RU2816753C2 - Immunologically privileged bioactive kidney cells for treatment of kidney disease - Google Patents

Abstract

FIELD: biotechnology and medicine.

SUBSTANCE: invention relates to a method of producing a bioactive kidney cell (BKC), including a genetic modification in the beta-2 microglobulin (B2M) gene to provide a regenerative effect on a natural kidney for the treatment of chronic renal failure.

EFFECT: invention makes it possible to obtain a population of “universal donor” immunologically privileged kidney cells, to which gene editing was applied to obtain a population of modified allogeneic kidney cells administered to patients without the use of immunosuppression.

44 cl, 16 dwg, 9 tbl, 6 ex

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Patent Application No. 62/523,241, filed June 21, 2017, the contents of which are incorporated herein by reference in their entirety.

INCLUDING A LIST OF SEQUENCES BY REFERENCE

The complete contents of the sequence listing text file named "050400-516001WO_SEQUENCE_LISTING.txt", which was created on June 21, 2018 and has a size of 88654 bytes, is incorporated herein by reference.

FIELD OF TECHNOLOGY TO WHICH THE INVENTION RELATES

The present invention particularly relates to cells, compositions and methods for treating kidney disease. Certain aspects relate to compositions and methods for generating genetically modified, preferably non-alloreactive, bioactive kidney cell populations for treating subjects with kidney disease, as well as methods of providing regenerative effects to natural kidneys using selected kidney cell populations.

PREREQUISITES FOR CREATION OF THE INVENTION

Renal cell-based therapies have recently attracted particular interest as tissue and organ regeneration is technologically feasible in modern medicine (Ludlow et al. The Future of Regenerative Medicine: Urinary System. Tissue Engineering. 2012; 18:218-24) . New treatment paradigms using tissue engineering and cell therapy have been described that provide significant and lasting improvements in renal function, slow disease progression and help improve the quality of life of this category of patients. These next-generation regenerative medicine technologies enable the production of isolated kidney cells as a therapeutic tool for the treatment of chronic kidney failure (CKD). In publications by Presnell et al. WO/2010/056328 and Ilagan et al. PCT/US2011/036347 describes isolated bioactive kidney cells, methods for isolating and culturing them, and methods for treating using cell populations. In preclinical studies, injection of these bioactive kidney cells into the recipient's kidneys resulted in significant improvements in animal survival and kidney function, as evidenced by, for example, urine concentrating and filtering functions.

The current protocol for treating patients using selected kidney cells is based on the transfer of autologous cells. In this approach, bioactive kidney cells are obtained from patients, selected ex vivo , cultured in vitro to expand cell numbers as needed, and then infused into the patient. Each patient receives a treatment that is individually formulated using the patient's natural kidney cells (that is, an autologous treatment). Autologous treatments have significant technical and logistical barriers to their practical application; they require expensive specialized facilities and experienced personnel to create, the drugs must be created quickly after a patient is diagnosed, and in some cases, depending on the extent of disease progression, the patient's cells may not function satisfactorily and/or be present in very small quantities. Because of these complexities, autologous cell-based therapies may vary significantly in terms of efficacy and safety.

SUMMARY OF THE INVENTION

The present invention relates in particular to cells with reduced immunogenicity for use in the treatment of subjects with kidney disease. In specific embodiments, cells obtained from a donor that would not normally be administered to a patient (e.g., due to the potential for inflammation and immune system rejection) are genetically modified to provide a benefit to the patient (e.g., such that the cells are able to persist and stimulate improvement of renal function). The present invention also relates to methods for producing such cells.

In one aspect, the present invention relates to a method for producing a genetically modified bioactive kidney cell (BRC). In specific embodiments, the genetically modified BOD is a genetically modified BOD (that is, a BOD with a genetic modification in its genome). In specific embodiments, the genetically modified BOD comprises an exogenous polynucleotide (such as a plasmid or viral vector) that expresses an RNA interference (RNAi) molecule that causes a decrease in the expression of the immunogenicity genomic BOD gene. In specific embodiments, the RNAi molecule is a short interfering or short hairpin RNA molecule. In specific embodiments, the method includes genetically modifying a genomic gene responsible for immunogenicity in the BOD.

In specific embodiments, the gene encodes a protein in a major histocompatibility complex (MHC) class I molecule or an MHC class II molecule. In specific embodiments, the gene is a beta 2 microglobulin gene (B2M, also known as β2M), human leukocyte antigen (HLA)-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1 or HLA-DQB1.

In specific embodiments, the gene encodes a minor histocompatibility antigen (MiHA or mHA). In specific embodiments, the gene is an HA-1, HA-2, HA-8, HB-1, HY-A1, HY-A2, HY-B7, HY-B8, HY-B60, or HY-DQ5 gene.

In embodiments, any allelic variant of a gene mentioned herein (eg, an HLA gene, a B2M gene, or an mHA gene) may be modified (eg, deleted) or targeted by RNA interference.

In specific embodiments, genetic modification of a gene includes introducing a mutation into the gene. In specific embodiments, introducing a mutation into a gene involves deleting the gene or a portion thereof.

In specific embodiments, genetic modification of a cell includes introducing a mutation in any combination of two or more of the genes B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA- DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1 and/or HLA-DQB1.

In specific embodiments, the genetically modified BPC is a genetically modified primary kidney cell. In specific embodiments, the genetically modified primary kidney cell has been reseeded at least about 1, 2, 3, 4, 5, or more times before or after genetic modification. In specific embodiments, the method further includes obtaining OPC from genetically modified BOD. In certain embodiments, the OPC is produced and then genetically modified.

In certain embodiments, the BOD is in the BOD population. In specific embodiments, the BPC is a selected kidney cell (SRC). In certain embodiments, the OPC is located in the population of the OPC. Various non-limiting examples of CMOs are provided herein. In specific embodiments, the OPC is a renal tubular cell. In specific embodiments, the renal tubule cell is a proximal renal tubule cell. In specific embodiments, the OPC is an endocrine, vascular, or glomerular cell. In specific embodiments, the OPC population includes hypoxia-resistant and iodixanol-resistant cells. In specific embodiments, the OPC population includes cells that express hyaluronic acid synthase 2. In certain embodiments, the OPC population includes cells that are capable of receptor-mediated albumin transfer. In specific embodiments, the OPC is characterized by the expression of CK18 and GGT1. In specific embodiments, PrestoBlue metabolism and production of VEGF and KIM-1 are used as markers for the presence of viable and functional progeny cells. In specific embodiments, the BOD is obtained from a kidney biopsy.

In specific embodiments, the BOD is genetically modified while it is in the BOD population, with less than all of the cells in the BOD population becoming genetically modified. In specific embodiments, the method further includes isolating or enriching genetically modified BODs from the BOD population. In specific embodiments, the method further includes isolating or enriching genetically modified OPCs from the OPC population. In specific embodiments, a population of BOD (eg, OPC) is genetically modified to produce a population of BOD in which some cells are genetically modified and other cells are not modified. In some embodiments, some of the genetically modified cells are homozygous for the modification. In specific embodiments, some of the genetically modified cells are heterozygous for the modification. In specific embodiments, cells that are homozygous for the modification are enriched or selected. In specific embodiments, cells that are heterozygous for the modification are enriched or selected. In specific embodiments, cells that are homozygous or heterozygous for the modification are enriched or selected. In specific embodiments, the modification is a mutation that results in decreased expression of the protein encoded by the gene. In specific embodiments, the mutation results in a decrease in the level of protein on the surface of the modified cells. In certain embodiments, cells that express the protein are depleted or eliminated. In specific embodiments, the mutation results in a decrease in the level of an MHC class I molecule and/or an MHC class II molecule on the cell surface. In specific embodiments, cells with the mutation do not have an MHC class I molecule and/or an MHC class II molecule on their surface. In certain embodiments, cells that express an MHC class I molecule on their surface are depleted or eliminated. In certain embodiments, cells that express an MHC class II molecule on their surface are depleted or eliminated. In particular embodiments, a cell sorting method is used to remove cells that express MHC class I molecule protein and/or MHC class II molecule from the population. In specific embodiments, the cell sorting method involves using an agent (such as an antibody) that binds a protein of an MHC class I molecule and/or an MHC class II molecule. In specific embodiments, cell depletion or selection involves binding to a bead/antibody to select cells with certain proteins on their cell surface. In specific embodiments, the cell sorting method is magnetic activated cell sorting (MACS) or fluorescence activated cell sorting (FACS). In specific embodiments, the gene selected for genetic modification is a gene whose protein is expressed on the cell surface such that FACS and/or MACS technology allows differentiation (eg, based on surface antibody binding) of living cells. In embodiments, MACS is used to remove cells that express an MHC molecule (such as an MHC class I molecule or an MHC class II molecule) from cells that do not express an MHC molecule. In specific embodiments, an integrating or non-integrating vector can be used to express another HLA polypeptide component to further modify or modulate the adaptive or innate immune system, for example, to prevent targeting and lysis by natural killer (NK) cells.

In specific embodiments, genetic modification (eg, introducing mutations) of a gene includes (i) expressing a gene editing protein in the BOD; or (ii) delivery of the gene editing protein across the BOD cell membrane. In specific embodiments, the gene editing protein is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), megaTAL, or an RNA-guided endonuclease. In specific embodiments, the RNA-guided endonuclease is a Cas protein. In specific embodiments, the Cas protein is a Cas9 protein. In specific embodiments, genetic modification of the gene further comprises (i) expressing a single guide RNA (gRNA) in the BOD; or (ii) delivery of a single guide RNA (gRNA) across the BOD cell membrane. In specific embodiments, the Cas9 protein and gRNA are part of a ribonucleoprotein complex.

In specific embodiments, a method for producing a genomically modified BOD includes genetically modifying a genomic gene responsible for immunogenicity in the BOD to produce a genomically modified BOD, followed by culturing the modified BOD to produce progeny with the genetic modification in the gene. In certain embodiments, the progeny have a lower likelihood of immune rejection compared to corresponding cells that do not have the genetic modification in the gene. In specific embodiments, the method includes procreating offspring. In specific embodiments, propagation of the progeny includes reseeding the progeny at least 1, 2, 3, 4, or 5 times. In certain embodiments, growth kinetics and/or cell viability are monitored at each subculture. In specific embodiments, the viability of the propagated progeny is analyzed. In specific embodiments, the number of cells expanded is determined. In specific embodiments, cell number and progeny viability are monitored by the trypan blue dye exclusion method and the PrestoBlue metabolic assay. In specific embodiments, the functionality of BOD or OPC is assessed by gene expression profiling or measurement of enzymatic activity. In specific embodiments, enzyme activity is measured for LAP and/or GGT.

In specific embodiments, the gene editing protein is expressed from the transfected mRNA. In specific embodiments, the Cas protein is expressed from the transfected mRNA, and the gRNA is expressed from the plasmid DNA. In certain embodiments, the transfected mRNA is stabilized by the inclusion of modified nucleotide bases or polyadenylation sequences. In specific embodiments, the transfected mRNA is associated with at least one cell penetrating peptide. In specific embodiments, the Cas protein is expressed from the vector DNA. In specific embodiments, Cas protein expression is induced during at least a portion of the time that the gRNA is expressed in the cell. In certain embodiments, the DNA vector is not integrated into the genome. In specific embodiments, the DNA vector is an episomal vector. In certain embodiments, the DNA vector is a transposon. In specific embodiments, the gRNA is a transcript from vector DNA. In specific embodiments, the gene editing protein is a recombinant protein and is complexed with a gRNA ex vivo . In specific embodiments, the gene editing protein is a recombinant protein and is complexed with the gRNA ex vivo , and the protein/gRNA complex is delivered into the cell by transfection, lipofection, electroporation, microinjection, or other method known to those skilled in the art. In specific embodiments, additional nucleic acid elements encoding a selectable marker and/or specific mutations of the target gene are introduced into the cell along with the Cas9 protein/gRNA complex.

In specific embodiments, genetic modification of a gene results in a decrease in the amount of MHC class I on the cell surface. In specific embodiments, genetic modification of a gene results in a decrease in the amount of MHC class II on the cell surface. In specific embodiments, the method includes genetically modifying two or more genes, wherein at least one of the genes encodes a protein in an MHC class I molecule and at least one of the genes encodes a protein in an MHC class II molecule. In specific embodiments, at least one of the genes is an HLA gene.

In one aspect, the present invention relates to a population of engineered (eg, genetically modified) BODs produced by the method disclosed herein. In specific embodiments, the population of genetically modified BODs is a population of genetically modified BODs. In specific embodiments, the population includes both non-genetically modified and genetically modified cells. In specific embodiments, the population is enriched for genetically modified BOD. In specific embodiments, the genetically modified BPCs are homozygous for the genetic modification.

In one aspect, the present invention provides an engineered (eg, genetically modified) BPC having a mutation in a gene encoding a protein in a major histocompatibility complex (MHC) class I molecule or an MHC class II molecule. In specific embodiments, at least a portion of the gene has been deleted, wherein the gene is a B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA- DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1 or HLA-DQB1. In specific embodiments, the genetically modified BOD is in the BOD population. In specific embodiments, the population of genetically modified BODs is a population of genetically modified BODs. In specific embodiments, the population includes both non-genetically modified and genetically modified cells. In specific embodiments, the population is enriched for genetically modified BOD. In specific embodiments, the genetically modified BPCs are homozygous for the genetic modification.

In one aspect, the present invention relates to a method of treating kidney disease in a patient, comprising administering a population of BPCs to the patient, wherein the population of BPCs includes genetically modified BPCs, wherein the genetically modified BPCs have a mutation in a gene encoding a protein in a major histocompatibility complex (MHC) molecule. class I or MHC class II molecule.

In specific embodiments, the kidney disease is chronic renal failure.

In specific embodiments, the BOD population is a CPC population. In specific embodiments, the CPC population is obtained from a patient. In specific embodiments, the OPC population is obtained from one or more donors. In specific embodiments, the OPC population is obtained after exposure to hypoxic culture conditions. In specific embodiments, the OPC population is obtained after density gradient separation of expanded kidney cells. In specific embodiments, the OPC population has a buoyant density greater than about 1.04, 1.0419, or 1.045 g/ml. In certain embodiments, the OPC population contains a higher percentage of one or more cell types and is devoid of, or contains a lower percentage of, one or more other cell types, compared to the original kidney cell population.

In one aspect, the present invention relates to an injectable preparation. In specific embodiments, the formulation comprises a) a temperature-sensitive cell-stabilizing biological material and b) a population of BPCs, wherein the population of BPCs includes genetically modified BPCs, wherein the genetically modified BPCs have a mutation in a gene encoding a protein in a major histocompatibility complex (MHC) class I molecule or MHC class II molecule. In specific embodiments, the temperature-sensitive cell-stabilizing biological material is a hydrogel that (i) remains a substantially solid state at or below a temperature of about 8° C., with the substantially solid state being a gel state, (ii) remains a substantially liquid state at a temperature of about ambient temperature or higher, and (iii) has a solid-liquid transition state in the temperature range from about 8°C to ambient temperature or higher.

In specific embodiments, the hydrogel contains an extracellular matrix protein of recombinant origin, derived from the extracellular matrix of a kidney or other tissue or organ, or contains gelatin. In specific embodiments, the hydrogel contains gelatin. In specific embodiments, gelatin is derived from type I, alpha-1 collagen. In specific embodiments, the gelatin is derived from porcine collagen type I, alpha-1, or recombinant human collagen type I, alpha-1. In specific embodiments, the BPC population is a population of selected kidney cells (SRCs), and the genetically modified BPCs are genetically modified SRCs.

In one aspect, the present invention relates to a method of treating kidney disease in a patient, comprising injecting a preparation of genetically modified BODs disclosed herein into the patient, wherein the preparation is injected through an 18-30 gauge needle. In specific embodiments, the needle has a diameter corresponding to about 27 gauge, about 26 gauge, about 25 gauge, about 24 gauge, about 23 gauge, about 22 gauge, about 21 gauge, or about 20 gauge.

The present invention relates to methods for genetically modifying BPCs into non-immunogenic allogeneic donor-derived BPCs to make them suitable for therapeutic purposes, the methods using RNA-guided endonucleases such as Cas9/clustered regularly interspaced short palindromic repeats (CRISPR). ). More specifically, the methods proposed herein allow for precise modification of the genome of BPCs important for renal tissue regeneration by inactivating and/or replacing genes involved in the immunological recognition of BPCs (e.g., MHC and/or immune checkpoint protein recognition), which makes it possible to introduce these cells as an allogeneic implant without eliminating them by the immune system.

In one aspect, the present invention relates to a method of obtaining a population of genetically modified immunologically privileged bioactive kidney cells, comprising the step of (a) genetic modification of BOD or OPC, including the introduction, and/or expression within cells, of RNA-guided endonucleases; and a specific guide RNA that directs the endonuclease to at least one immunogenicity target gene in the BOD or OPC genome; and (b) propagating resulting cells that are immunologically privileged with a low or reduced likelihood of immune rejection. In specific embodiments, the RNA-guided endonuclease is Cas9. The RNA-guided endonuclease can be expressed from the transfected mRNA, or the RNA-guided endonuclease is expressed from the transfected mRNA and the gRNA is expressed from the plasmid DNA. In certain embodiments, the transfected mRNA is stabilized by the inclusion of modified nucleotide bases or polyadenylation sequences. In specific embodiments, the transfected mRNA is associated with at least one cell penetrating peptide. In specific embodiments of the method, the endonuclease is expressed from the vector DNA. Endonuclease expression can be induced while guide RNA is being produced in the cell. In certain embodiments, the DNA vector is not integrated into the genome. The DNA vector may be an episomal vector, an artificial chromosome, or a transposon. In specific embodiments, the guide RNA is a transcript from the vector DNA. In specific embodiments, the Cas protein is a purified recombinant protein complexed ex vivo with a guide RNA and/or DNA targeting construct containing certain mutations. In specific embodiments, the Cas/gRNA complex or plasmid is introduced into a cell by electroporation.

In specific embodiments, the at least one immunogenicity target gene is one or more MHC class I control genes. In particular embodiments, the at least one immunogenicity target gene is one or more MHC class control genes II. In specific embodiments, the at least one immunogenicity target gene is one or more MHC class I and MHC class II control genes. In certain embodiments, the at least one target locus may be an HLA gene. In specific embodiments, the HLA gene is selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DRB3/4/5, an HLA-DQ family gene (e.g., HLA-DQA1 and/or HLA-DQB1) and the HLA-DP family gene (for example, HLA-DPA1 and/or HLA-DPA2).

In specific embodiments, MHC suppression in BPC (eg, GPC) allows the development of an off-the-shelf genetically modified/regenerative allogeneic tissue medicinal product for the treatment of chronic renal failure (CKD). In specific embodiments, modified OPCs (eg, modified OPCs, such as universal donor OPCs) are created by knocking down MHC class I on the surface of the OPCs. In particular embodiments, gene editing (such as CRISPR/Cas9 gene editing) is used to produce an effect (e.g., introducing a mutation, e.g., by partial or complete deletion, or by base pair editing, or by introducing an exogenous DNA element, such as selectable marker and/or modified genomic fragment) for the B2M or HLA-A (α-subunit) component of the MHC class I complex.

In specific embodiments of the method, the genetically modified BODs are propagated in vitro . In specific embodiments, the method is used to produce BOD or OPC for use as a therapeutic agent. In specific embodiments, the method is used to produce BOD or OPC for the treatment of chronic renal failure in a patient in need thereof.

In one aspect, a population of genetically modified BOD or OPC is provided, produced by the method of the present invention.

In one aspect, the present invention relates to a method of treating a patient, comprising (a) obtaining a population of genetically modified BOD or OPC in the manner described above; and (b) administering the genetically modified BPC or OPC to the patient. In specific embodiments, the patient is diagnosed with chronic renal failure. In certain embodiments, the BOD or OPC is obtained from a patient who will receive treatment. In specific embodiments, the BOD or OPC is obtained from one or more donors.

In one aspect, a population of bioactive kidney cells is obtained by isolating and expanding kidney cells from kidney tissue under culture conditions resulting in enrichment for cells capable of promoting kidney regeneration. In specific embodiments, the population of bioactive kidney cells is obtained after exposure to hypoxic culture conditions. In specific embodiments, the BOD population is a BPC population obtained after density gradient separation of expanded kidney cells. In specific embodiments, the OPCs have a buoyant density greater than about 1.04, 1.0419, or 1.045 g/ml. In specific embodiments, the BOD or OPC population contains a higher percentage of one or more cell types and is devoid of, or contains a lower percentage of, one or more other cell types, compared to the parent kidney cell population. In certain embodiments, the cell growth kinetics of the BOD or OPC population can be monitored at each subculture. For example, the amount and viability of BOD or OPC can be monitored by the trypan blue dye exclusion method and the PrestoBlue metabolism assay. In certain embodiments, BOD or OPC may be characterized based on the phenotypic expression of certain markers of viability and functionality, for example, CK18 and GGT1. In certain embodiments, the VEGF and KIM-1 produced can be used as markers for the presence of viable and functional BOD or OPC. In certain embodiments, viability and functionality can be determined by gene expression profiling or measurement of enzymatic activity. In certain embodiments, BOD or OPC is characterized by measuring enzymatic activity for LAP and/or GGT.

The present invention includes, but is not limited to, isolated cells or cell populations having the genetic modifications described herein (e.g., in the Summary, Detailed Description, Examples, and Figures), as well as any of the proteins, polypeptides, or vectors useful to carry out genetic modification of kidney cells in order to make them less immunogenic (for example, immunological privilege). The modified kidney cells provided by the present invention can be used as therapeutics, ideally as an "off-the-shelf" drug (e.g., that can be used in many, if not most or all, patients) in methods of treating or preventing chronic renal failure.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1: A flow diagram for the production of genetically modified human allogeneic kidney cells for use in the treatment of chronic renal failure is presented.

FIG. 2: A flow diagram for a non-limiting example of a complete NKA manufacturing process is presented.

FIG. 3A-D: More detailed flow diagrams are provided for a non-limiting example of the process shown in FIG. 2.

FIG. 4: Schematic representation of the MHC class I complex.

FIG. 5: Genomic scaffold of the B2M gene region showing the guide RNA binding site.

FIG. 6: Results of FACS analysis showing CRISPR/Cas9-mediated knockdown of B2M (the unchanged subunit of MHC-I) in human primary kidney cells.

FIG. 7: Results of FACS analysis showing CRISPR/Cas9-mediated knockdown of B2M (the unchanged subunit of MHC-I) in human primary kidney cells.

FIG. 8: Genome split analysis results showing successful gene editing at the B2M locus. The blot shown is an ethidium bromide-stained DNA gel, with black/white colors inverted for clarity. In non-limiting examples, genome segregation analysis or direct sequencing of the target locus can be used to confirm targeted modification of the genome.

FIG. 9: FACS analysis results demonstrating CRISPR-mediated editing of the B2M locus in the OPC. Note the different ABO haplotypes of donors, this indicates the possibility of performing MHC I gene editing regardless of the ABO haplotype:

donor blood type TCHK006 O(+) TCHK011 AB(-) TCHK004 O(-)

FIG. 10: Lymphocyte proliferation assay plot showing that CRISPR-modified B2M OPCs cause decreased lymphocyte proliferation compared to unmodified control OPCs, providing evidence that targeting B2M with CRISPR results in decreased CRISPR immunogenicity. modified OPK.

FIG. 11: Plot of activity assay testing OPC with CRISPR-modified B2M, showing no significant differences in VEGF and KIM1 secretion between modified and unmodified OPC. Modification by CRISPR does not affect the functionality of the OPC.

FIG. 12: Schematic representation of the HLA MHC complex on human chromosome 6.

FIG. 13: Image showing the morphology of exemplary human kidney cells in culture.

FIG. 14: Image showing the striping of illustrative OPCs when centrifuged across a phase boundary of different densities.

FIG. 15: Graph showing an exemplary gelation temperature profile for a gelatin solution.

FIG. 16: Graph showing exemplary cell distribution as a function of rotation time during NKA gelation process.

DETAILED DESCRIPTION OF THE INVENTION

The present invention particularly relates to preparations and methods for producing renal cell populations that can be used in a variety of patients. In certain embodiments, the cell populations are less immunogenic than the populations from which they are derived. In particular embodiments, gene editing is used to generate a population of allogeneic kidney cells for administration to patients without the use of immunosuppression. The present invention relates to suitable donor cells from different tissue types, or from different donors, which can be successfully transplanted into recipient subjects regardless of haplotype differences in the genes responsible for immunogenicity.

Ideally, it would be desirable to use standardized therapies in which allogeneic therapeutic cells could be pre-manufactured, extensively characterized, and made available for immediate administration to patients. Unfortunately, the availability of suitable donor cells with matching alleles at one or more immunogenicity gene loci is limited due to the heterogeneity of haplotypes in human populations. For example, HLAs are immunogenicity genes that were first identified during early clinical hematopoietic stem/progenitor cell transplantation (HSCT) procedures. HLA mismatches between the donor and the recipient can cause immune reactions when the recipient's T cells may perceive the donor allogeneic tissue introduced into the body as foreign due to recognition of HLA proteins or donor-specific antigens expressed or presented on the surface of the allogeneic donor cells, which ultimately leads to graft rejection. (Bhatia S. Expert Rev Hematol. 2011; 4(4):437-452; Garnett C, et al. TherAdv Hematol. 4(6): 366-78 (2013)). Despite medical advances in suppressing immune responses against allogeneic transplanted donor cells, there remains a need for additional methods and compositions capable of reducing rejection and/or increasing the immunological compatibility of donor cells. Most importantly, there remains a need to increase the availability of suitable donor cells that can be successfully transplanted into recipient subjects regardless of haplotype differences in the genes responsible for immunogenicity.

One approach to overcoming the immunological barrier to cell transplantation is genetic manipulation of HLA molecules. Using zinc finger nucleases, Torikai and colleagues selectively eliminated human leukocyte antigen (HLA) class I from embryonic stem cells (ESCs) and demonstrated that HLA-A cells can avoid lysis by HLA-restricted cytotoxic T lymphocytes. (Oberg L et al. , Eur J Immunol., 2004, 34(6): 1646-1653). In another study, Riolobos and colleagues disrupted the B2M gene, which encodes the accessory chain of MHC class I molecules and is required for their surface expression (Laura Riolobos et al. , 2013, 21(6): 1232-1241). Homozygous deletion of the B2M gene prevented surface translocation of human leukocyte antigen (HLA) class I molecules and resulted in decreased immunogenicity. More recently, the discovery and application of the CRISPR/Cas9 system in mammalian cells has enabled efficient and precise editing of target genes, such as through non-homologous end joining (NHEJ), homologous repair (HDR), or other DNA repair pathways. (Gasiunas, Barrangou et al. 2012; Jinek, Chylinski et al. 2012). Co-delivery of a Cas9 molecule and a target-specific guide RNA (gRNA) molecule enables gene editing of the target sequence in the genome. Thus, using the CRISPR/Cas9 system to modify genes in cells is also a promising strategy to improve the immunological compatibility of donor cells intended for transplantation into a recipient subject. (WO2016201047 A1).

Results from experiments related to the immunogenicity of one cell type (such as embryonic stem cells) cannot be predictably applied or transferred to other cells (such as kidney cells). Surprisingly, knocking out some degree of B2M expression also results in decreased immunogenicity of the kidney cell population. Moreover, the decrease in immunogenicity occurred despite the fact that some B2M expression was maintained in the modified cell population. The present invention includes gene editing technologies for modifying the adaptive immune system of BODs (such as OPCs) to create universal donor cells for the treatment of kidney disease. In specific embodiments, immunogenicity is the ability to initiate an adaptive (eg, T cell-mediated) immune response.

Aspects of the present invention relate, at least in part, to the discovery that OPCs from a donor with one haplotype can be genetically modified to reduce their immunogenicity in subjects with a different haplotype. The present invention relates to genetically modified OPCs, which can be successfully transplanted into recipient subjects, regardless of differences in haplotypes in the genes responsible for immunogenicity, as well as to methods and preparations for the treatment of kidney diseases with such modified OPCs.

Some embodiments of the invention will now be described in detail. Although the invention will be described by way of illustrative embodiments, it should be understood that the invention should not be limited to these embodiments. On the contrary, the invention is intended to cover all alternatives, modifications and equivalents that may be included within the scope of the present invention based on the claims. There are many methods and materials known to those skilled in the art, similar or equivalent to those described herein, that can be used in practicing the present invention. The present invention is in no way limited to the methods and materials described.

All literature cited in this application is expressly incorporated herein by reference in its entirety. To the extent that one or more of the included literature, patents and the like differs from, or conflicts with, this application, including, but not limited to, defined terms, usage of terms, techniques described, or the like, this application shall control.

Definitions

Unless otherwise indicated, all technical and scientific terms used herein have the meaning commonly given to them by those skilled in the art to which this invention relates. In Principles of Tissue Engineering, 3rd Ed. (edited by R Lanza, R Langer, & J Vacanti), 2007, one skilled in the art may find general guidance in understanding many of the terms used herein. One skilled in the art will appreciate that many methods and materials similar or equivalent to those described herein can be used in practicing the present invention. Indeed, the present invention is in no way limited to the methods and materials described.

When used herein, the singular form of terms shall also include the corresponding plural form, unless the context clearly indicates otherwise. As used herein, the term “and/or” includes any and all combinations of one or more of the related listed entities.

When used in this specification and claims, the words “comprise”, “comprising”, “include”, “including” and “includes” are intended to indicate the presence of the specified features, integers, components or steps, but they must not exclude the presence, or adding one or more other features, integers, components, steps, or groups thereof.

As used herein, the term “about” in the context of a numerical value or range means ±10% of the stated or stated numerical value or range, unless the context implies a more limited range.

As used herein, the term “cell population” means a number of cells obtained by isolation directly from a suitable source tissue, typically mammalian tissue. For example, the cell population may include kidney cell populations and mixtures thereof. The isolated population of cells can then be cultured in vitro . Those skilled in the art will appreciate that various methods for isolating and culturing cell populations useful in the present invention can be used, and varying numbers of cells in a population of cells suitable for use in the present invention can be used. The population of cells may be an unfractionated, heterogeneous population of cells or an enriched homogeneous population of cells obtained from an organ or tissue, such as a kidney. For example, a heterogeneous population of cells can be isolated from a biopsy tissue sample or from the tissue of an entire organ. Alternatively, a heterogeneous population of cells can be obtained from in vitro cultures of mammalian cells created from biopsy tissue samples or from whole organ tissue. An unfractionated heterogeneous cell population may also be referred to as a non-enriched cell population. In specific embodiments, the cell populations contain bioactive cells. Homogeneous populations of cells contain a greater number of cells of the same cell type, sharing a common phenotype, or having similar physical properties, compared to an unfractionated, heterogeneous population of cells. For example, a homogeneous population of cells can be isolated, extracted, or enriched from a heterogeneous population of kidney cells. In specific embodiments, a homogeneous population of cells is obtained as a cell fraction by separating a heterogeneous cell suspension by centrifugation across a boundary, barrier, or interface between phases of different densities. In specific embodiments, a homogeneous population of cells is obtained as a cell fraction by separating a heterogeneous cell suspension using a continuous or discontinuous (single or multi-step) density gradient separation method. In specific embodiments, a homogeneous or heterogeneous population of cells derived from a kidney is mixed with a homogeneous or heterogeneous population of cells derived from a tissue or organ other than the kidney, without further limitation.

As used herein, the term “bioactive” means “having biological activity,” such as pharmacological or therapeutic activity. In specific embodiments, the biological activity is an improvement in renal function and/or an effect on renal homeostasis. In specific embodiments, the biological activity is, without limitation, analgesic; antiviral; anti-inflammatory; antineoplastic; immunostimulating; immunomodulatory activity; increasing cell viability, antioxidant activity, oxygen transport capacity, cell recruitment, cell attachment, immunosuppression, angiogenesis, wound healing activity, mobilization of host stem or progenitor cells, cell proliferation ability, stimulation of cell migration to damaged areas, weakening of cellular and tissue fibrosis, interference with the epithelial-mesenchymal transition signaling cascade, secretion of cytokines, growth factors, proteins, nucleic acids, activity against exosomes, microvesicles, or any combination thereof.

As used herein, the term “bioactive kidney cells,” or “BRC,” means kidney cells that have one or more of the following properties when administered to a kidney of a subject: the ability to reduce (e.g., slow or stop) the worsening or progression of chronic renal failure or symptom thereof, the ability to improve renal function, the ability to influence (improve) renal homeostasis, and the ability to promote healing, repair and/or regeneration of renal tissue or the kidney. In specific embodiments, the BPCs are genetically modified (eg, genomically modified and/or modified by RNAi) such that they are less immunogenic in the patient than they would be without the genetic modification. In certain embodiments, BPC can be administered to a patient regardless of the patient's haplotype. In specific embodiments, BODs are genetically modified (e.g., genomically modified and/or modified by RNAi) immunologically privileged cells capable of improving renal function, influencing (improving) renal homeostasis, and/or promoting renal healing, repair, and/or regeneration. tissue or kidney, without immunological rejection. In specific embodiments, these cells may include functional renal tubular cells (eg, based on improved creatinine excretion and protein retention), glomerular cells (eg, based on improved protein retention), vascular cells, and other corticomedullary junction cells. In specific embodiments, BOD is produced by isolating and expanding kidney cells from kidney tissue. In specific embodiments, BOD is obtained by isolating and expanding kidney cells from kidney tissue using methods that select for bioactive cells (eg, cells with regenerative capacity). In specific embodiments, BODs have a regenerative effect on the kidney. In specific embodiments, the BPCs include, consist primarily of, or are composed of selected kidney cells (SRCs). In certain embodiments, the BODs are OPCs. Methods for producing bioactive kidney cells (BRC) are described, for example, in Presnell et al. WO/2010/056328, Ilagan et al. PCT/US2011/036347 and Jain et al. PCT/US2016/044866.

In specific embodiments, OPCs are cells obtained by isolating and expanding renal cells from appropriate renal tissue, wherein the OPCs contain a higher percentage of one or more cell types and lack, or contain a lower percentage of, one or more other cell types, compared with the original kidney cell population. In certain embodiments, the OPCs contain an increased percentage of BOD compared to the original kidney cell population. In specific embodiments, the OPC population is an isolated population of kidney cells enriched for specific bioactive components and/or cell types, and/or depleted for specific inactive and/or undesirable components or cell types, intended for use in the treatment of kidney disease, i.e. , to ensure stabilization and/or improvement and/or restoration of renal function. In specific embodiments, the OPCs are genetically modified (eg, genomically modified and/or modified by RNAi) such that they are less immunogenic in the patient than they would be without the genetic modification. In certain embodiments, OPC can be administered to a patient regardless of the patient's haplotype. In specific embodiments, the OPCs have been genetically modified (eg, genomically modified and/or modified by RNAi) to become immunologically privileged or non-rejection capable and capable of stabilizing and/or improving and/or restoring renal function. OPCs provide superior therapeutic and regenerative results compared to the original population. In specific embodiments, OPC is obtained from renal cortical tissue from a patient through a kidney biopsy. In certain embodiments, OPCs are selected (eg, by MACS or FACS) based on their expression of one or more markers. In specific embodiments, the OPC is depleted (eg, by MACS or FACS) of one or more cell types based on the expression of one or more markers on those cell types. In specific embodiments, cell depletion or selection involves binding to a bead/antibody to select cells with certain proteins on their cell surface. In specific embodiments, the OPCs are selected from a population of bioactive kidney cells. In specific embodiments, OPCs are selected by density gradient separation of expanded kidney cells. In specific embodiments, OPCs are selected by separating expanded kidney cells by centrifugation across a boundary, barrier, or interface between phases of different densities, or by separating a discontinuous single-step density gradient. In specific embodiments, OPCs are selected by continuous or discontinuous density gradient separation of expanded kidney cells that have been cultured under hypoxic conditions. In specific embodiments, OPCs are selected by density gradient separation of expanded kidney cells that have been cultured under hypoxic conditions for at least about 8, 12, 16, 20, or 24 hours. In specific embodiments, OPCs are selected by centrifugation separation across a boundary, barrier, or interface between phases of different densities of expanded kidney cells that have been cultured under hypoxic conditions. In specific embodiments, OPCs are selected by separating expanded kidney cells that have been cultured under hypoxic conditions for at least about 8, 12, 16, 20, or 24 hours by centrifugation across a boundary, barrier, or interface between phases of different densities (eg , separation in a discontinuous one-step density gradient). In certain embodiments, OPCs are composed primarily of renal tubular cells. In certain embodiments, other parenchymal (eg, vascular) and stromal (eg, collecting duct) cells may be present in the OPC. In specific embodiments, less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the cells in the OPC population are vascular cells. In specific embodiments, less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the cells in the OPC population are collecting duct cells. In specific embodiments, less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the cells in the OPC population are vascular or collecting duct cells. Methods for obtaining OPC are disclosed, for example, in Example 1 of this document, as well as in Presnellet al. WO/2010/056328, Ilaganet al. PCT/US2011/036347 and Jainet al. PCT/US2016/044866.

