.

[00113] As generally described above, n' is 1, 2, or 3.

[00114] In some embodiments, n' is 1 or 2. In some embodiments, n' is 1. In some embodiments, n' is 2. In some embodiments, n' is 3.

[00115] In some embodiments, n' is selected from those shown in Tables 1-3 below.

[00116] As generally described above, each R' is independently hydrogen, (C ₁ -C ₃ )alkyl, hydroxyl, halogen, -NO ₂ , -NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ )alkoxy, -OP(=O)-(OR ₃ )(OR ₄ ), -CN, group of formula (IIa):

or a group of formula (IIIa): .

[00117] In some embodiments, R' is hydrogen. In some embodiments, R' is (C ₁ -C ₃ )alkyl. In some embodiments, R' is hydroxyl. In some embodiments, R' is halogen. In some embodiments, R' is -NO ₂ . In some embodiments, R' is NR ₁ R ₂ . In some embodiments, R' is morpholinyl. In some embodiments, R' is a morpholino. In some embodiments, R' is N-methylpiperazinyl. In some embodiments, R' is (C ₁ -C ₃ )fluoroalkyl. In some embodiments, R' is (C ₁ -C ₄ )alkoxy. In some embodiments, R' is -OP(=O)-(OR ₃ )(OR ₄ ). In some embodiments, R' is -CN. In some embodiments, R' is a group of formula (IIa): . In some embodiments, R' is a group of formula (IIIa): .

[00118] In some embodiments, R' is amino. In some embodiments, R' is methyl. In some embodiments, R' is a group of the formula where A is O or NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ , provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other group R' is different from the specified group.

[00119] In some embodiments, R' is a group of the formula where A is O or NH, m is 2, and X ₁ is O, CH ₂ or N-CH ₃ , provided that when R' is such a group, n' is 1 or 2, and when n' is equal to 2, another group R' is different from the specified group.

[00120] In some embodiments, R' is a group of the formula where A is O or NH, m is 3, and X ₁ is O, CH ₂ or N-CH ₃ , provided that when R' is such a group, n' is 1 or 2, and when n' is equal to 2, another group R' is different from the specified group.

[00121] In some embodiments, each R' is independently hydrogen, halogen, amino, methyl, -OP(=O)-(OR ₃ )(OR ₄ ) or a group of the formula where A is O or NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ , provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other group R' group is different from the specified group.

[00122] In some embodiments, each R' independently represents hydrogen, halogen, methyl, or a group of the formula where A is O or NH, m is 2, and X ₁ is O, CH ₂ or N-CH ₃ , provided that when R' is such a group, n' is 1 or 2, and when n' is equal to 2, another group R' is different from the specified group.

[00123] In some embodiments, each R' is independently halogen, (C ₁ -C ₃ )alkyl, hydroxyl, NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ )alkoxy or group of formulas IIa or IIIa, as described in this application.

[00124] In some embodiments, R' is halogen or methyl.

[00125] In some embodiments, each R' is independently selected from those shown in Tables 1-3 below.

[00126] As generally described above, A represents a covalent bond, oxygen or NH.

[00127] In some embodiments, A is a covalent bond. In some embodiments, A is oxygen. In some embodiments, A is NH.

[00128] In some embodiments, A is selected from those shown in Tables 1-3 below.

[00129] As generally described above, B is a covalent bond or NH.

[00130] In some embodiments, B is a covalent bond. In some embodiments, B is NH.

[00131] In some embodiments, B is selected from those shown in Tables 1-3 below.

[00132] As generally described above, m is 1, 2, 3, 4, or 5.

[00133] In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5.

[00134] In some embodiments, m is selected from those shown in Tables 1-3 below.

[00135] As generally described above, p is 1, 2, or 3.

[00136] In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5.

[00137] In some embodiments, p is selected from those shown in Tables 1-3 below.

[00138] As generally described above, Ra and Rb are each independently hydrogen, (C ₁ -C ₅ )alkyl or (C ₃ -C ₆ )cycloalkyl, or Ra and Rb together with the nitrogen atom to which they are attached , form a saturated 5- or 6-membered heterocycle, wherein said heterocycle is optionally substituted with one or more Ra, with the proviso that when R' represents a group (IIa) or (IIIa), n' may be 2 or 3, only if other groups R' differ from the specified group (IIa) or (IIIa).

[00139] In some embodiments, Ra is hydrogen. In some embodiments, Ra is (C ₁ -C ₅ )alkyl. In some embodiments, Ra is (C ₃ -C ₆ )cycloalkyl. In some embodiments, Rb is hydrogen. In some embodiments, Rb is (C ₁ -C ₅ )alkyl. In some embodiments, Rb is (C ₃ -C ₆ )cycloalkyl.

[00140] In some embodiments, Ra and Rb, together with the nitrogen atom to which they are attached, form a saturated 5- or 6-membered heterocycle, wherein said heterocycle is optionally substituted with one or more Ra, provided that when R' is group of formulas (IIa) or (IIIa), n' can be equal to 2 or 3 only if the other groups R' are different from the specified group of formulas (IIa) or (IIIa). In some embodiments, the saturated 5- or 6-membered heterocycle formed by Ra and Rb together with the nitrogen atom to which they are attached as described above optionally has an additional heteroatom selected from N, O, and S.

[00141] In some embodiments, Ra and Rb, together with the nitrogen atom to which they are attached, form a saturated 5- or 6-membered heterocycle having an additional heteroatom selected from N, O, and S, wherein said heterocycle is replaced by one or more Ra provided that when R' is a group of formulas (IIa) or (IIIa), n' may be 2 or 3 only if the other R' groups are different from said group of formulas (IIa) or (IIIa).

[00142] In some embodiments, Ra and Rb, together with the nitrogen atom to which they are attached, form a saturated 5-membered heterocycle, provided that when R' represents a group of formulas (IIa) or (IIIa), n' may be equal to 2 or 3 only if the other R' groups are different from the specified group of formulas (IIa) or (IIIa).

[00143] In some embodiments, Ra and Rb, together with the nitrogen atom to which they are attached, form a saturated 6-membered heterocycle, provided that when R' represents a group of formulas (IIa) or (IIIa), n' may be equal to 2 or 3 only if the other groups R' differ from the specified group of formulas (IIa) or (IIIa).

[00144] In some embodiments, Ra and Rb, together with the nitrogen atom to which they are attached, form a saturated 5- or 6-membered heterocycle, optionally having an additional heteroatom selected from N, O, and S, which heterocycle is optionally substituted with one or more than Ra with the proviso that when R' represents a group (IIa) or (IIIa), n' can be equal to 2 only if the other group R' is different from the specified group (IIa) or (IIIa).

[00145] In some embodiments, Ra and Rb are each independently selected from those shown in Tables 1-3 below.

[00146] As generally described above, R'' represents hydrogen, (C ₁ -C ₄ )alkyl, or a group of formula (IIa) as defined above.

[00147] In some embodiments, R'' is hydrogen or (C ₁ -C ₄ )alkyl. In some embodiments, R'' is hydrogen. In some embodiments, R'' is (C ₁ -C ₄ )alkyl. In some embodiments, R'' is a group of formula (IIa), as described herein.

[00148] In some embodiments, R'' is a group of the formula where m is 2 or 3 and X ₁ is O, CH ₂ or N-CH ₃ .

[00149] In some embodiments, R'' is selected from those shown in Tables 1-3 below.

[00150] In some embodiments, n is 1; n' is equal to 1 or 2; R'' represents H; R is selected from methyl, methoxy, trifluoromethyl, halogen, trifluoromethoxy and amino; and each R' independently represents a halogen, methyl or group where A is O or NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ with the proviso that when n' is 2, the other group R' is different from the specified group.

[00151] In some embodiments, n is 1; n' is equal to 1; R'' represents H; R is selected from methyl, methoxy, trifluoromethyl, halogen and trifluoromethoxy; and R' represents halogen or methyl.

[00152] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ia):

(Ia)

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', R'', n and n' are independently as defined above and described in the embodiments herein, either individually or in combination.

[00153] In some embodiments, the present invention provides a method of treating a viral infection, inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib):

(Ib)

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', R'', n and n' are independently as defined above and described in the embodiments herein, either individually or in combination.

[00154] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ic):

(Ic)

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', R'', n and n' are independently as defined above and described in the embodiments herein, either individually or in combination.

[00155] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib'):

(Ib')

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', R'' and n are independently as defined above and described in the embodiments herein, either individually or in combination.

[00156] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib) or a pharmaceutically acceptable salt thereof, wherein:

each R independently represents halogen, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy or (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group;

n is 1 or 2;

n' is equal to 1 or 2;

each of R ₁ and R ₂ independently represents hydrogen or (C ₁ -C ₃ )alkyl;

each of R' independently represents halogen, (C ₁ -C ₃ )alkyl, hydroxyl, -NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ ) alkoxy or a group of formulas (IIa) or (IIIa) as described herein;

A represents a covalent bond, oxygen or NH;

B represents a covalent bond or NH;

m is equal to 1, 2, 3, 4 or 5;

p is 1, 2 or 3;

Ra and Rb are each independently hydrogen, (C ₁ -C ₅ )alkyl or (C ₃ -C ₆ )cycloalkyl, or

Ra and Rb, together with the nitrogen atom to which they are attached, form a saturated 5- or 6-membered heterocycle, optionally having an additional heteroatom selected from N, O and S, and said heterocycle is optionally substituted with one or more Ra, provided that when R' represents a group (IIa) or (IIIa), n' can be equal to 2 only if the other group R' is different from the specified group (IIa) or (IIIa); And

R'' represents hydrogen or (C ₁ -C ₄ )alkyl.

[00157] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib) or a pharmaceutically acceptable salt thereof, wherein each R' independently represents hydrogen , halogen, (C ₁ -C ₃ )alkyl or (C ₁ -C ₄ )alkoxy group, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group; R'' represents hydrogen or (C ₁ -C ₄ )alkyl; n is 1 or 2; n' is equal to 1 or 2; when n is 1, R is (C ₁ -C ₃ )fluoroalkoxy, -NR ₁ R ₂ or phenoxy, wherein R ₁ and R ₂ are each independently (C ₁ -C ₃ )alkyl; and when n is 2, one of the two R groups is (C ₁ -C ₃ )fluoroalkoxy, and the other R group is (C ₁ -C ₃ )alkyl.

[00158] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib) or a pharmaceutically acceptable salt thereof, wherein each R is independently (C ₁ -C ₃ )fluoroalkoxy; each R' independently represents hydrogen, halogen, (C ₁ -C ₃ )alkyl or (C ₁ -C ₄ )alkoxy; R'' represents hydrogen or (C ₁ -C ₄ )alkyl; n is 1; and n' is 1 or 2.

[00159] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib') or a pharmaceutically acceptable salt thereof, wherein each R independently represents hydrogen , halogen, (C ₁ -C ₃ )alkyl, -NR ₁ R ₂ , (C ₁ -C ₃ )fluoroalkoxy, -NO ₂ , phenoxy or (C ₁ -C ₄ )alkoxy, wherein said alkyl is optionally mono- or di -substituted with a hydroxyl group; each of R ₁ and R ₂ independently represents hydrogen or (C ₁ -C ₃ )alkyl; R' is hydrogen, halogen, (C ₁ -C ₃ )alkyl or (C ₁ -C ₄ )alkoxy, provided that R' is other than the methyl group at the 4-position of the quinoline group; R'' represents hydrogen or (C ₁ -C ₄ )alkyl; n is 1, 2 or 3; and n' is 1 or 2.

[00160] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Id):

(Id)

or a pharmaceutically acceptable salt thereof, wherein each of R and R' are independently as defined above and described in the embodiments herein, either alone or in combination, and R''' represents hydrogen or the group where A is O or NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ .

[00161] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Id) or a pharmaceutically acceptable salt thereof, wherein R is methyl, methoxy, trifluoromethyl, halogen, trifluoromethoxy or amino; R' represents halogen or methyl, and R''' represents hydrogen or a group where A is O or NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH _3.

[00162] In some embodiments, R''' is hydrogen. In some embodiments, R''' is a group where A is O or NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ . In some embodiments, R''' is a group where A is O, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ . In some embodiments, R''' is a group where A is NH, m is 2 or 3, and X ₁ is O, CH ₂ or N-CH ₃ .

[00163] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of the formula: (“ABX464”) or a pharmaceutically acceptable salt thereof.

[00164] In some embodiments, compound ABX464 or a pharmaceutically acceptable salt thereof is in amorphous form. In some embodiments, compound ABX464 or a pharmaceutically acceptable salt thereof is in crystalline form. In some embodiments, the crystalline form of compound ABX464 or a pharmaceutically acceptable salt thereof has a melting point of 120.5°C (±2°C). In some embodiments, the crystalline form of compound ABX464 or a pharmaceutically acceptable salt thereof exhibits X-ray powder diffraction (XRPD) peaks at angles of 7.3, 14.6, 18.4, and 24.9. In some embodiments, the crystalline form of compound ABX464 or a pharmaceutically acceptable salt thereof exhibits one or more XRPD peaks at angles selected from 18.0, 24.2, 28.3, and 29.5. In some embodiments, the crystalline form of compound ABX464 or a pharmaceutically acceptable salt thereof exhibits one or more XRPD peaks at angles selected from 18.6, 22.3, 23.0, and 23.5.

[00165] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound selected from Table 1:

Table 1 (compounds of formula Ia as defined above)

1 2 3 4 5 6 7 8 9 10 eleven 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 thirty 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94

or a pharmaceutically acceptable salt thereof.

[00166] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound selected from Table 2:

[00167] Table 2 (compounds of formula (Ib) as defined above)

95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164

or a pharmaceutically acceptable salt thereof.

[00168] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound selected from Table 3:

[00169] Table 3 (compounds of formula (I) other than compounds (Ia) and (Ib))

165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183

or a pharmaceutically acceptable salt thereof.

[00170] In some embodiments, the compound described herein is in the form of a salt selected from sulfate, hydrobromide, citrate, trifluoroacetate, ascorbate, hydrochloride, tartrate, triflate, maleate, mesylate, formate, acetate, fumarate, and sulfonate. In some embodiments, a compound described herein is in the form of an alkyl sulfonate or arylsulfonate salt. In some embodiments, the compound described herein is in the form of a salt, such as mesylate, triflate, edisylate, besylate, and tosylate.

[00171] In one aspect, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a metabolite of a compound described herein. In some embodiments, the metabolite of a compound described herein is an N-glucuronide metabolite.

[00172] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IV):

(IV)

or a pharmaceutically acceptable salt thereof, wherein each of the variables V, Z, R, R', n and n' is as defined above and described in the embodiments herein, either individually or in combination.

[00173] In some embodiments, the present invention provides a method of treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVa):

(IVa)

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', n, and n' are independently as defined above and as described in the embodiments herein, either individually or in combination.

[00174] In some embodiments, the present invention provides a method of treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVb):

(IVb)

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', n, and n' are independently as defined above and as described in the embodiments herein, either individually or in combination.

[00175] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVc):

(IVc )

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', n, and n' are independently as defined above and as described in the embodiments herein, either individually or in combination.

[00176] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVb'):

(IVb')

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R' and n are independently as defined above and as described in the embodiments herein, either individually or in combination.

[00177] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVd):

(IVd)

or a pharmaceutically acceptable salt thereof, wherein each of the variables R, R', R''' is independently as defined above and as described in the embodiments herein, either individually or in combination.

[00178] In some embodiments, the present invention provides a method of treating a viral infection or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of the formula:

or a pharmaceutically acceptable salt thereof.

[00179] In some embodiments, the method of the present invention includes measuring the level of a compound or a pharmaceutically acceptable salt thereof, as described herein, or a metabolite thereof in a patient. In some embodiments, the level of a compound or a pharmaceutically acceptable salt thereof, as described herein, or a metabolite thereof is measured in a biological sample from a patient. In some embodiments, the patient's biological sample is a blood, plasma, and/or serum sample. In some embodiments, the method of the present invention includes measuring the level of a compound of formula (I), (Ia), (Ib), (Ib'), (Ic) and (Id) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the level of a compound of formulas (IV), (IVa), (IVb), (IVb'), (IVc) and (IVd) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (I) and (IV) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (I) and (IV) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (Ia) and (IVa) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (Ib) and (IVb) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (Ib') and (IVb') or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (Ic) and (IVc) or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention includes measuring the total level of compounds of formulas (Id) and (IVd) or pharmaceutically acceptable salts thereof in a patient.

4. Application, compositions and administration

Pharmaceutically acceptable compositions

[00180] According to another embodiment, the invention provides a composition comprising a compound of the present invention or a pharmaceutically acceptable derivative thereof and a pharmaceutically acceptable carrier, excipient or excipient. In some embodiments, the composition of the present invention is formulated for administration to a patient in need of such a composition. In some embodiments, the composition of the present invention is formulated for oral administration to a patient.

[00181] As used herein, the term “patient” means an animal, preferably a mammal, and most preferably a human.

[00182] The term "pharmaceutically acceptable carrier, excipient or excipient" refers to a non-toxic carrier, excipient or excipient that does not interfere with the pharmacological activity of the compound with which it is formulated. Pharmaceutically acceptable carriers, excipients or excipients that can be used in the compositions of the present invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffers such as phosphates, glycine, sorbic acid, potassium sorbate, mixtures of partial glycerides of saturated fatty acids of vegetable origin, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silicon dioxide, magnesium trisilicate, polyvinylpyrrolidone, substances based on celluloses, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene block polymers, polyethylene glycol and wool fat.

[00183] “Pharmaceutically acceptable derivative” means any non-toxic salt, ester, ester salt or other derivative of a compound of the present invention which, when administered to a recipient, is capable of directly or indirectly providing a compound of this invention or an active metabolite or residue thereof.

[00184] A “biological sample” suitable for the present invention may be a biological fluid such as blood, plasma or serum, saliva, interstitial fluid or a urine sample; a cell sample, such as a cell culture, cell line, or PBMC sample, a tissue biopsy, such as oral tissue, gastrointestinal tissue, skin, an oral mucosal sample, or a variety of clinical trial samples. A biological sample may be crude or may be purified to varying degrees of purity before storage, processing, or measurement. In some embodiments, the biological sample is selected from the group consisting of a biological tissue sample, a whole blood sample, a smear sample, a plasma sample, a serum sample, a saliva sample, a vaginal fluid sample, a semen sample, a laryngopharyngeal fluid sample, a bronchial fluid sample, a sample fecal fluid, cerebrospinal fluid sample, tear fluid sample, and tissue culture supernatant sample.

[00185] The compositions of the present invention can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or through an implanted reservoir. As used herein, the term “parenteral” includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion routes. Preferably, the compositions are administered orally, intraperitoneally or intravenously. Sterile injectable forms of the compositions of the present invention may be an aqueous or oily suspension. These suspensions can be formulated according to techniques known in the art, using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, a solution in 1,3-butanediol. Acceptable vehicles and solvents that may be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are commonly used as a solvent or suspending medium.

[00186] Any soft, fixed oil can be used for this purpose, including synthetic mono- or diglycerides. Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injections, as are natural pharmaceutically acceptable oils such as olive oil or castor oil, especially in their polyoxyethylene versions. These oily solutions or suspensions may also include a long chain alcohol diluent or dispersant, such as carboxymethylcellulose or similar dispersing agents, which are commonly used in the formulation of pharmaceutically acceptable dosage forms, including emulsions and suspensions. Other commonly used surfactants such as Tweens, Spans, and other emulsifying agents or bioavailability enhancers that are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for formulation purposes.

[00187] The pharmaceutically acceptable compositions of the present invention can be administered orally in any orally acceptable dosage form, including, but not limited to, capsules, tablets, aqueous suspensions or solutions. For oral tablets, commonly used carriers include lactose and corn starch. Lubricants such as magnesium stearate are also commonly added. For oral administration in capsule form, suitable diluents include lactose and dried corn starch. When aqueous suspensions are required for oral administration, the active ingredient is combined with emulsifying and suspending agents. Certain sweeteners, flavors or colors may also be added if desired.

[00188] Alternatively, pharmaceutically acceptable compositions of the present invention can be administered in the form of suppositories for rectal administration. They can be prepared by mixing the agent with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature and therefore melts in the rectum to release the drug. Such materials include cocoa butter, beeswax and polyethylene glycols.

[00189] Pharmaceutically acceptable compositions of the present invention can also be administered topically, especially when the target of treatment involves areas or organs readily accessible for topical administration, including diseases of the eye, skin, or lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

[00190] Topical administration to the lower intestinal tract may be in the form of rectal suppositories (see above) or suitable enema formulations. Transdermal patches for topical application may also be used.

[00191] For topical use, the pharmaceutically acceptable compositions provided may be formulated as a suitable ointment containing the active ingredient suspended or dissolved in one or more carriers. Carriers for topical administration of the compounds of the present invention include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, a polyoxypropylene compound, emulsifying wax and water. Alternatively, the pharmaceutically acceptable compositions provided may be formulated as a suitable lotion or cream containing the active ingredients suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

[00192] For ophthalmic use, the pharmaceutically acceptable compositions provided may be formulated as micronized suspensions in isotonic, pH-adjusted sterile saline, or preferably as solutions in isotonic, pH-adjusted, sterile saline, or with a preservative such as benzylalkonium chloride, or without it. Alternatively, for ophthalmic applications, the pharmaceutically acceptable compositions may be formulated as an ointment such as petroleum jelly.

[00193] Pharmaceutically acceptable compositions of the present invention can also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the pharmaceutical composition art and can be formulated as solutions in saline using benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons and/or other conventional solubilizing or dispersing agents.

[00194] Most preferably, the pharmaceutically acceptable compositions of the present invention are formulated for oral administration. Such compositions can be administered with or without food. In some embodiments, the pharmaceutically acceptable compositions of the present invention are administered without food. In other embodiments, the pharmaceutically acceptable compositions of the present invention are administered with food.

[00195] The amount of compounds of the present invention that can be combined with carrier materials to form a composition in unit dosage form will vary depending on the recipient being treated and the particular route of administration. Preferably, the compositions provided will be formulated such that a dose of 0.01 to 100 mg/kg body weight/day of inhibitor can be administered to a patient receiving the compositions.

[00196] It should also be understood that the specific dosage and treatment regimen for any particular patient will depend on numerous factors, including the potency of the particular compound used, age, body weight, general health, gender, diet, time of administration, rate of elimination, drug combination funds, the opinion of the attending physician and the severity of the specific disease being treated. The amount of a compound of the present invention in the composition will also depend on the particular compound in the composition.

Use of Compounds and Pharmaceutically Acceptable Compositions

[00197] The compounds and compositions described herein are generally useful for the treatment of a viral infection or an inflammatory disease, disorder or condition, or cancer.

[00198] As used herein, the terms “treating,” “treating,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progression of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after the development of one or more symptoms. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be prescribed to a susceptible individual prior to the onset of symptoms (eg, in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have disappeared, for example to prevent or delay their recurrence.

[00199] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound or composition as described herein.

[00200] The compounds and compositions according to the method of the present invention can be administered using any amount and any route of administration effective for treating or reducing the severity of a disease or disorder, or one or more symptoms thereof, as described herein. The exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, the severity of the disease or condition, the specific agent, its route of administration, etc. The compounds as described herein are preferably formulated as a unit dosage form for ease of administration and consistency of dosage. The expression "unit dosage form" as used herein refers to a physically discrete unit of agent suitable for the patient being treated. However, it should be understood that the general daily use of the compounds and compositions of the present invention will be determined by the attending physician within the bounds of sound medical judgment. The specific effective dose level for any particular patient or organism will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the particular compound used; the specific composition used; the age, body weight, general health, gender and diet of the patient; timing of administration, route of administration, and rate of elimination of the particular compound used; duration of treatment; drugs used in combination or concurrently with the particular compound used, and similar factors well known in the medical field. As used herein, the term “patient” means an animal, preferably a mammal, and most preferably a human.

[00201] Pharmaceutically acceptable compositions of the present invention can be administered to humans and other animals orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (in the form of powders, ointments or drops), buccally, as an oral or nasal spray or the like, depending on the severity of the infection being treated. In some embodiments, the compounds of the invention may be administered orally or parenterally at dosage levels of from about 0.01 mg/kg to about 50 mg/kg, and preferably from about 1 mg/kg to about 25 mg/kg of the subject's body weight per day one or more than once a day to obtain the desired therapeutic effect.

[00202] Oral liquid dosage forms include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, liquid dosage forms may include inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, germ, olive, castor and sesame oils), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycols and sorbitan fatty acid esters and mixtures thereof. In addition to inert diluents, oral compositions may also include excipients such as wetting agents, emulsifying and suspending agents, sweeteners, flavoring agents and flavoring agents.

[00203] Injectable preparations, such as sterile aqueous or oleaginous injectable suspensions, can be formulated according to known prior art techniques using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a non-toxic parenterally acceptable diluent or solvent, for example, a solution in 1,3-butanediol. Acceptable excipients and solvents that may be used include water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile fixed oils can usually be used as a solvent or suspending medium. For this purpose, any soft, fixed oil can be used, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectable drugs.

[00204] Injectable compositions can be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable media prior to use.

[00205] To prolong the effect of the compound of the present invention, it is often desirable to slow down the absorption of the compound when administered subcutaneously or intramuscularly. This can be achieved by using a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of a compound then depends on its rate of dissolution, which in turn can depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered form of the compound is achieved by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are prepared by forming microencapsulated matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of the compound to the polymer and the nature of the particular polymer used, the rate of release of the compound can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Injectable depot formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[00206] Compositions for rectal or vaginal administration are preferably suppositories, which can be prepared by mixing the compounds described herein with suitable non-irritating excipients or carriers, such as cocoa butter, polyethylene glycol or suppository wax, which are solid at ambient temperature, but liquid at body temperature, and therefore melt in the rectum or vaginal cavity and release the active compound.

[00207] Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In such solid dosage forms, the active compound is mixed with at least one inert pharmaceutically acceptable excipient or carrier, such as sodium citrate or dicalcium phosphate, and/or a) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol and silicic acid b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose and acacia, c) humectants such as glycerin, d) disintegrants such as agar-agar, calcium carbonate, potato or tapioca starch , alginic acid, some silicates and sodium carbonate, e) dissolution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay; and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also include buffering agents.

[00208] Solid compositions of this type can also be used as fillers in soft and hard gelatin capsules using excipients such as lactose or milk sugar, as well as high molecular weight polyethylene glycols, etc. Solid dosage forms of tablets, dragees, capsules , pills and granules can be formulated with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical field. They may optionally include opacifying agents, and may also be a composition that releases the active ingredient(s) only or preferentially in a specific part of the intestinal tract, optionally in a delayed manner. Examples of potting compositions that can be used include polymeric materials and waxes. Solid compositions of this type can also be used as fillers in soft and hard gelatin capsules using excipients such as lactose or milk sugar, high molecular weight polyethylene glycols, etc.

[00209] The active compounds may also be in microencapsulated form with one or more excipients as described above. Solid dosage forms of tablets, dragees, capsules, pills and granules can be formulated with coatings and coatings, such as enteric coatings, controlled release coatings, and other coatings well known in the pharmaceutical arts. In such solid dosage forms, the active compound may be mixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also include, as is common in practice, additional substances other than inert diluents, such as tabletting lubricants and other tabletting aids such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also include buffering agents. They may optionally include opacifying agents, and may also be a composition that releases the active ingredient(s) only or preferentially in a specific part of the intestinal tract, optionally in a delayed manner. Examples of potting compositions that can be used include polymeric materials and waxes.

[00210] Dosage forms for topical or transdermal administration of a compound of the present invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches. The active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier and any necessary preservatives or buffers that may be required. An ophthalmic composition, ear drops and eye drops are also included within the scope of the present invention. In addition, the present invention involves the use of transdermal patches, which have the additional advantage of providing controlled delivery of the compound to the body. Such dosage forms can be prepared by dissolving or distributing the compound in a suitable medium. Absorption enhancers can also be used to increase penetration of the compound through the skin. The rate can be controlled either by providing a rate-controlling membrane or by dispersing the compound in a polymer matrix or gel.

Inflammatory diseases, disorders or conditions

[00211] The compounds described herein are useful in the treatment of inflammatory or obstructive airway diseases, resulting, for example, in reducing tissue damage, airway inflammation, bronchial hyperresponsiveness, remodeling or disease progression. In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory or obstructive airway disease, including, but not limited to, asthma of any type or origin, including both hereditary (non-allergic) asthma and acquired (allergic) asthma, mild asthma, asthma moderate, severe asthma, bronchitis asthma, exercise-induced asthma, occupational asthma and asthma caused by bacterial infection. Treatment of asthma should also be understood to mean the treatment of subjects, for example, less than 4 or 5 years of age, with symptoms of wheezing and diagnosed or being diagnosed as "wheezing infants", an established category of patients of serious medical concern, and now often identified as asthmatics at the initial or early stage.

