RU2817869C1 - Method for assessing status of 14th exon of met gene according to rna sequencing data - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is a method for evaluating status of 14th exon of the MET gene by RNA sequencing data. Method comprises the steps of obtaining a biological material suitable for RNA sequencing, obtaining RNA sequencing data from the material, obtaining data on mapping reads to exons of the human MET gene, counting the number of SJ reads per junction of 13th and 15th exons and passed the quality control, and comparing it with threshold, user-defined and selected based on the required rigor and accuracy of determining the presence of such readings, calculating the normalized level of asymmetry of 13th, 14th and 15th exons and comparing it with a threshold defined by the user and selected based on the analysis of clinical samples, and analysing the results, in which, when all selected thresholds are overcome, a conclusion is made on the presence in the sample of the MET gene with skipping 14th exon.

EFFECT: improved detection of missing 14th exon of MET gene based on RNA sequencing data.

2 cl, 2 dwg, 4 ex

Description

TECHNICAL FIELD

The claimed invention relates to personalized medicine for cancer, namely to a method for supporting clinical decision-making using RNA sequencing data analysis based on detection of reads mapped to exon junctions and asymmetry of MET gene read coverage.

BACKGROUND ART

Various methods are known to support clinical decision making using analysis of RNA sequencing data based on analysis of MET gene transcripts, for example, a method for identifying a cancer patient who is likely to respond to treatment with an antagonist of the MET gene product (see US2012089541A1, publ. 04/12/2012), including the stage of determining the level of C-MET expression. When the level of this biomarker is high, it is concluded that the patient is likely to respond to treatment with an antagonist of this gene product.

Today, the most reliable and does not require additional manipulations with biological material method for assessing the status of the 14th exon of MET is a method based on the detection of reads mapped to exon junctions and asymmetry of read coverage of the MET gene.

Deletion of the 14th exon in the MET gene transcript can lead to oncological transformation of the cell through several mechanisms. This isoform occurs in approximately 3% of all tumors of patients suffering from non-small cell lung cancer. In 2020, two adenosine triphosphate (ATP) competitor drugs that specifically inhibit MET exon 14 skipping, capmatinib and tepotinib, were approved for clinical use. These drugs have been shown to be effective in treating MET exon 14 skipping non-small cell lung cancer in clinical trials and have been approved in several countries. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8290191/].

Therefore, for effective therapy with these and other drugs that specifically target MET with exon 14 skipping, it is necessary to correctly detect this isoform.

There are several methods for detecting this isoform, namely: the DNA sequencing-based diagnostic platform Illumina TruSight Tumor 26 assay [https://support.illumina.com/downloads/trusight_tumor_product_files.html], based on RNA sequencing ArcherDx FusionPlex Solid Tumor assay [https http://archerdx.com/research-products/solid-tumor-research/fusionplex-solid-tumor/] and a system based on real-time PCR (see US20170327887A1, published 11/16/2017), selected by the applicant as the most a close analogue. All these methods are aimed at assessing the mutational status of only a small number of genomic loci, which include the MET gene, and are inferior in the amount of information obtained to RNA sequencing of tumor material [https://www.sciencedirect.com/science/article/pii/ S1556086419300073].

Accordingly, using the above methods, it is impossible to simultaneously assess the MET status and the expression level of most other genes - the RNA-sequencing procedure will need to be carried out separately, which, in particular, is necessary for the operation of personalized medicine systems, such as Oncobox [doi: 10.1007/978- 1-0716-0138-9_17].

The proposed method is a simple and reliable method for detecting the skipping of the 14th exon of the MET gene using RNA-seq data.

SUMMARY OF THE INVENTION

The technical result of this invention is to improve the detection of skipping the 14th exon of the MET gene based on RNA sequencing data. The invention is intended to improve systems of personalized medicine by introducing the possibility of detecting the skipping of the 14th exon of the MET gene directly based on total RNA-sequencing profiles of tumor tissue libraries.