The term "natural organ" means an organ from a living subject. The subject may be healthy or unhealthy. An unhealthy subject may have a disease associated with that particular organ.

The term "natural kidney" means a kidney from a living subject. The subject may be healthy or unhealthy. An unhealthy subject may have kidney disease.

The term "regenerative effect" means an effect that benefits a natural organ, such as a kidney. The effect may include, without limitation, reducing the extent of damage to a natural organ, or improving, restoring or stabilizing the function, or structure, of a natural organ. Kidney damage may take the form of fibrosis, inflammation, glomerular hypertrophy, atrophy, and so on, and is associated with disease of a natural organ in the subject.

As used herein, the term “mixture” in the context of a cell population means a combination of isolated enriched populations of cells of two or more phenotypes derived from an unfractionated, heterogeneous population of cells. In specific embodiments, the cell populations of the present invention are kidney cell populations.

An "enriched" cell population, or preparation, means a population of cells derived from the original cell population of an organ (eg, an unfractionated, heterogeneous cell population) that contains a greater percentage of a particular cell type than the percentage of that cell type in the original population. For example, the initial population of kidney cells may be enriched for the first, second, third, fourth, fifth, and so on, cell population of interest. As used herein, the terms “cell population,” “cell preparation,” and “cell phenotype” are used interchangeably.

As used herein, the term “hypoxic” culture conditions means culture conditions in which cells have available oxygen levels in the culture system that are reduced relative to standard conditions in which cells are cultured at atmospheric oxygen levels (approximately 21%). Non-hypoxic conditions are referred to herein as normal or normoxic culture conditions.

The present invention relates to BPCs (eg, GPCs) that are "genetically modified" or "genetically altered", or have been subjected to "genomic modification". In specific embodiments, such cells can be produced using a gene editing technique to remove one or more specific cell surface antigens, such as major histocompatibility complex antigens, from donor OPC/BPC populations. Various methods can be used to genetically modify such cells. For example, cloned or synthesized DNA can be introduced, replaced or removed to create genetically modified OPC/BOD by genetic editing methods using genetically engineered nucleases, such as: a) the CRISPR/Cas system; b) effector transcription activator-like nucleases (TALENs); c) zinc finger nucleases (ZFN) and d) genetically engineered meganucleases (homing endonucleases). Various other polynucleotide delivery methods known in the art may be suitable for genetic modification of OPC/BOD, such as, for example, transfection, electroporation, transduction, lipofection, the use of nanoengineered substances such as organically modified silica or organically modified silicate (eg , ormosil), viral delivery methods using adenoviruses, retroviruses, lentiviruses, adeno-associated viruses, or other suitable methods.

The term "RNA-guided endonuclease" means a polypeptide whose endonuclease activity and specificity depends on its association with an RNA molecule. The complete sequence of such an RNA molecule, or more commonly a fragment of such an RNA molecule, which has a sequence length of preferably greater than 8 nucleotide bases, more preferably greater than 10 nucleotide bases, even more preferably greater than 12 nucleotide bases, has the ability to recognize a target sequence in genome. Typically, such an RNA molecule can hybridize to a target sequence and mediate the endonuclease activity of such an endonuclease. An example of an RNA-guided endonuclease is Cas9 (CRISPR-associated protein 9) as part of the Cas9/CRISPR system. For a detailed description, see, for example, Sanders and Joung, Nature Biotechnology 32, 347–355 (2014).

As used herein, the term “immunogenicity” means the property that allows a substance to induce a detectable immune response (humoral or cellular) when administered to a subject (eg, a human subject).

The term "immunogenicity gene" covers genes encoding a major histocompatibility complex antigenic protein or a minor histocompatibility antigen. In specific embodiments, the immunogenicity gene is any one of, or any combination of, the B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA genes -DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1 and/or HLA-DQB1. In specific embodiments, the immunogenicity gene is a gene encoding a protein selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, a member of the HLA-DR family (e.g., HLA-DRA, HLA-DRB1 , HLA-DRB3, HLA-DRB4 and/or HLA-DRB5), a member of the HLA-DP family (eg, HLA-DPA1 and/or HLA-DPA2), and a member of the HLA-DQ family (eg, HLA-DQA1 and/or HLA -DQB1).

The term "immunologically compatible renal cell" or "immunologically compatible renal cell population" covers a renal cell, or population of cells, lacking one or more alleles of a gene encoding a major histocompatibility complex antigenic protein and/or a minor histocompatibility antigen that makes the cell immunologically recognizable . In specific embodiments, an immunocompatible kidney cell, or population of immunocompatible kidney cells, is a kidney cell, or population of cells, lacking one or more alleles of a gene encoding B2M. In specific embodiments, an immunocompatible kidney cell, or population of immunocompatible kidney cells, is a kidney cell, or population of cells, lacking one or more alleles of any of, or any combination of, the B2M, HLA-A, HLA-B, HLA genes -C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1 and/or HLA-DQB1. In certain embodiments, immunologically compatible kidney cells administered to a recipient subject are immunologically privileged and do not induce an immune response in the recipient subject.

As used herein, the term “biological material” means a natural or synthetic biocompatible material suitable for introduction into living tissue that supports selected bioactive cells in a viable state. Natural biological material is material that is created in or originates from a living system. Synthetic biological materials are materials that are not directly created in or derived from a living system, but are synthesized or produced using specific chemical procedures and protocols well known to those skilled in the art. The biological materials disclosed herein may be a combination of natural and synthetic biocompatible materials. Biological materials described herein include, for example, polymer matrices and scaffolds. Those skilled in the art understand that biological material(s) may be configured in various forms, such as foams, gels, liquids, granules, solids, and may contain one or more natural or synthetic biocompatible materials. In specific embodiments, the biological material is a solution in liquid form that is capable of being converted into a hydrogel.

As used herein, the term “hydrogel” means a substance formed when an organic polymer (natural or synthetic) cross-links through covalent, ionic or hydrogen bonding to form a three-dimensional open lattice structure that traps water to form a gel. Examples of materials that can be used to form a hydrogel include polysaccharides such as alginate, polyphosphazines and polyacrylates that are tonically cross-linked, or block copolymers such as Pluronics™ or Tetronics™, polyethylene oxide-polypropylene glycol block copolymers that are cross-linked temperature or pH account, respectively. The hydrogel used herein is preferably a biodegradable gelatin hydrogel.

Biological materials described herein include, for example, extracellular matrix derived from human or animal kidney wherein the natural population of cells has been eliminated through the use of detergents and/or other chemicals known to those skilled in the art. In specific embodiments, the biological material is a solution in liquid form that is capable of being converted into a hydrogel and forms layers with or without specific cell populations through the use of 3D bioprinting methodology known to those skilled in the art. In specific embodiments, the biological material is configured to mimic the three-dimensional fractal organization of a kidney devoid of cells.

The term "modified release" or the equivalent terms "controlled release", "delayed release" or "sustained release" refers to drugs that release the active agent, such as bioactive cells, over a period of time or at more than one point in time, after administration to an individual. Modified release of the active agent, which can occur over a range of desired periods of time, such as minutes, hours, days, weeks, or longer periods of time, depending on the formulation, differs from the release of standard formulations, in which virtually the entire dose unit becomes available immediately after administration. For applications in tissue engineering and regenerative medicine, preferred modified release formulations provide release of the active agent at multiple time points following local administration (eg, administration of the active agent directly into a solid organ). For example, a modified bioactive cell release formulation would provide an initial release of cells immediately upon administration and a subsequent second release of cells at a later time. The time delay for the second release of the active agent may be several minutes, hours or days after the initial administration. Typically, the period of time for delayed release corresponds to the period of time required for the biological material carrier of the active agent to lose its structural integrity. Delayed release of the active agent begins immediately after the onset of disruption of such integrity and is completed at the point in time when integrity is completely disrupted. Other suitable release mechanisms are known to those skilled in the art.

The term "ambient temperature" means the temperature at which the drugs of the present invention will be administered to a subject. Typically, the ambient temperature is the temperature of a temperature-controlled room. The ambient temperature ranges from about 18°C to about 30°C. In specific embodiments, the ambient temperature is about 18°C, about 19°C, about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26 °C, approximately 27°C, approximately 28°C, approximately 29°C or approximately 30°C.

As used herein, the term “kidney disease” means diseases associated with any stage or severity of acute or chronic renal failure that results in the kidney losing its ability to filter the blood and remove excess fluid, electrolytes, and waste products from the blood. Kidney disease can also include endocrine dysfunctions such as anemia (lack of erythropoietin) and mineral imbalance (lack of vitamin D). Kidney disease may initially develop in the kidneys, or may be secondary to various conditions, including (but not limited to) heart failure, hypertension, diabetes, autoimmune disease, or liver disease. Kidney disease may be a condition of chronic kidney failure that develops after acute kidney injury. For example, kidney damage due to ischemia and/or exposure to toxic substances can cause acute renal failure; incomplete recovery from acute kidney injury can lead to the development of chronic renal failure.

The term “treatment” means both therapeutic treatment and prophylactic or preventative measures for kidney disease, anemia, tubular transport disorders or glomerular filtration disorders, the goal being to reverse, prevent or slow down (alleviate) the target disease. Subjects in need of treatment include those who already have kidney disease, anemia, impaired tubular transport, or impaired glomerular filtration, as well as those who are predisposed to developing kidney disease, anemia, impaired tubular transport, or impaired glomerular filtration, or those who have the disease kidney disease, anemia, impaired tubular transport or impaired glomerular filtration should be prevented. As used herein, the term “treatment” includes stabilization and/or improvement of renal function.

As used herein, the term " in vivo contact" means direct in vivo contact between products secreted by an enriched population of cells and a natural organ. For example, products secreted by an enriched population of kidney cells (or a mixture or construct containing kidney cells/kidney cell fractions) may contact the natural kidney in vivo . Direct contact in vivo may be paracrine, endocrine or juxtacrine in nature. The secreted products may be a heterogeneous population of different products described herein.

The terms "construct" or "preparation" refer to one or more populations of cells located on the exterior, or surface, of a scaffold or matrix of one or more synthetic or natural biocompatible materials. One or more populations of cells may be coated, located on, embedded in, attached to, seeded on, or embedded in a biological material made from one or more synthetic or natural biocompatible biological materials, polymers, proteins, or peptides. In specific embodiments, the natural biological material is a cellless human or animal kidney. In specific embodiments, a structure has been created from biological material through 3D bioprinting. One or more populations of cells may be combined with biological material, either a scaffold or matrix, in vitro or in vivo . The one or more biological materials used to create the construct, or formulation, may be selected to control, facilitate, or enable the dispersion and/or integration of cellular components of the construct into endogenous host tissue, or to control, facilitate, or enable survival, engraftment, tolerance, or functional activity of the cellular components of the construct or drug. In specific embodiments, one or more biocompatible materials used to create the scaffold/biological material are selected to control, facilitate, or enable the formation of a multicellular three-dimensional organization from at least one of the populations of cells deposited thereon. In specific embodiments, biological materials direct the assembly of certain three-dimensional cellular aggregates, or organelles, that recapitulate aspects of native kidney tissue, including, but not limited to, organizational polarity. In specific embodiments, biological materials direct the assembly of specific tubular structures that recapitulate aspects of natural renal tissue, including lumens. In specific embodiments, the biological materials stimulate or facilitate the secretion of proteins, nucleic acids, and membrane-bound vesicles from cell populations coated thereon. Typically, one or more biological materials used to create the construct may also be selected to mimic or replicate aspects of a particular three-dimensional organization or ecological niche within a natural kidney or renal parenchyma representing the original biological environment from which these cell populations were derived. It is believed that recreating the original biological niche that served as the source of these cell populations further stimulates or promotes cell survival and activity.

The term "cellular aggregate", or "spheroid", means an aggregate or collection of cells cultured to achieve 3D growth, as opposed to monolayer growth. It should be noted that the term "spheroid" does not mean that the aggregate is a geometric sphere. The aggregate may be highly organized with a well-defined morphology and polarity, or it may be a disorganized mass; it may include one cell type or more than one cell type. The cells may be primary isolates or a stable cell line, or combinations of both. This definition covers organoids and organotypic cultures. In specific embodiments, spheroids (eg, cellular aggregates or organelles) are formed in a rotating flask. In specific embodiments, spheroids (eg, cellular aggregates or organoids) are formed in a 3-dimensional matrix.

The term "Neo-Kidney Augment (NKA)" refers to a bioactive cell drug, which is an injectable preparation consisting of selected kidney cells (SKCs) formulated in a biological material consisting of a gelatin hydrogel. The term "Advance Cell Therapy (ACT)" is also used to refer to treatment with NKA. In specific embodiments, NKA is an injectable formulation containing a population of immunologically compatible kidney cells (eg, immunocompatible OPCs) formulated in a biological material consisting of a gelatin hydrogel. In specific embodiments, NKA is an injectable formulation consisting of genetically modified, immunologically privileged, homologous OPCs incapable of causing immune rejection, formulated in a biological material consisting of a gelatin hydrogel.

The term “subject” shall mean any individual human subject, including a patient eligible for treatment, who is experiencing or has experienced one or more signs, symptoms, or other indicators of kidney disease. Such subjects include, without limitation, subjects who are newly diagnosed, or who have been previously diagnosed and are currently experiencing recurrence or recurrence of disease, or are at risk of developing kidney disease, regardless of the cause. The subject may or may not have previously received treatment for kidney disease.

The term “patient” means any individual animal, more preferably a mammal (including non-human animals such as dogs, cats, horses, rabbits, zoo animals, cows, pigs, sheep and primates) in need of treatment. Most preferably, the patient of the present invention is human.

The term “specimen” or “patient sample” or “biological sample” shall generally mean any biological sample obtained from a subject or patient, body fluid, body tissue, cell line, tissue culture, or other source. The term includes biopsy tissue samples, such as, for example, kidney biopsy samples. The term includes cultured cells, such as, for example, cultured mammalian kidney cells. Methods for obtaining biopsy tissue samples and cultured cells from mammals are well known in the art. If the term "sample" is used alone, it should still mean that the "sample" is a "biological sample" or a "patient sample", that is, the terms are used interchangeably.

The term "test sample" means a sample from a subject treated with the method of the present invention. The test sample may be obtained from a variety of sources within the body of a mammalian subject, including, but not limited to, blood, semen, serum, urine, bone marrow, mucosa, tissue, and so on.

The term "control" or "control sample" means a negative or positive control for which a negative or positive result is expected that can be compared with the result of the sample being tested. Controls suitable for the present invention include, but are not limited to, a sample known to exhibit features consistent with normal renal function, a sample obtained from a subject not known to have kidney disease, and a sample obtained from a subject , who is known to suffer from kidney disease. Additionally, the control may be a sample obtained from the subject prior to treatment with the method of the present invention. An additional suitable control may be a test sample obtained from a subject who is known to suffer from any type or stage of kidney disease, as well as a sample from a subject who is not known to suffer from any type or stage of kidney disease. The control may be a specially selected normal healthy subject. Other controls suitable for use in the present invention are known to those skilled in the art.

The terms “regeneration prognosis,” “recovery prognosis,” or “regeneration prognosis” generally refer to a prognosis or prediction of the likely regenerative process or outcome following administration or implantation of the population, mixture, or construct of cells described herein. In the case of regeneration prognosis, the basis for the prognosis, or prediction, may be one or more of the following: improvement in the functioning of an organ (eg, kidney) after implantation or insertion, development of a functional kidney after implantation or insertion, the appearance of improved kidney function or activity after implantation or insertion , as well as the expression of certain markers by the natural kidney after implantation or insertion.

The term "regenerated organ" means a natural organ after implantation or administration of a population, mixture or construct of cells described herein. The regenerated organ is characterized by various indicators, including, without limitation, development of function or activity in the natural organ, improvement of function or activity in the natural organ, reduction of certain markers and physiological parameters associated with the disease, and/or expression of certain markers in the natural organ. Those skilled in the art will appreciate that other metrics may be appropriate to characterize the regenerated organ.

The term "regenerated kidney" means a natural kidney after implantation or administration of a population, mixture or construct of cells described herein. The regenerated kidney is characterized by various indicators, including, but not limited to, development of function or activity in the natural kidney, improvement in function or activity in the natural kidney, reduction of certain markers and physiological parameters associated with renal failure, and expression of certain markers in the natural kidney. Those skilled in the art understand that other indicators may be suitable to characterize the regenerated kidney.

Cell populations

In specific embodiments, the therapeutic composition, or preparation, of the present invention contains an isolated, heterogeneous population of kidney cells that is enriched for specific bioactive components or cell types, and/or depleted for specific inactive or undesirable components or cell types. In specific embodiments, such compositions and preparations are used in the treatment of kidney disease, for example, to provide stabilization and/or improvement and/or restoration of renal function and/or structure. In specific embodiments, the compositions contain isolated renal cell fractions that are devoid of cellular components relative to cells from a healthy individual, but retain therapeutic properties, such as stabilization and/or improvement and/or restoration of renal function. In specific embodiments, the cell populations described herein can be obtained from healthy individuals, individuals with kidney disease, or subjects described herein.

The present invention relates to therapeutic compositions of populations of selected renal cells that will be introduced into a target organ, or tissue, of a subject. In specific embodiments, the population of bioactive selected kidney cells is typically a population of cells that have potential therapeutic properties when administered to a subject. In specific embodiments, when administered to a subject in need thereof, the bioactive renal cell population may provide stabilization and/or improvement and/or restoration and/or regeneration of renal function in the subject. In specific embodiments, the therapeutic properties may include a restorative or regenerative effect.

In specific embodiments, the kidney cell population is an unfractionated, heterogeneous population of cells or an enriched homogeneous population of kidney-derived cells. In specific embodiments, a heterogeneous population of cells is isolated from a biopsy tissue sample or from tissue from an entire organ. In specific embodiments, the kidney cell population is obtained from an in vitro culture of mammalian cells created from biopsy tissue samples or from whole organ tissue. In specific embodiments, the kidney cell population comprises subfractions or subpopulations of a heterogeneous kidney cell population that are enriched in bioactive components (eg, bioactive kidney cells) and depleted in inactive or unwanted components or cells.

In specific embodiments, the kidney cell population expresses GGT and cytokeratin. In certain embodiments, GGT has an expression level increased by about 10%, about 15%, about 18%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% , about 55% or about 60%. In specific embodiments, the GGT is GGT-1. In specific embodiments, the cells of the kidney cell population express GGT-1, cytokeratin, VEGF, and KIM-1. In specific embodiments, more than 18% of the cells in the kidney cell population express GGT-1. In specific embodiments, more than 80% of the cells in the kidney cell population express cytokeratin. In specific embodiments, the cytokeratin is selected from CK8, CK18, CK19, and combinations thereof. In specific embodiments, the cytokeratin is CK8, CK18, CK19, CK8/CK18, CK8/CK19, CK18/CK19, or CK8/CK18/CK19, with “/” indicating the combination of cytokeratins written next to it. In specific embodiments, cytokeratin has an expression level increased by about 80%, about 85%, about 90%, or about 95%. In specific embodiments, more than 80% of the cells in the kidney cell population express cytokeratin. In specific embodiments, cells in the kidney cell population express AQP2. In certain embodiments, less than 40% of the cells express AQP2. In specific embodiments, at least 3% of the cells in the kidney cell population express AQP2.

In specific embodiments, more than 18% of the cells in the cell population express GGT-1, and more than 80% of the cells in the cell population express cytokeratin. In specific embodiments, the cytokeratin is CK18. In specific embodiments, from 4.5% to 81.2% of the cells in the cell population express GGT-1, from 3.0% to 53.7% of the cells in the cell population express AQP2, and from 81.1% to 99.7 % of cells in the cell population express CK18.

In specific embodiments, the kidney cell population comprises cells that express one or more of any combination of biomarkers selected from AQP1, AQP2, AQP4, calbindin, calponin, CD117, CD133, CD146, CD24, CD31 (PECAM-1), CD54 (ICAM -1), CD73, CK18, CK19, CK7, CK8, CK8, CK18, CK19, combinations of CK8, CK18 and CK19, connexin 43, cubilin, CXCR4 (fusin), DBA, E-cadherin (CD324), EPO (erythropoietin ) GGT1, GLEPP1 (glomerular epithelial protein 1), haptoglobulin, Itgb1 (integrin 01), KIM-1 (kidney injury molecule 1), T1M-1 (T-cell immunoglobulin and mucin-containing molecule), MAP-2 (associated with microtubule protein 2), megalin, N-cadherin, nephrin, NKCC (Na-K-Cl cotransporters), OAT-1 (organic ion transporter 1), osteopontin, pan-cadherin, PCLP1 (podocalyxin-like molecule 1), podocin, SMA (alpha smooth muscle actin), synaptopodin, THP (Tamm-Horsfall protein), vimentin and αGST-1 (alpha glutathione S-transferase).

In specific embodiments, the kidney cell population is enriched in epithelial cells relative to the parent population, such as a population of cells in a kidney tissue biopsy specimen or primary cell culture (e.g., the kidney cell population contains at least about 5%, 10%, 15% , 20% or 25% more epithelial cells than the original population). In specific embodiments, the kidney cell population is enriched in renal tubular cells relative to a reference population, such as a population of cells in a kidney tissue biopsy specimen or a primary cell culture (e.g., the kidney cell population contains at least about 5%, 10%, 15 %, 20%, or 25% more renal tubular cells than the original population). In specific embodiments, the renal tubular cells include proximal renal tubular cells. In specific embodiments, the kidney cell population contains a lower relative proportion of distal tubular cells, collecting duct cells, endocrine cells, vascular cells, or progenitor-like cells compared to the parent population. In certain embodiments, the renal cell population contains a lower relative proportion of distal renal tubular cells compared to the parent population. In certain embodiments, the kidney cell population contains a lower relative proportion of collecting duct cells compared to the parent population. In certain embodiments, the kidney cell population contains a lower relative proportion of endocrine cells compared to the parent population. In certain embodiments, the kidney cell population contains a lower relative proportion of vascular cells compared to the parent population. In certain embodiments, the kidney cell population contains a lower relative proportion of progenitor-like cells compared to the parent population. In specific embodiments, the renal cell population contains a higher relative proportion of renal tubular cells and lower relative proportions of EPO-producing cells, glomerular cells, and vascular cells compared to the non-enriched population (eg, the parent renal cell population). In specific embodiments, the renal cell population contains a higher relative proportion of renal tubular cells and lower relative proportions of EPO-producing cells and vascular cells compared to the non-enriched population. In specific embodiments, the kidney cell population contains a higher relative proportion of renal tubular cells and lower relative proportions of glomerular cells and vascular cells compared to the non-enriched population.

In specific embodiments, the cells of the kidney cell population express hyaluronic acid (HA). In specific embodiments, the size range of HA is from about 5 kDa to about 20,000 kDa. In specific embodiments, HA has a molecular weight of 5 kDa, 60 kDa, 800 kDa, and/or 3000 kDa. In specific embodiments, the cells of the kidney cell population synthesize and/or stimulate the synthesis of high molecular weight HA through the expression of hyaluronic acid synthase 2 (HAS-2), especially after implantation into the kidney. In specific embodiments, the kidney cell population cells express higher molecular weight forms of HA in vitro and/or in vivo due to HAS-2 activity. In certain embodiments, the kidney cell population cells express higher molecular weight forms of HA both in vitro and in vivo due to HAS-2 activity. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 100 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of from about 800 kDa to about 3500 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of from about 800 kDa to about 3000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 800 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 3000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of approximately 800 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of approximately 3000 kDa. In specific embodiments, HAS-2 synthesizes HA with a molecular weight of 2x10 ⁵ to 2x10 ⁶ Da. In certain embodiments, smaller forms of HA are formed through the action of destructive hyaluronidases. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of from about 200 kDa to about 2000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of approximately 200 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of approximately 2000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 200 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 2000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 5000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 10,000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of at least 15,000 kDa. In specific embodiments, higher molecular weight forms of HA are HA having a molecular weight of approximately 20,000 kDa.

In specific embodiments, the population contains cells capable of receptor-mediated albumin transfer.

In specific embodiments, the cells of the kidney cell population are resistant to hypoxia.

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: megalin, cubilin, N-cadherin, E-cadherin, aquaporin 1, and aquaporin 2.

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: megalin, cubilin, hyaluronic acid synthase 2 (HAS2), vitamin D3 25-hydroxylase (CYP2D25), N-cadherin (Ncad ), E-cadherin (Ecad), aquaporin 1 (Aqp1), aquaporin 2 (Aqp2), RAB17, a member of the RAS oncogene family (Rab17), GATA-binding protein 3 (Gata3), FXYD domain-containing ion transport regulator 4 (Fxyd4 ), solute transporter (sodium/hydrogen exchanger) family 9 member 4, (Slc9a4), aldehyde dehydrogenase family 3 member B1 (Aldh3b1), aldehyde dehydrogenase family 1 member A3 (Aldh1a3), and calpain 8 (Capn8).

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: megalin, cubilin, hyaluronic acid synthase 2 (HAS2), vitamin D3 25-hydroxylase (CYP2D25), N-cadherin (Ncad ), E-cadherin (Ecad), aquaporin 1 (Aqp1), aquaporin 2 (Aqp2), RAB17, a member of the RAS oncogene family (Rab17), GATA-binding protein 3 (Gata3), FXYD domain-containing ion transport regulator 4 (Fxyd4 ), solute transporter (sodium/hydrogen exchanger) family 9 member 4, (Slc9a4), aldehyde dehydrogenase family 3 member B1 (Aldh3b1), aldehyde dehydrogenase family 1 member A3 (Aldh1a3), calpain 8 (Capn8), and aquaporin 4 ( Aqp4).

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: aquaporin 7 (Aqp7), FXYD domain-containing ion transport regulator 2 (Fxyd2), solute transporter family 17 (sodium phosphate ), member 3 (Slc17a3), solute transporter family 3, member 1 (Slc3a1), claudin 2 (Cldn2), napsin aspartate peptidase A (Napsa), solute transporter family 2 (facilitating glucose transport), member 2 (Slc2a2 ), alanine aminopeptidase (membrane) (Anpep), transmembrane protein 27 (Tmem27), medium chain fatty acid acyl-CoA synthetase family member 2 (Acsm2), glutathione peroxidase 3 (Gpx3), fructose 1,6-biphosphatase 1 (Fbp1), alanine glyoxylate aminotransferase 2 (Agxt2), platelet-endothelial adhesion molecule (Pecam) and podocin (Podn).

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: PECAM, VEGF, KDR, HIF1a, CD31, CD146, podocin (Podn) and nephrin (Neph), chemokine receptor (motif C-X-C) 4 (Cxcr4), endothelin receptor type B (Ednrb), collagen type V, alpha 2 (Col5a2), cadherin 5 (Cdh5), tissue plasminogen activator (Plat), angiopoietin 2 (Angpt2), receptor protein, insertion domain-containing kinase (Kdr), secreted acidic cysteine-rich protein (osteonectin) (Sparc), serglycin (Srgn), TIMP metallopeptidase inhibitor 3 (Timp3), Wilms tumor protein 1 (Wt1), MMTV Wingless type integration site family, member 4 (Wnt4), regulator of G protein signaling 4 (Rgs4), erythropoietin (EPO).

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: PECAM, vEGF, KDR, HIF1a, podocin, nephrin, EPO, CK7, CK8/18/19.

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: PECAM, vEGF, KDR, HIF1a, CD31, CD146.

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of podocin (Podn) and nephrin (Neph).

In specific embodiments, the kidney cell population comprises one or more cell types that express one or more of any combination of: PECAM, vEGF, KDR, HIF1a, and EPO.

In specific embodiments, the presence (e.g., expression) and/or level/amount of various biomarkers in a sample or population of cells can be analyzed using a number of methods, many of which are known in the art and understandable to one of ordinary skill in the art, including, but not limited to, immunohistochemical methods (“IHC”), Western blotting, immunoprecipitation, molecular binding assays, ELISA, ELIFA, fluorescence-activated cell sorting (“FACS”), MassARRAY, proteomics, biochemical enzyme activity assays, in situ hybridization, Southern blotting, Northern blotting , whole genome sequencing, polymerase chain reaction (“PCR”), including quantitative real-time PCR (“qRT-PCR”) and other amplification-based detection methods such as, for example, branched DNA analysis, SISBA, TMA and the like, RNA-seq, FISH, microarray analysis, gene expression profiling and/or serial analysis of gene expression (“SAGE”), as well as any of a wide range of analyzes that can be performed using protein, gene and/or fabric micropanels. Non-limiting examples of methods for assessing the status of genes and gene products include Northern blotting, Southern blotting, immunoblotting and PCR analysis. In particular embodiments, multiplex immunoassays such as those available from Rules Based Medicine or Meso Scale Discovery may also be used. In particular embodiments, the presence (e.g., expression) and/or level/amount of various biomarkers in a sample or population of cells can be analyzed using a number of methods, many of which are known in the art and understandable to one of ordinary skill in the art, including, but not limited to, platforms -omics" such as genomic transcriptomics, proteomics, secretomics, lipidomics, phosphatomics, exosomics and so on, where high throughput methodologies are combined with computational biology and bioinformatics methods to elucidate the complete biological signature of genes, microRNAs, proteins, secreted proteins, lipids, and so on, that are and are not expressed by the cell population being studied.

In specific embodiments, a method for detecting the presence of two or more biomarkers in a population of kidney cells includes contacting a sample with an antibody directed to the biomarker under conditions allowing binding of the antibody to its corresponding ligand (i.e., the biomarker), and detecting the presence of the bound antibody, e.g. , by determining whether a complex is formed between the antibody and the biomarker. In specific embodiments, the presence of one or more biomarkers is detected by immunohistochemical methods. As used herein, the term “detection” includes quantitative and/or qualitative detection.

In specific embodiments, a population of kidney cells is identified using one or more reagents that detect a biomarker disclosed herein, such as AQP1, AQP2, AQP4, calbindin, calponin, CD117, CD133, CD146, CD24, CD31 (PECAM-1 ), CD54 (ICAM-1), CD73, CK18, CK19, CK7, CK8, CK8/18, CK8/18/19, connexin 43, cubilin, CXCR4 (fusin), DBA, E-cadherin (CD324), EPO ( erythropoietin), GGT1, GLEPP1 (glomerular epithelial protein 1), haptoglobulin, Itgbl (integrin p), KIM-1 (kidney injury molecule 1), T1M-1 (T-cell immunoglobulin and mucin-containing molecule), MAP-2 ( microtubule associated protein 2), megalin, N-cadherin, nephrin, NKCC (Na-K-Cl cotransporters), OAT-1 (organic ion transporter 1), osteopontin, pan-cadherin, PCLP1 (podocalyxin-like molecule 1), podocin, SMA (alpha smooth muscle actin), synaptopodin, THP (Tamm-Horsfall protein), vimentin and αGST-1 (alpha glutathione 5-transferase). In specific embodiments, the biomarker is detected using a monoclonal or polyclonal antibody.

In certain embodiments, the source of cells is the same as the intended target organ or tissue. In specific embodiments, BOD or OPC may be obtained from the kidney and used in a formulation to be administered to the kidney. In specific embodiments, the cell population is obtained from a kidney biopsy sample. In specific embodiments, the cell population is derived from whole kidney tissue. In specific embodiments, the cell population is derived from in vitro cultures of mammalian kidney cells obtained from kidney biopsies or whole kidney tissue.

In specific embodiments, BOD or OPC comprise heterogeneous mixtures or fractions of bioactive kidney cells. In specific embodiments, BOD or OPC may be derived from, or are themselves, kidney cell fractions from healthy individuals. In particular embodiments, the invention relates to a population, or fraction, of kidney cells obtained from an unhealthy individual that may be deficient in certain cell types compared to a population of kidney cells from a healthy individual (eg, in his kidney or biopsy sample). In specific embodiments, the present invention provides a therapeutically active cell population that is depleted of certain cell types compared to a population from a healthy individual. In specific embodiments, a population of cells is isolated and expanded from a population of autologous cells.

In specific embodiments, OPC is obtained from renal cortical tissue from a patient through a kidney biopsy. In specific embodiments, kidney cells are isolated from kidney tissue by enzymatic digestion, expanded using standard cell culture techniques, and collected from the expanded kidney cells by centrifugation across a boundary, barrier, or interface between phases of different densities. In specific embodiments, kidney cells are isolated from kidney tissue by enzymatic digestion, expanded using standard cell culture techniques, and collected from the expanded kidney cells by continuous or intermittent, single or multi-step density gradient centrifugation. In certain embodiments, OPCs are composed primarily of renal epithelial cells, which are known for their regenerative potential. In certain embodiments, other parenchymal (vascular) and stromal cells may be present in the autologous OPC population.

As described above, BODs are a selected population of regenerative kidney cells naturally involved in kidney repair and regeneration. In specific embodiments, BOD is obtained from kidney cells isolated from kidney tissue by enzymatic digestion and propagated using standard cell culture techniques. The cell culture medium can be selected to promote the proliferation of bioactive kidney cells with regenerative capacity. In specific embodiments, the BPCs are derived from kidney cells isolated from kidney tissue by enzymatic digestion, genetically modified (e.g., genomically modified and/or modified by RNAi) to become immunologically privileged or unable to cause rejection, and expanded using standard culture techniques cells. The cell culture medium can be selected to promote immunologically privileged, bioactive kidney cells with regenerative capacity. In specific embodiments, the cell culture medium does not contain any differentiation factors. In specific embodiments, expanded heterogeneous mixtures of kidney cells are cultured under hypoxic conditions to further enrich the composition with cells with regenerative capacity. Without wishing to be bound by theory, this may be due to one or more of the following phenomena: 1) selective survival, death or proliferation of certain cellular components during culture under hypoxic conditions; 2) changes in cell granularity and/or size in response to culture under hypoxic conditions, leading to changes in buoyant density and subsequent localization when partitioning along a density gradient; and 3) changes in gene/protein expression in cells in response to culture under hypoxic conditions, which leads to differential characteristics of cells in the isolated and expanded populations.

In specific embodiments, a population of bioactive kidney cells is obtained by isolating and expanding kidney cells from kidney tissue (such as biopsy tissue) under culture conditions that result in enrichment for cells capable of kidney regeneration.