[00212] The compounds described herein are useful in the treatment of heteroimmune diseases. In some embodiments, the inflammatory disease, disorder, or condition is a heteroimmune disease, including, but not limited to, graft-versus-host disease, transplantation, blood transfusion, anaphylaxis, allergy (e.g., allergy to pollen, latex, drugs, food , insect venoms, animal dander, animal dander, dust mites or cockroach feces), type I hypersensitivity, allergic conjunctivitis, allergic rhinitis and atopic dermatitis.

[00213] Evidence of preventive effectiveness of asthma treatment would be a reduction in the frequency or severity of symptomatic attacks, such as acute asthmatic or bronchoconstrictor attacks, improvement in pulmonary function, or increased airway hyperresponsiveness. This may also be indicated by a decreased need for other symptomatic therapy, such as therapy for or intended to limit or stop a symptomatic attack when it occurs, such as anti-inflammatory or bronchodilator agents. A preventive effect on asthma may be evident, particularly in subjects prone to morning dips. "Morning dip" is a recognized asthmatic syndrome, common to a significant percentage of asthmatics and characterized by an asthma attack, for example, between approximately 4 and 6 am, that is, a time that is usually significantly removed from any previously prescribed symptomatic therapy for asthma.

[00214] In some embodiments, the inflammatory disease, disorder, or condition is selected from acute lung injury (ALI), adult acute respiratory distress syndrome (ARDS), chronic obstructive pulmonary, airway, or lung disease (COPD, COAD, or COLD) , including chronic bronchitis or associated dyspnea, emphysema, and exacerbation of airway hyperresponsiveness due to other drug therapy, in particular other inhaled drug therapy. In some embodiments, the inflammatory disease, disorder, or condition is bronchitis, wherein the bronchitis is bronchitis of any type or origin, including, but not limited to, acute, arachidic, catarrhal, lobar, chronic, or phthinoid bronchitis. In some embodiments, the inflammatory disease, disorder, or condition is pneumoconiosis (an inflammatory, usually occupational lung disease, often accompanied by airway obstruction, chronic or acute, and caused by repeated inhalation of dust) of any type or origin, including, for example, alumosis, anthracosis, asbestosis, chalicosis, ptilosis, siderosis, silicosis, tabacosis and byssinosis.

[00215] In some embodiments, the inflammatory disease, disorder, or condition is an eosinophil-related disorder, such as eosinophilia. In some embodiments, the eosinophil-related disorder is an eosinophil-related airway disorder (e.g., involving abnormal eosinophilic infiltration of lung tissue), including hypereosinophilia, as it affects the airways and/or lungs, as well as, for example, associated with eosinophils, airway disorders resulting from or associated with Loeffler's syndrome, eosinophilic pneumonia, parasitic (particularly multicellular) infestation (including tropical eosinophilia), bronchopulmonary aspergillosis, polyarteritis nodosa (including Churg-Strauss syndrome), eosinophilic granuloma and eosinophil-related disorder respiratory tract caused by a reaction to medications.

[00216] The compounds described herein are also useful in the treatment of inflammatory or allergic skin conditions. In some embodiments, the inflammatory or allergic skin condition is selected from psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus erythematosus, systemic lupus erythematosus, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, acne vulgaris and other inflammatory or allergic skin conditions.

[00217] In some embodiments, the inflammatory disease, disorder, or condition is a disease or condition that has an inflammatory component, such as eye diseases and conditions, such as ocular allergies, conjunctivitis, keratoconjunctivitis sicca, uveitis, and vernal conjunctivitis, diseases and conditions affecting nose, including allergic rhinitis, and inflammatory disease that involves autoimmune reactions or has an autoimmune component or etiology, including autoimmune hematological disorders (eg, hemolytic anemia, aplastic anemia, true red cell anemia, and idiopathic thrombocytopenia), systemic lupus erythematosus, rheumatoid arthritis, polychondritis, scleroderma, Wegener's granulomatosis, dermatomyositis, chronic active hepatitis, Steven-Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (eg, ulcerative colitis and Crohn's disease), irritable bowel syndrome, celiac disease, periodontitis, hyaline membrane disease, kidney disease, glomerular disease, alcoholic liver disease, multiple sclerosis, endocrine ophthalmopathy, Graves' disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), Sjögren's syndrome, keratoconjunctivitis sicca, uveitis and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis, systemic juvenile idiopathic arthritis, cryopyrin-associated periodic syndrome, Muckle-Wells syndrome, nephritis, vasculitis, diverticulitis, interstitial cystitis, glomerulonephritis (with and without nephrotic syndrome, including idiopathic nephrotic syndrome or nephropathy with minimal changes) , chronic granulomatous disease, endometriosis, leptospiriosis, renal failure, glaucoma, retinal disease, aging, headache, pain, complex regional pain syndrome, cardiac hypertrophy, muscle wasting, catabolic disorders, obesity, fetal growth restriction, intestinal failure, hypercholesterolemia, disease heart disease, chronic heart failure, mesothelioma, anhydrotic ecodermal dysplasia, Behcet's disease, pigment incontinence syndrome, Paget's disease, acute or chronic pancreatitis, hereditary periodic fever syndrome, asthma (allergic and non-allergic, mild, moderate, severe, bronchitis and exercise-induced) , acute lung injury, acute respiratory distress syndrome, eosinophilia, hypersensitivity, anaphylaxis, nasal sinusitis, ocular allergy, silica-induced diseases, COPD (damage reduction, airway inflammation, bronchial hyperresponsiveness, disease remodeling or progression), pulmonary diseases, cystic fibrosis, acid-induced lung injury, pulmonary hypertension, polyneuropathy, cataracts, muscle inflammation in combination with systemic sclerosis, inclusion body myositis, myasthenia gravis, thyroiditis, Addison's disease, lichen planus, type 1 diabetes or type 2 diabetes, appendicitis, atopic dermatitis, asthma, allergies, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chronic transplant rejection, colitis, conjunctivitis, Crohn's disease, cystitis, dacryoadenitis, dermatitis, dermatomyositis, encephalitis, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, fibrositis, gastritis, gastroenteritis, Henoch-Schonlein purpura, hepatitis, hidradenitis suppurativa, immunoglobulin A nephropathy, interstitial lung disease, laryngitis, mastitis, meningitis, myelitis, myocarditis, myositis, nephritis, oophoritis, orchitis, osteitis, otitis, pancreatitis, mumps, pericarditis, peritonitis, pharyngitis, pleurisy, phlebitis, pneumonitis, pneumonia, polymyositis, proctitis, prostatitis, pyelonephritis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, tendinitis, tonsillitis, ulcerative colitis, uveitis, vaginitis, vasculitis or vulvitis.

[00218] In some embodiments, the inflammatory disease, disorder, or condition is acute or chronic graft rejection in kidney, liver, heart, pulmonary transplantation, or graft-versus-host disease in bone marrow transplantation.

[00219] In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory disease, disorder, or condition of the skin. In some embodiments, the inflammatory disease, disorder, or skin condition is selected from contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, acquired epidermolysis bullosa and other inflammatory or allergic skin conditions.

[00220] In some embodiments, the inflammatory disease, disorder, or condition is selected from acute and chronic gout, chronic gouty arthritis, psoriasis, psoriatic arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, systemic juvenile idiopathic arthritis (SJIA), cryopyrin-associated periodic syndrome ( CAPS), Muckle-Wells syndrome and osteoarthritis.

[00221] In some embodiments, the inflammatory disease, disorder, or condition is a TH17-mediated disease. In some embodiments, the TH17-mediated disease is selected from systemic lupus erythematosus, multiple sclerosis, and inflammatory bowel disease (including Crohn's disease or ulcerative colitis).

[00222] In some embodiments, the inflammatory disease, disorder, or condition is selected from Sjögren's syndrome, allergic disorders, osteoarthritis, eye conditions such as ocular allergies, conjunctivitis, keratoconjunctivitis sicca, and vernal conjunctivitis, as well as diseases affecting the nose such as allergic rhinitis .

[00223] In some embodiments, the inflammatory disease, disorder, or condition is associated with transplantation. In some embodiments, the inflammatory disease, disorder, or condition is associated with organ transplantation, organ transplant rejection, and/or graft-versus-host disease.

[00224] In some embodiments, the inflammatory disease, disorder, or condition is an autoimmune disorder. In some embodiments, the autoimmune disorder is type 1 diabetes, systemic lupus erythematosus, multiple sclerosis, psoriasis, Behçet's disease, POEMS syndrome, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondylitis, primary biliary cirrhosis, autoimmune hepatitis, or inflammatory bowel disease.

[00225] In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory disorder. In some embodiments, the inflammatory disorder is rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, psoriasis, hepatomegaly, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondylitis, primary biliary cirrhosis, polymyalgia rheumatica, giant cell arteritis, or inflammatory bowel disease.

[00226] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or condition of the pancreas. In some embodiments, the inflammatory disease, disorder, or condition of the pancreas is selected from type 1 diabetes, type 2 diabetes, acute pancreatitis, and chronic pancreatitis.

[00227] In some embodiments, the present invention provides a method of treating an inflammatory kidney disease, disorder, or condition. In some embodiments, the inflammatory kidney disease, disorder, or condition is selected from glomerulosclerosis, glomerulonephritis, nephritis, acute kidney injury, Berger's disease, Goodpasture syndrome, Wegener's granulomatosis, and acute or chronic kidney transplant rejection.

[00228] In some embodiments, the present invention provides a method for treating an inflammatory liver disease, disorder, or condition. In some embodiments, the inflammatory disease, disorder, or condition in the liver is selected from nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), cholestatic liver disease, sclerosing cholangitis, and acute or chronic liver transplant rejection.

[00229] In some embodiments, the present invention provides a method of treating an inflammatory lung disease, disorder, or condition. In some embodiments, the inflammatory lung disease, disorder, or condition is selected from chronic obstructive pulmonary disease (COPD), asthma, pulmonary fibrosis, pulmonary hypertension, sarcoidosis, and acute or chronic lung transplant rejection.

[00230] In some embodiments, the present invention provides a method of treating an inflammatory skin disease, disorder, or condition. In some embodiments, the inflammatory disease, disorder, or skin condition is selected from contact dermatitis, atopic dermatitis, psoriasis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus , epidermolysis bullosa acquired, acne, keloid scars and other inflammatory or allergic skin conditions.

[00231] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or vascular/blood condition. In some embodiments, the inflammatory disease, disorder, or vascular/blood condition is selected from Behçet's disease, vasculitis, sepsis, tumor angiogenesis, atherosclerosis, proliferative vascular disease, and restenosis.

[00232] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or condition of the eye. In some embodiments, the inflammatory disease, disorder, or condition of the eye is selected from conjunctivitis, scleritis, episcleritis, panuveitis, choroiditis, chorioretinitis, neuroretinitis, uveitis, inflammatory disease of the orbit, and optic neuritis.

[00233] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or condition of the central or peripheral nervous system. In some embodiments, the inflammatory disease, disorder, or condition of the central or peripheral nervous system is selected from non-viral and viral encephalitis and meningitis, depression, neuropathic pain, including chronic pain, traumatic brain injury, including stroke, Alzheimer's disease, Parkinson's disease, myelitis, Charcot-Marie-Tooth type 1 (including CMT1A and CMT1B), multiple sclerosis, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, demyelinating polyneuropathy and peripheral neuropathy.

[00234] In some embodiments, the present invention provides a method of treating an autoimmune disease, disorder, or condition. In some embodiments, the autoimmune disease, disorder, or condition is selected from lupus, including skin and kidney, Guillain-Barré syndrome, myasthenia gravis, Hashimoto's thyroiditis, idiopathic purpura, aplastic anemia, Graves' disease, and myocarditis.

[00235] In some embodiments, the present invention provides a method of treating an inflammatory bowel disease, disorder, or condition. In some embodiments, the inflammatory disease, disorder, or bowel condition is selected from intestinal failure, ulcerative colitis, and Crohn's disease.

[00236] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or condition of the reproductive system. In some embodiments, the inflammatory disease, disorder, or condition of the reproductive system is selected from endometriosis, uterine fibroids, prostate dysplasia or growth, and cervical dysplasia.

[00237] In some embodiments, the present invention provides a method of treating an inflammatory bone and/or joint disease, disorder, or condition. In some embodiments, the inflammatory disease, disorder or condition of the bone and/or joints is selected from juvenile idiopathic arthritis, psoriatic arthritis, periodontitis and arthritis of the hand, foot, ankle, knee, hip, shoulder, elbow or spine and/or demineralization.

[00238] In some embodiments, the present invention provides a method of treating an AIDS-related or AIDS-concomitant inflammatory disorder or condition.

Combination therapy for inflammatory diseases, disorders or conditions

[00239] Depending on the particular condition or disease to be treated, additional therapeutic agents that are typically administered to treat that condition may be administered in combination with the compounds and compositions as described herein. As used herein, additional therapeutic agents that are typically administered to treat a particular disease or condition are known as “suitable for the disease or condition being treated.”

[00240] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or condition, comprising administering to a patient in need thereof a compound or composition as described herein in combination with another therapeutic agent.

[00241] These additional agents can be administered separately from the prescribed combination therapy as part of a multiple-dose regimen. Alternatively, these agents may be part of a unit dosage form mixed together with a compound of the present invention in a single composition. When administered as part of a multiple-dose regimen, the two active agents may be administered simultaneously, sequentially, or over a period of time separately from each other, usually within five hours of each other.

[00242] As used herein, the terms “combination,” “combined,” and related terms refer to the simultaneous or sequential administration of therapeutic agents according to this application. For example, the combination of the present invention can be administered with another therapeutic agent simultaneously or sequentially in separate unit dosage forms or together in one unit dosage form.

[00243] The amount of additional therapeutic agent present in the compositions of the present invention will be no more than the amount that is typically administered in a composition comprising that therapeutic agent as the sole active agent. Preferably, the amount of additional therapeutic agent in the compositions disclosed herein will range from about 50 to 100% of the amount typically present in a composition comprising that agent as the sole therapeutically active agent.

[00244] The combination may result in an additive or synergistic effect, where lower doses of one or both compounds may be used to achieve similar effectiveness, or the same doses may result in significantly increased effectiveness.

[00245] In some embodiments, the present invention provides a composition comprising a compound as described herein and one or more additional therapeutic agents. The therapeutic agent can be administered together with the compound, as described herein, or can be administered before or after administration of the compound, as described herein. Suitable therapeutic agents are described in more detail below. In some embodiments, a compound described herein may be administered over 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours , 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours or 18 hours before the therapeutic agent. In some embodiments, a compound as described herein may be administered over 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours or 18 hours after the therapeutic agent.

[00246] In some embodiments, the present invention provides a method of treating an inflammatory disease, disorder, or condition by administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents. Such additional therapeutic agents may be small molecules or recombinant biological agents and include, for example, acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDs) such as aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®), corticosteroids, such as prednisone, prednisolone, methylprednisolone, hydrocortisone and the like, probenecid, allopurinol, febuxostat (Uloric®), sulfasalazine (Azulfidine®), antimalarials such as hydroxychloroquine (Plaquenoquil®) and chloroquine (Aralen®), methotrexate (Rheumatrex® ), gold salts such as gold thioglucose (Solganal®), gold thiomalate (Myochrysine®) and auranofin (Ridaura®), D-penicillamine (Depen® or Cuprimine®), azathioprine (Imuran®), cyclophosphamide (Cytoxan®), chlorambucil (Leukeran®), cyclosporine (Sandimmune®, Neoral®), tacrolimus, sirolimus, mycophenolate, leflunomide (Arava®) and “anti-TNF” agents such as etanercept (Enbrel®), infliximab (Remicade®), golimumab ( Simponi®), certolizumab pegol (Cimzia®) and adalimumab (Humira®), “anti-IL-1” agents such as anakinra (Kineret®) and rilonacept (Arcalyst®), anti-T cell antibodies such as thymoglobulin, intravenous immunoglobulins (IVIg), canakinumab (Ilaris®), anti-Jak inhibitors such as tofacitinib, antibodies such as rituximab (Rituxan®), “anti-T cell” agents such as abatacept (Orencia®), "anti-IL-6" agents such as tocilizumab (Actemra®), diclofenac, cortisone, hyaluronic acid (Synvisc® or Hyalgan®), monoclonal antibodies such as tanezumab, anticoagulants such as heparin (Calcinparine® or Liquaemin®) and warfarin (Coumadin®), antidiarrheals such as diphenoxylate (Lomotil®) and loperamide (Imodium®), bile acid binders such as cholestyramine, alosetron (Lotronex®), lubiprostone (Amitiza®), laxatives such such as milk of magnesia, polyethylene glycol (MiraLax®), Dulcolax®, Correctol® and Senokot®, anticholinergics or antispasmodics such as dicyclomine (Bentyl®), Singulair®, beta-2 agonists such as albuterol (Ventolin® HFA, Proventil® HFA) , levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinafoate (Serevent®) and formoterol (Foradil®), anticholinergic agents such as ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), inhaled corticosteroids such as beclomethasone dipropionate (Beclovent®, Qvar®, and Vanceril®), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), and flunisolide (Aerobid®) , Afviar®, Symbicort®, Dulera®, cromolyn sodium (Intal®), methylxanthines such as theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®, Theo-24®) and aminophylline, IgE antibodies, such as omalizumab (Xolair®), nucleoside reverse transcriptase inhibitors such as zidovudine (Retrovir®), abacavir (Ziagen®), abacavir/lamivudine (Epzicom®), abacavir/lamivudine/zidovudine (Trizivir®), didanosine (Videx®) , emtricitabine (Emtriva®), lamivudine (Epivir®), lamivudine/zidovudine (Combivir®), stavudine (Zerit®) and zalcitabine (Hivid®), non-nucleoside reverse transcriptase inhibitors such as delavirdine (Rescriptor®), efavirenz (Sustiva® ), nevairapine (Viramune®) and etravirine (Intelence®), nucleotide reverse transcriptase inhibitors such as tenofovir (Viread®), protease inhibitors such as amprenavir (Agenerase®), atazanavir (Reyataz®), darunavir (Prezista®), fosamprenavir (Lexiva®), indinavir (Crixivan®), lopinavir and ritonavir (Kaletra®), nelfinavir (Viracept®), ritonavir (Norvir®), saquinavir (Fortovase® or Invirase®), and tipranavir (Aptivus®), penetration inhibitors, such as enfuvirtide (Fuzeon®) and maraviroc (Selzentry®), integrase inhibitors such as raltegravir (Isentress®), doxorubicin (Hydrodaunorubicin®), vincristine (Oncovin®), bortezomib (Velcade®) and dexamethasone (Decadron®) in combination with lenalidomide (Revlimid®), anti-IL36 agents such as BI655130, dihydroorotate dehydrogenase inhibitors such as IMU-838, anti-OX40 agents such as KHK-4083, microbiome agents such as RBX2660, SER-287, kinase inhibitors narrow spectrum agents such as TOP-1288, anti-CD40 agents such as BI-655064 and FFP-104, guanylate cyclase agonists such as dolcanatide, sphingosine kinase inhibitors such as opaganib, anti-IL-12/IL-23 agents such such as AK-101, ubiquitin-protein ligase complex inhibitors such as BBT-401, sphingosine receptor modulators such as BMS-986166, P38MAPK/PDE4 inhibitors such as CBS-3595, CCR9 antagonists such as CCX-507, antagonists FimH such as EB-8018, HIF-PH inhibitors such as FG-6874, HIF-1α stabilizer such as GB-004, MAP3K8 protein inhibitors such as GS-4875, anti-LAG-3 antibodies such as GSK- 2831781, RIP2 kinase inhibitors such as GSK-2983559, Farnesoid X receptor agonist such as MET-409, CCK2 antagonists such as PNB-001, IL-23 receptor antagonists such as PTG-200, Purinergic P2X7 receptor antagonists such like SGM-1019, PDE4 inhibitors such as apremilast, ICAM-1 inhibitors such as alicaforsen sodium, anti-IL23 agents such as guselkumab, brazicumab and mirkizumab, anti-IL-15 agents such as AMG-714 inhibitors TYK-2 such as BMS-986165, NK cell activators such as CNDO-201, RIP-1 kinase inhibitors such as GSK-2982772, anti-NKGD2 agents such as JNJ-4500, CXCL-10 antibodies such such as JT-02, IL-22 receptor agonists such as RG-7880, GATA-3 antagonists such as SB-012 and colony stimulating factor-1 receptor inhibitors such as edicotinib, or any combination(s) thereof.

[00247] In another embodiment, the present invention provides a method of treating gout, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from nonsteroidal anti-inflammatory drugs (NSAIDs), such as aspirin, ibuprofen , naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®), corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone and the like, probenecid, allopurinol and febuxostat (Uloric®).

[00248] In another embodiment, the present invention provides a method of treating rheumatoid arthritis, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from nonsteroidal anti-inflammatory drugs (NSAIDs), such as aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone and the like, sulfasalazine (Azulfidine®), antimalarials such as hydroxychloroquine (Plaquenil®) and chloroquine (Aralen®), methotrexate (Rheumatrex®), gold salts such as gold thioglucose (Solganal®), gold thiomalate (Myochrysine®) and auranofin (Ridaura®), D-penicillamine (Depen® or Cuprimine®), azathioprine (Imuran®), cyclophosphamide (Cytoxan) ®), chlorambucil (Leukeran®), cyclosporine (Sandimmune®), leflunomide (Arava®) and “anti-TNF” agents such as etanercept (Enbrel®), infliximab (Remicade®), golimumab (Simponi®), certolizumab pegol (Cimzia®) and adalimumab (Humira®), “anti-IL-1” agents such as anakinra (Kineret®) and rilonacept (Arcalyst®), antibodies such as rituximab (Rituxan®), “anti-T-cell " agents such as abatacept (Orencia®) and "anti-IL-6" agents such as tocilizumab (Actemra®).

[00249] In some embodiments, the present invention provides a method of treating osteoarthritis, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDs), such as aspirin , ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, diclofenac, cortisone, hyaluronic acid (Synvisc® or Hyalgan®), and monoclonal antibodies such as tanezumab.

[00250] In some embodiments, the present invention provides a method of treating lupus, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDs), such as aspirin , ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone and the like, antimalarial drugs such as hydroxychloroquine (Plaquenil®) and chloroquine (Cycloptoxanide®), cyclophosphamide (Cytoxan®), methotrexate (Rheumatrex®), azathioprine (Imuran®), and anticoagulants such as heparin (Calcinparine® or Liquaemin®) and warfarin (Coumadin®).

[00251] In some embodiments, the present invention provides a method of treating Crohn's disease, ulcerative colitis, or inflammatory bowel disease, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from mesalamine (Asacol® ), sulfasalazine (Azulfidine®), antidiarrheals such as diphenoxylate (Lomotil®) and loperamide (Imodium®), bile acid binders such as cholestyramine, alosetron (Lotronex®), lubiprostone (Amitiza®), laxatives, such as milk of magnesia, polyethylene glycol (MiraLax®), Dulcolax®, Correctol® and Senokot®, as well as anticholinergic or antispasmodic drugs such as dicyclomine (Bentyl®), anti-TNF therapies, steroids and antibiotics such as Flagyl or ciprofloxacin.

[00252] In some embodiments, the present invention provides a method of treating asthma, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from Singulair®, beta-2 agonists, such as albuterol ( Ventolin® HFA, Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinafoate (Serevent®) and formoterol (Foradil®), anticholinergic agents , such as ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), inhaled corticosteroids such as prednisone, prednisolone, beclomethasone dipropionate (Beclovent®, Qvar® and Vanceril®), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®) , budesonide (Pulmocort®), flunisolide (Aerobid®), Afviar®, Symbicort® and Dulera®, cromolyn sodium (Intal®), methylxanthines such as theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl® , Theo-24®) and aminophylline, and IgE antibodies such as omalizumab (Xolair®).

[00253] In some embodiments, the present invention provides a method of treating COPD, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from beta-2 agonists, such as albuterol (Ventolin® HFA , Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinafoate (Serevent®) and formoterol (Foradil®), anticholinergic agents such as ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), methylxanthines such as theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®, Theo-24®) and aminophylline, inhaled corticosteroids such as prednisone, prednisolone, beclomethasone dipropionate (Beclovent®, Qvar® and Vanceril®), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), flunisolide (Aerobid®), Afviar®, Symbicort® and Dulera®.

[00254] In some embodiments, the present invention provides a method of treating HIV, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from nucleoside reverse transcriptase inhibitors, such as zidovudine (Retrovir®) , abacavir (Ziagen®), abacavir/lamivudine (Epzicom®), abacavir/lamivudine/zidovudine (Trizivir®), didanosine (Videx®), emtricitabine (Emtriva®), lamivudine (Epivir®), lamivudine/zidovudine (Combivir®) , stavudine (Zerit®) and zalcitabine (Hivid®), non-nucleoside reverse transcriptase inhibitors such as delavirdine (Rescriptor®), efavirenz (Sustiva®), nevairapine (Viramune®) and etravirine (Intelence®), nucleotide reverse transcriptase inhibitors such such as tenofovir (Viread®), protease inhibitors such as amprenavir (Agenerase®), atazanavir (Reyataz®), darunavir (Prezista®), fosamprenavir (Lexiva®), indinavir (Crixivan®), lopinavir and ritonavir (Kaletra®), nelfinavir (Viracept®), ritonavir (Norvir®), saquinavir (Fortovase® or Invirase®) and tipranavir (Aptivus®), penetration inhibitors such as enfuvirtide (Fuzeon®) and maraviroc (Selzentry®), integrase inhibitors such as raltegravir (Isentress®), and combinations thereof.

[00255] In some embodiments, the present invention provides a method of treating organ transplant rejection or graft-versus-host disease, comprising administering to a patient in need thereof a compound as described herein and one or more additional therapeutic agents selected from the steroid, cyclosporine , FK506, rapamycin, hedgehog signaling inhibitor, BTK inhibitor, JAK/pan-JAK inhibitor, TYK2 inhibitor, PI3K inhibitor and SYK inhibitor.

[00256] The compounds of the invention are also suitable as co-therapeutic compounds for use in combination with other drugs, such as anti-inflammatory, bronchodilator or antihistamine drugs, in particular in the treatment of obstructive or inflammatory airway diseases such as those have been mentioned above, for example, to enhance the therapeutic activity of such drugs or to reduce the required dosage or potential side effects of such drugs. The compound of the present invention may be mixed with another drug in a fixed pharmaceutical composition, or it may be administered separately, before, simultaneously with, or after the other drug. Accordingly, the invention includes the combination of a compound of the invention as described above with an anti-inflammatory, bronchodilator, antihistamine or antitussive drug, wherein said compound of the invention and said drug are in the same or different pharmaceutical compositions.

[00257] Suitable anti-inflammatory drugs include steroids, in particular glucocorticosteroids such as budesonide, beclomethasone dipropionate, fluticasone propionate, ciclesonide or mometasone furoate; non-steroidal glucocorticoid receptor agonists; LTB4 antagonists such as LY293111, CGS025019C, CP-195543, SC-53228, BIIL 284, ONO 4057, SB 209247; LTD4 antagonists such as montelukast and zafirlukast; PDE4 inhibitors such as cilomilast (Ariflo® GlaxoSmithKline), roflumilast (Byk Gulden), V-11294A (Napp), BAY19-8004 (Bayer), SCH-351591 (Schering-Plough), arophylline (Almirall Prodesfarma), PD189659/PD168787 (ParkeDavis), AWD-12-281 (Asta Medica), CDC-801 (Celgene), SeICID™ CC-10004 (Celgene), VM554/UM565 (Vernalis), T-440 (Tanabe), KW-4490 (Kyowa Hakko Kogyo); A2a agonists; A2b antagonists; and beta-2 adrenergic agonists such as albuterol (salbutamol), metaproterenol, terbutaline, salmeterol, fenoterol, procaterol and especially formoterol and pharmaceutically acceptable salts thereof. Suitable bronchodilators include anticholinergic or antimuscarinic compounds, particularly ipratropium bromide, oxitropium bromide, tiotropium salts and CHF 4226 (Chiesi), and glycopyrrolate.

[00258] Suitable antihistamine drugs include cetirizine hydrochloride, acetaminophen, clemastine fumarate, promethazine, loratidine, desloratidine, diphenhydramine and fexofenadine hydrochloride, activastine, astemizole, azelastine, ebastine, epinastine, mizolastine and tefenadine.

