RU2810064C1 - New amide derivative used as an inhibitor of dialglycerol o-acyltransferase 2 and its use - Google Patents

Abstract

FIELD: organic chemistry and pharmaceuticals.

SUBSTANCE: group of inventions is aimed at the treatment of diseases associated with DGAT2. The following is disclosed: a compound of formula I, or a pharmaceutically acceptable salt or stereoisomer thereof, wherein A, B and E are each independently CH and N; D is either N, CH or C-halo-C₁-C₇ alkyl; R₁ represents C₁-C₇ alkyl, C₃-C₁₀ cycloalkyl or halogen-C₁-C₇ alkyl; R₂ represents hydrogen or C₁-C₇ alkyl; R₃ represents -G-J-L; G represents -NH- or a direct chemical bond; J represents C₁-C₇ alkylene, C₂-C₇ alkenylene, C₁-C₇ alkylene-C₆-C₁₀ arylene, C₁-C₇ alkylene-amino-C₆-C₁₀ arylene, C₁-C₇ alkylene-C₆-C₁₀ -aryloxylene-C₁-C₇ alkylene, C₁-C₇ alkylene-C₃-C₁₀ cycloalkyl, C₂-C₇ alkenylene-C₃-C₁₀ cycloalkyl, C₁-C₇ alkoxylene-C₆-C₁₀ arylene, C₆-C₁₀ arylene, C₃-C₁₀ cycloalkyl, C₆-C₁₀ arylene-C₁-C₇ alkylene, 5-12-membered heterocycloalkylene, 5-12- membered heterocycloalkylene-C₆-C₁₀ arylene or 5-12 membered heterocycloalkylene-5-12 membered heteroarylene; L represents hydrogen, halogen, nitro, carboxy (-COOH), aminocarbonyl-C₁-C₇ alkyl, carboxy-C₁-C₇ alkyl, carboxy -C₁-C₇ alkoxy, carboxy-C₁-C₇ alkyl -C₆-C₁₀ aryl, C₃-C₁₀ cycloalkyl, C6-C10 aryl, C₆-C₁₀ aryloxy, 5-12 membered heterocycloalkyl or 5-12 membered heteroaryl; or R₂ and R₃ together with the nitrogen atom to which they are attached can form a 5-12 membered heterocycloalkyl; alkyl, alkylene, alkylene-arylene, alkenyl, alkenylene, cycloalkyl, carboxyalkyl, carboxyalkoxy, alkoxyalkyl, aminocarbonyl, aryl, aryl-alkyl, arylene, aryloxy, heterocycloalkyl or heteroaryl optionally substituted with 1-4 substituents selected from hydroxy, halogen, oxo, nitro, -COOH, -CH₂COOH, C₁-C₇ alkyl, methylidene, C₂-C₇ alkenyl, C₁-C₇ alkoxy, halogen-C₁-C₇ alkyl, C₁-C₇ alkylsulphonyl, C₁-C₇ alkylcarbonyl, C₁-C₇ alkoxycarbonyl and 5-12-membered heteroaryle-C₁-C₇ alkyl; heterocycloalkylene, heterocycloalkyl, heteroarylene or heteroaryl includes from 1 to 5 heteroatoms, selected from N, O and S. Besides, the following is disclosed: a pharmaceutical composition containing a compound of formula (I), a pharmaceutical composition for the treatment of diseases associated with DGAT2, containing a compound of formula (I).

EFFECT: group of inventions provides effective treatment of diseases mediated by diacylglycerol O-acyltransferase 2 (DGAT2).

4 cl, 1 tbl, 130 ex

Description

FIELD OF TECHNOLOGY TO WHICH THE INVENTION RELATES

The present invention relates to an amide derivative compound represented by formula (1) which has an inhibitory effect on diacylglycerol O-acyltransferase 2 (DGAT2), a pharmaceutical composition including this compound as an active ingredient, and the use of this compound.

BACKGROUND OF THE ART

Increased living standards due to economic development, frequent consumption of fast food products and changes in the usual meat-based diet have led to excess accumulation of calories and energy in the body. These changes in the diet of modern people have also led to a decrease in caloric energy expenditure due to lack of exercise, which has led to a serious increase in metabolic diseases such as obesity, hyperlipidemia, diabetes, cardiovascular diseases and coronary heart disease. In particular, obesity is one of the rapidly spreading diseases and is reported to be a cause of metabolic diseases such as diabetes. Currently, there is particular interest in the development of therapeutic agents for the treatment of metabolic diseases by controlling the functions of enzymes involved in triglyceride biosynthesis reactions, which are the main cause of obesity.

Neutral fats such as triglycerides (TG) play a very important role as an energy source in the body's storage function. However, when neutral fats accumulate excessively in organs or tissues, they cause obesity, hypertriglyceridemia, fatty liver disease and other diseases, resulting in serious diseases such as diabetes, atherosclerosis, metabolic disorders and organ hypofunction. Diacylglycerol acyltransferase, which is an essential enzyme in triglyceride biosynthesis, is found in various mammalian tissues and is an enzyme that synthesizes TG by binding fatty acid acyl-CoA to the hydroxyl group of diacylglycerol in the final step of the glycerol phosphate reaction cascade, which is the main route of triglyceride synthesis. Currently, two isoforms are known, DGAT1 and DGAT2. Although their biochemical functions are similar, the difference is that DGAT1 is mainly expressed in the small intestine and adipose tissue, and DGAT2 is mainly expressed in the liver and adipose tissue. Moreover, regarding the gene family, DGAT1 belongs to the ACAT family and DGAT2 belongs to the MGAT family. Thus, their roles in triglyceride (TG) biosynthesis are also suggested to be different.

A number of studies, including animal studies, have shown that DGAT2 primarily contributes to triglyceride biosynthesis in vivo. Unlike DGAT2 knockout mice, which produce almost no triglycerides and die soon after birth due to an abnormal skin layer, DGAT1 knockout mice had a slight decrease in triglyceride levels and did not experience problems with mouse survival (Stone SJ et al., 2000. Nat. Genet. 25: 87-90). In addition, by reducing the expression of DGAT1 or DGAT2 using an antisense oligonucleotide (ASO) in an animal model of fatty liver disease, there was an improvement in the symptoms of fatty liver disease, and the rate of hepatic glucose production was significantly reduced only when the amount of DGAT2 was reduced (Choi CS et al ., 2007. Hepatology. 45: 1366-74).

The underlying molecular mechanisms of metabolic diseases are not fully understood, but inhibition of DGAT2 is thought to suppress the expression of many genes encoding proteins involved in lipid production, such as sterol regulatory element binding protein 1c (SREBP1c) and stearoyl-CoA desaturase 1 (SCD1). At the same time, it has been suggested that the oxidative pathway is induced by an increase in genes such as carnitine palmitoyltransferase 1 (CPT1). This change, in turn, leads to a decrease in the levels of DAG and TAG lipids in the liver and, therefore, an improvement in the responsiveness of the liver to the effects of insulin. In addition, inhibition of DGAT2 results in inhibition of VLDL TAG secretion in the liver and reduces circulating cholesterol levels. Finally, there was a suppression of plasma apolipoprotein B (APOB) levels, which was thought to be due to a decrease in the supply of TAG upon lipidation of newly synthesized APOB protein. That is, in the case of DGAT2 inhibition, a positive effect is found on both glycemic control and plasma cholesterol profile, which means that DGAT2 inhibition can be used to treat metabolic disorders.

DESCRIPTION OF THE INVENTION

TECHNICAL PROBLEM

The object of the present invention is to develop a new amide derivative compound represented by formula (1) having an inhibitory effect on diacylglycerol O-acyltransferase 2 (DGAT2).

Another object of the present invention is to provide a method for preparing an amide derivative compound.

And yet another object of the present invention is to provide a pharmaceutical composition for the treatment of metabolic diseases associated with DGAT2, comprising an amide derivative compound as an active ingredient, and a method of using it.

It is yet another object of the present invention to provide a method for treating metabolic diseases associated with DGAT2 in a subject, which improves the effectiveness of treating the diseases in animal models, as well as increases the effectiveness and ease of administration to the subject, by using an amide derivative compound as an active ingredient , which has improved physical and chemical properties compared to commonly used compounds.

SOLUTION OF A TECHNICAL PROBLEM

To solve the above problem, the present invention provides a compound of the following formula (1) or a pharmaceutically acceptable salt or isomer thereof:

Formula 1)

Where

A, B and E are each independently CH and N;

D is N, CH or C-haloalkyl;

R ₁ represents alkyl, cycloalkyl or haloalkyl;

R ₂ represents hydrogen or alkyl;

R ₃ represents -GJL;

where G represents -NH- or a direct chemical bond;

J is alkylene, alkenylene, alkylene-arylene, alkylene-amino-arylene, alkylene-aryloxylene-alkylene, alkylene-cycloalkyl, alkenylene-cycloalkyl, alkoxylene-arylene, arylene, cycloalkyl, aryl, aryl-alkyl, heterocycloalkylene, heterocycloalkylene-arylene , heterocycloalkylene-heteroarylene or heterocycloalkyl;

L is hydrogen, halogen, amino, nitro, carboxy (-COOH), aminocarbonylalkyl, carboxyalkyl, carboxyalkoxy, carboxyalkylaryl, cycloalkyl, aryl, aryloxy, heterocycloalkyl or heteroaryl; or

R ₂ and R ₃ together with the nitrogen atom to which they are attached can form heterocycloalkyl;

wherein alkyl, alkylene, alkylene-arylene, alkenyl, alkenylene, cycloalkyl, carboxyalkyl, carboxyalkoxy, alkoxyalkyl, aminocarbonyl, aryl, aryl-alkyl, arylene, aryloxy, heterocycloalkyl or heteroaryl is optionally substituted with one or more substituents selected from hydroxy, halogen , oxo, nitro, -COOH, -CH ₂ COOH, alkyl, alkenyl, alkoxy, haloalkyl, alkylsulfonyl, alkylcarbonyl, alkoxycarbonyl and heteroaryl-alkyl; And

heterocycloalkylene, heterocycloalkyl, heteroarylene or heteroaryl includes one or more heteroatoms selected from N, O and S.

The compound of formula (1) of the present invention can form a pharmaceutically acceptable salt. The pharmaceutically acceptable salt may include an acid addition salt formed with an inorganic acid such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid and hydroiodic acid; with an organic acid such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid and salicylic acid; or with a sulfonic acid such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid and p-toluenesulfonic acid, which form a non-toxic acid addition salt comprising a pharmaceutically acceptable anion. In addition, the pharmaceutically acceptable carboxylic acid salt includes an alkali metal or alkaline earth metal salt such as lithium, sodium, potassium, calcium and magnesium; amino acid salts such as lysine, arginine and guanidine; an organic salt such as a salt with dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, diethanolamine, choline and triethylamine. The compound of formula (1) of the present invention can be converted into its salts by conventional methods.

Moreover, since the compounds of formula (1) of the present invention may have an asymmetric carbon center and an axis or plane of asymmetry, they may exist in the form of an E- or Z-isomer, an R- or S-isomer, racemic mixtures or diastereoisomeric mixtures and each individual diastereoisomer, all of which are included within the scope of the present invention.

In the invention, unless otherwise indicated, the term "compound of formula (1)" is used to refer to all compounds of formula (1), including their pharmaceutically acceptable salts and isomers.

In the invention, the following terms defined for substituents are used to define the compound of formula (1).

The term "halogen" refers to fluorine (F), chlorine (Cl), bromine (Br) or iodine (I).

The term "alkyl" or "alkylene" refers to linear or branched hydrocarbons which may include a single bond, a double bond or a triple bond and are preferably C ₁ -C ₁₀ alkyl or C ₁ -C ₁₀ alkylene or C ₁ -C ₇ alkyl or C ₁ -C ₇ alkylene. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, acetylene, vinyl, trifluoromethyl and other similar alkyls.

The term "alkenyl" or "alkenylene" refers to linear or branched hydrocarbons having at least one carbon-carbon double bond and is preferably C ₂ -C ₁₀ alkenyl or C ₂ -C ₁₀ alkenylene or C ₂ -C ₇ alkenyl or C ₂ -C ₇ alkenylene. Examples of alkenyl include, but are not limited to, vinyl, allyl, butenyl, isopropenyl, isobutenyl and other similar alkenyls.

The term "cycloalkyl" refers to partially or fully saturated monocyclic or fused ring hydrocarbons and is preferably C ₃ -C ₁₀ cycloalkyl. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and other similar cycloalkyls.

Unless otherwise defined, the term "alkoxy" means alkyloxy having from 1 to 10 carbon atoms.

Unless otherwise defined, the term "cycloalkoxy" means cycloalkyloxy having from 3 to 10 carbon atoms.

The term "aryl" or "arylene" refers to aromatic hydrocarbons, preferably C ₅ -C ₁₂ aryl or C ₅ -C ₁₂ arylene, more preferably C ₆ -C ₁₀ aryl or C ₆ -C ₁₀ arylene, and includes, but without limitation, phenyl, naphthyl and other similar aromatic hydrocarbons.

The term "heteroaryl" or "heteroarylene" refers to 3-12 membered, more preferably 5-12 membered, aromatic hydrocarbons that form a single or fused ring, which may be fused with a benzo or C ₃ -C ₈ cycloalkyl, comprising one or more heteroatoms selected from N, O and S as ring atoms. Examples of heteroaryl include, but are not limited to, pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, oxadiazolyl, isoxadiazolyl, tetrazolyl, triazolyl, indolyl, indazolyl, isoxazolyl, oxazolyl, thiazolyl, isothiazolyl, furanyl, benzofuranyl, imidazolyl, thiophenyl, benzthiazole, benzimidazole, quinolinyl , indolinyl, 1,2,3,4-tetrahydroisoquinolyl, 3,4-dihydroisoquinolinyl, thiazolopyridyl, 2,3-dihydrobenzofuran, 2,3-dihydrothiophene, 2,3-dihydroindole, benzo[1,3]dioxy, chroman, thiochroman , 1,2,3,4-tetrahydroquinoline, 4H-benzo[1,3]dioxin, 2,3-dihydrobenzo[1,4]-dioxin, 6,7-dihydro-5H-cyclopenta[d]pyrimidine and others similar heteroaryls.

The term “heterocycloalkyl” refers to partially or fully saturated hydrocarbons that form a monocyclic or fused ring containing one or more heteroatoms selected from N, O and S, and are preferably 3 to 12 membered heterocycloalkyl or 5 to 12 membered heterocycloalkyl. Examples of heterocycloalkyl include, but are not limited to, pyrrolidinyl, piperidinyl, morpholinyl, imidazolinyl, piperazinyl, tetrahydrofuran, tetrahydrothiofuran and other similar heterocycloalkyl.

Aryl-alkyl, alkyl-aryl and heteroaryl-alkyl denote groups that are formed by combining the above-mentioned aryl and alkyl, or heteroaryl and alkyl. Examples include, but are not limited to, benzyl, thiophenemethyl, pyrimidinemethyl, and other similar groups.

According to one embodiment of the present invention, in the above formula (1)

A, B and E are each independently CH and N;

D is N, CH or C-halo-C ₁ -C ₇ alkyl;

R ₁ represents C ₁ -C ₇ alkyl, C ₃ -C ₁₀ cycloalkyl or halogen-C ₁ -C ₇ alkyl;

R ₂ represents hydrogen or C ₁ -C ₇ alkyl;

R ₃ represents -GJL;

where G represents -NH- or a direct chemical bond;

J represents C ₁ -C ₇ alkylene, C ₂ -C ₇ alkenylene, C ₁ -C ₇ alkylene-C ₆ -C ₁₀ arylene, C ₁ -C ₇ alkylene-amino-C ₆ -C ₁₀ arylene, C ₁ - C ₇ alkylene-C ₆ -C ₁₀ aryloxylene-C ₁ -C ₇ alkylene, C ₁ -C ₇ alkylene-C ₃ -C ₁₀ cycloalkyl, C ₂ -C ₇ alkenylene-C ₃ -C ₁₀ cycloalkyl, C ₁ -C ₇ alkoxylene-C ₆ -C ₁₀ arylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₀ cycloalkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ aryl-C ₁ -C ₇ alkyl, 5-12-membered heterocycloalkylene, 5-12 membered heterocycloalkylene-C ₆ -C ₁₀ arylene, 5-12 membered heterocycloalkylene, 5-12 membered heteroarylene or 5-12 membered heterocycloalkyl;

L represents hydrogen, halogen, amino, nitro, carboxy (-COOH), aminocarbonyl-C ₁ -C ₇ alkyl, carboxy-C ₁ -C ₇ alkyl, carboxy-C ₁ -C ₇ alkoxy, carboxy-C ₁ -C ₇ alkyl-C ₆ -C ₁₀ aryl, C ₃ -C ₁₀ cycloalkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ aryloxy, 5-12 membered heterocycloalkyl or 5-12 membered heteroaryl; or

R ₂ and R ₃ together with the nitrogen atom to which they are attached can form a 5-12 membered heterocycloalkyl;

wherein alkyl, alkylene, alkylene-arylene, alkenyl, alkenylene, cycloalkyl, carboxyalkyl, carboxyalkoxy, alkoxyalkyl, aminocarbonyl, aryl, aryl-alkyl, arylene, aryloxy, heterocycloalkyl or heteroaryl is optionally substituted with 1 to 4 substituents selected from hydroxy, halogen, oxo, nitro, -COOH, -CH ₂ COOH _, C ₁ -C ₇ alkyl, C ₂ -C ₇ alkenyl, C ₁ -C ₇ alkoxy, halogen-C 1 -C 7 alkyl, C _{1 -C 7} alkylsulfonyl , C ₁ -C ₇ alkylcarbonyl, C ₁ -C ₇ alkoxycarbonyl and 5-12-membered heteroaryl-C ₁ -C ₇ alkyl; And

heterocycloalkylene, heterocycloalkyl, heteroarylene or heteroaryl contains from 1 to 5 heteroatoms selected from N, O and S.