In specific embodiments, kidney cells from kidney tissue (such as tissue obtained from a biopsy) are passaged 1, 2, 3, 4, 5 or more times to obtain expanded bioactive kidney cells (for example, a population of cells enriched for cells capable of regeneration kidneys). In specific embodiments, kidney cells from kidney tissue (such as biopsy tissue) are subcultured once to obtain expanded bioactive kidney cells. In specific embodiments, kidney cells from kidney tissue (such as biopsy tissue) are subcultured 2 times to obtain expanded bioactive kidney cells. In specific embodiments, kidney cells from kidney tissue (such as biopsy tissue) are subcultured 3 times to obtain expanded bioactive kidney cells. In specific embodiments, kidney cells from kidney tissue (such as biopsy tissue) are subcultured 4 times to obtain expanded bioactive kidney cells. In specific embodiments, kidney cells from kidney tissue (such as biopsy tissue) are subcultured 5 times to obtain expanded bioactive kidney cells. In certain embodiments, cell subculture depletes the population of non-bioactive kidney cells. In certain embodiments, cell subculture depletes a population of cells of at least one cell type. In certain embodiments, subculture of cells depletes a population of cells having a density greater than 1.095 g/ml. In certain embodiments, cell reseeding results in depletion of a population of small, low granularity cells. In certain embodiments, cell subculture depletes a population of cells that are smaller in size than red blood cells. In certain embodiments, cell reseeding results in depletion of a population of cells with a diameter less than 6 μm. In certain embodiments, cell reseeding results in depletion of a population of cells with a diameter less than 2 μm. In certain embodiments, cell subculture depletes a population of cells with less granularity than red blood cells. In certain embodiments, the viability of the cell population increases after 1 or more subcultures. In particular embodiments, descriptions of small cells and low granularity are used when analyzing cells by fluorescence-activated cell sorting (FACS), for example, using the X-Y axes of a data scatter plot in which cells are shown.

In specific embodiments, the expanded bioactive kidney cells are grown under hypoxic conditions for at least about 6, 9, 10, 12, or 24 hours, but less than 48 hours, or for 6-9 hours, or 6-48 hours, or from about 12 to about 15 hours, or about 8 hours, or about 12 hours, or about 24 hours, or about 36 hours, or about 48 hours. In certain embodiments, cells grown under hypoxic conditions are selected based on density. In specific embodiments, the bioactive kidney cell population is a population of selected kidney cells (SRCs) obtained after separation of expanded kidney cells along a continuous or discontinuous (single or multi-step) density gradient (e.g., after subculture and/or culture under hypoxic conditions). In specific embodiments, the bioactive kidney cell population is a population of selected kidney cells (SRCs) obtained after separation of expanded kidney cells by centrifugation across a boundary, barrier, or interface between phases of different densities (e.g., after subculture and/or culture under hypoxic conditions) . In specific embodiments, hypoxic culture conditions are culture conditions in which cells are exposed to reduced levels of available oxygen in the culture system, compared to standard culture conditions in which cells are cultured at atmospheric oxygen levels (approximately 21%). In specific embodiments, cells cultured under hypoxic culture conditions are cultured at an oxygen level of from about 5% to about 15%, or from about 5% to about 10%, or from about 2% to about 5%, or from about 2% to about 7%, or about 2%, or about 3%, or about 4%, or about 5%. In certain embodiments, the OPCs have a buoyant density greater than about 1.0419 g/ml. In certain embodiments, the OPCs have a buoyant density greater than about 1.04 g/ml. In certain embodiments, the OPCs have a buoyant density greater than about 1.045 g/ml. In specific embodiments, the BPC or OPC contains a higher percentage of one or more cell populations and is devoid of, or contains a smaller percentage of, one or more other cell populations compared to the original kidney cell population.

In specific embodiments, the expanded bioactive kidney cells may be subjected to density gradient separation to produce OPCs. In certain embodiments, the OPC is then genetically modified. In specific embodiments, genetically modified (eg, genetically modified and/or RNAi modified) BPCs are subjected to density gradient separation to produce genetically modified BPCs. In specific embodiments, genetically modified (eg, genetically modified and/or RNAi modified) BPCs are subjected to both hypoxic culture conditions and density gradient separation to produce genetically modified BPCs. In particular embodiments, continuous or intermittent, single or multi-stage density gradient centrifugation is used to separate the collected kidney cell populations based on buoyant cell density. In specific embodiments, the expanded bioactive kidney cells can be separated by centrifugation across a boundary, barrier, or interface between phases of different densities to obtain OPC. In specific embodiments, centrifugation across a boundary, barrier, or interface between phases of different densities is used to separate collected populations of kidney cells based on buoyant cell density. In specific embodiments, OPC is prepared using, in part, OPTIPREP medium (Axis-Shield) containing a 60% (w/v) solution of the nonionic iodinated compound iodixanol in water. However, one skilled in the art will appreciate that other media, density gradients (continuous or discontinuous), boundaries, barriers, interfaces between phases of different densities, or other methods, such as immunoseparation using cell surface markers, are known in the art to have the necessary properties to isolate the cell populations described herein can be used to produce bioactive kidney cells. In specific embodiments, the fraction of cells having a buoyant density greater than about 1.04 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.04 g/ml are excluded and discarded. In certain embodiments, the fraction of cells having a buoyant density greater than about 1.0419 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.0419 g/ml are excluded and discarded. In certain embodiments, the fraction of cells having a buoyant density greater than about 1.045 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.045 g/ml are excluded and discarded.

In specific embodiments, the buoyant cell density is used to obtain a population of OPCs and/or determine whether a population of kidney cells is a population of bioactive kidney cells. In specific embodiments, buoyant cell density is used to isolate bioactive kidney cells. In specific embodiments, buoyant cell density is determined by centrifugation through an OptiPrep single-step density interface (7% iodixanol; 60% (w/v) in OptiMEM) (single-step discontinuous density gradient). Optiprep is a 60% (w/v) solution of iodixanol in water. In the illustrative use of a density interface or single-step discontinuous density gradient, Optiprep is diluted with OptiMEM (minimal cell culture medium) to obtain a final solution of 7% iodixanol (in water and OptiMEM). OptiMEM is a modification of Eagle's minimal maintenance medium buffered with HEPES and sodium bicarbonate, and supplemented with hypoxanthine, thymidine, sodium pyruvate, L-glutamine or GLUTAMAX, trace elements and growth factors. Protein levels are minimal (15 mcg/ml), with the only protein supplements being insulin and transferrin. Phenol red is included at reduced concentrations as a pH indicator. In certain embodiments, 2-mercaptoethanol may be added to OptiMEM prior to use.

In specific embodiments, an OptiPrep solution is prepared and the refractive index is measured as an indicator of the desired density (IR 1.3456 ± 0.0004) prior to use. In specific embodiments, the kidney cells are layered on top of the solution. In specific embodiments, the phase interface or single-step discontinuous density gradient is centrifuged at 800 g for 20 min at room temperature (without braking) in either a centrifuge tube (e.g., a 50 mL conical tube) or a cell processing device (e.g. COBE 2991). In specific embodiments, the fraction of cells having a buoyant density greater than about 1.04 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.04 g/ml are excluded and discarded. In certain embodiments, the fraction of cells having a buoyant density greater than about 1.0419 g/ml is collected after centrifugation as a clear cell pellet. In certain embodiments, cells having a buoyant density of less than 1.0419 g/ml are excluded and discarded. In specific embodiments, the fraction of cells having a buoyant density greater than about 1.045 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.045 g/ml are excluded and discarded. In specific embodiments, before assessing cell density, or selecting based on density, cells are cultured to at least 50% confluence and incubated overnight (e.g., at least about 8 or 12 hours) under hypoxic conditions in an incubator set at level of 2% oxygen in an atmosphere with 5% CO ₂ at 37°C.

In specific embodiments, cells obtained from a kidney sample are expanded and then processed (eg, using hypoxia and centrifugal separation) to obtain a population of OPCs. In specific embodiments, the OPC population is prepared using the reagents and methods described herein. In specific embodiments, a sample of cells from the OPC population is tested for viability before the cells from the population are administered to a subject. In specific embodiments, a sample of cells from the OPC population is tested for expression of one or more of the markers disclosed herein before the cells of the population are administered to a subject.

For non-limiting examples of compositions and methods for preparing OPC, see US Patent Application Publication No. 2017/0281684 A1, the entire contents of which are incorporated herein by reference.

In specific embodiments, BOD or OPC is obtained from a natural sample of an autologous or allogeneic kidney. In specific embodiments, BOD or OPC is obtained from a non-autologous kidney sample. In specific embodiments, the sample may be obtained by kidney biopsy.

In specific embodiments, isolation and expansion of kidney cells results in a mixture of different types of kidney cells, including renal epithelial cells and stromal cells. In specific embodiments, OPCs are obtained by continuous or discontinuous density gradient separation of expanded kidney cells. In specific embodiments, the primary cell type in the density gradient separated OPC population has a renal tubular epithelial cell phenotype. In specific embodiments, OPCs are obtained by separating expanded kidney cells by centrifugation across a boundary, barrier, or interface between phases of different densities. In specific embodiments, the primary cell type in the phase-divided OPC population has a renal tubular epithelial cell phenotype. In specific embodiments, the characteristics of OPCs derived from renal cell expansion are assessed using a multi-step approach. In specific embodiments, cellular morphology, growth kinetics, and cell viability are monitored during renal cell proliferation. In specific embodiments, the buoyant density and viability of the OPC are characterized by the medium or no medium density gradient centrifugation method and the trypan blue exclusion method. In specific embodiments, the OPC phenotype is characterized by flow cytometry, and the function of the OPC is determined based on the expression of VEGF and KIM-1. In certain embodiments, the cellular function of OPC prior to formulation can also be assessed by measuring the activity of two specific enzymes; GGT (γ-glutamyl transpeptidase) and LAP (leucine aminopeptidase) present in the proximal tubules of the kidney.

In specific embodiments, cellular features that promote separation of subpopulations of cells in a dense environment (size and granularity) can be used to separate subpopulations of cells by flow cytometry (forward light scatter reflects cell size by flow cytometry, and side light scatter reflects granularity). In specific embodiments, the density gradient medium, or separation medium, should have low toxicity to the specific cells of interest. In specific embodiments, while the solid medium should have low toxicity to the specific cells of interest, the present invention provides for the use of media that play a role in the selection process for the cells of interest. In specific embodiments, and without being bound by theory, it is apparent that the cell populations disclosed herein that are recovered using media containing iodixanol are resistant to iodixanol because significant cell loss occurs between the application and recovery steps, this suggests that exposure to iodixanol at a density gradient, or boundary, barrier, or interface between phases of different densities, results in the elimination of some cells. In specific embodiments, the cells found after separation through a density gradient or phase interface of different iodixanol densities are resistant to any adverse effects of exposure to iodixanol and/or the density gradient or phase interface. In specific embodiments, a contrast medium having a mild to moderate nephrotoxin content is used to isolate and/or select a population of cells, for example, a population of OPCs. In specific embodiments, the OPCs are resistant to iodixanol. In specific embodiments, the solid medium should not bind proteins in human plasma or adversely affect key functions of the cells of interest.

In specific embodiments, a population of cells was enriched and/or depleted for one or more kidney cell types by fluorescence-activated cell sorting (FACS). In specific embodiments, kidney cell types can be enriched and/or depleted using BD FACSAria™ or equivalent. In specific embodiments, kidney cell types can be enriched and/or depleted using FACSAria III™ or equivalent.

In specific embodiments, a population of cells was enriched and/or depleted for one or more kidney cell types using magnetic cell sorting. In specific embodiments, one or more kidney cell types may be enriched and/or depleted using the Miltenyi ^autoMACS® system or equivalent.

In specific embodiments, the kidney cell population has been subjected to three-dimensional culture. In specific embodiments, methods for culturing cell populations involve continuous perfusion. In certain embodiments, cell populations cultured using three-dimensional culture and continuous perfusion exhibit greater cell richness and cell-cell interaction compared to cell populations cultured in a static manner. In specific embodiments, cell populations cultured using three-dimensional culture and continuous perfusion exhibit greater expression of EPO, as well as increased expression of renal tubule-related genes, such as E-cadherin, compared to static cultures of such cell populations. In specific embodiments, a population of cells cultured using continuous perfusion exhibits higher levels of glucose and glutamine consumption compared to a population of cells cultured statically.

In certain embodiments, low or oxygen-deficient conditions can be used in the methods for producing a population of cells of the present invention. In specific embodiments, the method of obtaining a population of cells can be used without the low oxygen culture step. In certain embodiments, normal oxygen conditions may be used.

In specific embodiments, a population of kidney cells has been isolated and/or cultured from kidney tissue. Provided herein are non-limiting examples of methods for separating and isolating renal cellular components, for example, enriched populations of cells to be used in formulations for therapeutic applications, including the treatment of kidney disease, anemia, EPO deficiency, tubular transport disorders and glomerular filtration disorders. In specific embodiments, the population of cells is isolated from freshly digested, that is, mechanically or enzymatically digested, kidney tissue, or from a heterogeneous in vitro culture of mammalian kidney cells.

In specific embodiments, the kidney cell population includes EPO-producing kidney cells. In specific embodiments, the subject has anemia and/or EPO deficiency. In specific embodiments, populations of EPO-producing kidney cells are characterized by EPO expression and biological sensitivity to oxygen such that a decrease in oxygen pressure in the culture system results in the induction of EPO expression. In specific embodiments, populations of EPO-producing cells are enriched in EPO-producing cells. In specific embodiments, EPO expression is induced when a population of cells is cultured under conditions in which the cells are in the culture system at reduced levels of available oxygen, compared to a population of cells cultured at normal atmospheric (about 21%) levels of available oxygen. In certain embodiments, EPO-producing cells cultured under reduced-oxygen conditions express EPO at higher levels compared to EPO-producing cells cultured under normal-oxygen conditions. In general, culturing cells under reduced levels of available oxygen (also called hypoxic culture conditions) means that the oxygen level is reduced compared to culturing cells under normal atmospheric levels of available oxygen (also called normal conditions or normoxic conditions). In specific embodiments, culturing cells under hypoxic conditions includes culturing cells at less than about 1% oxygen, less than about 2% oxygen, less than about 3% oxygen, less than about 4% oxygen, or less than about 5% oxygen. In specific embodiments, culturing cells under normal, or normoxic, conditions includes culturing cells at about 10% oxygen, about 12% oxygen, about 13% oxygen, about 14% oxygen, about 15% oxygen, about 16% oxygen, about 17 % oxygen, about 18% oxygen, about 19% oxygen, about 20% oxygen, or about 21% oxygen.

In specific embodiments, the implementation seeks to induce, or increase, the expression of EPO; it can be observed when cells are cultured with less than about 5% available oxygen and compared with EPO expression levels in cells cultured at atmospheric (about 21%) oxygen levels. In specific embodiments, EPO induction is achieved in a culture of cells capable of expressing EPO by a method comprising a first culture phase in which the cells are cultured at atmospheric oxygen levels (about 21%) for a period of time, and a second culture phase in which levels of available oxygen is reduced and the same cells are cultured with less than about 5% available oxygen. In specific embodiments, expression of EPO, which is sensitive to hypoxic conditions, is regulated by HIF1α. In specific embodiments, other oxygen-manipulating culture conditions known in the art may be used for the cells described herein.

In specific embodiments, the formulation contains enriched populations of EPO-producing mammalian cells characterized by biological sensitivity (such as, for example, EPO expression) to perfusion conditions. In specific embodiments, perfusion conditions include temporary, intermittent, or continuous fluid flow (perfusion). In specific embodiments, EPO expression is induced mechanically when the medium in which the cells are cultured is periodically or continuously circulated or agitated such that dynamic forces are transferred to the cells through flow. In specific embodiments, cells exposed to transient, intermittent or continuous fluid flow are cultured such that they are present as three-dimensional structures in, or on, a material that provides a scaffold and/or space for the formation of such three-dimensional structures. In specific embodiments, cells are cultured on porous beads and exposed to intermittent or continuous fluid flow through the use of a rocking platform, rotating platform, or rotating flask. In specific embodiments, cells are cultured on a three-dimensional scaffold and placed in a device that allows the scaffold to remain stationary and fluid to flow toward or through the scaffold. Those skilled in the art will appreciate that other perfusion culture conditions known in the art may be used for the cells described herein.

In specific embodiments, the population of cells is obtained from a kidney biopsy sample. In specific embodiments, the cell population is obtained from whole kidney tissue. In specific embodiments, the population of cells is obtained from in vitro cultures of mammalian kidney cells obtained from kidney biopsies or whole kidney tissue. In specific embodiments, the kidney cell population is a population of OPCs. In specific embodiments, the cell population is an unfractionated cell population, also referred to herein as an unenriched cell population.

Compositions containing various active agents (eg, other than renal cells) are within the scope of the present invention. Non-limiting examples of suitable active agents include, but are not limited to, cellular aggregates, acellular biological materials, bioactive cell secreted products, high molecule and small molecule therapeutic agents, and combinations thereof. For example, bioactive cells of one type can be combined with bio-based microcarriers with or without therapeutic molecules, or bioactive cells of another type. In certain embodiments, non-attached cells may be combined with cell-free particles.

In specific embodiments, the cells of the kidney cell population are contained within the spheroids. In specific embodiments, the kidney cell population is in the form of spheroids. In specific embodiments, spheroids containing bioactive kidney cells are administered to a subject. In specific embodiments, the spheroids contain at least one type, or population, of non-renal cells. In specific embodiments, spheroids are prepared by a method comprising (i) combining a population of bioactive kidney cells and a population of non-renal cells, and (ii) culturing the population of bioactive kidney cells and a population of non-renal cells in a 3-dimensional culture system including a spinner flask until formation spheroids.

In specific embodiments, the non-renal cell population comprises a population of endothelial cells or a population of endothelial progenitor cells. In specific embodiments, the population of bioactive cells is a population of endothelial cells. In specific embodiments, the endothelial cell population is a cell line. In specific embodiments, the endothelial cell population comprises human umbilical cord blood endothelial cells (HUVEC). In specific embodiments, the non-renal cell population is a mesenchymal stem cell population. In specific embodiments, the non-renal cell population is a population of stem cells from a hematopoietic organ, mammary gland, intestine, placenta, lung, bone marrow, blood, umbilical cord, endothelium, dental pulp, adipose tissue, neural tissue, olfactory epithelium, neural crest, or testicles. In specific embodiments, the non-renal cell population is a population of adipose tissue progenitor cells. In specific embodiments, the cell populations are xenogeneic, syngeneic, allogeneic, autologous, or a combination thereof. In specific embodiments, the population of bioactive kidney cells and the population of non-renal cells are cultured in a ratio of 0.1:9.9 to 9.9:0.1. In specific embodiments, the population of bioactive kidney cells and the population of non-renal cells are cultured in a ratio of approximately 1:1. In specific embodiments, the kidney cell population and the bioactive cell population are suspended in a growth medium.

The expanded bioactive kidney cells can then be subjected to continuous or discontinuous density gradient separation to obtain OPCs. In particular, continuous or intermittent, single- or multi-stage density gradient centrifugation is used to separate collected kidney cell populations based on buoyant cell density. In specific embodiments, the expanded bioactive kidney cells may be further subjected to centrifugation separation across a boundary, barrier, or interface between phases of different densities to obtain OPC. In particular, centrifugation across a boundary, barrier, or interface between phases of different densities is used to separate collected kidney cell populations based on buoyant cell density. In specific embodiments, OPC is prepared using, in part, OPTIPREP medium (Axis-Shield) containing a 60% (w/v) solution of the nonionic iodinated compound iodixanol in water. However, one skilled in the art will understand that any density gradient media, without limitation to specific media, or other methods, such as immunoseparation using cell surface markers, known in the art, having the necessary properties for isolating cell populations of the present invention, can be used in accordance with the present invention. For example, Percoll or sucrose can be used to create a density gradient or phase boundary of different densities. In specific embodiments, the fraction of cells having a buoyant density greater than about 1.04 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.04 g/ml are excluded and discarded. In certain embodiments, the fraction of cells having a buoyant density greater than about 1.0419 g/ml is collected after centrifugation as a clear cell pellet. In certain embodiments, cells having a buoyant density of less than 1.0419 g/ml are excluded and discarded. In specific embodiments, the fraction of cells having a buoyant density greater than about 1.045 g/ml is collected after centrifugation as a clear cell pellet. In specific embodiments, cells having a buoyant density of less than 1.045 g/ml are excluded and discarded.

Therapeutic compositions and preparations of the present invention may contain isolated heterogeneous populations of renal cells, and/or mixtures thereof, enriched for specific bioactive components or cell types, and/or depleted for specific inactive or undesirable components or cell types, wherein such populations have been genetically modified by removing genetic components encoding cell surface antigens responsible for immune rejection in the recipient for use in the treatment of kidney disease, that is, to provide stabilization and/or improvement and/or restoration of renal function and/or structure. Non-limiting examples of cells to provide such stabilization and/or enhancement are previously described in Presnell et al . US 8318484 and Ilagan et al . PCT/US2011/036347 and Jain et al. PCT/US2016/044866, the entire contents of which are incorporated herein by reference. The compositions may contain isolated fractions of renal cells that are devoid of cellular components compared to the cells of a healthy individual, but retain therapeutic properties, that is, provide stabilization and/or improvement and/or restoration of renal function. The cell populations, cell fractions and/or mixtures of cells described herein can be obtained from healthy individuals, individuals with kidney disease or the subjects described herein.

The present invention provides therapeutic compositions of populations of genetically modified (eg, genomically modified and/or modified by RNAi) immunologically privileged selected kidney cells that will be introduced into target organs or tissues of a subject in need thereof. “A population of bioactive selected renal cells” generally means a population of cells that have potential therapeutic properties when administered to a subject. For example, when administered to a subject in need thereof, the bioactive renal cell population may provide stabilization and/or improvement and/or restoration and/or regeneration of renal function in the subject. Therapeutic properties may include restorative or regenerative effects.

In certain embodiments, the source of cells is the same as the intended target organ or tissue. For example, BOD and/or OPC may be obtained from the kidney and used in a formulation to be administered to the kidney. In specific embodiments, the cell population is obtained from a kidney biopsy sample. In specific embodiments, the cell population is derived from whole kidney tissue. In specific embodiments, the cell population is derived from in vitro cultures of mammalian kidney cells obtained from kidney biopsies or whole kidney tissue. In specific embodiments, BOD and/or OPC comprise heterogeneous mixtures or fractions of bioactive kidney cells. BOD or OPC can be obtained from, or are themselves, fractions of kidney cells from healthy individuals. In addition, the present invention relates to kidney cell fractions obtained from an unhealthy individual that may be depleted of certain cell types compared to the corresponding kidney cell fractions from a healthy individual, but still retain therapeutic properties. The present invention also relates to populations of therapeutically active cells lacking certain cellular components compared to cells from a healthy individual, which cell populations in particular embodiments can be isolated and expanded from autologous sources in various disease states.

In specific embodiments, OPCs are obtained by isolating and expanding kidney cells from biopsied renal cortical tissue from a patient. Kidney cells are isolated from kidney tissue by enzymatic digestion, expanded using standard cell culture techniques, and selected by centrifuging expanded kidney cells across a boundary, barrier, or interface between phases of different densities. In this embodiment, the RPCs consist primarily of renal tubular epithelial cells, which are known for their regenerative potential (Bonventre JV. Dedifferentiation and proliferation of surviving epithelial cells in acute renal failure. J Am Soc Nephrol. 2003;14(Suppl. 1):S55 –61; Humphreys BD, Czerniak S, DiRocco DP, et al. Repair of injured proximal tubule does not involve specialized progenitors. PNAS. 2011;108:9226–31; Humphreys BD, Valerius MT, Kobayashi A, et al. Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell. 2008;2:284–91). Both other parenchymal (vascular) and stromal cells may be present in the autologous OPC population. In specific embodiments, kidney cells are collected by centrifugation through a continuous or discontinuous, single or multi-stage density gradient.

The present invention provides therapeutic compositions of populations of genetically modified (eg, genomically modified and/or modified by RNAi) immunologically privileged selected kidney cells that will be introduced into target organs or tissues of a subject in need thereof. “A population of bioactive selected renal cells” generally means a population of cells that have potential therapeutic properties when administered to a subject. For example, when administered to a subject in need thereof, the bioactive renal cell population may provide stabilization and/or improvement and/or restoration and/or regeneration of renal function in the subject. Therapeutic properties may include restorative or regenerative effects.

In certain embodiments, the source of cells is the same as the intended target organ or tissue. For example, BOD and/or OPC may be obtained from the kidney and used in a formulation to be administered to the kidney. In specific embodiments, the cell population is obtained from a kidney biopsy sample. In specific embodiments, the cell population is derived from whole kidney tissue. In specific embodiments, the cell population is derived from in vitro cultures of mammalian kidney cells obtained from kidney biopsies or whole kidney tissue. In specific embodiments, BOD and/or OPC comprise heterogeneous mixtures or fractions of genetically modified (eg, genomically modified and/or modified by RNAi) immunologically privileged bioactive kidney cells. BOD or OPC can be obtained from, or are themselves, fractions of kidney cells from healthy individuals. In addition, the present invention relates to kidney cell fractions obtained from an unhealthy individual that may be depleted of certain cell types compared to the corresponding kidney cell fractions from a healthy individual, but still retain therapeutic properties. The present invention also provides populations of therapeutically active cells lacking certain cellular components compared to cells from a healthy individual, which cell populations in particular embodiments can be isolated and expanded from kidneys obtained from various mammals.

In specific embodiments, OPCs are obtained by isolating and expanding renal cells from another patient's renal cortical tissue obtained by renal biopsy. In specific embodiments, kidney cells are isolated from kidney tissue by enzymatic digestion, genetically modified (e.g., genomically modified and/or modified by RNAi) to become immunologically privileged or unable to cause rejection, expanded using standard cell culture techniques, and selected by centrifugation. in a density gradient from expanded kidney cells. In certain embodiments, OPCs are composed primarily of renal epithelial cells, which are known for their immunological privilege and regenerative potential. Both other parenchymal (vascular) and stromal cells may be present in small quantities in the OPC population.

As described herein, the present invention is based, in part, on the surprising fact that certain subfractions of the heterogeneous population of kidney cells, enriched in bioactive components and depleted in inactive or undesirable components, provide better therapeutic and regenerative results than the parent population.

By isolating and expanding kidney cells, a mixture of kidney cell types is obtained, including renal epithelial cells and stromal cells. As noted above, OPCs are obtained by density gradient separation of expanded kidney cells. The main cell type in the density-gradient OPC population has the phenotype of renal tubular epithelial cells. The characteristics of OPCs derived from renal cell expansion are assessed using a multistep approach. Cellular morphology, growth kinetics, and cell viability are monitored during renal cell proliferation. The buoyant density and viability of OPCs are characterized by the density gradient centrifugation method and the trypan blue exclusion method. OPC phenotype is characterized by flow cytometry, and OPC function is determined based on the expression of VEGF and KIM-1.

Those skilled in the art will understand that other isolation and culture methods known in the art may be used for the cells described herein. Those skilled in the art also understand that bioactive cell populations may be obtained from sources other than those specifically listed above, including, without limitation, tissues and organs other than the kidney, body fluids, and adipose tissue.

OPC phenotype

In specific embodiments, the cell phenotype is monitored by analyzing the expression of renal cell markers by flow cytometry. Phenotypic cell analysis is based on the use of antigenic markers specific to the cell type being analyzed. Flow cytometric analysis quantifies the cells in a population sample that express the antigenic marker being analyzed.

Various markers useful for analyzing the phenotypic characteristics of renal tubular epithelial cells have been described in the literature: (i) cytokeratins; (ii) transport membrane proteins (aquaporins and cubilin); (iii) cell binding molecules (adherins and cluster of differentiation, and lectins); and (iv) metabolic enzymes (glutathione and gamma-glutamyl transpeptidase (GGT)). (Table 1). Because the majority of cells found in cultures prepared from whole kidney hydrolysates are epithelial and endothelial cells, marker analysis focuses primarily on the expression of proteins characteristic of these two groups.

Table 1. Phenotypic markers for OPC analysis

Antigenic marker Reactivity CK8/18/19 Epithelial cells, proximal and distal tubules CK8 Epithelial cells, proximal tubules CK18 Epithelial cells, proximal tubules CK19 Epithelial cells, collecting ducts, distal tubules CK7 Epithelial cells, collecting ducts, distal tubules CXCR4 Epithelial cells, distal and proximal tubules E-cadherin Epithelial cells, distal tubules Kubilin Epithelial cells, proximal tubules Aquaporin 1 Epithelial cells, proximal tubules, descending small portion GGT1 Embryonic and adult kidney cells, proximal tubules Aquaporin 2 Collecting duct cells of the kidney, distal tubules DBA Collecting duct cells of the kidney, distal tubules CD31 Kidney endothelial cells (rat) CD146 Kidney endothelial cells (dog, human) MHC//minor antigen HC Reduced to give cells immunological privilege

Table 2 shows the selected markers, the range and mean values, in percentages, for phenotypic markers in the OPC population, and the rationale for their selection.

Table 2. Markers selected for phenotypic analysis of OPC

Phenotypic marker Expression Range Average Rationale Expression level CK18 81.1-99.7% (n=87) 96.7% Epithelial cell marker High GGT1 4.5-81.2%
(n=63) 50.7% Functional marker of tubular cells Moderate MHC//minor antigen HC Reduced to give cells immunological privilege >90% Immunological privilege Short

Cellular function

OPCs actively secrete proteins that can be detected by analyzing the conditioned medium. Cellular function is assessed based on the cells' ability to metabolize PrestoBlue and secrete VEGF (vascular endothelial growth factor) and KIM-1 (kidney injury molecule 1).

Table 3 shows the amounts of VEGF and KIM-1 in conditioned media from kidney cells and OPC cultures. Kidney cells were cultured to a state close to confluence. Conditioned medium in which the kidney cells were exposed overnight was tested for VEGF and KIM-1.

Table 3. Production of VEGF and KIM-1 by human kidney cells and OPCs

Conditioned environment VEGF KIM-1 ng/ml ng/million cells ng/ml ng/million cells Kidney cell culture
(n=15) 0.50-2.42 2.98-14.6 0.20-3.41 1.14-15.2 defense industry
(n=14) 0.80-3.85 4.83-23.07 0.32-2.10 1.93-12.59

Enzymatic activity of OPC

Cellular function of OPC, prior to formulation, can also be assessed by measuring the activity of two specific enzymes; GGT (γ-glutamyl transpeptidase) and LAP (leucine aminopeptidase) present in the proximal tubules of the kidney.

Although selected renal cell compositions are described herein, the present invention provides compositions containing various other active agents. Other suitable active agents include, but are not limited to, cellular aggregates, cell-free biological materials, bioactive cell secreted products, high molecule and small molecule therapeutics, and combinations thereof. For example, bioactive cells of one type can be combined with bio-based microcarriers with or without therapeutic molecules, or bioactive cells of another type, unattached cells can be combined with cell-free particles.

Illustrative Genetic Modification Techniques

In specific embodiments, genetic modification of a cell such as a BPC (eg, OPC) involves introducing (eg, through expression or delivery across a cell membrane) a gene editing protein and/or nucleic acid into the BPC.

In specific embodiments, the gene editing protein is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), megaTAL, or a Cas protein. In specific embodiments, the protein is a single-stranded nuclease structure (“megaTAL”). In specific embodiments, a gene editing protein, such as ZFN, megaTAL, or a Cas protein (eg, Cas9), can be delivered as a protein or, alternatively, a polynucleotide (such as mRNA or vector) encoding the protein is delivered to cells.

In specific embodiments, the Cas9 protein is delivered as a protein. In specific embodiments, a polynucleotide (such as mRNA or vector) encoding a Cas9 protein is delivered to cells. In certain embodiments, a gene-editing polynucleotide, such as a gRNA, is delivered into the cell. In the context of the CRISPR/Cas9 system, a single guide RNA (“gRNA” or “guide RNA”) contains both a guide sequence (crRNA sequence) and a Cas9 nuclease recruitment sequence (tracrRNA). In certain embodiments, crRNA and/or tracrRNA are delivered into the cell. In specific embodiments, the gene editing polynucleotide is expressed in a cell, for example, from an mRNA or vector. In specific embodiments, a gene editing complex comprising a Cas9 protein and gRNA or crRNA and tracrRNA, that is, a CRISPR ribonucleoprotein (RNP) complex, is delivered into a cell or is expressed in a cell.

In specific embodiments, a Cas protein (eg, expressed or delivered as part of an RNP) is used to genetically modify a cell. In specific embodiments, the Cas protein is a Cas9 protein or mutants thereof. Non-limiting examples of Cas proteins (including Cas9 and non-limiting examples of Cas9 mutants) are described herein.

In specific embodiments, the first and second gRNA molecules, or the first and second crRNA molecules, together represent nucleotide sequences complementary to target sequences flanking a gene or fragment thereof (e.g., a promoter and/or one or more exons and/or introns thereof) , while the gene, or its fragment, has a length of approximately 1, 2, 3, 4, 5, 6, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-100 thousand base pairs , or has a length of at least about 1, 2, 3, 4, 5, 6, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-100 thousand base pairs. In specific embodiments, pairs of RNPs comprising first and second gRNA molecules, or first and second crRNA molecules, are expressed in the cell or delivered into the cell. In specific embodiments, one component of the RNP (such as a Cas protein or gRNA) is expressed in the cell, and the other component (such as a gRNA or Cas protein) is delivered across the cell membrane into the cell.

In specific embodiments, the gRNA or crRNA target sequence has a length of from about 12 to about 25, or about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 17 -23, or 18-22 nucleotides. In specific embodiments, the target sequence is 20 nucleotides in length, or about 20 nucleotides.

In specific embodiments, an epigenomic modification at a genomic target locus may alter the accessibility of the DNA target site to the Cas protein. In specific embodiments, the gRNA targets a gene near its transcription start site and/or in a region of open chromatin characterized by extensive methylation of an H3K4 (or other) nucleosomal residue. In specific embodiments, the target sequence is within about 5000, 2500, 2000, 1500, 1250, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, or 25 bases from the transcription start site ( for example, either at the 5' end or 3' end) of the target gene. In specific embodiments, the target sequence overlaps with, or is complementary to, at least a portion of the transcription start site of a gene. In specific embodiments, publicly available programs (CHOPCHOP, WU-CRISPR) can be used to design CRISPR targeting constructs (defined by gRNA binding DNA sequences). Non-limiting examples of potential gRNA target sites for the B2M and HLA-A genes are provided in Tables 4 and 5.