[00259] Other useful combinations of the compounds of the invention with anti-inflammatory drugs are combinations with chemokine receptor antagonists, for example CCR-1, CCR-2, CCR-3, CCR-4, CCR-5, CCR-6, CCR-7, CCR -8, CCR-9 and CCR10, CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, in particular with CCR-5 antagonists such as Schering-Plough antagonists SC-351125, SCH-55700 and SCH-D, and Takeda antagonists such as N-[[4-[[[6,7-dihydro-2-(4-methylphenyl)-5H-benzocyclohepten-8-yl]carbonyl]amino]phenyl]-methyl]tetrahydro-N,N-dimethyl-2H -pyran-4-amine chloride (TAK-770).

[00260] The structure of active compounds, identified by code numbers, generic or trade names, can be taken from the current edition of the standard reference book "The Merck Index" or databases such as Patents International (eg, IMS World Publications).

[00261] A compound of the present invention may be administered alone or in combination with one or more other therapeutic compounds, combination therapy may be in the form of fixed combinations, or administration of a compound of the present invention and one or more other therapeutic compounds may be staggered or administered independently of each other. , or combined administration of fixed combinations and one or more other therapeutic compounds.

[00262] These additional agents may be administered separately from a composition comprising a compound of the invention as part of a multiple dosage regimen. Alternatively, these agents may be part of a unit dosage form, mixed together with a compound of the present invention in a single composition. When administered as part of a multiple-dose regimen, the two active agents may be administered simultaneously, sequentially, or over a period of time separately from each other, typically within five hours of each other.

[00263] As used herein, the terms “combination,” “combined,” and related terms refer to the simultaneous or sequential administration of therapeutic agents in accordance with the present invention. For example, a compound of the present invention may be administered with another therapeutic agent simultaneously or sequentially in separate unit dosage forms or together in a single unit dosage form. Accordingly, the present invention provides a unit dosage form comprising a compound of the present invention, an additional therapeutic agent and a pharmaceutically acceptable carrier, excipient or excipient.

[00264] The amount of both the compound as described herein and the additional therapeutic agent (in those compositions that include the additional therapeutic agent as described above) that may be combined with the carrier materials to form a unit dosage form will vary by depending on the patient being treated and the particular route of administration. Preferably, the compositions of the present invention should be formulated so that a dose of from 0.01 to 100 mg/kg body weight/day of a compound of the present invention can be administered.

[00265] In those compositions that include an additional therapeutic agent, the additional therapeutic agent and the compound of the present invention may act synergistically. Therefore, the amount of additional therapeutic agent in such compositions will be less than the amount required for monotherapy using only that therapeutic agent. In such compositions, a dose of from 0.01 to 1000 μg/kg body weight/day of the additional therapeutic agent can be administered.

[00266] The amount of additional therapeutic agent present in the compositions of the present invention will be no more than the amount that is typically included in compositions containing that therapeutic agent as the sole active agent. Preferably, the amount of additional therapeutic agent in the compositions disclosed herein will range from about 50 to 100% of the amount typically present in a composition comprising that agent as the sole therapeutically active agent.

[00267] The compounds of the present invention or pharmaceutical compositions thereof may also be included in compositions for coating an implantable medical device such as prostheses, artificial valves, vascular grafts, stents and catheters. Vascular stents, for example, have been used to overcome restenosis (re-narrowing of the vessel wall after injury). However, patients using stents or other implantable devices are at risk for clot formation or platelet activation. These undesirable effects can be prevented or mitigated by precoating the device with a pharmaceutically acceptable composition comprising a kinase inhibitor. Implantable devices coated with the compound of the present invention are another embodiment of the present invention.

Cancer

[00268] Cancer includes, in one embodiment, without limitation, leukemias (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia , chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (eg, Hodgkin's disease or non-Hodgkin's disease), Waldenström's macroglobulinemia, multiple myeloma, heavy chain disease, and solid tumors such as sarcomas and carcinomas (eg, fibrosarcoma, myxosarcoma, liposarcoma , chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, ally -cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma a, Wilmis tumor, cancer cervical, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma , oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma and retinoblastoma).

[00269] In some embodiments, the cancer is a glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, neuroblastoma, or retinoblastoma.

[00270] In some embodiments, the cancer is an acoustic neuroma, an astrocytoma (e.g., grade I - pilocytic astrocytoma, grade II - low-grade astrocytoma, grade III - anaplastic astrocytoma, or grade IV - glioblastoma (GBM)), chordoma, CNS lymphoma ( central nervous system), craniopharyngioma, brainstem glioma, ependymoma, mixed glioma, optic nerve glioma, subependymoma, medulloblastoma, meningioma, metastatic brain tumor, oligodendroglioma, pituitary tumors, primitive neuroectodermal tumor (PNET), or schwannoma. In some embodiments, the cancer is a type of cancer that is more common in children than in adults, such as a brainstem glioma, craniopharyngioma, ependymoma, juvenile pilocytic astrocytoma (JPA), medulloblastoma, optic nerve glioma, pineal tumor, primitive neuroectodermal tumors (PNET) or rhabdoid tumor. In some embodiments, the patient is an adult. In some embodiments, the patient is a child or pediatric patient.

[00271] Cancer includes, in another embodiment, but is not limited to, mesothelioma, hepatobiliary (liver and bile duct), bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, ovarian cancer, colon cancer , rectal cancer, anal cancer, stomach cancer, gastrointestinal tract (gastric, colorectal and duodenal), uterine cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, lymphocytic lymphomas, cancer bladder, kidney or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, non-Hodgkin's lymphoma, spinal axis tumors, brainstem glioma, pituitary adenoma, adrenocortical adrenal cancer, gallbladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma or a combination of one or more of the above cancers.

[00272] In some embodiments, the cancer is selected from hepatocellular carcinoma, ovarian cancer, epithelial ovarian cancer, or fallopian tube cancer; papillary serous cystadenocarcinoma or uterine serous papillary carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; synovial sarcoma of soft tissues and bones; rhabdomyosarcomas; osteosarcomas; chondrosarcomas; Ewing's sarcoma; anaplastic thyroid cancer; adrenocortical adenoma; pancreatic cancer; pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal/stomach cancer (GIST); lymphomas; squamous cell carcinoma of the head and neck (SCCHN); salivary gland cancer; glioma or brain cancer; neurofibromatosis-1 associated malignant peripheral nerve sheath tumors (MPNST); Waldenström's macroglobulinemia or medulloblastoma.

[00273] In some embodiments, the cancer is selected from hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, epithelial ovarian cancer, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine serous papillary carcinoma (UPSC), hepatocholangiocarcinoma, synovial sarcoma of soft tissue and bone, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis-1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenström's macroglobulinemia or medulloblastoma.

[00274] In some embodiments, the cancer is a solid tumor, such as a sarcoma, carcinoma, or lymphoma. Solid tumors usually include an abnormal mass of tissue that usually does not include cysts or fluid areas. In some embodiments, the cancer is selected from renal cell carcinoma or kidney cancer; hepatocellular carcinoma (HCC) or hepatoblastoma or liver cancer; melanoma; breast cancer; colorectal carcinoma or colorectal cancer; colon cancer; rectal cancer; anal cancer; lung cancer such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC); ovarian cancer, epithelial ovarian cancer, ovarian carcinoma or fallopian tube cancer; papillary serous cystadenocarcinoma or uterine serous papillary carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; synovial sarcoma of soft tissues and bones; rhabdomyosarcomas; osteosarcomas; chondrosarcomas; Ewing's sarcoma; anaplastic thyroid cancer; adrenocortical carcinoma; pancreatic cancer; pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal/stomach cancer (GIST); lymphomas; squamous cell carcinoma of the head and neck (SCCHN); salivary gland cancer; glioma or brain cancer; neurofibromatosis-1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenström's macroglobulinemia or medulloblastoma.

[00275] In some embodiments, the cancer is selected from renal cell carcinoma, hepatocellular carcinoma (HCC), hepatoblastoma, colorectal carcinoma, colorectal cancer, colon cancer, rectal cancer, anal cancer, ovarian cancer, epithelial ovarian cancer, ovarian carcinoma , fallopian tube cancer, papillary serous cystadenocarcinoma, uterine serous papillary carcinoma (UPSC), hepatocholangiocarcinoma, synovial sarcoma of soft tissue and bone, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic duct carcinoma glands, pancreatic adenocarcinoma, glioma, brain cancer, neurofibromatosis-1-associated malignant peripheral nerve sheath tumors (MPNST), Waldenström's macroglobulinemia, or medulloblastoma.

[00276] In some embodiments, the cancer is selected from hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, epithelial ovarian cancer, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine serous papillary carcinoma ( UPSC), hepatocholangiocarcinoma, synovial sarcoma of soft tissue and bone, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis-1 associated malignant peripheral nerve sheath tumors ( MPNST), Waldenström's macroglobulinemia or medulloblastoma.

[00277] In some embodiments, the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is a hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer or ovarian carcinoma. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is fallopian tube cancer. In some embodiments, the cancer is papillary serous cystadenocarcinoma. In some embodiments, the cancer is uterine serous papillary carcinoma (UPSC). In some embodiments, the cancer is hepatocholangiocarcinoma. In some embodiments, the cancer is a synovial sarcoma of soft tissue and bone. In some embodiments, the cancer is a rhabdomyosarcoma. In some embodiments, the cancer is osteosarcoma. In some embodiments, the cancer is anaplastic thyroid cancer. In some embodiments, the cancer is adrenocortical carcinoma. In some embodiments, the cancer is pancreatic cancer or pancreatic ductal carcinoma. In some embodiments, the cancer is pancreatic adenocarcinoma. In some embodiments, the cancer is a glioma. In some embodiments, the cancer is a malignant peripheral nerve sheath tumor (MPNST). In some embodiments, the cancer is a neurofibromatosis-1 associated MPNST. In some embodiments, the cancer is Waldenström's macroglobulinemia. In some embodiments, the cancer is a medulloblastoma.

[00278] In some embodiments, the cancer is a virus-associated cancer, including human immunodeficiency virus (HIV)-associated solid tumors, incurable human papillomavirus (HPV)-16-positive solid tumors, and adult T-cell leukemia, which is caused by human T-cell leukemia virus type I (HTLV-I) and is a highly aggressive form of CD4+ T-cell leukemia characterized by clonal integration of HTLV-I into leukemia cells (see https://clinicaltrials.gov/ct2/show/ study/NCT02631746); and virus-associated tumors in gastric cancer, nasopharyngeal carcinoma, cervical cancer, vaginal cancer, vulvar cancer, head and neck squamous cell carcinoma, and Merkel cell carcinoma (see https://clinicaltrials.gov/ct2/show/study/ NCT02488759; see also https://clinicaltrials.gov/ct2/show/study/NCT0240886; https://clinicaltrials.gov/ct2/show/NCT02426892).

[00279] In some embodiments, the cancer is a melanoma cancer. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the cancer is small cell lung cancer (SCLC). In some embodiments, the cancer is non-small cell lung cancer (NSCLC).

[00280] In some embodiments, cancer is treated by stopping further growth of the tumor. In some embodiments, cancer is treated by reducing the size (e.g., volume or weight) of the tumor by at least 5%, 10%, 25%, 50%, 75%, 90%, or 99% relative to the size of the tumor before treatment. In some embodiments, cancer is treated by reducing the size of the patient's tumor by at least 5%, 10%, 25%, 50%, 75%, 90%, or 99% of the size of the tumor before treatment.

Combination cancer therapy

[00281] In some embodiments, the present invention provides a method of treating a disclosed disease or condition, comprising administering to a patient in need thereof an effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and simultaneous or sequential co-administration of an effective amount of one or more additional therapeutic agents. agents such as those described in this application. In some embodiments, the method includes co-administration of one additional therapeutic agent. In some embodiments, the method includes coadministration of two additional therapeutic agents. In some embodiments, the combination of a disclosed compound and an additional therapeutic agent or agents acts synergistically.

[00282] The compound of the present invention can also be used in combination with known therapeutic processes, for example, with the administration of hormones or radiation. In some embodiments, the present compound is used as a radiosensitizer, especially for the treatment of tumors that exhibit poor sensitivity to radiation therapy.

[00283] A compound of the present invention can be administered alone or in combination with one or more other therapeutic compounds, combination therapy may be in the form of fixed combinations, or administration of a compound of the present invention and one or more other therapeutic compounds in a staggered manner or independently of each other, or combined administration of fixed combinations and one or more other therapeutic compounds. The compound of the present invention, in addition to or in addition, can be administered, in particular, for the treatment of tumors in combination with chemotherapy, radiation therapy, immunotherapy, phototherapy, surgery or a combination thereof. Long-term therapy is equally possible, as is adjuvant therapy, in the context of other treatment strategies as described above. Other possible treatments are therapy to maintain the patient's condition after tumor regression or even chemoprophylactic therapy, for example in patients at risk.

[00284] One or more other therapeutic agents can be administered separately from a compound or composition of the present invention as part of a multiple-dose regimen. Alternatively, one or more other therapeutic agents may be part of a unit dosage form mixed together with a compound of the present invention in a single composition. When administered as a multiple-dose regimen, one or more other therapeutic agents and a compound or composition of the present invention may be administered simultaneously, sequentially, or over a period of time separately from each other, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20, 21, 22, 23 or 24 hours apart. In some embodiments, one or more other therapeutic agents and a compound or composition of the present invention are administered as a multiple dosage regimen over more than 24 hours separately from each other.

[00285] As used herein, the terms “combination,” “combined,” and related terms refer to the simultaneous or sequential administration of therapeutic agents in accordance with the present invention. For example, a compound of the present invention may be administered with one or more other therapeutic agents simultaneously or sequentially in separate unit dosage forms or together in one unit dosage form. Accordingly, the present invention provides a unit dosage form comprising a compound of the present invention, one or more other therapeutic agents and a pharmaceutically acceptable carrier, excipient or excipient.

[00286] The amount of a compound of the invention and one or more other therapeutic agents (in those compositions that include an additional therapeutic agent as described above) that may be combined with the carrier materials to form a unit dosage form will vary depending on the patient. being treated and the specific route of administration. Preferably, the composition of the invention should be formulated such that a dose of 0.01 to 100 mg/kg body weight/day of a compound of the invention can be administered.

[00287] In those compositions that include one or more other therapeutic agents, the one or more other therapeutic agents and the compound of the present invention may act synergistically. Therefore, the amount of one or more other therapeutic agents in such compositions may be less than the amount required for monotherapy using that therapeutic agent alone. In such compositions, a dose of from 0.01 to 1000 μg/kg body weight/day of one or more other therapeutic agents can be administered.

[00288] The amount of one or more other therapeutic agents present in the compositions of the present invention may not be greater than the amount that would typically be administered in a composition comprising that therapeutic agent as the sole active agent. Preferably, the amount of one or more other therapeutic agents in the compositions disclosed herein will range from about 50 to 100% of the amount typically present in a composition comprising that agent as the sole therapeutically active agent. In some embodiments, one or more other therapeutic agents are administered at a dosage of about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% of the amount typically administered for this agent. As used herein, the phrase “usually administered” means the amount of an FDA-approved therapeutic agent authorized for administration in accordance with the FDA label insert.

[00289] The compounds of the present invention or pharmaceutical compositions thereof may also be included in compositions for coating an implantable medical device such as prostheses, prosthetic valves, vascular grafts, stents and catheters. Vascular stents, for example, have been used to overcome restenosis (re-narrowing of the vessel wall after injury). However, patients using stents or other implantable devices are at risk for clot formation or platelet activation. These undesirable effects can be prevented or mitigated by precoating the device with a pharmaceutically acceptable composition comprising a kinase inhibitor. Implantable devices coated with the compound of the present invention are another embodiment of the present invention.

Examples of other therapeutic agents

[00290] In some embodiments, the one or more other therapeutic agents is a poly-ADP-ribose polymerase (PARP) inhibitor. In some embodiments, the PARP inhibitor is selected from olaparib (Lynparza®, AstraZeneca); rucaparib (Rubraca®, Clovis Oncology); niraparib (Zejula®, Tesaro); talazoparib (MDV3800/BMN 673/LT00673, Medivation/Pfizer/Biomarin); veliparib (ABT-888, AbbVie) and BGB-290 (BeiGene, Inc).

[00291] In some embodiments, the one or more other therapeutic agents is a histone deacetylase (HDAC) inhibitor. In some embodiments, the HDAC inhibitor is selected from vorinostat (Zolinza®, Merck); romidepsin (Istodax®, Celgene); panobinostat (Farydak®, Novartis); belinostat (Beleodaq®, Spectrum Pharmaceuticals); entinostat (SNDX-275, Syndax Pharmaceuticals) (NCT00866333) and chidamide (Epidaza®, HBI-8000, Chipscreen Biosciences, China).

[00292] In some embodiments, the one or more other therapeutic agents is a CDK inhibitor, such as a CDK4/CDK6 inhibitor. In some embodiments, the CDK 4/6 inhibitor is selected from palbociclib (Ibrance®, Pfizer); ribociclib (Kisqali®, Novartis); abemaciclib (Ly2835219, Eli Lilly) and trilaciclib (G1T28, G1 Therapeutics).

[00293] In some embodiments, the one or more other therapeutic agents is a phosphatidylinositol 3-kinase (PI3K) inhibitor. In some embodiments, the PI3K inhibitor is selected from idealalisib (Zydelig®, Gilead), alpelisib (BYL719, Novartis), tazelisib (GDC-0032, Genentech/Roche); pictilizib (GDC-0941, Genentech/Roche); copanlisib (BAY806946, Bayer); duvelisib (formerly IPI-145, Infinity Pharmaceuticals); PQR309 (Piqur Therapeutics, Switzerland) and TGR1202 (formerly RP5230, TG Therapeutics).

[00294] In some embodiments, the one or more other therapeutic agents are platinum-based therapeutics, also referred to as platinums. Platinums cause DNA cross-linking such that they inhibit DNA repair and/or DNA synthesis, mainly in rapidly reproducing cells such as cancer cells. In some embodiments, the platinum-based therapeutic agent is selected from cisplatin (Platinol®, Bristol-Myers Squibb); carboplatin (Paraplatin®, Bristol-Myers Squibb; also Teva; Pfizer); oxaliplatin (Eloxitin® Sanofi-Aventis); nedaplatin (Aqupla®, Shionogi), picoplatin (Poniard Pharmaceuticals), and satraplatin (JM-216, Agennix).

[00295] In some embodiments, the one or more other therapeutic agents is a taxane compound that causes disruption of microtubules that are essential for cell division. In some embodiments, the taxane compound is selected from paclitaxel (Taxol®, Bristol-Myers Squibb), docetaxel (Taxotere®, Sanofi-Aventis; Docefrez®, Sun Pharmaceutical), albumin-bound paclitaxel (Abraxane®; Abraxis/Celgene), cabazitaxel ( Jevtana®, Sanofi-Aventis) and SID530 (SK Chemicals, Co.) (NCT00931008).

[00296] In some embodiments, the one or more other therapeutic agents is a nucleoside inhibitor or therapeutic agent that interferes with normal DNA synthesis, protein synthesis, cell replication, or will otherwise inhibit rapidly proliferating cells.

[00297] In some embodiments, the nucleoside inhibitor is selected from trabectidine (guanidine alkylating agent, Yondelis®, Janssen Oncology), mechlorethamine (alkylating agent, Valchlor®, Aktelion Pharmaceuticals); vincristine (Oncovin®, Eli Lilly; Vincasar®, Teva Pharmaceuticals; Marqibo®, Talon Therapeutics); temozolomide (a prodrug of the alkylating agent 5-(3-methyltriazen-1-yl)-imidazol-4-carboxamide (MTIC) Temodar®, Merck); cytarabine injection (ara-C, antimetabolic cytidine analogue, Pfizer); lomustine (alkylating agent, CeeNU®, Bristol-Myers Squibb; Gleostine®, NextSource Biotechnology); azacitidine (pyrimidine nucleoside analogue of cytidine, Vidaza®, Celgene); omacetaxine mepesuccinate (cephalotaxin ester) (protein synthesis inhibitor, Synribo®; Teva Pharmaceuticals); Erwinia chrysanthemi asparaginase (enzyme to reduce asparagine incorporation, Elspar®, Lundbeck; Erwinaze®, EUSA Pharma); eribulin mesylate (microtubule inhibitor, tubulin-based antimitotic, Halaven®, Eisai); cabazitaxel (microtubule inhibitor, tubulin-based antimitotic, Jevtana®, Sanofi-Aventis); capacetrin (thymidylate synthase inhibitor, Xeloda®, Genentech); bendamustine (a bifunctional mechlorethamine derivative believed to cross-link DNA strands, Treanda®, Cephalon/Teva); ixabepilone (semi-synthetic analogue of epothilone B, microtubule inhibitor, tubulin-based antimitotic, Ixempra®, Bristol-Myers Squibb); nelarabine (deoxyguanosine analogue prodrug, nucleoside metabolism inhibitor, Arranon®, Novartis); clorafabin (ribonucleotide reductase inhibitor prodrug, deoxycytidine competitive inhibitor, Clolar®, Sanofi-Aventis) and trifluridine and tipiracil (thymidine nucleoside analog and thymidine phosphorylase inhibitor, Lonsurf®, Taiho Oncology).

[00298] In some embodiments, the one or more other therapeutic agents is a kinase inhibitor or a VEGF-R antagonist. Approved VEGF inhibitors and kinase inhibitors useful in the present invention include: bevacizumab (Avastin®, Genentech/Roche), an anti-VEGF monoclonal antibody; ramucirumab (Cyramza®, Eli Lilly), an anti-VEGFR-2 antibody, and ziv-aflibercept, also known as VEGF Trap (Zaltrap®; Regeneron/Sanofi). VEGF-R inhibitors such as regorafenib (Stivarga®, Bayer); vandetanib (Caprelsa®, AstraZeneca); axitinib (Inlyta®, Pfizer) and lenvatinib (Lenvima®, Eisai); Raf inhibitors such as sorafenib (Nexavar®, Bayer AG and Onyx); dabrafenib (Tafinlar®, Novartis) and vemurafenib (Zelboraf®, Genentech/Roche); MEK inhibitors such as cobimetanib (Cotellic®, Exelexis/Genentech/Roche); trametinib (Mekinist®, Novartis); Bcr-Abl tyrosine kinase inhibitors such as imatinib (Gleevec®, Novartis); nilotinib (Tasigna®, Novartis); dasatinib (Sprycel®, BristolMyersSquibb); bosutinib (Bosulif®, Pfizer) and ponatinib (Inclusig®, Ariad Pharmaceuticals); Her2 and EGFR inhibitors such as gefitinib (Iressa®, AstraZeneca); erlotinib (Tarceeva®, Genentech/Roche/Astellas); lapatinib (Tykerb®, Novartis); afatinib (Gilotrif®, Boehringer Ingelheim); osimertinib (targeting activated EGFR, Tagrisso®, AstraZeneca) and brigatinib (Alunbrig®, Ariad Pharmaceuticals); c-Met and VEGFR-2 inhibitors such as cabozanitib (Cometriq®, Exelexis); and multikinase inhibitors such as sunitinib (Sutent®, Pfizer); pazopanib (Votrient®, Novartis); ALK inhibitors such as crizotinib (Xalkori®, Pfizer); ceritinib (Zykadia®, Novartis) and alectinib (Alecenza®, Genentech/Roche); Bruton's tyrosine kinase inhibitors such as ibrutinib (Imbruvica®, Pharmacyclics/Janssen); and Flt3 receptor inhibitors such as midostaurin (Rydapt®, Novartis).

[00299] Other kinase inhibitors and VEGF-R antagonists that are under development and may be used in the present invention include tivozanib (Aveo Pharmaecuticals); vatalanib (Bayer/Novartis); lucitanib (Clovis Oncology); dovitinib (TKI258, Novartis); chiauanib (Chipscreen Biosciences); CEP-11981 (Cephalon); linifanib (Abbott Laboratories); neratinib (HKI-272, Puma Biotechnology); radotinib (Supect®, IY5511, Il-Yang Pharmaceuticals, South Korea); ruxolitinib (Jakafi®, Incyte Corporation); PTC299 (PTC Therapeutics); CP-547632 (Pfizer); foretinib (Exelexis, GlaxoSmithKline); hisartinib (Daiichi Sankyo) and motesanib (Amgen/Takeda).

[00300] In some embodiments, the one or more other therapeutic agents is an mTOR inhibitor that inhibits cell proliferation, angiogenesis, and glucose uptake. In some embodiments, the mTOR inhibitor is everolimus (Afinitor®, Novartis); temsirolimus (Torisel®, Pfizer) and sirolimus (Rapamune®, Pfizer).

[00301] In some embodiments, the one or more other therapeutic agents is a proteasome inhibitor. Approved proteasome inhibitors useful in the present invention include bortezomib (Velcade®, Takeda); carfilzomib (Kyprolis®, Amgen) and ixazomib (Ninlaro®, Takeda).

[00302] In some embodiments, the one or more other therapeutic agents is a growth factor antagonist, such as an antagonist of platelet-derived growth factor (PDGF) or epidermal growth factor (EGF) or its receptor (EGFR). Approved PDGF antagonists that can be used in the present invention include olaratumab (Lartruvo®; Eli Lilly). Approved EGFR antagonists that can be used in the present invention include cetuximab (Erbitux®, Eli Lilly); necitumumab (Portrazza®, Eli Lilly), panitumumab (Vectibix®, Amgen), and osimertinib (targeting activated EGFR, Tagrisso®, AstraZeneca).

[00303] In some embodiments, the one or more other therapeutic agents is an aromatase inhibitor. In some embodiments, the aromatase inhibitor is selected from exemestane (Aromasin®, Pfizer); anastazole (Arimidex®, AstraZeneca) and letrozole (Femara®, Novartis).

[00304] In some embodiments, the one or more other therapeutic agents are hedgehog pathway antagonists. Approved hedgehog pathway inhibitors that can be used in the present invention include sonidegib (Odomzo®, Sun Pharmaceuticals); and vismodegib (Evedge®, Genentech), both for the treatment of basal cell carcinoma.

[00305] In some embodiments, the one or more other therapeutic agents is a folic acid inhibitor. Approved folic acid inhibitors useful in the present invention include pemetrexed (Alimta®, Eli Lilly).

[00306] In some embodiments, the one or more other therapeutic agents is a CC chemokine receptor 4 (CCR4) inhibitor. Study CCR4 inhibitors that can be used in the present invention include mogamulizumab (Poteligeo®, Kyowa Hakko Kirin, Japan).

[00307] In some embodiments, the one or more other therapeutic agents is an isocitrate dehydrogenase (IDH) inhibitor. IDH inhibitors under investigation that may be used in the present invention include AG120 (Celgene; NCT02677922); AG221 (Celgene, NCT02677922; NCT02577406); BAY1436032 (Bayer, NCT02746081); IDH305 (Novartis, NCT02987010).

[00308] In some embodiments, the one or more other therapeutic agents is an arginase inhibitor. Investigational arginase inhibitors that may be used in the present invention include AEB1102 (PEGylated recombinant arginase, Aeglea Biotherapeutics), which is being studied in phase 1 clinical trials for acute myeloid leukemia and myelodysplastic syndrome (NCT02732184) and solid tumors (NCT02561234); and CB-1158 (Calithera Biosciences).

[00309] In some embodiments, the one or more other therapeutic agents is a glutaminase inhibitor. Studied glutaminase inhibitors that may be used in the present invention include CB-839 (Calithera Biosciences).

[00310] In some embodiments, the one or more other therapeutic agents are an antibody that binds to tumor antigens, that is, proteins expressed on the cell surface of tumor cells. Approved antibodies that bind to tumor antigens that can be used in the present invention include rituximab (Rituxan®, Genentech/BiogenIdec); ofatumumab (anti-CD20, Arzerra®, GlaxoSmithKline); obinutuzumab (anti-CD20, Gazyva®, Genentech), ibritumomab (anti-CD20 and yttrium-90, Zevalin®, Spectrum Pharmaceuticals); daratumumab (anti-CD38, Darzalex®, Janssen Biotech), dinutuximab (anti-glycolipid GD2, Unituxin®, United Therapeutics); trastuzumab (anti-HER2, Herceptin®, Genentech); ado-trastuzumab emtansine (anti-HER2 emtansine fusion, Kadcyla®, Genentech); and pertuzumab (anti-HER2, Perjeta®, Genentech); and brentuximab vedotin (anti-CD30 drug conjugate, Adcetris®, Seattle Genetics).