Representative compounds of formula (1) of the present invention include, but are not limited to, the following compounds:

(R)-1-(3,5-bis(trifluoromethyl)phenyl)-3-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)urea;

((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)-L-phenylalanine;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-morpholine-4-carboxamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-pyrrolidin-1-carboxamide;

1-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)pyrrolidine-3-carboxylic acid;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-benzamide;

(R)-4-chloro-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)benzamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3-methoxybenzamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-4-methoxybenzamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-4-nitrobenzamide;

(R)-2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)benzoic acid;

(R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)acetic acid;

(R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)-2-methylpropanoic acid;

(R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenoxy)-2-methylpropanoic acid;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-1-(methylsulfonyl)piperidine)-4-carboxamide;

(R)-1-acetyl-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)piperidine)-4-carboxamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-1-(isopropylsulfonyl)piperidine-4-carboxamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-1-(5-ethylpyrimidin-2-yl)piperidin-4-carboxamide;

(R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-4-oxobutanoic acid;

(1R)-2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)cyclopentane-1-carboxylic acid;

(R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)bicyclo[2,2,2]octane-1-carboxylic acid;

(R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-2,2-dimethyl-4-oxobutanoic acid;

(R)-1-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3,3-dimethylpyrrolidine-2,5-dione;

(R)-5-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-2,2-dimethyl-5-oxopentanoic acid;

(R)-5-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-3,3-dimethyl-5-oxopentanoic acid;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-(3-trifluoromethyl)phenyl)acetamide;

(R)-2-(3,5-bis(trifluoromethyl)phenyl)-N-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-phenylacetamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3-phenylpropanamide;

(R)-2-(3-chlorophenyl)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-methyl-2-phenylpropanamide;

(R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid;

(R)-3-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid;

(R)-2-(4-(2-amino-2-oxoethyl)phenyl-N-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide;

(R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-(4-hydroxyphenyl)acetamide;

(R)-4-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy)butanoic acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino-2-oxoethyl)phenoxy)-2-methylpropanoic acid ;

(R)-2-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2-methylpropanoic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid;

(R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1-en-1-yl) benzoic acid;

(R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxoprop-1-ene- 1-yl)benzoic acid;

4-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxopropyl)benzoic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-fluorobenzoic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-methylbenzoic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-methoxybenzoic acid;

(R)-2-chloro-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid;

(R)-3-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid;

(R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid;

(R)-3-(4-(2-amino-2-oxoethyl)phenyl-N-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)propenamide;

(R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid;

(R)-1-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)cyclopropane-1- carboxylic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2,6-difluorobenzoic acid;

(R)-2,6-dichloro-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2,6-dimethylbenzoic acid;

(R)-1-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)piperidin-4- carboxylic acid;

(R)-1-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl-2,6-difluorophenyl)piperidine-4-carboxylic acid;

(R)-2-(1-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl-2,6-difluorophenyl)piperidin-4-yl )acetic acid;

(R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)benzoic acid;

(R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropane acid;

(R)-3-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)propanoic acid;

(R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenoxy)benzoic acid;

(R)-3-(4-(3-((6-(R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)- 2-methylpropanoic acid;

(S)-3-(4-(3-((6-(R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)- 2-methylpropanoic acid;

(R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyridin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid;

(R)-2-(4-(3-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)ureido)phenyl)acetic acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyridin-2-yl)amino)-2-oxoethyl)phenyl)-2-methylpropane acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2-methylpropane acid;

(R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyridin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid;

(R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyridin-2-yl)amino-2-oxoethyl)phenyl)-2,2- dimethylpropanoic acid;

(R)-3-(4-(2-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-6-(trifluoromethyl)pyrimidin-2-yl)amino-2-oxoethyl)phenyl) -2,2-di-methylpropanoic acid;

(R)-3-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)propanoic acid;

(R)-3-(4-((2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)allyl)amino)phenyl)propanoic acid;

(R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)pyrimidin-5-carboxylic acid;

3-(3-((R)-3-((6-((R)-3-((3-ethoxypyridin-2-yl)oxy)-piperidin-1-yl)pyrazin-2-yl)carbamoyl) piperidin-1-yl)phenyl-2,2-dimethylpropanoic acid;

(R)-3-(4-(1-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(4-(1-((4-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidin-2-yl)amino)-2-methyl- 1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid;

(R)-2-(4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)phenyl)acetic acid;

(R)-2-(4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)phenyl)-2- methylpropanoic acid;

(R)-2-(6-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)pyridin-3-yl )-2-methylpropanoic acid;

(R)-2-(5-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)-2H-tetrazol- 2-yl)-acetic acid;

(R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)-4-oxobutanoic acid;

(R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)acetic acid;

3-(3-((R)-3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)phenyl )-2,2-dimethylpropanoic acid;

(R)-1-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)piperidine-4-carboxylic acid;

6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)pyrrolidin-1-yl)nicotinic acid;

N-(6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3-methylpyrrolidine-3-carboxamide;

6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-3-methylpyrrolidin-1-yl)nicotinic acid;

(R)-2-(4-(2-((6-(3-(2-isopropoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid;

(R)-2-(4-(3-((6-(3-(2-methoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid;

(R)-2-methyl-2-(4-(3-oxo-3-((6-(3-(2-(trifluoromethoxy)phenoxy)piperidin-1-yl)pyrazin-2-yl)amino) propyl)phenyl)propanoic acid;

(R)-2-(4-(3-((6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl) -2-methylpropanoic acid;

(R)-3-(4-(2-((6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl) -2,2-dimethylpropanoic acid;

(R)-3-(4-(2-((6-(3-(2-cyclopropoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2- dimethylpropanoic acid;

(R)-3-(4-(2-((6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid;

(R)-2-(4-(3-((6-(3-(2-cyclopropoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid ;

(R)-2-(4-(3-((6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino-2-oxoethyl)phenoxy)acetic acid;

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethoxy)phenyl)acetic acid;

2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethoxy)phenyl)propanoic acid;

(R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy-2,2- dimethylpropanoic acid;

(R)-2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy) propanoic acid;

(S)-2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy) propanoic acid;

(R)-2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl) phenoxy)-2-methylpropanoic acid;

(R)-2-(4-(2-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-2-oxoethyl)phenoxy)-2-methylpropane acid;

(R)-2-(4-((4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy) methyl)phenyl)-2-methylpropanoic acid;

(R)-2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) phenoxy)-2-methylpropanoic acid;

(R)-2-(4-(3-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropane acid;

(R)-3-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid;

(R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2,2-dimethyl-3-oxopropyl) phenyl)-2-methylpropanoic acid;

(R)-3-(4-(2-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid;

(R)-3-(4-(2-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-2-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid;

(R)-3-(4-(2-((4-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidin-2-yl)amino)-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(4-(2-((2-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid;

(R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)bicyclo[2,2,2]octane- 1-carboxylic acid;

(R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)bicyclo[2,2,2]octane- 1-carboxylic acid;

(R)-4-(3-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-3-oxopropyl)bicyclo[2,2,2]octane- 1-carboxylic acid;

(R)-4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)bicyclo[ 2,2,2]octane-1-carboxylic acid;

(R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1-en-1-yl) bicyclo[2,2,2]octane-1-carboxylic acid;

(R)-2-(4-(3-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid

(R)-2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) phenyl)-2-methylpropanoic acid;

(R)-3-(4-(1-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl- 1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(4-(1-((6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(3-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2,2 -dimethylpropanoic acid;

(R)-3-(3-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) phenyl)-2,2-dimethylpropanoic acid;

(R)-3-(3'-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-[1,1'-biphenyl]-3-yl) -2,2-dimethylpropanoic acid and

(R)-3-(3'-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-[1,1'-biphenyl]-4-yl) -2,2-dimethylpropanoic acid.

Unless otherwise indicated, the terms and abbreviations used in the invention retain their generally accepted meaning.

The present invention also provides a method for preparing the compound of formula (1). For the purpose of illustrating the present invention, a method for preparing the compound of formula (1) is next explained by reaction examples. However, any person skilled in the art could prepare the compound of formula (1) using various methods based on structural formula (1), and such methods should be considered within the scope of the present invention. That is, the compound of formula (1) can be prepared using the methods described in the invention or by combining various methods disclosed in the prior art, which should be considered as falling within the scope of the present invention. Accordingly, the method for preparing the compound of formula (1) is not limited to the following methods.

The compound of formula (1) of the present invention can be prepared by directly introducing a substituted amide group such as a compound of formula (4) into compound (2), or by introducing a protected amine into compound (2), removing the protecting group, and then reacting amidation of the resulting compound (3) according to the method shown in Reaction Scheme 1 below.

Reaction scheme 1

Compound (2) can be prepared from tert-butyl 3-hydroxypiperidine-1-carboxylate as a starting material according to the method shown in Reaction Scheme 2.

Reaction scheme 2

In addition, compound (3) can be obtained by the method according to the following reaction scheme 3.

Reaction scheme 3

The amide derivative compounds of formula (4) in Scheme 1 can be prepared by reacting with thionyl chloride or oxalyl chloride from the appropriate acid and then reacting with an aqueous ammonia solution. For example, methyl 4-(3-amino-3-oxopropyl)benzoate can be prepared by the method described in Reaction Scheme 4 below.

Reaction scheme 4

A compound that is not specifically described in the production method of the present invention is a known compound or a compound that can be easily synthesized from a known compound by a known synthesis method or a similar method.

The compound of formula (1) obtained by the methods described above can be separated or purified from the reaction products by conventional methods such as recrystallization, iontophoresis, silica gel column chromatography or ion exchange chromatography.

As already explained above, the compounds of the present invention, starting materials or intermediates for their preparation can be prepared by various methods, which should be considered as falling within the scope of the present invention in relation to the preparation of the compound of formula (1).

The compound of formula (1) has an inhibitory effect on diacylglycerol O-acyltransferase 2 (DGAT2). Accordingly, the present invention provides a pharmaceutical composition for the treatment of diseases associated with DGAT2, comprising a compound of formula (1) or a pharmaceutically acceptable salt or isomer thereof together with a pharmaceutically acceptable carrier. Also included within the scope of the present invention are various types of prodrugs that are converted to the compound of formula (1) in vivo.

Examples of DGAT2 associated diseases that can be treated with the pharmaceutical composition of the present invention include, but are not limited to, diseases selected from the group consisting of fatty liver disease, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD ), diabetes, obesity, hyperlipidemia, atherosclerosis and hypercholesterolemia.

In the present invention, a "pharmaceutical composition", in addition to the active ingredient of the present invention, may include other components such as carriers, diluents, excipients and the like. Accordingly, the pharmaceutical composition may include, as appropriate, pharmaceutically acceptable carriers, diluents, excipients, or combinations thereof. The pharmaceutical composition facilitates the administration of the compounds into the body. Various methods of administration of the compounds include, but are not limited to, oral, injection, aerosol, parenteral and topical administration.

In the invention, "carrier" means a compound that facilitates the introduction of compounds into a cell or tissue. For example, dimethyl sulfoxide (DMSO) is a traditional carrier that facilitates the introduction of many organic compounds into living cells or tissues.

As used herein, "diluent" means a compound that not only stabilizes the biologically active form, but also dilutes the compound in a solvent that dissolves the compounds. In this case, salt dissolved in the buffer is used as a diluent. A commonly used buffer is phosphate buffered saline, which mimics the salt form in body fluids. Because the buffer solution can control the pH of the solution at low concentrations, the buffer diluent has virtually no effect on the biological activity of the compounds.

In the invention, "pharmaceutically acceptable" means a property that does not adversely affect the biological activity and physical properties of the compounds.

The compounds of the present invention can be prepared in various pharmaceutically administered dosage forms. In preparing the pharmaceutical composition of the present invention, the active ingredient, in particular a compound of formula (1) or a pharmaceutically acceptable salt or isomer thereof, is mixed with selected pharmaceutically acceptable carriers based on the dosage form being prepared. For example, the pharmaceutical composition of the present invention can be prepared in the form of injections, oral preparations and, if necessary, other similar dosage forms.

The compound of the present invention can be prepared by conventional methods using known pharmaceutical carriers and excipients and administered in single-dose or multi-dose containers. Dosage forms may be a solution, suspension or emulsion in oil or in an aqueous solvent and include conventional dispersing agents, suspending agents or stabilizers. In addition, the compound may be, for example, in the form of a dry powder, which is dissolved in sterilized pyrogen-free water before use. The compound of the present invention can be prepared in the form of suppositories by using a traditional suppository base such as cocoa butter or other glycerides. Solid forms for oral administration include capsules, tablets, pills, powders and granules. Capsules and tablets are preferred. Tablets and pills are preferably enteric-coated. Solid forms are prepared by admixing the compounds of the present invention with at least one carrier selected from inert diluents such as sucrose, lactose or starch, lubricants such as stearate, disintegrants, binders and the like.

The compound or pharmaceutical composition comprising the compound of the present invention may be administered, if necessary, in combination with other drugs, for example, other therapeutic agents for metabolic disorders.

The dose of the compound of formula (1) of the present invention is determined by the attending physician taking into account the patient's body weight, age and disease state. The typical dose for adult patients ranges from approximately 0.3 to 500 mg per day depending on the frequency and dose of administration. A typical daily dose for intramuscular or intravenous administration in adult patients ranges from approximately 1 to 300 mg per day, which may be administered in divided single doses. Some patients require a higher daily dose.

In the invention, the term "treatment" is used to mean slowing, delaying or blocking the progression of diseases in a subject who exhibits symptoms of diseases.

USEFUL EFFECTS OF THE INVENTION

The novel amide derivative compound of formula (1) of the present invention exhibits high inhibitory activity against diacylglycerol O-acyltransferase 2 (DGAT2), and therefore can be effectively used in the prevention, alleviation or treatment of metabolic disorders associated with DGAT2. In addition, the new amide derivative compound of formula (1) of the present invention is characterized by increased lipophilicity and liver selectivity, thereby increasing the effectiveness due to increased exposure to the liver, as well as the expected benefits of ease of use, since the half-life is relatively long-term in experimental animal models of the disease and in clinical practice.

OPTION FOR IMPLEMENTATION OF THE INVENTION

Hereinafter, the present invention will be described in more detail using examples of syntheses and examples. However, these examples are illustrative only and in no way limit the scope of the present invention.

In the following examples, M denotes the molar concentration and N denotes the normal concentration. In addition, descriptions of the abbreviations and terms used in the reaction schemes, synthetic examples, and examples are as follows:

DCM: dichloromethane

DIPEA: diisopropylethylamine

DMF: N,N-dimethylformamide

EA: ethyl acetate

HCl: hydrochloric acid

TBAF: tetrabutylammonium fluoride

TEA: triethylamine

TFA: trifluoroacetic acid

THF: tetrahydrofuran

Synthesis example 1. (R)-2-chloro-6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazine

Step 1. Tert-butyl-(R)-3-(2-ethoxyphenoxy)piperidine-1-carboxylate

(S)-tert-butyl-3-hydroxypiperidine-1-carboxylate (30.0 g, 149 mmol), 2-ethoxyphenol (20.6 g, 149 mmol) and triphenylphosphine (43.8 g, 167 mmol) were dissolved in 500 ml toluene and stirred at room temperature. Diethyl azodicarboxylate (30.4 ml) was diluted in 50 ml of toluene and slowly added dropwise to the reaction mixture. After stirring at room temperature for 15 hours, the reaction mixture was filtered, washed with 300 ml of diethyl ether and washed with 100 ml of 3 N sodium hydroxide solution. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 6) to obtain the desired product. (Yield: 47%)

m/z (M+NH ₄ ) ⁺ calculated for C ₁₈ H ₂₇ NO ₄ : 344, detected 344.2

^1H NMR (300 MHz, CHLOROFORM-D): δ 6.89-6.95 (m, 4H), 4.07 (m, 3H), 3.9 (br.s, 1H), 3.66 ( br.s, 1H), 3.16 (m, 2H), 2.07 (br.s, 1H), 1.76-1.83 (m, 2H), 1.45 (m+s, 3H)

Step 2. (R)-3-(2-ethoxyphenoxy)piperidine hydrochloride

Tert-butyl-(R)-3-(2-ethoxyphenoxy)piperidine-1-carboxylate (10.0 g, 31.1 mmol) obtained in step 1 was dissolved in 100 ml dichloromethane, and 4 M hydrochloric acid solution was added dropwise at room temperature. After stirring at room temperature for 4 hours, the completion of the reaction was confirmed by thin layer chromatography (TLC), and the organic solvent was removed under reduced pressure. After dilution with ethyl acetate, the mixture was washed with an aqueous sodium carbonate solution, and the organic solvent was dried over magnesium sulfate. The compound obtained by distillation under reduced pressure was used in the next reaction without further purification.

m/z (M+H) ⁺ calculated for C ₁₃ H ₁₉ NO ₂ : 221.3, detected 222.1

Step 3. (R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazine

(R)-3-(2-ethoxyphenoxy)piperidine hydrochloride obtained in step 2, 2,6-dichloropyrazine (5.10 g, 34.2 mmol) and triethylamine (13 ml, 93 mmol) were mixed with 100 ml ethanol and stirred at room temperature. After stirring at room temperature for 24 hours, the completion of the reaction was confirmed by thin layer chromatography (TLC). After removing the organic solvent under reduced pressure, the mixture was dissolved in ethyl acetate and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 3) to obtain the desired product. (Yield: 91%)

m/z (M+Na) ⁺ calculated for C ₁₇ H ₂₀ ClN ₃ O ₂ : Na 356.8, detected 356.1

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.93 (s, 1H), 7.74 (s, 1H), 7.04-6.93 (m, 2H), 6.92-6, 80 (m, 2H), 4.35-4.24 (m, 1H), 4.07-3.89 (m, 3H), 3.82-3.68 (m, 1H), 3.67- 3.46 (m, 2H), 2.09 (kv, J=4.3 Hz, 1H), 2.02-1.97 (m, 1H), 1.93 (kv, J=4.3 Hz , 1H), 1.68-1.58 (m, 1H), 1.38 (t, J=7.0 Hz, 3H)

Synthesis Example 2: (R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine

Step 1. Tert-butyl (R)-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (1.41 g, 4.22 mmol) prepared in Synthesis Example 1, tert-butyl carbamate (0.55) g, 4.65 mmol), cesium carbonate (3.44 g, 10.56 mmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthine (220 mg, 0.38 mmol) and tris(dibenzylideneacetone) dipalladium(0) (232 mg, 0.25 mmol) was dissolved in 50 ml of 1,4-dioxane, dissolved oxygen was removed by bubbling nitrogen while stirring, and then the outside air was shut off to a sealed container. The reaction mixture was stirred at 110°C for 5 hours and then cooled to room temperature. After filtering through a pad of celite and removing the organic solvent under reduced pressure, the mixture was dissolved in ethyl acetate and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 3: 1) to obtain the desired product. (Yield: 89%)

m/z (M+H) ⁺ calculated for C ₂₂ H ₃₀ N ₄ O ₄ : 415.5, detected 415.0

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.40 (s, 1H), 7.78 (s, 1H), 6.96 (t, J=7.0 Hz, 2H), 6.91 -6.77 (m, 2H), 6.66 (s, 1H), 4.48-4.15 (m, 1H), 4.14-3.85 (m, 3H), 3.84-3 .69 (m, 1H), 3.52-3.41 (1H), 3.40-3.23 (m, 1H), 2.11 (t, J=6.1 Hz, 1H), 2, 01-1.92 (m, 1H), 1.88 (kv, J=4.3 Hz, 1H), 1.57 (dt, J=13.4, 4.0 Hz, 1H), 1.52 (s, 9H), 1.37 (t, J=7.0 Hz, 3H)

Step 2. (R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-amine

Tert-butyl (R)-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamate obtained in step 1 was dissolved in 10 ml of dichloromethane and 2 ml of trifluoroacetic acid was added dropwise with stirring. acids. After confirmation of completion of the reaction by TLC, the organic solvent was removed under reduced pressure. The reaction mixture was diluted with ethyl acetate and washed with an aqueous sodium carbonate solution. The organic solvent was dried over magnesium sulfate and removed under reduced pressure to obtain the crude product, which was used in the next reaction without further purification.

m/z (M+H) ⁺ calculated for C ₁₇ H ₂₂ N ₄ O ₂ : 315.3, detected 315.0

^1H NMR (300 MHz, CHLOROFORM-D): δ 7.49 (s, 1H), 7.28 (s, 1H), 7.27 (d, 1H), 6.90-7.05 (m, 3H), 3.80-4.25 (m, 7H), 3.25 (m, 2H), 2.18 (m, 1H), 1.75-1.98 (m, 2H), 1.91 (m, 1H), 1.43 (t, 3H), 1.27 (m, 1H)

Synthesis Example 3: Methyl 2-(4-carbamoylphenyl)acetate

Step 1. 4-(2-Methoxy-2-oxoethyl)benzoic acid

In 150 ml of methanol at 0°C, 0.34 ml of thionyl chloride was slowly added dropwise. 4-(Carboxymethyl)benzoic acid (17.0 g, 94 mmol) was then dissolved and stirred at room temperature for 5.5 hours. After confirmation of completion of the reaction by TLC, the organic solvent was removed under reduced pressure. The reaction mixture was diluted with 200 ml of diethyl ether, washed with aqueous sodium carbonate (2 x 50 ml) and water (30 ml), and the resulting aqueous solution layer was acidified at 0°C with concentrated hydrochloric acid. The resulting solid was filtered, washed with water and dried to obtain the desired product. (Yield: 71%)

Step 2. Methyl 2-(4-carbamoylphenyl) acetate

4-(2-Methoxy-2-oxoethyl)benzoic acid (1.0 g, 5.15 mmol) obtained in step 1 was dissolved in 30 ml of dichloromethane, and thionyl chloride (0.8 ml) was slowly added dropwise at room temperature , 10.3 mmol). After stirring at room temperature for 4 hours, the organic solvent was removed under reduced pressure. The mixture was dissolved in 5 ml THF, and then slowly added dropwise to a 25% aqueous ammonia solution at 0°C. After stirring for 1 hour, the resulting solid was filtered to obtain the desired product.

Synthesis Example 4: Methyl 2-(4-carbamoylphenyl)-2-methylpropanoate

Step 1. 2-(Trimethylsilyl)ethyl 4-(2-methoxy-2-oxoethyl)-benzoate

4-(2-Methoxy-2-oxoethyl)benzoic acid (7.1 g, 36.6 mmol) obtained in step 1 of Synthesis Example 3 was dissolved in 12 ml THF in the presence of nitrogen and 2-(trimethylsilyl)ethane was added sequentially -1-ol (6.5 g, 54.8 mmol) and triphenylphosphine (24 g, 91 mmol). Diisopropyl azodicarboxylate (16.35 ml) was dissolved in 30 ml THF and slowly added dropwise to the reaction mixture. The mixture was stirred at room temperature for 15 hours. After confirming the disappearance of the starting materials by TLC, the mixture was filtered and washed with 100 ml of diethyl ether. After washing the organic layer with a 3N aqueous sodium hydroxide solution, the organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 10) to obtain the desired product. (Yield: 35%)

Step 2. 2-(Trimethylsilyl)ethyl 4-(1-methoxy-2-methyl-1-oxoprop-2-yl)benzoate

2-(Trimethylsilyl)ethyl 4-(2-methoxy-2-oxoethyl)benzoate (3.81 g, 12.9 mmol) obtained in step 1 was dissolved in 50 ml dimethylformamide and added dropwise slowly at 0°C sodium hydride (60%, 1.04 g, 25.9 mmol). After stirring for 15 minutes, iodomethane (1.62 mL, 25.9 mmol) was slowly added dropwise and stirred at room temperature for 12 hours. The reaction was stopped with 1 N aqueous hydrochloric acid, and the reaction mixture was extracted with ethyl acetate (2 x 30 ml) and washed with brine (20 ml). The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 9) to obtain the desired product. (Yield: 76%)

Step 3. 4-(1-Methoxy-2-methyl-1-oxoprop-2-yl)benzoic acid

2-(Trimethylsilyl)ethyl 4-(1-methoxy-2-methyl-1-oxoprop-2-yl)benzoate (1.0 g, 3.10 mmol) obtained in step 2 was dissolved in 10 ml THF in the presence nitrogen, and 1.0 M TBAF (4.65 mL, 4.65 mmol) was added at 0°C and stirred at room temperature for 12 hours. After confirming the disappearance of the starting materials by TLC, THF was concentrated under reduced pressure, adjusted to pH 2 with 1 N hydrochloric acid plus H ₂ O (3 ml), and the resulting solid was collected by filtration.