Table 4. CHOPCHOP results showing potential genomic target sites for guide RNAs specifically designed to knockdown the b2-microglobulin gene NM_004048

List Target sequence Genomic localization Exon Chain GC (%) Self-complementarity Missing the target Efficiency 0 1 2 3 1 CGCGAGCACAGCTAAGGCCACGG (SEQ ID NO: 17) chr15:44711557 1 - 65 2 1 0 0 0 0.68 2 TCACGTCATCCAGCAGAGAATGG (SEQ ID NO: 18) chr15:44715446 2 + 50 0 1 0 0 0 0.55 3 ACAAAGTCACATGGTTCACACGG (SEQ ID NO: 19) chr15:44715655 2 - 40 1 1 0 0 0 0.52 4 GAGTAGCGCGAGCACAGCTAAGG (SEQ ID NO: 20) chr15:44711563 1 - 60 1 1 0 0 1 0.62 5 AGTCACATGGTTCACACGGCAGG (SED ID NO: 21) chr15:44715651 2 - 55 0 1 0 0 1 0.57 6 AAGTCAACTTCAATGTCGGATGG (SEQ ID NO: 22) chr15:44715509 2 - 40 0 1 0 0 1 0.56 7 ACTCACGCTGGATAGCCTCCAGG (SEQ ID NO: 23) chr15:44711597 1 - 60 2 1 0 0 1 0.53 8 TCCTGAATTGCTATGTGTCTGGG (SEQ ID NO: 24) chr15:44715480 2 + 40 0 1 0 0 1 0.44 9 GGCCACGGAGCGAGACATCTCGG (SEQ ID NO: 25) chr15:44711542 1 - 65 2 1 0 0 1 0.45 10 CGTGAGTAAACCTGAATCTTTGG (SEQ ID NO: 26) chr15:44715428 2 - 40 0 1 0 0 1 0.4 eleven TTGGAGTACCTGAGGAATATCGG (SEQ ID NO: 27) chr15:44715409 2 - 40 0 1 0 0 1 0.38 12 CAGTAAGTCAACTTCAATGTCGG (SEQ ID NO: 28) chr15:44715513 2 - 35 1 1 0 0 0 0.58 13 GCATACTCATCTTTTTCAGTGGG (SEQ ID NO: 29) chr15:44715629 2 - 35 0 1 0 0 0 0.52 14 AGGGTAGGAGAGACTCACGCTGG (SEQ ID NO: 30) chr15:44711609 1 - 60 0 1 0 0 2 0.6 15 GGCCGAGATGTCTCGCTCCGTGG (SEQ ID NO: 31) chr15:44711540 1 + 70 2 1 0 0 2 0.5 16 GAGACATGTAAGCAGCATCATGG (SEQ ID NO: 32) chr15:44716332 3 + 45 0 1 0 0 2 0.42 17 GTCTTTTCCCGATATTCCTCAGG (SEQ ID NO: 33) chr15:44715401 2 + 45 0 1 0 0 2 0.4 18 CATACTCATCTTTTTCAGTGGGG (SEQ ID NO: 34) chr15:44715628 2 - 35 0 1 0 0 1 0.49 19 ACAGCCCAAGATAGTTAAGTGGG (SEQ ID NO: 35) chr15:44715679 2 + 40 1 1 0 1 1 0.48 20 ACATGTAAGCAGCATCATGGAGG (SEQ ID NO: 36) chr15:44716335 3 + 45 1 1 0 0 3 0.63 21 GGCATACTCATCTTTTTCAGTGG (SEQ ID NO: 37) chr15:44715630 2 - 40 0 1 0 0 3 0.47 22 TGGAGTACCTGAGGAATATCGGG (SEQ ID NO: 38) chr15:44715408 2 - 45 0 1 0 0 3 0.38 23 TTCCTGAATTGCTATGTGTCTGG (SEQ ID NO: 39) chr15:44715479 2 + 40 0 1 0 0 3 0.26 24 TCGATCTATGAAAAAGACAGTGG (SEQ ID NO: 40) chr15:44716311 3 - 35 0 1 0 0 2 0.67 25 CACAGCCCAAGATAGTTAAGTGG (SEQ ID NO: 41) chr15:44715678 2 + 45 1 1 0 0 4 0.51 26 TTCAGACTTGTCTTTCAGCAAGG (SEQ ID NO: 42) chr15:44715568 2 + 40 2 1 0 0 4 0.47 27 ATACTCATCTTTTTCAGTGGGGG (SEQ ID NO: 43) chr15:44715627 2 - 35 0 1 0 0 3 0.64 28 TTACCCCACTTAACTATCTTGGG (SEQ ID NO: 44) chr15:44715683 2 - 35 1 1 0 0 3 0.37 29 ACTTGTCTTTCAGCAAGGACTGG (SEQ ID NO: 45) chr15:44715573 2 + 45 1 1 0 1 3 0.55 thirty CAGCCCAAGATAGTTAAGTGGGG (SEQ ID NO: 46) chr15:44715680 2 + 45 1 1 0 0 5 0.58 31 ACCCAGACACATAGCAATTCAGG (SEQ ID NO: 47) chr15:44715481 2 - 45 0 1 0 0 5 0.33 32 TGGGCTGTGACAAAGTCACATGG (SEQ ID NO: 48) chr15:44715664 2 - 50 4 1 0 1 4 0.56 33 GCTACTCTCTCTTCTGGCCTGG (SEQ ID NO: 49) chr15:44711579 1 + 55 0 1 0 0 6 0.47 34 CTCGCGCTACTCTCTCTTTCTGG (SEQ ID NO: 50) chr15:44711574 1 + 55 0 1 0 0 6 0.27 35 CTCAGGTACTCCAAAGATTCAGG (SEQ ID NO: 51) chr15:44715418 2 + 45 0 1 0 1 8 0.41 36 CTGAATCTTTGGAGTACCTGAGG (SEQ ID NO: 52) chr15:44715417 2 - 45 0 1 0 1 eleven 0.56 37 ACTCTCTCTTTCTGGCCTGGAGG (SEQ ID NO: 53) chr15:44711582 1 + 55 1 1 0 0 14 0.51 38 CTTACCCCACTTAACTATCTTGG (SEQ ID NO: 54) chr15:44715684 2 - 40 0 1 0 1 13 0.34 39 TTTGACTTTCCATTCTCTGCTGG (SEQ ID NO: 55) chr15:44715455 2 - 40 0 1 0 0 16 0.5 40 GAAGTTGACTTACTGAAGAATGG (SEQ ID NO: 56) chr15:44715521 2 + 35 1 1 0 0 17 0.53 41 TGGAGAGAAATTGAAAAAGTGG (SEQ ID NO: 57) chr15:44715541 2 + 35 0 1 0 0 19 0.65

Table 5. CHOPCHOP results showing potential genomic target sites for guide RNAs specifically designed to knock down the HLA-A gene NM_002116

List Target sequence Genomic localization exon Chain GC (%) Self-complementarity Missing the target Efficiency 0 1 2 3 1 CAGTTGAGAGCCTACCTGGATGG (SEQ ID NO: 58) chr6:29943459 3 + 55 2 0 0 0 2 0.51 2 TGCCGTCGTAGGCGTCCTGCCGG (SEQ ID NO: 59) chr6:29943335 3 - 70 0 3 0 0 0 0.46 3 GGCGCTTCCTCCGCGGGTACCGG (SEQ ID NO: 60) chr6:29943316 3 + 75 0 3 0 0 0 0.48 4 AGACTGACCGAGTGGACCTGGGG (SEQ ID NO: 61) chr6:29942970 2 + 60 3 0 2 4 1 0.58 5 CAGACTGACCGAGTGGACCTGGG (SEQ ID NO: 62) chr6:29942969 2 + 60 3 0 2 4 1 0.57 6 ACAGACTGACCGAGTGGACCTGG (SEQ ID NO: 63) chr6:29942968 2 + 60 2 0 2 4 2 0.42 7 CTTCCTCCGCGGGTACCGGCAGG (SEQ ID NO: 64) chr6:29943320 3 + 75 0 3 1 1 0 0.6 8 TACCGGCAGGACGCCTACGACGG (SEQ ID NO: 65) chr6:29943333 3 + 65 2 3 1 1 2 0.68 9 AGGCGTCCTGCCGGTACCCGCG (SEQ ID NO: 66) chr6:29943326 3 - 75 0 3 1 1 2 0.64 10 CGTCCTGCCGGTACCCGCGGAGG (SEQ ID NO: 67) chr6:29943323 3 - 80 0 3 2 0 2 0.73 eleven CCAGTCACAGACTGACCGAGTGG (SEQ ID NO: 68) chr6:29942962 2 + 60 3 0 0 2 12 0.55 12 GCAGCCATACATTATCTGGATGG (SEQ ID NO: 69) chr6:29943277 3 - 45 1 2 2 1 10 0.47 13 CCAGGAGACACGGAATGTGAAGG (SEQ ID NO: 70) chr6:29942938 2 + 55 2 1 2 1 13 0.72 14 CTCTCAACTGCTCCGCCTCATGG (SEQ ID NO: 71) chr6:29943446 3 - 60 1 0 3 6 6 0.4 15 TTGTAAAGGTGAGAGCTTGGAGG (SEQ ID NO: 72) chr6:29945274 7 + 45 0 2 5 0 7 0.52 16 TCGCTGCCGTGATGTGGAGGAGG (SEQ ID NO: 73) chr6:29944584 5 + 65 0 2 3 6 4 0.66 17 GGCGCCATGACGGCCATCCTCGG (SEQ ID NO: 74) chr6:29942548 1 - 70 1 6 0 0 9 0.52 18 TGTGTCTTGGGGGGGTCTGACGG (SEQ ID NO: 75) chr6:29944115 4 - 60 0 6 0 3 5 0.47 19 GCGCCCGCGGCTCCATCCTCTGG (SEQ ID NO: 76) chr6:29942881 2 - 80 0 7 3 0 3 0.53 20 CTCAGGTGGAGAAGGGTGAAGG (SEQ ID NO: 77) chr6:29944612 5 + 60 0 2 3 2 15 0.55 21 ATTTCTTCACATCCGTGTCCCGG (SEQ ID NO: 78) chr6:29942775 2 + 45 0 5 0 3 12 0.5 22 GTGGACCTGGGGACCCTGCGCGG (SEQ ID NO: 79) chr6:29942981 2 + 75 2 2 0 4 17 0.57 23 TTCACATCCGTGTCCCGGCCCGG (SEQ ID NO: 80) chr6:29942780 2 + 65 0 5 0 4 eleven 0.45 24 AGCTTGTAAAGGTGAGAGCTTGG (SEQ ID NO: 81) chr6:29945271 7 + 45 0 2 5 1 14 0.42 25 ACGGCCATCCTCGGCGTCTGGGG (SEQ ID NO: 82) chr6:29942539 1 - 70 0 6 0 0 16 0.41 26 GACGGCCATCCTCGGCGTCTGGG (SEQ ID NO: 83) chr6:29942540 1 - 70 0 6 0 0 16 0.39 27 TCAGGTGGAGAAGGGGTGAAGGG (SEQ ID NO: 84) chr6:29944613 5 + 55 0 2 2 1 21 0.45 28 GACGCCGAGGATGGCCGTCATGG (SEQ ID NO: 85) chr6:29942544 1 + 70 0 6 0 0 17 0.46 29 TGACGGCCATCCTCGGCGTCTGG (SEQ ID NO: 86) chr6:29942541 1 - 70 3 6 0 0 17 0.4 thirty TCTCAACTGCTCCGCCTCATGGG (SEQ ID NO: 87) chr6:29943445 3 - 55 1 0 3 12 12 0.37 31 GTATGGCTGCGACGTGGGGTCGG (SEQ ID NO: 88) chr6:29943290 3 + 65 0 3 4 14 0 0.54 32 CACTCGGTCAGTCTGTGACTGGG (SEQ ID NO: 89) chr6:29942961 2 - 55 2 0 9 8 7 0.56 33 CGCACGGGTACCAGGGGCCACGG (SEQ ID NO: 90) chr6:29943537 3 + 75 1 6 7 5 0 0.58 34 GGATGTGAAGAAATACCTCATGG (SEQ ID NO: 91) chr6:29942766 2 - 40 0 5 0 3 21 0.57 35 CACACCATCCAGATAATGTATGG (SEQ ID NO: 92) chr6:29943273 3 + 40 0 2 2 7 19 0.42 36 CGTCGCAGCCATACATTATCTGG (SEQ ID NO: 93) chr6:29943281 3 - 50 1 2 9 4 10 0.35 37 CGGCTCCATCCTCTGGCTCGCGG (SEQ ID NO: 94) chr6:29942874 2 - 70 0 8 2 0 16 0.61 38 GTGTCTTGGGGGGGTCTGACGGG (SEQ ID NO: 95) chr6:29944114 4 - 65 0 6 0 9 13 0.32 39 ACAGCGACGCCGCGAGCCAGAGG (SEQ ID NO: 96) chr6:29942865 2 + 75 1 8 0 2 18 0.68 40 CGACGCCGCGAGCCAGAGGATGG (SEQ ID NO: 97) chr6:29942869 2 + 75 2 8 2 8 8 0.6 41 GATAATGTATGGCTGCGACGTGG (SEQ ID NO: 98) chr6:29943284 3 + 50 0 2 8 12 10 0.62 42 ATAATGTATGGCTGCGACGTGGG (SEQ ID NO: 99) chr6:29943285 3 + 45 0 2 8 13 9 0.52 43 CACCAAGCGCAAGTGGGAGGCGG (SEQ ID NO: 100) chr6:29943422 3 + 65 0 50 50 50 50 0.74 44 GCTGCAAGTAAGTATGAAGGAGG (SEQ ID NO: 101) chr6:29945085 6 + 45 0 50 50 50 50 0.73 45 CGTGGAGACCAGGCCTGCAGGG (SEQ ID NO: 102) chr6:29944264 4 + 70 1 50 50 50 50 0.72 46 GGTGGAGAAGGGGTGAAGGGTGG (SEQ ID NO: 103) chr6:29944616 5 + 65 0 50 50 50 50 0.71 47 CTGCAGCGCACGGGTACCAGGGG (SEQ ID NO: 104) chr6:29943531 3 + 70 1 50 50 50 50 0.72 48 CGGCTACTACAACCAGAGCGAGG (SEQ ID NO: 105) chr6:29943001 2 + 60 0 50 50 50 50 0.71 49 AGATCACACTGACCTGGCAGCGG (SEQ ID NO: 106) chr6:29944209 4 + 55 0 50 50 50 50 0.69 50 TGTGGTGGTGCCTTCTTGGAGAGG (SEQ ID NO: 107) chr6:29944312 4 + 60 1 50 50 50 50 0.68 51 AGACAGCTCTGGGAAAAGAGGGG (SEQ ID NO: 108) chr6:29944485 5 - 50 2 50 50 50 50 0.69 52 GAAGAGCTCAGGTGGAGAAGGGG (SEQ ID NO: 109) chr6:29944606 5 + 55 0 50 50 50 50 0.67 53 TGAAGAAATACCTCATGGAGTGG (SEQ ID NO: 110) chr6:29942761 2 - 40 0 50 50 50 50 0.67 54 TAGCCCACGGCGATGAAGCGGGG (SEQ ID NO: 111) chr6:29942813 2 - 65 1 50 50 50 50 0.68 55 CGTGTCGTCCACGTAGCCCACGG (SEQ ID NO: 112) chr6:29942826 2 - 65 2 50 50 50 50 0.68 56 GATCACCAAGCGCAAGTGGGAGG (SEQ ID NO: 113) chr6:29943419 3 + 60 0 50 50 50 50 0.66 57 GGACCTGCGCTCTTGGACCGCGG (SEQ ID NO: 114) chr6:29943380 3 + 70 2 50 50 50 50 0.68 58 GGCGCCGTGGATAGAGCAGGAGG (SEQ ID NO: 115) chr6:29942899 2 + 70 0 50 50 50 50 0.66 59 CGCCGTGGATAGAGCAGGAGGGG (SEQ ID NO: 116) chr6:29942901 2 + 65 0 50 50 50 50 0.66 60 TGGATGGCACGTGCGTGGAGTGG (SEQ ID NO: 117) chr6:29943475 3 + 65 1 50 50 50 50 0.67 61 CTTCTCACAGATAGAAAAGGAGG (SEQ ID NO: 118) chr6:29945049 6 + 40 0 50 50 50 50 0.66 62 TGGTCGCTGCCGTGATGTGGAGG (SEQ ID NO: 119) chr6:29944581 5 + 65 0 50 50 50 50 0.66 63 CAGATTCTCCCCAGACGCCGAGG (SEQ ID NO: 120) chr6:29942531 1 + 65 1 50 50 50 50 0.66 64 GGATGGGGAGGACCAGACCCAGG (SEQ ID NO: 121) chr6:29944231 4 + 70 1 50 50 50 50 0.66 65 TGGGGTAAGGAGGGAGATGGGGG (SEQ ID NO: 122) chr6:29944394 4 + 60 0 50 50 50 50 0.65 66 CTCATGGAGTGGGAGCCTGGGGG (SEQ ID NO: 123) chr6:29942750 2 - 65 2 50 50 50 50 0.67 67 CAGATACCTGGAGAACGGGAAGG (SEQ ID NO: 124) chr6:29943503 3 + 55 1 50 50 50 50 0.66 68 GAGCCAGAGGATGGAGCCGCGGG (SEQ ID NO: 125) chr6:29942878 2 + 70 1 50 50 50 50 0.65 69 CCTGGCCCTGACCCAGACCTGGG (SEQ ID NO: 126) chr6:29942601 1 + 70 0 50 50 50 50 0.64 70 CATGGTCAGAGATGGGGTGGTGG (SEQ ID NO: 127) chr6:29944144 4 - 60 0 50 50 50 50 0.64 71 TGGAGGAGGAAGAGCTCAGGTGG (SEQ ID NO: 128) chr6:29944598 5 + 60 0 50 50 50 50 0.64 72 TTGGACCGCGGCGGACATGGCGG (SEQ ID NO: 129) chr6:29943392 3 + 70 4 50 50 50 50 0.67 73 TGGAACCTTCCAGAAGTGGGCGG (SEQ ID NO: 130) chr6:29944288 4 + 55 2 50 50 50 50 0.65 74 CCTCCTCCTGCTACTCTCGGGGG (SEQ ID NO: 131) chr6:29942577 1 + 65 0 50 50 50 50 0.63 75 AGCTCTGGGAAAAGAGGGGAAGG (SEQ ID NO: 132) chr6:29944481 5 - 55 1 50 50 50 50 0.64 76 GGGATGGAACCTTCCAGAAGTGG (SEQ ID NO: 133) chr6:29944284 4 + 55 3 50 50 50 50 0.65 77 AGATGGGGTAAGGAGGGAGATTGG (SEQ ID NO: 134) chr6:29944391 4 + 55 0 50 50 50 50 0.62 78 GGTGGCCTCATGGTCAGAGATGG (SEQ ID NO: 135) chr6:29944152 4 - 60 1 50 50 50 50 0.62 79 CTGACCATGAGGCCACCCTGAGG (SEQ ID NO: 136) chr6:29944158 4 + 65 1 50 50 50 50 0.62 80 GGGTCATATGTGTCTTGGGGGG (SEQ ID NO: 137) chr6:29944123 4 - 55 0 50 50 50 50 0.61 81 CTCCGCAGGGTAGAAGCCCAGGG (SEQ ID NO: 138) chr6:29944188 4 - 65 1 50 50 50 50 0.62 82 AAGCCCCTCACCCTGAGATGGGG (SEQ ID NO: 139) chr6:29944376 4 + 60 1 50 50 50 50 0.62 83 GTGGAGAAGGGGTGAAGGGTGGG (SEQ ID NO: 140) chr6:29944617 5 + 60 0 50 50 50 50 0.61 84 GTGGATAGAGCAGGAGGGGCCGG (SEQ ID NO: 141) chr6:29942905 2 + 65 0 50 50 50 50 0.61 85 TGCTCTATCCACGGCGCCCGCGG (SEQ ID NO: 142) chr6:29942894 2 - 70 1 50 50 50 50 0.62 86 AAAAGGAGGGAGTTACACTCAGG (SEQ ID NO: 143) chr6:29945063 6 + 45 1 50 50 50 50 0.61 87 TGAGGGACACATCAGAGCCCTGG (SEQ ID NO: 144) chr6:29945247 7 - 60 2 50 50 50 50 0.62 88 GAAGGAGACGCTGCAGCGCACGG (SEQ ID NO: 145) chr6:29943521 3 + 65 1 50 50 50 50 0.61 89 TCTCCGCAGGGTAGAAGCCCAGG (SEQ ID NO: 146) chr6:29944189 4 - 65 1 50 50 50 50 0.61 90 GAAGACAGCTCTGGGAAAAGAGG (SEQ ID NO: 147) chr6:29944487 5 - 50 0 50 50 50 50 0.59 91 CCAGAAGTGGGCGGCTGTGGTGG (SEQ ID NO: 148) chr6:29944297 4 + 70 0 50 50 50 50 0.59 92 TCTGGTTGTAGTAGCCGCGCAGG (SEQ ID NO: 149) chr6:29942995 2 - 60 2 50 50 50 50 0.61 93 AATGATGCCCACGATGGGGATGG (SEQ ID NO: 150) chr6:29944518 5 - 55 1 50 50 50 50 0.6 94 TGGAAGGTTCCATCCCCTGCAGG (SEQ ID NO: 151) chr6:29944277 4 - 60 2 50 50 50 50 0.61 95 ACTGACCTGGCAGCGGGATGGGG (SEQ ID NO: 152) chr6:29944216 4 + 65 0 50 50 50 50 0.59 96 AGGAAGAGCTCAGGTGGAGAAGG (SEQ ID NO: 153) chr6:29944604 5 + 55 0 50 50 50 50 0.59 97 ATGTGGAGGAGGAAGAGCTCAGG (SEQ ID NO: 154) chr6:29944595 5 + 55 0 50 50 50 50 0.59 98 GAGCCCCGCTTCATCGCCGTGGG (SEQ ID NO: 155) chr6:29942810 2 + 70 0 50 50 50 50 0.58 99 CAGGTCAGTGTGATCTCCGCAGG (SEQ ID NO: 156) chr6:29944202 4 - 60 0 50 50 50 50 0.58 100 GCGCCGTGGATAGAGCAGGAGGG (SEQ ID NO: 157) chr6:29942900 2 + 65 0 50 50 50 50 0.58 101 AGACCTGGGCGGGTGAGTGCGGG (SEQ ID NO: 158) chr6:29942615 1 + 70 1 50 50 50 50 0.59 102 GGAGGACCAGACCCAGGACACGG (SEQ ID NO: 159) chr6:29944237 4 + 65 2 50 50 50 50 0.6 103 GAGACCAGGCCTGCAGGGGATGG (SEQ ID NO: 160) chr6:29944268 4 + 70 2 50 50 50 50 0.6 104 TATCTCTGCTCCTCTCCAGAAGG (SEQ ID NO: 161) chr6:29944322 4 - 50 1 50 50 50 50 0.59 105 CACCCTGAGATGGGGTAAGGAGG (SEQ ID NO: 162) chr6:29944384 4 + 60 0 50 50 50 50 0.58 106 CGTAGCCCACGGCGATGAAGCGG (SEQ ID NO: 163) chr6:29942815 2 - 65 3 50 50 50 50 0.61 107 TGGGTCATATGTGTCTTGGGGGG (SEQ ID NO: 164) chr6:29944124 4 - 50 0 50 50 50 50 0.57 108 CCCAGGCAGTGACAGTGCCCAGG (SEQ ID NO: 165) chr6:29945229 7 + 70 2 50 50 50 50 0.59 109 GGATGGAACCTTCCAGAAGTGGG (SEQ ID NO: 166) chr6:29944285 4 + 50 3 50 50 50 50 0.6 110 CCAAGCCCCTCACCCTGAGATGG (SEQ ID NO: 167) chr6:29944374 4 + 65 2 50 50 50 50 0.59 111 CAAGTGGGAGGCGGCCCATGAGG (SEQ ID NO: 168) chr6:29943431 3 + 70 1 50 50 50 50 0.58 112 GGAAGAGCTCAGGTGGAGAAGGG (SEQ ID NO: 169) chr6:29944605 5 + 55 0 50 50 50 50 0.56 113 CAGCAATGATGCCCACGATGGGG (SEQ ID NO: 170) chr6:29944522 5 - 55 2 50 50 50 50 0.58 114 ATGGGGTAAGGAGGGAGATTGGGG (SEQ ID NO: 171) chr6:29944393 4 + 55 0 50 50 50 50 0.56 115 CTGCGGAGATCACACTGACCTGG (SEQ ID NO: 172) chr6:29944203 4 + 60 1 50 50 50 50 0.57 116 GAAGAAATACCTCATGGAGTGGG (SEQ ID NO: 173) chr6:29942760 2 - 40 0 50 50 50 50 0.56 117 TCAGATCACCAAGCGCAAGTGGG (SEQ ID NO: 174) chr6:29943416 3 + 50 0 50 50 50 50 0.56 118 GCTCTTCCTCCTCCACATCACGG (SEQ ID NO: 175) chr6:29944590 5 - 55 0 50 50 50 50 0.56 119 GGATTACATCGCCCTGAACGAGG (SEQ ID NO: 176) chr6:29943359 3 + 55 0 50 50 50 50 0.56 120 AAGACAGCCTCTGGGAAAAGAGGG (SEQ ID NO: 177) chr6:29944486 5 - 45 1 50 50 50 50 0.57 121 CCAGGCAGTGACAGTGCCCAGGG (SEQ ID NO: 178) chr6:29945230 7 + 65 1 50 50 50 50 0.57 122 AGCTGTGATCACTGGAGCTGTGG (SEQ ID NO: 179) chr6:29944561 5 + 55 0 50 50 50 50 0.56 123 AAGGAGACGCTGCAGCGCACGGG (SEQ ID NO: 180) chr6:29943522 3 + 65 1 50 50 50 50 0.56 124 TCACAGCTCCAAGGAGAACCAGG (SEQ ID NO: 181) chr6:29944546 5 - 55 2 50 50 50 50 0.57 125 ACACTGACCTGGCAGCGGGATGG (SEQ ID NO: 182) chr6:29944214 4 + 65 2 50 50 50 50 0.57 126 GGCCCTGGGCTTCTACCCTGCGG (SEQ ID NO: 183) chr6:29944186 4 + 70 1 50 50 50 50 0.56 127 TTCTGTTTTTGTTCTACCCCAGG (SEQ ID NO: 184) chr6:29945212 7 + 40 0 50 50 50 50 0.55 128 CTGGGCACTGTCACTGCCTGGGG (SEQ ID NO: 185) chr6:29945228 7 - 65 2 50 50 50 50 0.57 129 GTGTCCCTCACAGCTTGTAAAGG (SEQ ID NO: 186) chr6:29945260 7 + 50 0 50 50 50 50 0.55 130 AGGTCAGTGTGATCTCCGCAGGG (SEQ ID NO: 187) chr6:29944201 4 - 55 0 50 50 50 50 0.54 131 CAGCCCACCATCCCCATCGTGGG (SEQ ID NO: 188) chr6:29944511 5 + 65 0 50 50 50 50 0.54 132 GATCACACTGACCTGGCAGCGGG (SEQ ID NO: 189) chr6:29944210 4 + 60 2 50 50 50 50 0.56 133 GCAGACCCTCATGCTGCACATGG (SEQ ID NO: 190) chr6:29944351 4 - 60 0 50 50 50 50 0.54 134 GCCAGCAATGATGCCCACGATGG (SEQ ID NO: 191) chr6:29944524 5 - 60 1 50 50 50 50 0.55 135 GATGCCACGATGGGGATGGTGG (SEQ ID NO: 192) chr6:29944515 5 - 65 1 50 50 50 50 0.55 136 GCTGCAGCGCACGGGTACCAGGG (SEQ ID NO: 193) chr6:29943530 3 + 70 2 50 50 50 50 0.55 137 TGGCCTCATGGTCAGAGATGGGG (SEQ ID NO: 194) chr6:29944150 4 - 55 1 50 50 50 50 0.54 138 ACACGGAGCTCGTGGAGACCAGG (SEQ ID NO: 195) chr6:29944254 4 + 65 3 50 50 50 50 0.56 139 CACGCACGTGCCATCCAGGTAGG (SEQ ID NO: 196) chr6:29943469 3 - 65 0 50 50 50 50 0.53 140 TGGGCTGGGAAGACAGCTCTGGG (SEQ ID NO: 197) chr6:29944495 5 - 60 1 50 50 50 50 0.54 141 ACCCGCCCAGGTCTGGGTCAGGG (SEQ ID NO: 198) chr6:29942606 1 - 70 2 50 50 50 50 0.55 142 GTAGCCCACGGCGATGAAGCGGG (SEQ ID NO: 199) chr6:29942814 2 - 65 2 50 50 50 50 0.55 143 GGTGGGTCATATGTGTCTTGGGG (SEQ ID NO: 200) chr6:29944126 4 - 50 0 50 50 50 50 0.52 144 GAGGGACACATCAGAGCCCTGGG (SEQ ID NO: 201) chr6:29945246 7 - 60 2 50 50 50 50 0.54 145 CTCCGCAGATACCTGGAGAACGG (SEQ ID NO: 202) chr6:29943498 3 + 55 0 50 50 50 50 0.52 146 TTCTCCCCAGACGCCGAGGATGG (SEQ ID NO: 203) chr6:29942535 1 + 65 0 50 50 50 50 0.52 147 GGGGCCGGAGTATTGGGACCAGG (SEQ ID NO: 204) chr6:29942920 2 + 70 2 50 50 50 50 0.54 148 TCCGCAGATACCTGGAGAACGGG (SEQ ID NO: 205) chr6:29943499 3 + 55 0 50 50 50 50 0.52 149 CTTACCCCATCTCAGGGTGAGGG (SEQ ID NO: 206) chr6:29944380 4 - 55 1 50 50 50 50 0.53 150 ATGAGGCCACCCTGAGGTGCTGG (SEQ ID NO: 207) chr6:29944164 4 + 65 1 50 50 50 50 0.53 151 GTGGGGCTGGGAAGACAGCTCTGG (SEQ ID NO: 208) chr6:29944496 5 - 65 1 50 50 50 50 0.52 152 GCAGGACGCCTACGACGGCAAGG (SEQ ID NO: 209) chr6:29943338 3 + 70 3 50 50 50 50 0.54 153 GATGGGGTAAGGAGGGAGATGGG (SEQ ID NO: 210) chr6:29944392 4 + 55 0 50 50 50 50 0.51 154 TCCCTCCTTACCCCATCTCAGGG (SEQ ID NO: 211) chr6:29944386 4 - 55 1 50 50 50 50 0.52 155 CCCCAGGCTCCCACTCCATGAGG (SEQ ID NO: 212) chr6:29942751 2 + 70 0 50 50 50 50 0.51 156 CTGGTTGTAGTAGCCGCGCAGGG (SEQ ID NO: 213) chr6:29942994 2 - 60 2 50 50 50 50 0.53 157 CACCTGCCATGTGCAGCATGAGG (SEQ ID NO: 214) chr6:29944345 4 + 60 3 50 50 50 50 0.54 158 CTCACCTTTACAAGCTGTGAGGG (SEQ ID NO: 215) chr6:29945264 7 - 45 0 50 50 50 50 0.51 159 GAGGGTTCGGGGCGCCATGACGG (SEQ ID NO: 216) chr6:29942558 1 - 70 0 50 50 50 50 0.51 160 CCCTCCTCCTGCTACTCTCGGGG (SEQ ID NO: 217) chr6:29942576 1 + 65 0 50 50 50 50 0.51 161 CCACCCCATCTCTGACCATGAGG (SEQ ID NO: 218) chr6:29944147 4 + 60 1 50 50 50 50 0.51 162 GGCCCCTCCTGCTCTATCCACGG (SEQ ID NO: 219) chr6:29942903 2 - 65 0 50 50 50 50 0.5 163 GTCTCCTGGTCCCAATACTCCGG (SEQ ID NO: 220) chr6:29942924 2 - 55 0 50 50 50 50 0.5 164 CCAGCCACCATCCCCATCGTGG (SEQ ID NO: 221) chr6:29944510 5 + 70 1 50 50 50 50 0.51 165 ACCCTGAGATGGGGTAAGGAGGG (SEQ ID NO: 222) chr6:29944385 4 + 55 1 50 50 50 50 0.51 166 GTGGGTCATATGTGTCTTGGGG (SEQ ID NO: 223) chr6:29944125 4 - 50 0 50 50 50 50 0.5 167 GATGTAATCCTTGCCGTCGTAGG (SEQ ID NO: 224) chr6:29943346 3 - 50 0 50 50 50 50 0.5 168 CTCAGATCACCAAGCGCAAGTGG (SEQ ID NO: 225) chr6:29943415 3 + 55 0 50 50 50 50 0.5 169 AGTAGCAGGAGGAGGGTTCGGGG (SEQ ID NO: 226) chr6:29942569 1 - 60 1 50 50 50 50 0.51 170 CACAGCCGCCCACTTCTGGAAGG (SEQ ID NO: 227) chr6:29944293 4 - 65 1 50 50 50 50 0.5 171 GTGGCCTCATGGTCAGAGATGGG (SEQ ID NO: 228) chr6:29944151 4 - 55 1 50 50 50 50 0.5 172 GTGGTGGGTCATATGTGTCTTGG (SEQ ID NO: 229) chr6:29944128 4 - 50 0 50 50 50 50 0.49 173 CTCCAGTGATCACAGCTCCAAGG (SEQ ID NO: 230) chr6:29944555 5 - 55 0 50 50 50 50 0.49 174 GACCCAGGACACGGAGCTCGTGG (SEQ ID NO: 231) chr6:29944246 4 + 70 3 50 50 50 50 0.52 175 CTGTGGTCGCTGCCGTGATGTGG (SEQ ID NO: 232) chr6:29944578 5 + 65 0 50 50 50 50 0.48 176 CTACCTGGATGGCACGTGCGTGG (SEQ ID NO: 233) chr6:29943470 3 + 65 1 50 50 50 50 0.49 177 CCTCACCCTGAGATGGGGTAAGG (SEQ ID NO: 234) chr6:29944381 4 + 60 1 50 50 50 50 0.48 178 ACCCTGAGGTGCTGGGCCCTGGG (SEQ ID NO: 235) chr6:29944172 4 + 70 2 50 50 50 50 0.49 179 CTCGTGGAGACCAGGCCTGCAGG (SEQ ID NO: 236) chr6:29944262 4 + 70 1 50 50 50 50 0.48 180 GCACTCACCCGCCCAGGTCTGGG (SEQ ID NO: 237) chr6:29942612 1 - 70 2 50 50 50 50 0.49 181 ACCTCATGGAGTGGGAGCCTGGG (SEQ ID NO: 238) chr6:29942752 2 - 60 3 50 50 50 50 0.5 182 CTTCCAGAAGTGGGCGGCTGTGG (SEQ ID NO: 239) chr6:29944294 4 + 65 0 50 50 50 50 0.46 183 GTGAGACAGCTGCCTTGTGTGGG (SEQ ID NO: 240) chr6:29945452 8 + 55 1 50 50 50 50 0.47 184 TACTACAACCAGAGCGAGGCCGG (SEQ ID NO: 241) chr6:29943005 2 + 55 0 50 50 50 50 0.46 185 TGGACGACACGCAGTTCGTGCGG (SEQ ID NO: 242) chr6:29942838 2 + 60 3 50 50 50 50 0.49 186 TCCCGTTCTCCAGGTATCTGCGG (SEQ ID NO: 243) chr6:29943500 3 - 55 0 50 50 50 50 0.46 187 CTCTTGGACCGCGGCGGACATGG (SEQ ID NO: 244) chr6:29943389 3 + 70 4 50 50 50 50 0.5 188 CCCATCGTGGGCATCATTGCTGG (SEQ ID NO: 245) chr6:29944523 5 + 60 0 50 50 50 50 0.45 189 AGAGTAGCAGGAGGAGGGTTCGG (SEQ ID NO: 246) chr6:29942571 1 - 55 1 50 50 50 50 0.46 190 CAAGCCCCCTCACCCTGAGATGGG (SEQ ID NO: 247) chr6:29944375 4 + 60 2 50 50 50 50 0.47 191 CGTGGGCATCATTGCTGGCCTGG (SEQ ID NO: 248) chr6:29944528 5 + 65 0 50 50 50 50 0.44 192 CACGATGGGGATGGTGGGCTGGG (SEQ ID NO: 249) chr6:29944509 5 - 65 0 50 50 50 50 0.44 193 ATCTGGATGGTGTGAGAACCTGG (SEQ ID NO: 250) chr6:29943264 3 - 50 0 50 50 50 50 0.44 194 ACCTGCCATGTGCAGCATGAGGG (SEQ ID NO: 251) chr6:29944346 4 + 55 3 50 50 50 50 0.47 195 TCTCACCTTTACAAGCTGTGAGG (SEQ ID NO: 252) chr6:29945265 7 - 45 0 50 50 50 50 0.44 196 GGTTCCATCCCCTGCAGGCCTGG (SEQ ID NO: 253) chr6:29944272 4 - 70 0 50 50 50 50 0.44 197 CAGACCTGGGCGGGTGAGTGCGG (SEQ ID NO: 254) chr6:29942614 1 + 70 1 50 50 50 50 0.44 198 GGAGTGGCTCCGCAGATACCTGG (SEQ ID NO: 255) chr6:29943491 3 + 65 1 50 50 50 50 0.44 199 AAGAGCGCAGGTCCTCGTTCAGG (SEQ ID NO: 256) chr6:29943371 3 - 60 0 50 50 50 50 0.43 200 TCGTGGAGACCAGGCCTGCAGGG (SEQ ID NO: 257) chr6:29944263 4 + 65 1 50 50 50 50 0.43 201 ATGCCCACGATGGGGATGGTGGG (SEQ ID NO: 258) chr6:29944514 5 - 60 1 50 50 50 50 0.43 202 TTACCCCATCTCAGGTGAGGGG (SEQ ID NO: 259) chr6:29944379 4 - 55 3 50 50 50 50 0.45 203 CTTCATCGCCGTGGGCTACGTGG (SEQ ID NO: 260) chr6:29942818 2 + 65 0 50 50 50 50 0.42 204 AGAGCCAGGTCCTCGTTCAGGG (SEQ ID NO: 261) chr6:29943370 3 - 60 0 50 50 50 50 0.41 205 GAGTAGCAGGAGGAGGGTTCGGG (SEQ ID NO: 262) chr6:29942570 1 - 60 1 50 50 50 50 0.42 206 AACCCTCCTCCTGCTACTCTCGG (SEQ ID NO: 263) chr6:29942574 1 + 55 0 50 50 50 50 0.41 207 CTCCTTGGAGCTGTGATCACTGG (SEQ ID NO: 264) chr6:29944553 5 + 55 1 50 50 50 50 0.42 208 TGTGGAGACAGCTGCCTTGTGTGG (SEQ ID NO: 265) chr6:29945451 8 + 55 1 50 50 50 50 0.42 209 TGAGGCCACCCTGAGGTGCTGGG (SEQ ID NO: 266) chr6:29944165 4 + 65 1 50 50 50 50 0.41 210 ACTCCACGCACGTGCCATCCAGG (SEQ ID NO: 267) chr6:29943473 3 - 65 1 50 50 50 50 0.41 211 CACTGACCTGGCAGCGGGATGGG (SEQ ID NO: 268) chr6:29944215 4 + 65 1 50 50 50 50 0.41 212 CATCTCAGGGTGAGGGGCTTGGG (SEQ ID NO: 269) chr6:29944373 4 - 60 1 50 50 50 50 0.4 213 TCTCCACGAGCTCCGTGTCCTGG (SEQ ID NO: 270) chr6:29944249 4 - 65 1 50 50 50 50 0.4 214 ACCCTCATGCTGCACATGGCAGG (SEQ ID NO: 271) chr6:29944347 4 - 60 2 50 50 50 50 0.4 215 AGCAGGAGGGGCCGGAGTATTGG (SEQ ID NO: 272) chr6:29942913 2 + 65 1 50 50 50 50 0.39 216 GCGTCTCCTTCCCGTTCTCCAGG (SEQ ID NO: 273) chr6:29943509 3 - 65 0 50 50 50 50 0.38 217 CTCCCTCCTTACCCCATCTCAGG (SEQ ID NO: 274) chr6:29944387 4 - 60 0 50 50 50 50 0.38 218 CGAGCTCCGTGTCCTGGGTCTGG (SEQ ID NO: 275) chr6:29944243 4 - 70 0 50 50 50 50 0.37 219 GTCACTCACCGGCCTCGCTCTGG (SEQ ID NO: 276) chr6:29943013 2 - 70 1 50 50 50 50 0.38 220 ATGGTCAGAGATGGGGTGGTGGG (SEQ ID NO: 277) chr6:29944143 4 - 55 0 50 50 50 50 0.37 221 TGGTGGGTCATATGTGTCTTGGG (SEQ ID NO: 278) chr6:29944127 4 - 45 0 50 50 50 50 0.37 222 TGAACGAGGACCTGCGCTCTTGG (SEQ ID NO: 279) chr6:29943373 3 + 60 1 50 50 50 50 0.38 223 ATTGCTGGCCTGGTTCTCCTTGG (SEQ ID NO: 280) chr6:29944538 5 + 55 1 50 50 50 50 0.37 224 ACCCTCCTCCTGCTACTCTCGGG (SEQ ID NO: 281) chr6:29942575 1 + 60 1 50 50 50 50 0.37 225 TACCTCATGGAGTGGGAGCCTGG (SEQ ID NO: 282) chr6:29942753 2 - 60 1 50 50 50 50 0.36 226 GCAGGAGGGGCCGGAGTATTGGG (SEQ ID NO: 283) chr6:29942914 2 + 65 1 50 50 50 50 0.34 227 GCGGCTGTGGTGGTGCCTTCTGG (SEQ ID NO: 284) chr6:29944307 4 + 70 1 50 50 50 50 0.34 228 GGAGCAGTTGAGAGCCTACCTGG (SEQ ID NO: 285) chr6:29943455 3 + 60 2 50 50 50 50 0.34 229 AGCACCTCAGGGTGGCCTCATGG (SEQ ID NO: 286) chr6:29944162 4 - 65 2 50 50 50 50 0.34 230 CTCCACGAGCTCCGTGTCCTGGG (SEQ ID NO: 287) chr6:29944248 4 - 65 1 50 50 50 50 0.33 231 CGGTGAGTGACCCCGGCCGGGGG (SEQ ID NO: 288) chr6:29943025 2 + 80 1 50 50 50 50 0.78 232 GGGCCCCCGAGAGTAGCAGGAGG (SEQ ID NO: 289) chr6:29942580 1 - 75 1 50 50 50 50 0.75 233 CAGGGCCCAGCACCTCAGGGTGG (SEQ ID NO: 290) chr6:29944170 4 - 75 0 50 50 50 50 0.71 234 GGGAGCCTGGGGGCGAGCAGTGG (SEQ ID NO: 291) chr6:29942740 2 - 80 2 50 50 50 50 0.72 235 CTGAGCCGCCATGTCCGCCGCGG (SEQ ID NO: 292) chr6:29943397 3 - 75 1 50 50 50 50 0.71 236 CCGGTGAGTGACCCCGGCCGGGG (SEQ ID NO: 293) chr6:29943024 2 + 80 2 50 50 50 50 0.71 237 CCTGCGCTCTTGGACCGCGGCGG (SEQ ID NO: 294) chr6:29943383 3 + 75 1 50 50 50 50 0.7 238 CGATGAAGCGGGGCTCCCCGCGG (SEQ ID NO: 295) chr6:29942803 2 - 75 2 50 50 50 50 0.7 239 GACCTGGCAGCGGGATGGGGAGG (SEQ ID NO: 296) chr6:29944219 4 + 75 1 50 50 50 50 0.69 240 TCCGTGTCCCGGCCCGGCCGCGG (SEQ ID NO: 297) chr6:29942786 2 + 85 3 50 50 50 50 0.67 241 CGGGTGAGTGCGGGGTCGGGAGG (SEQ ID NO: 298) chr6:29942624 1 + 80 0 50 50 50 50 0.64 242 TTTCTTCTCACAGATAGAAAAGG (SEQ ID NO: 299) chr6:29945046 6 + thirty 0 50 50 50 50 0.61 243 GGATGGAGCCGCGGGCGCCGTGG (SEQ ID NO: 300) chr6:29942886 2 + 85 1 50 50 50 50 0.62 244 CGGACGGGCGCTTCCTCCGCGGG (SEQ ID NO: 301) chr6:29943310 3 + 80 2 50 50 50 50 0.63 245 TCGGACGGGCGCTTCCTCCGCGG (SEQ ID NO: 302) chr6:29943309 3 + 75 2 50 50 50 50 0.62 246 GCGGGCGCCGTGGATAGAGCAGG (SEQ ID NO: 303) chr6:29942896 2 + 75 0 50 50 50 50 0.6 247 GGAGCCCCGCTTCATCGCCGTGG (SEQ ID NO: 304) chr6:29942809 2 + 75 1 50 50 50 50 0.61 248 TTCTCACAGATAGAAAAGGAGGG (SEQ ID NO: 305) chr6:29945050 6 + 35 0 50 50 50 50 0.6 249 CCGTGTCCCGGCCCGGCCGCGGG (SEQ ID NO: 306) chr6:29942787 2 + 90 3 50 50 50 50 0.6 250 AAGCGGGGCTCCCCGCGGCCGGG (SEQ ID NO: 307) chr6:29942798 2 - 85 3 50 50 50 50 0.6 251 GGGTGAGTGCGGGGTCGGGAGGG (SEQ ID NO: 308) chr6:29942625 1 + 75 0 50 50 50 50 0.57 252 GGCCCTGACCCAGACCTGGGCGG (SEQ ID NO: 309) chr6:29942604 1 + 75 2 50 50 50 50 0.58 253 GCCCAGGGCCCAGCACCTCAGGG (SEQ ID NO: 310) chr6:29944173 4 - 75 1 50 50 50 50 0.56 254 TGGGCGGGTGAGTGCGGGGTCGG (SEQ ID NO: 311) chr6:29942620 1 + 75 0 50 50 50 50 0.55 255 GCCGGTGAGTGACCCCGGCCGGG (SEQ ID NO: 312) chr6:29943023 2 + 80 0 50 50 50 50 0.55 256 GCACGGGTACCAGGGGCCACGGG (SEQ ID NO: 313) chr6:29943538 3 + 75 2 50 50 50 50 0.57 257 CTCAGCCACTGCTCGCCCCCAGG (SEQ ID NO: 314) chr6:29942735 2 + 75 2 50 50 50 50 0.56 258 GCCCTGACCCAGACCTGGGCGGG (SEQ ID NO: 315) chr6:29942605 1 + 75 3 50 50 50 50 0.56 259 CGTGTCCCGGCCCGGCCGCGGGG (SEQ ID NO: 316) chr6:29942788 2 + 90 3 50 50 50 50 0.55 260 GCGAGGCCGGTGAGTGACCCCGG (SEQ ID NO: 317) chr6:29943018 2 + 75 0 50 50 50 50 0.52 261 CCCTGGCCCTGACCCAGACCTGG (SEQ ID NO: 318) chr6:29942600 1 + 75 1 50 50 50 50 0.53 262 GGGCGGGTGAGTGCGGGGTCGGG (SEQ ID NO: 319) chr6:29942621 1 + 80 0 50 50 50 50 0.52 263 GACCCCGCACTCACCCGCCCAGG (SEQ ID NO: 320) chr6:29942618 1 - 80 0 50 50 50 50 0.51 264 GACCTGGGCGGGTGAGTGCGGGG (SEQ ID NO: 321) chr6:29942616 1 + 75 1 50 50 50 50 0.52 265 GGGGCTCCCCGCGGCCGGGCCGG (SEQ ID NO: 322) chr6:29942794 2 - 95 2 50 50 50 50 0.52 266 GAAGCGGGGCTCCCCGCGGCCGG (SEQ ID NO: 323) chr6:29942799 2 - 85 5 50 50 50 50 0.55 267 AGTAGCCGCGCAGGGTCCCCAGG (SEQ ID NO: 324) chr6:29942986 2 - 75 2 50 50 50 50 0.52 268 GCTGCGACGTGGGGTCGGACGGG (SEQ ID NO: 325) chr6:29943295 3 + 75 2 50 50 50 50 0.5 269 GGGCTCCCCGCGGCCGGGCCGGG (SEQ ID NO: 326) chr6:29942793 2 - 95 2 50 50 50 50 0.5 270 GGCCGGTGAGTGACCCCGGCCGG (SEQ ID NO: 327) chr6:29943022 2 + 80 2 50 50 50 50 0.49 271 CTGACCGCGGGGTCGGGGCCAGG (SEQ ID NO: 328) chr6:29943246 3 + 85 2 50 50 50 50 0.49 272 GGCTGCGACGTGGGGTCGGACGG (SEQ ID NO: 329) chr6:29943294 3 + 75 1 50 50 50 50 0.47 273 CCTGCTACTCTCGGGGGCCCTGG (SEQ ID NO: 330) chr6:29942583 1 + 75 0 50 50 50 50 0.46 274 CACCCTGAGGTGCTGGGCCCTGG (SEQ ID NO: 331) chr6:29944171 4 + 75 2 50 50 50 50 0.45 275 CACCCGCCCAGGTCTGGGTCAGG (SEQ ID NO: 332) chr6:29942607 1 - 75 2 50 50 50 50 0.45 276 AGCCCAGGGCCCAGCACCTCAGG (SEQ ID NO: 333) chr6:29944174 4 - 75 2 50 50 50 50 0.42 277 GGCCGCCTCCCACTTGCGCTTGG (SEQ ID NO: 334) chr6:29943424 3 - 75 1 50 50 50 50 0.41 278 CGCACTCACCCGCCCAGGTCTGG (SEQ ID NO: 335) chr6:29942613 1 - 75 0 50 50 50 50 0.39 279 GTCCTCCCCATCCCGCTGCCAGG (SEQ ID NO: 336) chr6:29944221 4 - 75 1 50 50 50 50 0.35 280 CGCTGCAGCGCACGGGTACCAGG (SEQ ID NO: 337) chr6:29943529 3 + 75 1 50 50 50 50 0.35 281 GCAGGGTCCCCAGGTCCACTCGG (SEQ ID NO: 338) chr6:29942977 2 - 70 0 2 0 18 20 0.46 282 CGAGCCAGAGGATGGAGCCGCGG (SEQ ID NO: 339) chr6:29942877 2 + 70 2 8 2 0 thirty 0.69 283 AGTATTGGGACCAGGAGACACGG (SEQ ID NO: 340) chr6:29942928 2 + 50 1 9 7 eleven 2 0.56 284 AGAACCTGGCCCCGACCCCGCGG (SEQ ID NO: 341) chr6:29943250 3 - 75 0 2 eleven 19 5 0.62 285 TAATGTATGGCTGCGACGTGGGG (SEQ ID NO: 342) chr6:29943286 3 + 50 0 2 16 5 26 0.56 286 GTGGGAGGGCGGCCCATGAGGCGG (SEQ ID NO: 343) chr6:29943434 3 + 75 0 7 9 12 18 0.76 287 CACGGGTACCAGGGGCCACGGGG (SEQ ID NO: 344) chr6:29943539 3 + 75 0 6 12 16 14 0.6 288 CAGGCTGCAAGTAAGTATGAAGG (SEQ ID NO: 345) chr6:29945082 6 + 45 0 31 1 1 5 0.6