[00311] In some embodiments, the one or more other therapeutic agents is a topoisomerase inhibitor. Approved topoisomerase inhibitors useful in the present invention include irinotecan (Onivyde®, Merrimack Pharmaceuticals); topotecan (Hycamtin®, GlaxoSmithKline). Topoisomerase inhibitors under investigation that may be used in the present invention include pixantrone (Pixuvri®, CTI Biopharma).

[00312] In some embodiments, the one or more other therapeutic agents is an inhibitor of anti-apoptotic proteins, such as BCL-2. Approved anti-apoptotic agents that can be used in the present invention include venetoclax (Venclexta®, AbbVie/Genentech) and blinatumomab (Blincyto®, Amgen). Other therapeutic agents targeting apoptotic proteins that have undergone clinical trials and may be useful in the present invention include navitoclax (ABT-263, Abbott), a BCL-2 inhibitor (NCT02079740).

[00313] In some embodiments, the one or more other therapeutic agents is an androgen receptor inhibitor. Approved androgen receptor inhibitors useful in the present invention include enzalutamide (Xtandi®, Astellas/Medivation); approved androgen synthesis inhibitors include abiraterone (Zytiga®, Centocor/Ortho); an approved gonadotropin-releasing hormone (GnRH) receptor antagonist (degaralix, Firmagon®, Ferring Pharmaceuticals).

[00314] In some embodiments, the one or more other therapeutic agents are a selective estrogen receptor modulator (SERM) that interferes with the synthesis or activity of estrogens. Validated SERMs useful in the present invention include raloxifene (Evista®, Eli Lilly).

[00315] In some embodiments, the one or more other therapeutic agents is a bone resorption inhibitor. An approved therapeutic agent that inhibits bone resorption is denosumab (Xgeva®, Amgen), an antibody that binds to RANKL, preventing binding to its receptor RANK, found on the surface of osteoclasts, their precursors and osteoclast-like giant cells that mediate bone pathology in solid tumors with bone metastases. Other approved therapeutic agents that inhibit bone resorption include bisphosphonates such as zoledronic acid (Zometa®, Novartis).

[00316] In some embodiments, the one or more other therapeutic agents are an inhibitor of the interaction between two major p53 suppressor proteins, MDMX and MDM2. Inhibitors of p53 suppression proteins under investigation that may be used in the present invention include ALRN-6924 (Aileron), a cross-linked peptide that uniformly binds and disrupts the interaction of MDMX and MDM2 with p53. ALRN-6924 is currently in clinical trials for the treatment of AML, advanced myelodysplastic syndrome (MDS), and peripheral T-cell lymphoma (PTCL) (NCT02909972; NCT02264613).

[00317] In some embodiments, the one or more other therapeutic agents is a transforming growth factor-beta (TGF-beta or TGFβ) inhibitor. Investigational inhibitors of TGF-beta proteins that may be used in the present invention include NIS793 (Novartis), an anti-TGF-beta antibody being tested in the clinic for the treatment of various types of cancer, including breast, lung, hepatocellular, colorectal, pancreatic, prostate cancer. gland and kidney (NCT 02947165). In some embodiments, the TGF-beta protein inhibitor is frezolimumab (GC1008; Sanofi-Genzyme), which is being studied for the treatment of melanoma (NCT00923169); renal cell carcinoma (NCT00356460) and non-small cell lung cancer (NCT02581787). Additionally, in some embodiments, the additional therapeutic agent is a TGF-beta decoy such as described by Connolly et al. (2012) Int'l J. Biological Sciences 8: 964-978. One therapeutic compound currently in clinical trials for the treatment of solid tumors is M7824 (Merck KgaA - formerly MSB0011459X), which is a bispecific anti-PD-L1/TGFβ decoy compound (NCT02699515); and (NCT02517398). M7824 consists of a fully human IgG1 anti-PD-L1 antibody fused to the extracellular domain of the human TGF-beta II receptor, which functions as a TGFβ decoy.

[00318] In some embodiments, one or more other therapeutic agents is selected from glembatumumab vedotin-monomethyl auristatin E (MMAE) (Celldex), an antibody against glycoprotein NMB (gpNMB) (CR011), associated with cytotoxic MMAE. gpNMB is a protein overexpressed by multiple tumor types associated with the ability of cancer cells to metastasize.

[00319] In some embodiments, the one or more other therapeutic agents are an antiproliferative compound. Such antiproliferative compounds include, but are not limited to, aromatase inhibitors; antiestrogens; topoisomerase I inhibitors; topoisomerase II inhibitors; active microtubule junctions; alkylating compounds; histone deacetylase inhibitors; compounds that induce cell differentiation processes; cyclooxygenase inhibitors; MMP inhibitors; mTOR inhibitors; antitumor antimetabolites; platinum compounds; compounds targeting/reducing protein or lipid kinase activity and other antiangiogenic compounds; compounds that target, reduce or inhibit protein or lipid phosphatase activity; gonadorelin agonists; antiandrogens; methionine aminopeptidase inhibitors; matrix metalloproteinase inhibitors; bisphosphonates; biological response modifiers; antiproliferative antibodies; heparanase inhibitors; inhibitors of oncogenic Ras isoforms; telomerase inhibitors; proteasome inhibitors; compounds used in the treatment of hematological malignancies; compounds that target, reduce or inhibit Flt-3 activity; Hsp90 inhibitors such as 17-AAG (17-allylaminogeldanamycin, NSC330507), 17-DMAG (17-dimethylaminoethylamino-17-demethoxy-geldanamycin, NSC707545), IPI-504, CNF1010, CNF2024, CNF1010 from Conforma Therapeutics; temozolomide (Temodal®); kinesin spindle protein inhibitors such as SB715992 or SB743921 from GlaxoSmithKline or pentamidine/chlorpromazine from CombinatoRx; MEK inhibitors such as ARRY142886 from Array BioPharma, AZd _6,244 from AstraZeneca, PD181461 from Pfizer and leucovorin.

[00320] As used herein, the term “aromatase inhibitor” refers to a compound that inhibits the production of estrogen, for example, the conversion of the substrates androstenedione and testosterone to estrone and estradiol, respectively. The term includes, but is not limited to, steroids, especially atamestane, exemestane and formestane, and in particular non-steroids, especially aminoglutethimide, rogletimide, pyridoglutetimide, trilostane, testolactone, ketoconazole, vorozole, fadrozole, anastrozole and letrozole. Exemestane is sold under the trade name Aromasin™. Formestane is sold under the trade name Lentaron™. Fadrozole is sold under the trade name Afema™. Anastrozole is sold under the trade name Arimidex™. Letrozole is sold under the trade names Femara™ or Femar™. Aminoglutethimide is sold under the trade name Orimeten™. The combination of the invention, comprising a chemotherapeutic agent that is an aromatase inhibitor, is particularly useful for the treatment of hormone receptor positive tumors, such as breast tumors.

[00321] As used herein, the term "anti-estrogen" refers to a compound that antagonizes the action of estrogens at the estrogen receptor level. The term includes, but is not limited to, tamoxifen, fulvestrant, raloxifene and raloxifene hydrochloride. Tamoxifen is sold under the trade name Nolvadex™. Raloxifene hydrochloride is sold under the trade name Evista™. Fulvestrant can be administered under the trade name Faslodex™. The combination of the invention, comprising a chemotherapeutic agent that is an antiestrogen, is particularly useful for the treatment of estrogen receptor positive tumors, such as breast tumors.

[00322] As used herein, the term “antiandrogen” refers to any substance that is capable of inhibiting the biological effects of androgenic hormones and includes, but is not limited to, bicalutamide (Casodex™). As used herein, the term “gonadorelin agonist” includes, but is not limited to, abarelix, goserelin and goserelin acetate. Goserelin can be administered under the trade name Zoladex™.

[00323] As used herein, the term “topoisomerase I inhibitor” includes, but is not limited to, topotecan, gimatecan, irinotecan, camptothecin and analogs thereof, 9-nitrocamptothecin and the macromolecular camptothecin conjugate PNU-166148. Irinotecan can be administered, for example, in the form in which it is sold, for example, under the brand name Camptosar™. Topotecan is sold under the trade name Hycamptin™.

[00324] As used herein, the term “topoisomerase II inhibitor” includes, but is not limited to, anthracyclines such as doxorubicin (including liposomal formulations such as Caelyx™), daunorubicin, epirubicin, idarubicin and nerubicin, the anthraquinones mitoxantrone and losoxantrone, and podophyllotoxins etoposide and teniposide. Etoposide is sold under the trade name Etopophos™. Teniposide is sold under the trade name VM 26-Bristol. Doxorubicin is sold under the trade names Acriblastin™ or Adriamycin™. Epirubicin is sold under the trade name Farmorubicin™. Idarubicin is sold under the trade name Zavedos™. Mitoxantrone is sold under the trade name Novantron™.

[00325] The term "microtubule active agent" refers to microtubule stabilizing, microtubule destabilizing, and microtubule polymerization inhibitor compounds, including, but not limited to, taxanes such as paclitaxel and docetaxel; vinca alkaloids such as vinblastine or vinblastine sulfate, vincristine or vincristine sulfate and vinorelbine; discodermolides; cochicine and epothilones and their derivatives. Paclitaxel is sold under the trade name Taxol™. Docetaxel is sold under the trade name Taxotere™. Vinblastine sulfate is sold under the trade name Vinblastin R.P™. Vincristine sulfate is sold under the trade name Farmistin™.

[00326] As used herein, the term "alkylating agent" includes, but is not limited to, cyclophosphamide, ifosfamide, melphalan or nitrosourea (BCNU or Gliadel). Cyclophosphamide is sold under the trade name Cyclostin™. Ifosfamide is sold under the trade name Holoxan™.

[00327] The term “histone deacetylase inhibitors” or “HDAC inhibitors” refers to compounds that inhibit histone deacetylase and have antiproliferative activity. This includes, but is not limited to, suberoylanilide hydroxamic acid (SAHA).

[00328] The term "antitumor antimetabolite" includes, but is not limited to, 5-fluorouracil or 5-FU, capecitabine, gemcitabine, DNA demethylating compounds such as 5-azacytidine and decitabine, methotrexate and edatrexate, and folate antagonists such as like pemetrexed. Capecitabine is sold under the trade name Xeloda™. Gemcitabine is sold under the trade name Gemzar™.

[00329] As used herein, the term “platinum compound” includes, but is not limited to, carboplatin, cis-platin, cisplatin and oxaliplatin. Carboplatin can be administered, for example, in the form in which it is sold, for example, under the brand name Carboplat™. Oxaliplatin can be administered, for example, in the form in which it is sold, for example, under the brand name Eloxatin™.

[00330] As used herein, the term “compounds that target/reduce protein or lipid kinase activity; or protein or lipid phosphatase activity; or other anti-angiogenic compounds" includes, but is not limited to, protein tyrosine kinase and/or serine, and/or threonine kinase inhibitors or lipid kinase inhibitors, such as a) compounds that target, reduce or inhibit the activity of platelet-derived growth factor receptors (PDGFR), such as compounds that target, reduce or inhibit the activity of PDGFR, especially compounds that inhibit the PDGF receptor such as N-phenyl-2-pyrimidine amine derivative such as imatinib, SU101, SU6668 and GFB-111; b) compounds that target, reduce or inhibit the activity of fibroblast growth factor receptors (FGFR); c) compounds that target, reduce or inhibit the activity of the insulin-like growth factor I receptor (IGF-IR), such as compounds that target, reduce or inhibit the activity of IGF-IR, especially compounds that inhibit the kinase activity of the IGF-I receptor, or antibodies that target the extracellular domain of the IGF-I receptor or its growth factors; d) compounds that target, reduce or inhibit the activity of the Trk receptor family of tyrosine kinases, or ephrin B4 inhibitors; e) compounds that target, reduce or inhibit the activity of the AxI receptor family of tyrosine kinases; f) compounds that target, reduce or inhibit Ret receptor tyrosine kinase activity; g) compounds that target, reduce or inhibit Kit/SCFR receptor tyrosine kinase activity, such as imatinib; h) compounds that target, reduce or inhibit the activity of the C-kit receptor tyrosine kinases that are part of the PDGFR family, such as compounds that target, reduce or inhibit the activity of the c-Kit receptor family of tyrosine kinases, especially compounds that inhibit the c-Kit receptor , such as imatinib; i) compounds that target, reduce or inhibit the activity of c-Abl family members, their gene fusion products (e.g. BCR-Abl kinase) and mutants, such as compounds that target or inhibit the activity of c-Abl family members and their gene fusion products such as an N-phenyl-2-pyrimidine amine derivative such as imatinib or nilotinib (AMN107); PD180970; AG957; NSC 680410; PD173955 from ParkeDavis; or dasatinib (BMS-354825); j) compounds that target, reduce or inhibit the activity of members of the protein kinase C (PKC) family and Raf serine/threonine kinase family members MEK, SRC, JAK/pan-JAK, FAK, PDK1, PKB/Akt, Ras/MAPK, PI3K , SYK, TYK2, BTK and TEC and/or members of the cyclin-dependent kinase (CDK) family, including staurosporine derivatives such as midostaurin; examples of other compounds include UCN-01, safingol, BAY 43-9006, bryostatin 1, perifosine; ilmofosine; RO 318220 and RO 320432; GO 6976; lsis 3521; LY333531/LY379196; isoquinoline compounds; IFT; PD184352 or QAN697 (P13K inhibitor), or AT7519 (CDK inhibitor); k) compounds that target, reduce or inhibit the activity of protein tyrosine kinase inhibitors, such as compounds that target, reduce or inhibit the activity of protein tyrosine kinase inhibitors include imatinib mesylate (Gleevec™) or tyrphostin, such as tyrphostin A23/RG- 50810; AG 99; tyrphostin AG 213; tyrphostin AG 1748; tyrphostin AG 490; tyrphostin B44; enantiomer of tyrphostin B44 (+); tyrphostin AG 555; AG 494; tyrphostin AG 556, AG957 and adapostin (4-{[(2,5-dihydroxyphenyl)methyl]amino}-benzoic acid adamantyl ester; NSC 680410, adapostin); l) compounds that target, reduce or inhibit the activity of the epidermal growth factor receptor tyrosine kinase family (EGFR ₁ ErbB2, ErbB3, ErbB4 as homo- or heterodimers) and their mutants, such as compounds that target, reduce or inhibit the activity of the receptor family epidermal growth factor, in particular compounds, proteins or antibodies that inhibit members of the EGF receptor tyrosine kinase family, such as EGF receptor, ErbB2, ErbB3 and ErbB4, or bind to EGF or related EGF ligands, CP 358774, ZD 1839, ZM 105180; trastuzumab (Herceptin™), cetuximab (Erbitux™), Iressa, Tarceva, OSI-774, Cl-1033, EKB-569, GW-2016, E1.1, E2.4, E2.5, E6.2, E6.4, E2.11, E6.3 or E7.6.3 and 7H-pyrrolo-[2,3-d]pyrimidine derivatives; m) compounds that target, reduce or inhibit the activity of the c-Met receptor, such as compounds that target, reduce or inhibit the activity of c-Met, especially compounds that inhibit the kinase activity of the c-Met receptor, or antibodies targeting extracellular c-Met domain or binds to HGF, n) compounds that target, reduce or inhibit the kinase activity of one or more members of the JAK family (JAK1/JAK2/JAK3/TYK2 and/or pan-JAK), including, but not limited to, PRT-062070, SB-1578, baricitinib, pacritinib, momelotinib, VX-509, AZD-1480, TG-101348, tofacitinib and ruxolitinib; o) compounds that target, reduce or inhibit the kinase activity of PI3 kinase (PI3K), including, but not limited to, ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, buparlisib, pictrelisib , PF-4691502, BYL-719, dactolisib, XL-147, XL-765 and idelalisib; and q) compounds that target, reduce or inhibit the signaling effects of hedgehog (Hh) or smoothed receptor (SMO) protein pathways, including, but not limited to, cyclopamine, vismodegib, itraconazole, erismodegib and IPI-926 (saridegib).

[00331] As used herein, the term “PI3K inhibitor” includes, but is not limited to, compounds that have inhibitory activity against one or more enzymes of the phosphatidylinositol 3-kinase family, including, but not limited to, PI3Kα, PI3Kγ, PI3Kδ, PI3Kβ, PI3K-C2α, PI3K-C2β, PI3K-C2γ, Vps34, p110-α, p110-β, p110-γ, p110-δ, p85-α, p85-β, p55-γ, p150, p101 and p87. Examples of PI3K inhibitors useful in the present invention include, but are not limited to, ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, buparlisib, pictrelisib, PF-4691502, BYL- 719, dactolisib, XL-147, XL-765 and idelalisib.

[00332] As used herein, the term “Bcl-2 inhibitor” includes, but is not limited to, compounds having inhibitory activity against B-cell lymphoma protein 2 (Bcl-2), including, but not limited to, ABT-199 , ABT-731, ABT-737, apogosypol, Ascenta pan-Bcl-2 inhibitors, curcumin (and its analogs), dual Bcl-2/Bcl-xL inhibitors (Infinity Pharmaceuticals/Novartis Pharmaceuticals), Genasense (G3139), HA14- 1 (and its analogs; see WO2008118802), navitoclax (and its analogs, see US7390799), NH-1 (Shenayng Pharmaceutical University), obatoclax (and its analogs, see WO2004106328), S-001 (Gloria Pharmaceuticals), TW series compounds (University of Michigan), and venetoclax. In some embodiments, the Bcl-2 inhibitor is a small molecule therapeutic agent. In some embodiments, the Bcl-2 inhibitor is a peptidomimetic.

[00333] As used herein, the term “BTK inhibitor” includes, but is not limited to, compounds that have Bruton's tyrosine kinase (BTK) inhibitory activity, including, but not limited to, AVL-292 and ibrutinib.

[00334] As used herein, the term “SYK inhibitor” includes, but is not limited to, compounds having spleen tyrosine kinase (SYK) inhibitory activity, including, but not limited to, PRT-062070, R-343, R-333 , Excellair, PRT-062607 and fostamatinib.

[00335] Additional examples of BTK inhibitory compounds and conditions that can be treated with such compounds in combination with the compounds of the present invention can be found in WO2008039218 and WO2011090760, which are incorporated herein by reference in their entirety.

[00336] Additional examples of SYK inhibitory compounds and conditions that can be treated with such compounds in combination with the compounds of the present invention can be found in WO2003063794, WO2005007623 and WO2006078846, which are incorporated herein by reference in their entirety.

[00337] Additional examples of PI3K inhibitory compounds and conditions that can be treated with such compounds in combination with the compounds of the present invention can be found in WO2004019973, WO2004089925, WO2007016176, US8138347, WO2002088112, WO2007084786, 29161, WO2006122806, WO2005113554 and WO2007044729, which are incorporated herein by reference in their entirety.

[00338] Additional examples of JAK inhibitory compounds and conditions that can be treated with such compounds in combination with the compounds of the present invention can be found in WO2009114512, WO2008109943, WO2007053452, WO2000142246 and WO2007070514, which are incorporated herein by reference in their entirety.

[00339] Other antiangiogenic compounds include those having a different mechanism of activity, such as non-protein or lipid kinase inhibition, such as thalidomide (Thalomid™) and TNP-470.

[00340] Examples of proteasome inhibitors suitable for use in combination with the compounds of the invention include, but are not limited to, bortezomib, disulfiram, epigallocatechin-3-gallate (EGCG), salinosporamide A, carfilzomib, ONX-0912, CEP-18770 and MLN9708.

[00341] Compounds that target, reduce or inhibit protein or lipid phosphatase activity are, for example, phosphatase 1, phosphatase 2A or CDC25 inhibitors, such as okadaic acid or a derivative thereof.

[00342] Compounds that induce cell differentiation processes include, but are not limited to, retinoic acid, α-, γ-, or δ-tocopherol, or α-γ- or δ-tocotrienol.

[00343] As used herein, the term “cyclooxygenase inhibitor” includes, but is not limited to, Cox-2 inhibitors, 5-alkyl-2-arylaminophenylacetic acid and derivatives such as celecoxib (Celebrex™), rofecoxib (Vioxx™), etoricoxib, valdecoxib or 5-alkyl-2-arylaminophenylacetic acid such as 5-methyl-2-(2'-chloro-6'-fluoroanilino)phenylacetic acid, lumiracoxib.

[00344] As used herein, the term “bisphosphonates” includes, but is not limited to, etridonic acid, clodronic acid, tiludronic acid, pamidronic acid, alendronic acid, ibandronic acid, risedronic acid, and zoledronic acid. Etridonic acid is sold under the trade name Didronel™. Clodronic acid is sold under the trade name Bonefos™. Tiludronic acid is sold under the trade name Skelid™. Pamidronic acid is sold under the trade name Aredia™. Alendronic acid is sold under the trade name Fosamax™. Ibandronic acid is sold under the trade name Bondranat™. Risedronic acid is sold under the trade name Actonel™. Zoledronic acid is sold under the trade name Zometa™. The term “mTOR inhibitors” refers to compounds that inhibit mammalian target of rapamycin (mTOR) and which have antiproliferative activity, such as sirolimus (Rapamune®), everolimus (Certican™), CCI-779 and ABT578.

[00345] As used herein, the term “heparanase inhibitor” refers to compounds that target, reduce or inhibit the degradation of heparin sulfate. The term includes, but is not limited to, PI-88. As used herein, the term “biological response modifier” refers to lymphokine or interferons.

[00346] The term "oncogenic Ras isoform inhibitor", such as H-Ras, K-Ras or N-Ras, as used herein refers to compounds that target, reduce or inhibit the oncogenic activity of Ras; for example, a “farnesyl transferase inhibitor” such as L-744832, DK8G557 or R115777 (Zarnestra™). The term "telomerase inhibitor" as used herein refers to compounds that target, reduce or inhibit telomerase activity. Compounds that target, reduce or inhibit telomerase activity are, in particular, compounds that inhibit the telomerase receptor, such as telomestatin.

[00347] As used herein, the term “methionine aminopeptidase inhibitor” refers to compounds that target, reduce or inhibit the activity of methionine aminopeptidase. Compounds that target, reduce or inhibit methionine aminopeptidase activity include, but are not limited to, bengamide or a derivative thereof.

[00348] As used herein, the term “proteasome inhibitor” refers to compounds that target, reduce or inhibit the activity of the proteasome. Compounds that target, reduce or inhibit proteasome activity include, but are not limited to, bortezomib (Velcade™) and MLN 341.

[00349] As used herein, a “matrix metalloproteinase inhibitor” or (“MMP inhibitor”) includes, but is not limited to, peptidomimetic and non-peptidomimetic collagen inhibitors, tetracycline derivatives, for example, the hydroxamate peptidomimetic inhibitor batimastat and its orally bioavailable analog marimastat (BB- 2516), prinomastat (AG3340), metastat (NSC 683551), BMS-279251, BAY 12-9566, TAA211, MMI270B or AAJ996.

[00350] As used herein, the term “compounds used in the treatment of hematologic malignancies” includes, but is not limited to, FMS-like tyrosine kinase inhibitors, which are compounds that target, reduce, or inhibit the activity of FMS-like tyrosine kinase receptors (Flt -3R); interferon, 1-β-D-arabinofuransylcytosine (ara-c) and bisulfan; and ALK inhibitors, which are compounds that target, reduce or inhibit anaplastic lymphoma kinase.

[00351] Compounds that target, reduce or inhibit the activity of FMS-like tyrosine kinase receptors (Flt-3R) are, in particular, compounds, proteins or antibodies that inhibit members of the Flt-3R receptor kinase family, such as PKC412, midostaurin , a staurosporine derivative, SU11248 and MLN518.

[00352] As used herein, the term “HSP90 inhibitors” includes, but is not limited to, compounds that target, reduce or inhibit the intrinsic ATPase activity of HSP90; reducing, targeting, reducing or inhibiting HSP90 client proteins through the ubiquitin proteasome pathway. Compounds that target, reduce or inhibit the intrinsic ATPase activity of HSP90 are, in particular, compounds, proteins or antibodies that inhibit the ATPase activity of HSP90, such as 17-allylamino,17-demethoxygeldanamycin (17AAG), a derivative of geldanamycin ; other geldanamycin-related compounds; radicicol and HDAC inhibitors.

[00353] The term "antiproliferative antibodies" as used herein includes, but is not limited to, trastuzumab (Herceptin™), trastuzumab-DM1, Erbitux, bevacizumab (Avastin™), rituximab (Rituxan®), PRO64553 (anti-CD40) and antibody 2C4. Antibodies include intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies formed from at least 2 intact antibodies, and antibody fragments if they exhibit the desired biological activity.

[00354] For the treatment of acute myeloid leukemia (AML), the compounds of the present invention can be used in combination with standard leukemia therapies, especially in combination with therapies used to treat AML. In particular, the compounds of the present invention can be administered in combination, for example, with farnesyltransferase inhibitors and/or other drugs useful for the treatment of AML, such as daunorubicin, adriamycin, Ara-C, VP-16, teniposide, mitoxantrone, idarubicin, carboplatin and PKC412.

[00355] Other antileukemic compounds include, for example, Ara-C, a pyrimidine analogue that is a 2'-alpha-hydroxy-ribose(arabinoside) deoxycytidine derivative. Also included are the purine analogue of hypoxanthine, 6-mercaptopurine (6-MP) and fludarabine phosphate. Compounds that target, reduce, or inhibit the activity of histone deacetylase (HDAC) inhibitors, such as sodium butyrate and suberoylanilide hydroxamic acid (SAHA), inhibit the activity of enzymes known as histone deacetylases. Specific HDAC inhibitors include MS275, SAHA, FK228 (formerly FR901228), trichostatin A and the compounds described in US 6,552,065, including, but not limited to, N-hydroxy-3-[4-[[[2-(2-methyl- 1H-indol-3-yl)-ethyl]-amino]methyl]phenyl]-2E-2-propenamide or a pharmaceutically acceptable salt thereof and N-hydroxy-3-[4-[(2-hydroxyethyl){2-(1H -indol-3-yl)ethyl]-amino]methyl]phenyl]-2E-2-propenamide or a pharmaceutically acceptable salt thereof, especially the lactate salt. Somatostatin receptor antagonists, as used herein, refer to compounds that target, treat, or inhibit the somatostatin receptor, such as octreotide and SOM230. Approaches to damage tumor cells include approaches such as ionizing radiation. The term “ionizing radiation,” mentioned above and below, means ionizing radiation that occurs either as electromagnetic rays (such as X-rays and gamma rays) or particles (such as alpha and beta particles). Ionizing radiation is used in, but is not limited to, radiation therapy and is known in the art. See Hellman, Principles of Radiation Therapy, Cancer, in Principles and Practice of Oncology, Devita et al., Eds., 4th Edition, Vol. 1. pp. 248-275 (1993).

[00356] Also included are EDG-binding drugs and ribonucleotide reductase inhibitors. As used herein, the term “EDG-binding drugs” refers to a class of immunosuppressants that modulate lymphocyte recycling, such as FTY720. The term "ribonucleotide reductase inhibitors" refers to pyrimidine or purine nucleoside analogues, including, but not limited to, fludarabine and/or cytosine arabinoside (ara-C), 6-thioguanine, 5-fluorouracil, cladribine, 6-mercaptopurine (especially in combination with ara-C against ALL (acute lymphocytic leukemia)) and/or pentostatin. Ribonucleotide reductase inhibitors are, in particular, derivatives of hydroxyurea or 2-hydroxy-1H-isoindole-1,3-dione.

[00357] Also particularly included are anti-VEGF compounds, proteins or monoclonal antibodies such as 1-(4-chloroanilino)-4-(4-pyridylmethyl)phthalazine or a pharmaceutically acceptable salt thereof, 1-(4-chloroanilino)-4 -(4-pyridylmethyl)phthalazine succinate; Angiostatin™; Endostatin™; anthranilic acid amides; ZD4190; Zd ₆ 474; SU5416; SU6668; bevacizumab; or anti-VEGF antibodies or anti-VEGF receptor antibodies such as rhuMAb and RHUFab, a VEGF aptamer such as Macugon; FLT-4 inhibitors, FLT-3 inhibitors, anti-VEGFR-2 IgGI antibodies, angiozyme (RPI 4610) and bevacizumab (Avastin™).

[00358] Photodynamic therapy, as used herein, refers to a therapy that uses certain chemicals known as photosensitizing compounds to treat or prevent cancer. Examples of photodynamic therapy include treatment with compounds such as Visudyne™ and sodium porfimer.

[00359] As used herein, the term "angiostatic steroids" refers to compounds that block or inhibit angiogenesis, such as, for example, anecortave, triamcinolone, hydrocortisone, 11-α-epihydrocotisol, cortexolone, 17α-hydroxyprogesterone, corticosterone, deoxycorticosterone, testosterone , estrone and dexamethasone.

