RU2813914C1 - RECOMBINANT PLASMID L4440, PROVIDING SYNTHESIS OF DOUBLE-STRANDED RNA, COMPLEMENTARY TO FRAGMENT OF MATRIX RNA OF inf4 GENE PHYTOPHTHORA INFESTANS - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, specifically to genetic engineering, and represents a recombinant plasmid L4440, which provides synthesis of double-stranded RNA, complementary to a fragment of matrix RNA of the inf4 gene Phytophthora infestans SEQ ID NO: 1, having size of 3182 bp, and consisting of the following elements: a) T7 promotor — sequence of T7 bacteriophage late promoter: 1–19 bp; b) Inf4 is a DNA region complementary to the matrix RNA of the inf4 gene P. infestans: 108–518 bp; c) T7 promotor — a sequence complementary to the late promoter of T7 bacteriophage: 586–604 bp; d) f1 ori — point of origin of replication of bacteriophage f1: 772–1227; e) Amp(R) — Amp gene providing ampicillin resistance: 1253–2218 bp; f) ori — bacterial pUC replication origin point: 2389–2997 bp.

EFFECT: invention provides protection of agricultural plants of the family Solanaceae against late blight.

1 cl, 2 dwg, 1 ex

Description

The invention relates to the biotechnological field, in particular to genetic engineering, and is intended for the biosynthesis of double-stranded ribonucleic acid (dsRNA) complementary to the inf4 elicitin gene fragment of Phytophthora infestans. The resulting dsRNA is capable of causing silencing of this gene through RNA interference, which leads to a decrease in the pathogenicity of late blight and, as a consequence, a decrease in the incidence of late blight in agricultural plants. The inf4 gene is responsible for the production of a protein that is actively secreted by Phytophthora haustoria during the colonization of Solanaceae, and, apparently, is responsible for the transport of sterols from the host plant [1]. Since late blight does not have independent synthesis of sterols, turning off this method of sterol production leads to inhibition of plant colonization and, as a consequence, a decrease in pathogenicity.

RNA interference methods are a powerful tool for protecting agricultural plants from pathogens, and dsRNA can be either of endogenous origin or synthesized exogenously. The advantage of the first method is its relative cheapness and speed - it is enough to obtain a transgenic plant once, carrying a fragment complementary to the target gene, and the line obtained from it will be resistant to the pathogen. However, taking into account the legislation of the Russian Federation, such lines are prohibited for food purposes. Plant protection methods using exogenously synthesized dsRNA are permitted from a legislative point of view, but are more expensive, as they require the constant production of large quantities of dsRNA and regular plant treatments.

Obtaining exogenous dsRNA for gene silencing using RNA interference is possible using special devices and in an in vivo system, which includes the L4440 vector, which contains all the necessary elements for dsRNA synthesis, as well as the E. coli HT115 strain, which is RNase-deficient III and thus allows the accumulation of dsRNA synthesized in the bacterial cell.

Thus, based on this system, an approach has been developed for protecting tobacco plants (Nicotiana tabacum) from the cotton bollworm insect pest (Helicoverpa armigera) [1], which is the prototype for the present invention. A recombinant plasmid L4440 was obtained containing a fragment complementary to a region of one of the cutworm genes, HaHR3, responsible for molting. Transformation of E. coli strain HT115 with this recombinant plasmid produced large quantities of the corresponding dsRNA, which was treated with plants. Cutworm caterpillars consumed exogenous dsRNA along with plant tissues, as a result of which, through the mechanism of RNA interference, dsRNA fragments turned off the HaHR3 gene. The significant protective effect of the proposed method of protecting tobacco from the cotton bollworm is shown.

Currently, not a single method has been described for protecting agricultural plants from fungal diseases, in particular late blight, using approaches based on RNA interference in general and exogenously synthesized dsRNA in particular. All available work relates to the protection of plants from phytophagous insects. The objective of the present invention is the synthesis of exogenous dsRNA complementary to the fragment of the late blight inf4 gene, which, through RNA interference, will selectively lead to the silencing of this gene without affecting the expression of genes, including plant genes. The inf4 gene is responsible for the production of a protein that is actively secreted by Phytophthora haustoria during the colonization of Solanaceae, and, apparently, is responsible for the transport of sterols from the host plant. Since late blight does not have independent synthesis of sterols, turning off this method of sterol production leads to inhibition of plant colonization and, as a consequence, a decrease in pathogenicity.