In specific embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 1-99%, or more, of the population cells (such as BOD, e.g., OPC) are viable after treating the cells to deliver a Cas protein, a gRNA molecule, an RNP, and/or one or more vectors expressing a Cas protein and/or a gRNA molecule across their cell membrane (e.g., by electroporation or any other method).

Various aspects of the CRISPR-Cas system are known in the art. Non-limiting aspects of this system are described, for example, in US Pat. No. 9,023,649, issued May 5, 2015; US Patent No. 9,074,199, issued July 7, 2015; US Patent No. 8697359, issued April 15, 2014; US Patent No. 8932814, issued January 13, 2015; US Patent Application Publication No. 2016/0298096 published October 13, 2016; Cho et al., (2013) Nature Biotechnology Vol. 31 No. 3 pp. 230-232 (including additional information); and Jinek et al., (2012) Science Vol. 337 No. 6096 pp. 816-821, the entire contents of which are incorporated herein by reference.

In the CRISPR/Cas nuclease system, the CRISPR locus encodes the RNA components of the system, and the Cas (CRISPR-associated) locus encodes the proteins. CRISPR loci in microorganismal hosts contain combinations of CRISPR-associated (Cas) genes as well as non-RNA coding elements capable of programming the specificity of CRISPR-mediated polynucleotide cleavage.

Type II CRISPR is one of the most fully characterized systems and introduces targeted double-strand breaks in a process of four sequential steps. First, two non-coding RNAs, template pre-crRNA and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to pre-crRNA repeat regions and mediates the processing of pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA through Watson-Crick base pairing between a spacer on the crRNA and a protospacer on the target DNA near the protospacer adjacent motif (PAM), an additional prerequisite for target recognition . In engineered CRISPR/Cas9 systems, gRNA, also called single guide RNA (“gRNA”), can replace crRNA and tracrRNA with a single RNA construct that includes a protospacer element and a linker loop sequence. The use of gRNA reduces the number of components required to use CRISPR/Cas9 for genome editing. Cas9 species from different organisms have different PAM sequences. For example, Streptococcus pyogenes (Sp) has a PAM sequence of 5′-NGG-3′, Staphylococcus aureus (Sa) has a PAM sequence of 5′-NGRRT-3′ or 5′-NGRRN-3′, Neisseria meningitidis (NM) has a PAM sequence 5′-NNNNGATT-3′, Streptococcus thermophilus (St) has a PAM sequence of 5′-NNAGAAW-3′, Treponema denticola (Td) has a PAM sequence of 5′-NAAAAC-3′. Cas9 mediates cleavage of target DNA by creating a DSB in the protospacer. The activity of the CRISPR/Cas system in vivo involves three steps: (i) insertion of foreign DNA sequences into the CRISPR template to prevent future attacks, in a process called "adaptation", (ii) expression of the corresponding proteins, and expression and processing of the template, with subsequent (iii) RNA-mediated interference with a foreign polynucleotide. Foreign polynucleotides come from viruses that attack a bacterial cell. Thus, in a bacterial cell, several of the so-called "Cas" proteins participate in the natural function of the CRISPR/Cas system and play specific roles in functions such as insertion of foreign DNA, and so on. CRISPR can also function with nucleases other than Cas9. The proteins of two genes from the Cpf1 family contain a RuvC-like endonuclease domain, but they lack the second HNH endonuclease domain found in Cas9. Cpf1 cleaves DNA at a bias and requires only one RNA rather than the two (tracrRNA and crRNA) that Cas9 requires for cleavage. The preferred PAM for Cpf1 is 5′-TTN, which differs from that of Cas9 (3′-NGG) both in genomic localization and GC content. Mature crRNAs for Cpf1-mediated cleavage are 42–44 nucleotides in length, approximately the same size as Cas9, but with the direct repeat preceding the spacer rather than following it. The Cpf1 crRNA also has a much simpler structure than Cas9; only a short stem-loop structure in the direct repeat region is required for target cleavage. Cpf1 also does not require additional tracrRNA. While Cas9 creates blunt ends in a region 3 nt upstream of the PAM site, Cpf1 cleaves offset, creating a five-nucleotide-long “sticky end” in the 5′ direction 18–23 nt from the PAM. And other CRISPR-associated proteins besides Cas9 can be used instead of Cas9. For example, CRISPR-associated protein 1 (Cas1) is one of two universally conserved proteins found in the prokaryotic CRISPR immune defense system. Cas1 is a metal-dependent DNA-specific endonuclease that creates double-stranded DNA fragments. Cas1 forms a stable complex with another universally conserved CRISPR-associated protein, Cas2, which is part of an acquired spacer for the CRISPR system. There are also CRISPR/Cas9 variants that do not use the PAM sequence, such as NgAgo. NgAgo operates on a 24-nucleotide guide ssDNA and is thought to make a cut 8-11 nucleotides from the start of the sequence. ssDNA is loaded upon protein folding and cannot be replaced by another guide unless the temperature rises to a non-physiological level of 55°C. Several nucleotides in the target DNA are removed near the cut site. Methods for using NgAgo are described in Gao, F. et al., DNA-guided Genome Editing Using the Natronobacterium Gregoryi Argonaute, 34 Nature Biotechnology 768 (2016), the entire contents of which are incorporated herein by reference. DSBs can be formed by creating two single-strand breaks at different sites, resulting in a cut DNA molecule with sticky ends. Single-strand breaks, or “nicks,” can be formed by modified variants of the Cas9 enzyme that contain only one active catalytic domain (called “Cas9 nickase”). Cas9 nickases still bind DNA depending on the specificity of the gRNA, but nickases are only able to cut one of the DNA strands. Two nickases directed at opposite strands are required to create a DSB in the target DNA (often called a “double-nick” or “double-nickase” CRISPR system). This requirement greatly increases target specificity, since it is unlikely that two non-target nicks will be produced at a sufficiently close distance to cause DSB. Methods for using the double nickase CRISPR system to create DSBs are described in Ran, et al., Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity, 154 Cell 6:1380 (2013), the full content of which is incorporated herein by links.

Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5 , Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf 2, Csf3 , Csf4, as well as their homologues and modified variants. These enzymes are known; for example, the amino acid sequence of the S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2 (SEQ ID NO: 1) and in the NCBI database under accession number Q99ZW2.1. Proteins in the UniProt database with accession numbers A0A0G4DEU5 and CDJ55032 are other examples of the amino acid sequence of the Cas9 protein (SEQ ID NO: 2). Another non-limiting example is the Cas9 protein of Streptococcus thermophilus , the amino acid sequence of which can be found in the UniProt database under accession number Q03JI6.1 (SEQ ID NO: 3). In specific embodiments, the unmodified CRISPR enzyme has DNA cleaving activity, such as Cas9. In specific embodiments, the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae . In specific embodiments, the CRISPR enzyme directs cleavage of one or both strands at a region of a target sequence, such as the target sequence and/or the complement of the target sequence. In specific embodiments, the CRISPR enzyme directs the cleavage of one or both strands at a site about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200 distant. 500 or more base pairs from the first or last nucleotide of the target sequence. In specific embodiments, the vector encodes a CRISPR enzyme that is mutant relative to the corresponding wild-type enzyme in that the mutant CRISPR enzyme is unable to cleave one or both strands of a target polynucleotide containing the target sequence. For example, replacing aspartate with alanine (D10A, amino acid numbering is as shown for SEQ ID NO: 1) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (which cleaves one strand) . Other examples of mutations that convert Cas9 to nickase include, but are not limited to, H840A, N854A, and N863A (amino acid numbering is as shown for SEQ ID NO: 1). In specific embodiments, nickases can be used to edit the genome through homologous recombination.

In specific embodiments, the Cas9 nickase can be used in combination with a guide sequence(s), for example, two guide sequences that are directed, respectively, to the sense and antisense strands of a target DNA. This combination allows the introduction of nicks into both chains and can be used to induce NHEJ.

In specific embodiments, the genetic manipulation is performed using a nucleotide editing protein. In specific embodiments, the nucleotide-editing protein is a modified protein (such as a Cas protein, or other protein) that catalyzes the transitions and conversions of one nucleotide to another (for example, A to T, C to G, and so on) without introducing (the original or other) double-stranded DNA break. CRISPR/Cas systems containing the nucleotide-editing protein Cas are the next generation of CRISPR systems. Non-limiting descriptions of such systems are given in the publications of Gaudelli et al. (2017) Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage, Nature volume 551, pages 464–471; and Gehrke et al. (2018) High-precision CRISPR-Cas9 base editors with minimized bystander and off-target mutations, bioRxiv 273938; doi: https://doi.org/10.1101/273938, each of which is incorporated herein by reference in its entirety. In specific embodiments, the nucleotide editing protein is an adenine nucleotide editor (ABE), which mediates the conversion of A•T to G•C in genomic DNA. In specific embodiments, the nucleotide editing protein comprises an adenosine deaminase (eg, an RNA adenosine deaminase modified to act on DNA) fused to a catalytically inactive CRISPR-Cas mutant (such as a CRISPR-Cas9 mutant). In specific embodiments, the nucleotide editing protein is a cytidine nucleotide editor (ABE), which mediates the conversion of C•G to T•A in genomic DNA. In specific embodiments, the nucleotide editing protein comprises a Cas9 nuclease having a mutation that converts it to a nickase (nCas9) fused to an apolipoprotein B editing complex (APOBEC) (e.g., cytidine deaminase with rat APOBEC1 or human APOBEC3A (A3A)) and the inhibitor uracil -glycosylase (UGI). In specific embodiments, the RNA or DNA nucleotide editor includes a Cas variant other than the Cas9 variant, for example, a Cas13 variant. Various gene-editing proteins and Cas variants can be used to edit nucleotides.

In specific embodiments, the delivered gene editing protein (such as ZFN, megaTAL or Cas protein) may contain, or be fused to, a subcellular localization signal, forming a gene editing fusion protein. Depending on the context, a fusion protein including, for example, Cas9 and a nuclear localization signal may be referred to herein as “Cas9” without specifying the inclusion of a nuclear localization signal. In certain embodiments, the fusion protein may contain a nuclear localization signal. In certain embodiments, the Cas protein may contain more than one localization signal, such as 2, 3, 4, 5, or more nuclear localization signals. In certain embodiments, the localization signal is at the N-terminus of the Cas protein, and in other embodiments, the localization signal is at the C-terminus of the Cas protein.

Non-limiting examples of nuclear localization signals include GGSGPPKKKRKV (SEQ ID NO: 4), PKKKRKV (SEQ ID NO: 5), KR[PAATKKAGQA]KKKK (SEQ ID NO: 6), KR[XXXXXXXXXX]KKKK (SEQ ID NO: 7), KKXK (SEQ ID NO: 8), KRXK (SEQ ID NO: 9), KKXR (SEQ ID NO: 10), KRXR (SEQ ID NO: 11), AVKRPAATKKAGQAKKKKLD (SEQ ID NO: 12), MSRRRKANPTKLSENAKKLAKEVEN (SEQ ID NO : 13), PAAKRVKLD (SEQ ID NO: 14), PPKKKRKV (SEQ ID NO: 15) and KLKIKRPVK (SEQ ID NO: 16).

In specific embodiments, the enzyme coding sequence encoding the CRISPR enzyme is codon-optimized for expression in specific cells, such as mammalian cells, such as human cells.

Generally, a guide sequence is any polynucleotide sequence that has a sufficient degree of complementarity to the target polynucleotide sequence to hybridize to the target sequence and direct sequence-specific binding of the CRISPR complex to the target sequence. In specific embodiments, the degree of complementarity between the guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is or greater than about 90%, 95%, 97.5%, 98%, 99%, or more. In specific embodiments, the degree of complementarity is 100%. The optimal alignment can be determined using any of the appropriate algorithms for sequence alignment, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, Burrows-Wheeler transform-based algorithms (eg, Burrows-Wheeler alignment algorithm), Clustal W, Clustal X , BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In specific embodiments, the guide sequence has length of about, or more than about 15, 16, 17, 18, 19, or 20 or more nucleotides. In particular embodiments, the guide sequence is less than about 30, 25, 20, 15, or less, nucleotides in length. Capability of the guide sequence control of sequence-specific binding of the CRISPR complex to a target sequence can be assessed in any suitable assay.For example, components of the CRISPR system sufficient to form a CRISPR complex, including a test guide sequence, can be introduced into a host cell having a corresponding target sequence, e.g. by transfection with vectors encoding CRISPR sequence components, followed by assessment of cleavage preference at the target sequence. Similarly, cleavage of a target polynucleotide sequence can be assessed in vitro by introducing the target sequence, components of the CRISPR complex, including a test guide sequence and a control guide sequence other than the test guide sequence, and comparing the binding or degree of cleavage of the target sequence in reactions with the test and guide control sequences.

The guide sequence can be selected to target any target sequence. In specific embodiments, the target sequence is a sequence in the genome of a cell. In certain embodiments, the target sequence is unique in the target genome.

In particular embodiments, ZFN is used to genetically modify a cell. ZFNs are artificial restriction enzymes created by fusing a zinc finger DNA binding domain to a DNA cleavage domain. Zinc finger domains can be designed to target specific DNA sequences of interest, and this allows zinc finger nucleases to target unique sequences in complex genomes. By exploiting the endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms. Along with the Cas9 and TALEN proteins, ZFN is emerging as a prominent tool in the field of genome editing. Zinc finger nuclease is a site-specific endonuclease designed to bind and cleave DNA at specific positions. It has two protein domains. The first domain is the DNA-binding domain, which contains eukaryotic transcription factors and the zinc finger. The second domain is a nuclease domain that includes a restriction enzyme (such as the FokI restriction enzyme) and is responsible for the catalytic cleavage of DNA. Each of the DNA-binding domains of individual ZFNs typically contains three to six distinct zinc finger repeats and can recognize from 9 to 18 base pairs. In specific embodiments, if zinc finger domains are ideally specific for their specific target site, then even a pair of 3-finger ZFNs that recognize a total of 18 base pairs can target a single locus in the mammalian (e.g., human) genome. . In specific embodiments, smaller zinc finger modules with known specificity are combined. In specific embodiments, the module assembly process involves combining three separate zinc fingers, each of which can recognize a 3-nucleotide DNA sequence, to produce a 3-finger array capable of recognizing a 9-nucleotide target site. In specific embodiments, the nonspecific cleavage domain from the type II restriction endonuclease FokI is used as the cleavage domain in ZFN. This cleavage domain must dimerize to cleave DNA. In specific embodiments, a ZFN pair is used to target a non-palindromic DNA site. In specific embodiments, the cleavage domain is fused to the C-terminus of each zinc finger domain. In specific embodiments, two separate ZFNs bind opposing DNA strands at their C-terminal ends some distance apart.

TALENs are restriction enzymes that can be engineered to cleave specific DNA sequences. They can be produced by fusing the DNA binding domain of a TAL effector with a DNA cleavage domain (that is, a nuclease that cleaves DNA strands). Transcription activator-like effectors (TALEs) can be designed to bind to virtually any desired DNA sequence so that, when combined with a nuclease, they can cut DNA at specific sites. Restriction enzymes can be introduced into cells for use in gene editing or for in situ genome editing. The DNA binding domain contains repeats of a highly conserved sequence of 33-34 amino acids with divergent amino acids 12 and 13. These two positions, called repeat variable residue pair (RVD), are highly variable and show strong correlation with specific nucleotide recognition. This direct relationship between amino acid sequence and DNA recognition allowed the design of specific DNA-binding domains by selecting a combination of repeat segments containing the corresponding RVDs. Notably, making small changes to the RVD and including “unusual” RVD sequences allows for increased targeting specificity. One skilled in the art will know how to design and use TALENs to create a DSB in dsDNA at the desired target site. Some relevant protocols can be found in Hermann, M. et al., Mouse Genome Engineering Using Designer Nucleases, 86 J. Vis. Exp. 50930 (2014) and Sakuma, T. et al., Efficient TALEN Construction and Evaluation Methods for Human Cell and Animal Applications, 18(4) Genes Cells 315 (2013).

MegaTAL is produced by combining two different classes of DNA-targeting enzymes. Meganucleases (also called homing endonucleases) are single peptide chains that have the advantages of both DNA recognition and nuclease activity in the same domain. However, meganuclease target recognition is difficult to alter, and they often have lower specificity and lower target cleavage efficiency than other genome-targeted endonucleases. Transcription activator-like (TAL) effectors are DNA recognition proteins that have been coupled to distinct DNA endonuclease domains to mediate the creation of targeted DNA double-strand breaks. Unlike meganucleases, TALs can be easily modified to target specific DNA sequences. The megaTAL molecule combines a TAL effector with a meganuclease and uses the DNA-binding region of the TAL effector to target the site-specific meganuclease to a site near a single desired genomic target site. For non-limiting descriptions of megaTAL, see Boisselet al. (2014) Nucleic Acids Research 42(4):2591-2601, the entire contents of which are incorporated herein by reference.

Aspects of the present invention relate to modification of a genomic gene responsible for immunogenicity, for example, by mutation (for example, insertion, deletion or point mutation). In specific embodiments, the gene encodes an MHC-I component. In specific embodiments, the gene encodes an MHC-II component. Non-limiting examples of immunogenicity genomic genes include B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2 genes , HLA-DQA1 and/or HLA-DQB1. Many variants of such genes exist naturally, for example in humans.

In certain embodiments, the genetic modifications are non-genomic. In specific embodiments, small interfering and short hairpin RNA are used to mediate gene silencing. In particular embodiments, the natural genome is not modified, but RNAi acts at the RNA level to reduce or silence the expression of a target gene, such as B2M or HLA-A, potentially achieving an end result similar to that of gene editing.

Genetically modified kidney cell populations

One important objective of the present invention is to utilize gene editing techniques (eg, CRISPR/Cas9) previously described in a method for constructing non-aloreactive kidney cells, particularly BPCs (eg, BPC populations), for use in the treatment of chronic renal failure. The methods and compositions described herein result in increased immunological compatibility (immunological privilege) of donor cells (e.g., BODs, such as OPCs) for transplantation into a recipient subject, thereby allowing the use of a population of “universal donor” kidney cells and the ability administer a population of “allogeneic” kidney cells to patients without the use of immunosuppression. This can be achieved through target-specific inactivation or modification of one or more immunogenicity genes (eg, the HLA gene) in a cell, resulting in donor cells suitable for transplantation into a recipient subject.

The discovery and application of the CRISPR/Cas9 system in mammalian cells has enabled efficient and precise editing of target genes, for example, through non-homologous end joining (NHEJ), homologous DNA repair (HDR), or other DNA repair pathways. Co-delivery of a Cas9 molecule and a target-specific guide RNA (gRNA) molecule, optionally along with a donor DNA repair template molecule, enables gene editing of the target sequence in the genome. Thus, using the CRISPR/Cas9 system to modify genes in cells is a promising strategy for treating many genetic diseases. For a detailed description, see, for example, Sanders and Joung, Nature Biotechnology 32, 347–355 (2014).

In specific embodiments, a particular HLA allele is altered by contacting the cells described herein with a Cas9 molecule and at least one target-specific guide RNA (gRNA) that targets an endogenous immunogenicity gene to produce an immunologically compatible population cells (for example, an immunologically compatible population of renal cells). Cells obtained using the methods and compositions described herein are less likely to induce an immune response when transplanted into a recipient subject and/or are less likely to be rejected by the recipient subject's immune system. The ability to increase the immunological compatibility of donor cells, which can be adapted for transplantation into any subject, regardless of the haplotype of the donor genes responsible for immunogenicity, creates special advantages, since this leads to a sharp increase in the pool of donor cells that can be used in the field of cell therapy for a wide variety of purposes. clinical application.

Gene inactivation means that the gene of interest is not expressed as a functional protein. In specific embodiments, the genetic modification method relies on the expression, in the cells to be modified, of a directed RNA endonuclease such that it catalyzes cleavage at one target gene, resulting in inactivation of the target gene. Breaks in the nucleic acid chain caused by the action of endonuclease are usually repaired by certain mechanisms of homologous recombination or non-homologous end joining (NHEJ). However, NHEJ is an imperfect repair process that often results in changes in the DNA sequence at the cleavage site. Mechanisms include rejoining what remains of the two DNA ends by direct religation (Critchlow and Jackson 1998) or by so-called microhomology-mediated end joining (Betts, Brenchley et al. 2003; Ma, Kim et al. 2003). Nonhomologous end joining (NHEJ) repair often results in small insertions or deletions and can be used to create knockouts of specific genes. The modification may be a substitution, deletion or addition of at least one nucleotide. Cells that have experienced a cleavage mutagenesis event, that is, a mutagenesis event due to an NHEJ event, can be identified and/or selected by methods well known in the art. In particular embodiments, a CRISPR nucleotide-editing protein that does not introduce DNA breaks (eg, DNA double-strand breaks) is used. In specific embodiments, the nucleotide-editing protein is a modified Cas protein that catalyzes transitions and conversions from one nucleotide to another (eg, A to T, C to G, and so on) without introducing (initial or otherwise) a DNA double-strand break. In specific embodiments, the nucleotide editing protein comprises an adenosine deaminase fused to a catalytically inactive CRISPR-Cas mutant (such as a CRISPR-Cas9 mutant). In specific embodiments, the nucleotide editing protein comprises a Cas9 nuclease having a mutation that converts it to a nickase (nCas9) fused to an apolipoprotein B editing complex (APOBEC) (e.g., cytidine deaminase with rat APOBEC1 or human APOBEC3A (A3A)) and the inhibitor uracil -glycosylase (UGI). In specific embodiments, the nucleotide editing protein is a Cas13 mutant that specifically acts on RNA.