[00360] Implants containing corticosteroids include compounds such as fluocinolone and dexamethasone.

[00361] Other chemotherapeutic compounds include, but are not limited to, plant alkaloids, hormonal compounds and antagonists; biological response modifiers, preferably lymphokines or interferons; antisense oligonucleotides or derivatives of oligonucleotides; shRNAs (small hairpin RNAs) or siRNAs; or different compounds or compounds with a different or unknown mechanism of action.

[00362] The structure of active compounds, identified by code numbers, generic names or trade names, can be taken from the current edition of the standard reference book "The Merck Index" or databases such as Patents International (eg, IMS World Publications).

Examples of immuno-oncology agents

[00363] In some embodiments, the one or more other therapeutic agents is an immuno-oncology agent. As used herein, the term “immuno-oncology agent” refers to an agent that is effective to enhance, stimulate and/or enhance immune responses in a subject. In some embodiments, administration of an immuno-oncology agent with a compound of the invention has a synergistic effect in the treatment of cancer.

[00364] The immuno-oncology agent may be, for example, a small molecule drug, antibody, biological or small molecule. Examples of biological immuno-oncology agents include, but are not limited to, cancer vaccines, antibodies, and cytokines. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the monoclonal antibody is humanized or human.

[00365] In some embodiments, the immuno-oncology agent is (i) a stimulatory (including co-stimulatory) receptor agonist or (ii) an inhibitory (including co-inhibitory) signal antagonist on T cells, both of which result in increased antigen-specific T -cellular responses.

[00366] Some of the stimulatory and inhibitory molecules are members of the immunoglobulin superfamily (IgSF). One important family of membrane-bound ligands that bind to co-stimulatory or co-inhibitory receptors is the B7 family, which includes B7-1, B7-2, B7-H1 (PD-L1), B7-DC (PD-L2) , B7-H2 (ICOS-L), B7-H3, B7-H4, B7-H5 (VISTA) and B7-H6. Another family of membrane-bound ligands that bind to co-stimulatory or co-inhibitory receptors is the TNF family of molecules, which bind to related members of the TNF receptor family, which include CD40 and CD40L, OX-40, OX-40L, CD70, CD27L, CD30 , CD30L, 4-1BBL, CD137 (4-1BB), TRAIL/Apo2-L, TRAILR1/DR4, TRAILR2/DR5, TRAILR3, TRAILR4, OPG, RANK, RANKL, TWEAKR/Fn14, TWEAK, BAFFR, EDAR, XEDAR, TACI, APRIL, BCMA, LTβR, LIGHT, DcR3, HVEM, VEGI/TL1A, TRAMP/DR3, EDAR, EDA1, XEDAR, EDA2, TNFR1, lymphotoxin α/TNFβ, TNFR2, TNFα, LTβR, lymphotoxin α1β2, FAS, FASL, RELT, DR6, TROY, NGFR.

[00367] In some embodiments, the immuno-oncology agent is a cytokine that inhibits T cell activation (e.g., IL-6, IL-10, TGF-β, VEGF, and other immunosuppressive cytokines) or a cytokine that stimulates T cell activation , to stimulate the immune response.

[00368] In some embodiments, the combination of a compound of the present invention and an immuno-oncology agent can stimulate T cell responses. In some embodiments, the immuno-oncology agent is: (i) an antagonist of a protein that inhibits T cell activation (eg, immune checkpoint inhibitors), such as CTLA-4, PD-1, PD-L1, PD-L2, LAG- 3, TIM-3, galectin 9, CEACAM-1, BTLA, CD69, galectin-1, TIGIT, CD113, GPR56, VISTA, 2B4, CD48, GARP, PD1H, LAIR1, TIM-1 and TIM-4; or (ii) a protein agonist that stimulates T cell activation, such as B7-1, B7-2, CD28, 4-1BB (CD137), 4-1BBL, ICOS, ICOS-L, OX40, OX40L, GITR, GITRL , CD70, CD27, CD40, DR3 and CD28H.

[00369] In some embodiments, the immuno-oncology agent is an inhibitory receptor antagonist on NK cells or an activating receptor agonist on NK cells. In some embodiments, the immuno-oncology agent is a KIR antagonist, such as lirilumab.

[00370] In some embodiments, the immuno-oncology agent is an agent that inhibits or depletes macrophages or monocytes, including, but not limited to, CSF-1R antagonists, such as CSF-1R antagonist antibodies, including RG7155 (WO11/70024, WO11/ 107553, WO11/131407, WO13/87699, WO13/119716, WO13/132044) or FPA-008 (WO11/140249; WO13169264; WO14/036357).

[00371] In some embodiments, the immuno-oncology agent is selected from agonistic agents that bind positive co-stimulatory receptors, blocking agents that attenuate signaling through inhibitory receptors, antagonists, and one or more agents that systemically increase the frequency of anti-tumor T cells, agents that overcome various immunosuppressive pathways in the tumor microenvironment (eg, block inhibitory receptor interaction (eg, PD-L1/PD-1 interaction), deplete or inhibit Tregs (eg, using anti-CD25 monoclonal antibodies (eg, daclizumab) or by ex vivo anti-CD25 granular depletion), inhibit metabolic enzymes such as IDO, or reverse/prevent T cell energy or exhaustion), and agents that trigger innate immune activation and/or inflammation at tumor sites.

[00372] In some embodiments, the immuno-oncology agent is a CTLA-4 antagonist. In some embodiments, the CTLA-4 antagonist is an anti-CTLA-4 antagonist antibody. In some embodiments, the anti-CTLA-4 antagonist antibody is YERVOY (ipilimumab) or tremelimumab.

[00373] In some embodiments, the immuno-oncology agent is a PD-1 antagonist. In some embodiments, the PD-1 antagonist is administered by infusion. In some embodiments, the immuno-oncology agent is an antibody or an antigen-binding portion thereof that specifically binds to programmed death-1 (PD-1) receptor and inhibits PD-1 activity. In some embodiments, the PD-1 antagonist is an anti-PD-1 antagonist antibody. In some embodiments, the anti-PD-1 antagonist antibody is OPDIVO (nivolumab), KEYTRUDA (pembrolizumab), or MEDI-0680 (AMP-514; WO2012/145493). In some embodiments, the immuno-oncology agent may be pidilizumab (CT-011). In some embodiments, the immuno-oncology agent is a recombinant protein consisting of a PD-L2 extracellular domain (B7-DC) fused to the Fc portion of IgG1, called AMP-224.

[00374] In some embodiments, the immuno-oncology agent is a PD-L1 antagonist. In some embodiments, the PD-L1 antagonist is an anti-PD-L1 antagonist antibody. In some embodiments, the anti-PD-L1 antibody is MPDL3280A (RG7446; WO2010/077634), durvalumab (MEDI4736), BMS-936559 (WO2007/005874), and MSB0010718C (WO2013/79174).

[00375] In some embodiments, the immuno-oncology agent is a LAG-3 antagonist. In some embodiments, the LAG-3 antagonist is an anti-LAG-3 antagonist antibody. In some embodiments, the anti-LAG3 antibody is BMS-986016 (WO10/19570, WO14/08218) or IMP-731 or IMP-321 (WO08/132601, WO009/44273).

[00376] In some embodiments, the immuno-oncology agent is a CD137 (4-1BB) agonist. In some embodiments, the CD137 agonist (4-1BB) is an anti-CD137 agonist antibody. In some embodiments, the anti-CD137 antibody is urelumab or PF-05082566 (WO12/32433).

[00377] In some embodiments, the immuno-oncology agent is a GITR agonist. In some embodiments, the GITR agonist is an anti-GITR agonist antibody. In some embodiments, the anti-GITR antibody is BMS-986153, BMS-986156, TRX-518 (WO006/105021, WO009/009116), or MK-4166 (WO11/028683).

[00378] In some embodiments, the immuno-oncology agent is an indoleamine (2,3)-dioxygenase (IDO) antagonist. In some embodiments, the IDO antagonist is selected from epacadostat (INCB024360, Incyte); indoximod (NLG-8189, NewLink Genetics Corporation); capmanitib (INC280, Novartis); GDC-0919 (Genentech/Roche); PF-06840003 (Pfizer); BMS:F001287 (Bristol-Myers Squibb); Phy906/KD108 (Phytoceutica); an enzyme that breaks down kynurenine (Kynase, Kyn Therapeutics); and NLG-919 (WO09/73620, WO009/1156652, WO11/56652, WO12/142237).

[00379] In some embodiments, the immuno-oncology agent is an OX40 agonist. In some embodiments, the OX40 agonist is an OX40 agonist antibody. In some embodiments, the anti-OX40 antibody is MEDI-6383 or MEDI-6469.

[00380] In some embodiments, the immuno-oncology agent is an OX40L antagonist. In some embodiments, the OX40L antagonist is an OX40 antagonist antibody. In some embodiments, the OX40L antagonist is RG-7888 (WO06/029879).

[00381] In some embodiments, the immuno-oncology agent is a CD40 agonist. In some embodiments, the CD40 agonist is an anti-CD40 agonist antibody. In some embodiments, the immuno-oncology agent is a CD40 antagonist. In some embodiments, the CD40 antagonist is an anti-CD40 antagonist antibody. In some embodiments, the anti-CD40 antibody is lucatumumab or dacetuzumab.

[00382] In some embodiments, the immuno-oncology agent is a CD27 agonist. In some embodiments, the CD27 agonist is an anti-CD27 agonist antibody. In some embodiments, the anti-CD27 antibody is varlilumab.

[00383] In some embodiments, the immuno-oncology agent is MGA271 (to B7H3) (WO11/109400).

[00384] In some embodiments, the immuno-oncology agent is abagovomab, adecatumumab, afutuzumab, alemtuzumab, anatumomab, mafenatox, apolizumab, atezolimab, avelumab, blinatumomab, BMS-936559, catumaxomuzab, durvalumab, epacadostat, epratuzumab, indoximod, and notuzumab ozogamicin, intelumumab, ipilimumab, isatuximab, lambrolizumab, MED14736, MPDL3280A, nivolumab, obinutuzumab, ocaratuzumab, ofatumumab, olatatumab, pembrolizumab, pidilizumab, rituximab, ticilimumab, samalizumab, or tremelimumab.

[00385] In some embodiments, the immuno-oncology agent is an immunostimulant agent. For example, antibodies that block the PD-1 and PD-L1 axes of inhibition can release activated tumor-reactive T cells and have been shown in clinical trials to induce durable antitumor responses in a growing number of tumor histologies, including some tumor types which were not generally considered sensitive to immunotherapy. See, for example, Okazaki, T. et al. (2013) Nat. Immunol. 14, 1212-1218; Zou et al. (2016) Sci. Transl. Med. 8. The anti-PD-1 antibody nivolumab (Opdivo®, Bristol-Myers Squibb, also known as ONO-4538, MDX1106 and BMS-936558) has shown potential to improve overall survival in patients with RCC (renal cell carcinoma) in whom disease progression was observed during or after previous antiangiogenic therapy.

[00386] In some embodiments, the immunomodulatory therapeutic agent specifically induces apoptosis of tumor cells. Approved immunomodulatory therapeutic agents that can be used in the present invention include pomalidomide (Pomalyst®, Celgene); lenalidomide (Revlimid®, Celgene); ingenol mebutate (Picato®, LEO Pharma).

[00387] In some embodiments, the immuno-oncology agent is a cancer vaccine. In some embodiments, the cancer vaccine is selected from sipuleucel-T (Provenge®, Dendreon/Valeant Pharmaceuticals), which has been approved for the treatment of asymptomatic or minimally symptomatic metastatic castration-resistant (hormone-resistant) prostate cancer; and talimogene laherparepvec (Imlygic®, BioVex/Amgen, formerly known as T-VEC), a genetically modified oncolytic viral therapy approved for the treatment of unresectable cutaneous, subcutaneous and nodular lesions in melanoma. In some embodiments, the immuno-oncology agent is selected from an oncolytic viral therapy such as pexastimogen devacirepvec (PexaVec/JX-594, SillaJen/formerly Jennerex Biotherapeutics), a thymidine kinase (TK)-deficient vaccinia virus engineered to express GM-CSF, for hepatocellular carcinoma (NCT02562755) and melanoma (NCT00429312); pelareorep (Reolysin®, Oncolytics Biotech), a respiratory enteric orphan virus (reovirus) variant that does not replicate in non-RAS activated cells in many cancers, including colorectal cancer (NCT01622543); prostate cancer (NCT01619813); squamous cell carcinoma of the head and neck (NCT01166542); pancreatic adenocarcinoma (NCT00998322) and non-small cell lung cancer (NSCLC) (NCT 00861627); enadenotucirev (NG-348, PsiOxus, formerly known as ColoAd1), an adenovirus engineered to express full-length CD80 and a CD3 T-cell receptor protein-specific antibody fragment in ovarian cancer (NCT02028117); metastatic or advanced epithelial tumors such as colorectal cancer, bladder cancer, squamous cell carcinoma of the head and neck and salivary gland cancer (NCT02636036); ONCOS-102 (Targovax/formerly Oncos), an adenovirus engineered to express GM-CSF, in melanoma (NCT03003676) and peritoneal, colorectal, or ovarian cancer (NCT02963831); GL-ONC1 (GLV-1h68/GLV-1h153, Genelux GmbH), vaccinia viruses engineered to express human beta-galactosidase (beta-gal)/beta-glucuronidase or beta-gal/sodium iodide symporter (hNIS), respectively, were studied for peritoneal carcinomatosis (NCT01443260); fallopian tube cancer, ovarian cancer (NCT 02759588); or CG0070 (Cold Genesys), an adenovirus engineered to express GM-CSF in bladder cancer (NCT02365818).

[00388] In some embodiments, the immuno-oncology agent is selected from JX-929 (SillaJen/formerly Jennerex Biotherapeutics), a TK-deficient vaccinia virus and vaccinia growth factor engineered to express a cytosine deaminase that is capable of converting the prodrug 5-fluorocytosine into the cytotoxic drug 5- fluorouracil; TG01 and TG02 (Targovax/formerly Oncos), peptide immunotherapy agents targeting difficult-to-treat RAS mutations; and TILT-123 (TILT Biotherapeutics), an engineered adenovirus designated: Ad5/3-E2F-delta24-hTNFα-IRES-hIL20; and VSV-GP (ViraTherapeutics), a vesicular stomatitis virus (VSV) engineered to express the lymphocytic choriomeningitis virus (LCMV) glycoprotein (GP), which can be further engineered to express antigens designed to enhance antigen-specific CD8+ T cell responses.

[00389] In some embodiments, the immuno-oncology agent is a T cell engineered to express a chimeric antigen receptor or CAR. T cells engineered to express this chimeric antigen receptor are called CAR-T cells.

[00390] CARs are constructed that consist of binding domains that can be derived from natural ligands, single chain variable fragments (scFvs) derived from monoclonal antibodies specific for cell surface antigens fused to endodomains that are the functional end of the T cell receptor ( TCR), such as the CD3-zeta signaling domain of the TCR, which is capable of generating an activation signal in T lymphocytes. Upon antigen binding, such CARs bind to endogenous signaling pathways in the effector cell and generate activating signals similar to those initiated by the TCR complex.

[00391] For example, in some embodiments, the CAR-T cell is one of those described in US Pat. No. 8,906,682 (June; hereby incorporated by reference in its entirety), which discloses CAR-T cells engineered to they comprised an extracellular domain having an antigen binding domain (such as the domain that binds CD19) fused to an intracellular signaling domain of the T cell antigen receptor complex zeta chain (eg, CD3 zeta). When expressed in a T cell, CAR is capable of redirecting antigen recognition based on antigen binding specificity. In the case of CD19, the antigen is expressed on malignant B cells. There are currently more than 200 CAR-T clinical trials underway across a wide range of indications [https://clinicaltrials.gov/ct2/results?term=chimeric+antigen+receptors&pg=1].

[00392] In some embodiments, the immunostimulant agent is an activator of retinoic acid receptor-related orphan γ (RORγt). RORγt is a transcription factor that plays a key role in the differentiation and maintenance of type 17 effector subsets of CD4+ (Th17) and CD8+ (Tc17) T cells, as well as in the differentiation of IL-17 expressing subsets of innate immune cells such as NK cells . In some embodiments, the RORγt activator is LYC-55716 (Lycera), which is currently in clinical trials for the treatment of solid tumors (NCT02929862).

[00393] In some embodiments, the immunostimulant agent is a toll-like receptor (TLR) agonist or activator. Suitable TLR activators include a TLR9 agonist or activator such as SD-101 (Dynavax). SD-101 is an immunostimulatory CpG that is being studied in B cell, follicular and other lymphomas (NCT02254772). TLR8 agonists or activators that can be used in the present invention include motolimod (VTX-2337, VentiRx Pharmaceuticals), which is being studied for the treatment of head and neck squamous cell carcinoma (NCT02124850) and ovarian cancer (NCT02431559).

[00394] Other immuno-oncology agents that can be used in the present invention include urelumab (BMS-663513, Bristol-Myers Squibb), an anti-CD137 monoclonal antibody; Varlilumab (CDX-1127, Celldex Therapeutics), an anti-CD27 monoclonal antibody; BMS-986178 (Bristol-Myers Squibb), an anti-OX40 monoclonal antibody; lirilumab (IPH2102/BMS-986015, Innate Pharma, Bristol-Myers Squibb), an anti-KIR monoclonal antibody; monalizumab (IPH2201, Innate Pharma, AstraZeneca), a monoclonal antibody against NKG2A; andecaliximab (GS-5745, Gilead Sciences), an anti-MMP9 antibody; MK-4166 (Merck & Co.), a monoclonal antibody against GITR.

[00395] In some embodiments, the immunostimulatory agent is selected from elotuzumab, mifamurtide, a toll-like receptor agonist or activator, and a RORγt activator.

[00396] In some embodiments, the immunostimulatory therapeutic agent is recombinant human interleukin 15 (rhIL-15). rhIL-15 has been tested in the clinic for the treatment of melanoma and renal cell carcinoma (NCT01021059 and NCT01369888) and leukemia (NCT02689453). In some embodiments, the immunostimulatory agent is recombinant human interleukin 12 (rhIL-12). In some embodiments, the IL-15 immunotherapy drug is heterodimeric IL-15 (hetIL-15, Novartis/Admune), a fusion complex consisting of a synthetic form of endogenous IL-15 complexed with a soluble IL-15-binding alpha chain IL-15 receptor protein (IL15:sIL-15RA), which was tested in phase 1 clinical trials for melanoma, renal cell carcinoma, non-small cell lung cancer and squamous cell carcinoma of the head and neck (NCT02452268). In some embodiments, the recombinant human interleukin 12 (rhIL-12) is NM-IL-12 (Neumedicines, Inc.), NCT02544724 or NCT02542124.

[00397] In some embodiments, the immuno-oncology agent is selected from the agents described in Jerry L. Adams ET. AL., “Big opportunities for small molecules in immuno-oncology”, Cancer Therapy 2015, Vol. 14, p. 603-622, which is incorporated herein by reference in its entirety. In some embodiments, the immuno-oncology agent is selected from the examples described in Table 1 by Jerry L. Adams ET. AL. In some embodiments, the immuno-oncology agent is a small molecule targeting an immune-oncology target selected from those listed in Jerry L. Adams ET Table 2. AL. In some embodiments, the immuno-oncology agent is a small molecule agent selected from those listed in Jerry L. Adams ET Table 2. AL.

[00398] In some embodiments, the immuno-oncology agent is selected from the small molecule immuno-oncology agents described in Peter L. Toogood, “Small molecule immuno-oncology therapeutic agents,” Bioorganic & Medicinal Chemistry Letters 2018, Vol. 28, p. 319-329, which are incorporated herein by reference in their entirety. In some embodiments, the immuno-oncology agent is an agent that targets signaling pathways, as described by Peter L. Toogood.

[00399] In some embodiments, the immuno-oncology agent is selected from those described in Sandra L. Ross et al., “Bispecific T cell engager (BiTE®) antibody constructs can mediate bystander tumor cell killing,” PLoS ONE 12(8): e0183390 , which are incorporated herein by reference in their entirety. In some embodiments, the immuno-oncology agent is a bispecific T-cell recruiting antibody (BiTE®) construct. In some embodiments, the bispecific T cell engagement (BiTE®) antibody construct is a CD19/CD3 bispecific antibody construct. In some embodiments, the bispecific T cell engagement (BiTE®) antibody construct is an EGFR/CD3 bispecific antibody construct. In some embodiments, the bispecific T cell-engaging antibody (BiTE®) construct activates T cells. In some embodiments, a bispecific T cell-attracting antibody (BiTE®) construct activates T cells that release cytokines that cause upregulation of intercellular adhesion molecule 1 (ICAM-1) and FAS on bystander cells. In some embodiments, the bispecific T cell-engaging antibody (BiTE®) construct activates T cells, resulting in induced lysis of bystander cells. In some embodiments, the bystander cells are located in solid tumors. In some embodiments, the bystander cells to be lysed are adjacent to the activated BiTE® T cells. In some embodiments, the bystander cells include cancer cells negative for tumor-associated antigen (TAA). In some embodiments, the bystander cells include EGFR-negative cancer cells. In some embodiments, the immuno-oncology agent is an antibody that blocks the PD-L1/PD1 and/or CTLA4 axis. In some embodiments, the immuno-oncology agent is an ex-vivo expanded tumor-infiltrating T cell. In some embodiments, the immuno-oncology agent is a bispecific antibody construct or chimeric antigen receptors (CARs) that directly bind T cells to tumor-associated surface antigens (TAAs).

Examples of immune checkpoint inhibitors

[00400] In some embodiments, the immuno-oncology agent is an immune checkpoint inhibitor, as described herein.

[00401] As used herein, the term “checkpoint inhibitor” refers to agents useful for preventing cancer cells from evading a patient's immune system. One of the main mechanisms by which antitumor immunity is undermined is known as “T cell exhaustion,” which occurs as a result of chronic exposure to antigens that has resulted in upregulation of inhibitory receptors. These inhibitory receptors serve as immune checkpoints to prevent uncontrolled immune responses.

[00402] PD-1 and co-inhibitory receptors such as cytotoxic T-lymphocyte antigen 4 (CTLA-4, B and T-lymphocyte attenuator (BTLA; CD272), T-cell immunoglobulin and mucin domain-3 (Tim-3 ), lymphocyte activation gene-3 (Lag-3; CD223), and others, are often called checkpoint regulators. They act as molecular gatekeepers that allow extracellular information to dictate whether cell cycle progression and other intracellular signaling processes should continue.

[00403] In some embodiments, the immune checkpoint inhibitor is an anti-PD-1 antibody. PD-1 binds to the programmed cell death receptor 1 (PD-1) to prevent the receptor from binding to the inhibitory ligand PDL-1, thereby suppressing the ability of tumors to suppress the host antitumor immune response.

[00404] In one aspect, a checkpoint inhibitor is a biological therapeutic agent or small molecule. In another aspect, the checkpoint inhibitor is a monoclonal antibody, a humanized antibody, a fully human antibody, a fusion protein, or a combination thereof. In a further aspect, the checkpoint inhibitor inhibits a checkpoint protein selected from CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN -15049, CHK 1, CHK2, A2aR, B-7 family ligands, or combinations thereof. In an additional aspect, the checkpoint inhibitor interacts with a checkpoint protein ligand selected from CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160 , CGEN-15049, CHK 1, CHK2, A2aR, B-7 family ligands, or combinations thereof. In one aspect, the checkpoint inhibitor is an immunostimulant, T cell growth factor, interleukin, antibody, vaccine, or a combination thereof. In a further aspect, the interleukin is IL-7 or IL-15. In a particular aspect, interleukin is glycosylated IL-7. In a further aspect, the vaccine is a dendritic cell (DC) vaccine.

[00405] Checkpoint inhibitors include any agent that blocks or inhibits in a statistically significant manner inhibitory pathways of the immune system. Such inhibitors may include small molecule inhibitors or may include antibodies or antigen-binding fragments thereof that bind to and block or inhibit immune checkpoint receptors, or antibodies that bind to and block or inhibit ligands of immune checkpoint receptors. Exemplary checkpoint molecules that may be targeted for blocking or inhibition include, but are not limited to, CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, GAL9, LAG3, TIM3, VISTA, KIR , 2B4 (belongs to the CD2 family of molecules and is expressed on all NK, γδ and memory CD8+ (αβ) T cells), CD160 (also referred to as BY55), CGEN-15049, CHK 1 and CHK2 kinases, A2aR and various B family ligands -7. B7 family ligands include, but are not limited to, B7-1, B7-2, B7-DC, B7-H1, B7-H2, B7-H3, B7-H4, B7-H5, B7-H6, and B7-H7. Checkpoint inhibitors include antibodies or antigen-binding fragments thereof, other binding proteins, biological therapeutics, or small molecules that bind to and block or inhibit the activity of one or more of CTLA-4, PDL1, PDL2, PD1, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160 and CGEN-15049. Exemplary immune checkpoint inhibitors include tremelimumab (CTLA-4 blocking antibody), anti-OX40, anti-PD-L1 monoclonal antibody (anti-B7-H1; MEDI4736), MK-3475 (PD-1 blocker), nivolumab (anti-PD1 antibody ), CT-011 (anti-PDL antibody), monoclonal antibody BY55, AMP224 (anti-PDL1 antibody), BMS-936559 (anti-PDL1 antibody), MPLDL3280A (anti-PDL1 antibody), MSB0010718C (anti-PDL1 antibody), and ipilimumab (anti-CTLA -4 checkpoint inhibitor). Checkpoint protein ligands include, but are not limited to, PD-L1, PD-L2, B7-H3, B7-H4, CD28, CD86, and TIM-3.

[00406] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antagonist, a PD-L1 antagonist, and a CTLA-4 antagonist. In some embodiments, the checkpoint inhibitor is selected from the group consisting of nivolumab (Opdivo®), ipilimumab (Yervoy®), and pembrolizumab (Keytruda®). In some embodiments, the checkpoint inhibitor is selected from nivolumab (anti-PD-1 antibody, Opdivo®, Bristol-Myers Squibb); pembrolizumab (anti-PD-1 antibody, Keytruda®, Merck); ipilimumab (anti-CTLA-4 antibody, Yervoy®, Bristol-Myers Squibb); durvalumab (anti-PD-L1 antibody, Imfinzi®, AstraZeneca) and atezolizumab (anti-PD-L1 antibody, Tecentriq®, Genentech).

[00407] In some embodiments, the checkpoint inhibitor is selected from the group consisting of lambrolizumab (MK-3475), nivolumab (BMS-936558), pidilizumab (CT-011), AMP-224, MDX-1105, MEDI4736, MPDL3280A, BMS -936559, ipilimumab, lirlumab, IPH2101, pembrolizumab (Keytruda®), and tremelimumab.

[00408] In some embodiments, the immune checkpoint inhibitor is REGN2810 (Regeneron), an anti-PD-1 antibody tested in patients with basal cell carcinoma (NCT03132636); NSCLC (NCT03088540); cutaneous squamous cell carcinoma (NCT02760498); lymphoma (NCT02651662) and melanoma (NCT03002376); pidilizumab (CureTech), also known as CT-011, an antibody that binds to PD-1, in clinical trials for diffuse large B-cell lymphoma and multiple myeloma; avelumab (Bavencio®, Pfizer/Merck KGaA), also known as MSB0010718C), a fully human IgG1 anti-PD-L1 antibody, in clinical trials for non-small cell lung cancer, Merkel cell carcinoma, mesothelioma, solid tumors, kidney cancer, ovarian cancer, cancer bladder, head and neck and stomach cancer; or PDR001 (Novartis), an inhibitory antibody that binds to PD-1, in clinical trials for non-small cell lung cancer, melanoma, triple-negative breast cancer, and advanced or metastatic solid tumors. Tremelimumab (CP-675,206; Astrazeneca) is a fully human anti-CTLA-4 monoclonal antibody that has been studied in clinical trials for a number of indications including: mesothelioma, colorectal cancer, kidney cancer, breast cancer, lung cancer and non-small cell lung cancer. pancreatic duct adenocarcinoma, pancreatic cancer, germ cell cancer, squamous cell carcinoma of the head and neck, hepatocellular carcinoma, prostate cancer, endometrial cancer, metastatic liver cancer, liver cancer, large B-cell lymphoma, ovarian cancer, cervical cancer, metastatic anaplastic thyroid cancer, urothelial cancer, fallopian tube cancer, multiple myeloma, bladder cancer, soft tissue sarcoma and melanoma. AGEN-1884 (Agenus) is an anti-CTLA4 antibody that is being studied in a phase 1 clinical trial for advanced solid tumors (NCT02694822).