The claimed technical result is achieved by means of a method for assessing the detection of the status of exon 14 of the MET gene according to RNA sequencing data, which consists of at least the following steps:

a) obtaining biological material (a patient’s tissue sample or physiological fluids) suitable for RNA sequencing;

b) obtaining RNA sequencing data from the material in point (a);

c) obtaining from the data in point (b) data on mapping reads to exons of the human MET gene, including mapping to exon junctions;

d) counting the number of SJ reads at the junction of exons 13 and 15 that have passed quality control, and comparing it with the selected threshold;

e) calculating the normalized level of coverage asymmetry of the 13th, 14th and 15th exons, and comparing it with a selected threshold, the absolute value of which should be large enough to conclude that the 14th exon was skipped;

f) analysis of the results of points (c) and (d), in which, when all selected thresholds described in points (c) and (d) are overcome, a conclusion is made about the presence of the MET gene with the skipping of the 14th exon in the sample.

In a preferred embodiment, when only one of the thresholds (either in point (c) or in point (d)) is passed, the biological material from which the RNA sequencing data was obtained is subjected to additional testing to assess the status of the 14th exon of the MET gene in this biological material. If the thresholds of points (c) and (d) have not been passed, it is concluded that there are no transcripts in the sample corresponding to the MET gene without exon 14.

BRIEF DESCRIPTION OF DRAWINGS

The essence of the invention is illustrated by drawings in which;

Fig. 1. Visualization of the level of coverage obtained by processing RNA sequencing data of a tumor with expression of the MET gene with exon 14 missing (you can notice the low degree of coverage of the 14th exon compared to its neighboring exons)

Fig. 2. Range diagram showing the distribution of length-normalized mean differences of exons 14 and 13 and exons 14 and 15. Samples with reads located at the junction of exons 13 and 15 are marked in red.

These drawings do not cover and, moreover, do not limit the entire scope of implementation options for this technical solution, but represent only illustrative material of a particular case of its implementation.

OPTION FOR IMPLEMENTATION OF THE INVENTION

Next, an embodiment of a method for assessing the status of the 14th exon of the MET gene according to RNA sequencing data will be described, which does not limit all embodiments of the claimed invention.

MET is a tyrosine kinase and proto-oncogene encoded on chromosome 7. Activated MET induces signaling pathways involved in cell survival and proliferation.

Mutations in MET are associated with a number of cancers, including kidney, gastric, nervous system, sarcoma and lung cancer. Mutations that result in higher expression or deletion of certain exons are often associated with these cancers. In particular, deletion of exon 14 is associated with a significant percentage of cases of non-small cell lung cancer and adenocarcinoma. MET is not typically degraded upon loss of exon 14. The resulting dysregulation of MET causes sustained activation of downstream cell proliferation and survival pathways. Mutations that cause deletions of MET exon 14 are heterogeneous, often affecting acceptor or donor splice sites.

Detection of missing exon 14 of the MET gene will allow the patient to be prescribed drugs that demonstrate high efficacy against this isoform, such as capmatinib and tepotinib.

Personalized medicine systems such as Oncobox [US11614434, publ. 03/28/2023], use RNA sequencing to provide recommendations for the treatment of patients with malignant neoplasms.

To map RNA sequencing reads, programs such as STAR [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3530905/] can be used, the result of which is the genomic coordinates to which certain reads were mapped, in including with a gap inside them. It is expected that the majority of RNA sequencing reads will be mapped to exons, and the normalized coverage values of each exon included in the final version of a particular transcript of a gene expressed in tumor tissue will not differ significantly (estimates of acceptable differences in exon coverage will be given below). If a read was mapped to a reference genome with a gap, it is concluded that it came from an exon junction.

The claimed invention uses these data to detect reads mapped to the junction of the 13th and 15th exons of the MET gene. The presence of such reads may indicate that exon 14 in the gene transcript was skipped.

Asymmetry of the exon 13, 14, and 15 coverages is also tested. The uneven coverage of these exons by reads is often due to the fact that exon 14 is skipped in the mature mRNA; accordingly, we expect to find only a small number of reads mapped to this region of the genome in the sample under study. Therefore, in the presence of a skip in the 14th exon, the average difference in read coverage between the 14th and 13th, and the 14th and 15th exons will be detectably lower than in the case without a skip.