In specific embodiments, a method is provided for reducing cell surface expression of a first allele of an endogenous immunogenicity gene(s) in a kidney cell, comprising contacting the kidney cell with a first allele-specific gRNA molecule and a Cas9 molecule, wherein the allele-specific gRNA molecule and the Cas9 molecule bind to the first allele of the endogenous immunogenicity gene, thereby resulting in decreased cell surface expression of the first allele of the endogenous immunogenicity gene. In specific embodiments, a method is provided for producing a population of modified immunologically compatible kidney cells by contacting the population of kidney cells with a first allele-specific modified gRNA molecule and a Cas9 molecule, wherein the first allele-specific modified gRNA molecule and the Cas9 molecule bind to the first allele of the endogenous responsible immunogenicity of the gene, thus leading to modification of the first allele of the endogenous immunogenicity gene and to the production of a population of immunologically compatible kidney cells. In specific embodiments, the genetically modified kidney cell is less likely to be rejected by the recipient subject due to greater concordance between donor and recipient cells and reduced immunogenicity, as determined by a mixed culture lymphocyte, or leukocyte, reaction assay. In specific embodiments, the methods described herein can be used to alter the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more alleles using one or more allele-specific gRNA molecules and Cas9 molecules. In certain embodiments, altering alleles using the methods described herein may result in inactivation of the altered allele. In specific embodiments, the method may further include contacting a cell, or population of cells, with a second Cas9 molecule.

In specific embodiments, an ex vivo method is provided for producing a composition comprising a population of cells enriched for modification of a specific gene by contacting the population of cells with at least one target-specific gRNA molecule and a Cas9 molecule, wherein the target-specific gRNA molecule and the Cas9 molecule bind to a gene encoding a detectable gene product; and enrichment for cells lacking expression of a detectable gene product. In specific embodiments, the step of enriching for cells that express the gene product in the methods described herein may include cell sorting using, for example, FACS or MACS. In specific embodiments, the ex vivo method comprises enriching for a population of cells having an allele-specific gene modification, wherein the allele-specific gRNA molecule and the Cas9 molecule bind to one allele of a gene encoding a detectable gene product; and enrichment for cells that express a detectable gene product but do not express the first allele. In specific embodiments, the step of enriching for cells that express the gene but not the first allele may include contacting each of the plurality of cells with a first antibody that specifically binds to a first variant of a detectable gene product encoded by the first allele of the gene and to a second an antibody that binds to a second variant of the detectable gene product. In specific embodiments, the step of enriching for cells that express the gene but not the first allele may involve detecting, in each cell of the cell population, a substance or signal associated with a functional variant of the detectable gene product. The population of cells may be a population of bioactive kidney cells.

The methods described herein may optionally also include selecting a cell expressing a particular allele of a gene by sorting a population of cells using an allele-specific antibody. In specific embodiments, the population of cells can be sorted by fluorescence-activated cell sorting (FACS) or immunomagnetic microbead cell sorting. In specific embodiments, the method further includes sequencing the cell to confirm the modification.

In certain embodiments, the gene may be an immunogenicity gene. In certain embodiments, the detectable gene product may be a cell surface marker. In specific embodiments, the detectable gene product may be a human leukocyte antigen (HLA). In specific embodiments, the detectable gene product may be a major histocompatibility complex antigenic protein or a minor histocompatibility antigen (MiHA or mHA) (eg, a chemokine receptor).

Non-limiting examples of mHA include:

Examples of mHA Chromosome HA-1 19 HA-2 6 HA-8 9 HB-1 5 HY-A1 Y HY-A2 Y HY-B7 Y HY-B8 Y HY-B60 Y HY-DQ5 Y

Although any genetic polymorphism can give rise to minor histoincompatibility, the number of genes encoding minor antigens is limited. Approximately 10 minor antigens located on autosomal chromosomes have been identified among the existing hundred or so. The Y chromosome also carries some genes encoding mHA. The first minor histocompatibility peptide identified was HA-2, an mHA associated with graft-versus-host disease. The most studied of all mHAs are HY antigens. In specific embodiments, the gRNA molecule may comprise a targeting domain that is complementary to a target domain in the mHA gene. In specific embodiments, the gRNA molecule may contain a targeting domain that is complementary to the target domain in the HA-1, HA-2, HA-8, HB-1, HY-A1, HY-A2, HY-B7, HY-B8, HY-B60 or HY-DQ5.

In specific embodiments, the gRNA molecule may comprise a targeting domain that is complementary to a target domain in the HLA gene. The HLA gene may be selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DRB3/4/5, an HLA-DQ family gene (eg, HLA-DQA1 and/or HLA- DQB1) and the HLA-DP family gene (for example, HLA-DPA1 and/or HLA-DPA2).

In specific embodiments, the cell, or population of cells, may be a primary kidney cell, or a population of selected kidney cells. In specific embodiments, the population of cells may be a heterogeneous population of cells or a homogeneous population of cells.

In specific embodiments, to confirm that one or more target HLA alleles have been inactivated by CRISPR/Cas9 activity, pre- and post-targeting donor cells can be analyzed for changes in allele sequence(s) or allele(s) expression using conventional methods (eg, one or more of allele-specific PCR, qRT-PCR or flow cytometry). In specific embodiments, donor cells, whether or not genome edited, can be cocultured with NK cells, and cytolytic activity directed against the donor cells is quantified to determine downregulation of HLA expression. After validation, cells having one or more mismatched donor HLA alleles inactivated and/or introduced one or more matched recipient HLA alleles can be enriched, isolated, or purified from unmodified cells by conventional sorting methods.

Cellular aggregates

In one aspect, the preparations of the present invention contain cellular aggregates or spheroids. In specific embodiments, the cellular aggregate contains a population of bioactive cells described herein. In specific embodiments, the cell aggregate comprises bioactive kidney cells, such as, for example, mixtures of kidney cells, enriched populations of kidney cells, as well as combinations of kidney cell fractions and mixtures of kidney cells with mesenchymal stem cells, endothelial cell progenitors, stromal vascular-derived cells adipose tissue fraction, or any other non-renal cell population, without limitation.

In specific embodiments, the bioactive kidney cells of the invention can be cultured in 3D formats, as described later herein. In specific embodiments, the term “organoid” means a mass of cells with a phenotype and/or function that recapitulates aspects of the natural kidney. In specific embodiments, the organoids contain mixed populations of cells from different lineages that typically occurin vivo in a certain tissue. In specific embodiments, the organelles of the present invention are formedin vitro, any means by which the cells of the invention form aggregates, which in turn can form spheroids, organoids, or a combination thereof. In some embodiments, such aggregates, spheroids or organoids adopt a structure corresponding to a specific organ. In specific embodiments, such aggregates, spheroids, or organoids express surface markers that are typically expressed by cells of a particular organ. In specific embodiments, such aggregates, spheroids, or organelles produce compounds or materials that are typically expressed by cells of a particular organ. In specific embodiments, cells of the invention can be cultured on natural substrates, e.g. gelatin. In specific embodiments, cells of the invention can be cultured on synthetic substrates, e.g. P.L.G.A.

Biological materials

Various biological materials can be combined with the active agent to obtain therapeutic drugs of the present invention. In specific embodiments, the biological materials may have any suitable form (eg, granules) or consistency (eg, liquid, gel, etc.). Suitable biological materials in the form of polymer matrices are described in Bertram et al. , US Patent Application Published No. 20070276507 (the entire contents of which are incorporated herein by reference). In specific embodiments, the polymer matrices or scaffolds can be formed into a variety of desired configurations to meet any number of general system, geometric, or spatial constraints. In specific embodiments, the biological material is in the form of a liquid suspension. In specific embodiments, the matrices or scaffolds of the present invention may be three-dimensional and shaped to conform to the size and shape of the organ or tissue structure. For example, when using a polymer scaffold to treat kidney disease, tubular transport disorder, or glomerular filtration disorder, a three-dimensional (3-D) matrix may be used that reproduces individual aspects, or the entire structure and organization, of natural kidney tissue as well as renal parenchyma.

A variety of different shaped 3-D frames can be used. Naturally, the polymer matrix can come in different sizes and shapes to suit different sized patients. The polymer matrix can also be formed in other ways to meet the specific needs of patients. In certain embodiments, the polymer matrix or scaffold may be a biocompatible material (eg, a porous polymer scaffold). Scaffolds can be formed from a variety of synthetic or natural materials, including, but not limited to, open cell polylactic acid ( ^OPLA® ), cellulose ether, cellulose, cellulose ester, fluorinated polyethylene, phenolic polymer, poly-4-methylpentene, polyacrylonitrile, polyamide, polyamidimide, polyacrylate, polybenzoxazole, polycarbonate, polycyanoaryl ether, polyester, polyether carbonate, polyether, polyetheretherketone, polyetherimide, polyetherketone, polyethersulfone, polyethylene, polyfluoroolefin, polyimide, polyolefin, polyoxadiazole, polyphenylene oxide, polyphenylene sulfide, polypropylene, polystyrene, poly sulfide, polysulfone, polytetrafluoroethylene , polythioether, polytriazole, polyurethane, polyvinyl, polyvinylidene fluoride, regenerated cellulose, silicone, urea-formaldehyde, collagens, gelatin, alginate, laminins, fibronectin, silk, elastin, alginate, hyaluronic acid, agarose, or their copolymers or physical mixtures. Frame configurations can range from soft porous frames to rigid, shape-retaining porous frames. In specific embodiments, the scaffold is configured as a liquid solution capable of becoming a hydrogel, for example, a hydrogel to a melting point.

In specific embodiments, the scaffold is obtained from a living kidney or other organ of a human or animal, wherein the natural population of cells is eliminated through the use of detergent and/or other chemicals and/or other enzymatic and/or physical methods known to those skilled in the art. In this embodiment, the natural three-dimensional structure of the original organ is preserved, along with all associated extracellular matrix components, in their natural, bioactive context. In specific embodiments, the scaffold is an extracellular matrix derived from a kidney or other organ of a human or animal. In specific embodiments, the configuration is assembled into a tissue-like structure using 3D bioprinting techniques. In specific embodiments, the configuration is a solution in liquid form that is capable of being converted into a hydrogel.

In specific embodiments, the biological material is a hydrogel. Hydrogels can be formed from various polymeric materials and have various biological applications. Hydrogels can be described physically as three-dimensional networks of hydrophilic polymers. Depending on the type, hydrogels have different percentages of water, but are generally insoluble in water. Despite their high water content, hydrogels are also capable of binding large volumes of liquid due to the presence of hydrophilic residues. Hydrogels swell intensely without changing their gel-like structure. The basic physical attributes of a hydrogel can be specifically modified, depending on the properties of the polymers and the device used to administer the hydrogel.

The hydrogel material preferably does not induce an inflammatory response. Examples of other materials that can be used to formulate a hydrogel include (a) modified alginates, (b) polysaccharides (eg, gellan gum and carrageenans) that form a gel when exposed to monovalent cations, (c) polysaccharides (eg, hyaluronic acid), which are highly viscous liquids or are thixotropic and form a gel over time through slow evolution of structure, (d) gelatin or collagen, and (e) polymeric hydrogel precursors (eg, polyethylene oxide-polypropylene glycol block copolymers and proteins). US Pat. No. 6,224,893 B1 provides a detailed description of various polymers and the chemical properties of such polymers that are suitable for preparing the hydrogels of the present invention.

In a specific embodiment, the hydrogel used to formulate the biological materials of the present invention is gelatin. Gelatin is a non-toxic, biodegradable and water-soluble protein derived from collagen, which is a major component of the extracellular matrix of mesenchymal tissue (ECM). Collagen is the main structural protein in the extracellular space of various connective tissues in animal bodies. As a major component of connective tissue, it is the most abundant protein in mammals, accounting for 25% to 35% of total body protein content. Depending on the degree of mineralization, collagen tissues can be hard (bone), elastic (tendon), or range from hard to elastic (cartilage). Collagen, in the form of elongated fibers, is predominantly found in fibrous tissues such as tendons, ligaments and skin. It is also abundant in the cornea, cartilage, bones, blood vessels, digestive tract, intervertebral discs and dental dentin. In muscle tissue it is the main component of endomysium. Collagen makes up one to two percent of muscle tissue, and accounts for 6% of the weight of strong tendon muscles. Collagen is found in many areas throughout the body. However, more than 90% of collagen in the human body is type I.

To date, 28 types of collagen have been discovered and described. They can be divided into several groups depending on the structure they form: fibrillar (types I, II, III, V, XI). Non-fibrillar FACIT (fiber-associated collagens with interrupted triple helices) (types IX, XII, XIV, XVI, XIX). Short-chain (type VIII, X). Basement membrane (type IV). Multiplexin (multiple interrupted three-helix domains) (types XV, XVIII). MACIT (membrane-associated collagens with interrupted triple helices) (types XIII, XVII). Others (types VI, VII). The five most common types are: Type I: skin, tendons, vascular connections, organs, bones (the main component of the organic part of bones). Type II: cartilage (the main collagen component of cartilage). Type III: Reticulin (main component of reticulin fibers), usually found together with Type I. Type IV: Forms the basal lamina, the epithelial-secreting layer of the basement membrane. Type V: Cell surfaces, hair and placenta.

Gelatin preserves information signals, including the arginine-glycine-aspartic acid (RGD) sequence, which stimulates cell adhesion, proliferation and differentiation of stem cells. A characteristic property of gelatin is that it exhibits a dependence on the upper critical solution temperature (UCST). Above a certain temperature threshold of 40°C, gelatin can dissolve in water, forming flexible, random single spirals. Upon cooling, hydrogen bonds and van der Waals interactions arise, leading to the formation of triple helices. These collagen-like triple helices act as junction zones, thus initiating the sol-to-gel transition. Gelatin is widely used for pharmaceutical and medical purposes.

In specific embodiments, the hydrogel used to formulate the injectable cell compositions of the present invention is based on porcine gelatin, which can be derived from pork skin and is commercially available, for example, from Nitta Gelatin NA Inc. (NC, USA) or Gelita USA Inc. (IA, USA). Gelatin can be dissolved, for example, in Dulbecco's phosphate-buffered saline (DPBS), creating a temperature-sensitive hydrogel that can gel and liquefy at different temperatures. In specific embodiments, the hydrogel used to formulate the injectable cell compositions of the present invention is based on recombinant human or animal gelatin expressed and purified by methods known to those skilled in the art. In specific embodiments, an expression vector containing all or part of the cDNA for human collagen type I, alpha-1 is expressed in the yeast Pichia pastoris . Other expression vector systems and organisms are known to those skilled in the art. In a specific embodiment, the gelatin hydrogel of the present invention is liquid at room temperature (22-28°C) and above, and forms a gel when cooled to refrigeration temperature (2-8°C).

Those skilled in the art will understand that other types of synthetic or natural materials known in the art can be used to form the scaffolds described herein.

In specific embodiments, the biological material used in the present invention consists of hyaluronic acid (HA) in the form of a hydrogel containing HA molecules ranging in size from 5.1 kDa to >2 x 10 ⁵ kDa. HA can stimulate branching morphogenesis and three-dimensional self-organization of associated populations of bioactive cells. In specific embodiments, the biological material used in the present invention consists of hyaluronic acid in the form of a poroplast also containing HA molecules ranging in size from 5.1 kDa to >2 x 10 ⁵ kDa. In specific embodiments, the hydrogel is derived from, or contains extracellular matrix from, without limitation, a kidney, or any other tissue or organ. In another embodiment, the biological material used in the present invention consists of a polylactic acid (PLA) foam having an open cell structure and a pore size of from about 50 microns to about 300 microns.

Thermosensitive biological materials

The biological materials described herein may also be designed, or adapted, to respond to specific environmental conditions, for example, in vitro or in vivo . In certain embodiments, the biological materials are heat sensitive (eg, either in vitro or in vivo ). In specific embodiments, the biological materials are adapted to react to enzymatic degradation (eg, either in vitro or in vivo ). Biological materials that respond to environmental conditions can be precisely tuned as described herein. The temperature sensitivity of the described preparation can be varied by changing the percentage of biological material in the preparation. For example, the percentage of gelatin in the solution can be adjusted to modulate the temperature sensitivity of the gelatin in the final preparation (eg, liquid, gel, granules, etc.). Alternatively, biological materials can be chemically cross-linked to provide greater resistance to enzymatic degradation. For example, the crosslinking reagent carbodiimide can be used to chemically crosslink gelatin granules, thereby reducing sensitivity to endogenous enzymes.

In one aspect, the formulations described herein include biological materials having properties that provide a favorable environment for an active agent, such as bioactive kidney cells, to be administered to a subject. In specific embodiments, the formulation comprises a first biological material that provides a favorable environment from the time the active agent is formulated with the biological material until the time the formulation is administered to the subject. In specific embodiments, a favorable environment means that there is an advantage of having the bioactive cells suspended in a substantially solid medium, as opposed to the cells in a liquid (as described herein), prior to administration to a subject. In specific embodiments, the first biological material is a thermosensitive biological material. The temperature-sensitive biological material may be in (i) a substantially solid state at or below about 8° C., and (ii) a substantially liquid state at or above ambient temperature. In certain embodiments, the ambient temperature is approximately room temperature.

In specific embodiments, the biological material is a temperature-sensitive biological material that can maintain at least two different phases, or states, depending on temperature. The biological material is capable of maintaining a first state at a first temperature, a second state at a second temperature, and/or a third state at a third temperature. The first, second and third states may be substantially solid, substantially liquid, or substantially semi-solid or semi-liquid. In specific embodiments, the biological material has a first state at a first temperature and a second state at a second temperature, wherein the first temperature is lower than the second temperature.

In specific embodiments, the state of the thermosensitive biological material is a substantially solid state at a temperature of about 8°C, or lower. In specific embodiments, the substantially solid state is maintained at a temperature of about 1°C, about 2°C, about 3°C, about 4°C, about 5°C, about 6°C, about 7°C, or about 8°C. In certain embodiments, the substantially solid state is in the form of a gel. In certain embodiments, the state of the thermosensitive biological material is a substantially liquid state at or above ambient temperature. In specific embodiments, the substantially liquid state is maintained at a temperature of about 25°C, about 25.5°C, about 26°C, about 26.5°C, about 27°C, about 27.5°C, about 28°C , approximately 28.5°C, approximately 29°C, approximately 29.5°C, approximately 30°C, approximately 31°C, approximately 32°C, approximately 33°C, approximately 34°C, approximately 35°C, approximately 36°C or approximately 37°C. In certain embodiments, the ambient temperature is approximately room temperature.

In certain embodiments, the state of the thermosensitive biological material is a substantially solid state at a temperature at or below ambient temperature. In certain embodiments, the ambient temperature is approximately room temperature. In specific embodiments, the substantially solid state is maintained at a temperature of about 17°C, about 16°C, about 15°C, about 14°C, about 13°C, about 12°C, about 11°C, about 10°C, about 9°C, about 8°C, about 7°C, about 6°C, about 5°C, about 4°C, about 3°C, about 2°C, or about 1°C. In certain embodiments, the substantially solid state is in the form of a granule. In specific embodiments, the state of the thermosensitive biological material is a substantially liquid state at a temperature of about 37°C or higher. In particular embodiments, the substantially solid state is maintained at a temperature of about 37°C, about 38°C, about 39°C, or about 40°C.

Thermosensitive biological materials may be provided in solution form, solid form, granule form, or other suitable forms described herein and/or known to those skilled in the art. The cell populations and formulations described herein can be coated, coated on, immersed in, attached to, seeded, suspended in, or embedded in a thermosensitive biological material. In specific embodiments, the populations of cells described herein may be organized into three-dimensional cellular aggregates or organelles, or three-dimensional tubular structures, prior to complexation with a temperature-sensitive biological material, or may be organized as indicated upon formation of a complex with a temperature-sensitive biological material. material. Alternatively, the thermosensitive biological material may be provided without any cells, for example in the form of release beads. In this embodiment, the thermosensitive biological material plays a completely passive role, creating space within the target organ for regenerative biological activity to occur, such as angiogenesis or infiltration and migration of host cell populations.

In specific embodiments, the thermosensitive biological material has a transition state between a first state and a second state. In specific embodiments, the transition state is a solid-to-liquid transition state over a temperature range of about 8°C to about ambient temperature. In certain embodiments, the ambient temperature is approximately room temperature. In specific embodiments, the solid-to-liquid transition occurs at one or more temperatures of about 8°C, about 9°C, about 10°C, about 11°C, about 12°C, about 13°C, about 14°C, about 15°C, about 16°C, about 17°C and about 18°C.

Thermosensitive biological materials have a specific viscosity at a specific temperature, measured in centipoise (cP). In specific embodiments, the biological material has a viscosity at 25°C of about 1 cP to about 5 cP, about 1.1 cP to about 4.5 cP, about 1.2 cP to about 4 cP, about 1 .3 cP to about 3.5 cP, about 1.4 cP to about 3.5 cP, about 1.5 cP to about 3 cP, about 1.55 cP to about 2.5 cP, or about 1 .6 cP to about 2 cP. In specific embodiments, the biological material has a viscosity at 37°C of from about 1.0 cP to about 1.15 cP. Viscosity at 37°C may be about 1.0 cP, about 1.01 cP, about 1.02 cP, about 1.03 cP, about 1.04 cP, about 1.05 cP, about 1.06 cP, about 1.07 cP, about 1.08 cP, about 1.09 cP, about 1.10 cP, about 1.11 cP, about 1.12 cP, about 1.13 cP, about 1.14 cP or about 1. 15 cP. In specific embodiments, the biological material is a gelatin solution. Gelatin is present in the solution at a concentration of about 0.5%, about 0.55%, about 0.6%, about 0.65%, about 0.7%, about 0.75%, about 0.8%, about 0 .85%, about 0.9%, about 0.95%, or about 1% (w/v). In one example, the biological material is a 0.75% (w/v) solution of gelatin in PBS. In specific embodiments, the 0.75% (w/v) solution has a viscosity at 25°C of about 1.6 cP to about 2 cP. In specific embodiments, the 0.75% (w/v) solution has a viscosity at 37°C of about 1.07 cP to about 1.08 cP. The gelatin solution can be prepared in PBS, DMEM or other suitable solvent.

In one aspect, the formulation contains bioactive cells in combination with a second biological material that provides a favorable environment for the cells associated therewith from the time of formulation until after administration to the subject. In specific embodiments, the favorable environment provided by the second biological material means having the advantage of introducing cells into the biological material that maintains structural integrity up to the time of administration to the subject and for a period of time after administration. In certain embodiments, the structural integrity of the second biological material is maintained for several minutes, hours, days, or weeks after implantation. In specific embodiments, structural integrity is maintained for less than one month, less than one week, less than one day, or less than one hour. Within a short period of time, structural integrity allows for a formulation that is capable of delivering the active agent and biological material to the target site in the tissue or organ, with controlled processing, placement or dispersion, without impeding or interfering with the interaction of the included elements with the tissue or organ in which he was placed.

In specific embodiments, the second biological material is a thermosensitive biological material that has a different sensitivity than the first biological material. The second biological material may be (i) a substantially solid state at or below ambient temperature, and (ii) a substantially liquid state at or above about 37°C. In certain embodiments, the ambient temperature is approximately room temperature.

In specific embodiments, the second biological material is cross-linked beads. The cross-linked beads can have a finely tuned in vivo residence time depending on the degree of cross-linking, as described herein. In specific embodiments, the cross-linked beads contain bioactive cells and are resistant to enzymatic degradation as described herein. The formulations of the present invention may include a first biological material in combination with an active agent, such as bioactive cells, with or without the addition of a second biological material in combination with an active agent, such as bioactive cells. If the formulation includes a second biological material, it may be heat-sensitive beads and/or cross-linked beads.

In one aspect, the present invention relates to preparations containing biological materials that disintegrate over a period of time on the order of minutes, hours or days. This is in contrast to a lot of work that focuses on implanting solid materials that then slowly disintegrate over days, weeks or months. In specific embodiments, the biological material has one or more of the following characteristics: biocompatibility, biodegradability/bioabsorbability, a substantially solid state before and during implantation into a subject, loss of structural integrity (substantially solid state) after implantation, and a cell-compatible environment for maintaining cell viability and proliferation. The ability of a biological material to hold implanted particles at a distance during implantation stimulates the ingrowth of natural tissue. Biological material also facilitates the implantation of solid drugs. The biological material provides localization of the drug described herein, since the introduction of the solid element helps prevent the delivery materials from dispersing into the tissue during implantation. In the case of cell preparations, solid biological material also helps to increase the stability and viability of adherent cells, compared to cells suspended in liquid. However, the short duration of structural integrity means that shortly after implantation, the biological material no longer poses a significant barrier to tissue ingrowth or integration of the delivered cells/materials with host tissue.

In one aspect, the present invention relates to formulations that contain biological materials that are implanted in substantially solid form and then liquefy/melt or otherwise lose structural integrity upon implantation into the body. This is in contrast to much of the work that has been done using materials that can be injected as liquids that subsequently solidify in the body.

Biocompatible granules

In one other aspect, the formulation includes a thermosensitive biological material described herein and a population of biocompatible beads containing the biological material. In specific embodiments, the granules are cross-linked. Crosslinking can be accomplished using any suitable crosslinking agent known to those skilled in the art, such as, for example, carbodiimides; aldehydes (e.g. furfural, acrolein, formaldehyde, glutaraldehyde, glyceryl aldehyde), succinimide crosslinkers (bis(sulfosuccinimidyl)suberate (BS3), disuccinimidyl glutarate (DSG), disuccinimidyl suberate (DSS), dithiobis(succinimidyl propionate), ethylene glycol bis( sulfosuccinimidyl succinate), ethylene glycol bis(succinimidyl succinate) (EGS), bis(sulfosuccinimidyl) glutarate (BS2G), disuccinimidyl tartrate (DST)); epoxides (ethylene glycol diglycidal ether, 1,4-butanediol diglycidal ether); saccharides (glucose and aldose sugars); sulfonic acids and p-toluenesulfonic acid; carbonyldiimidazole; genipin; imines; ketones; diphenylphosphoryl azide (DDPA); terephthaloyl chloride; cerium(III) nitrate hexahydrate; microbial transglutaminase and hydrogen peroxide. Other suitable crosslinking agents and crosslinking methods for use in the present invention are known to those skilled in the art.

In specific embodiments, the beads are carbodiimide cross-linked beads. Carbodiimide cross-linked beads can be cross-linked using a carbodiimide selected from the group consisting of 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC), DCC - N,N'-dicyclohexylcarbodiimide (DCC) and N,N'- diisopropylcarbodiimide (DIPC). It is believed that beads treated with lower concentrations of EDC will have more free primary amines, while samples treated with higher concentrations of crosslinker will have the majority of primary amines involved in amide bonds. The intensity of the orange color developed by covalent binding between the primary amine and picrolesulfonic acid, which can be determined spectrophotometrically at 335 nm, is proportional to the amount of primary amine present in the sample. When normalized per milligram of protein present in the sample, an inverse correlation can be observed between the amount of free amines present and the initial concentration of EDC used for cross-linking. This result indicates differential cross-linking of the granules due to the amount of carbodiimide used in the reaction. Typically, cross-linked granules contain fewer free primary amines compared to non-cross-linked granules.

Crosslinked beads are less susceptible to enzymatic degradation than non-crosslinked biocompatible beads, allowing the beads to be finely tuned for in vivo life. For example, cross-linked granules are resistant to endogenous enzymes such as collagenases. The use of cross-linked beads is part of a delivery system that facilitates one or more of: (a) delivering adherent cells to desired sites and creating space for regeneration and ingrowth of natural tissue and vasculature; (b) the ability to exist in the desired site long enough for the cells to adapt, function, remodel their microenvironment, and secrete their natural extracellular matrix (ECM); (c) stimulating the integration of transplanted cells with surrounding tissue; (d) the ability to implant cells in a substantially solid form; (e) transient structural integrity that does not significantly impede tissue ingrowth, de novo angiogenesis, or integration of the delivered cells/materials with host tissue; (f) localized in vivo delivery in a substantially solid form, which prevents cells from dispersing into tissue during implantation; (g) increased stability and viability of adherent cells compared to cells suspended in liquid; (h) a biphasic release profile when delivering cells 1) in substantially solid form (eg, attached to beads), and 2) in substantially liquid form (eg, suspended in liquid); i) recreating and simulating the three-dimensional biological niche or kidney parenchyma from which these bioactive cell populations were derived.

In specific embodiments, the present invention relates to cross-linked granules containing gelatin. Non-crosslinked gelatin beads are not suitable for bioactive cell preparation because they quickly lose their integrity and the cells disperse from the injection site. In contrast, highly cross-linked gelatin granules can survive quite long at the injection site and may interfere with de-novo ECM secretion, cell integration, angiogenesis, and tissue regeneration. The present invention makes it possible to precisely control the in vivo lifetime of cross-linked beads. To precisely control the biodegradability of biological materials, different concentrations of carbodiimide are used during cross-linking, while the general reaction conditions are kept constant for all samples. For example, the enzyme sensitivity of carbodiimide cross-linked beads can be finely tuned by varying the concentration of the cross-linking agent from about zero to about 1 M. In particular embodiments, the concentration is about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM , about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 26 mM, about 27 mM, about 28 mM, about 29 mM, about 30 mM, about 31 mM, about 32 mM, about 33 mM, about 34 mM, about 35 mM, about 36 mM, about 37 mM, about 38 mM, about 39 mM, about 40 mM, about 41 mM, about 42 mM, about 43 mM, about 44 mM, about 45 mM, about 46 mM , about 47 mM, about 48 mM, about 49 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM or approximately 100 mM. The crosslinker concentration may also be about 0.15 M, about 0.2 M, about 0.25 M, about 0.3 M, about 0.35 M, about 0.4 M, about 0.45 M, about 0 .5 M, approximately 0.55 M, approximately 0.6 M, approximately 0.65 M, approximately 0.7 M, approximately 0.75 M, approximately 0.8 M, approximately 0.85 M, approximately 0.9 M, about 0.95 M or about 1 M. In specific embodiments, the crosslinking agent is 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC). In specific embodiments, the cross-linked EDC beads are gelatin beads. Degradation (%) of the granules can be finely adjusted depending on the crosslinker concentration. In certain embodiments, gelatin beads may be mixed with non-gelatin beads or microparticles (eg, but not limited to, alginate or HA) to further enhance the effectiveness of the delivered bioactive cell population.

The cross-linked beads may have certain characteristics that are favorable for seeding, attaching or encapsulating populations of bioactive cells. For example, the granules may have a porous surface and/or may be substantially hollow. The presence of pores provides a larger surface area for cell attachment, making it possible for more cells to attach than would be the case with a nonporous or smooth surface. In addition, the porous structure may promote integration of host tissue with porous granules, facilitating de novo tissue formation. The granules have a size distribution that can be fitted to a Weibull plot corresponding to the general particle distribution pattern. In specific embodiments, the cross-linked beads have an average diameter of less than about 120 microns, about 115 microns, about 110 microns, about 109 microns, about 108 microns, about 107 microns, about 106 microns, about 105 microns, about 104 microns, about 103 microns, about 102 µm, about 101 µm, about 100 µm, about 99 µm, about 98 µm, about 97 µm, about 96 µm, about 95 µm, about 94 µm, about 93 µm, about 92 µm, about 91 µm or about 90 µm. The characteristics of cross-linked pellets vary depending on the manufacturing method. For example, to produce granules having the above characteristics, a method is used in which a stream of air is used to aerosolize a liquid gelatin solution and spray it into liquid nitrogen using a thin layer chromatography reagent nebulizer (ACE Glassware). Those skilled in the art understand that varying the parameters of the manufacturing method makes it possible to fine-tune various characteristics of the granules, such as changing the particle size distribution. In certain embodiments, the microtopography, surface and internal characteristics of the granules can be further modified to facilitate cell attachment.

The cell compatibility of cross-linked beads is assessed in vitro prior to drug formulation using cell culture methods in which the beads are cultured with cells corresponding to the final bioactive cell preparation. For example, beads are cultured with primary kidney cells prior to making a bioactive kidney cell preparation, using live/dead cell assays to confirm cell compatibility. In addition to cell viability, certain functional assays to determine cellular metabolic activity, secretion of specific key cytokines, growth factors and exosomes, and expression of specific key protein and nucleotide markers, including microRNAs associated with functional populations of bioactive kidney cells, are well known to those skilled in the art. and can be additionally used to confirm the activity of cells in a preparation with cross-linked granules.

In some formulations, biocompatible cross-linked beads are combined with a thermosensitive biological material in a solution at a concentration of from about 5% (w/w) to about 15% (w/w) by volume of the solution. Crosslinked granules may be present at a concentration of about 5% (w/w), about 5.5% (w/w), about 6% (w/w), about 6.5% (w/w), about 7% ( w/w), about 7.5% (w/w), about 8% (w/w), about 8.5% (w/w), about 9% (w/w), about 9.5% (wt/wt), about 10% (wt/wt), about 10.5% (wt/wt), about 11% (wt/wt), about 11.5% (wt/wt), about 12% ( w/w), about 12.5% (w/w), about 13% (w/w), about 13.5% (w/w), about 14% (w/w), about 14.5% (wt/wt) or approximately 15% (wt/wt) of the solution volume.

In one aspect, the present invention relates to formulations containing biological materials that disintegrate over a period of time on the order of minutes, hours or days. This is in contrast to a lot of work that focuses on implanting solid materials that then slowly disintegrate over days, weeks or months.

In one aspect, the present invention relates to formulations containing biocompatible cross-linked beads seeded with bioactive cells together with a delivery matrix. In specific embodiments, the delivery matrix has one or more of the following characteristics: biocompatibility, biodegradability/bioabsorbability, a substantially solid state before and during implantation into a subject, loss of structural integrity (substantially solid state) after implantation, and a cell-compatible environment for maintaining cell viability. The ability of the delivery matrix to keep implanted particles (eg, cross-linked beads) spatially separated during implantation stimulates natural tissue ingrowth. In the absence of a delivery matrix, compaction of cell-seeded beads during implantation may result in insufficient space for sufficient tissue ingrowth. The delivery matrix facilitates the implantation of solid drugs. In addition, the short duration of structural integrity means that shortly after implantation, the matrix no longer poses a significant barrier to tissue ingrowth, de novo angiogenesis, or integration of delivered cells/materials with host tissue. The delivery matrix provides localization of the drug described herein, since the introduction of the solid element helps prevent the delivery materials from dispersing into the tissue during implantation. In specific embodiments, use of the delivery matrix described herein helps prevent rapid urinary loss of implanted cells after delivery to the renal parenchyma. For cell-based formulations, a solid delivery matrix enhances the stability and viability of adherent cells compared to cells suspended in liquid.