Step 4. Methyl 2-(4-carbamoylphenyl)-2-methylpropanoate

4-(1-Methoxy-2-methyl-1-oxoprop-2-yl)benzoic acid obtained in step 3 was used in the same manner as in step 2 of Synthesis Example 3 to obtain the desired product.

Synthesis Example 5: Ethyl 2-(4-carbamoylphenoxy)-2-methylpropanoate

Using benzyl 4-hydroxybenzoate (0.73 g, 3.20 mmol) and ethyl 2-bromo-2-methylpropanoate (0.563 mL, 3.84 mmol), the methods of Synthesis Example 7, Step 2 of Synthesis Example 10, and Step 3 were applied sequentially synthesis example 6 to obtain the desired product. (Yield: 46%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 7.72 (d, 2H), 6.85 (d, 2H), 5.97 (s, 1H), 5.75 (s, 1H), 4.23 (m, 2H), 1.63 (s, 6H), 1.23 (t, 3H)

Synthesis Example 6: Methyl 2-(4-(2-amino-2-oxoethyl)phenyl)-acetate

Step 1. Dimethyl 2,2'-(1,4-phenylene)diacetate

Acetyl chloride (2.9 mL, 40.8 mmol) was slowly added dropwise to methanol (20 mL) at 0°C. 1,4-Phenylenediacetic acid (4.0 g, 20.6 mmol) was then dissolved and the mixture was stirred at reflux for 5 hours. After confirmation of completion of the reaction by TLC, the mixture was cooled to room temperature and the organic solvent was removed under reduced pressure. The reaction product was diluted with 100 ml of ethyl acetate, washed with an aqueous sodium carbonate solution and brine, and the organic solvent was dried over magnesium sulfate and removed under reduced pressure to obtain the desired product.

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.24 (s, 2H), 3.68 (s, 3H), 3.61 (s, 2H)

Step 2. 2-(4-(2-Methoxy-2-oxoethyl)phenyl)acetic acid

Dimethyl 2,2'-(1,4-phenylene)diacetate (4.58 g, 20.6 mmol) obtained in step 1 was dissolved in THF (30 ml) and methanol (10 ml), and slowly added dropwise 10 ml of 2 N sodium hydroxide solution and stirred at room temperature for 3 hours. The organic solvent was removed under reduced pressure, and the reaction mixture was diluted with water and acidified with 2 N hydrochloric acid solution. After extraction with ethyl acetate, the organic solvent was dried over magnesium sulfate and removed under reduced pressure. The desired product was obtained by recrystallization. (Yield: 30%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.25 (d, J=4.9 Hz, 4H), 3.68 (s, 3H), 3.66-3.62 (2H), 3 .61 (s, 2H)

Step 3. Methyl 2-(4-carbamoylphenoxy)-2-methylpropanoate

2-(4-(2-Methoxy-2-oxoethyl)phenyl)acetic acid (1.0 g, 4.8 mmol) obtained in step 2 was dissolved in 30 ml of dichloromethane and thionyl chloride was added dropwise slowly at room temperature. 0.7 ml, 9.6 mmol). After stirring at room temperature for 4 hours, the organic solvent was removed under reduced pressure, and the reaction mixture was dissolved in 5 ml THF, and then slowly added dropwise to a 25% aqueous ammonia solution at 0°C. After stirring for 1 hour, the resulting solid was filtered to obtain the desired product. (Yield: 74%)

¹ H-NMR (500 MHz, DMSO-D6) δ 7.42 (s, 1H), 7.15 (dd, J=12.2, 7.9 Hz, 4H), 6.83 (s, 1H) , 3.60 (s, 2H), 3.57 (d, J=4.3 Hz, 3H), 3.30 (s, 2H)

Synthesis Example 7: Ethyl 4-(4-(2-amino-2-oxoethyl)phenoxy)-butanoate

2-(4-Hydroxyphenyl)acetamide (1.00 g, 6.62 mmol), ethyl 4-bromobutanoate (1.041 mL, 7.28 mmol) and cesium carbonate (4.31 g, 13.23 mmol) were dissolved in DMF (22.05 ml). The reaction mixture was stirred at room temperature for 48 hours. After completion of the reaction, water was added to the reaction solution, then extracted with ethyl acetate. The organic layer was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=2:1) to obtain the desired product. (Yield: 66%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 7.16 (d, 2H), 6.85 (d, 2H), 5.89 (s, 1H), 5.45 (s, 1H), 4.13 (m, 2H), 3.97 (t, 2H), 3.48 (s, 2H), 2.51 (m, 2H), 2.10 (m, 2H), 1.25 (t , 3H)

Synthesis Example 8: Ethyl 2-(4-(2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate

2-(4-Hydroxyphenyl)acetamide (2.0 g, 13.23 mmol) and ethyl 2-bromo-2-methylpropanoate (3.88 mL, 26.5 mmol) were used by the same method as in Synthesis Example 7. to obtain the required product. (Yield: 26%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 7.11 (d, 2H), 6.79 (d, 2H), 6.03 (s, 1H), 5.54 (s, 1H), 4.22 (m, 2H), 3.46 (s, 2H), 1.56 (s, 6H), 1.24 (t, 3H)

Synthesis Example 9: Methyl 2-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2-methylpropanoate

Step 1. Dimethyl 2,2'-(1,4-phenylene)bis(2-methylpropanoate)

Dimethyl 2,2'-(1,4-phenylene)diacetate (3.0 g, 13.5 mmol) obtained in step 1 of Synthesis Example 6 was dissolved in 50 ml of dimethylformamide and sodium hydride (60%, 2.16 g, 54 mmol). After stirring for 15 minutes, iodomethane (3.71 mL, 59.4 mmol) was slowly added dropwise and stirred at room temperature for 12 hours. The reaction was stopped with 1 N aqueous hydrochloric acid, the resulting product was extracted with ethyl acetate and washed with brine, and the organic solvent was dried with magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 9) to obtain the desired product. (Yield: 76%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.28 (s, 4H), 3.66 (s, 6H), 1.57 (s, 12H)

Step 2. Methyl 2-(4-(1-amino-2-methyl-1-oxopropan-2-yl)-phenyl)-2-methylpropanoate

Using the dimethyl 2,2'-(1,4-phenylene)bis(2-methylpropanoate) obtained in Step 1, the methods of Steps 2 and 3 of Synthesis Example 6 were followed sequentially to obtain the title compound. (Yield: 26%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.25-7.29 (m, 4H), 5.31-5.38 (br.s, 2H), 3.66 (s, 3H), 1.56 (s, 12H)

Synthesis Example 10: Methyl 4-(3-amino-3-oxopropyl)benzoate

Step 1. Methyl (E)-4-(3-tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate

Methyl 4-bromobenzoate (16.4 g, 0.07 mol), t-butyl acrylate (18 g, 0.14 mol) and triethylamine (50 ml, 0.35 mol) were dissolved in 200 ml dimethylformamide, and dissolved oxygen was removed by bubbling nitrogen , and bis(triphenylphosphine)palladium dichloride (2.5 g, 3.58 mmol) was added and stirred at 75°C for 12 hours. The organic solvent was removed under reduced pressure, and the reaction mixture was diluted with ethyl acetate, washed with brine and dried with magnesium sulfate. The organic solvent was removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 3) to obtain the desired product. (Yield: 79%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.56 (d, J=15.9 Hz, 1H), 7.46 (d, J=8.7 Hz, 2H), 7.28 (d , J=7.9 Hz, 2H), 6.34 (d, J=15.9 Hz, 1H), 3.70 (s, 3H), 3.64 (s, 2H), 1.53 (s , 9H)

Step 2. Methyl 4-(3-(tert-butoxy)-3-oxopropyl)benzoate

Methyl (E)-4-(3-tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate (5.0 g, 18 mmol) obtained in step 1 was dissolved in 50 ml of methanol, palladium was added in portions on carbon (0.5 g), and carried out the reduction reaction using hydrogen from a cylinder. After confirming the completion of the reaction, the resulting product was filtered through a pad of celite, and the organic solvent was removed under reduced pressure to obtain the desired product. (Yield: 93%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.17 (dd, J=18.3, 7.9 Hz, 4H), 3.68 (s, 3H), 3.59 (s, 2H) , 2.88 (t, J=7.9 Hz, 2H), 2.52 (t, J=7.6 Hz, 2H), 1.41 (s, 9H)

Step 3. 3-(4-(Methoxycarbonyl)phenyl)propanoic acid

Methyl 4-(3-(tert-butoxy)-3-oxopropyl)benzoate (4.67 g, 16.8 mmol) obtained in step 2 was dissolved in 100 ml of 20% trifluoroacetic acid/dichloromethane solution and stirred at room temperature for 2 hours. After confirming the completion of the reaction, the organic solvent was removed under reduced pressure, and the desired product was obtained by recrystallization. (Yield: 100%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 9.58 (s, 2H), 7.18 (dd, J=19.0, 7.9 Hz, 4H), 3.70 (s, 3H) , 3.61 (s, 2H), 2.95 (t, J=7.6 Hz, 2H), 2.69 (t, J=7.9 Hz, 2H)

Step 4. Methyl 4-(3-amino-3-oxopropyl)benzoate

Using 3-(4-(methoxycarbonyl)phenyl)propanoic acid (2.08 g, 9.98 mmol) obtained in Step 3, the desired product was obtained by amidation reaction by the same method as in Step 3 of Synthesis Example 6. (Yield: 65%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.18 (sq, J=7.7 Hz, 4H), 5.41 (s, 2H), 3.66 (d, J=15.9 Hz , 3H), 3.59 (s, 2H), 3.02-2.87 (2H), 2.51 (t, J=7.6 Hz, 2H)

Synthesis Example 11: Methyl (E)-4-(3-amino-3-oxoprop-1-en-1-yl)benzoate

Using methyl (E)-4-(3-tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate (0.09 g, 0.44 mmol) obtained in Step 1 of Synthesis Example 10, the desired product was obtained hydrolysis reaction (yield: 100%) and amidation reaction (yield: 76%) by the same method as in steps 3 and 4 of synthesis example 10.

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.05 (d, J=8.4 Hz, 2H), 7.68 (d, J=15.6 Hz, 1H), 7.58 (d , J=8.4 Hz, H), 6.53 (d, J=15.6 Hz, 1H), 5.5 (br.s, 2H), 3.93 (s, 3H)

Synthesis Example 12: Methyl (E)-4-(3-amino-2-methyl-3-oxoprop-1-en-1-yl)benzoate

Step 1. Methyl (E)-4-(3-(tert-butoxy)-2-methyl-3-oxoprop-1-en-1-yl)benzoate

Tert-butyl methacrylate (3.97 g, 27.9 mmol) and methyl 4-bromobenzoate (3.0 g, 13.95 mmol) were used in the same manner as in Step 1 of Synthesis Example 10 to obtain the desired product. (Yield: 48%)

¹ H-NMR (500 MHz, METHANOL-D3) δ 8.04 (d, J=6.7 Hz, 2H), 7.95 (d, J=7.3 Hz, 2H), 7.58 (s , 1H), 7.42 (dd, J=20.5, 13.1 Hz, 2H), 7.25 (dd, J=4.0, 2.8 Hz, 6H), 3.99-3, 85 (m, 7H), 3.63 (s, 2H), 2.11-2.01 (m, 3H), 1.47-1.36 (9H)

Step 2. (E)-3-(4-(methoxycarbonyl)phenyl)-2-methylacrylic acid

Methyl (E)-4-(3-(tert-butoxy)-2-methyl-3-oxoprop-1-en-1-yl)benzoate (0.72 g, 2.59 mmol) obtained in step 1 was used as follows the same method as in step 3 of synthesis example 10 to obtain the desired product. (Yield: 100%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.07 (d, J=7.9 Hz, 2H), 7.97 (d, J=7.9 Hz, 2H), 7.80 (s , 1H), 7.47 (d, J=7.9 Hz, 2H), 7.28 (d, J=7.9 Hz, 2H), 7.25 (s, 5H), 7.23 (s , 1H), 6.41 (s, 1H), 5.62 (s, 1H), 3.93 (s, 3H), 3.89 (d, J=13.4 Hz, 3H), 3.69 (s, 2H), 2.17-2.07 (m, 3H)

Step 3. Methyl (E)-4-(3-amino-2-methyl-3-oxoprop-1-en-1-yl)benzoate

Using (E)-3-(4-(methoxycarbonyl)phenyl)-2-methyl-acrylic acid (0.57 g, 2.59 mmol) obtained in step 2, the desired product was obtained by amidation reaction using a method similar to the method at step 4 of synthesis example 10. (Yield: 92%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.10-8.02 (2H), 7.98 (d, J=7.9 Hz, 2H), 7.45 (d, J=10, 4 Hz, 1H), 7.42-7.34 (m, 2H), 7.29 (d, J=7.9 Hz, 2H), 5.81 (s, 1H), 5.38-5, 28 (m, 1H), 3.93 (s, 3H), 3.90 (s, 3H), 3.72 (s, 2H), 2.17 (s, 2H), 2.12 (d, J =1.2 Hz, 3H), 2.03 (d, J=10.4 Hz, 0H), 1.26 (t, J=7.0 Hz, 2H), 0.88 (t, J=7 .0 Hz, 1H)

Synthesis Example 13: Methyl 4-(3-amino-2-methyl-3-oxopropyl)-benzoate

Step 1. Methyl 4-(3-(tert-butoxy)-2-methyl-3-oxopropyl)-benzoate

Using methyl (E)-4-(3-(tert-butoxy)-2-methyl-3-oxoprop-1-en-1-yl)benzoate (1.12 g, 4.05 mmol) prepared in Step 1 of Synthetic Example 12, the desired product was obtained by reduction reaction using a method similar to the method in step 2 of Synthesis Example 10. (Yield: 96%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.98-7.91 (m, 2H), 7.28-7.25 (m, 2H), 7.24 (s, 1H), 3, 91 (d, J=10.4 Hz, 3H), 3.05-2.95 (m, 1H), 2.72-2.59 (m, 2H), 1.58 (s, 0H), 1 .43-1.32 (m, 10H), 1.17 (s, 0H), 1.17-1.10 (3H)

Step 2. 3-(4-(Methoxycarbonyl)phenyl)-2-methylpropanoic acid

Methyl 4-(3-(tert-butoxy)-2-methyl-3-oxopropyl)benzoate (1.08 g, 3.90 mmol) obtained in step 1 was used in the same manner as in step 3 of Synthesis Example 10, with obtaining the required product. (Yield: 100%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.95 (q, J=7.7 Hz, 2H), 7.35-7.22 (m, 2H), 3.99-3.85 ( m, 3H), 3.11 (kv, J=6.5 Hz, 1H), 2.87-2.69 (m, 2H), 2.34 (d, J=15.3 Hz, 1H), 1.32-1.13 (m, 3H)

Step 3. Methyl 4-(3-amino-2-methyl-3-oxopropyl)benzoate

Using 3-(4-(methoxycarbonyl)phenyl)-2-methylpropanoic acid (0.87 g, 3.90 mmol) obtained in step 2, the desired product was prepared by amidation reactions using a method similar to that in step 4 of Synthesis Example 10 (Yield: 92%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.10-8.02 (2H), 7.98 (d, J=7.9 Hz, 2H), 7.45 (d, J=10, 4 Hz, 1H), 7.42-7.34 (m, 2H), 7.29 (d, J=7.9 Hz, 2H), 5.81 (s, 1H), 5.38-5, 28 (m, 1H), 3.93 (s, 3H), 3.90 (s, 3H), 3.72 (s, 2H), 2.17 (s, 2H), 2.12 (d, J =1.2 Hz, 3H), 2.03 (d, J=10.4 Hz, 0H), 1.26 (t, J=7.0 Hz, 2H), 0.88 (t, J=7 .0 Hz, 1H)

Synthesis Example 14: Methyl 4-(3-amino-3-oxopropyl)-2-fluorobenzoate

Step 1. Methyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2-fluorobenzoate

Methyl 4-bromo-2-fluorobenzoic acid (0.34 g, 1.46 mmol) and tert-butyl acrylate (0.37 g, 2.92 mmol) were used in the same manner as in Step 1 of Synthesis Example 10 to obtain the desired product . (Yield: 56%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.94 (s, 1H), 7.51 (d, J=15.9 Hz, 1H), 7.32 (d, J=7.9 Hz , 1H), 7.26 (t, J=5.8 Hz, 1H), 6.43 (d, J=15.9 Hz, 1H), 3.93 (s, 3H), 1.53 (s , 9H)

Step 2. Methyl 4-(3-(tert-butoxy)-3-oxopropyl)-2-fluorobenzoate

Using methyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2-fluorobenzoate (0.23 g, 0.82 mmol) obtained in step 1, the desired product prepared by reduction reaction using a method similar to the method in step 2 of Synthesis Example 10. (Yield: 99%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.85 (t, J=7.9 Hz, 1H), 7.04 (dd, J=7.9, 1.2 Hz, 1H), 6.98 (dd, J=11.6, 1.2 Hz, 1H), 3.91 (s, 3H), 2.93 (t, J=7.6 Hz, 2H), 2.55 (t , J=7.3 Hz, 2H), 1.41 (s, 9H)

Step 3. 3-(3-Fluoro-4-(methoxycarbonyl)phenyl)propanoic acid

Methyl 4-(3-(tert-butoxy)-3-oxopropyl)-2-fluorobenzoate (0.23 g, 0.82 mmol) obtained in Step 2 was used in the same manner as in Step 3 of Synthesis Example 10 to give required product. (Yield: 98%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 10.05 (s, 1H), 7.87 (t, J=7.9 Hz, 1H), 7.12-7.04 (m, 1H ), 7.00 (d, J=11.6 Hz, 1H), 3.92 (s, 3H), 2.99 (t, J=7.6 Hz, 2H), 2.72 (t, J =7.6 Hz, 2H)

Step 4. Methyl 4-(3-amino-3-oxopropyl)-2-fluorobenzoate

3-(3-Fluoro-4-(methoxycarbonyl)phenyl)propanoic acid (0.18 g, 0.8 mmol) obtained in step 3 was used in the same method as in step 4 of Synthesis Example 10 to obtain the desired product . (Yield: 95%)

Synthesis Example 15: Methyl 4-(3-amino-3-oxopropyl)-2-methyl benzoate

Step 1. Methyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2-methylbenzoate

Methyl 4-bromo-2-methylbenzoate (1.0 g, 4.54 mmol) and tert-butyl acrylate (1.15 g, 9.08 mmol) were used in the same manner as in Step 1 of Synthesis Example 10 to obtain the desired product. (Yield: 100%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.90 (d, J=7.9 Hz, 1H), 7.54 (d, J=15.9 Hz, 1H), 7.42- 7.31 (2H), 6.42 (d, J=15.9 Hz, 1H), 3.89 (s, 3H), 2.60 (s, 3H), 1.53 (s, 9H)

Step 2. Methyl 4-(3-(tert-butoxy)-3-oxopropyl)-2-methyl benzoate

Using methyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2-methylbenzoate (1.2 g, 4.34 mmol) obtained in step 1, the desired product was obtained by reduction reaction using the same method as in step 2 of synthesis example 10. (Yield: 96%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.89-7.78 (m, 1H), 7.06 (d, J=6.1 Hz, 2H), 3.86 (s, 3H ), 2.89 (t, J=7.6 Hz, 2H), 2.57 (s, 3H), 2.52 (d, J=7.9 Hz, 2H), 1.41 (s, 9H )

Step 3. 3-(4-Methoxycarbonyl)-3-methylphenyl)propanoic acid

Methyl 4-(3-(tert-butoxy)-3-oxopropyl)-2-methylbenzoate (1.16 g, 4.17 mmol) obtained in Step 2 was used in the same manner as in Step 3 of Synthesis Example 10 to give required product. (Yield: 92%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 10.96 (s, 1H), 7.85 (d, J=8.6 Hz, 1H), 7.08 (s, 2H), 3, 88 (s, 3H), 2.95 (t, J=7.6 Hz, 2H), 2.70 (t, J=7.6 Hz, 2H), 2.57 (s, 3H)