Detection of the above two signs is considered sufficient reason to prescribe Capmatinib or Tepotinib to a patient suffering from non-small cell lung cancer. Detection of one of them may be a reason for further testing using RT-PCR with specially selected conditions and primers or any other method that allows the detection of skipping of exon 14 of the MET gene.

By RNA sample we mean RNA extracted from any human cells.

By “read mapping” we mean a bioinformatics method for analyzing sequencing results, which consists of determining the positions in the reference genome from which each specific read could most likely have been obtained.

By “SJ reads” or “splice junction reads” we mean reads classified by mapping programs as likely mapped to the junction of two exons.

By “genomic coordinates” we mean a position in the reference genome.

By “read flag” we mean a read characteristic indicated in mapping files (.sam, .bam) as a combination of binary flags that carry information about certain read properties.

By “base pair” we mean a pair of two nitrogenous nucleotide bases on complementary nucleic acid chains, connected by hydrogen bonds.

By “read coverage” we mean the number of reads mapped to a specific region of the reference genome.

Unless otherwise defined, technical and scientific terms used in this specification have their standard meanings generally accepted in the scientific and technical literature.

This method of detecting the skipping of the 14th exon in the MET gene transcript is intended to improve systems for selecting therapy for patients with cancer. Improvement is possible if the system uses RNA sequencing.

The first technical challenge to be solved (1) is the analysis of reads mapped to exon junctions. It includes the following subtasks:

1.1 Detection of reads at the junction of exons 13 and 15 of the MET gene

1.2 Analysis of the quality of detected reads.

The second task to be solved (2) is to assess the level of uneven coverage of exons 13, 14, and 15 by reads. This task is also divided into subtasks:

2.1 Finding reads mapped to exons of the MET gene.

2.2 Analysis of the quality of mapping of each of the found reads.

2.3 Calculation of exon read coverage

2.4 Calculation of asymmetry coverage of exons 13, 14 and 15 of the MET gene

2.5 Determination of the coverage difference limit, after which it can be considered that the RNA sample contains transcripts corresponding to the MET gene with exon 14 missing.

The problem of paragraph 1.1 is solved using programs for mapping reads obtained during RNA sequencing, which detect SJ reads. Reads falling at the junction of exons 13 and 15 are located according to genomic coordinates: the genomic coordinates of one end of the read should fall on exon 13, the coordinates of the other end should fall on exon 15.

Quality control (clause 1.2) was performed at the level of overlap length: the length of read overlap with each exon must be at least 10 base pairs.

To solve problem 2, we also use data generated by mapping RNA sequencing reads to the human genome.

Objective 2.1 involves finding all reads that overlap exons of the MET gene. This is done using programs for bioinformatics analysis of human nucleic acid sequences.

After finding the required readings, their quality is analyzed (clause 2.2). The mapping quality metric (mapQ) is used. Reading must pass a certain threshold for this metric. Depending on the RNA sequencing protocol, a criterion such as read direction (forward or reverse) may be added. If programs that additionally signal failure of the program's internal read quality control are used to align reads, reads that also fail this control are not included in further analysis. Reads are also subject to mapping quality requirements: the overlap length of the read with each exon must be at least 10 base pairs (similar to point 1.2). Reads that do not have these properties are not included in the coverage count.

Calculation of exon coverage (clause 2.3) occurs as follows: the overlap lengths with the exon in question of all reads that have passed quality control are summed and divided by the length of the exon in base pairs. The intuitive meaning of this value is that it represents the average number of reads per exon base pair. A visualization of the calculated MET gene exon coverage values can be found in Fig. 1.

For further assessment of asymmetry (clause 2.4), only those samples are taken whose sum of coverage for each exon exceeds 210 (this threshold corresponds to the average coverage of exons of the MET gene equal to 10). Samples with a lower number of mapped MET gene reads are not subject to analysis by the described method due to severe uneven coverage.