In specific embodiments, the delivery matrix is a population of biocompatible beads that are not seeded with cells. In certain embodiments, the unseeded granules are dispersed throughout, and between individual seeded granules. Unseeded granules act as "separation granules" between seeded granules before and immediately after transplantation. The release beads contain a temperature-sensitive biological material that is in a substantially solid state at a first temperature and in a substantially liquid state at a second temperature, wherein the first temperature is lower than the second temperature. For example, release beads contain biological material that is in a substantially solid state at or below ambient temperature, and in a substantially liquid state at about 37°C, as described herein. In certain embodiments, the ambient temperature is approximately room temperature. In specific embodiments, the biological material is a gelatin solution. The gelatin solution is used at a concentration of about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, about 10%, about 10.5%, or about 11% (w/v). The gelatin solution can be prepared in PBS, cell culture medium (eg DMEM) or other suitable solvent. In specific embodiments, the biological material is hyaluronic acid. In specific embodiments, the biological material is a cell-free extracellular matrix from a human or animal kidney that can be further reconstituted as a hydrogel.

In one aspect, the present invention relates to formulations that contain biological materials that are implanted in substantially solid form (eg, release beads) and then liquefy/melt or otherwise lose structural integrity once implanted into the body. This is in contrast to much of the work that has been done using materials that can be injected as liquids that subsequently solidify in the body.

The temperature sensitivity of release granules can be assessed in vitro prior to formulation. Release beads can be labeled and mixed with unlabeled non-heat sensitive beads. The mixture is then incubated at 37°C to observe changes in the physical transition between states. Loss of shape of heat-sensitive granules at higher temperatures is observed over time. For example, heat-sensitive gelatin beads can be made with the dye alcian blue, which serves as a marker of physical transition between states. Blue gelatin beads are mixed with cross-linked beads (white), placed in a catheter, then extruded and incubated in 1X PBS, pH 7.4, at 37°C. The loss of shape of the blue gelatin granules is observed under a microscope at different points in time. Changes in the physical state of the blue gelatin granules become noticeable after 30 minutes, becoming more pronounced with increasing incubation time. The granules do not disappear completely due to the viscosity of the material.

Modified release drugs

In one aspect, the formulations of the present invention are provided as modified release formulations. Typically, modified release is characterized by an initial release of a first active agent upon administration, followed by at least one additional release of a second active agent. The first and second active agents may be the same, or they may be different. In certain embodiments, the formulations provide modified release due to the presence of multiple components in the same formulation. In specific embodiments, the modified release formulation contains the active agent as part of a first component that allows the active agent to freely move throughout the formulation resulting in immediate release at the target site upon administration. The first component may be a thermosensitive biological material having a substantially liquid phase and a substantially solid phase, the first component being in a substantially liquid phase at the time of administration. In certain embodiments, the active agent is in a substantially liquid phase such that it can move substantially freely throughout the formulation and is thus immediately released at the target site upon administration.

In specific embodiments, the modified release formulation contains the active agent as part of a second component, wherein the active agent is attached, applied, coated, embedded, seeded or enclosed in the second component, which is maintained before and after administration to the target site. The second component contains structural elements to which the active agent can bind, which prevents the immediate release of the active agent from the second component at the time of administration. For example, the second component is in substantially solid form, such as biocompatible beads that can be cross-linked to prevent or delay in vivo enzymatic degradation. In certain embodiments, the substantially solid phase active agent maintains its structural integrity in the formulation before and after administration and thus does not immediately release the active agent at the target site upon administration. Suitable carriers for modified release formulations are described herein, but other carriers suitable for use in the present invention will be known to those skilled in the art.

In specific embodiments, the formulation provides an initial rapid delivery/release of delivered elements, including cells, nanoparticles, therapeutic molecules, etc., followed by release of the elements at a later time. In specific embodiments, the formulation provides the initial rapid delivery/release of exosomes, microRNAs, and other bioactive nucleic acid or protein molecules that are soluble and secreted bioactive products from kidney or other cell populations. Other molecules or drugs associated with regenerative biological activity are known to those skilled in the art. The formulations of the present invention can be designed to have a biphasic release profile where the delivered agent is present in both unbound form (eg, cells in solution) and bound form (eg, cells bound to beads or other suitable carrier). After initial administration, the unbound agent is immediately delivered to the delivery site, while the release of the bound agent is delayed until the structural integrity of the carrier (eg, granules) is compromised, at which point the previously bound agent is released. As described below, other suitable release mechanisms are known to those skilled in the art.

The delayed release time can be adjusted depending on the nature of the active agent. For example, the delay time for the release of bioactive cells in the preparation may be on the order of seconds, minutes, hours or days. In certain circumstances, a delay of a few weeks may be appropriate. For other active agents, such as small and large molecules, the delayed release time in the formulation may be on the order of seconds, minutes, hours, days, weeks or months. The drug may also contain different biological materials that provide different delayed release profiles. For example, a first biological material with a first active agent may have a first release time, and a second biological material with a second active agent may have a second release time. The first and second active agents may be the same or different.

As described herein, the period of time for sustained release may generally correspond to the period of time for the biological material to lose structural integrity. However, other sustained release mechanisms are known to those skilled in the art. For example, the active agent can be continuously released over time independent of the decay time of any particular biological material, for example, due to the diffusion of the drug from the polymer matrix. In addition, bioactive cells can migrate from the preparation containing biological material and bioactive cells into natural tissue. In specific embodiments, the bioactive cells migrate from a biological material, such as a granule, into natural tissue. In one embodiment, the bioactive cells migrate from the biological material into natural tissue and induce the secretion of growth factors, cytokines, exosomes, microRNAs, other nucleic acids and proteins associated with regenerative biological activities. In specific embodiments, exosomes and other extracellular vesicles, as well as microRNAs, other bioactive nucleic acids and proteins migrate from the biological material. In another embodiment, bioactive cells migrate from biological material into natural tissue and mediate the mobilization of host stem and progenitor cells, which then migrate, or are directed, to the site of injury or disease.

Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Prolonged absorption of injectable drugs can be achieved by including in the drug an agent that slows down absorption, for example, monostearate salts and gelatin. Many methods for preparing such preparations are patented or well known to those skilled in the art. See, for example, Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. Additional methods for producing controlled or sustained release polypeptide drugs are described, for example, in US Pat. Nos. 6,306,406 and 6,346,274, as well as, for example, US Patent Application Nos. US20020182254 and US20020051808, all of which are incorporated herein by reference.

Bioactive cell preparations

The bioactive cell preparations described herein contain implantable constructs made from the above-described biological materials, including genetically modified bioactive kidney cells described herein, for treating kidney disease in a subject in need thereof. In specific embodiments, the structure is made of a biocompatible material, or biological material, a scaffold or matrix of one or more synthetic or natural biocompatible materials, and one or more populations of cells or mixtures of cells described herein, deposited on, or embedded in, a surface frame by attachment and/or gripping. In specific embodiments, the construct is made of a biological material and one or more populations of cells or mixtures of cells described herein, coated with, applied to, introduced into, attached to, enclosed in, embedded in, seeded with, or combined with the biological component(s). material. Any of the cell populations described herein, including enriched cell populations or mixtures thereof, can be used in combination with the matrix to form the construct. In specific embodiments, the bioactive cell preparation is derived from a biocompatible material, or biological material, and the genetically modified OPC populations described herein.

In specific embodiments, the bioactive cell preparation is an injectable preparation consisting of OPCs genetically modified to reduce immunogenicity and formulated in a biological material (e.g. gelatin hydrogel). In one aspect, allogeneic OPCs are produced by isolating and expanding renal cells from a patient's renal biopsy donor cortical tissue, genetically modifying the OPCs using gene editing techniques, and selecting by density gradient centrifugation from the expanded renal cells. OPCs are composed primarily of renal epithelial cells, which are well known for their regenerative potential (Humphreyset al. (2008) Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell. 2(3):284-91). Both other parenchymal (vascular) and stromal (collecting duct) cells may be present in small numbers in the OPC population. Injection of OPC into the recipient's kidneys resulted in significant improvements in survival rates, urine concentrating and filtration functions in animals in preclinical studies. However, OPCs have a limited shelf life and limited stability. The formulation of OPC in a biological material, which is a gelatin hydrogel, provides increased cell stability, thereby increasing the shelf life of the drug, increasing stability during transportation and delivery to the renal cortex during clinical use.

In one aspect, bioactive cell preparations are produced by first obtaining renal cortical tissue from a donor using a standard clinical kidney biopsy procedure. Kidney cells are isolated from kidney tissue by enzymatic digestion and expanded using standard cell culture techniques. The cell culture medium is designed for the expansion of primary kidney cells and does not contain any differentiation factors. The collected kidney cells are subjected to density gradient separation to obtain OPC. Gene editing techniques to alter the immunogenicity of OPCs can be applied either before or after density gradient separation.

In certain embodiments, the formulated population of cells can move substantially freely throughout the biological material at a temperature at or above ambient temperature. Suspending a population of cells in a substantially solid phase at a lower temperature provides a stability advantage for cells, such as adherent cells, compared to cells in a liquid. Moreover, suspending cells in a substantially solid state provides one or more of the following advantages: i) prevents cell sedimentation, ii) allows cells to remain anchored to the biological material in a suspended state; iii) allows cells to remain more evenly distributed throughout the biological material; iv) prevents the formation of cellular aggregates and v) provides better protection of cells during storage and transportation of the drug. A formulation capable of maintaining such features prior to administration to a subject has at least the advantage that the cells will generally be healthier in the formulation and a more uniform and reproducible dose of cells can be administered.

In a preferred embodiment, the gelatin hydrogel biological material used to formulate the OPC is porcine gelatin dissolved in a buffer to form a thermosensitive hydrogel. This hydrogel is liquid at room temperature, but forms a gel when cooled to refrigeration temperature (2-8°C). The OPC is formulated with a hydrogel, gelled by cooling, and sent to the clinic under refrigerated conditions (2-8°C). At the clinical center, the drug is warmed to room temperature before being injected into the patient's kidney. The bioactive cell preparation is implanted into the renal cortex using a needle and syringe suitable for percutaneous or laparoscopic delivery.

Description and composition of the illustrative composition Neo-Kidney Augment

In specific embodiments, the bioactive cell preparation is a Neo-Kidney Augment (NKA), which is an injectable preparation consisting of autologous, selected kidney cells (AKCs) formulated in a biological material (gelatin hydrogel). In one aspect, autologous OPCs are prepared by isolating and expanding kidney cells from a patient's renal cortical tissue obtained from a kidney biopsy and centrifuging the expanded kidney cells across a boundary, barrier, or interface between phases of different densities. In specific embodiments, autologous OPCs are prepared by isolating and expanding renal cells from a patient's renal cortical tissue obtained from a renal biopsy and centrifuging the expanded renal cells on a continuous or intermittent, single- or multi-stage, density gradient. RPCs are composed primarily of renal tubular epithelial cells, which are well known for their regenerative potential (Humphreys et al. (2008) Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell. 2(3):284-91). Both other parenchymal (vascular) and stromal (collecting duct) cells may be present in small numbers in the autologous OPC population. Injection of OPC into the recipient's kidneys resulted in significant improvements in survival rates, urine concentrating and filtration functions in animals in preclinical studies. However, OPCs have a limited shelf life and limited stability. The formulation of OPC in a biological material, which is a gelatin hydrogel, provides increased cell stability, thereby increasing the shelf life of the drug, increasing the stability of NKA during transportation and delivery of NKA to the renal cortex during clinical use.

In one aspect, NKA is produced by first obtaining renal cortical tissue from a donor/recipient using a standard clinical kidney biopsy procedure. In specific embodiments, kidney cells are isolated from kidney tissue by enzymatic digestion and expanded using standard cell culture techniques. In specific embodiments, the cell culture medium is designed for the expansion of primary kidney cells, and does not contain any differentiation factors. In specific embodiments, the collected kidney cells are subjected to separation across a boundary or interface between phases of different densities, or along a density gradient, to produce OPCs. In specific embodiments, the OPC is genetically modified in accordance with the present invention.

The present invention relates to a preparation derived from biological materials designed or adapted to respond to environmental conditions as described herein. As a result, the nature of the connection between the population of bioactive cells and the biological material in the structure will change depending on external conditions. For example, the association of a population of cells with a temperature-sensitive biological material changes as a function of temperature. In specific embodiments, the construct comprises a population of bioactive kidney cells and biological material that is in a substantially solid state at or below about 8° C. and in a substantially liquid state at or above ambient temperature, wherein the population of cells is suspended in biological material at a temperature of approximately 8°C or lower. However, a population of cells can move almost freely throughout the entire volume of biological material at temperatures around ambient temperature, or higher. Suspending a population of cells in a substantially solid phase at a lower temperature provides a stability advantage for cells, such as adherent cells, compared to cells in a liquid. Moreover, suspending cells in a substantially solid state provides one or more of the following advantages: i) prevents cell sedimentation, ii) allows cells to remain anchored to the biological material in a suspended state; iii) allows cells to remain more evenly distributed throughout the biological material; iv) prevents the formation of cellular aggregates and v) provides better protection of cells during storage and transportation of the drug. A formulation capable of maintaining such features prior to administration to a subject has at least the advantage that the cells will generally be healthier in the formulation and a more uniform and reproducible dose of cells can be administered.

In specific embodiments, the gelatin hydrogel biological material used to formulate the OPC in NKA is porcine gelatin dissolved in a buffer to form a thermosensitive hydrogel. This hydrogel is liquid at room temperature, but forms a gel when cooled to refrigeration temperature (2-8°C). OPC is formulated with hydrogel to obtain NKA. NKA is gelled by cooling and sent to the clinic under refrigerated conditions (2-8°C). NKA has a shelf life of 3 days. At the clinical center, the drug is warmed to room temperature before being injected into the patient's kidney. NKA is implanted into the renal cortex using a needle and syringe suitable for delivering NKA via percutaneous or laparoscopic administration. In specific embodiments, the hydrogel is derived from gelatin or other recombinant extracellular matrix protein. In specific embodiments, the hydrogel is derived from the extracellular matrix of a kidney, or other tissue or organ. In specific embodiments, the hydrogel is derived from a recombinant extracellular matrix protein. In specific embodiments, the hydrogel comprises gelatin derived from recombinant collagen (i.e., recombinant gelatin).

Agents preserving cell viability

In one aspect, the bioactive cell preparation also contains an agent that maintains cell viability. In specific embodiments, the cell viability preserving agent is selected from the group consisting of an antioxidant, an oxygen transporter, an immunomodulatory factor, a cell recruitment factor, a cell attachment factor, an anti-inflammatory agent, an angiogenic factor, a matrix metalloproteinase, a wound healing factor, and products secreted from bioactive cells .

Antioxidants are characterized by their ability to inhibit the oxidation of other molecules. Antioxidants include, without limitation, one or more of 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid ( ^Trolox® ), carotenoids, flavonoids, isoflavones, ubiquinone, glutathione, lipoic acid, superoxide dismutase, ascorbic acid , vitamin E, vitamin A, mixed carotenoids (e.g. beta-carotene, alpha-carotene, gamma-carotene, lutein, lycopene, phytoene, phytofluene and astaxanthin), selenium, coenzyme Q10, indole-3-carbinol, proanthocyanidins, resveratrol, quercetin, catechins, salicylic acid, curcumin, bilirubin, oxalic acid, phytic acid, lipoic acid, vanillic acid, polyphenols, ferulic acid, theaflavins, as well as their derivatives. Other suitable antioxidants are known to those skilled in the art that may be used in particular embodiments of the present invention.

Oxygen carriers are agents characterized by the ability to transport and release oxygen. These include, without limitation, perfluorocarbons and pharmaceutical preparations containing perfluorocarbons. Suitable perfluorocarbon oxygen carriers include, but are not limited to, perfluorooctyl bromide (C8F17Br); perfluorodichorotane (C8F16C12); perfluorodecyl bromide; perflubron; perfluorodecalin; perfluorotripopylamine; perfluoromethylcyclopiperidine; fluozol ^® (perfluorodecalin and perfluorotripopylamine); perftoran ^® (perfluorodecalin and perfluoromethylcyclopiperidine); oxygent ^® (perfluorodecyl bromide and perflubron); oxycit™ (perfluoro(tert-butylcyclohexane)). Those skilled in the art will appreciate that other suitable perfluorocarbon-based oxygen carriers may be used in particular embodiments of the present invention.

Immunomodulatory factors include, but are not limited to, osteopontin, FAS ligand factors, interleukins, transforming growth factor beta, platelet-derived growth factor, clusterin, transferrin, protein expressed and secreted by normal T cells upon activation (RANTES), plasminogen activator inhibitor 1 (Pai -1), tumor necrosis factor alpha (TNF-alpha), interleukin 6 (IL-6), alpha-1 microglobulin and beta 2 microglobulin. Those skilled in the art will understand that other suitable immunomodulatory factors may be used in particular embodiments of the present invention.

Anti-inflammatory drugs or immunosuppressants (described below) may also be part of the drug. Those skilled in the art will appreciate that other suitable antioxidants may be used in particular embodiments of the present invention.

Cell recruitment factors include, but are not limited to, monocyte chemotactic protein 1 (MCP-1) and CXCL-1. Those skilled in the art will appreciate that other suitable cell recruitment factors may be used in particular embodiments of the present invention.

Cell attachment factors include, but are not limited to, fibronectin, procollagen, collagen, ICAM-1, connective tissue growth factor, laminins, proteoglycans, specific cell adhesion peptides such as RGD and YSIGR. Those skilled in the art will understand that other suitable cell attachment factors may be used in particular embodiments of the present invention.

Angiogenic factors include, but are not limited to, vascular endothelial growth factor F (VEGF) and angiopoietin-2 (ANG-2). Those skilled in the art will appreciate that other suitable angiogenic factors may be used in particular embodiments of the present invention.

Matrix metalloproteases include, but are not limited to, matrix metalloproteinase 1 (MMP1), matrix metalloproteinase 2 (MMP2), matrix metalloproteinase 9 (MMP-9), and tissue inhibitor of metalloproteinases 1 (TIMP-1).

Wound healing factors include, but are not limited to, keratinocyte growth factor 1 (KGF-1), tissue plasminogen activator (tPA), calbindin, clusterin, cystatin C, trefoil factor 3. Those skilled in the art understand that other suitable wound healing factors may be used in specific embodiments of the present invention.

Products secreted by the bioactive cells described herein can also be added to the bioactive cell preparation as an agent to maintain cell viability.

Compositions derived from human or animal body fluids, tissues or organs, including, without limitation, human plasma, human platelet lysate, fetal bovine serum, or bovine pituitary gland extract, may also be added to the bioactive cell preparation as an agent to preserve cell viability.

Those skilled in the art will appreciate that there are several suitable methods for applying, or otherwise combining, populations of cells with biological materials to form a construct.

Methods of application

In one aspect, the cells and preparations of the present invention are suitable for use in the methods of application described herein. In specific embodiments, the drugs of the present invention can be administered to treat a disease. For example, genetically modified bioactive cells can be introduced into a natural organ as part of a drug described herein. In specific embodiments, the genetically modified bioactive cells may be obtained from the natural organ to which administration will be performed, or from a source that is not the target natural organ.

In specific embodiments, the present invention relates to methods of treating kidney disease in a subject in need thereof with preparations containing populations of bioactive kidney cells described herein. In specific embodiments, the therapeutic preparation comprises a population of selected kidney cells, or mixtures thereof, that are modified by gene editing to reduce immunogenicity. In particular embodiments, the formulations are suitable for administration to a subject who is in need of improving renal function.

In one aspect, the effectiveness of treating kidney disease in a subject by the methods of the present invention can be judged based on various measures of renal function. In specific embodiments, measures of renal function include, but are not limited to, serum albumin, albumin to globulin ratio (A/G ratio), serum phosphorus, serum sodium, kidney size (determined by ultrasound), serum calcium, phosphorus:calcium ratio, serum potassium, proteinuria, urine creatinine, serum creatinine, blood urea nitrogen (BUN), cholesterol levels, triglyceride levels and glomerular filtration rate (GFR). In addition, certain indicators of general health and well-being include, but are not limited to, weight gain and loss, survival rate, blood pressure (mean systemic blood pressure, diastolic blood pressure, or systolic blood pressure), and physical endurance.

In one aspect, the effectiveness of treatment with a bioactive renal cell preparation is indicated by stabilization of one or more indicators of renal function. Stabilization of renal function can be judged based on the change in any parameter in a subject treated with the method of the present invention compared to that of a subject not treated with the method of the present invention. Alternatively, stabilization of renal function can be inferred based on the change in any parameter in a subject receiving treatment with the method of the present invention, compared with the same parameter in the same subject before treatment. A change in the first indicator may represent an increase or decrease in value. In specific embodiments, treatment provided by the present invention may include stabilizing serum creatinine and/or blood urea nitrogen (BUN) levels in a subject, wherein the levels of BUN observed in the subject are lower compared to levels in a subject with a similar condition disease that has not been treated by the methods of the present invention. In specific embodiments, treatment may include stabilizing serum creatinine levels in the subject, wherein the serum creatinine levels observed in the subject are lower compared to levels in a subject with a similar disease state who has not been treated with the methods of the present invention. In specific embodiments, stabilization of one or more of the above indicators of renal function results from treatment with the drug of selected kidney cells modified by gene editing to reduce immunogenicity.

Those skilled in the art will understand that one or more additional indicators described herein or known in the art can be measured to determine the effectiveness of treatment for kidney disease in a subject.

In specific embodiments, effective treatment with a genetically modified bioactive kidney cell preparation is indicated by an improvement in one or more indicators of renal structure and/or function. In specific embodiments, the genetically modified bioactive kidney cell population results in improved serum creatinine and/or blood urea nitrogen (BUN) levels. In specific embodiments, the genetically modified bioactive kidney cell population results in improved serum protein retention. In specific embodiments, the genetically modified bioactive kidney cell population results in improved serum albumin levels compared to a non-enriched cell population. In specific embodiments, the genetically modified bioactive kidney cell population results in an improved A:G ratio compared to a non-enriched cell population. In specific embodiments, the genetically modified bioactive kidney cell population results in improvements in serum cholesterol and/or triglyceride levels. In specific embodiments, the genetically modified bioactive kidney cell population results in improved vitamin D levels. In specific embodiments, the genetically modified bioactive kidney cell population results in an improvement in the phosphorus:calcium ratio compared to an unenriched cell population. In specific embodiments, the genetically modified bioactive kidney cell population results in improved hemoglobin levels compared to a non-enriched cell population. In specific embodiments, the genetically modified bioactive kidney cell population results in improved serum creatinine levels compared to a non-enriched cell population. In specific embodiments, the genetically modified bioactive kidney cell population results in improved hematocrit levels compared to a non-enriched cell population. In specific embodiments, improvement in one or more of the above measures of renal function results from treatment of the selected renal cells with the drug. In one embodiment, improvement in one or more of the above indicators of renal function results from treatment with the preparation of selected kidney cells modified by gene editing to reduce immunogenicity.

In one aspect, the present invention relates to preparations for use in methods of regenerating a natural kidney in a subject in need thereof. In specific embodiments, the method includes the step of administering or implanting into a subject a population, mixture, or construct of genetically modified bioactive cells described herein. The regenerated natural kidney can be characterized by a number of indicators, including, but not limited to, development of function or capacity in the natural kidney, improvement in function or capacity in the natural kidney, and expression of certain markers in the natural kidney. In certain embodiments, development or improvement of function or ability can be judged based on the various measures of renal function described above. In specific embodiments, the regenerated kidney is characterized by differential expression of one or more stem cell markers. The stem cell marker may be one or more of the following: SRY (sex determining region Y)-box 2 (Sox2); undifferentiated embryonic cell transcription factor (UTF1); mouse lymph node homologue (NODAL); prominin 1 (PROM1) or CD133 (CD133); CD24; as well as any combination thereof (see Ilagan et al. PCT/US2011/036347, the entire contents of the application are incorporated herein by reference), see also Genheimer et al., 2012. Molecular characterization of the regenerative response induced by intrarenal transplantation of selected renal cells in a rodent model of chronic kidney disease. Cells Tissue Organs 196: 374-384, which is incorporated herein by reference in its entirety. In certain embodiments, the expression of the stem cell marker(s) is increased compared to the control.

In one aspect, the present invention provides a method of treating kidney disease in a subject, comprising injecting a drug, composition, or population of cells disclosed herein into the subject. In specific embodiments, the drug, composition, or population of cells is administered by injection through an 18-30 gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 20 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 21 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 22 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 23 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 24 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 25 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 26 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 27 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 28 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through a needle of less than 29 gauge. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 20-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 21-gauge needle.

In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 22-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 23-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 24-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 25-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 26-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 27-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 28-gauge needle. In specific embodiments, the drug, composition, or population of cells is administered by injection through an approximately 29-gauge needle.

In specific embodiments, the inner diameter of the needle is less than 0.84 mm. In specific embodiments, the inner diameter of the needle is less than 0.61 mm. In specific embodiments, the inner diameter of the needle is less than 0.51 mm. In specific embodiments, the inner diameter of the needle is less than 0.41 mm. In specific embodiments, the inner diameter of the needle is less than 0.33 mm. In specific embodiments, the inner diameter of the needle is less than 0.25 mm. In specific embodiments, the inner diameter of the needle is less than 0.20 mm. In specific embodiments, the inner diameter of the needle is less than 0.15 mm. In specific embodiments, the outer diameter of the needle is less than 1.27 mm. In specific embodiments, the outer diameter of the needle is less than 0.91 mm. In specific embodiments, the outer diameter of the needle is less than 0.81 mm. In specific embodiments, the outer diameter of the needle is less than 0.71 mm. In specific embodiments, the outer diameter of the needle is less than 0.64 mm. In specific embodiments, the outer diameter of the needle is less than 0.51 mm. In specific embodiments, the outer diameter of the needle is less than 0.41 mm. In specific embodiments, the outer diameter of the needle is less than 0.30 mm. In specific embodiments, the needle has one of the sizes shown in the following table:

VD ND Caliber inch mm inch mm 14 0.060 1.55 0.072 1.83 15 0.054 1.37 0.065 1.65 16 0.047 1.19 n/a n/a 18 0.033 0.84 0.050 1.27 20 0.023 0.61 0.036 0.91 21 0.020 0.51 0.032 0.81 22 0.016 0.41 0.028 0.71 23 0.013 0.33 0.025 0.64 25 0.010 0.25 0.020 0.51 27 0.008 0.20 0.016 0.41 thirty 0.006 0.15 0.012 0.30 32 0.004 0.10 0.009 0.23

Secreted products

In certain embodiments, the effect may be produced by the cells themselves and/or products secreted by the cells. The regenerative effect can be characterized by one or more of the following: a decrease in epithelial-mesenchymal transition (which may occur through attenuation of TGF-β signaling); reduction of renal fibrosis; reduction of renal inflammation; differential expression of stem cell marker in natural kidney; migration of implanted cells and/or natural cells to a site of renal injury, eg tubular injury, engraftment of implanted cells at a site of renal injury, eg tubular injury; stabilization of one or more indicators of renal function (described herein); de novo formation of S-shaped bodies/comma-shaped bodies associated with nephrogenesis, de novo formation of renal tubules or nephrons, restoration of erythroid homeostasis (as described herein); as well as any combination of them (see also the publications of Basu et al., 2011. Functional evaluation of primary renal cell/biomaterial neo-kidney augment prototypes for renal tissue engineering. Cell Transplantation 20: 1771-90; Bruce et al., 2015. Selected renal cells modulate disease progression in rodent models of chronic kidney disease via NF-κB and TGF-β1 pathways. Regenerative Medicine 10: 815-839, each of which is incorporated herein by reference in its entirety.

As an alternative to tissue biopsy, the regenerative outcome of the subject receiving treatment can be assessed based on tests of body fluids, such as urine. Microvesicles obtained from urine samples of a subject have been found to contain certain components, including, without limitation, certain proteins and microRNAs, which are ultimately derived from a population of kidney cells treated with the cell populations of the present invention. These components may include, but are not limited to, factors involved in stem cell replication and differentiation, apoptosis, inflammation and immunomodulation, fibrosis, epithelial-mesenchymal transition, TGF-β signaling, and PAI-1 signaling. Temporal analysis of microvesicle-associated miRNA/protein expression patterns allows for continuous monitoring of regenerative outcomes in the kidneys of subjects receiving cell populations, mixtures, or constructs of the present invention.

In specific embodiments, the present invention relates to methods for assessing whether a patient with kidney disease (RD) responds to treatment with a therapeutic drug. The method may include the step of determining or detecting the number of vesicles, or the contents of their lumens, in a test sample obtained from a patient with PN receiving treatment with a therapeutic drug, in comparison with, or relative to, the number of vesicles in a control sample (for example, a sample obtained from that the same patient before treatment with the therapeutic agent), wherein a greater or lesser number of vesicles, or their luminal contents, in the test sample compared to the number of vesicles, or their luminal contents, in the control sample is an indicator of the response of the treated patient to treatment with the therapeutic agent.

These kidney-derived vesicles and/or the luminal contents of kidney-derived vesicles may also be excreted in the subject's urine and can be analyzed for biomarkers that are an indicator of regenerative outcome or treatment effectiveness. Non-invasive predictive methods may include the step of obtaining a urine sample from a subject before and/or after administration or implantation of a population, mixture or construct of genetically modified bioactive kidney cells described herein. Vesicles and other secreted products can be isolated from urine samples by standard methods, including, but not limited to, centrifugation to remove unwanted debris (Zhou et al. 2008. Kidney Int. 74(5):613-621; Skog et al. , patent published US Application No. 20110053157, the contents of which are incorporated herein by reference in their entirety), precipitation to isolate exosomes from urine, polymerase chain reaction and nucleic acid sequencing to identify specific nucleic acids, and mass spectroscopy and/or 2D gel electrophoresis for identification specific proteins associated with regenerative outcome.

Methods and routes of administration

The bioactive cell preparations of the present invention can be administered alone or in combination with other bioactive components. The drugs are suitable for injecting or implanting incorporated genetically modified tissue elements into solid organs for tissue regeneration. In addition, drugs are used to inject or implant genetically modified tissue elements into the wall of hollow organs for tissue regeneration.

In one aspect, the present invention relates to methods of providing a preparation of bioactive cells described herein to a subject in need thereof. In specific embodiments, the source of bioactive cells may be allogeneic or syngeneic, or any combination thereof. In specific embodiments, the methods may include administering an immunosuppressant. (See, for example, US Patent No. 7563822).

The methods of treatment of the present invention include delivery of a preparation of bioactive cells described herein. In one embodiment, direct administration of cells to the target area is preferred. A subject in need thereof may also be treated by contacting a natural kidney in vivo with a preparation of bioactive cells described herein, along with products secreted by one or more enriched populations of kidney cells, and/or a mixture or construct containing them . The stage of creating in vivo contact provides a regenerative effect for the natural kidney.

Various methods for administering selected kidney cell compositions to subjects will be apparent to those skilled in the art. Such methods involve injecting cells into a target area in a subject's body.

Delivery means

The cells and/or secreted products may be incorporated into a delivery device or medium that facilitates administration to subjects by injection or implantation. In certain embodiments, the delivery medium may include natural materials. In other specific embodiments, the delivery medium may include synthetic materials. In one embodiment, the delivery medium has a structure that mimics, or fits well with, the architecture of an organ. In other embodiments, the delivery medium is liquid in nature. In these cases, delivery devices may include tubes, such as catheters, for injecting cells and fluids into the body of the recipient subject. In a preferred embodiment, the tubes also have a needle, such as a syringe, through which the cells of the invention can be injected into the desired area in the subject's body. In some embodiments, mammalian kidney cell populations are formulated for introduction into a blood vessel through a catheter (where the term "catheter" is intended to include any of various tube-like systems for delivering substances to a blood vessel). Alternatively, the cells may be placed in, or on, a biological material or scaffold, including, but not limited to, fabric such as woven, knitted, braided, mesh and non-woven fabric, perforated films, sponges and foams, and granules such as monolithic or porous granules, microparticles, nanoparticles and the like (for example, Cultispher-S - Sigma gelatin granules). Cells can be prepared for delivery in a variety of forms. For example, cells can be suspended in a solution or gel. The cells may be mixed with a pharmaceutically acceptable carrier or diluent in which the cells of the invention remain viable. Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and/or dispersion media. The use of such carriers and diluents is well known in the art. The solution is preferably sterile and liquid, and will often be isotonic. Preferably, the solution is stable under the conditions of manufacture and storage, and is protected from the contaminating action of microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. One skilled in the art will understand that the delivery medium used to deliver the cell populations and mixtures thereof of the present invention may have a combination of the above characteristics.

Methods of administration

Methods of drug administration include, but are not limited to, systemic, intrarenal (eg, parenchymal), intravenous or intra-arterial injection, and injection directly into tissue at the intended site of activity. Additional routes of administration useful in the present invention include one or more injections by direct laparotomy, direct laparoscopy, transabdominal or percutaneous procedure. Additional routes of administration useful in the present invention include, for example, retrograde and ureteropelvic infusion. Surgical routes of administration include single-stage procedures such as, but not limited to, partial nephrectomy and construct implantation, partial nephrectomy, partial pyelectomy, omental vascularization ± peritoneum, multifocal biopsy insertion into puncture channels, conical or pyramidal, into a cylinder, and insertion by pole-like replacement, as well as two-stage procedures including, for example, an organoid internal bioreactor for transplantation. In specific embodiments, preparations containing mixtures of cells are delivered by the same route of administration at the same time. In another embodiment, each of the cell compositions containing the controlled mixture is delivered separately to specific areas or by specific methods, either simultaneously or at controlled times, by one or more of the methods described herein. In specific embodiments, the selected kidney cells are administered by transdermal injection into the renal cortex. In another embodiment, the guide cannula is inserted percutaneously and used to pierce the renal capsule before injecting the composition into the kidney.

To gain access to the kidney for injection of a formulated BPC or OPC population, a laparoscopic or percutaneous method can be used. The use of laparoscopic surgical technique makes it possible to directly visualize the kidney so that any bleeding or other adverse events can be noticed during the injection process and action can be taken immediately. The percutaneous renal approach has been used for over a decade, primarily for ablation of intrarenal masses. During these procedures, an electrode or cryogenic needle is inserted into a specific mass in the kidney and left in contact for (usually) 10-20 minutes to ablate the lesion. Instrumentation for percutaneous injection of a therapeutic drug is neither larger nor more complex than this equipment, and this approach has the safety advantages of no surgery (no abdominal puncture wounds or gas injection) and minimal immobilization time. In addition, a hemostatic biodegradable material may be left in the inlet channels to further reduce the likelihood of significant bleeding.

In one embodiment of injection delivery, the bioactive cell therapeutic is injected into the renal cortex. It is important to achieve maximum distribution of the therapeutic drug in the renal cortex, which can be achieved, for example, by entering the needle into the renal cortex at an angle that allows the therapeutic drug to be deposited in the renal cortex with the maximum possible distribution. This may require longitudinal or transverse imaging of the kidney using ultrasound imaging equipment or axial computed tomography (CT), depending on the individual patient characteristics. Ideally, the injection will involve several depositions of the drug while gradually withdrawing the injection needle/cannula. The entire volume of the therapeutic drug may be deposited at one or more entry points. In specific embodiments, up to two entry points can be used to deposit the full volume of therapeutic drug in the kidney. In specific embodiments, the injection may be performed into a single kidney using one or more entry points, such as one or two entry points. In specific embodiments, the injection is performed into both kidneys using one or more entry points for each kidney, for example, one or two entry points.

The above description is considered sufficient to enable one skilled in the art to practice the present invention. It should be understood that while the present invention is specifically described by preferred embodiments and optional features, modifications and variations of the concepts set forth herein may be made by those skilled in the art, and such modifications and variations are to be considered within the scope of the present invention as defined by the appended claims. . The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Indeed, various modifications of the invention other than those described herein will be apparent to those skilled in the art from the foregoing description and are intended to be included within the scope of the appended claims.