Step 4. Methyl 4-(3-amino-3-oxopropyl)-2-methylbenzoate

Using 3-(4-methoxycarbonyl)-3-methylphenyl)propanoic acid (0.9 g, 4.04 mmol) obtained in step 3, the desired product was obtained by amidation reaction using the same method as in step 4 of Synthesis Example 10 (Yield: 90%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.84 (t, J=4.3 Hz, 1H), 7.08 (d, J=5.5 Hz, 2H), 5.37 ( d, J=22.0 Hz, 2H), 3.86 (s, 3H), 2.96 (t, J=7.6 Hz, 2H), 2.56 (s, 3H), 2.52 ( t, J=7.6 Hz, 2H)

Synthesis Example 16: Methyl 4-(3-amino-3-oxopropyl)-2-methoxybenzoate

Methyl 4-bromo-2-methoxybenzoate (0.98 g, 4.00 mmol) was used in the same manner as Synthesis Example 10 to obtain the desired product. (Yield: 39%)

Synthesis Example 17: Methyl 4-(3-amino-3-oxopropyl)-2-chloro-benzoate

Step 1. Methyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2-chlorobenzoate

Methyl 4-bromo-2-chlorobenzoate (2.0 g, 8.73 mmol) and tert-butyl acrylate (2.24 g, 17.5 mmol) were used in the same manner as in Step 1 of Synthesis Example 10 to obtain the desired product. (Yield: 85%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.84 (d, J=8 Hz, 1H), 7.58 (d, J=1.2 Hz, 1H), 7.54 (d, J =13.6 Hz, 1H), 7.42 (d, J=8 Hz, 1H), 6.43 (d, J=16 Hz, 1H), 3.94 (s, 3H), 1.54 ( s, 9H)

Step 2. Methyl 4-(3-(tert-butoxy)-3-oxopropyl)-2-chloro-benzoate

Using methyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2-chlorobenzoate (0.28 g, 0.93 mmol) obtained in step 1, the desired product was obtained by reduction reaction using the same method as in step 2 of synthesis example 10. (Yield: 89%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.78 (d, J=8 H, 1H), 7.30 (s, 1H), 7.15 (d, J=8 Hz, 1H), 3.92 (s, 3H), 2.92 (t, J=8 Hz, 2H), 2.55 (t, J=8 Hz, 2H), 1.42 (s, 9H)

Step 3. 3-(3-Chloro-4-(methoxycarbonyl)phenyl)propanoic acid

Methyl 4-(3-(tert-butoxy)-3-oxopropyl)-2-chlorobenzoate (0.25 g, 0.83 mmol) obtained in step 2 was used in the same manner as in step 3 of Synthesis Example 10 to obtain required product. (Yield: 100%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.79 (s, J=8 Hz, 1H), 7.32 (d, J=4 Hz, 1H), 7.17 (dd, J=8 Hz, 4 Hz, 1H), 3.92 (s, 3H), 2.97 (t, J=8 Hz, 2H), 2.70 (t, J=8 Hz, 2H)

Step 4. Methyl 4-(3-amino-3-oxopropyl)-2-chlorobenzoate

Using 3-(3-chloro-4-(methoxycarbonyl)phenyl)propanoic acid (0.20 g, 0.83 mmol) obtained in step 3, the desired product was obtained by amidation reaction by the same method as in step 4 of Synthesis Example 10 (Yield: 89%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.78 (d, J=8 Hz, 1H), 7.32 (s, 1H), 7.17 (d, J=8 Hz, 1H), 3.92 (s, 3H), 2.99 (t, J=8 Hz, 2H), 2.53 (t, J=8 Hz, 2H)

Synthesis Example 18: Methyl 3-(3-amino-3-oxopropyl)benzoate

Step 1. Methyl (E)-3-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate

Methyl 3-formyl benzoate (0.60 g, 3.65 mmol) and (tert-butoxycarbonylmethylene)triphenylphosphorane (2.06 g, 5.48 mmol) were dissolved in dichloromethane (18.27 ml) and stirred at room temperature for 16 hours. The reaction solution was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=1:4) to obtain the desired product. (Yield: 94%)

Step 2. Methyl 3-(3-(tert-butoxy)-3-oxopropyl)benzoate

Methyl (E)-3-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate (0.90 g, 3.43 mmol) obtained in step 1 was used in the same manner as in step 2 of Synthesis Example 10 to obtain the desired product. (Yield: 99%)

Step 3. Methyl 3-(3-amino-3-oxopropyl)benzoate

Using methyl 3-(3-(tert-butoxy)-3-oxopropyl)benzoate (0.90 g, 3.40 mmol) obtained in step 2, the methods of steps 3 and 4 of Synthesis Example 10 were applied sequentially to obtain the desired product. (Yield: 78%)

Synthesis Example 19: Methyl 2-(4-(3-amino-3-oxopropyl)phenyl)-acetate

Step 1. Methyl (E)-4-(3-tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate

Methyl 2-(4-bromophenyl)acetate (16.4 g, 70.0 mmol) and tert-butyl acrylate (18.0 g, 140.0 mmol) were used in the same manner as Step 1 of Synthesis Example 10 to obtain the desired product . (Yield: 79%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.56 (d, J=15.9 Hz, 1H), 7.46 (d, J=8.7 Hz, 2H), 7.28 (d , J=7.9 Hz, 2H), 6.34 (d, J=15.9 Hz, 1H), 3.70 (s, 3H), 3.64 (s, 2H), 1.53 (s , 9H)

Step 2. Methyl 4-(3-(tert-butoxy)-3-oxopropyl)benzoate

Using methyl (E)-4-(3-tert-butoxy)-3-oxoprop-1-en-1-yl)benzoate (5.0 g, 18.0 mmol) obtained in step 1, the desired product was obtained by reduction reaction as follows the same method as in step 2 of synthesis example 10. (Yield: 93%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.17 (dd, J=18.3, 7.9 Hz, 4H), 3.68 (s, 3H), 3.59 (s, 2H) , 2.88 (t, J=7.9 Hz, 2H), 2.52 (t, J=7.6 Hz, 2H), 1.41 (s, 9H)

Step 3. 3-(4-(2-Methoxy-2-oxoethyl)phenyl)propanoic acid

Methyl 4-(3-(tert-butoxy)-3-oxopropyl)benzoate (4.67 g, 16.8 mmol) obtained in Step 2 was used in the same manner as in Step 3 of Synthesis Example 10 to obtain the desired product. (Yield: 100%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 9.58 (s, 2H), 7.18 (dd, J=19.0, 7.9 Hz, 4H), 3.70 (s, 3H) , 3.61 (s, 2H), 2.95 (t, J=7.6 Hz, 2H), 2.69 (t, J=7.9 Hz, 2H)

Step 4. Methyl 2-(4-(3-amino-3-oxopropyl)phenyl)acetate

Using 3-(4-(2-methoxy-2-oxoethyl)phenyl)propanoic acid (3.73 g, 16.8 mmol) obtained in step 3, the desired product was obtained by amidation reaction by the same method as in step 4 of example synthesis 10. (Yield: 65%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.18 (sq, J=7.7 Hz, 4H), 5.41 (s, 2H), 3.66 (d, J=15.9 Hz , 3H), 3.59 (s, 2H), 3.02-2.87 (2H), 2.51 (t, J=7.6 Hz, 2H)

Synthesis Example 20: Methyl 2-(4-(3-amino-3-oxopropyl)phenyl-2-methylpropanoate

Step 1. Tert-butyl (E)-3-(4-(1-methoxy-2-methyl-1-oxo-propan-2-yl)phenyl)acrylate

Methyl 2-(4-bromophenyl)-2-methylpropanoate (1.0 g, 3.89 mmol) and tert-butyl acrylate (0.98 g, 7.8 mmol) were used in the same manner as in step 1 of Synthesis Example 10, with obtaining the required product. (Yield: 79%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.56 (dd, J=15.9, 4.3 Hz, 1H), 7.51-7.42 (2H), 7.41-7 .31 (m, 2H), 6.34 (dd, J=15.9, 4.9 Hz, 1H), 3.66 (d, J=4.9 Hz, 3H), 1.58 (d, J=4.9 Hz, 6H), 1.53 (d, J=4.9 Hz, 9H)

Step 2. Methyl 2-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-2-methylpropanoate

Using tert-butyl (E)-3-(4-(1-methoxy-2-methyl-1-oxo-propan-2-yl)phenyl)acrylate (0.93 g, 3.06 mmol) obtained in step 1, the desired product was obtained by reduction reaction using the same method as in step 2 of synthesis example 10. (Yield: 96%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.23 (s, 2H), 7.15 (d, J=7.9 Hz, 2H), 3.63 (s, 3H), 2, 87 (t, J=7.9 Hz, 2H), 2.52 (t, J=7.9 Hz, 2H), 1.55 (s, 6H), 1.40 (s, 9H)

Step 3. 3-(4-(1-Methoxy-2-methyl-1-oxopropan-2-yl)-phenyl)propanoic acid

Methyl 2-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-2-methylpropanoate (0.90 g, 2.92 mmol) obtained in step 2 was used in the same manner as in step 3 examples of synthesis 10, obtaining the desired product. (Yield: 96%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.26 (d, J=7.3 Hz, 2H), 7.16 (d, J=7.9 Hz, 2H), 3.66 ( s, 3H), 3.03-2.84 (2H), 2.82-2.55 (2H), 1.56 (s, 6H)

Step 4. Methyl 2-(4-(3-amino-3-oxopropyl)phenyl)-2-methylpropanoate

Using 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)-phenyl)propanoic acid (0.7 g, 2.8 mmol) obtained in step 3, the desired product was obtained by amidation reaction by the same method as in step 4 of synthesis example 10. (Yield: 99%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.25 (dd, J=6.4, 2.1 Hz, 2H), 7.17 (d, J=7.9 Hz, 2H), 5.36 (s, 2H), 3.64 (s, 3H), 3.00-2.90 (2H), 2.52 (t, J=7.6 Hz, 2H), 1.56 (d , J=4.3 Hz, 6H)

Synthesis Example 21: Methyl 1-(4-(3-amino-3-oxopropyl)phenyl)cyclopropane-1-carboxylate

Step 1. Methyl (E)-1-(4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)phenyl)cyclopropane-1-carboxylate

Methyl 1-(4-bromophenyl)cyclopropane-1-carboxylate (1.0 g, 3.92 mmol) and tert-butyl acrylate (0.99 g, 7.84 mmol) were used in the same manner as in step 1 of Synthesis Example 10. to obtain the required product. (Yield: 78%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.56 (d, J=15.9 Hz, 1H), 7.44 (d, J=7.9 Hz, 2H), 7.33 ( d, J=7.9 Hz, 2H), 6.34 (d, J=15.9 Hz, 1H), 3.62 (s, 3H), 1.62 (t, J=3.4 Hz, 2H), 1.52 (s, 9H), 1.19 (t, J=3.4 Hz, 2H)

Step 2. Methyl 1-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-cyclopropane-1-carboxylate

Using methyl (E)-1-(4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)phenyl)cyclopropane-1-carboxylate (0.93 g, 3.08 mmol), obtained in step 1, the desired product was obtained by reduction reaction by the same method as in step 2 of synthesis example 10. (Yield: 96%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.24 (d, J=8.6 Hz, 2H), 7.13 (d, J=7.9 Hz, 2H), 3.61 ( s, 3H), 2.89 (t, J=7.9 Hz, 2H), 2.53 (t, J=7.9 Hz, 2H), 1.57 (kv, J=3.7 Hz, 2H), 1.40 (d, J=4.9 Hz, 9H), 1.16 (kv, J=3.7 Hz, 2H)

Step 3. 3-(4-(1-(Methoxycarbonyl)cyclopropyl)phenyl)-propanoic acid

Methyl 1-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)cyclopropane-1-carboxylate (0.90 g, 2.96 mmol) obtained in step 2 was used in the same manner as in Step 3 of Synthesis Example 10 to obtain the desired product. (Yield: 97%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.61 (s, 1H), 7.26 (d, J=8.6 Hz, 2H), 7.15 (d, J=7.9 Hz, 2H), 3.64 (s, 3H), 2.95 (t, J=7.3 Hz, 2H), 2.74 (s, 2H), 1.61 (kv, J=3.5 Hz, 2H), 1.20 (kv, J=3.5 Hz, 2H)

Step 4. Methyl 1-(4-(3-amino-3-oxopropyl)phenyl)cyclopropane-1-carboxylate

Using 3-(4-(1-(methoxycarbonyl)cyclopropyl)phenyl)-propanoic acid (0.7 g, 2.82 mmol) obtained in step 3, the desired product was obtained by amidation reaction by the same method as in step 4 of example synthesis 10. (Yield: 95%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.28-7.24 (m, 2H), 7.15 (d, J=8.6 Hz, 2H), 5.41 (s, 2H ), 3.61 (t, J=2.4 Hz, 3H), 2.95 (t, J=7.6 Hz, 2H), 2.52 (t, J=7.6 Hz, 2H), 1.58 (kv, J=3.7 Hz, 2H), 1.16 (kv, J=3.5 Hz, 2H)

Synthesis Example 22: Methyl 4-(3-amino-3-oxopropyl)-2,6-difluorobenzoate

Methyl 4-bromo-2,6-difluorobenzoate (1.0 g, 3.98 mmol) was used in the same manner as Synthesis Example 10 to obtain the desired product. (Yield: 39%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 6.81 (d, J=9.1 Hz, 2H), 5.35 (s, 2H), 3.92 (s, 3H), 3, 02-2.92 (t, 2H), 2.51 (t, J=7.5 Hz, 2H)

Synthesis Example 23: 2-(trimethylsilyl)ethyl 4-(3-amino-3-oxopropyl)2,6-dichlorobenzoate

Step 1. 2-(Trimethylsilyl)ethyl 4-bromo-2,6-dichlorobenzoate

After dissolving 4-bromo-2,6-dichlorobenzoic acid (300 mg, 1.112 mmol) in 8 ml THF in the presence of nitrogen, 2-(trimethylsilyl)ethan-1-ol (0.250 ml, 1.667 mmol) was added successively at 0°C. , diisopropyl azodicarboxylate (0.530 ml, 2.56 mmol) and triphenylphosphine (729 mg, 2.78 mmol), and stirred at room temperature for 2 hours. After confirming the disappearance of starting materials by TLC, the reaction was stopped with water, then extracted with ethyl acetate (30 ml × 3). The organic layer was dried over magnesium sulfate, and the organic solvent was removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 10) to obtain the desired product. (Yield: 47%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 7.52 (s, 2H), 4.52-4.46 (m, 2H), 1.20-1.14 (m, 2H), 0. 10 (s, 9H)

Step 2. 2-(Trimethylsilyl)ethyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2,6-dichlorobenzoate

2-(Trimethylsilyl)ethyl 4-bromo-2,6-dichlorobenzoate (205 mg, 0.554 mmol) obtained in Step 1 was used in the same method as in Step 1 of Synthesis Example 10 to obtain the desired product.

¹ H NMR (300 MHz, CHLOROFORM-D): δ 7.45 (s, 2H), 7.44 (d, J=15.9 Hz, 1H), 6.41 (d, J=15.9 Hz , 1H), 4.53-4.47 (m, 2H), 1.55 (s, 9H) 1.21-1.15 (m, 2H), 0.10 (s, 9H)

Step 3. 2-(Trimethylsilyl)ethyl 4-(3-(tert-butoxy)-3-oxopropyl)-2,6-dichlorobenzoate

Using 2-(trimethylsilyl)ethyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2,6-dichlorobenzoate (150 mg, 0.453 mmol) obtained in step 2 , the desired product was obtained by reduction reaction using the same method as in step 2 of synthesis example 10.

¹ H NMR (300 MHz, CHLOROFORM-D): δ 7.19 (s, 2H), 3.98 (s, 3H), 2.87 (t, J=7.5 Hz, 2H), 2.54 (t, J=7.5 Hz, 2H), 1.44 (s, 9H)

Step 4. 3-(3,5-Dichloro-4-((2-(trimethylsilyl)ethyl)-carbonyl)phenyl)propanoic acid

2-(Trimethylsilyl)ethyl 4-(3-(tert-butoxy)-3-oxopropyl)-2,6-dichlorobenzoate (141 mg, 0.423 mmol) obtained in step 3 was used in the same manner as in step 3 of Synthesis Example 10 , obtaining the required product.

Step 5. 2-(Trimethylsilyl)ethyl 4-(3-amino-3-oxopropyl)-2,6-dichlorobenzoate

Using 3-(3,5-dichloro-4-((2-(trimethylsilyl)ethyl)carbonyl)phenyl)propanoic acid obtained in step 4, the desired product was obtained by amidation reaction by the same method as in step 4 of Synthesis Example 10 .

Synthesis Example 24: 2-(trimethylsilyl)ethyl 4-(3-amino-3-oxopropyl)-2,6-dimethylbenzoate

Step 1. 2-(Trimethylsilyl)ethyl 4-bromo-2,6-dimethylbenzoate

4-Bromo-2,6-dimethylbenzoic acid (2.0 g, 8.73 mmol) was used in the same manner as in Step 1 of Synthesis Example 23 to obtain the desired product. (Yield: 69%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.19 (s, 2H), 4.40 (t, J=8.9 Hz, 2H), 2.29 (s, 6H), 1, 11 (t, J=8.9 Hz, 2H), 0.07 (d, J=3.1 Hz, 9H)

Step 2. 2-(Trimethylsilyl)ethyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2,6-dimethylbenzoate

2-(Trimethylsilyl)ethyl 4-bromo-2,6-dimethylbenzoate (1.99 g, 6.04 mmol) obtained in Step 1 was used in the same manner as in Step 1 of Synthesis Example 10 to obtain the desired product. (Yield: 50%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.49 (d, J=15.9 Hz, 1H), 7.17-7.10 (2H), 6.35 (d, J=15 .9 Hz, 1H), 4.41 (t, J=8.9 Hz, 2H), 2.30 (s, 6H), 1.52 (s, 9H), 1.16-1.07 (m , 2H), 0.07 (d, J=2.4 Hz, 9H)

Step 3. 2-(Trimethylsilyl)ethyl 4-(3-(tert-butoxy)-3-oxo-propyl)-2,6-dimethylbenzoate

Using 2-(trimethylsilyl)ethyl (E)-4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)-2,6-dimethylbenzoate (1.13 g, 3.0 mmol), obtained in step 2, the desired product was obtained by reduction reaction by the same method as in step 2 of synthesis example 10. (Yield: 69%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 6.85 (s, 2H), 4.39 (t, J=8.9 Hz, 2H), 2.81 (d, J=7.9 Hz, 2H), 2.49 (t, J=7.9 Hz, 2H), 2.29 (s, 6H), 1.45-1.39 (9H), 1.16-1.07 (m , 2H), 0.06 (s, 9H)

Step 4. 3-(3,5-Dimethyl-4-((2-(trimethylsilyl)ethyl)-carbonyl)phenyl)propanoic acid

2-(Trimethylsilyl)ethyl 4-(3-(tert-butoxy)-3-oxopropyl)-2,6-dimethylbenzoate (0.78 g, 2.06 mmol) obtained in step 3 was used in the same manner as in step 3 examples of synthesis 10, obtaining the desired product. (Yield: 60%)

Step 5. 2-(Trimethylsilyl)ethyl 4-(3-amino-3-oxopropyl)-2,6-dimethylbenzoate

Using 3-(3,5-dimethyl-4-((2-(trimethylsilyl)ethyl)carbonyl)phenyl)propanoic acid obtained in step 4, the desired product was obtained by amidation reaction by the same method as in step 4 of Synthesis Example 10 (Yield: 88%)

Synthesis Example 25: Ethyl 1-(4-(3-amino-3-oxopropyl)phenyl)-piperidine-4-carboxylate

Step 1. Ethyl 1-(4-formylphenyl)piperidine-4-carboxylate

4-Fluorobenzaldehyde (0.864 ml, 8.06 mmol), ethyl piperidine-4-carboxylate (1.490 ml, 9.67 mmol) and potassium carbonate (5.57 g, 40.3 mmol) were dissolved in DMF (16.11 ml) . The temperature was raised to 100°C and stirred for 16 hours. After completion of the reaction, water was added to the reaction solution, then extracted with ethyl acetate. The organic layer was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=1:4) to obtain the desired product. (Yield: 81%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 9.72 (d, J=3.1 Hz, 1H), 7.70 (m, 2H), 6.97-6.78 (m, 2H ), 4.12 (m, 2H), 3.91-3.72 (m, 2H), 3.10-2.88 (m, 2H), 2.61-2.43 (m, 1H), 2.08-1.89 (m, 2H), 1.87-1.69 (m, 2H), 1.23 (m, 3H)