The exon coverages are then divided by the sum of the coverages of all exons of the MET gene and multiplied by 100 (the latter is done for ease of visualization and documentation). In this way, unification of the assessment of unevenness is achieved - the effect of different levels of MET gene expression in different samples is eliminated:

,

where i and j are exon numbers.

Next, the arithmetic mean of the difference between the normalized coverages of exons 14 and 13 and exons 14 and 15 is calculated. The resulting value is a measure of the asymmetry of coverage between these exons.

After calculating the measure of coverage asymmetry, it is necessary to understand what asymmetry is considered sufficient to conclude that exon 14 was skipped (section 2.5). To determine this threshold, coverage asymmetry was determined for 478 experimental RNA-seq samples of human tumor tissue, previously obtained by Oncobox, with an average coverage of each base pair on exons greater than 10. The cutoff value proposed in this invention was approximately the value of the outer lower limit of the X1 range diagram:

where Q1 and Q3 are the first and third quartiles of the distribution of normalized coverages. This value turned out to be close to 2, which was taken as the limit value (Fig. 2.)

Thus, after finding the required number of SJ reads and calculating the coverage asymmetry, we can draw conclusions about the presence of skipping exon 14 of the MET gene. If only one of these 2 signs is present (the presence of SJ reads or the presence of asymmetry), the RNA sequencing sample is checked by some other method for the presence of skipping the 14th exon of the MET gene. If there is both asymmetry of coverage and a sufficient number of SJ reads, it is concluded that the sample contains the missing 14th exon of the MET gene. In the absence of all the above-mentioned features, it is concluded that there is no missing exon 14 of the MET gene in the sample.

Example 1

RNA-seq sample A was collected from patient A, who had non-small cell lung cancer. After mapping RNA-seq reads, normalized coverage and skewness calculations were performed as described above. The skewness was -3.95, which is less than the selected threshold of -2. The latter indicates the potential presence in the sample of a MET gene transcript skipping the 14th exon. Among the RNA sequencing reads, reads were also found that were mapped with high quality to the junction of the 13th and 15th exons of the MET gene. This confirmed the expression of the MET gene isoform skipping the 14th exon in the sample under consideration. From these facts, it is concluded that the patient’s tumor expresses an isoform of the MET gene skipping the 14th exon, and there is reason to prescribe a drug effective against this isoform.

Example 2

RNA-seq sample B was collected from patient B, who had non-small cell lung cancer. After mapping RNA-seq reads, normalized coverage and skewness calculations were performed as described above. The skewness was -2.1, which is less than the selected threshold of -2. Among the mapped RNA sequencing reads, there were NOT those for the junction of exons 13 and 15 of the MET gene. These facts suggest that further testing of this sample for missing exon 14 of the MET gene is required.

To do this, 2 real-time PCR tests (RT-PCR) are performed. The first RT-PCR was carried out with 2 primers: forward primer F_13ex (sequence: CAGAATTTCACAGGATTGATTG), mapping to exon 13 of the MET gene, and reverse primer R_13-15ex (sequence: GATGAATTAGGAAACTGATCTTTAA), mapping to the junction of exons 13 and 15. The length of the PCR product is 122 base pairs. The second RT-PCR was carried out with the following primers: forward primer F_13ex (sequence: CAGAATTTCACAGGATTGATTG), mapping to exon 13 of the MET gene, and reverse primer, mapping to the junction of exons 13 and 14 (K_13-14ex: TCACTGCCCAGATCTTTAA). The length of the PCR product is 116 base pairs. Both PCRs were run under the following conditions: initial denaturation for 180 seconds at 95°C, followed by 40 cycles of 93°C for 10 seconds, 58°C for 30 seconds and 72°C for 45 seconds, and a final extension of 2 minutes at 72°C. To assess the quality of the PCR product, a melting curve and Sanger sequencing were used: in both cases, the F_13ex primer was used. Skipping of exon 14 was considered verified if the threshold cycle of both PCRs was no more than 35. After performing the above-described RT-PCR with sample B, we obtained a threshold cycle of more than 35 only in the control RT-PCR.