[00409] In some embodiments, the checkpoint inhibitor is a T-cell immunoglobulin mucin-containing protein 3 (TIM-3) inhibitor. TIM-3 inhibitors that can be used in the present invention include TSR-022, LY3321367 and MBG453. TSR-022 (Tesaro) is an anti-TIM-3 antibody that is being studied in solid tumors (NCT02817633). LY3321367 (Eli Lilly) is an anti-TIM-3 antibody being studied in solid tumors (NCT03099109). MBG453 (Novartis) is an anti-TIM-3 antibody that is being studied in common malignancies (NCT02608268).

[00410] In some embodiments, the checkpoint inhibitor is an immunoreceptor T cell inhibitor with Ig and ITIM or TIGIT domains, an immune receptor for certain T cells and NK cells. TIGIT inhibitors that can be used in the present invention include BMS-986207 (Bristol-Myers Squibb), an anti-TIGIT monoclonal antibody (NCT02913313); OMP-313M32 (Oncomed) and anti-TIGIT monoclonal antibody (NCT03119428).

[00411] In some embodiments, the checkpoint inhibitor is a lymphocyte activation gene-3 (LAG-3) inhibitor. LAG-3 inhibitors that can be used in the present invention include BMS-986016, and REGN3767, and IMP321. BMS-986016 (Bristol-Myers Squibb), an anti-LAG-3 antibody, is being studied in glioblastoma and gliosarcoma (NCT02658981). REGN3767 (Regeneron) is also an anti-LAG-3 antibody being studied in cancer (NCT03005782). IMP321 (Immutep S.A.) is a LAG-3-Ig fusion protein studied in melanoma (NCT02676869); adenocarcinoma (NCT02614833) and metastatic breast cancer (NCT00349934).

[00412] Checkpoint inhibitors that can be used in the present invention include OX40 agonists. OX40 agonists being studied in clinical trials include PF-04518600/PF-8600 (Pfizer), an anti-OX40 agonist antibody, in metastatic kidney cancer (NCT03092856) and advanced cancers and neoplasms (NCT02554812; NCT05082566); GSK3174998 (Merck), an agonistic anti-OX40 antibody, in a phase 1 cancer trial (NCT02528357); MEDI0562 (Medimmune/AstraZeneca), an agonistic anti-OX40 antibody, for advanced solid tumors (NCT02318394 and NCT02705482); MEDI6469, an agonistic anti-OX40 antibody (Medimmune/AstraZeneca), in patients with colorectal cancer (NCT02559024), breast cancer (NCT01862900), head and neck cancer (NCT02274155), and metastatic prostate cancer (NCT01303705); and BMS-986178 (Bristol-Myers Squibb), an agonistic anti-OX40 antibody, in advanced cancers (NCT02737475).

[00413] Checkpoint inhibitors that can be used in the present invention include CD137 agonists (also called 4-1BB). CD137 agonists being studied in clinical trials include utomilumab (PF-05082566, Pfizer), an agonistic anti-CD137 antibody, in diffuse large B-cell lymphoma (NCT02951156) and in advanced cancers and neoplasms (NCT02554812 and NCT05082566); urelumab (BMS-663513, Bristol-Myers Squibb), an agonistic anti-CD137 antibody, in melanoma and skin cancer (NCT02652455) and glioblastoma and gliosarcoma (NCT02658981).

[00414] Checkpoint inhibitors that can be used in the present invention include CD27 agonists. CD27 agonists being studied in clinical trials include varlilumab (CDX-1127, Celldex Therapeutics), an anti-CD27 agonist antibody, in head and neck squamous cell carcinoma, ovarian carcinoma, colorectal cancer, renal cell carcinoma, and glioblastoma (NCT02335918); lymphomas (NCT01460134); both glioma and astrocytoma (NCT02924038).

[00415] Checkpoint inhibitors that can be used in the present invention include glucocorticoid-induced tumor necrosis factor receptor (GITR) agonists. GITR agonists being studied in clinical trials include TRX518 (Leap Therapeutics), an agonistic antibody against GITR, in malignant melanoma and other malignant solid tumors (NCT01239134 and NCT02628574); GWN323 (Novartis), an agonistic anti-GITR antibody, in solid tumors and lymphomas (NCT 02740270); INCAGN01876 (Incyte/Agenus), an agonistic anti-GITR antibody, for advanced cancers (NCT02697591 and NCT03126110); MK-4166 (Merck), an agonistic anti-GITR antibody, in solid tumors (NCT02132754) and MEDI1873 (Medimmune/AstraZeneca), an agonistic hexameric GITR ligand molecule with the human IgG1 Fc domain, in advanced solid tumors (NCT02583165).

[00416] Checkpoint inhibitors that can be used in the present invention include inducible T cell costimulator (ICOS, also known as CD278) agonists. ICOS agonists being studied in clinical trials include MEDI-570 (Medimmune), an anti-ICOS agonist antibody, in lymphomas (NCT02520791); GSK3359609 (Merck), an agonistic anti-ICOS antibody, in phase 1 (NCT02723955); JTX-2011 (Jounce Therapeutics), an agonistic anti-ICOS antibody, is in phase 1 (NCT02904226).

[00417] Checkpoint inhibitors that can be used in the present invention include killer IgG-like receptor (KIR) inhibitors. KIR inhibitors being studied in clinical trials include lirilumab (IPH2102/BMS-986015, Innate Pharma/Bristol-Myers Squibb), an anti-KIR antibody in leukemia (NCT01687387, NCT02399917, NCT02481297, NCT02599649), multiple myeloma (NCT022522 63) and lymphoma (NCT01592370); IPH2101 (1-7F9, Innate Pharma) in myeloma (NCT01222286 and NCT01217203) and IPH4102 (Innate Pharma), an anti-KIR antibody that binds to three long cytoplasmic tail domains (KIR3DL2), in lymphoma (NCT02593045).

[00418] Checkpoint inhibitors that can be used in the present invention include CD47 inhibitors of the interaction between CD47 and signal regulatory protein alpha (SIRPa). CD47/SIRPa inhibitors being studied in clinical trials include ALX-148 (Alexo Therapeutics), an antagonistic variant (SIRPa) that binds to CD47 and prevents CD47/SIRPa-mediated signaling (NCT03013218) in phase 1; TTI-621 (SIRPa-Fc, Trillium Therapeutics), a soluble recombinant fusion protein created by linking the N-terminal CD47 binding domain of SIRPa to the Fc domain of human IgG1, acts by binding to human CD47 and interfering with its delivery of the "don't eat" signal ( “do not eat”) to macrophages, is undergoing clinical trials in phase 1 (NCT02890368 and NCT02663518); CC-90002 (Celgene), an anti-CD47 antibody, in leukemia (NCT02641002) and Hu5F9-G4 (Forty Seven, Inc.) in colorectal neoplasms and solid tumors (NCT02953782), acute myeloid leukemia (NCT02678338), and lymphoma (NCT02953509).

[00419] Checkpoint inhibitors that can be used in the present invention include CD73 inhibitors. CD73 inhibitors being studied in clinical trials include MEDI9447 (Medimmune), an anti-CD73 antibody, in solid tumors (NCT02503774) and BMS-986179 (Bristol-Myers Squibb), an anti-CD73 antibody, in solid tumors (NCT02754141).

[00420] Checkpoint inhibitors that can be used in the present invention include agonists of the stimulator of interferon genes (STING, also known as transmembrane protein 173 or TMEM173). STING agonists being studied in clinical trials include MK-1454 (Merck), an agonistic synthetic cyclic dinucleotide, in lymphoma (NCT03010176) and ADU-S100 (MIW815, Aduro Biotech/Novartis), an agonistic synthetic cyclic dinucleotide, in phase 1 (NCT02675439 and NCT03172936).

[00421] Checkpoint inhibitors that can be used in the present invention include CSF1R inhibitors. CSF1R inhibitors being studied in clinical trials include pexidartinib (PLX3397, Plexxikon), a small molecule CSF1R inhibitor in colorectal cancer, pancreatic cancer, metastatic and advanced cancer (NCT02777710) and melanoma, non-small cell lung cancer, squamous cell carcinoma of the head and neck, stromal tumor gastrointestinal tract (GIST) and ovarian cancer (NCT02452424), and IMC-CS4 (LY3022855, Lilly), an anti-CSF-1R antibody, in pancreatic cancer (NCT03153410), melanoma (NCT03101254) and solid tumors (NCT02718911); and BLZ945 (4-[2((1R,2R)-2-hydroxycyclohexylamino)-benzothiazol-6-yloxyl]-pyridine-2-carboxylic acid methylamide, Novartis), an orally available CSF1R inhibitor, for advanced solid tumors (NCT02829723).

[00422] Checkpoint inhibitors that can be used in the present invention include NKG2A receptor inhibitors. NKG2A receptor inhibitors being studied in clinical trials include monalizumab (IPH2201, Innate Pharma), an anti-NKG2A antibody in head and neck neoplasms (NCT02643550) and chronic lymphocytic leukemia (NCT02557516).

[00423] In some embodiments, the immune checkpoint inhibitor is selected from nivolumab, pembrolizumab, ipilimumab, avelumab, durvalumab, atezolizumab, or pidilizumab.

[00424] In addition to the methods of prevention and/or treatment as described above, the present invention also provides corresponding use for the prevention and/or treatment of a disease, disorder or condition as described herein. In some embodiments, the present invention provides the use of a compound or a pharmaceutically acceptable salt thereof, as described herein, for the prevention and/or treatment of a viral infection, or an inflammatory disease, disorder or condition, or cancer, as described herein. In some embodiments, use for the prevention and/or treatment of HIV infection as provided by the invention is for a patient in whom the presence and/or expression level of an HIV splice variant as a biomarker is measured and/or monitored using the methods described herein . In some embodiments, use for the prevention and/or treatment of an inflammatory disease, disorder or condition, or cancer, as provided in the invention, is for a patient in whom the presence and/or expression level of spliced long non-coding RNA at the miR-124 locus as a biomarker is measured and/or is monitored by the methods described in this application.

[00425] This application further provides a compound of formulas I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc or IVd, as defined above, or pharmaceutically acceptable salts thereof, for use in the treatment of or preventing an inflammatory disease, disorder or condition or cancer in a patient in need thereof. In some embodiments, a compound of formulas I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc, or IVd as defined above, or pharmaceutically acceptable salts thereof, for use as an anti-inflammatory agent intended for patients in whom the presence and/or expression level of spliced long non-coding RNA at the miR-124 locus is monitored in a blood and/or tissue sample of the specified patient before and/or during the specified use.

[00426] This application further provides a compound of formulas I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc or IVd, as defined above, or pharmaceutically acceptable salts thereof, for use in the treatment of HIV infection in a patient in need. In some embodiments, compounds of formulas I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc, or IVd, as defined above, or pharmaceutically acceptable salts thereof, for use as a treatment for HIV , intended for patients in whom the presence and/or level of expression of an HIV splice variant is monitored in a blood and/or tissue sample of the specified patient during the specified use.

Additional exemplary embodiments:

1. Method of using HIV splice variant with SEQ. ID. No. 1 as a biomarker of HIV infection or the effectiveness of therapeutic treatment for HIV infection, including measuring the presence or level of expression of an HIV splice variant with SEQ. ID. No. 1 in a biological sample.

2. A method for assessing the biological effect of a compound in the treatment of HIV infection, comprising measuring the presence or expression level of an HIV splice variant with SEQ. ID. No. 1 as a biomarker of HIV infection.

3. A method of screening a compound or vaccine for the prevention and/or treatment of HIV infection, comprising measuring the presence or expression level of an HIV splice variant with SEQ. ID. No. 1 as a biomarker of HIV infection.

4. A method of treating HIV infection, comprising administering therapeutic treatment to a patient and measuring and/or monitoring the presence and/or level of expression of an HIV splice variant with SEQ. ID. No. 1 in a patient.

5. A method of using lncRNA 0599-205 at the miR-124-1 locus as a biomarker of an inflammatory disease, disorder or condition or cancer or the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition or cancer, including measuring the presence or expression level of lncRNA 0599-205 in miR-124-1 locus in a biological sample.

6. A method of assessing the biological effect of a compound or medical device in the treatment of an inflammatory disease, disorder or condition or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker of the inflammatory disease, disorder or condition or cancer.

7. A method of screening a compound or medical device for the treatment of an inflammatory disease, disorder or condition or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker of the inflammatory disease, disorder or condition or cancer.

8. A method of treating an inflammatory disease, disorder or condition or cancer, comprising administering a therapeutic treatment to a patient and measuring and/or monitoring the presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.

9. A method of treating an inflammatory disease, disorder or condition or cancer, comprising administering a therapeutic treatment to a patient and measuring and/or monitoring the presence and/or expression level of miR-124 in the patient.

10. A method of selecting a patient for therapeutic treatment of an inflammatory disease, disorder or condition or cancer, comprising measuring and/or monitoring the presence and/or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.

11. A method for selecting a patient for therapeutic treatment, including measuring and/or monitoring the presence and/or expression level of miR-124 in the patient.

12. The method according to any one of embodiments 4 and 8-11, wherein the therapeutic treatment is a compound of formula I:

I

or a pharmaceutically acceptable salt thereof, wherein:

Z represents C or N;

V represents C or N;

means an aromatic ring in which V is C or N, and when V is N, V is in the ortho, meta or para position relative to Z;

each R independently represents hydrogen, halogen, -CN, hydroxyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, (C ₃ -C ₆ )cycloalkyl, -NO ₂ , -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy, phenoxy, - NR ₁ -SO ₂ -NR ₁ R ₂ , -NR ₁ -SO ₂ -R ₁ , -NR ₁ -C(=O)-R ₁ , -NR ₁ -C(=O)-NR ₁ R ₂ , -SO ₂ -NR ₁ R ₂ , -SO ₃ H, -O-SO ₂ -OR ₃ , -OP(=O)-(OR ₃ )(OR ₄ ) , -O-CH ₂ -COOR ₃ , (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group, or a group of formula (IIa):

, or a group of formula (IIIa): ;

Q is N or O, with the proviso that R'' is absent when Q is O;

each of R ₁ and R ₂ independently represents hydrogen or (C ₁ -C ₃ )alkyl;

R ₃ and R ₄ are each independently hydrogen, Li ⁺ , Na ⁺ , K ⁺ , N ⁺ (Ra) ₄ or benzyl;

n is 1, 2 or 3;

n' is 1, 2 or 3;

each R' independently represents hydrogen, (C ₁ -C ₃ )alkyl, hydroxyl, halogen, -NO ₂ , -NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ )alkoxy, OP(=O)-(OR ₃ )(OR ₄ ), -CN, group of formula (IIa):

, or a group of formula (IIIa): ;

A represents a covalent bond, oxygen or NH;

B represents a covalent bond or NH;

m is equal to 1, 2, 3, 4 or 5;

p is 1, 2 or 3;

Ra and Rb are each independently hydrogen, (C ₁ -C ₅ )alkyl or (C ₃ -C ₆ )cycloalkyl, or

Ra and Rb together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle, said heterocycle optionally being substituted by one or more Ra, provided that when R' represents a group (IIa) or (IIIa ), n' can be equal to 2 or 3 only if the other groups R' are different from the specified group (IIa) or (IIIa); And

R'' represents hydrogen, (C ₁ -C ₄ )alkyl or a group of formula (IIa) as defined herein.

13. The method according to embodiment 12, wherein the compound is selected from formulas Ia-Id:

Ia Ib Ic Ib'
ID

or pharmaceutically acceptable salts thereof.

14. The method of embodiment 12 or 13, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof.

15. The method according to any one of embodiments 4 or 8-11, wherein the therapeutic treatment is a compound of formula IV:

IV

or a pharmaceutically acceptable salt thereof, wherein each of the variables V, Z, R, R', n and n' is as described in Embodiment 8.

16. The method according to embodiment 15, where the compound is selected from formulas IVa-IVd:

IVa
IVb IVc
IVb'
IVd

or a pharmaceutically acceptable salt thereof.

Example

Human specimens

[00427] All human biopsy experiments were carried out in accordance with relevant instructions and regulations. The experiments were approved by AEMPS (Spanish Agency for the Control of Medicines and Medical Devices) AEMPS No.: 16-0728 under contract No. EudraCT: 2016-002797-1título ESTUDIO ABIERTODE LA SEGURIDAD, FARMACOCINÉTICA Y FARMACODINÁMICA DE ABX464 EN ADULTOS ATIVOS Y SEROPOSITIVOS PARA EL VIH-1. Informed consent was obtained from all subjects.

Cell culture, infection and transfection

[00428] Buffy coats from HIV-negative individuals were obtained from a local blood donation center, Center de transfusion sanguine Montpellier. Human peripheral blood mononuclear cells (PBMC) were isolated by Ficoll gradient centrifugation (Histopaque, Sigma). CD4+ and CD8+ T cells were purified from PBMCs after Ficoll gradient centrifugation using positive selection on human CD4+ beads and positive selection on CD8+ beads, respectively (Miltenyi). PBMC, CD4+ and CD8+ T cells were grown at 37°C and 5% CO ₂ to a density of 1.5 × 10 ⁶ cells/ml in RPMI GlutaMAX medium (Life Technologies) supplemented with 10% fetal calf serum (FCS) (Thermo Fisher ), 40 U/ml IL2 (PeproTech) and 5 μg/ml PHA (Roche) for 2 days. Three days later, the cells were resuspended at a concentration of 1.5 x 10 ⁶ cells/ml in RPMI supplemented with 10% FCS and 40 U/ml IL2 and divided into two parts (infected and uninfected cells). Cells were infected with 80 ng of p24/10 ⁶ cells strain YU-2 for 4-6 hours and then washed with PBS before refreshing the medium.

[00429] Both infected and uninfected cells were then centrifuged and resuspended to a density of 1.5 x 10 ⁶ cells/ml in medium supplemented with diluted drug solubilized in DMSO (Sigma) to a final concentration of 0.05% DMSO, or antiretroviral connections in accordance with the manufacturer's instructions. Cells were treated for 6 days with the medium renewed on day 3. Titration of HIV p24 was performed by ELISA from cell culture supernatants using the Innotest kit (Ingen) according to the manufacturer's instructions.

[00430] To generate monocyte-derived macrophages, monocytes were isolated using CD14+ positive microbeads (Miltenyi) and cultured in X-VIVO 10 medium (Lonza) supplemented with 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid), 1 mM sodium pyruvate, 1% non-essential amino acids, 10% FBS, 10 ng/ml GM-CSF (granulocyte-macrophage colony-stimulating factor) and 100 ng/ml M-CSF (macrophage colony-stimulating factor) for 7 days with renewal Wednesdays on day 3. After 7 days of differentiation, cells were washed, seeded into 6-well plates, and incubated for 24 hours in media without added cytokines. Cells were treated for 6 days with partial replacement of the medium on day 3.

[00431] HeLa cells from ATCC were cultured at 37°C and 5% CO ₂ in DMEM GlutaMAX (Life Technologies) supplemented with 10% FCS (Thermo Fisher). The region corresponding to lncRNA0599-205 was synthesized using IDT (Integratde DNA Technologies) and cloned into pcDNA3.1 (pcDNA3.1) to create plasmid pc-lncRNA-0599-205. pc-lncRNA-0599-205 (2 μg per 400,000 cells) was transiently transfected into HeLa cells using jetPEI reagent (Polyplus) according to the manufacturer's instructions.

microRNA (RT-q)-PCR analysis

[00432] miRNAs were extracted from PBMC, CD4+ or CD8+ T cells using the NucleoSpin miRNeasy kit (Macherey-Nagel) according to the manufacturer's instructions. Reverse transcription (RT) of miRNAs was performed using the miScript II RT kit (Qiagen). The resulting cDNA was used as a template for quantitative real-time PCR (qPCR) performed using the miScript SYBR Green PCR kit (Qiagen) along with the appropriate primers (Qiagen). miR-124 specific primer (Hs_miR-124a), control specific primer (Ce_miR-39) and two housekeeping gene specific (miR-26 and miR-191) primers (Hs_miR-26a and Hs_miR-191) were used to perform comparative qPCR. PCR analysis was performed on a LightCycler 480 Instrument II (Roche Molecular Systems, Inc). All reactions were carried out in triplicate. Relative miR-124 levels were calculated using the 2 ^-ΔΔCt method.

[00433] Total RNA was extracted from macrophages using the Macherey-Nagel NucleoSpin miRNeasy kit. Reverse transcription (RT) of miRNAs was performed on 2 μl of total RNA according to the Applied Biosystems TaqMan Advanced miRNA Assay protocol for TaqMan qPCR. For comparative qPCR, miR-124 specific primer (Hs_miR-124a), spike control specific primer (Ce_miR-39) and housekeeping gene (miR-191) specific primers (Hs_miR-191) were used. PCR cycles were analyzed using Applied Biosystems ViiA 7 software.

Quantification of miR-124 in human biopsies

[00434] Quantification of miR-124 was performed on patient rectal biopsy samples that were collected in PAXgene tissue containers (PreAnalytiX). RNA extraction was performed using the PAXgene microRNA tissue kit (PreAnalytiX) according to the manufacturer's protocol. Briefly, samples were immersed in 250 μL of TM1 buffer in a 2 mL Safe-Lock microcentrifuge tube containing one 5-mm stainless steel bead. Samples were disrupted and homogenized using a Qiagen TissueLyser for 2×2 minutes at 20 Hz. The rest of the procedure was performed according to the manufacturer's protocol. At the end of the procedure, each RNA was eluted with 32 μl of TM4 buffer. RNA concentration and purity were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). RNA integrity was assessed using an Agilent 2200 TapeStation with RNA ScreenTape. cDNA templates were prepared using the TaqMan Advanced miRNA cDNA Synthesis Kit (Applied Biosystems), starting with 10 ng of total RNA template and following the manufacturer's protocol. qPCR was performed using two TaqMan Advanced miRNA assays (Applied Biosystems), one targeting the miR-124-1 miRNA (Assay ID: 477879_mir), and the other targeting the endogenous miRNA, miR16 (Assay ID: 477860_mir), which was used as a reference to normalize expression data according to the manufacturer's instructions. qPCR was performed on a LightCycler 480 Instrument II (Roche Molecular Systems, Inc). All assays were labeled using FAM-MGB chemistry.

Statistical data analysis

[00435] All statistical analyzes and plots were performed using R v3.5 software. For normalization and processing, the inventors used edgeR v3.22.1, EDASeq v2.14 and DESeq2 v1.20. The inventors chose to count in millions (CPM) versus read per million (TPM) primarily because TPM discards a lot of information about the original quantitative count and therefore creates too much noise in differential testing. First, we filtered the data. The inventors believed that a gene would be expressed at a reasonable level in a sample if at least five counts were obtained for every million mapped reads in that sample. For marker selection, we used an α type 1 ^(*) error threshold of 5%, which provided a very flexible approach to differential analysis despite the lack of replicates. For the same reason, the log ₂ -fold change cutoff was set to 1.5 for both positive and negative values, and the p -value cutoff was typically ≤ 0.05. These appropriate cutoffs allowed the inventors to identify differentially expressed genes. False discovery rate (FDR) values were calculated for illustrative purposes but were not taken into account in decision making due to lack of replicates. The Benjamini and Hochberg methodology was chosen first. This procedure provides less stringent control for Type 1 errors than procedures for determining the group error rate (FWER) (such as Bonferroni correction). The inventors have added an MDS plot for data with the R and edgeR packages. The MDS plot produces a graph in which the distances between samples correspond to the leading biological coefficient of variation (BCV) between those samples. In this graph, we observed no separation between the DMSO-NI, 464-NI, DMSOI, and 464-I conditions. The inventors also created several volcano diagrams using the R package and EDASeq. These plots well represented differential expression (DE) testing in RNA sequencing experiments. These plots showed log ₂ fold change (FC) and -log ₁₀ p-values for all genes examined in the DE test. Highlighted green dots represent markers that met the author's selection criteria (significant for both p-value and log ₂ FC). Yellow dots highlight genes that met the log ₂ FC criterion but did not meet the p-value criterion. The inventors retained these points for further study, although they were not critical.

Sequencing and bioinformatics analysis

RNA CaptureSeq HIV RNA and cellular miRNAs

[00436] Total RNA was extracted from infected and uninfected PBMC samples using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. RNA concentration and purity were determined using an RNA 6000 Bioanalyzer kit (Agilent). For cDNA synthesis, 1 μg of total RNA was treated with DNase I (Invitrogen) and then used as a template for reverse transcription using the Verso cDNA kit with a mixture of random hexamers and anchored oligo-dT (Thermo Scientific), according to the manufacturer's instructions. After preparing the KAPA Hyper Prep (ROCHE) library from 1 μg of total RNA, we proceeded to capture SeqCap EZ (ROCHE) following the manufacturer's recommendations. Hybrid selection was performed using a custom SeqCap EZ Choice Library (Roche NimbleGen) including the following regions; chromosome 8 (from 9,760,617 to 9,761,780 and from 65,285,285 to 65,296,944), chromosome 20 (from 61,797,549 to 61,812,855), chromosome 1 (from 1,102,000 to 1,106,000), chromosome 13 (from 92, 000,074 to 92,006,833), chromosome 15 (22,512,831 to 2,513,641) and genome of HIV strain Ada8. This library was developed through the NimbleDesign portal (v1.2.R1) using the hg19 genome assembly NCBI Build 37.1/GRCh37. Sequencing was performed on a NextSeq 500 (Illumina) with 18 samples on a HighOutput cartridge (2 × 400 million reads of 75 bases each).

CD4+ T cell sequencing

[00437] A full detailed report describing the complete analysis has been submitted to the Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE116073). Total RNA extraction was performed using the Qiagen miRNeasy® kit. RNA concentration was determined using a Qubit® fluorometric quantitation assay and purity using an RNA 6000 Bioanalyzer kit (Agilent). Sequenced RNA libraries were constructed using the TruSeq multistrand mRNA sample preparation kit (low throughput protocol) from Illumina according to the manufacturer's instructions. Aliquots of 1.2 μg of total RNA were used to create libraries. The final cDNA libraries were screened using a fragment analyzer (Advanced Analytical, Ankeny, IA) and quantified using a KAPA qPCR kit (Kapa Biosystems, Wilmington, MA). In 8 sequencing lanes of the V4 flow cell, 32 libraries were pooled in equal proportions in sets of 4 libraries per lane, denatured with NaOH, and diluted to 16 pM before clustering. Cluster formation, primer hybridization and single-read, 50-cycle sequencing were performed on cBot and HiSeq 2500 (Illumina, San Diego, CA), respectively. Image analysis and nucleobase recognition were performed using HiSeq Control software with a Real-Time Analysis component. Demultiplexing was performed using Illumina sequencing analysis software. Data quality was assessed using FastQC from the Babraham Institute and Illumina SAV (Sequence Analysis Viewer) software. Potential contaminants were examined using FastQ Screen software from the Babraham Institute.

[00438] To study splicing activity, the inventors used SUPPA v2.0.0, a tool developed in Python 3.4 and specifically created for this approach. To study splicing under multiple conditions, we performed three modular operations that were run separately. The first step was to create the events from an annotation file, commonly called a GTF (General Transfer Format) file. The second step was to quantify event inclusion rates (PSI) in the authors' samples. Finally, differential splicing was calculated for all repeats under multiple conditions.

[00439] To generate various alternative splicing events from an input annotation file (GTF format), the method reads transcript and gene information solely from the "exon" strings in the GTF. It then generates events and outputs an "ioe" file that includes the relationship between each event and the transcripts that share that particular event. Specifically, it provides transcripts that contribute to the numerator (one event form) and denominator (both event forms) of the PSI calculation. To generate PSI values, SUPPA reads the “ioe” file generated in the first step and the transcript expression file with transcript abundance.

[00440] SUPPA calculates the magnitude of splicing changes (ΔPSI) and their significance in biological conditions using four replicates for each condition. The conditions are analyzed in the sequential order specified as input. Statistical significance is calculated by comparing the observed ΔPSI between conditions with the distribution of ΔPSI between replicates as a function of gene expression (measured as the expression of event-determining transcripts). Using the results of differential splicing analysis, we classified the events into four main groups: alternative 5' splice site (A5), alternative 3' splice site (A3), alternative first and last exons (Alt exons) and retained intron (RI). Using this classification, we classified differential splicing events occurring across different sample comparisons using a very stringent psi score difference (ΔPSI) cutoff fixed at greater than 0.4 and a p value less than 0.05. The inventors used simple Perl scripts to create raw count tables from SUPPA output.