Step 2. Ethyl (E)-1-(4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)phenyl)piperidine-4-carboxylate

Ethyl 1-(4-formylphenyl)piperidine-4-carboxylate (0.52 g, 1.990 mmol) obtained in step 1 and (tert-butoxycarbonylmethylene)triphenylphosphorane (0.974 g, 2.59 mmol) were dissolved in dichloromethane (9, 95 ml) and stirred at room temperature for 16 hours. The reaction solution was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=1:4) to obtain the desired product. (Yield: 84%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.50 (d, J=15.9 Hz, 1H), 7.39 (d, J=8.6 Hz, 2H), 6.86 ( d, J=8.6 Hz, 2H), 6.19 (d, J=15.9 Hz, 1H), 4.15 (kv, J=7.1 Hz, 2H), 3.74 (m, 2H), 2.98-2.80 (m, 2H), 2.55-2.37 (m, 1H), 2.11-1.94 (m, 2H), 1.94-1.74 ( m, 2H), 1.51 (s, 9H), 1.26 (t, J=7.0 Hz, 3H)

Step 3. Ethyl 1-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-piperidine-4-carboxylate

Using ethyl (E)-1-(4-(3-(tert-butoxy)-3-oxoprop-1-en-1-yl)phenyl)piperidine-4-carboxylate (0.60 g, 1.669 mmol) obtained from step 2, the desired product was obtained by reduction reaction using the same method as in step 2 of Synthesis Example 10. (Yield: 99%)

Step 4. Ethyl 1-(4-(3-amino-3-oxopropyl)phenyl)piperidine-4-carboxylate

Using ethyl 1-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-piperidine-4-carboxylate (0.60 g, 1.660 mmol) obtained in step 3, the methods of steps 3 and 4 of the synthesis example were followed sequentially 10 with obtaining the required product. (Yield: 69%)

Synthesis Example 26: Ethyl 1-(4-carbamoyl-2,6-difluorophenyl)-piperidine-4-carboxylate

Using tert-butyl 3,4,5-trifluorobenzoate (0.50 g, 2.15 mmol) and ethyl piperidine-4-carboxylate (0.398 mL, 2.58 mmol), the methods from step 1 of Synthesis Example 25 and steps 3 were followed sequentially and 4 examples of the synthesis of 10 to obtain the desired product. (Yield: 58%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 7.33 (m, 2H), 5.78 (s, 2H), 4.19 (m, 2H), 3.42 (d, 2H), 3.17 (t, 2H), 2.50 (m, 1H), 2.00-1.82 (m, 4H), 1.29 (t, 3H)

Synthesis Example 27: Ethyl 2-(1-(4-carbamoyl-2,6-difluorophenyl)-piperidin-4-yl)acetate

Tert-butyl 3,4,5-trifluorobenzoate (0.50 g, 2.15 mmol) and ethyl 2-(piperidin-4-yl) acetate (0.44 g, 2.58 mmol) were used by the same method as in the example synthesis 26 to obtain the desired product. (Yield: 59%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 7.27 (m, 2H), 5.67 (s, 2H), 4.18 (m, 2H), 3.38 (d, 2H), 3.17 (t, 2H), 2.30 (d, 2H), 1.97 (m, 1H), 1.79 (d, 2H), 1.45 (m, 2H), 1.29 (t , 3H)

Synthesis Example 28: Ethyl 2-(4-(3-amino-3-oxopropyl)phenoxy)-2-methylpropanoate

4-Hydroxybenzaldehyde (1.0 g, 8.19 mmol) and ethyl 2-bromo-2-methylpropanoate (2.404 mL, 16.38 mmol) were used in the same manner as Synthesis Example 25 to obtain the desired product. (Yield: 29%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 7.07 (d, 2H), 6.77 (d, 2H), 5.29 (s, 2H), 4.25 (m, 2H), 2.91 (t, 2H), 2.50 (t, 2H), 1.59 (s, 6H), 1.26 (t, 3H)

Synthesis Example 29: Ethyl 3-(4-(3-amino-3-oxopropyl)phenyl)propanoate

Using 4-bromobenzaldehyde (0.5 g, 2.70 mmol) and (carbethoxymethylene)triphenylphosphorane (1.224 g, 3.51 mmol), the methods from Step 1 of Synthesis Example 18 and Synthesis Example 10 were followed sequentially to obtain the desired product. (Yield: 66%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.14 (m, 4H), 5.36 (s, 2H), 4.12 (m, 2H), 2.93 (m, 4H), 2.60 (t, 2H), 2.52 (t, 2H), 1.25 (t, 3H)

Synthesis Example 30: Ethyl 4-(4-carbamoylphenoxy)benzoate

Using benzyl 4-fluorobenzoate (0.5 g, 2.172 mmol) and ethyl 4-hydroxybenzoate (0.361 g, 2.172 mmol), the methods from step 1 of synthesis example 25, step 2 of synthesis example 10 and step 3 of synthesis example 6 were applied sequentially to obtain required product. (Yield: 11%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.06 (d, 2H), 7.84 (d, 2H), 7.08 (m, 4H), 6.03 (s, 1H), 5.63 (s, 1H), 4.38 (m, 2H), 1.40 (t, 3H)

Synthesis Example 31: Methyl (R)-3-(4-(2-amino-2-oxoethyl)-phenyl)-2-methylpropanoate

Step 1. Tert-butyl 2-(4-((R)-3-((S)-4-benzyl-2-oxo-oxazolidin-3-yl)-2-methyl-3-oxopropyl)phenyl) acetate

(S)-4-Benzyl-3-propionyloxazolidin-2-one (1.363 g, 5.84 mmol) was dissolved in anhydrous tetrahydrofuran, the temperature was lowered to -78°C and the mixture was stirred for 15 minutes. Sodium bis(trimethylsilyl)amide (3.38 mL, 6.43 mmol, 1.0 M in THF) was slowly added dropwise. After which the reaction solution was stirred at the same temperature for 1 hour, tert-butyl 2-(4-(bromomethyl)phenyl)acetate (2 g, 7.01 mmol) was added in portions. After stirring at the same temperature for 6 hours, the temperature was raised to room temperature. A saturated aqueous ammonium chloride solution was added to stop the reaction, and the mixture was extracted with ethyl acetate. The organic layer was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=1:2) to obtain the desired product. (Yield: 94%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.17 (d, J=7.9 Hz, 2H), 7.10 (d, J=7.9 Hz, 2H), 3.63 ( s, 3H), 3.48 (s, 2H), 3.00 (kv, J=6.7 Hz, 1H), 2.77-2.67 (m, 1H), 2.66-2.58 (m, 1H), 1.42 (s, 9H), 1.13 (d, J=7.3 Hz, 3H)

Step 2. Methyl (R)-3-(4-(2-(tert-butoxy)-2-oxoethyl)-phenyl)-2-methylpropanoate

Tert-butyl 2-(4-((R)-3-((S)-4-benzyl-2-oxooxazolidin-3-yl)-2-methyl-3-oxopropyl)phenyl)acetate (2.4 g, 5. 49 mmol) obtained in step 1 was dissolved in tetrahydrofuran (21 ml) and water (7 ml), and hydrogen peroxide (3.36 ml, 54.9 mmol) and lithium hydroxide (0.921 g, 21 .94 mmol). The reaction solution was stirred at room temperature for 3 hours, and the reaction was stopped with 1 N hydrochloric acid solution. The resulting product was extracted with ethyl acetate and concentrated under reduced pressure. The crude compound was dissolved in diethyl ether (28 ml) and the temperature was lowered to 0°C. Diazomethane (0.5 M in diethyl ether) was added dropwise until the solution turned yellow. The reaction solution was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=1:4) to obtain the desired product. (Yield: 31%)

Step 3. Methyl (R)-3-(4-(2-amino-2-oxoethyl)phenyl)-2-methylpropanoate

Using methyl (R)-3-(4-(2-(tert-butoxy)-2-oxoethyl)-phenyl)-2-methylpropanoate (0.5 g, 1.71 mmol) obtained in step 2, the methods with steps 3 and 4 of synthesis example 10 to obtain the desired product. (Yield: 87%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.16 (m, 4H), 5.35 (s, 2H), 3.62 (s, 3H), 3.54 (s, 2H), 3.00 (m, 1H), 2.68 (m, 2H), 1.14 (d, J=6.9 Hz, 3H)

Synthesis example 32. Methyl (S)-3-(4-(2-amino-2-oxoethyl)-phenyl)-2-methylpropanoate

(R)-4-benzyl-3-propionyloxazolidin-2-one (0.744 g, 3.19 mmol) and tert-butyl 2-(4-(bromomethyl)phenyl) acetate (1.00 g, 3.51 mmol) were used as the same method as in synthesis example 31, obtaining the desired product. (Yield: 25%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.16 (m, 4H), 5.38 (s, 2H), 3.62 (s, 3H), 3.54 (s, 2H), 3.00 (m, 1H), 2.68 (m, 2H), 1.13 (t, J=7.5 Hz, 3H)

Synthesis Example 33: Methyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate

Step 1. 2-(4-(3-Methoxy-2,2-dimethyl-3-oxopropyl)phenyl)-acetic acid

Diisopropylamine (1.867 ml, 13.10 mmol) was added to anhydrous tetrahydrofuran (20 ml), and 2.5 M n-butyllithium (5.24 ml, 13.10 mmol) was slowly added dropwise at -78°C. The reaction solution was stirred at the same temperature for 20 minutes. After raising the temperature to room temperature and stirring for 10 minutes, the temperature was again lowered to -78°C and stirring for 10 minutes. The reaction solution was added dropwise to methyl isobutyrate (1.501 mL, 13.10 mmol) dissolved in anhydrous tetrahydrofuran (20 mL). The reaction solution was stirred at -78°C for 1 hour and slowly added dropwise to 2-(4-(bromomethyl)phenyl)acetic acid (1 g, 4.37 mmol) dissolved in anhydrous tetrahydrofuran (20 ml). The temperature was raised to room temperature, and the reaction solution was stirred for 20 minutes. The reaction was stopped by adding 1N aqueous hydrochloric acid (10 ml) to the reaction solution, then extracted with diethyl ether. The organic layer was concentrated under reduced pressure and purified by a silica gel column (methanol:dichloromethane=1:9) to obtain the desired product. (Yield: 82%).

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 7.17 (d, J=7.9 Hz, 2H), 7.06 (d, J=7.9 Hz, 2H), 3.65 ( s, 3H), 3.61 (s, 2H), 2.83 (s, 2H), 1.17 (s, 6H)

Step 2. Methyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate

2-(4-(3-Methoxy-2,2-dimethyl-3-oxopropyl)phenyl)acetic acid (0.90 g, 3.60 mmol) obtained in step 1 was used in the same way as in step 3 synthesis example 6, obtaining the desired product. (Yield: 87%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 7.17 (d, 2H), 7.09 (d, 2H), 5.36 (s, 2H), 3.66 (s, 3H), 3.55 (s, 2H), 2.84 (s, 2H), 1.17 (s, 6H)

Synthesis Example 34: Ethyl 4-(4-carbamoylpiperidin-1-yl)-benzoate

Using ethyl 4-fluorobenzoate (0.524 mL, 3.57 mmol) and benzyl piperidine-4-carboxylate hydrochloride (1.10 g, 4.28 mmol), the methods from Step 1 of Synthesis Example 25, Step 2 of Synthesis Example 10, and step 3 of synthesis example 6 to obtain the desired product. (Yield: 26%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 7.97 (d, 2H), 6.92 (d, 2H), 5.51 (s, 1H), 5.41 (s, 1H), 4.40 (m, 2H), 3.96 (d, 2H), 2.98 (m, 2H), 2.46 (m, 1H), 2.05 (m, 2H), 1.94 (m , 2H), 1.43 (t, 3H)

Synthesis Example 35: 1-(5-Ethylpyrimidin-2-yl)piperidin-4-carboxamide

Step 1. Ethyl 1-(5-ethylpyrimidin-2-yl)piperidine-4-carboxylate

Ethyl piperidine-4-carboxylate (0.980 ml, 6.36 mmol), cesium carbonate (2.176 g, 6.68 mmol) and 2-chloro-5-ethylpyrimidine (0.796 ml, 6.55 mmol) were dissolved in DMF (6, 36 ml) and stirred at 100°C for 4 hours. After completion of the reaction, water was added to the reaction solution, then extracted with ethyl acetate. The organic layer was concentrated under reduced pressure and purified by a silica gel column (ethyl acetate:hexane=1:4) to obtain the desired product. (Yield: 96%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.16 (s, 2H), 4.61 (m, 2H), 4.14 (q, J=7.1 Hz, 2H), 3, 09-2.91 (m, 2H), 2.62-2.51 (m, 1H), 2.45 (kv, J=7.5 Hz, 2H), 1.96 (m, 2H), 1 .80-1.63 (m, 2H), 1.25 (t, J=7.3 Hz, 3H), 1.18 (t, J=7.6 Hz, 3H)

Step 2. 1-(5-Ethylpyrimidin-2-yl)piperidine-4-carboxamide

Using ethyl 1-(5-ethylpyrimidin-2-yl)piperidin-4-carboxylate (0.56 g, 2.127 mmol) obtained in Step 1, the methods of Steps 2 and 3 of Synthesis Example 6 were applied sequentially to obtain the desired product. (Yield: 14%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.16 (s, 2H), 5.49 (s, 2H), 4.76 (m, 2H), 2.94 (m, 2H), 2.48 (m, 3H), 1.96 (m, 2H), 1.70 (m, 2H), 1.19 (t, 3H)

Synthesis Example 36: Methyl 2-(4-(2-amino-2-oxoethyl)phenyl)2-methylpropanoate

Step 1. Methyl 2-(4-(bromomethyl)phenyl)-2-methylpropanoate

Methyl 2-methyl-2-(p-tolyl)propanoate was dissolved in DCE (55.3 ml) and N-bromosuccinimide (4.63 g, 26.0 mmol) and azobisisobutyronitrile (0.085 g, 0.520 mmol) were added. The reaction mixture was stirred at 80°C for 2 hours and 30 minutes. The solvent was removed under reduced pressure, diluted with EA, washed with brine, and the organic solvent was dried over magnesium sulfate. Purification was carried out on a silica gel column to obtain the desired product. (Yield: 56.7%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.37-7.27 (m, 4H), 4.47 (s, 2H), 3.65 (d, J=4.6 Hz, 3H) , 1.56 (d, J=3.2 Hz, 6H)

Step 2. Methyl 2-(4-cyanomethyl)phenyl)-2-methylpropanoate

Methyl 2-(4-(bromomethyl)phenyl)-2-methylpropanoate (100 mg, 0.369 mmol) obtained in step 1 was dissolved in DMF (5 ml), and potassium cyanide (36.0 mg, 0.553 mmol) was added and stirred at room temperature for 16 hours. The reaction was then stopped by adding water, the resulting product was diluted with diethyl ether, washed with brine, and the organic solvent was dried with magnesium sulfate. Purification was carried out on a silica gel column to obtain the desired product. (Yield: 52.4%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.34 (d, J=8.7 Hz, 2H), 7.28 (d, J=8.2 Hz, 2H), 3.71 (s , 2H), 3.64 (s, 3H), 1.54 (d, J=15.6 Hz, 6H)

Step 3. Methyl 2-(4-(2-methoxy-2-oxoethyl)phenyl)-2-methylpropanoate

Methyl 2-(4-cyanomethyl)phenyl)-2-methylpropanoate (1.46 g, 6.72 mmol) obtained in step 2 was dissolved in methanol (8.4 ml), and 4 N HCl solution (8, 40 ml, 33.6 mmol). The reaction mixture was stirred at 100°C for 16 hours. After removing the solvent under reduced pressure, the resulting product was diluted with ethyl acetate and washed with brine, and the organic solvent was dried over magnesium sulfate. The desired product was obtained on a silica gel column. (Yield: 32.1%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.28 (d, J=8.2 Hz, 2H), 7.23 (d, J=8.2 Hz, 2H), 3.68 (s , 3H), 3.64 (s, 3H), 3.59 (s, 2H), 1.57 (s, 6H)

Step 4. 2-(4-(1-Methoxy-2-methyl-1-oxopropan-2-yl)-phenyl)-acetic acid

Methyl 2-(4-(2-methoxy-2-oxoethyl)phenyl)-2-methylpropanoate (27 mg, 0.108 mmol) obtained in step 3 was dissolved in THF (1 ml) and methanol (1 ml) and added Lithium hydroxide (2.58 mg, 0.108 mmol) dissolved in water (0.5 ml). The reaction mixture was stirred at room temperature for 3 hours. After removing the solvent under reduced pressure, the resulting product was diluted with EA and washed with brine, and the organic solvent was dried over magnesium sulfate. Purification was carried out on a silica gel column to obtain the desired product. (Yield: 100%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.36-7.19 (m, 7H), 3.75-3.57 (m, 6H), 1.69-1.50 (m, 6H )

Step 5. Methyl 2-(4-(2-amino-2-oxoethyl)phenyl)-2-methylpropanoate

2-(4-(1-Methoxy-2-methyl-1-oxopropan-2-yl)phenyl)acetic acid (26 mg, 0.110 mmol) obtained in step 4 was used in the same way as in step 3 of the synthesis example 6, obtaining the required product. (Yield: 77%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.31 (d, J=8.2 Hz, 2H), 7.22 (d, J=8.2 Hz, 2H), 5.47 (d , J=59.9 Hz, 1H), 3.64 (s, 3H), 3.55 (s, 2H), 1.56 (t, J=14.6 Hz, 6H)

Synthesis example 37. Methyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)propanoate

2-(4-Bromophenyl)-2-methylpropanoic acid (1.00 g, 4.11 mmol) was dissolved in DCM (21 ml), oxalyl chloride (0.94 g, 7.40 mmol) was added, and 5 drops of DMF were added . The reaction mixture was stirred at room temperature for 30 minutes, and the solvent was removed under reduced pressure. The concentrate was dissolved in THF (21 ml), the temperature was lowered to 0°C and potassium tert-butoxide (0.55 g, 4.94 mmol) was added. After stirring at room temperature for 12 hours, water was added, then extracted with ethyl acetate. After washing with water and brine, the organic layer was dried over magnesium sulfate and concentrated under reduced pressure. Purification by column chromatography gave tert-butyl 2-(4-bromophenyl)-2-methylpropanoate. The same methods as in Synthesis Example 10 were then sequentially applied to obtain the desired product. (Yield: 31%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.37-7.29 (m, 2H), 7.18 (d, J=8.2 Hz, 2H), 5.97 (s, 1H ), 5.24 (s, 1H), 3.67 (d, J=1.4 Hz, 3H), 2.94 (t, J=7.5 Hz, 2H), 2.63 (t, J =7.8 Hz, 2H), 1.66-1.44 (m, 6H)

Synthesis example 38. Ethyl 3-(4-(3-carbamoyl azetidin-1-yl)-phenyl)propanoate

Step 1. Benzyl 1-(4-formylphenyl)azetidine-3-carboxylate

1-(4-Formylphenyl)azetidine-3-carboxylic acid (1.50 g, 7.31 mmol), potassium carbonate (1.11 g, 8.04 mmol) and benzyl bromide (1.25 g, 7.31 mmol ) was added to DMF (7.3 ml) and stirred at room temperature for 12 hours. Water was added to the reaction mixture, then extracted with ethyl acetate. After washing with water and brine, the organic layer was dried over magnesium sulfate and concentrated under reduced pressure. Purification was carried out by column chromatography to obtain the desired product. (Yield: 56%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 9.74 (s, 1H), 7.72 (d, J=8.7 Hz, 2H), 7.45-7.29 (m, 5H) , 6.42 (d, J=8.7 Hz, 2H), 5.20 (s, 2H), 4.26-4.13 (m, 4H), 3.70-3.59 (m, 1H )

Step 2. 1-(4-(3-Ethoxy-3-oxopropyl)phenyl)azetidine-3-carboxylic acid

Using benzyl 1-(4-formylphenyl)azetidine-3-carboxylate (1.20 g, 4.06 mmol) obtained in Step 1, the methods of Steps 2 and 3 of Synthesis Example 25 were followed sequentially to obtain the title compound. (Yield: 52%)

¹ H NMR (400 MHz, CHLOROFORM-D): δ 7.07 (d, J=8.2 Hz, 2H), 6.43 (d, J=8.2 Hz, 2H), 4.18-3 .97 (m, 6H), 3.59 (dd, J=14.4, 6.2 Hz, 1H), 2.86 (t, J=7.8 Hz, 2H), 2.56 (t, J=7.8 Hz, 2H), 1.30-1.16 (m, 3H)

Step 3. Ethyl 3-(4-(3-(chlorocarbonyl)azetin-1-yl)phenyl)propanoate

After dissolving 1-(4-(3-ethoxy-3-oxopropyl)phenyl)-azetidine-3-carboxylic acid (590 mg, 2.13 mmol) obtained in step 2 in dichloromethane, the temperature was lowered to 0°C. Oxalyl chloride (0.37 mL, 4.26 mmol) was added dropwise and the temperature was gradually raised to room temperature. After completion of the reaction, the resulting product was concentrated under reduced pressure and used in the next reaction without further purification. (Yield: 99%)

m/z (M+H) ⁺ calculated for C ₁₅ H ₁₉ ClNO ₃ : 296, detected 296

Step 4. Ethyl 3-(4-(3-carbamoyl azetidin-1-yl)phenyl)-propanoate

Ethyl 3-(4-(3-(chlorocarbonyl)azetin-1-yl)phenyl)propanoate (629 mg, 2.127 mmol) obtained in step 3 was used in the same manner as in step 3 of Synthesis Example 6 to obtain the required product. (Yield: 4%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.08-6.90 (m, 2H), 6.57 (dd, J=23.8, 15.6 Hz, 2H), 6.09 ( s, NH), 5.59 (s, NH), 4.10 (kv, J=7.0 Hz, 3H), 3.87-3.54 (m, 2H), 3.50-3.32 (m, 2H), 3.02-2.86 (m, 1H), 2.82 (t, J=7.8 Hz, 2H), 2.72-2.43 (m, 2H), 1, 22 (t, J=7.1 Hz, 3H)

Synthesis Example 39: Methyl 2-(4-carbamoylpiperidin-1-yl)-pyrimidine-5-carboxylate

Step 1. 1-(5-(Methoxycarbonyl)pyrimidin-2-yl)piperidine-4-carboxylic acid

Piperidine-4-carboxylic acid (50 mg, 0.387 mmol) and methyl 2-chloropyrimidine-5-carboxylate (80 mg, 0.465 mmol) were dissolved in DMF and TEA (108 μL, 0.774 mmol) was added and stirred at 80°C. After stirring for 1 hour, completion of the reaction was confirmed by TLC. After removing the DMF, extraction and neutralization gave an organic layer, the water was removed with magnesium sulfate, and the resulting material was distilled under reduced pressure and purified by column chromatography (methylene chloride:methanol=10:1) to give 1-(5-(methoxycarbonyl)pyrimidine -2-yl)piperidin-4-carboxylic acid (40 mg, 0.151 mmol, yield: 39%).