All patents, patent applications and literature cited in this specification are incorporated herein by reference in their entirety.

EXAMPLES

Example 1: Non-limiting Examples of Methods and Compositions for Producing OPC

Example 1.1 - Preparation of solutions

This example provides compositions of various drug media and solutions used to isolate and characterize a heterogeneous population of renal cells, as well as the production of a regenerative therapeutic drug.

Table 6: Culture media and solutions

Material Composition Fabric transport medium -Viaspan™ or HypoThermosol-FRS ^® or DMEM
-Kanamycin: 100 µg/ml Growth medium for kidney cells - DMEM:KSFM (50:50)
- 5% EBS
- Growth supplements:
-HGF: 10 mg/l
-EGF: 2.5 µg/l
-Insulin: 10.0 mg/l,
-Transferrin: 5.5 mg/l
-Selenium: 670 µg/l
-Kanamycin: 100 µg/ml Fabric Wash Solution -DMEM
- Kanamycin: 100 µg/ml Tissue digestion solution -Collagenase IV: 300 units
-Dispase: 5 mg/ml
-Calcium chloride: 5 mM Cell dissociation solution - TrypLE™ Density gradient solution -7% OptiPrep
-OptiMEM Cryopreservation solution - DMEM or HypoThermosol-FRS
- 10% DMSO
- 10% EBS

Dulbecco's phosphate-buffered saline (DPBS) was used to wash the cells in all cases.

Example 1.2 – Isolation of a heterogeneous, unfractionated population of kidney cells

This example describes the isolation of an unfractionated (U/FR) heterogeneous population of kidney cells from a human kidney. Initial tissue dissociation was performed to obtain a heterogeneous cell suspension from human kidney tissue.

Renal tissue obtained from a kidney biopsy was the starting material for obtaining a heterogeneous population of renal cells. You can use renal tissue containing one or more of: cortex, corticomedullary junction or medullary tissue. Preferably, corticomedullary junction tissue is used. Multiple biopsies (minimum 2) free of scar tissue are required to obtain samples from a kidney with ESRD. Kidney tissue was obtained by the clinical investigator from the patient at the clinical center approximately 4 weeks before the planned implantation of the final NKA product. The tissue was transported in the tissue transport medium described in Example 1.1.

The tissue was then washed with the tissue wash solution described in Example 1.1 to reduce the incoming bioburden before processing the tissue for cell extraction.

Kidney tissue was minced, weighed and dissociated in the tissue digestion solution described in Example 1.1. The resulting cell suspension was neutralized in Dulbecco's modified Eagle's medium (DMEM) + 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad Calif.), washed and resuspended in serum-free, supplement-free keratinocyte medium (KSFM) (Invitrogen). The cell suspension was then centrifuged through a density limit of 15% (w/v) iodixanol solution (OptiPrep™, Sigma) to remove red blood cells and debris, followed by seeding for culture into tissue culture-treated polystyrene flasks or plates at a density of 25,000 cells/ ^cm2 . growth medium for kidney cells described in example 1.1. For example, cells can be seeded into Nunc T500 flasks at a density of 25 x 10 ⁶ cells/vial in 150 ml of 50:50 media.

Example 1.3 - Propagation of an isolated population of kidney cells

The proliferation of kidney cells depends on the amount of tissue obtained and on the successful isolation of kidney cells from the obtained tissue. The isolated cells can be cryopreserved if necessary (see below). Kidney cell growth kinetics may vary from sample to sample due to the inherent variability of cells obtained from individual patients.

A specific cell expansion method has been developed that takes into account the range of cell recovery resulting from the variability of the tissue obtained. Table 7. Kidney cell expansion involves serial subcultures in closed cell culture flasks (e.g., T-flasks, Cell Factories, HyperStacks ^® ) in the kidney cell growth medium from Table 6 using specific cell culture techniques.

EBG-free media have been developed for human clinical trials to address the inherent risks associated with the use of EBG. Cell growth, phenotype (CK18) and cellular function (GGT and LAP enzymatic activities) were assessed in EBG-free medium and compared with results for EBG-containing medium used in animal studies. Kidney cell growth, phenotype, and function were equivalent in the two media. (Data not shown).

Table 7. Cell extraction from human kidney biopsies

Source Kidney cells
(cells/10 mg tissue) (reseeding 0) (reseeding 1) Human kidney tissue samples (n=7) 1.44-10.80x106x 10 ⁶ 4.61-23.10x10 ⁷

Once cell growth was detected in the original T-flasks (subculture 0) and there were no visible signs of contamination, the culture medium was replaced and subsequently changed every 2-4 days (FIG. 3B). Cells were assessed to confirm renal cell morphology by visually examining the cultures under a microscope. The cultures typically had the characteristic appearance of dense pavement or large pebbles due to the cells forming clumps. These morphological characteristics change during propagation and may not be present in all subcultured crops. Cell culture confluency was assessed at different confluency levels in the culture vessels used in the cell expansion process.

Kidney cells were subcultured by trypsinization when the culture vessels were at least 50% confluent (FIG. 3B). The detached cells were collected in containers containing growth medium for kidney cells, their number was counted, and cell viability was calculated. At each subculture, cells were seeded at a density of 500-4000 cells/cm ² in a sufficient number of culture containers to expand to the number of cells required for the NKA preparation (FIG. 3B). The culture containers were placed in an incubator with a temperature of 37°C and an atmosphere of 5% CO ₂ . As described above, cell morphology and confluency were monitored, and cell culture medium was replaced every 2–4 days. Table 8 shows the viability of human kidney cells observed when cells were isolated and expanded from six biopsy specimens from human donors.

Table 8 Viability of human kidney cells in culture

Reseeding (n=6) Cell viability (average, %) Range(%) P0 88 84-93 P1 91 80-98 P2 94 92-99 P3 98 97-99

Inherent tissue variability from patient to patient resulted in varying cell yields in culture. Thus, it is not practical to strictly determine the timing of cell subcultures, or the number and type of culture vessels required at each subculture, to achieve target cell numbers. As a rule, kidney cells are passed through 2 or 3 subcultures; however, culture duration and cell yield may vary depending on cell growth rate.

Cells were detached for harvest or subculture with 0.25% trypsin-EDTA (Invitrogen). Viability was assessed by trypan blue exclusion, and cell counts were performed manually using a hemocytometer or using an automated Cellometer ^® system (Nexcelom Bioscience, Lawrence Mass.).

Example 1.4. Cryopreservation of cultured cells

Expanded kidney cells are typically cryopreserved to eliminate the inherent variability in cell growth rates from individual patients and to deliver the drug according to a predetermined clinical schedule. Cryopreserved cells also provide a backup source of cells if another NKA drug is needed (eg, in case of delay due to patient illness, unexpected events, etc.). Conditions were developed that were used to cryopreserve cells and restore viable functional cells upon thawing.

For cryopreservation, cells were suspended to a final concentration of approximately 50x10 ⁶ cells/ml in cryopreservation solution (see Example 1.1) and poured into vials. One milliliter vials containing approximately 50 x 10 ⁶ cells/ml were placed in the freezer compartment of a rate-controlled freezer and frozen at a predetermined rate. After freezing, the cells were transferred to a container with liquid nitrogen for intermediate storage.

Example 1.5. Obtaining a cell population of OPCs

Selected kidney cells (SBCs) can be obtained from final culture vessels in which cells are grown from cryopreserved cells or directly from expansion cultures, depending on the schedule (FIG. 3B).

When cryopreserved cells were used, the cells were thawed and placed in tissue culture flasks for one final expansion step. When confluency reached approximately 50-100% in the final expansion vessels, the cells were ready for the OPC separation procedure. During media changes and final rinsing of the NKA, any residual cryopreservation solution is diluted into the final preparation.

Once the final expansion vessels reached at least 50% cell confluency, the culture vessels were transferred to a hypoxic incubator set to 2% oxygen in a 5% CO ₂ atmosphere at 37°C (FIG. 3C) and cultured in during the night. Cells can be maintained in a controlled oxygen incubator of 2% oxygen for up to 48 hours. Exposure to a more physiologically appropriate low level of oxygen (2%) increases the efficiency of cell separation and facilitates the detection of hypoxia-inducible markers such as VEGF.

Once cells have been exposed to hypoxic conditions for sufficient time (e.g. overnight or up to 48 hours), cells were detached with 0.25% trypsin-EDTA (Invitrogen). Viability was assessed by trypan blue exclusion and cell counts were performed manually using a hemocytometer or using an automated Cellometer system^® (Nexcelom Bioscience, Lawrence Mass.). Cells were washed once with DPBS and resuspended to a density of approximately 850x10⁶ cells/ml in DPBS.

Centrifugation across the phase boundary/interface of different densities was used to separate the collected kidney cell populations based on buoyant cell densities. Kidney cell suspensions were separated by centrifugation through 7% iodixanol solution (OptiPrep; 60% (w/v) in OptiMEM; see Example 1.1).

A 7% OptiPrep solution interfaced between phases of different densities was prepared, and the refractive index indicating the desired density was measured before use (RI 1.3456 ± 0.0004). The collected kidney cells were layered on top of the solution. Centrifugation was performed at 800 g for 20 min at room temperature (without braking) either in centrifuge tubes or in a cell processing device (eg, COBE 2991). The fraction of cells having a buoyant density greater than about 1.045 g/ml was collected after centrifugation as a clear cell pellet. Cells having a buoyant density less than 1.045 g/mL were excluded and discarded.

The OPC cell pellet was resuspended in DPBS (FIG. 3C). Carry-over residuals of OptiPrep, EBS, culture medium and auxiliary materials in the final preparation were kept to a minimum by using 4 wash steps with DPBS and 1 wash step with gelatin solution.

Example 2: Preparation of Selected Kidney Cells

Briefly, kidney biopsies were enzymatically dissociated in a buffer containing 4.0 units/ml dispase (Stem Cell Technologies, Inc., Vancouver, BC, Canada) and 300 units/ml collagenase IV (Worthington Biochemical, Lakewood, NJ, USA) . Red blood cells and debris are removed by centrifugation through 15% iodixanol (Optiprep ^® , Axis Shield, Norton, MA, USA). Primary kidney cells are seeded into tissue culture-treated polystyrene plates (NUNC, Rochester, NY, USA) and cultured in a 50:50 medium, a 1:1 mixture of high-glucose Dulbecco's modified Eagle's medium (DMEM) and serum-free keratinocyte medium. (KSFM) containing 5% fetal bovine serum (FBS), 1X ITS (insulin/transferrin/sodium selenite supplement for media) and an antibiotic/antimycotic mixture (all from Invitrogen, Carlsbad, CA, USA). Before performing cell separation after culture, primary kidney cell cultures are transferred from an atmospheric oxygen environment (21%) to a more physiological low oxygen environment (2%) for 24 hours to increase the efficiency of cell separation. Separation of primary kidney cell cultures brought to a density of 75 x 10 ⁶ cells in 2 ml of additive-free KSFM medium (uKSFM) is carried out by centrifugation in a four-step iodixanol density gradient (OptiPrep; 60% w/v in uKSFM) (16%, 13%, 11% and 7%) in 15 ml conical polypropylene tubes at 800 g for 20 min at room temperature. After centrifugation, all strips are washed 3 times with sterile phosphate-buffered saline (PBS) before use.

In specific embodiments, cells are genetically modified to remove genes encoding immunologically active cell surface antigens to confer immunological privilege on the genetically modified OPCs to reduce rejection in the recipient. In specific embodiments, cells are genetically modified (eg, using RNAi) to reduce the expression of genes encoding immunologically active cell surface antigens to confer immunological privilege on the genetically modified OPCs to reduce rejection in the recipient.

By combining bioactive kidney cells having a buoyant density greater than about 1.0419 g/ml from the density gradient centrifugation step, therapeutically bioactive OPCs are obtained. The preparation of selected kidney cells is also described, for example, in Kelley et al. (Am J Physiol Renal Physiol 2010;299:F1026-39), Kelley et al. (Cell Transplant 2013;22:1023-39), Bruce et al. (Methods Mol Biol. 2013;1001:53-64) and Basu et al. (Cell Transplant. 2011;20:1171-901). Cell suspensions (100 μl) are added to a 10 ml syringe mixed with biological material, which is a gelatin hydrogel, to formulate a therapeutic drug.

Cell viability is determined at each subculture and during the formulation process (trypan blue exclusion). Analysis of cellular phenotype and activity is performed on the final product as previously described (Basu and Ludlow. Regen Med 2014; 9:497-512). All procedures are carried out in accordance with current Good Manufacturing Practices (cGMP) principles developed by the FDA and MPA QP.

Example 3: General Method for Genetically Modifying Human Allogeneic Kidney Cells for the Treatment of Chronic Renal Failure

Treatment of patients with the selected kidney cells of the present invention is based on the use of genetically modified immunologically privileged cells lacking surface antigens that may cause cell rejection. In specific embodiments, bioactive kidney cells are obtained from a patient or donor, selected ex vivo , cultured in vitro to expand cell numbers as needed, and ultimately infused into the patient. Each patient receives a treatment based on the use of genetically modified immunologically privileged bioactive kidney cells that lack the surface antigens that lead to kidney cell rejection (ie, immunologically privileged bioactive kidney cells therapy). For a better understanding of the invention, a schematic representation of the manufacturing process steps for obtaining the immunologically privileged NKA preparation is shown in FIG. 1.

To improve the level of match between a potential donor who has an unsuitable level of HLA match with the recipient, targeted allele-specific gene editing is performed using Cas9 and specific gRNA molecules. As a result, due to gene destruction, the level of HLA match with cells from the mismatched donor becomes more suitable (by reducing the HLA mismatch) for transfer to a potential recipient patient. To improve the suitability of donor OPCs for the recipient, multiplex gene editing of HLA (MHC class I and class II) can be used in primary human kidney cells or enriched OPCs from a potential allogeneic donor and recipient pair.

To reduce the likelihood of rejection of transplanted HLA-mismatched allogeneic cells (for example, bioactive kidney cells), the recipient subject requiring transplantation is HLA-typed (for example, HLA-A, HLA-B and HLA-DRB 1 polymorphism is determined) in 6 alleles HLA (2 alleles for each of HLA-A, HLA-B and HLA-DRB1). Ideally, the recipient's genotype matches that of the donor, who has the same 6/6 HLA alleles, since 6/6 HLA allele matching is associated with a lower risk of immune rejection after transplantation. If a donor with a 6/6 allele match is not available (for example, in the bone marrow or cord blood HSC donor registry, or among relatives), but there are partial match donors with 5/6, 4/6, 3/6 or 2/ 6 matched HLA alleles, the methods described herein can be used to reduce the mismatch between a partially matched donor and recipient. As needed, one allele or multiple alleles (two, three, four, five or six alleles) can be disrupted using gene editing techniques described herein to reduce the risk of immunosuppression and/or the risk of increased disease severity in the transplant recipient recipient.

The methods described herein can be used to modify donor kidney cells (eg, BOD and/or OPC) to produce immunologically privileged kidney cells. For example, the methods can be used to disrupt (eg, knockout) 1, 2, or 3 HLA alleles in donor OPCs to produce cells corresponding to the HLA genotypes most commonly found in specific populations. For example, the most common 10 haplotypes for four ethnic groups in North America can be found, for example, in the National Bone Marrow Donor Program HLA Haplotype Frequency Data document, available at https://bioinformatics.bethematchclinical.org/ hla-resources/haplotype-frequencies/; Burdett et al., Hum. Immunol. 64 (10 Suppl): S6 (2003)).

For each gRNA, one oligonucleotide is designed and prepared. The U6 promoter and gRNA scaffold (e.g., including all but the targeting domain, e.g., including sequences from crRNA and tracrRNA, e.g., including first complementarity domain; binding domain; second complementarity domain; proximal domain and terminal domain) are separately amplified by PCR and purified as dsDNA molecules. A specific gRNA oligonucleotide is used in a PCR reaction to join U6 and the gRNA backbone linked by the targeting domain defined by the oligonucleotide. The resulting dsDNA molecule is purified for transfection. Alternative promoters can be used to drive in vivo transcription or to drive in vitro transcription. Any gRNA scaffold can be used to create gRNA molecules compatible with Cas9 molecules from any bacterial species.

Each gRNA tested is transfected, along with a Cas9 expression plasmid and a small amount of GFP expression plasmid, into human cells. In preliminary experiments, these cells may be immortalized human cell lines such as 293T, K562, or U20S. Alternatively, primary human cells can be used. In this case, the cells may be related to the final target therapeutic cells (eg, erythroid cells). The use of primary cells similar to the potential therapeutic target cell population may provide important information about the frequency of gene targeting in the context of endogenous chromatin and about gene expression.

Transfection can be performed by lipid transfection (eg, using Lipofectamine or Fugene ^® ) or by electroporation (eg, Lonza Nucleofection™). Following transfection, GFP expression can be determined by either fluorescence microscopy or flow cytometry to confirm consistent and high levels of transfection. In these preliminary transfection experiments, different gRNAs and different targeting approaches (17-mer, 20-mer, nuclease, double nickase, etc.) can be used to determine which gRNAs/gRNA combinations result in the greatest activity.

Cleavage efficiency with each gRNA can be assessed by determining NHEJ-induced insertion/deletion formation at the target locus in a T7E1 assay or by sequencing. Alternatively, other mismatch-sensitive enzymes such as Cell/Surveyor nuclease can also be used.

For the T7E1 assay, PCR amplicons are approximately 500–700 bp in size, with the putative cut site located asymmetrically within the amplicon. After amplification, purification and size confirmation of the PCR products, the DNA is denatured and rehybridized by heating to 95°C, followed by slow cooling. The hybridized PCR products are then digested by T7 endonuclease I (or other mismatch-sensitive enzyme), which recognizes and cleaves the mismatch sites in the DNA. If insertions/deletions are present in the original template DNA, then when the amplicons are denatured and re-annealed, this leads to hybridization of DNA strands having different insertions/deletions, resulting in less than perfectly matching double-stranded DNA. Digestion products can be visualized by gel electrophoresis or capillary electrophoresis. The fraction of DNA that is cleaved (density of cleaved products divided by the density of cleaved and undigested products) can be used to estimate the percentage of NHEJ using the following formula: %NHEJ = (1-(1-cleaved fraction)'72). The T7E1 assay has a sensitivity of only approximately 2-5% NHEJ.

Sequencing can be used instead of, or in addition to, T7E1 analysis. For Sanger sequencing, purified PCR amplicons are cloned into a plasmid backbone, cells are transformed, a miniprep is prepared, and sequenced with a single primer. Sanger sequencing can be used to accurately determine the nature of insertions/deletions after determining the extent of NHEJ using the T7E1 method. Sequencing can also be performed using next generation sequencing methods. When using next generation sequencing, amplicons can be 300-500 bp in size, with the predicted cut site placed asymmetrically. Following PCR, next-generation sequencing adapters and barcodes (e.g., multiplex adapters and Illumina indices) can be added to the ends of the amplicon, for example, for use in high-throughput sequencing (e.g., on the Illumina MiSeq). This method can detect very low levels of NHEJ.

While the methods described herein are exemplary for identifying gRNA molecules for use with a CRISPR/Cas9 molecule, one skilled in the art will appreciate that the gRNA identification methods described herein can be used to identify and select sequences that can be used with other nucleases (eg TALEN, Cpfl and zinc finger nucleases). Various modifications to the example embodiments will be apparent to those skilled in the art, and the general principles defined herein may be applied to other embodiments and uses without departing from the spirit and scope of the invention. Moreover, in the following description, numerous details are provided for purposes of clarification. However, one skilled in the art will appreciate that the invention may be practiced without the use of these specific details.

Example 4: Immunogenicity and Efficacy Studies with Genetically Modified Immunologically Privileged OPCs

In the first animal study, genomically modified immunologically privileged OPCs from a wild-type rat were injected into the kidney of mutant Sprague Dawley (SD) rats with polycystic kidney disease (PKD). The primary outcome assessed is the number of genomically modified immunologically privileged wild-type OPCs that persist in the nephrons of the mutant kidney. SD PKD rats with chronic renal failure (CRF) and injected with syngeneic OPC from wild-type SD rats will be assessed by in situ hybridization and tissue PCR, histological methods to qualitatively determine localization, and at the molecular level to quantify the degree of integration and retention of wild-type cells. type in diseased nephrons.

In the second study, gene editing of human OPCs will be assessed in an in vitro assay using 4 activity assays to assess OPC function after deletion of genes controlling MHC class I, class II, or classes I and II. The CRISPR/Cas9 system will be introduced by electroporation and OPCs will be studied for affective chemotaxis, tubule formation, cytokine release and efficient chemotaxis.

Example 5: MHC Suppression in the OPC

CRISPR/Cas9 enables specific genome disruption and substitutions in a flexible and simple system, resulting in high specificity and low toxicity to cells. The CRISPR/Cas9 genome editing system requires coexpression of the Cas9 protein with a guide RNA vector expressed from the human U6 promoter for polymerase III. With the protospacer-adjacent motif (PAM—NGG sequence) located at the 3′ end, Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of the target sequence by guide RNA. The functional cassette synthesized in the rescue donor vector can then be inserted into the unwound DNA. The reconstructed genome will then express the desired sequence with or without tags. CRISPR was originally used to knock out target genes in various types of cells and organisms, but modifications using the Cas9 enzyme have expanded the scope of CRISPR to selectively activate or suppress target genes, purify specific regions of DNA, and even visualize DNA in living cells using fluorescence microscopy.

The inventors decided to use gene editing using CRISPR/Cas9 to target the B2M or HLA-A (subunit) component of MHC-I. An epigenomic modification at a genomic target locus can alter the accessibility of the DNA target site to the Cas protein. We found that guide RNA molecules successfully knock down the expression of a B2M target gene near the gene transcription start site in a region of open chromatin characterized by extensive methylation of the H3K4 residue of the nucleosome. A publicly available program (CHOPCHOP, WU-CRISPR) was used to design CRISPR target constructs (defined by guide RNA binding of DNA sequences) and electroporation was used to transfect kidney cells. The DNA target sequence for the B2M gene that was successfully targeted for FACS data is as follows:

Target DNA sequence

GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 346)

PAM sequence

AGG

Target locus

Chromium. 15: 44711563-44711585 on GRCh38 (see NM_004048.2 on chr15:45003685-45010357 on the search portal of the University of California Santa Cruz genome browser genome assembly GRCh37/hg19)

Chain

Reverse

Electroporation was used to introduce CRISPR/Cas9 constructs into primary human kidney cells. And other methods, including lipofection, transfection, microinjection, etc., known to those skilled in the art, can be used to deliver CRISPR/Cas9 constructs. Although the results presented below focus on the B2M subunit, similar approaches can be used to target the polypeptide (HLA-A).

Human primary kidney cells (1x10 ⁶ ) were electroporated with a CRISPR/Cas9 construct specifically targeting the B2M component of the MHC-I complex. All experiments, the results of which are shown in FIG. 6-8 were performed using human primary kidney cells cultured after enzymatic digestion of kidney tissue. These cells were not processed to obtain OPC. Cells were allowed to recover for 48 hours after electroporation. B2M expression was assessed by FACS. Electroporation was performed using the Gene pulser Xcell™ electroporation system (Bio-Rad Laboratories, Inc., Hercules, California, USA), standard program #1: square pulse, for 5 milliseconds, at 160 volts, at 0.2 cm cuvette, total volume 100 µl.

Separately, human primary kidney cells (1x10 ⁶ ) were electroporated with a CRISPR/Cas9 construct specifically targeting the B2M component of the MHC-I complex. Cells were allowed to recover for 5 days after electroporation. B2M expression was assessed by FACS.

As shown in FIG. 6, the inventors were able to achieve a reduction in B2M expression by 47%, which was determined by FACS 48 hours after electroporation. A similar decrease was observed 5 days after electroporation, indicating stability of transfection. See FIG. 7.

Regarding position, molecular analysis showed that the B2M knockout occurred at the correct B2M locus. See FIG. 8. This result is important for the safety of the cell preparation.

Regardless of the ABO haplotype of the donor OPC cells, this approach resulted in successful B2M knockout without affecting OPC function, as determined by the results of VEGF and KIM1 secretion assays, which are assays for OPC activity. See FIG. 9 and 11.

The mixed lymphocyte reaction (MLR) is a test used by pharmaceutical and biotechnology organizations to study the safety of a drug or implanted material. It is commonly used as part of the process to obtain drug approval from the US Food and Drug Administration (FDA). Technically, it is an ex vivo cellular immunoassay using two populations of allogeneic lymphocytes (from individuals of the same species but genetically different). In unilateral MLR, only one population of lymphocytes can respond or proliferate. In bilateral MLR, both populations can proliferate. MLR is performed to assess how T cells respond to external stimuli. T cells are white blood cells that monitor cellular abnormalities and infections. They are vital for human immunity.

We performed unilateral MLR using control and genetically edited CRISPER cells as the stimulator population. In the case of successful knockout or knockdown of B2M expression, a decrease in lymphocyte cell proliferation could be predicted. As shown in FIG. 10, when testing 3 different OPC preparations, each with a different level of B2M downregulation based on FACS results, we observed a concomitant decrease in lymphocyte proliferation.

The inventors have a system by which they can demonstrate the adjusted degree of gene knockout and the correlation with the immune response in vitro . As a result, people receiving this treatment will require little or no use of immunosuppressive drugs, which themselves have harmful effects on the body.

Example 6: Components of the illustrative formulation NKA

1. Cellular components and materials

OPCs are the bioactive component of NKA. OPCs are composed primarily of renal tubular epithelial cells, which are well known for their regenerative potential. Other parenchymal (vascular), mesenchymal, endothelial, and stromal (collecting duct) cells may be present in the autologous OPC population.

OPC is obtained from renal cortical tissue obtained during a standard clinical renal biopsy procedure to collect renal tissue biopsies. Kidney cells are isolated from kidney tissue by enzymatic digestion and expanded using standard cell culture techniques. Cells are assessed to confirm renal cell morphology by visually examining the cultures under a microscope. The cultures have the characteristic appearance of dense pavement or large pebbles due to the cells forming clumps (FIG. 13). OPCs are obtained by separating isolated and expanded cells across a boundary or interface between phases of different densities, or in a single-step discontinuous density gradient.

Centrifugation across a boundary or interface between phases of different densities is used to separate collected kidney cell populations based on buoyant cell densities. Kidney cell suspensions are separated in OptiPrep solution (7% iodixanol; 60% (wt/vol) in OptiMEM medium). The fraction of cells having a buoyant density greater than about 1.0419 g/ml is collected after centrifugation as a clear cell pellet (FIG. 14). Cells having a buoyant density less than 1.0419 g/ml are excluded and discarded.

The OPC cell pellet is resuspended in DPBS. Carry-over residuals of OptiPrep, EBS, culture medium and auxiliary materials in the final preparation are minimized through the use of washing steps.

2. Biological materials and auxiliary materials

The following biological materials and auxiliary materials are used to formulate the OPC in NKA:

1. Pork gelatin - used to create a thermosensitive hydrogel.

2. Dulbecco's phosphate buffered saline (DPBS) - used to dissolve pork gelatin. The buffer can be replaced with, or mixed with, human plasma or human platelet lysate.

Production of biological material

The biological material is a gelatin solution consisting of porcine gelatin in DPBS. Gelatin is dissolved in DPBS or human plasma/human platelet lysate, or a mixture thereof, to a certain concentration, producing a gelatin solution for a thermosensitive hydrogel. The gelatin solution is sterilized by filtration through a 0.1-μm filter and stored refrigerated or frozen in single-use aliquots ready for formulation.

The key property of the biological material is that it is a thermosensitive hydrogel that can take the form of a gel and liquefy at different temperatures. The gelatin solution used in NKA is liquid at room temperature (22-28°C) and above, and forms a gel when cooled to refrigeration temperature (2-8°C).

Concentration of gelatin solution

Gelatin in the concentration range of 0.5-1.0% was evaluated for gelling properties - the ability to form a gel at refrigeration temperature (does not flow when inverted) and become liquid at room temperature (free flow when inverted). Table 9 shows the gelation rates at different concentrations of gelatin solution.

Table 9 - Gel-forming properties of gelatin solution at different concentrations

Gelatin concentration Gel
(cooling temperature) flowing liquid
(room temperature) 0.50% +/- + 0.63% + + 0.75% + + 0.88% + + 1.00% + +

Because NKA formulated with a gelatin solution at a concentration of 0.63% or higher reproducibly met the acceptance criteria, a concentration range of 0.88 ± 0.12% was selected for the gelatin in the NKA formulation. It should be noted, however, that preparations containing gelatin in concentrations ranging from about 0.63% to about 1% are also suitable.

3. Drug NKA

OPC is formulated in NKA with gelatin solution, a gelatin thermosensitive hydrogel. The gelatin thermosensitive hydrogel provides enhanced cell stability, thereby facilitating increased shelf life, shipping stability, and delivery of OPCs to the renal cortex for clinical use. When developing a drug, the composition, concentration and stability of the gelatin solution are evaluated.

Washed OPCs are counted using the trypan blue dye exclusion method. The gelatin solution is removed from cold storage and liquefied by heating to 26-30°C. A volume of OPC suspension containing the required number of cells is centrifuged, and the cell pellet is resuspended in a dilute gelatin solution for the final washing step. This suspension is centrifuged and the OPC pellet is resuspended in a sufficient volume of gelatin solution to achieve a final OPC concentration of 100x10 ⁶ cells/ml in the formulated NKA preparation.

Adding NKA to containers and forming a gel

The NKA drug is aseptically added to the syringe. Dynamic air sampling is performed throughout the filling process, including pot life and non-pot life sampling. The NKA package is rotated for a minimum of 2 hours to maintain the cells in suspension while cooling to 2-8°C to produce the final NKA gel preparation. For gelation, cooling must be done quickly so that the cells do not settle in the gelatin solution. The temperature of the gelatin solution in the syringe is controlled when it is placed under cooling conditions. A rapid drop in temperature is observed, as shown in FIG. 15. After 1 hour the temperature typically drops to within 0.3°C of the final temperature of 4.4°C.

Cooling the gelatin solution initiates the gel formation process, but a certain amount of time is required to stabilize the formed gel so that the OPCs remain suspended in the gel during storage. Syringes containing formulated NKA are rotated either overnight or for 1.25 hours and then kept upright overnight. The contents are then removed and the concentration of cells in four different segments of the preparation is measured. Analysis shows that there is no difference between the four segments, thus no detectable cell settling when the NKA is rotated at refrigeration temperature for a minimum of 1.25 hours (FIG. 16).

Claims (47)

1. A method for producing a bioactive kidney cell (BRC), including a genetic modification in the beta-2 microglobulin (B2M) gene, including genetic modification of the B2M BOD gene, wherein the genetic modification involves delivering an RNA-guided endonuclease and a guide RNA (gRNA) to the BPC, wherein the gRNA targets the RNA-guided endonuclease to a region of about 200 bases of the transcription start site of the B2M gene for modification, and where genetic modification reduces the expression of B2M on the surface of the genetically modified BOD. 2. The method of claim 1, wherein the gRNA targets the RNA-guided endonuclease to the sequence comprising SEQ ID NO: 346 for modification. 3. The method according to claim 1, characterized in that the genetic modification of the B2M gene includes introducing a mutation into the B2M gene. 4. The method according to claim 3, characterized in that introducing a mutation into the B2M gene includes deletion of the B2M gene or part thereof. 5. The method according to claim 1, characterized in that the BPC is a selected kidney cell (SRC). 6. The method according to claim 5, characterized in that the OPC is located in the OPC population. 7. The method according to claim 5, characterized in that the OPC is a renal tubule cell. 8. The method according to claim 7, characterized in that the renal tubule cell is a proximal tubule cell. 9. The method according to claim 5, characterized in that the OPC is an endocrine, vascular or glomerular cell. 10. The method according to claim 6, characterized in that the OPC population contains hypoxia-resistant and iodixanol-resistant cells. 11. The method according to claim 6, characterized in that the OPC population contains cells that express hyaluronic acid synthase 2. 12. The method according to claim 6, characterized in that the OPC population contains cells that are capable of receptor-mediated albumin transfer. 13. The method according to claim 1, characterized in that delivery of the RNA-guided endonuclease includes (i) expression of the guide RNA endonuclease in the BOD; or (ii) delivery of an RNA-guided endonuclease across the BOD cell membrane. 14. The method according to claim 1, characterized in that the RNA-guided endonuclease is a Cas protein. 15. The method according to claim 14, characterized in that the Cas protein is a Cas9 protein. 16. The method according to claim 1, characterized in that delivery of gRNA includes (i) expression of gRNA in BOD; or (ii) delivery of gRNA across the BOD cell membrane. 17. The method according to claim 15, wherein the Cas9 protein and gRNA are part of the ribonucleoprotein complex. 18. The method according to claim 1, further including the cultivation of genetically modified BOD. 19. The method according to claim 18, wherein the genetically modified BPC is less immunogenic in comparison with the corresponding cells that do not have a genetic modification in the B2M gene. 20. The method according to claim 1, characterized in that the RNA-guided endonuclease is expressed from the transfected mRNA. 21. The method according to claim 1, characterized in that the RNA-guided endonuclease is a recombinant protein and is complexed with gRNA ex vivo . 22. The method according to claim 1, characterized in that the RNA-guided endonuclease is a recombinant protein and is complexed with gRNA ex vivo , and the protein/gRNA complex is delivered into the cell by transfection, lipofection, electroporation or microinjection. 23. The method according to claim 17, characterized in that additional nucleic acid elements encoding a selective marker and/or specific mutations of the B2M gene are introduced into the cell together with the Cas9 protein/gRNA complex. 24. The method according to claim 14, characterized in that the Cas protein is expressed from the transfected mRNA, and the gRNA is expressed from the plasmid DNA. 25. The method of claim 20, wherein the transfected mRNA is stabilized by the inclusion of modified nucleotide bases or polyadenylation sequences. 26. The method according to claim 20, characterized in that the transfected mRNA is associated with at least one cell-penetrating peptide. 27. The method according to claim 14, characterized in that the Cas protein is expressed from the vector DNA. 28. The method of claim 27, wherein expression of the Cas protein is induced during at least a portion of the time that the gRNA is expressed in the cell. 29. The method according to claim 27, characterized in that the DNA vector is not integrated into the genome. 30. The method according to claim 27, characterized in that the DNA vector is an episomal vector or an artificial chromosome. 31. The method according to claim 27, characterized in that the DNA vector is a transposon. 32. The method according to claim 16, characterized in that the gRNA is a transcript from the vector DNA. 33. The method according to claim 1 for obtaining BOD intended for use as a medicine. 34. The method according to claim 1 for producing BPC intended for the treatment of chronic renal failure in a patient. 35. The method according to claim 18, where the cultivation includes reseeding the BOD at least once. 36. The method according to claim 35, where the cultivation includes reseeding the BOD at least twice. 37. The method of claim 36, wherein the OPC exhibits a buoyant density greater than about 1.0419 g/ml. 38. The method according to claim 37, characterized in that the OPC expresses CK18. 39. The method according to claim 5, characterized in that the OPC expresses CK18. 40. The method according to claim 39, characterized in that the OPC expresses GGT1. 41. The method according to claim 36, characterized in that the function of the OPC is determined by the production of VEGF and KIM-1. 42. The method according to claim 41, characterized in that the function of the OPC is additionally assessed by measuring enzymatic activity. 43. The method according to claim 42, characterized in that the enzymatic activities are LAP and/or GGT. 44. The method according to claim 1, characterized in that BOD is obtained by kidney biopsy.

Images