The technical result achieved through the implementation of the present invention is the protection of agricultural plants of the nightshade family (potatoes, tomatoes, eggplants, peppers, tobacco) from late blight.

The technical result is achieved by creating a recombinant plasmid L4440, which provides the synthesis of double-stranded RNA complementary to the messenger RNA fragment of the inf4 gene of Phytophthora infestans SEQ ID NO: 1, having a size of 3182 bp. and consisting of the following elements:

a) T7 promotor - sequence of the late promoter of bacteriophage T7: 1 - 19 bp;

b) Inf4 - DNA section complementary to the messenger RNA of the P. infestans inf4 gene: 108-518 bp;

c) T7 promotor - sequence complementary to the late promoter of bacteriophage T7: 586 - 604 bp;

d) f1 ori - origin of replication of bacteriophage f1: 772-1227;

e) Amp(R) - Amp gene, which provides resistance to ampicillin: 1253-2218 bp;

e) ori - bacterial origin of replication pUC: 2389-2997 bp.

To achieve the technical result, it is necessary to transform the E. coli HT115 strain with the proposed recombinant plasmid based on the vector L4440 SEQ ID NO: 1, and then induce dsRNA synthesis in bacterial cells. Next, the bacterial suspension is lysed and the total fraction of nucleic acids is first isolated, and then the target dsRNA is isolated. The resulting dsRNA preparation is diluted to the required concentration and then applied to the lower leaves of potato plants, since they are the most vulnerable to late blight. After 5 days, a significant protective effect against late blight appears.

Example 1

To develop an overnight culture by injection, E. coli HT115 bacteria containing the recombinant plasmid L4440 with a fragment of the inf4 elistin gene were inoculated in 5 ml of LB nutrient medium. After 16 h of incubation at 37 °C, the fresh overnight culture was transferred to 50 ml of LB medium with ampicillin (100 μg/ml) and tetracycline (10 μg/ml) and incubated at 37 °C with continuous stirring at 200 rpm until OD600 = 0.5. To induce the production of dsRNA, IPTG was added to the culture at this stage to a concentration of 0.6 mM, after which the suspension was left to grow under the same conditions for 4 hours.

Then, 50 ml of the bacterial culture was pelleted in a centrifuge (5 min, 5000 g) and resuspended in 5 ml of a 1:1 mixture of 1 M ammonium acetate and 10 mM isoamyl acetate. 5 ml of a 25:24:1 mixture of phenol, chloroform, isoamyl acetate was added to the suspension, and then incubated for 30 min at 65 °C, stirring occasionally. Next, the mixture was centrifuged for 20 min at 4 °C and 12000 g, the aqueous phase was removed, an equivalent volume of isopropanol was added and left overnight at -20 °C. The next day, the mixture was centrifuged for 10 min at 4 °C 12000 g, and the resulting precipitate was washed twice with 70% ethanol, followed by centrifugation for 2.5 min at 4 °C 12000 g. The precipitate was dried at 37°C until the alcohol was completely removed and dissolved in 100 μl of RNase-free water. Next, treatment was carried out with DNase (Thermo Fisher, USA) and then with RNase A (Sigma, Germany). Treatment with DNase was carried out according to the manufacturer's instructions, and with RNase A in 0.3 M NaCl solution to prevent hydrolysis of dsRNA. From the reaction mixture, dsRNA was extracted with a phenol/chloroform/isoamyl acetate mixture, followed by reprecipitation with isopropanol and washing with ethanol twice according to the standard protocol.

Potato plants of the Nikulinsky variety, 1 month old, were treated with purified dsRNA at a concentration of 100 ng/μl. Application was carried out using a micropipette at a dose of 5 μg per plant. DsRNA was distributed over the lower leaves (5 μl per leaf, 10 leaves per plant) or added to the nutrient medium (50 μl at 100 ng/μl). Distilled water was used as a control. One day after treatment of plants with dsRNA, zoospores were infected with late blight. The lesion was assessed after 5 days.

For statistical processing, each leaf was assigned a rank depending on the area of the lesion, where 9 is a completely healthy leaf, and 1 is a completely affected leaf.

The results confirming the protective effect of the proposed method against late blight are presented in Fig. 1 and fig. 2.

In Fig. Figure 1 shows visual differences between treated (water or dsRNA) and healthy plants.