¹ H-NMR (400 MHz, methanol-D4) δ 8.77 (d, J=2.3 Hz, 2H), 4.71 (d, J=13.7 Hz, 2H), 3.83 (d , J=2.3 Hz, 3H), 3.22-3.04 (m, 2H), 2.61 (s, 1H), 2.09-1.88 (m, 2H), 1.75- 1.49 (m, 2H)

Step 2. Methyl 2-(4-carbamoylpiperidin-1-yl)pyrimidine-5-carboxylate

1-(5-(Methoxycarbonyl)pyrimidin-2-yl)piperidin-4-carboxylic acid (42.8 mg, 0.151 mmol) obtained in Step 1 was used in the same manner as in Step 3 of Synthesis Example 6 to obtain required product. (Yield: 88%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.80 (s, 2H), 8.41 (s, 1H), 4.81-4.70 (m, 2H), 4.68 (s, 1H), 3.86-3.75 (m, 3H), 3.24-3.13 (m, 1H), 2.65 (tt, J=10.7, 3.9 Hz, 1H), 2 .12-1.84 (m, 5H), 1.86-1.61 (m, 3H)

Synthesis Example 40. Tert-butyl 2-(4-(4-carbamoylpiperidin-1-yl)phenyl)acetate

Using tert-butyl 2-(4-bromophenyl)acetate (0.3 g, 1.106 mmol) and ethyl piperidine-4-carboxylate (0.209 g, 1.328 mmol), the same methods as in step 1 of synthesis example 2 and steps 2 were used sequentially and 3 examples of synthesis 6, obtaining the desired product. (exit beyond 3 stages: 20.1%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.13 (d, J=8.7 Hz, 2H), 6.90-6.83 (2H), 5.60 (d, J=16, 9 Hz, 2H), 3.68 (d, J=12.3 Hz, 2H), 3.42 (s, 2H), 2.70 (td, J=12.1, 2.4 Hz, 2H) , 2.32-2.20 (m, 1H), 1.96 (d, J=11.0 Hz, 2H), 1.84 (kvd, J=12.2, 3.7 Hz, 2H), 1.43 (d, J=10.5 Hz, 9H)

Synthesis Example 41: Methyl 2-(4-(4-carbamoylpiperidin-1-yl)-phenyl)-2-methylpropanoate

Using methyl 2-(4-bromophenyl)-2-methylpropanoate (0.20 g, 0.78 mmol) and tert-butyl piperidine-4-carboxylate (0.17 g, 0.93 mmol), the methods of Synthesis Example 2 and step 3 of synthesis example 6 to obtain the desired product. (Yield: 64%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.23-7.13 (m, 2H), 6.91-6.80 (m, 2H), 5.54 (s, 2H), 3 .70 (d, J=12.3 Hz, 2H), 3.63 (d, J=7.8 Hz, 3H), 2.72 (td, J=12.1, 2.3 Hz, 2H) , 2.27 (kvd, J=7.8, 4.0 Hz, 1H), 1.97 (d, J=10.5 Hz, 2H), 1.84 (kvd, J=12.2, 3 .9 Hz, 2H), 1.54 (d, J=7.3 Hz, 6H)

Synthesis Example 42: Methyl 2-(6-(4-carbamoylpiperidin-1-yl)-pyridin-3-yl)-2-methylpropanoate

Methyl 2-(6-chloropyridin-3-yl)-2-methylpropanoate (2.05 g, 9.59 mmol) and tert-butyl piperidine-4-carboxylate (2.13 g, 11.51 mmol) were used in the same manner. as in synthesis example 41, to obtain the desired product. (Yield: 12%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.15 (t, J=2.1 Hz, 1H), 7.44 (dt, J=9.0, 2.4 Hz, 1H), 6.61 (dd, J=8.9, 1.6 Hz, 1H), 5.58 (s, 2H), 4.30 (d, J=12.8 Hz, 2H), 3.62 (d , J=2.3 Hz, 3H), 2.95-2.76 (m, 2H), 2.45-2.28 (m, 1H), 2.00-1.88 (2H), 1, 80-1.63 (m, 2H), 1.53 (d, J=1.8 Hz, 6H)

Synthesis Example 43: Ethyl 2-(5-(4-carbamoylpiperidin-1-yl)-2H-tetrazol-2-yl)acetate

Step 1. 4-Benzyl 1-(tert-butyl)-piperidine-1,4-dicarboxylate

1-(T-Butoxycarbonyl)piperidine-4-carboxylic acid (4.37 g, 19.06 mmol) was dissolved in acetone and benzyl bromide (2.72 ml, 22.87 mmol) and potassium carbonate (6.32 g, 45.0 mmol) were added. 7 mmol). The reflux condenser was connected and the reaction mixture was heated for 2 hours. After completion of the reaction, the resulting product mixture was cooled to room temperature and water was added. The organic layer was separated and dried over magnesium sulfate. The material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give 4-benzyl 1-(tert-butyl)piperidine-1,4-dicarboxylate (6.09 g, 19.07 mmol, yield: 99%).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.45-7.27 (m, 6H), 5.12 (s, 2H), 4.07-3.91 (2H), 2.91- 2.71 (2H), 2.56-2.39 (m, 1H), 1.88 (d, J=10.5 Hz, 2H), 1.71-1.56 (m, 2H), 1 .44 (t, J=15.1 Hz, 9H)

Step 2. Benzyl piperidine-4-carboxylate

4-Benzyl 1-(tert-butyl)piperidine-1,4-dicarboxylate (6.09 g, 19.07 mmol) obtained in Step 1 was used in the same manner as in Step 2 of Synthesis Example 2 to obtain the desired product. (Yield: 48%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 7.40-7.20 (m, 5H), 5.09 (s, 2H), 2.98 (td, J=8.5, 4.1 Hz, 2H), 2.58 (td, J=12.1, 2.7 Hz, 2H), 2.50 (kvd, J=7.5, 3.5 Hz, 1H), 1.86 (dd , J=13.7, 3.2 Hz, 2H), 1.70-1.47 (m, 2H)

Step 3. Benzyl 1-cyanopiperidine-4-carboxylate

Benzyl piperidine-4-carboxylate (1.9934 g, 9.09 mmol) obtained in step 2 was dissolved in acetonitrile, DIPEA (4.76 ml, 27.3 mmol) and cyanogen bromide (0.573 ml, 10.91 mmol) were added ) and stirred at room temperature for 2 hours. After completion of the reaction, water was added. The organic layer was separated and dried over magnesium sulfate, and the material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give benzyl 1-cyanopiperidine-4-carboxylate (2.1838 g, 8.94 mmol, yield: 98 %).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.45-7.27 (m, 5H), 5.20-5.05 (2H), 3.41 (td, J=8.5, 4 ,3 Hz, 2H), 3.15-2.95 (m, 2H), 2.57-2.37 (m, 1H), 1.98 (dd, J=14.2, 3.7 Hz, 2H), 1.92-1.73 (2H)

Step 4. Benzyl 1-(2H-tetrazol-5-yl)piperidine-4-carboxylate

Benzyl 1-cyanopiperidine-4-carboxylate (2.1838 g, 8.94 mmol) obtained in step 3 was dissolved in DMF and ammonium chloride (0.717 g, 13.41 mmol) and sodium azide (0.872 g, 13. 41 mmol), and the reaction was carried out at 100°C for 6 hours. After completion of the reaction, water was added. The organic layer was separated and dried over magnesium sulfate, and the material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give benzyl 1-(2H-tetrazol-5-yl)piperidin-4-carboxylate (2.57 g, 8.94 mmol, yield: 99%).

¹ H-NMR (400 MHz, METHANOL-D4) δ 7.95 (s, 1H), 7.31 (dt, J=12.3, 4.3 Hz, 5H), 5.12 (s, 2H) , 3.78 (dt, J=13.3, 3.9 Hz, 2H), 3.32 (s, 1H), 3.21-3.05 (m, 2H), 2.97 (s, 2H ), 2.83 (s, 2H), 2.76-2.56 (m, 1H), 2.00 (dd, J=13.5, 3.4 Hz, 2H), 1.74 (dd, J=24.6, 11.3, 4.0 Hz, 2H)

Step 5. Benzyl 1-(2-(2-ethoxy-2-oxoethyl)-2H-tetrazol-5-yl)piperidine-4-carboxylate

Benzyl 1-(2H-tetrazol-5-yl)piperidine-4-carboxylate (1.465 g, 5.10 mmol) obtained in step 4 was dissolved in DMF and potassium carbonate (1.409 g, 10.20 mmol) was added and ethyl 2-bromoacetate (1.277 g, 7.65 mmol), and stirred at room temperature for 12 hours. After completion of the reaction, water was added. The organic layer was separated and dried over magnesium sulfate, and the material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give benzyl 1-(2-(2-ethoxy-2)-oxoethyl)-2H-tetrazol-5- yl)piperidine-4-carboxylate (1.8039 g, 4.83 mmol, yield: 95%).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.44-7.27 (m, 5H), 5.17 (s, 2H), 5.13 (s, 2H), 4.31-4, 19 (m, 2H), 4.03 (td, J=8.5, 4.6 Hz, 2H), 3.13-2.93 (m, 2H), 2.55 (td, J=11, 1, 3.8 Hz, 1H), 1.99 (d, J=1.8 Hz, 2H), 1.81 (ddd, J=24.8, 11.1, 4.2 Hz, 2H), 1.32-1.26 (m, 3H)

Step 6. 1-(2-(2-Ethoxy-2-oxoethyl)-2H-tetrazol-5-yl)-piperidine-4-carboxylic acid

Benzyl 1-(2-(2-ethoxy-2-oxoethyl)-2H-tetrazol-5-yl)-piperidin-4-carboxylate (1.8039 g, 4.83 mmol) obtained in step 5 was used the same method as in step 2 of synthesis example 10 to obtain the desired product. (Yield: 79%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 5.35 (s, 2H), 4.23 (q, J=7.2 Hz, 2H), 3.96 (dt, J=13.0, 3.5 Hz, 2H), 3.14-2.93 (m, 2H), 2.61-2.42 (m, 1H), 1.96 (dd, J=13.7, 3.2 Hz , 2H), 1.71 (ddd, J=24.7, 11.4, 4.1 Hz, 2H), 1.34-1.21 (m, 3H)

Step 7. Ethyl 2-(5-(4-carbamoylpiperidin-1-yl)-2H-tetrazol-2-yl)acetate

1-(2-(2-Ethoxy-2-oxoethyl)-2H-tetrazol-5-yl)piperidin-4-carboxylic acid (1.085 g, 4.83 mmol) obtained in step 6 was used in the same manner as in step 3 of Synthesis Example 6 to obtain the desired product. (Yield: 13%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 5.35 (s, 2H), 4.32-4.16 (2H), 4.05 (d, J=12.8 Hz, 2H), 3 .32 (d, J=6.9 Hz, 1H), 2.96 (td, J=12.6, 2.7 Hz, 2H), 2.50-2.34 (2H), 1.84 ( d, J=12.3 Hz, 2H), 1.74 (td, J=12.1, 4.4 Hz, 2H), 1.26 (t, J=7.3 Hz, 3H)

Synthesis Example 44: Ethyl 2-(4-carbamoylpiperidin-1-yl)acetate

Piperidine-4-carboxamide (300 mg, 2.341 mmol) and ethyl 2-bromoacetate (311 μL, 2.81 mmol) were used in the same manner as in step 3 of Synthesis Example 43 to obtain the desired product. (Yield: 36%)

¹ H-NMR (MeOD) δ 4.19 (q, J=7.1 Hz, 2H), 3.24 (s, 2H), 3.00 (d, J=11.3 Hz, 2H), 2 .35-2.16 (m, 3H), 1.88-1.72 (m, 4H), 1.28 (t, J=7.0 Hz, 3H)

Synthesis Example 45: Ethyl 1-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)piperidine-4-carboxylate

Ethyl piperidine-4-carboxylate (0.13 g, 0.80 mmol) and tert-butyl 2-(4-bromophenyl)-2-methylpropanoate (0.2 g, 0.67 mmol) were used in the same manner as in the synthesis example 41, obtaining the required product. (Yield: 72%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.27-7.15 (m, 2H), 6.95-6.75 (m, 2H), 5.88 (s, 1H), 5 .24 (s, 1H), 4.19-4.06 (2H), 3.60 (dt, J=12.3, 3.4 Hz, 2H), 2.83-2.66 (m, 2H ), 2.46-2.32 (m, 1H), 1.98 (dd, J=13.3, 2.7 Hz, 2H), 1.92-1.74 (m, 2H), 1, 51 (s, 6H), 1.24 (t, J=7.1 Hz, 3H)

Synthesis Example 46: Methyl 6-(3-carbamoylpyrrolidin-1-yl)-nicotinate

Step 1. 3-Benzyl 1-(tert-butyl)pyrrolidine-1,3-dicarboxylate

1-(T-Butoxycarbonyl)pyrrolidine-3-carboxylic acid (1.22 g, 5.67 mmol) was dissolved in DMF and benzyl bromide (0.808 ml, 6.80 mmol) and cesium carbonate (2.216 g, 6.80 mmol) were added. and stirred at room temperature for 12 hours. After completion of the reaction, water was added and the organic layer was separated and dried over magnesium sulfate. The material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give 3-benzyl 1-(tert-butyl)pyrrolidine-1,3-dicarboxylate (1.7 g, 5.57 mmol, yield: 98%).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.34 (s, 5H), 5.12 (d, J=11.0 Hz, 2H), 3.57 (s, 2H), 3.33 (s, 1H), 3.08 (s, 1H), 2.12 (s, 2H), 1.43 (d, J=11.0 Hz, 9H)

Step 2. Benzyl pyrrolidine-3-carboxylate

3-Benzyl 1-(tert-butyl)pyrrolidine-1,3-dicarboxylate (1.7 g, 5.57 mmol) obtained in Step 1 was used in the same manner as in Step 2 of Synthesis Example 2 to obtain the desired product. (Yield: 99%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.44-7.26 (m, 14H), 7.10 (dd, J=7.5, 1.6 Hz, 6H), 5.12 ( s, 2H), 4.11 (kv, J=7.2 Hz, 3H), 4.00 (td, J=8.5, 4.6 Hz, 2H), 3.07-2.87 (m , 2H), 2.61-2.42 (m, 1H), 1.97 (dd, J=13.5, 3.9 Hz, 2H), 1.90-1.67 (m, 2H)

Step 3. Methyl 6-(3-((benzyloxy)carbonyl)pyrrolidin-1-yl)nicotinate

Benzyl pyrrolidine-3-carboxylate (1.277 g, 6.22 mmol) obtained in Step 2 was used in the same manner as in Step 1 of Synthesis Example 2 to obtain the desired product. (Yield: 46%)

¹ H-NMR (CHLOROFORM-D) δ 8.82 (d, J=2.4 Hz, 1H), 8.02 (dd, J=9.0, 2.3 Hz, 1H), 7.44- 7.30 (m, 5H), 6.35 (d, J=8.8 Hz, 1H), 5.18 (dd, J=16.0, 12.4 Hz, 2H), 3.88 (s , 3H), 3.87-3.75 (2H), 3.76-3.63 (1H), 3.63-3.48 (1H), 3.29 (t, J=7.3 Hz, 1H), 2.43-2.28 (m, 2H)

Step 4. 1-(5-(Methoxycarbonyl)pyridin-2-yl)pyrrolidine-3-carboxylic acid

Methyl 6-(3-((benzyloxy)carbonyl)pyrrolidin-1-yl)nicotinate (524 mg, 1.539 mmol) obtained in Step 3 was used in the same manner as in Step 2 of Synthesis Example 10 to obtain the desired product. (Yield: 99%)

¹ H-NMR (MeOD) δ 8.68 (d, J=2.1 Hz, 1H), 8.03 (dd, J=9.0, 2.3 Hz, 1H), 6.55 (d, J=9.2 Hz, 1H), 3.87 (s, 3H), 3.77 (t, J=5.0 Hz, 3H), 3.71-3.51 (m, 3H), 3, 28 (t, J=7.2 Hz, 1H), 2.42-2.25 (m, 2H)

Step 5. Methyl 6-(3-carbamoylpyrrolidin-1-yl)nicotinate

1-(5-(Methoxycarbonyl)pyridin-2-yl)pyrrolidine-3-carboxylic acid (423 mg, 1.690 mmol) obtained in step 4 was dissolved in DMF, the temperature was lowered to 0°C and ammonium chloride (380 mg) was added , 7.10 mmol), DIPEA (886 μl, 5.07 mmol) and 1-hydroxy-benzotriazole (337 mg, 2.197 mmol). After slowly adding 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (389 mg, 2.028 mmol) to the reaction solution, the reaction temperature was raised to room temperature and stirred for 12 hours. After completion of the reaction, water was added and the organic layer was separated and dried over magnesium sulfate. The material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give methyl 6-(3-carbamoylpyrrolidin-1-yl)nicotinate (213 mg, 0.854 mmol, yield: 51%).