MicroRNA array analysis

[00441] Total RNA was extracted from infected and uninfected PBMC samples using the miRNeasy kit (Qiagen) according to the manufacturer's protocol. RNA concentrations were determined using a Nanodrop spectrophotometer (ThermoFisher). Quality control was performed using expression console metrics. A full detailed report describing the full analysis has been submitted to GEO (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE116148). All miRNA arrays were normalized using the “RMA+DABG” normalization method in Affymetrix Expression Console using custom annotation files downloaded from the Affymetrix web server. Probes were considered to be expressed if the DABG p-value was less than 0.05 and were not expressed otherwise. A miRNA was considered to be expressed in one condition if the probe was expressed in 3/4 or more repeats. Finally, a miRNA was considered to be differentially expressed between conditions A and B if 1) it was expressed in A or B; 2) its multiplicity is greater than or equal to 1.5; and 3) the p-value for the paired t-test was less than or equal to 0.05.

[00442] Volcano plots were generated using R. They show the M-value (log ₂ (fold change)) and -log ₁₀ (p-value) of all miRNAs for comparisons of 464_I vs. DMSO_I, 464_NI vs. DMSO_NI, and DMSO_I vs. DMSO_NI. Significantly (FC greater than or equal to 1.5 and p-value less than or equal to 0.05) upregulated miRNAs were highlighted in red and downregulated miRNAs in green.

TaqMan Low Density Array (TLDA)

[00443] MicroRNA profiling of samples was performed using TaqMan Array human miRNA panels A and B (Life Technologies). Each TLDA map detected 384 features, including 377 human miRNAs, three endogenous small RNA controls (one of them in quadruplicate), and a negative control. A total of 754 human microRNAs were identified. Reverse transcription and preamplification were performed according to the manufacturer's instructions (Megaplex™ RT primers and Megaplex™ PreAmp primers, Life Technologies). Nine microliters of diluted preamplified product added to 900 μl of the total mixture was applied per TLDA card. Quantitative real-time PCR was performed using the ViiA 7 Real-Time PCR System and data was collected using the manufacturer's ViiA™ software. Gene Expression Suite software (Applied Biosystems) was further used to process the array data. Automatic thresholds were checked individually and adjusted if necessary.

[00444] During the data preprocessing phase, the HiSeq real-time monitoring and analysis software automatically generates image analysis, nucleobase recognition, and nucleobase quality analysis in real time. “Dirty” raw reads were defined as reads including adapter sequence or high inclusion of unknown bases and low quality reads. These reads were removed before subsequent analysis to reduce data noise. The filtering steps were as follows:

The quality of the RNA-seq libraries was first assessed using FastQC v0.11.5 software. The inventors used the FastQ Screen contamination search tool to test the matches of a large data set to different genomes representing potential sources of contamination. The software generates a graph showing the proportions of reads matching the different genomes tested. FastQ Screen uses the Bowtie2 aligner. Alignment is performed on a subset of sequences from each sample.

Reads were then subjected to standard quality control (QC) and filtering criteria according to the following parameters: (1) trimming and purification of reads aligned to primers and/or adapters, (2) reads with more than 50% low quality bases (quality value less than or equal to 15) per read, and (3) reads with more than 10% unknown bases (N bases). The inventors used a program called Trimmomatic to remove primers and bad reads. After filtering, we removed short reads (less than 36 bp); the remaining reads were called “clean reads” and saved in FASTQ format.

Once the quality of the sequencing data was assured, the inventors began aligning the clean reads in the FASTQ files to the reference sequence. Alignments were performed using the TopHat2 v2.0.8b tool against the human reference genome GRCh38.

[00445] TopHat2 is a splice-enabled aligner that uses the Bowtie2 aligner to align the data before counting the reads mapped to each gene. Bowtie2's behavior was adjusted to support local alignment by adjusting the sensitivity. TopHat2 outputs were stored in BAM files (usually accept_hits.bam) that included all alignments. TopHat2 outputs also reported alignment statistics. Since the SAM file format was then required for read counting, BAM files were sorted by name and converted to SAM format using SAMtools-1.3.1 software. To calculate gene-level raw counts from mapped reads in each library, we used the htseq-count v0.6.1p1 tool from the Python HTSeq package, using the default unit count mode. The HTSeq package generated a raw count table for each library that was needed to determine the expression level of each gene. DEG (differentially expressed gene) screening aims to discover genes that are differentially expressed in different samples and perform further functional analysis on them. Gene expression levels and DEGs were calculated using R software and a set of R packages. We decided to focus our efforts and limit statistical analysis to specific libraries only to delineate and gain a deeper understanding of the effect of ABX464. In their work, the inventors decided to compare the DMSO libraries with DMSOi, the ABX464 libraries with DMSO, and the 464i libraries with DMSOi. Additionally, to obtain a meaningful result, the inventors considered 4 donors as biological replicates in their statistical design.

Flow cytometry

[00446] PBMC or CD4+ T cells from different donors in suspension were labeled with the corresponding anti-human monoclonal antibodies (mAbs) (all from BioLegend). Washing and reagent dilutions were performed using FACS buffer (PBS containing 2% fetal bovine serum and 0.05% sodium azide [NaN3]). All sampling was performed on a Cyan ADP flow cytometer (Beckman Coulter). Data were analyzed using FlowJo software (Ashland, OR). Cellular debris and dead cells were excluded based on their light scattering characteristics.

Measurement of unspliced and spliced lncRNA 599-205

[00447] Retrotranscription (RT) reactions were performed with 1 μg of total RNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific). Removal of genomic DNA was performed prior to amplification, but a negative RT control was nonetheless performed without enzyme to confirm the absence of DNA contamination. qPCR was performed using LightCycler® 480 SYBR Green I Master Mix (Roche) and the following primers: total lncRNA 599-205 Fwd (CCCTCACCACTTGGGAC) and total lncRNA 599-205 Rev (GACCTGGGGATTCAGCCTTC), unspliced lncRNA 599-205 Fwd (GAACAAAGAGCCTTTGGAAGAC) and unspliced lncRNA 599-205 Rev (GGAAGGGACCACAGCATC), spliced lncRNA 599-205 Fwd (CACTCAGCGATGGAGGAAA) and spliced lncRNA 599-205 Rev (CCAATCACACAGACAATGAGATAAC), internal control β-actin Fwd (GTGAAGGTGACAGCAGTCGGTT) and β-actin Rev (GAAG TGGGGTGGCTTTTAGGA). The amplification trigger conditions were 95°C (10 seconds), 58°C (30 seconds), and 72°C (30 seconds) for 40 cycles.

results

1. ABX464 generates HIV RNA splice variants

[00448] To profile viral transcriptional events modulated by ABX464 and thereby assess the full depth of the HIV transcriptome, we used a recently described RNA targeted capture and sequencing (RNA CaptureSeq) strategy. This strategy involves constructing mosaic arrays of the HIV genome against which cDNAs are hybridized, eluted, and sequenced. RNA CaptureSeq is similar to previous solution capture methods and exome sequencing approaches, but when combined with deep sequencing technology, it provides rich coverage and enables the reliable collection of rare and unannotated HIV transcripts.

[00449] PBMC from 6 HIV-negative donors were infected with strain YU-2 followed by treatment with ABX464. The protocol of the invention resulted in a mild infection that did not result in cell death at 8 days postinfection (dpi), and viral replication was inhibited by more than 70% by 5 μM ABX464 ( Fig. 1B ). After capturing cDNA from untreated and ABX464-treated infected cells, libraries were prepared and sequenced using Illumina sequencing facility. To highlight potential novel splicing events induced by ABX464, we used a custom bioinformatics pipeline, the main step of which was the assembly of putative transcripts from targeted RNA sequencing reads to construct contigs (Illumina paired-end 2x75 bp) (Figure 6 A and B) . The putative transcripts (contigs) were then mapped to the HIV genome. The HIV profiling datasets used in this analysis provided high sequence coverage (2 to 30 million reads for a 9-kb genome), allowing for in-depth quantification of HIV splice variants. We were able to reliably quantify each HIV alternative splice across a wide range of transcript abundances and show that although ABX464 treatment resulted in increased splicing, ABX464 did not promote the generation of any splice variants beyond those present ( Fig. 1C , Table III).

[00450] To test whether increased splicing by ABX464 results in new viral RNA variants, splicing events were filtered and analyzed. After aligning the contigs with the genome of strain YU-2, the latter was used as an anchor for additional clustering and assembly of new HIV transcripts. Partial gene structures resulting from splicing alignments were combined when they shared sequential splice sites spanning the intronic viral sequence. The superstructures thus generated correspond to all possible HIV gene structures for which each complete exon is supported by at least one of the alignments. At the HIV transcript level, this resulted in the formation of superassemblies, where each superassembly is a fusion of the original contigs corresponding to the predicted superstructure. Notably, anchoring the contigs to the HIV-1 genomic sequence and requiring that all splice sites in the fused contigs match prevented the formation of spurious superassemblies. In fig. Figure 1C and Table III present the distribution of the number of contigs that were fused to form one superassembly for each donor. While in all ABX464-treated samples, the majority of assembled contigs (90%) corresponded to spliced RNAs ( Fig. 1C , Table IV , and Fig. 7 ) or small RNAs including gag-pol sequences that can be freed from introns, in untreated samples, spliced RNA comprised a small proportion (less than 24%) and most contigs corresponded to full-length unspliced viral RNA (more than 74%) (Fig. 1C, Table IV, and Fig. 7). This result indicated that ABX464 preferentially generated HIV RNA splice variants in infected PBMCs, which impaired subsequent synthesis of full-length HIV-1 pre-mRNA and assembly of infectious particles, thereby leading to inhibition of viral replication.

[00451] Interestingly, one of the splice variants generated by ABX464 treatment (Figure 1 A and D) was present in cells infected with strains YU-2 and Ada-M, and no polymorphism in its sequence was detected in B and C HIV-1 subtypes that were strongly inhibited by ABX464. Moreover, this novel splice variant was detected using long-read sequencing, indicating the added precision of this method in identifying complex and rare spliced isoforms and estimating their relative abundance. This new RNA variant may generate immunogenic peptides or be toxic to cells containing proviral DNA. This is consistent with the reduction in viral load and reduction in viral DNA levels (ABIVAX, data on file) observed in HIV patients treated with ABX464. Thus, ABX464 not only increased HIV RNA splicing, but also created a new HIV splicing variant.

[00452] Table III shows read assemblies and contig counts obtained from PBMCs infected with strain YU2, either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464 and D8_464).

[00453] Table IV shows total mRNA or spliced RNA transcript counts of Gag, Pol, vif, vpr, tat, rev, vpu and env from PBMCs infected with strain YU2 or untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464 and D8_464).

Table III.

Names of LIBs (libraries) Total number of paired-end reads before purging Total number of paired-end reads after adapter cleaning Total number of paired-end reads after contamination cleanup Total assembled contigs Contigs displayed D1_DMSO 7 948 802 7 884 109 7 006 433 683 63 D4_DMSO 30 625 849 30 363 868 27 810 800 1873 373 D5_DMSO 27 140 691 26 874 233 23 571 947 693 273 D6_DMSO 2 997 402 2 927 628 2 674 892 558 38 D7_DMSO 15 024 678 14 803 409 13 887 294 1489 190 D8_DMSO 17 570 815 17 386 693 16 491 699 1687 180 D1_464 4 940 644 4 879 559 4 557 902 362 90 D4_464 30 800 345 30 505 238 28 468 138 1413 225 D5_464 1,973,736 1 939 172 1,826,516 293 17 D6_464 4 450 825 4 385 103 4 174 706 227 49 D7_464 7 374 222 7 279 017 6 912 908 982 46 D8_464 8 507 861 8 381 026 7 835 264 759 48

Table IV.

YU2 Libraries Full mRNA Gag Pol Vif vpr tat rev vpu env D1_DMSO 123 6 9 2 6 2 2 5 3 D4_DMSO 174 6 12 5 5 7 9 eleven 8 D5_DMSO 194 6 7 6 4 8 eleven 5 10 D6_DMSO 80 3 10 3 2 8 2 4 2 D7_DMSO 146 6 6 2 7 2 8 3 6 D8_DMSO 166 8 4 9 2 4 3 10 4 D1_464 eleven 18 67 32 14 16 23 7 59 D4_464 13 42 61 34 14 18 21 5 42 D5_464 6 25 17 15 9 19 17 13 37 D6_464 32 13 14 16 12 15 9 eleven 13 D7_464 15 19 12 12 eleven 18 12 eleven 35 D8_464 6 26 35 25 12 24 29 17 42

2. ABX464 does not affect cellular splicing

[00454] To ensure that ABX464 acts specifically on HIV splicing and does not have a significant or global effect on human gene splicing events, we used a high-throughput RNA sequencing method. Many genome-wide expression studies of HIV infection rely on the analysis of total peripheral blood mononuclear cells (PBMCs), which are composed of more than a dozen cell subsets, including T cells, B cells, NK cells, and monocytes. To avoid diluting the specific gene expression signals of certain cell subpopulations with signals from other cells and thus reducing the specificity of this approach, we used purified CD4+ T cells from PBMC 4 donors. CD4+ T cells were uninfected or infected with the YU-2 strain and untreated or treated with ABX464 for 6 days followed by high-throughput RNA sequencing. Each raw sample data set included between 44 and 105 million single-end reads (50 bp), with an average of approximately 60 million raw reads per sample ( Figure 2A ). More than 97% of the bases had a quality score greater than or equal to Q20. About 98% of all raw reads were mapped to the human genome sequence (GRCh38), resulting in an average of 60 million reads per person per sample for further analysis. Reads that were correctly mapped (about 98% of total raw reads) to gene and transcript locations (GTF annotation file) ( Figure 2A ) were subsequently analyzed using in-house packages for normalization and transcript abundance estimation. Multidimensional scaling (MDS) analysis is an unsupervised global analysis approach that is suitable for reducing the dimensionality of gene expression data ( Figure 2B ). MDS minimizes dimensionality by preserving distances between data points and allows high-dimensional gene data to be projected onto just two or three new dimensions that explain most of the variance. As a result, major trends in the data can be visually interpreted, for example in terms of similarities between different data points. MDS of the resulting gene expression data showed, without any outliers, that the different donors were well separated and distributed across DMSO (untreated) and ABX464 preparations that were infected or uninfected. The variance shown was donor dependent (donor clustering) but not treatment dependent (lack of data structure associated with different treatments), suggesting that the ABX464 molecule did not cause a significant difference in CD4+ T cell gene expression (Figure 2B ).

[00455] To crudely assess the alternative splicing events modulated by ABX464 in infected and uninfected CD4+ T cells, we compared the number of reads per exon-exon junction in different samples (Figure 2C). Although the alignment of reads to exon boundaries was purely random, we did not observe gross differences in the total number of reads corresponding to exon-exon junctions between treated and untreated CD4+ T cells, both infected and uninfected, in any of the samples (Fig. 2C). To more statistically qualify alternative splicing in these CD4+ T cells, the inventors used a method for analyzing differential splicing under various conditions called SUPPA (Suppressed Ultrafast Pipeline for Alternative Splicing Analysis). Alternative splicing events were classified into five main groups: alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), alternative first and last exons (Alt. exons), and retained exon (RI) (Figure 2C). For each transcription variant, the “percentage splicing index (psi)” (ψ-value) was calculated for each sample. Using a strict cutoff, the difference in ψ-value for the untreated sample was fixed at 0.4 and the p-value was fixed at 0.05 for differential splicing events caused by ABX464 treatment to be considered significant. The number of significant events for each of the 5 possible AS events is presented in Fig. 2C and Table I. No switch-type events were detected when the difference in psi value was exactly 1 or -1. We next calculated ψ values of transcripts in uninfected and infected CD4+ T cells (Figure 2C). No switching events were detected in infected or uninfected CD4+ T samples compared with ABX464-treated samples (Fig. 2C). The exact number of common and differential splicing events between infected and uninfected CD4+ T cells treated with ABX464 was very low (less than 10 events, Table I), while depletion of NCBP1 (nuclear cap binding protein complex 1), a component of CBC, in stem cells, only 50% resulted in greater variation, with 81 Alt. exon, 12 A5'SS, 10 A3'SS, and 206 IR events (Figure 2C). The high level of IR indicated that the CBC complex is a major component preventing the accumulation of unspliced RNA, since most unspliced transcripts would be degraded by nonsense-mediated decay (NMD). Comparison of exon read coverage readings of the common highly expressed gene B2M under ABX464 and DMSO conditions in 4 donors showed that ABX464 did not increase the number of splicing events in B2M (Figure 2D). Thus, ABX464 treatment did not induce alternative splicing of transcripts, and therefore ABX464 is not able to dramatically alter gene expression in activated CD4+ T cells. Consistent with this result, FACS analysis of purified activated CD4+ T cells or PBMCs from 7 donors after 6 days of ABX464 treatment revealed no changes in the CCR6/CXCR3 or CD45/CCR7 subset (Th17/Th1 and effector memory cells, respectively) (Fig. . 8).

[00456] Table I below lists the splicing events in CD4 T cells: infected vs. uninfected (DMSO_I vs. DMSO), uninfected ABX464-treated vs. uninfected and untreated (464 vs. DMSO), and infected, ABX464-treated vs. infected and untreated ( 464_I vs DMSO_I).

Table I.

ABX464_NI_vs_DMSO_NI Gene designation Ensembl ID Description Event type LINC01119 ENSG00000239332 long intergenic non-protein coding RNA 1119 A3 STMND1 ENSG00000230873 stathmin domain including 1 Alto. exons ZNF177 ENSG00000188629 zinc finger protein 177 A3 FGF22 ENSG00000070388 fibroblast growth factor 22 A3 AL139035.1 ENSG00000280710 based on clones Alto. exons MRPL52 ENSG00000172590 mitochondrial ribosomal protein L52 A5; Alto. exons HCG20 ENSG00000228022 HLA complex group 20 (non-protein coding) Alto. exons RHBDD2 ENSG00000005486 diamond-shaped domain including 2 Alto. exons

ABX464_I_vs_DMSO_I Gene designation Ensembl ID Description Event type AL157955.2 ENSG00000258826 based on clones A3 TMEM147 ENSG00000105677 transmembrane protein 147 R.I. COX6C ENSG00000164919 subunit 6C of cytochrome c oxidase Alt exons ATIC ENSG00000138363 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase A5 STMND1 ENSG00000230873 stathmin domain including 1 Alt exons G.E.M. ENSG00000164949 GTP-binding protein overexpressed in skeletal muscle Alt exons CDRT15 ENSG00000223510 CMT1A Duplicated Region Transcript 15 A5 WDR72 ENSG00000166415 WD repeat domain 72 A5 SMIM11A ENSG00000205670 small integral membrane protein 11A AL EGLN2 ENSG00000269858 hypoxia-inducible factor 2, egl-9 family Alt exons GNRHR2 ENSG00000211451 gonadotropin-releasing hormone receptor 2 (pseudogen) R.I. ZNF584 ENSG00000171574 zinc finger protein 584 A3 LINC01869 ENSG00000180279 long intergenic non-protein coding RNA 1869 A3

DMSO_I_vs_DMSO_NI Gene designation Ensembl ID Description Event type CHTF8 ENSG00000168802 coefficient of transmission reliability of chromosome 8 Alt exons KCTD2 ENSG00000180901 potassium channel tetramerization domain including 2 A5 ETS1 ENSG00000134954 ETS 1 proto-oncogene; transcription factor A5 RASAL2-AS1 ENSG00000224687 RASAL2 antisense RNA 1 A5 SLC16A9 ENSG00000165449 solute carrier family 16 member 9 Alt exons RPP40 ENSG00000124787 p40 subunit of P/MRP ribonuclease Alt exons

3. ABX464 does not change cellular gene expression

[00457] To determine whether ABX464 induces quantitative changes in the transcriptome of infected cells, we measured transcript levels (see Figure 6 for pipeline) based on RNA sequencing data. More than 60,000 different transcripts were detected across all samples. After counts per million (CPM) normalization, transcripts from each sample were filtered with a CPM coverage threshold greater than 5; that is, a gene was considered expressed in a sample if it had at least five counts for every million mapped reads in that sample. Because four donors were used in this experiment, four replicates were available for each condition (infected/uninfected cells with/without ABX464 treatment), and a gene was considered expressed if it was expressed by at least five counts per million reads displayed across all replicates. Following these selection criteria, the inventors obtained a list of transcripts common to all samples, including 11,700 distinct transcripts with an average of approximately 3,000 raw counts per transcript. Using the CPM values of the qualified genes, a global expression plot was generated for each donor. Under the mild infection conditions used in this study, we did not detect large changes in gene expression: only 15 genes were downregulated in response to infection in untreated samples ( Fig. 2E , top panel, Table II). ABX464 treatment resulted in up-regulation of 9 genes in infected samples, as well as down-regulation of 6 and up-regulation of 7 genes in uninfected samples (Fig. 2E, middle and bottom panels, respectively; Table II), demonstrating the average effect of ABX464 treatment on expression gene (Figure 2E). Six genes that were upregulated after ABX464 treatment were shared between infected and uninfected samples, suggesting that this upregulation was mediated by ABX464 treatment and was independent of infection. Three of the six genes, TOR1AIP2, SCML1 and PPP1R2, had fold changes greater than 3 with p-values of 10 ^-5 . Interestingly, TOR1AIP2, a protein thought to regulate protein folding as well as intracellular trafficking, was recently shown to limit late stages of HIV replication and may therefore be an effector of the changes induced by ABX464.

[00458] Table II below lists the genes modulated in CD4 T cells: infected vs uninfected (DMSO_I vs DMSO), uninfected ABX464 treated vs uninfected and untreated (464 vs DMSO) and infected ABX464 treated vs infected and untreated (464_I vs DMSO_I). Upregulated genes are in bold and downregulated genes are in italics.

Table II.

DMSO_I_vs_DMSO_NI Gene designation Ensembl ID Chromosome Description _log2 (FC) F.C. P-value SNORD104 ENSG00000199753 17 small nucleolar RNA, C/D box 104 -1.593239134 0.3314265 0.000113748 MZT2B ENSG00000152082 2 mitotic spindle organizing protein 2B -1.545615646 0.342549493 0.005014214 HLA-L ENSG00000243753 6 major histocompatibility complex, class I, L (pseudogene) -2.155554923 0.224446745 0.018996735 FMO5 ENSG00000131781 1 flavin-containing monooxygenase 5 -2.32723033 0.199266303 0.022279359 RP11-69M1.6 ENSG00000279865 12 pseudogene -1.75254756 0.296777256 0.040623948 UBE4A ENSG00000110344 eleven ubiquitination factor E4A -2.226441782 0.2136851 0.039977521 SNORD3A ENSG00000263934 17 small nucleolar RNA, C/D box 3A -2.648926643 0.159438656 0.041651979 HIST1H1E ENSG00000168298 6 histone cluster 1 family member H1 -2.769812645 0.146623409 0.043246739 PKD2 ENSG00000118762 4 polycystin 2, transient receptor potential cation channel -3.020380563 0.123246573 0.014543367 NAALADL1 ENSG00000168060 eleven N-acetylated alpha-linked acid dipeptidase like 1 -3.333148179 0.099225299 0.012581 RNU4-1 ENSG00000200795 12 RNA, U4 small nucleus 1 -3.972391545 0.063707563 0.014002979 RNU4-2 ENSG00000202538 12 RNA, U4 small nucleus 2 -3.830896068 0.070272495 0.010356151 MOSPD3 ENSG00000106330 7 sperm mobile domain, including 3 -3.845633809 0.069558286 0.022670456 FP236383.10 ENSG00000277105 8 microRNA -3.494083339 0.088751583 0.040882842 NBPF20 ENSG00000162825 1 neuroblastoma breakpoint family, member 20 -4.017571383 0.061743395 0.001624932

ABX464_NI_vs DMSO_NI Gene designation Ensembl ID Chromosome Description _log2 (FC) F.C. P-value SNORD3A ENSG00000263934 17 small nucleolar RNA, C/D box 3A -2.923985868 0.13176 0.026481173 HELLS ENSG00000119969 10 helicase, lymphoid specific -2.246421514 0.21075 0.018558217 MZT2B ENSG00000152082 2 mitotic spindle organizing protein 2B -1.658291634 0.31681 0.002657817 HIST1H1D ENSG00000124575 6 histone cluster 1 family member H1 d -1.559586171 0.33925 5.18E-05 RPS19BP1 ENSG00000187051 22 ribosomal protein S19 binding protein 1 -1.566230636 0.33769 0.000115799 NDUFB7 ENSG00000099795 19 NADH: subunit B7 of ubiquinone oxidoreductase -1.520475764 0.34857 0.000168054 CECR1 ENSG00000093072 22 Adenosine deaminase 2 1.842665068 3.58672 2.65E-18 DPF2 ENSG00000133884 eleven double fingers PHD 2 1.560531204 2.94962 2.45E-11 HOPX ENSG00000171476 4 Homeobox HOP 1.744005457 3.34964 1.47E-07 LARS2 ENSG00000011376 3 leucyl-tRNA synthetase 2, mitochondrial 1.580307045 2.99033 0.026767164 TOR1AIP2 ENSG00000169905 1 torsin 1A interacting protein 2 3.485915121 11.20379 2.59E-16 SCML1 ENSG00000047634 X Scm polycomb group protein like 1 3.229297195 9.37811 9.67E-11 PPP1R2 ENSG00000184203 3 protein phosphatase regulatory inhibitor 1 subunit 2 3.136231549 8.79224 2.52E-05

ABX464_I_vs_DMSO_I Gene designation Ensembl ID Chromosome Description _log2 (FC) F.C. P-value CECR1 ENSG00000093072 22 Adenosine deaminase 2 1.770654479 3.41208711 4.33E-17 DPF2 ENSG00000133884 eleven double fingers PHD 2 1.61885639 3.071314797 4.52E-12 NOP9 ENSG00000196943 14 Nucleolar protein NOP9 1.594464835 3.019824765 4.35E-06 LGALS3 ENSG00000131981 14 galectin 3 1.589357824 3.009153755 0.723536038 LARS2 ENSG00000011376 3 leucyl-tRNA synthetase 2, mitochondrial 1.580389838 2.990506469 0.025849185 SCML1 ENSG00000047634 X Scm polycomb group protein like 1 2.85086263 7.214316067 3.52E-09 NBPF20 ENSG00000162825 1 neuroblastoma breakpoint family member 20 3.029199621 8.163566761 0.013076519 TOR1AIP2 ENSG00000169905 1 torsin 1A interacting protein 2 3.84681594 14.38821722 6.11E-19 PPP1R2 ENSG00000184203 3 protein phosphatase regulatory inhibitor 1 subunit 2 4.073227898 16.83308732 1.35E-07

4. ABX464 upregulates miR-124

[00459] Since the CBC complex targeted by ABX464 is involved in the biogenesis of small non-coding RNAs, and the disclosed global analysis has not yet included them, we decided to evaluate whether microRNAs or small nucleolar RNAs (snoRNAs) are regulated by ABX464 in differently. We performed microarray analysis of these RNAs from PBMCs of 6 donors. Cells infected with strain YU-2 followed by ABX464 treatment were compared with uninfected and untreated controls. A total of 104 human miRNAs and 40 snoRNAs were significantly differentially expressed in infected PBMCs compared with uninfected PBMCs (data not provided), with detection error less than 0.05 and fold change greater than 1.5. Cluster analysis revealed complete separation of infected and uninfected samples based on the expression profiles of differentially expressed miRNAs ( Fig. 3A ). While infection resulted in a significant change in the expression of small noncoding RNAs (Figure 3A, left panel), ABX464 treatment induced reproducible upregulation of one microRNA, miR-124, in infected and uninfected cells (Figure 3A, middle and right panels, respectively ). To confirm this result, we used another miRNA profiling method, TaqMan Low Density Array (TLDA), which is based on real-time reverse transcription-PCR with the ability to screen 760 miRNAs (Figure 9A). Again, only miR-124 was observed to be upregulated by ABX464. Additionally, qPCR of total RNA isolated from infected and uninfected PBMC 5 donors showed that infection resulted in a slight decrease in miR-124 expression (Fig. 3B, also seen in the global analysis in Fig. 3A), but treatment with ABX464 resulted in significant activation of miR-124 in both infected and uninfected cells (Fig. 3B). We then determined whether the observed miR-124 response to ABX464 treatment in PBMC could be attributed to specific cell types. Using purified CD4+, CD8, and macrophage cells, we found that ABX464 treatment resulted in upregulation of miR-124 in lymphoid cells (Figure 3C) but not in monocytic macrophages, where no miR-124 expression was detected (Figure 3C; Fig. 9B). Finally, we proved that this upregulation of miR-124 is specific to the ABX class of small molecules, since other antiretroviral drugs such as maraviroc, efavirenz, darunavir and AZT do not upregulate miR-124 expression in PBMCs, whereas ABX530, a molecule, having the same properties as ABX464 caused an increase in miR-124 expression to the same extent as ABX464 (Figure 3D).