Rice. 2 demonstrates the effectiveness of protecting potatoes from late blight when treated with dsRNA. Above the bars is the p-value of the Student's t test when compared with water. Error is standard error of the mean. Statistical processing was performed on 10 leaves of one plant.

Thus, we can conclude that the product in the form of dsRNA, obtained using the described technical solution - a recombinant plasmid, reliably reduces the pathogenicity of late blight for potato plants of the Nikulinsky variety.

Bibliography

1. Wang, S., Welsh, L., Thorpe, P., Whisson, S. C., Boevink, P. C., & Birch, P. R. J. (2018). The Phytophthora infestans Haustorium Is a Site for Secretion of Diverse Classes of Infection-Associated Proteins. https://doi.org/10.1128/mBio.01216-18

--->

<ST26SequenceListing dtdVersion="V1_3" fileName="L4440 + inf4.xml"

softwareName="WIPO Sequence" softwareVersion="2.3.0"

productionDate="2023-08-30">

<ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>1</ApplicationNumberText>

<FilingDate></FilingDate>

</ApplicationIdentification>

<ApplicantName languageCode="ru">Federal state

budgetary scientific institution "Federal Research Center

Institute of Cytology and Genetics, Siberian Branch of the Russian

Academy of Sciences" (ICIG SB RAS)</ApplicantName>

<ApplicantNameLatin>Institute of Cytology and Genetics, Siberian

Branch of Russian Academy of Sciences</ApplicantNameLatin>

<InventionTitle languageCode="en">Recombinant plasmid for

reducing the pathogenicity of Phytophthora infestans through gene silencing

inf4</InventionTitle>

<SequenceTotalQuantity>1</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>3182</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..3182</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Escherichia coli</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>taatacgactcactatagggagaccggcagatctgatatcatcgatgaa

ttcgagctccaccgcggtggcggccgctctagaactagtggatccaccggttccatggtatgggattgca

gacatgccgagcttaaagcctcttacagtcagaagagaaatcgtgcgccattttgtagacgttggtctta

aggccgctcgtgggaacagttagtgtgcagttcggtgggttgagagcgatgatcttcttgatcatggact

tgcaagaggaggacttgcacatggccttcttctccttgggccgtggtagcgttttggacgtgatcatcga

gtagcccgaatccttggagcacgtggagaatgaggcttcggatagaaggctcacgagtgtattgtaagca

gcagtttgttgttttgccgtgcacgctgcggcgttagtggatccaacgagaacggcgacggtgacagcga

tcagggcaacgaagttcatgttaagaatgtgctggatgaagtggttgtctgcaggaattcgatatcaagc

ttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgc

gctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgc

agcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttg

cgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgc

gcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgc

cacgttcgccggctttccccgtcaagctctaaatcggggggctccctttagggttccgatttagtgcttta

cggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacgg

tttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacact

caaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaat

gagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtggcacttt

tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatg

agacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtg

tcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagt

aaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatc

cttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcgg

tattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctctcagaatgacttggt

tgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgcc

ataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg

cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccat

accaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc

gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccac

ttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcg

cggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagt

caggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaac

tgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatcta

ggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca

gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaa

caaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggt

aactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttc

aagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg

ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaac

ggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgag

ctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaa

caggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcca

cctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaac

gcggcctttttacggttcctggccttttgctggccttttgctggccttttgctcacatgttctttcctgc

gttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccga

acgaccgagcgcagcgagtcagtgagcgaggaagcaacctggcttatcgaaat</INSDSeq_sequenc

e>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (7)

Recombinant plasmid L4440, providing the synthesis of double-stranded RNA complementary to the messenger RNA fragment of the inf4 gene of Phytophthora infestans SEQ ID NO: 1, having a size of 3182 bp. and consisting of the following elements: a) T7 promotor - sequence of the late promoter of bacteriophage T7: 1-19 bp; b)Inf4- a section of DNA complementary to the messenger RNA of a geneinf4 P. infestans: 108-518 bp; c) T7 promotor - sequence complementary to the late promoter of bacteriophage T7: 586-604 bp; d) f1 ori - origin of replication of bacteriophage f1: 772-1227; e) Amp(R) - Amp gene, which provides resistance to ampicillin: 1253-2218 bp; e) ori - bacterial origin of replication pUC: 2389-2997 bp.