¹ H-NMR (400 MHz, METHANOL-D4) δ 8.66-8.61 (1H), 8.02-7.96 (1H), 6.54-6.46 (1H), 3.85- 3.80 (4H), 3.79-3.71 (1H), 3.69-3.56 (2H), 3.55-3.42 (1H), 3.23-3.06 (1H) , 2.37-2.07 (3H)

Synthesis Example 47. Tert-butyl 3-carbamoyl-3-methylpyrrolidine-1-carboxylate

Step 1. 3-Benzyl 1-(tert-butyl) (R)-pyrrolidine-1,3-dicarboxylate

(R)-1-(tert-butoxycarbonyl)pyrrolidine-3-carboxylic acid (518 mg, 2.407 mmol) was used in the same manner as in Step 1 of Synthesis Example 43 to obtain the desired product. (Yield: 93%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.44-7.26 (m, 5H), 5.13 (s, 2H), 3.66-3.39 (m, 2H), 3, 33 (s, 1H), 3.07 (d, J=7.3 Hz, 1H), 2.13 (t, J=7.1 Hz, 2H), 1.50-1.33 (9H)

Step 2. 3-Benzyl 1-(tert-butyl) 3-methylpyrrolidine-1,3-dicarboxylate

3-Benzyl 1-(tert-butyl) (R)-pyrrolidine-1,3-dicarboxylate (684 mg, 2.240 mmol) obtained in step 1 was dissolved in anhydrous THF and iodomethane (0.42 ml, 6.72 mmol) was added ). The temperature of the reaction solution was lowered to -78°C, and then lithium bis(trimethylsilyl)amide (6.72 mL, 6.72 mmol) was slowly added dropwise. After TLC analysis, the reaction was stopped with aqueous ammonium hydroxide and the organic layer was separated and dried over magnesium sulfate. The material obtained by distillation under reduced pressure was purified by column chromatography (hexane:ethyl acetate) to give 3-benzyl 1-(tert-butyl)3-methylpyrrolidine-1,3-dicarboxylate (594 mg, 2.240 mmol, yield: 83%).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.33 (dd, J=13.3, 5.5 Hz, 5H), 5.13 (s, 2H), 3.78 (dd, J= 16.0, 11.0 Hz, 1H), 3.40 (td, J=13.6, 6.7 Hz, 2H), 3.19 (dd, J=33.6, 11.2 Hz, 1H ), 2.32 (kv, J=5.9 Hz, 1H), 1.86-1.66 (m, 1H), 1.43 (s, 9H), 1.29 (d, J=36, 1 Hz, 3H)

Step 3. 1-(Tetbutoxycarbonyl)-3-methylpyrrolidine-3-carboxylic acid

3-Benzyl 1-(tert-butyl)3-methylpyrrolidine-1,3-dicarboxylate (80 mg, 0.250 mmol) obtained in Step 2 was used in the same manner as in Step 2 of Synthesis Example 10 to obtain the desired product. (Yield: 99%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 3.75 (d, J=11.0 Hz, 1H), 3.47-3.31 (m, 2H), 3.09 (d, J= 11.0 Hz, 1H), 2.38-2.21 (m, 1H), 1.77 (dd, J=12.8, 5.5 Hz, 1H), 1.43 (s, 9H), 1.30 (s, 3H)

Step 4. Tert-butyl 3-carbamoyl-3-methylpyrrolidine-1-carboxylate

1-(T-Butoxycarbonyl)-3-methylpyrrolidine-3-carboxylic acid (60 mg, 0.262 mmol) obtained in Step 3 was used in the same manner as in Step 5 of Synthesis Example 46 to obtain the desired product. (Yield: 62%)

¹ H-NMR (CHLOROFORM-D) δ 5.87-5.28 (2H), 3.81-3.61 (m, 1H), 3.50 (d, J=36.0 Hz, 2H), 3.23 (s, 1H), 2.28 (s, 1H), 1.79 (dd, J=12.5, 7.0 Hz, 1H), 1.46 (d, J=12.5 Hz , 10H), 1.36 (d, J=13.7 Hz, 3H)

Synthesis example 48. Methyl 6-(3-carbamoyl-3-methylpyrrolidin-1-yl)nicotinate

Step 1. Benzyl 3-methylpyrrolidine-3-carboxylate

3-Benzyl 1-(tert-butyl)3-methylpyrrolidine-1,3-dicarboxylate (510 mg, 1.597 mmol) obtained in Step 2 of Synthesis Example 47 was used in the same manner as in Step 2 of Synthesis Example 2 to obtain the desired product . (Yield: 99%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 7.44-7.25 (m, 5H), 5.28-5.11 (m, 2H), 3.76 (d, J=11.9 Hz, 1H), 3.40 (ddd, J=12.6, 7.5, 4.3 Hz, 1H), 3.27-3.17 (m, 1H), 3.05 (d, J= 11.9 Hz, 1H), 2.53-2.34 (m, 1H), 2.07-1.87 (m, 1H), 1.41 (s, 3H)

Step 2. Methyl 6-(3-((benzyloxy)carbonyl)-3-methyl-pyrrolidin-1-yl)nicotinate

Benzyl 3-methylpyrrolidine-3-carboxylate (357 mg, 1.628 mmol) obtained in step 1 and methyl 6-chloronicotinate (307 mg, 1.791 mmol) were used in the same method as in step 1 of Synthesis Example 2 to obtain the desired product . (Yield: 23%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.78 (d, J=2.3 Hz, 1H), 7.98 (dd, J=9.1, 2.3 Hz, 1H), 7 ,39-7.26 (m, 6H), 6.29 (d, J=8.7 Hz, 1H), 5.14 (d, J=1.4 Hz, 2H), 4.13-4, 00 (1H), 3.85 (s, 3H), 3.58 (s, 2H), 3.48-3.30 (1H), 2.52 (t, J=6.2 Hz, 1H), 1.96 (dd, J=7.1, 5.7 Hz, 1H), 1.43 (s, 3H)

Step 3. 1-(5-(Methoxycarbonyl)pyridin-2-yl)-3-methyl-pyrrolidine-3-carboxylic acid

Methyl 6-(3-((benzyloxy)carbonyl)-3-methylpyrrolidin-1-yl)nicotinate (130 mg, 0.367 mmol) obtained in Step 2 was used in the same manner as in Step 2 of Synthesis Example 10 to obtain required product. (Yield: 99%)

¹ H-NMR (MeOD) δ 8.67 (d, J=2.1 Hz, 1H), 8.01 (dd, J=9.2, 2.1 Hz, 1H), 6.52 (d, J=9.2 Hz, 1H), 4.09-3.98 (1H), 3.87 (d, J=4.6 Hz, 3H), 3.70-3.55 (m, 2H), 3.35 (s, 1H), 2.52 (t, J=6.3 Hz, 1H), 2.03-1.88 (m, 1H), 1.41 (s, 3H)

Step 4. Methyl 6-(3-carbamoyl-3-methylpyrrolidin-1-yl)-nicotinate

1-(5-(Methoxycarbonyl)pyridin-2-yl)-3-methylpyrrolidine-3-carboxylic acid (97 mg, 0.367 mmol) obtained in step 3 was used in the same manner as in step 5 of Synthesis Example 46, with obtaining the required product. (Yield: 59%)

¹ H-NMR (MeOD) δ 8.68 (d, J=2.1 Hz, 1H), 8.03 (dd, J=9.0, 2.3 Hz, 1H), 6.53 (d, J=9.2 Hz, 1H), 3.96 (d, J=10.7 Hz, 1H), 3.88 (d, J=7.9 Hz, 3H), 3.69-3.56 ( m, 2H), 2.87-2.81 (2H), 2.76 (t, J=7.5 Hz, 1H), 2.56-2.40 (m, 1H), 2.10-1 .94 (1H), 1.46 (d, J=22.3 Hz, 3H)

Synthesis example 49. Tert-butyl 2-(4-(2-amino-2-oxoethyl)-phenoxy) acetate

2-(4-Hydroxyphenyl)acetamide (1.00 g, 6.62 mmol) and tert-butyl 2-bromoacetate (1.36 g, 6.95 mmol) were used in the same manner as in Step 1 of Synthesis Example 38 to give required product. (Yield: 85%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.22-7.14 (m, 2H), 6.87 (dt, J=9.5, 2.4 Hz, 2H), 5.34 (s, 2H), 4.50 (s, 2H), 3.52 (s, 2H), 1.48 (s, 9H)

Synthesis Example 50: Methyl 2-(4-(2-amino-2-oxoethoxy)phenyl)-acetate

Using methyl 2-(4-hydroxyphenyl) acetate (1.00 g, 6.02 mmol) and tert-butyl 2-bromoacetate (1.29 g, 6.62 mmol), the methods from Step 1 of Synthesis Example 38, Step 2 were followed sequentially synthesis example 2 and step 3 of synthesis example 6 to obtain the desired product. (Yield: 52%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.25-7.19 (m, 2H), 6.89 (dt, J=9.3, 2.5 Hz, 2H), 6.53 (s, 1H), 5.68 (s, 1H), 4.49 (s, 2H), 3.69 (s, 3H), 3.58 (s, 2H)

Synthesis Example 51: Methyl 2-(4-(2-amino-2-oxoethoxy)phenyl)propanoate

Using methyl 2-(4-(benzyloxy)phenyl)acetate (3.10 g, 12.10 mmol) and iodomethane (6.87 g, 48.4 mmol), the methods from Step 2 of Synthesis Example 4, Step 2 were followed sequentially synthesis example 10 and synthesis example 50 to obtain the desired product. (Yield: 63%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.22 (d, J=8.2 Hz, 2H), 6.86 (d, J=8.7 Hz, 2H), 6.52 ( d, J=43.9 Hz, 2H), 4.45 (s, 2H), 3.74-3.57 (m, 4H), 1.45 (d, J=7.3 Hz, 3H)

Synthesis Example 52: Methyl 3-(4-(2-amino-2-oxoethyl)phenoxy)-2,2-dimethylpropanoate

Using methyl 3-hydroxy-2,2-dimethylpropanoate (0.80 g, 6.02 mmol) and methyl 2-(4-hydroxyphenyl) acetate (1.00 g, 6.02 mmol), the methods from step 1 were applied sequentially synthesis example 4, steps 2 and 3 of synthesis example 6 to obtain the desired product. (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.13 (d, J=8.2 Hz, 2H), 6.84 (d, J=8.7 Hz, 2H), 6.02 ( s, 1H), 5.52 (s, 1H), 3.91 (s, 2H), 3.66 (s, 3H), 3.46 (s, 2H), 1.28 (s, 6H)

Synthesis Example 53: Ethyl (R)-2-(4-(2-amino-2-oxoethyl)phenoxy)propanoate

Using benzyl 2-(4-hydroxyphenyl)acetate (0.80 g, 3.30 mmol) and ethyl (S)-2-hydroxypropanoate (0.43 g, 3.63 mmol), the methods from step 1 of the synthesis example were followed sequentially 4, and steps 2 and 4 of Synthesis Example 10 to obtain the desired product. (Yield: 33%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.15 (d, J=8.2 Hz, 2H), 6.83 (d, J=8.7 Hz, 2H), 5.87 ( s, 1H), 5.60 (s, 1H), 4.70 (kv, J=6.9 Hz, 1H), 4.20 (kv, J=7.2 Hz, 2H), 3.49 ( s, 2H), 1.59 (d, J=6.9 Hz, 3H), 1.24 (t, J=7.1 Hz, 3H)

Synthesis Example 54: Methyl (S)-2-(4-(2-amino-2-oxoethyl)phenoxy)propanoate

Using methyl (R)-2-hydroxypropanoate (1.081 mL, 11.35 mmol) and benzyl 2-(4-hydroxyphenyl) acetate (2.5 g, 10.32 mmol), the methods from step 1 of Synthesis Example 4 were followed sequentially. and steps 2 and 4 of Synthesis Example 10 to obtain the desired product. (3 steps yield: 11.3%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.25-7.16 (m, 2H), 6.88 (dt, J=9.4, 2.5 Hz, 2H), 5.41 ( d, J=28.4 Hz, 2H), 4.77 (kv, J=6.7 Hz, 1H), 3.79 (s, 3H), 3.54 (s, 2H), 1.43- 1.04 (m, 3H)

Synthesis Example 55: Ethyl 2-(4-(2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate

Using benzyl 2-(4-hydroxyphenyl)acetate (0.80 g, 3.30 mmol) and ethyl 2-bromo-2-methylpropanoate (1.29 g, 6.60 mmol), the methods from step 1 of the synthesis example were followed sequentially 38, and steps 2 and 4 of synthesis example 10 to obtain the desired product. (Yield: 55%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.13 (d, J=8.2 Hz, 2H), 6.81 (d, J=8.7 Hz, 2H), 5.88- 5.29 (m, 2H), 4.22 (kv, J=7.2 Hz, 2H), 3.51 (s, 2H), 1.58 (s, 6H), 1.24 (t, J =7.1 Hz, 3H)

Synthesis example 56. Methyl 2-(4-((4-(2-amino-2-oxoethyl)-phenoxy)methyl)phenyl)-2-methylpropanoate

Using methyl 2-(4-hydroxyphenyl) acetate (1.50 g, 9.03 mmol) and methyl 2-(4-(bromomethyl)phenyl)-2-methylpropanoate (2.69 g, 9.93 mmol), sequentially applied the methods from step 1 of synthesis example 38, and steps 2 and 3 of synthesis example 6 to obtain the desired product. (Yield: 52%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.43-7.28 (m, 4H), 7.18 (dt, J=9.3, 2.5 Hz, 2H), 6.95 (dt, J=9.3, 2.5 Hz, 2H), 5.53 (s, 2H), 5.02 (s, 2H), 3.64 (s, 3H), 3.53 (s, 2H), 1.57 (s, 6H)

Synthesis example 57. (R)-2-chloro-6-(3-(2-cyclobutoxyphenoxy)-piperidin-1-yl)pyrazine

2-(Benzyloxy)phenol (2.00 g, 9.99 mmol) and bromocyclobutane (2.70 g, 19.98 mmol) were used in the same manner as Synthesis Example 73 to obtain the desired product. (Yield: 29%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 7.92 (s, 1H), 7.74 (s, 1H), 7.02-6.90 (m, 2H), 6.89-6 .81 (m, 1H), 6.74 (dd, J=8.0, 1.6 Hz, 1H), 4.62-4.52 (m, 1H), 4.28 (td, J=7 ,2, 3.5 Hz, 1H), 4.03 (dd, J=13.3, 3.2 Hz, 1H), 3.81-3.68 (m, 1H), 3.68-3, 50 (m, 2H), 2.48-2.32 (m, 2H), 2.23-1.75 (m, 6H), 1.73-1.52 (m, 2H)

Synthesis example 58. Methyl 2-(4-(3-amino-2,2-dimethyl-3-oxo-propyl)phenyl)-2-methylpropanoate

Step 1. Tert-butyl 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate

Methyl 2-(4-(bromomethyl)phenyl)-2-methylpropanoate (5.40 g, 19.91 mmol) and tert-butyl isobutyrate (3.45 g, 23.90 mmol) were used by the same method as in step 1 of the synthesis example 33, obtaining the required product. (Yield: 78%)

¹ H-NMR (400 MHz, CHLOROFORM-D:) δ 7.20 (d, J=8.2 Hz, 2H), 7.09 (d, J=8.2 Hz, 2H), 3.63 ( s, 3H), 2.78 (s, 2H), 1.54 (s, 6H), 1.41 (s, 9H), 1.11 (s, 6H)

Step 2. Methyl 2-(4-(3-amino-2,2-dimethyl-3-oxopropyl)-phenyl)-2-methylpropanoate

Using tert-butyl 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.50 g, 1.50 mmol) obtained in step 1, sequentially applied the methods from steps 3 and 4 of Synthesis Example 10 to obtain the desired product. (Yield: 72%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.19 (d, J=7.8 Hz, 2H), 7.08 (d, J=8.2 Hz, 2H), 5.81 ( d, J=49.4 Hz, 2H), 3.61 (d, J=1.4 Hz, 3H), 2.79 (s, 2H), 1.52 (s, 6H), 1.15 ( d, J=1.4 Hz, 6H)

Synthesis example 59. Tert-butyl 3-(4-(1-amino-2-methyl-1-oxo-propan-2-yl)phenyl)-2,2-dimethylpropanoate

Using tert-butyl 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.50 g, 1.50 mmol) prepared in step 1 of the synthesis example 58, the methods from steps 2 and 3 of Synthesis Example 6 were applied sequentially to obtain the desired product. (Yield: 76%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.25 (d, J=8.2 Hz, 2H), 7.11 (d, J=8.2 Hz, 2H), 5.85 ( s, 1H), 5.31 (s, 1H), 2.78 (s, 2H), 1.53 (s, 6H), 1.41 (s, 9H), 1.10 (s, 6H)

Synthesis Example 60. Benzyl (E)-4-(3-amino-3-oxoprop-1-en-1-yl)bicyclo[2,2,2]octane-1-carboxylate

Step 1. Benzyl 4-(hydroxymethyl)bicyclo[2,2,2]octane-1-carboxylate

4-(Hydroxymethyl)bicyclo[2,2,2]octane-1-carboxylic acid (8.50 g, 46.1 mmol) and benzyl bromide (11.84 g, 69.2 mmol) were used in the same manner as in step 1 of synthesis example 38 to obtain the desired product. (Yield: 66%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.42-7.27 (m, 5H), 5.08 (s, 2H), 3.27 (s, 2H), 1.88-1 .76 (m, 6H), 1.49-1.37 (m, 6H)

Step 2. Benzyl 4-formylbicyclo[2,2,2]octane-1-carboxylate

Oxalyl chloride (1.02 g, 8.02 mmol) was dissolved in DCM (25 ml), and the temperature was reduced to -78°C. DMSO (1.25 g, 16.04 mmol) was then added and after 5 minutes dissolved in DCM (10 ml) and benzyl 4-(hydroxymethyl)bicyclo[2,2,2]octane-1-carboxylate (2, 00 g, 7.29 mmol) obtained in step 1. After stirring for another 15 minutes, triethylamine (3.69 g, 36.4 mmol) was added and the temperature was raised to room temperature. After adding water, the reaction mixture was extracted with DCM. The organic layer was dried over magnesium sulfate, filtered, concentrated under reduced pressure, and the resulting product was used in the next reaction without further purification.

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 9.44 (s, 1H), 7.39-7.27 (m, 5H), 5.09 (s, 2H), 1.91-1 .82 (m, 6H), 1.72-1.62 (m, 6H)

Step 3. Benzyl (E)-4-(3-amino-3-oxoprop-1-en-1-yl)-bicyclo[2,2,2]octane-1-carboxylate

Benzyl 4-formylbicyclo[2,2,2]octane-1-carboxylate (1.00 g, 3.67 mmol) obtained in Step 2 was used in the same manner as Synthesis Example 18 to obtain the desired product. (Yield: 68%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.39-7.27 (m, 5H), 6.76 (d, J=15.6 Hz, 1H), 5.65 (d, J =15.6 Hz, 1H), 5.33 (s, 2H), 5.09 (s, 2H), 1.91-1.81 (m, 6H), 1.59-1.55 (m, 6H)

Synthesis example 61. Methyl 4-(2-amino-2-oxoethyl)bicyclo-[2,2,2]octane-1-carboxylate

2-(4-(Methoxycarbonyl)bicyclo[2,2,2]octan-1-yl)acetic acid (0.90 g, 3.98 mmol) was used in the same manner as Step 3 of Synthesis Example 6 to give required product. (Yield: 84%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 5.51 (s, 2H), 3.62 (s, 3H), 2.01 (s, 2H), 1.91-1.70 (m , 6H), 1.62-1.47 (m, 6H)

Synthesis example 62. Tert-butyl 3-(3-(3-amino-3-oxopropyl)-phenyl)-2,2-dimethylpropanoate

Using 1-bromo-3-(bromomethyl)benzene (5.00 g, 20.01 mmol) and tert-butyl isobutyrate (3.46 g, 24.01 mmol), the methods from step 1 of synthesis example 33, step 1 of synthesis example 10 were applied sequentially , and step 2 and step 3 of synthesis example 6 to obtain the desired product. (Yield: 31%)

¹ H-NMR (400 MHz, CHLOROFORM-D:) δ 7.17 (t, J=7.8 Hz, 1H), 7.04 (d, J=7.8 Hz, 1H), 6.99 ( d, J=5.5 Hz, 2H), 5.30 (s, 2H), 2.92 (t, J=7.8 Hz, 2H), 2.78 (s, 2H), 2.50 ( t, J=7.5 Hz, 2H), 1.43 (s, 9H), 1.10 (s, 6H)

Synthesis example 63. Tert-butyl 3-(4-(2-amino-2-oxoethyl)-phenyl)-2,2-dimethylpropanoate

2-(4-(Bromomethyl)phenyl)acetic acid (14.0 g, 61.1 mmol) and tert-butyl isobutyrate (26.4 g, 183 mmol) were used in the same manner as Synthesis Example 33 to obtain the desired product. (Yield: 42%)

¹ H-NMR (400 MHz, CHLOROFORM-D:) δ 7.19-7.11 (m, 4H), 5.38 (d, J=23.8 Hz, 2H), 3.54 (s, 2H ), 2.80 (s, 2H), 1.46-1.37 (9H), 1.11 (s, 6H)

Synthesis example 64. Tert-butyl (R)-3-(3-(3-carbamoyl-piperidin-1-yl)phenyl)-2,2-dimethylpropanoate

Using 1-bromo-3-(bromomethyl)benzene (5.00 g, 20.01 mmol) and tert-butyl isobutyrate (3.46 g, 24.01 mmol), the methods from Step 1 of Synthesis Example 33, Step 1 of Synthesis Example 33 were followed sequentially 2 and steps 2 and 3 of synthesis example 6 to obtain the desired product. (Yield: 16%)

¹ H-NMR (400 MHz, CHLOROFORM-D:) δ 7.18-7.09 (m, 1H), 6.82 (d, J=8.2 Hz, 1H), 6.79-6.66 (m, 3H), 5.80 (s, 1H), 3.30-3.23 (m, 2H), 3.16-3.08 (m, 2H), 2.77 (dd, J=16 ,0, 13.3 Hz, 2H), 2.59 (s, 1H), 1.92-1.77 (m, 3H), 1.77-1.64 (m, 1H), 1.45- 1.35 (m, 9H), 1.15-1.06 (m, 6H)