From these facts, it is concluded that the patient’s tumor does not express the MET gene isoform skipping the 14th exon and there is no reason to prescribe a drug effective against this isoform.

Example 3

RNA-seq sample B was collected from patient B, who had non-small cell lung cancer. After mapping RNA-seq reads, normalized coverage and skewness calculations were performed as described above. The asymmetry was -1.6, which is greater than the selected threshold of -2. Among the RNA sequencing reads, reads were found that were mapped with high quality to the junction of the 13th and 15th exons of the MET gene. These facts suggest that further testing of this sample for missing exon 14 of the MET gene is required.

To do this, 2 real-time PCR tests (RT-PCR) are performed. The first RT-PCR was carried out with 2 primers: forward primer F_13ex (sequence: CAGAATTTCACAGGATTGATTG), mapping to exon 13 of the MET gene, and reverse primer R_13-15ex (sequence: GATGAATTAGGAAACTGATCTTTAA), mapping to the junction of exons 13 and 15. The length of the PCR product is 122 base pairs. The second RT-PCR was carried out with the following primers: forward primer F_13ex (sequence: CAGAATTTCACAGGATTGATTG), mapping to exon 13 of the MET gene, and reverse primer, mapping to the junction of exons 13 and 14 (K_13-14ex: TCACTGCCCAGATCTTTAA). The length of the PCR product is 116 base pairs. Both PCRs were run under the following conditions: initial denaturation for 180 seconds at 95°C, followed by 40 cycles of 93°C for 10 seconds, 58°C for 30 seconds and 72°C for 45 seconds, and a final extension of 2 minutes at 72°C. To assess the quality of the PCR product, a melting curve and Sanger sequencing were used: in both cases, the F_13ex primer was used. Skipping of exon 14 was considered verified if the threshold cycle of both PCRs was no more than 35. After performing the above-described RT-PCR with sample B, we obtained threshold cycles greater than 35 in all RT-PCRs.

From these facts, it is concluded that the patient’s tumor expresses an isoform of the MET gene skipping the 14th exon, and there is reason to prescribe a drug effective against this isoform.

Example 4

The RNA-seq sample G was collected from patient G suffering from non-small cell lung cancer. After mapping RNA-seq reads, normalized coverage and skewness calculations were performed as described above. The asymmetry was -0.3, which is greater than the selected threshold of -2. Among the RNA sequencing reads, no reads were found that were mapped with high quality to the junction of the 13th and 15th exons of the MET gene. From these facts, it is concluded that the patient’s tumor does not express the MET gene isoform skipping the 14th exon and there is no reason to prescribe a drug effective against this isoform.

INDUSTRIAL APPLICABILITY

The present invention is intended for use in personalized oncology.

Claims (8)

1. A method for assessing the status of the 14th exon of the MET gene according to RNA sequencing data, which consists of at least the following steps: a) obtaining biological material suitable for RNA sequencing; b) obtaining RNA sequencing data from the material in point (a); c) obtaining from the data in point (b) data on mapping reads to exons of the human MET gene, including mapping at the junction of exons; d) counting the number of SJ reads at the junction of exons 13 and 15 that have passed quality control, and comparing it with a user-defined threshold selected based on the required rigor and accuracy of determining the presence of such reads; e) calculating the normalized level of coverage asymmetry of exons 13, 14 and 15 and comparing it with a user-defined threshold selected based on analysis of clinical samples; f) analysis of the results of points (c) and (d), in which, when all selected thresholds described in points (c) and (d) are overcome, a conclusion is made about the presence of the MET gene with the skipping of the 14th exon in the sample. 2. The assessment method according to claim 1, characterized in that when only one of the thresholds is overcome, either in point (c) or in point (d), the biological material from which the RNA sequencing data was obtained is subjected to additional testing, allowing evaluate the status of the 14th exon of the MET gene in this biological material, if the thresholds of points (c) and (d) have not been overcome, it is concluded that there are no transcripts in the sample corresponding to the MET gene without the 14th exon.