[00460] In recent years, miR-124 has become one of the most important modulators of immunity and inflammation. miR-124 is known as a key regulator of microglial quiescence in the central nervous system and as a modulator of monocyte and macrophage activation. miR-124 also plays an important role in both innate and adaptive immune responses. In particular, miR-124 has been shown to be a critical mediator of cholinergic anti-inflammatory effects by reducing the production of IL-6, TNF-α and MCP-1. Interestingly, IL-6, TNF-α, and MCP-1 were upregulated in a widely used DSS-induced experimental mouse model of colitis, whereas ABX464 decreased the expression of these proinflammatory cytokines. Sustained activation of the immune system and systemic inflammation also play a central role in the pathogenesis of HIV infection. Many HIV-infected individuals receiving antiretroviral therapy (ART) experience residual inflammation associated with non-AIDS-related morbidity and mortality. Based on the observed suppression of miR-124 expression upon HIV infection of PBMCs or CD4+ T cells and subsequent activation by ABX464 treatment, the authors decided to test whether a similar modulation of miR-124 expression was observed in HIV patients undergoing antiretroviral therapy (ART). . Because the chronic inflammatory state in patients receiving combination ART is primarily associated with the degree of damage to gut-associated lymphoid tissue, miR-124 expression was monitored in rectal biopsies of HIV-infected patients on ART receiving ABX464 (N=9). miR-124 expression was decreased in HIV patients receiving ART compared with its expression in colon biopsies from healthy donors (N=10). Treatment with ABX464 for 28 days restored miR-124 expression to the level of healthy donors (Figure 3E). When ABX464 treatment was stopped for 28 days, miR-124 expression decreased to the level observed before treatment (Fig. 9 C and D), indicating that the observed expression changes were specifically due to ABX464. Thus, ABX464 modulates miR-124 expression both in vitro and in HIV patients.

5. ABX464-induced splicing of long non-coding RNA at the miR-124-1 locus leads to up-regulation of miR-124

[00461] miR-124 is encoded by three independent genes, miR-124-1, miR-124-2 and miR-124-3, located on human chromosomes 8 and 20 (Figure 4A). To determine which of these genes was induced by ABX464, we used CaptureSeq RNA targets to estimate the full depth of the transcriptome. Increased depth of CaptureSeq RNA sequencing coupled with ab initio transcript assembly was used to determine which locus was affected by ABX464 treatment ( Figure 4 A and B). We reconstructed all transcripts collected within the RNA-seq precapture data with equal uniformity of transcript coverage (100% of transcript strands reconstructed; Figure 4 A and B). The total number of reads for untreated as well as ABX464-treated samples ranged from 2 to 30 million in infected and uninfected PBMCs (Table V). The number of reads from the three loci encoding miR-124 in treated samples was 4- to 12-fold higher than in untreated samples (Figure 4B, Table V), confirming that ABX464 leads to a significant increase in miR-124. In contrast, ABX464 had no effect on the expression of miR-429 ( Figure 4B ), located outside the miR-124 region, further demonstrating the specificity of ABX464 in targeting miR-124.

[00462] The majority of aligned reads from the 10-kb regions of each locus were from miR-124-1 and miR-124-3, while the number of aligned reads from miR-124-2 was quite low even after treatment with ABX464 (Figure 4B) . The effect of ABX464 on miR-124 expression was most pronounced from the miR-124-1 locus (Figure 4B). All mapped reads from the miR-124-1 locus in the processed samples aligned to miR-124 and its surrounding 2 kb region. Close examination of this region revealed that the miR-124 sequence is inserted into a long non-coding RNA (lncRNA 0599-205) at the miR-124-1 locus (Figure 4 A and C).

[00463] The depth of CaptureSeq RNA sequencing allowed ab initio assembly of transcripts exhibiting a complex array of splicing patterns. This approach revealed that lncRNA 0599-205 splicing is activated by ABX464, and this splicing was not present in untreated samples (Figure 4 C and D). The majority of contigs in the raw samples aligned with unspliced lncRNA 0599-205. Mapping reads to splice junctions (J1, J2, J3, and J4) and exon-exon junctions (J5 and J6) of this lncRNA allowed quantification of spliced and unspliced RNAs in the treated samples ( Figure 4D ). After 8 days of ABX464 treatment, which we hypothesized was sufficient time for transcripts to reach steady-state levels, the level of unspliced RNA was nine times higher than the level of spliced RNA. Since spliced RNA is more stable than unspliced RNA, it should be considered that spliced lncRNA 0599-205 is the source of up-regulation of miR-124 and therefore becomes less stable. Consistent with this prediction, we found that miR-124 production (reads mapping only to the 85-bp region of miR-124) compensated for the absence of spliced lncRNA 0599-205 ( Figure 4D ).

[00464] Table V shows the read counts for the three genes encoding miR-124; mir124.1, mir124.2, and mir124.3 in PBMCs either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or ABX464-treated (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464).

Table V

LIB names Total number of readings mir124.1 mir124.2 mir124.3 D1_DMSO 4 879 559 116164 2580 21900 D4_DMSO 30 505 238 51798 1204 5306 D5_DMSO 1 939 172 16352 1440 11709 D6_DMSO 4 385 103 13294 5358 8498 D7_DMSO 7 279 017 45480 17676 55708 D8_DMSO 8 381 026 30950 8830 18253 D1_464 7 884 109 4014 704 6439 D4_464 30 363 868 7114 4 701 D5_464 26 874 233 4748 4222 21941 D6_464 2 927 628 324 362 2542 D7_464 14 803 409 2486 2326 14460 D8_464 17 386 693 1088 5452 7772

6. Splicing of lncRNA 0599-205 is required for miR-124 production

[00465] To directly assess the contribution of lncRNA 0599-205 to miR-124 production, we cloned the genomic sequence of chromosome 8 from 9,903,167 to 9,904,210 of lncRNA 0599-205 into a plasmid vector (Figure 5A). Both spliced and unspliced lncRNA 0599-205 transcripts could be readily detected in transfected HeLa cells (Figure 5B). However, we were unable to detect upregulation of miR-124 in transfected HeLa cells in response to ABX464 treatment because splicing is maximal in HeLa cells and the CBC complex would have an effect on the transcription site (Figure 5B). However, transient transfection of the plasmid into HeLa cells resulted in a dramatic (1250-fold) increase in miR-124 levels (Figure 5C, left panel). In contrast, when lncRNA 0599-205 splice sites are mutated, only traces of miR-124 are detected ( Figure 5C , left panel). Consistent with the fact that unspliced lncRNA 0599-205 is less stable, the amount of mutated lncRNA 0599-205 is less than that of the wild type ( Figure 5C , right panel). Overall, the results demonstrate that lncRNA 0599-205 splicing is a prerequisite for mir-124 production.

Discussion

[00466] The present study provides new insight into the mechanism of action of ABX464 in upregulating anti-inflammatory miR-124 in treated patients with UC (ulcerative colitis) and in inhibiting viral replication in patients with HIV. ABX464 binds CBC (ABIVAX, data on file), a complex that stimulates capped RNA processing reactions, including splicing, 3' end formation, degradation, and transport. Given that CBC is thought to bind all classes of m7G-capped RNAs, including precursor and mature forms of mRNA, stable long noncoding RNAs (lncRNAs), nonadenylated histone RNAs, and precursor spliceosomal small nuclear RNAs (snRNAs), it is important to understand how ABX464 binds with the CBC complex it achieves its specificity. Both HIV RNA splicing variation and lncRNA 0599-205 are robustly induced by ABX464. The inventors do not know the reason for this. It is possible that weak splice sites characteristic of both transcripts underlie the induction of these splicing events by the ABX464-CBC complex. Most genes encoding human proteins are spliced before being exported to the cytoplasm unless they have been degraded in the nucleus, and in the cytoplasm, the first step of translation is important to control the quality of mRNA. lncRNA 0599-205, like any RNA in the cell, will degrade or remain at its transcription site, which is typical for many long coding RNAs. The miR-124 sequence is located in exon 3 of lncRNA 0599-205, which is also a specific situation because most miRNAs are usually classified as “intergenic” or “intronic” based on their genomic position. Intergenic miRNAs are known to be transcribed as independent transcription units, while intronic miRNAs are thought to be processed from the introns of their host transcription units and therefore share regulatory mechanisms and expression patterns with their host genes. Because ABX464 treatment did not induce any miRNA variation other than miR-124 and very little variation in the expression of genes that could be miRNA hosts, we believe that the ABX464-CBC interaction induces a specific effect of viral RNA and miR-124 biogenesis. The latter is also supported by the fact that miR-124 is transcribed by 3 loci, but only the miR-124.1 locus is affected by ABX464, and miR-124 production requires lncRNA 0599-205 splicing (Figure 5).

[00467] The functions of the nuclear cap are mediated by the proteins CBP80 and CBP20, which co-transcriptionally bind to nascent RNA. CBP20 directly interacts with the m7G cap through its classical RNA recognition motif (RRM), while CBP80 mediates high-affinity binding of the complete CBC and serves as a platform for interaction with other factors. We demonstrated that ABX464, by binding to CBC, prevents the production of unspliced viral RNA required for viral replication and induces the production of miR-124 from lncRNA-0599-205. However, ABX464 had little effect on cellular splicing. Therefore, ABX464 acts as an enhancer of viral but not cellular splicing. ABX464 binding may change the conformation of CBC to allow efficient interaction of CBP80 with the splicing factor and thus make recognition of viral splice sites more efficient. HIV RNA is known to have suboptimal splice sites, which allows splicing of the 9-kb primary transcript to be inhibited later in the infection. In contrast, most cellular genes require splicing for expression, and unspliced intron-containing transcripts are retained in the nucleus where they are degraded. Depletion of NCBP1 by 50% results in upregulation of unspliced IR transcripts, supporting a role for CBC in NMD. ABX464 ensures that HIV viral RNA is spliced (as it is transcribed from integrated proviral DNA, which resembles any gene in the cell), exported, and unspliced viral RNA is degraded (presumably by NMD). ABX464 does not alter any of the functions of the CBC, so ABX464, by binding to the CBC complex, is not expected to alter overall RNA biogenesis in the cell. However, very little is known about the CBC complex in HIV infection or immune cell activation. Finding that ABX464 binds to CBC and induces specific changes in immune cells; overexpression of miR-124 by modulating the splicing of long coding RNA 0599-205 and enhancing HIV RNA splicing will be of great importance for understanding the involvement of CBC in HIV infection and inflammation.

[00468] Prediction of splice site strength using maximum entropy (MaxEnt) showed that the 5' splice site between exon 2 and intron 2 of lncRNA 0599-205 is very weak compared to the other splice site (Table VI). Because unspliced lncRNA 0599-205 cannot exit the nucleus due to CBC-mediated quality control and control mechanisms, spliced lncRNA 0599-205 represents a storage form of miRNA, possibly in addition to other functional properties of the intact spliced transcript. This repository may be maintained by the low transcriptional and degradation activity of unspliced lncRNA 0599-205 and the production of only low levels of mature miR-124 release under normal conditions. Indeed, when lncRNA 0599-205 is unspliced, its fate is similar to that of other short-lived transcripts sensitive to a CBC complex called CBC-NEXT, which promotes RNA degradation via the nuclear RNA exosome. Accordingly, splicing of lncRNA 0599-205 is a prerequisite for miR-124 production. Splicing of lncRNA 0599-205 is important for stabilizing the mature transcript for recognition by the microRNA processing machinery and thereby for the production of miR-124. Thus, ABX464 treatment may allow rapid release of large amounts of miR-124 through lncRNA 0599-205 splicing without requiring transcriptional activation of the lncRNA 0599-205 locus. In HIV patients, this may be the mechanism by which miR-124 is upregulated following ABX464 treatment ( Figure 3E ).

[00469] HeLa cells incorporating a large excess of splicing factors efficiently produce HIV viral RNA splice products and large amounts of miR-124 from transfected HIV and lncRNA 0599-205 constructs, respectively. Thus, ABX464 does not interfere with the normal function of CBC splicing, but makes it more efficient. Because viral but not cellular genes require an unspliced state for viral replication, and lncRNA 0599-205 splicing can affect miR-124 expression, ABX464 inhibits viral replication and induces anti-inflammatory miR-124 expression. A large number of studies in various cells and systems have shown that miR-124 is a critical modulator of inflammatory and immunological responses. The finding that ABX464 upregulates miR-124 expression in infected patients may provide a major benefit in treating residual inflammation associated with non-AIDS-related morbidity and mortality in patients with HIV. In many cases, miR-124 acts as a negative regulator of inflammatory signals, providing negative feedback to help maintain homeostasis. Additionally, ulcerative colitis patients treated with ABX464 also exhibited an increase in miR-124, showing evidence of a robust and sustained ABX464 efficacy signal. Thus, ABX464 is a small molecule with therapeutic potential not only against HIV but also against inflammatory diseases.

[00470] Table VI shows the prediction of splice site strength using maximum entropy (MaxEnt). MAXENT score for 5' splice sites and 3' splice sites at exon1-intron1-exon2 (exon1-exon2 ss) and exon2-intron2-exon3 (exon2-exon3 ss) junctions.

Table VI

5' ss sequence MAXENT rating 3' ss sequence MAXENT rating Consensus CAG/guaagu 10.86 ugucccuuuuuuuccacag/CUG 12.6 Exon1-Exon2 ss GAG/guaaag 9.65 ucccuccuuuccuuuccucag/GAG 11.46 Exon2-Exon3 ss GCG/gcggga -4.66 ucccuccuuuccuuccucag/GAG 11.46

Sequences

SEQ ID NO 1

GGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGAAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAGGACAGTCAGACTCATCAAAGTTCTCTATCAAAGCA

SEQ ID NO 2

ggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaaggaaaaccagaggagctctctcgacgcaggactc ggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactg

SEQ ID NO: 3

Gaagaagcggagacagcgacgaagacctcctcaggacagtcagactcatcaaagttctctatcaaagca

--->

LIST OF SEQUENCES

<110> ABIVAX

CENTER NATIONAL DE LA RECHERCHE SCIENTIFIQUE

INSTITUT CURIE

UNIVERSITE DE MONTPELLIER

<120> BIOMARKERS AND APPLICATIONS FOR THE TREATMENT OF VIRAL INFECTIONS,

INFLAMMATION OR CANCER

<130> PR86007

<150>EP18306784

<151> 2018-12-20

<160> 18

<170> BiSSAP 1.3.6

<210> 1

<211> 193

<212> RNA

<213> Homo sapiens

<220>

<223> New putative mRNA sequence

<400> 1

ggaaaatctc tagcagtggc gcccgaacag ggacttgaaa gcgaaaggaa aaccagagga

60

gctctctcga cgcaggactc ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg

120

actggaagaa gcggagacag cgacgaagac ctcctcagga cagtcagact catcaaagtt

180

ctctatcaaa gca

193

<210> 2

<211> 124

<212> RNA

<213> Homo sapiens

<220>

<223> Exon 1: 615-739

<400> 2

ggaaaatctc tagcagtggc gcccgaacag ggacttgaaa gcgaaaggaa aaccagagga

60

gctctctcga cgcaggactc ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg

120

actng

124

<210> 3

<211> 69

<212> RNA

<213> Homo sapiens

<220>

<223> Exon 2: 5976-6045

<400> 3

gaagaagcgg agacagcgac gaagacctcc tcaggacagt cagactcatc aaagttctct

60

atcaaagca

69

<210> 4

<211> 23

<212> RNA

<213> Homo sapiens

<220>

<223> Consensus 3ʹcc sequence

<400> 4

ugucccuuuu uuuuccacag cug

23

<210> 5

<211> 23

<212> RNA

<213> Homo sapiens

<220>

<223> Exon1-Exon2 3ʹcc sequence

<400> 5

uccuccuuuc cuuuccucag gag

23

<210> 6

<211> 22

<212> RNA

<213> Homo sapiens

<220>

<223> Exon2-Exon3 3ʹcc sequence

<400> 6

ucccuccuuuc cuuccucagg ag

22

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> General lncRNA primer 599-205 Fwd

<400> 7

ccctccacca cttgggac

18

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> General lncRNA primer 599-205 Rev

<400> 8

gacctgggga ttcagccttc

20

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Primer of unspliced lncRNA 599-205 Fwd

<400> 9

gaacaaagag cctttggaag ac

22

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Primer of unspliced lncRNA 599-205 Rev

<400> 10

ggaagggacc acagcatc

18

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Primer of spliced lncRNA 599-205 Fwd

<400> 11

cactcagcga tggaggaaa

19

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> Primer spliced lncRNA 599-205 Rev

<400> 12

ccaatcacac agacaatgag ataac

25

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Fwd β-actin internal control primer

<400> 13

gtgaaggtga cagcagtcgg tt

22

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> β-Actin Primer Rev

<400> 14

gaagtggggt ggcttttagg a

21

<210> 15

<211> 1164

<212> RNA

<213> Homo sapiens

<220>

<223> lncRNA 0599-205

<400> 15

tcttcttcct ctctctctct ctctctctgt ctctctctct ctcgtctctc ttcctttccc

60

ccctccacca cttgggacct gagcgagagg actgcagcag gcgagttccg gaaggctgaa

120

tccccaggtc ccagccccgg accgcggcaa ctcgccctg cggcacgccc ggcccggctg

180

cgcccccact cagcgatgga ggtaaagagg cggcggccgc gcgccctgcc ccggctgccg

240

ctgccgagtc cccgctgctc tccttgtcct tcgctctctt cttcctcctc ctagtcccct

300

tcagtttcct gggcgaagca gagggcgaca tgggtgggtg ggttgctgcg ctggggcgag

360

gtggggtcga tgttgttttt tcattgtctg gagctgcagg ggaggcgagg cgcggggaaa

420

ggggcgaggg gagccggggt aattaacacg ggggaggcac ccctccgtct cccacttcca

480

cccacacccc catccctcca ccccctccgc tttgcaggaa aaagcctgga tgcgaaagga

540

tggggggagaa caaagagcct ttggaagacg tcgctgttat ctcattgtct gtgtgattgg

600

gggagctgcg gcggggagga tgctgtggtc ccttcctccg gcgttcccca cccccatccc

660

tctccccgct gtcagtgcgc acgcacacgc gccgcttttt atttcttttt cctggttttc

720

ttattccatc ttctacccac ccctcttcct ttctttcacc tttccttcct tccttcctcc

780

tttccttcct caggagaaag gcctctctct ccgtgttcac agcggacctt gatttaaatg

840

tccatacaat taaggcacgc ggtgaatgcc aagaatgggg ctggctgagc accgtgggtc

900

ggcgagggcc cgccaaggaa ggagcgaccg accgagccag gcgccctccg cagacctccg

960

cgcagcggcc gcgggcgcga ggggaggggt ctggagctcc ctccggctgc ctgtcccgca

1020

ccggagcccg tggggtgggg aggtgtgcag cctgtgacag acaggggctt agagatgcaa

1080

acagactcag ggagagaaac agaagctgat tctgtgacag aagcagatct gtgcagcaca

1140

gatgcggtgt gcgtggggag gggg

1164

<210> 16

<211> 141

<212> RNA

<213> Homo sapiens

<220>

<223> Exon 1 lncRNA

<400> 16

ccctccacca cttgggacct gagcgagagg actgcagcag gcgagttccg gaaggctgaa

60

tccccaggtc ccagccccgg accgcggcaa ctcgccctg cggcacgccc ggcccggctg

120

cgcccccact cagcgatgga g

141

<210> 17

<211> 93

<212> RNA

<213> Homo sapiens

<220>

<223> Exon 2 lncRNA

<400> 17

gaaaaagcct ggatgcgaaa ggatggggga gaacaaagag cctttggaag acgtcgctgt

60

tatctcattg tctgtgtgat tgggggagct gcg

93

<210> 18

<211> 311

<212> RNA

<213> Homo sapiens

<220>

<223> Exon 3 lncRNA

<400> 18

gagaaaggcc tctctctccg tgttcacagc ggaccttgat ttaaatgtcc atacaattaa

60

ggcacgcggt gaatgccaag aatggggctg gctgagcacc gtgggtcggc gagggcccgc

120

caaggaagga gcgaccgacc gagccaggcg ccctccgcag acctccgcgc agcggccgcg

180

ggcgcgaggg gaggggtctg gagctccctc cggctgcctg tcccgcaccg gagcccgtgg

240

ggtggggagg tgtgcagcct gtgacagaca ggggcttaga gatgcaaaca gactcaggga

300

gagaaacaga a

311

<---

Claims (81)

1. Use of the HIV splice variant (human immunodeficiency virus) with SEQ ID NO 1 as a biomarker of HIV infection or the effectiveness of therapeutic treatment of HIV infection. 2. Use of the HIV splice variant of SEQ ID NO 1 as a biomarker to evaluate the biological effect of the compound in the treatment of HIV infection. 3. Use of the HIV splice variant of SEQ ID NO 1 as a biomarker for screening a compound or vaccine for the prevention and/or treatment of HIV infection. 4. A method of treating HIV infection, wherein the HIV splice variant of SEQ ID NO 1 is used as a biomarker of HIV infection or the effectiveness of a therapeutic treatment, wherein the therapeutic treatment comprises administering a compound of formula I I or a pharmaceutically acceptable salt thereof, where Z represents C or N; V represents C or N; means an aromatic ring in which V is C or N and, when V is N, V is in the ortho, meta or para position relative to Z; each R independently represents hydrogen, halogen, -CN, hydroxyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, (C ₃ -C ₆ )cycloalkyl, -NO ₂ , -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy, phenoxy, -NR ₁ -SO ₂ -NR ₁ R ₂ , -NR ₁ -SO ₂ -R ₁ , -NR ₁ -C(=O)-R ₁ , -NR ₁ -C(═O)-NR ₁ R ₂ , -SO ₂ -NR ₁ R ₂ , -SO ₃ H, -O-SO ₂ -OR ₃ , -OP(═O)-(OR ₃ )(OR ₄ ) , -O-CH ₂ -COOR ₃ , (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group, a group of formula (IIa) or a group of formula (IIIa) ; Q is N or O, with the proviso that R'' is absent when Q is O; each of R ₁ and R ₂ independently represents hydrogen or (C ₁ -C ₃ )alkyl; R ₃ and R ₄ are each independently hydrogen, Li ⁺ , Na ⁺ , K ⁺ , N ⁺ (Ra) ₄ or benzyl; n is 1, 2 or 3; n' is 1, 2 or 3; each R' independently represents hydrogen, (C ₁ -C ₃ )alkyl, hydroxyl, halogen, -NO ₂ , -NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ )alkoxy, -OP(═O)-(OR ₃ )(OR ₄ ), -CN, group of formula (IIa) or a group of formula (IIIa) ; A represents a covalent bond, oxygen or NH; B represents a covalent bond or NH; m is equal to 1, 2, 3, 4 or 5; p is 1, 2 or 3; Ra and Rb are each independently hydrogen, (C ₁ -C ₅ )alkyl or (C ₃ -C ₆ )cycloalkyl, or Ra and Rb together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle, said heterocycle optionally being substituted by one or more Ra, provided that when R' represents a group (IIa) or (IIIa ), n' can be equal to 2 or 3 only if the other groups R' are different from the specified group (IIa) or (IIIa); And R'' represents hydrogen, (C ₁ -C ₄ )alkyl or a group of formula (IIa) as defined in the present formula. 5. Use according to claim 1, wherein the therapeutic treatment comprises administering a compound of formula I I or a pharmaceutically acceptable salt thereof, where Z represents C or N; V represents C or N; means an aromatic ring in which V is C or N and, when V is N, V is in the ortho, meta or para position relative to Z; each R independently represents hydrogen, halogen, -CN, hydroxyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₃ )fluoroalkoxy, (C ₃ -C ₆ )cycloalkyl, -NO ₂ , -NR ₁ R ₂ , (C ₁ -C ₄ )alkoxy, phenoxy, -NR ₁ -SO ₂ -NR ₁ R ₂ , -NR ₁ -SO ₂ -R ₁ , -NR ₁ -C(=O)-R ₁ , -NR ₁ -C(═O)-NR ₁ R ₂ , -SO ₂ -NR ₁ R ₂ , -SO ₃ H, -O-SO ₂ -OR ₃ , -OP(═O)-(OR ₃ )(OR ₄ ) , -O-CH ₂ -COOR ₃ , (C ₁ -C ₃ )alkyl, wherein said alkyl is optionally mono- or di-substituted with a hydroxyl group, a group of formula (IIa) or a group of formula (IIIa) ; Q is N or O, with the proviso that R'' is absent when Q is O; each of R ₁ and R ₂ independently represents hydrogen or (C ₁ -C ₃ )alkyl; R ₃ and R ₄ are each independently hydrogen, Li ⁺ , Na ⁺ , K ⁺ , N ⁺ (Ra) ₄ or benzyl; n is 1, 2 or 3; n' is 1, 2 or 3; each R' independently represents hydrogen, (C ₁ -C ₃ )alkyl, hydroxyl, halogen, -NO ₂ , -NR ₁ R ₂ , morpholinyl, morpholino, N-methylpiperazinyl, (C ₁ -C ₃ )fluoroalkyl, (C ₁ -C ₄ )alkoxy, -OP(═O)-(OR ₃ )(OR ₄ ), -CN, group of formula (IIa) or a group of formula (IIIa) ; A represents a covalent bond, oxygen or NH; B represents a covalent bond or NH; m is equal to 1, 2, 3, 4 or 5; p is 1, 2 or 3; Ra and Rb are each independently hydrogen, (C ₁ -C ₅ )alkyl or (C ₃ -C ₆ )cycloalkyl, or Ra and Rb together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle, said heterocycle optionally being substituted by one or more Ra, provided that when R' represents a group (IIa) or (IIIa ), n' can be equal to 2 or 3 only if the other groups R' are different from the specified group (IIa) or (IIIa); And R'' represents hydrogen, (C ₁ -C ₄ )alkyl or a group of formula (IIa) as defined in the present formula. 6. Application according to claim 5, where the compound is selected from formulas Ia-Id: or a pharmaceutically acceptable salt thereof. 7. Use according to claim 5 or 6, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof. 8. Method according to claim 4, where the compound is selected from formulas Ia-Id: or a pharmaceutically acceptable salt thereof. 9. The method of claim 8, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof. 10. Use according to claim 1, wherein the therapeutic treatment comprises administering a compound of formula IV IV or a pharmaceutically acceptable salt thereof, wherein each of the variables V, Z, R, R', n and n' is as described in claim 5. 11. Application according to claim 10, where the compound is selected from formulas IVa-IVd: or a pharmaceutically acceptable salt thereof. 12. The method according to claim 4, wherein the therapeutic treatment comprises administering a compound of formula IV IV or a pharmaceutically acceptable salt thereof, wherein each of the variables V, Z, R, R', n and n' is as described in claim 4. 13. Method according to claim 12, where the compound is selected from formulas IVa-IVd: or a pharmaceutically acceptable salt thereof. 14. Use in vitro or ex vivo of the HIV splice variant of SEQ ID NO 1 as a biomarker of HIV infection or the effectiveness of therapeutic treatment of HIV infection. 15. In vitro or ex vivo use of the HIV splice variant of SEQ ID NO 1 as a biomarker to assess the biological effect of a compound in the treatment of HIV infection. 16. In vitro or ex vivo use of the HIV splice variant of SEQ ID NO 1 as a biomarker for screening a compound or vaccine for the prevention and/or treatment of HIV infection. 17. Use in vitro or ex vivo according to claim 14, where the therapeutic treatment includes the administration of a compound of formula I, Ia, Ib, Ib', Ic, Id or IV, IVa, IVb, IVb', IVc, IVd, IV; such as ABX464, or a pharmaceutically acceptable salt thereof. 18. Use in vitro or ex vivo according to claim 15 or 16, where the compound has the formula I, Ia, Ib, Ib', Ic, Id or IV, IVa, IVb, IVb', IVc, IV; such as ABX464, or a pharmaceutically acceptable salt thereof. 19. Application according to any one of paragraphs. 14-18, wherein the measured expression level of said HIV splice variant of SEQ ID NO 1, or said lncRNA splice variant 0599-205 at the miR-124-1 locus, or said miR-124 in the isolated biological sample is compared with a control reference value.