Synthesis example 65. Benzyl (E)-2-(4-(3-amino-3-oxoprop-1-en-1-yl)phenyl)-2-methylpropanoate

Using 2-(4-bromophenyl)-2-methylpropanoic acid (5.00 g, 20.57 mmol) and benzyl bromide (4.22 g, 24.68 mmol), the methods from step 1 of Synthesis Example 43 and steps 1, 3 and 4 examples of the synthesis of 10 to obtain the desired product. (Yield: 60%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.66-7.59 (m, 1H), 7.54-7.40 (m, 2H), 7.40-7.25 (m, 5H), 7.19-7.10 (m, 2H), 6.47-6.40 (m, 1H), 5.61 (s, 2H), 5.09 (s, 2H), 1.59 (s, 6H)

Synthesis example 66. (R)-2-chloro-4-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrimidine

(R)-3-ethoxy-2-(piperidin-3-yloxy)pyridine hydrochloride (5.90 g, 22.80 mmol) prepared in step 3 of Synthesis Example 70, and 2,4-dichloropyrimidine (3.74) g, 25.08 mmol) was used in the same manner as in step 3 of Synthesis Example 1 to obtain the desired product. (Yield: 26%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.91 (d, J=6.4 Hz, 1H), 7.70 (dd, J=4.8, 1.6 Hz, 1H), 7.03 (dd, J=7.8, 1.4 Hz, 1H), 6.82 (kv, J=4.1 Hz, 1H), 6.32 (d, J=5.9 Hz, 1H ), 5.19 (s, 1H), 4.05-3.59 (m, 6H), 2.25-1.90 (m, 3H), 1.76-1.57 (m, 1H), 1.31 (t, J=6.9 Hz, 3H)

Synthesis example 67. Tert-butyl 3-(4-(2-((2-chloropyrimidin-4-yl)-amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoate

Tertbutyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.50 g, 1.50 mmol) prepared in Synthesis Example 63, and 2,4-dichloropyrimidine ( 0.20 g, 1.34 mmol) was used in the same manner as in Step 1 of Synthesis Example 2 to obtain the desired product. (Yield: 28%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.46 (d, J=5.5 Hz, 1H), 8.11 (d, J=5.5 Hz, 1H), 8.01 ( s, 1H), 7.17 (s, 4H), 3.72 (s, 2H), 3.70-3.65 (m, 1H), 2.82 (s, 2H), 1.42 (s , 9H), 1.12 (s, 6H)

Synthesis example 68. (R)-4-chloro-2-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrimidine

Tert-butyl-(R)-3-(2-ethoxyphenoxy)piperidine-1-carboxylate (15.0 g, 46.7 mmol) prepared in step 1 of Synthesis Example 1, and 2,4-dichloropyrimidine (13.9 g, 93 mmol) was used in the same manner as in steps 2 and 3 of Synthesis Example 1 to obtain the desired product. (Yield: 19%)

m/z (M+H) ⁺ calculated for C ₁₇ H ₂₁ ClN ₃ O ₂ : 334, detected 334

Synthesis example 69. (R)-2-chloro-4-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrimidine

Tert-butyl-(R)-3-(2-ethoxyphenoxy)piperidine-1-carboxylate (15.0 g, 46.7 mmol) prepared in step 1 of Synthesis Example 1, and 2,4-dichloropyrimidine (13.9 g, 93 mmol) was used in the same manner as in steps 2 and 3 of Synthesis Example 1 to obtain the desired product. (Yield: 72%)

m/z (M+H) ⁺ calculated for C ₁₇ H ₂₁ ClN ₃ O ₂ : 334, detected 334

Synthesis Example 70. (R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazine

Step 1. 2-Chloro-3-ethoxypyridine

2-Chloro-3-hydroxypyridine (10.0 g, 77 mmol), iodoethane (14.45 g, 93 mmol) and potassium carbonate (21.34 g, 154 mmol) were added to 77 ml DMF and stirred at room temperature in within 48 hours. The reaction mixture was filtered, water was added and then extracted with ethyl acetate. After washing with water and brine, the organic layer was dried over magnesium sulfate and concentrated under reduced pressure. Purification was carried out by column chromatography to obtain the desired product. (Yield: 99%)

¹ H NMR (400 MHz, CHLOROFORM-D): δ 7.96 (t, J=3.0 Hz, 1H), 7.17 (d, J=3.2 Hz, 2H), 4.10 (q , J=7.0 Hz, 2H), 1.48 (t, J=7.1 Hz, 3H)

Step 2. Tert-butyl (R)-3-((3-ethoxypyridin-2-yl)oxy)-piperidine-1-carboxylate

Sodium hydride (3.38 g, 84 mmol) was added to 96 ml of anhydrous DMF, and then tert-butyl (R)-3-hydroxypiperidine-1-carboxylate (17.00 g, 84 mmol) was added. The temperature was raised to 60°C and the reaction mixture was stirred for 1 hour. 2-chloro-3-ethoxypyridine (12.1 g, 77 mmol) obtained in step 1 was added, then stirred for 24 hours. Water was added to the reaction mixture, then extracted with ethyl acetate. After washing with water and brine, the organic layer was dried over magnesium sulfate and concentrated under reduced pressure. Purification was carried out by column chromatography to obtain the desired product. (Yield: 75%)

¹ H NMR (400 MHz, CHLOROFORM-D): δ 7.68 (td, J=3.2, 1.7 Hz, 1H), 7.03 (dt, J=7.8, 1.4 Hz, 1H), 6.82-6.72 (m, 1H), 5.06 (s, 1H), 4.03 (kv, J=7.0 Hz, 2H), 3.55 (d, J=100 .2 Hz, 4H), 2.16-1.96 (m, 1H), 1.96-1.70 (m, 2H), 1.68-1.50 (m, 1H), 1.50- 1.27 (m, 12H)

Step 3. (R)-3-ethoxy-2-(piperidin-3-yloxy)pyridine hydrochloride

Tert-butyl (R)-3-((3-ethoxypyridin-2-yl)oxy)piperidine-1-carboxylate (31.5 g, 98 mmol) obtained in step 2 was used in the same manner as in step 2 of the synthesis example 1 to obtain the title compound.

Step 4. (R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)-piperidin-1-yl)pyrazine

(R)-3-ethoxy-2-(piperidin-3-yloxy)pyridine hydrochloride (30 g, 116 mmol) obtained in step 3 and 2,6-dichloropyrazine (19 g, 128 mmol) were used in the same manner. as in step 3 of Synthesis Example 1 to obtain the title compound. (Yield: 80%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 7.96 (d, J=11.0 Hz, 1H), 7.74-7.66 (m, 2H), 7.04 (dd, J= 7.8, 1.4 Hz, 1H), 6.83 (dd, J=7.8, 5.0 Hz, 1H), 5.24 (td, J=7.0, 3.4 Hz, 1H ), 4.05-3.83 (m, 3H), 3.83-3.70 (m, 2H), 3.67-3.53 (m, 1H), 2.22-2.09 (m , 1H), 2.07-1.93 (m, 2H), 1.75-1.60 (m, 1H), 1.35-1.27 (t, J=7.1 Hz, 3H)

Synthesis example 71. (R)-2-chloro-6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyridine

(R)-3-(2-ethoxyphenoxy)piperidine hydrochloride (10 g, 45.2 mmol) prepared in step 2 of Synthesis Example 1 and 2,6-dichloropyridine (11.37 g, 77 mmol) were used in the same manner , as in step 3 of synthesis example 1, to obtain the desired product. (Yield: 41%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.44-7.29 (m, 1H), 7.17-7.05 (m, 1H), 6.94-6.86 (m, 3H ), 6.73-6.49 (m, 1H), 6.49-6.32 (m, 1H), 4.30-4.17 (m, 2H), 4.04-3.96 (m , 2H), 3.95-3.78 (m, 1H), 3.35-3.18 (m, 2H), 2.22-2.07 (m, 1H), 1.97-1.75 (m, 2H), 1.64-1.52 (m, 1H), 1.40 (kV, J=6.9 Hz, 3H)

Synthesis example 72. (R)-2-chloro-4-(3-(2-ethoxyphenoxy)-piperidin-1-yl)-6-(trifluoromethyl)pyrimidine

(R)-3-(2-ethoxyphenoxy)piperidine hydrochloride (0.23 g, 0.89 mmol) obtained in step 2 of Synthesis Example 1, and 2,4-dichloro-6-(trifluoromethyl)pyrimidine (0.21 g, 0.98 mmol) was used in the same manner as in step 3 of Synthesis Example 1 to obtain the title compound. (Yield: 86%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 7.14-6.31 (m, 5H), 4.79-3.18 (m, 7H), 2.04 (s, 3H), 1. 60 (s, 1H), 1.30 (dt, J=29.7, 6.7 Hz, 3H)

Synthesis example 73. (R)-2-chloro-6-(3-(2-isopropoxyphenoxy)-piperidin-1-yl)pyrazine

Step 1. 1-(Benzyloxy)-2-isopropoxybenzene

2-(Benzyloxy)phenol (1.15 g, 5.74 mmol), 2-bromopropane (1.413 g, 11.49 mmol) and potassium carbonate (3.17 g, 22.97 mmol) were dissolved in 19 ml DMF and stirred at 45°C for 15 hours. After confirmation of completion of the reaction by TLC, the organic solvent was removed under reduced pressure. After extraction with ethyl acetate (2 x 30 ml), the resulting product was washed with brine (20 ml), and the organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 30) to obtain the desired product. (Yield: 93%)

m/z (M+H) ⁺ calculated for C ₁₆ H ₁₈ O ₂ : 242, detected 243

Stage 2. 2-Isopropoxyphenol

1-(Benzyloxy)-2-isopropoxybenzene (1.3 g, 5.36 mmol) obtained in step 1 was dissolved in 40 ml methanol, and palladium on carbon (0.143 g, 1.341 mmol) was added in portions, then the removal reaction was carried out protecting group using hydrogen from a cylinder. After confirming the completion of the reaction, the resulting product was filtered through a pad of celite, and the organic solvent was removed under reduced pressure to obtain the desired product. (Yield: 99%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.02-6.75 (m, 4H), 5.69 (d, J=19.0 Hz, 1H), 4.63-4.52 ( m, 1H), 1.46-1.32 (m, 6H)

Step 3. Tert-butyl (R)-3-(2-isopropoxyphenoxy)piperidine-1-carboxylate

2-Isopropoxyphenol (0.81 g, 5.32 mmol) obtained in step 2 and (S)-tert-butyl-3-hydroxypiperidine-1-carboxylate (1.07 g, 5.32 mmol) were used by the same method. as in step 1 of Synthesis Example 1 to obtain the desired product. (Yield: 13.6%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.01-6.81 (m, 4H), 4.45 (td, J=12.2, 6.1 Hz, 1H), 4.11 ( kv, J=7.3 Hz, 2H), 3.62 (s, 1H), 3.27 (s, 1H), 3.16 (s, 1H), 2.03 (d, J=7.9 Hz, 2H), 1.83 (s, 1H), 1.74 (d, J=6.7 Hz, 1H), 1.42 (s, 9H), 1.32 (kv, J=2.9 Hz, 6H)

Step 4. (R)-3-(2-isopropoxyphenoxy)piperidine

Tert-butyl (R)-3-(2-isopropoxyphenoxy)piperidine-1-carboxylate (0.27 g, 0.805 mmol) obtained in Step 3 was used in the same manner as in Step 2 of Synthesis Example 1 to obtain the desired product.

m/z (M+H) ⁺ calculated for C ₁₆ H ₁₈ O ₂ : 235.3, detected 236.2

Step 5. (R)-2-chloro-6-(3-(2-isopropoxyphenoxy)piperidin-1-yl)pyrazine

(R)-3-(2-isopropoxyphenoxy)piperidine (0.189 g, 0.803 mmol) obtained in Step 4 was used in the same method as in Step 3 of Synthesis Example 1 to obtain the desired product. (Yield: 25%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 7.93 (s, 1H), 7.74 (s, 1H), 7.01-6.85 (m, 4H), 4.44 (td, J=12.2, 6.1 Hz, 1H), 4.32-4.22 (m, 1H), 4.02 (dd, J=13.4, 3.1 Hz, 1H), 3.74 (kvd, J=6.5, 3.8 Hz, 1H), 3.64-3.47 (m, 2H), 2.12-2.05 (m, 1H), 2.03-1.85 (m, 2H), 1.61 (kvd, J=8.7, 4.3 Hz, 1H), 1.32-1.18 (m, 6H)

Synthesis example 74. (R)-2-chloro-6-(3-(2-methoxyphenoxy)-piperidin-1-yl)pyrazine

(S)-tert-butyl-3-hydroxypiperidine-1-carboxylate (2.00 g, 9.94 mmol) and 2-methoxyphenol (1.23 g, 9.94 mmol) were used by the same method as in Synthesis Example 1. to obtain the required product. (exit beyond 3 stages: 32%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.95 (s, 1H), 7.77 (s, 1H), 7.13-6.82 (m, 4H), 4.31 (td, J=7.8, 4.1 Hz, 1H), 4.25-4.15 (m, 1H), 3.97-3.64 (m, 4H), 3.57-3.33 (m, 2H), 2.14 (d, J=5.0 Hz, 1H), 2.03-1.82 (m, 2H), 1.73-1.59 (m, 1H)

Synthesis Example 75: (R)-2-chloro-6-(3-(2-(trifluoromethoxy)phenoxy)piperidin-1-yl)pyrazine

(S)-tert-butyl-3-hydroxypiperidine-1-carboxylate (2.00 g, 9.94 mmol) and 2-(trifluoromethoxy)phenol (1.77 g, 9.94 mmol) were used by the same method as in Example synthesis 1 to obtain the desired product. (Yield: 8%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.98 (s, 1H), 7.79 (s, 1H), 7.45-7.28 (1H), 7.25-7.07 ( m, 2H), 6.98 (t, J=7.5 Hz, 1H), 4.39 (d, J=3.7 Hz, 1H), 4.18 (d, J=13.3 Hz, 1H), 3.93-3.70 (m, 1H), 3.67-3.39 (2H), 2.15 (d, J=18.3 Hz, 1H), 2.02-1.82 (m, 2H), 1.79-1.60 (m, 1H)

Synthesis example 76. (R)-2-chloro-6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)pyrazine

Step 1. 1-(Benzyloxy)-2-(2-fluoroethoxy)benzene

2-Fluoroethan-1-ol (1.10 ml, 18.7 mmol), 2-(benzyloxy)phenol (3.26 ml, 18.7 mmol) and triphenylphosphine (5.50 g, 21.0 mmol) were dissolved in 50 ml of toluene and stirred at room temperature. To the reaction mixture, diethyl azodicarboxylate (3.82 ml) dissolved in 44 ml of toluene was slowly added dropwise. After stirring at room temperature for 15 hours, the mixture was filtered, washed with diethyl ether, washed with 1 N sodium hydroxide solution and dried over magnesium sulfate, and the organic solvent was removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 20) to obtain the desired product. (Yield: 76%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.53-7.27 (m, 5H), 7.05-6.84 (m, 4H), 5.14 (s, 2H), 4, 75 (dt, J=47.4, 4.2 Hz, 2H), 4.29 (dt, J=27.7, 4.3 Hz, 2H)

Step 2. 2-(2-Fluoroethoxy)phenol

1-(Benzyloxy)-2-(2-fluoroethoxy)benzene (1.50 g, 6.09 mmol) obtained in step 1 and palladium on carbon (0.65 g, 0.61 mmol) were dissolved in 122 ml methanol and stirred at room temperature while purging hydrogen gas. After stirring for 15 hours, the resulting product was filtered and the organic solvent was removed under reduced pressure. (Yield: 96%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.04-6.75 (m, 4H), 5.76-5.61 (1H), 4.90-4.63 (m, 2H), 4.40-4.18 (2H)

Step 3. (R)-2-chloro-6-(3-(2-(2-fluoroethoxy)phenoxy)-piperidin-1-yl)pyrazine

(S)-tert-butyl-3-hydroxypiperidine-1-carboxylate (1.17 g, 5.83 mmol) and 2-(2-fluoroethoxy)phenol (0.91 g, 5.8 mmol) obtained in step 2, used the same method as in synthesis example 1 to obtain the desired product. (Yield: 24%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.95 (s, 1H), 7.75 (s, 1H), 7.11-6.85 (m, 4H), 4.71 (dt, J=47.6, 4.1 Hz, 2H), 4.41-4.28 (m, 1H), 4.28-4.14 (m, 2H), 4.03 (dd, J=13, 5, 3.0 Hz, 1H), 3.83-3.47 (m, 3H), 2.18-2.05 (m, 1H), 2.04-1.84 (m, 2H), 1 .72-1.58 (m, 1H)

Synthesis example 77. (R)-2-chloro-6-(3-(2-cyclopropoxy-phenoxy)piperidin-1-yl)pyrazine

2-(Benzyloxy)phenol (2.00 g, 9.99 mmol) and cyclopropyl bromide (3.63 g, 30.0 mmol) were used in the same manner as Synthesis Example 73 to obtain the desired product. (Yield: 8.1%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.92 (s, 1H), 7.74 (s, 1H), 7.24-7.18 (m, 1H), 7.04-6 .94 (m, 2H), 6.93-6.85 (m, 1H), 4.23 (td, J=7.5, 3.7 Hz, 1H), 4.09-4.01 (m , 1H), 3.83-3.67 (m, 2H), 3.59-3.44 (m, 2H), 2.15-2.04 (m, 1H), 2.02-1.84 (m, 2H), 1.67-1.51 (m, 1H), 0.74 (d, J=4.6 Hz, 4H)

Synthesis example 78. Tert-butyl 3-(3′-(chlorocarbonyl)-[1,1′-biphenyl]-3-yl)-2,2-dimethylpropanoate

Step 1. Tert-butyl 2,2-dimethyl-3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolin-2-yl)phenyl)propanoate

Intermediate tert-butyl 3-(3-bromophenyl)-2,2-dimethylpropanoate (0.870 g, 2.78 mmol) obtained in Synthesis Example 64, bis(pinacolato)diboron (0.846 g, 3.33 mmol) and potassium acetate ( 0.818 g, 8.33 mmol) was dissolved in 1,4-dioxane (13.89 ml) and [1,1'-bis(diphenylphosphino)ferrocene]dichloro-palladium dichloromethane adduct (0.113 g, 0.139 mmol) was added. The reaction mixture was stirred at reflux at 100°C for 16 hours. The resulting product was filtered through a pad of celite, and the organic solvent was removed under reduced pressure. Purification was carried out on a silica gel column to obtain the desired product. (Yield: 32.4%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.69-7.54 (2H), 7.23 (d, J=1.4 Hz, 2H), 2.82 (s, 2H), 1.55 (d, J=1.4 Hz, 2H), 1.43 (s, 9H), 1.31 (s, 12H), 1.12 (s, 6H)

Step 2. Ethyl 3′-(3-(tert-butoxy)-2,2-dimethyl-3-oxo-propyl)-[1,1′-biphenyl]-3-carboxylate

Tertbutyl 2,2-dimethyl-3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxa-borolin-2-yl)phenyl)propanoate (0.173 g, 0.480 mmol), obtained from step 1, ethyl 3-bromobenzoate (0.100 g, 0.437 mmol) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium dichloromethane adduct (0.018 g, 0.022 mmol) were dissolved in 1,4-dioxane (4.37 ml ), and 2 M sodium carbonate solution (0.655 ml, 1.310 mmol) was added dropwise, then stirred at 90°C for 5 hours. After cooling to room temperature, the resulting product was filtered through a pad of celite, washed with dichloromethane and dried over magnesium sulfate, and the organic solvent was removed under reduced pressure. Purification was carried out on a silica gel column to obtain the desired product. (Yield: 68.6%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.24 (t, J=1.6 Hz, 1H), 8.00 (dt, J=7.8, 1.4 Hz, 1H), 7.74 (dt, J=7.8, 1.4 Hz, 1H), 7.47 (kv, J=7.5 Hz, 2H), 7.39 (s, 1H), 7.34 (t , J=7.8 Hz, 1H), 7.17 (d, J=7.8 Hz, 1H), 4.40 (kv, J=7.2 Hz, 2H), 2.90 (s, 2H ), 1.43-1.37 (m, 12H), 1.15 (s, 6H)

Step 3. 3′-(3-(Tretbutoxy)-2,2-dimethyl-3-oxopropyl)-[1,1′-biphenyl]-3-carboxylic acid

Using ethyl 3′-(3-(tert-butoxy)-2,2-dimethyl-3-oxo-propyl)-[1,1′-biphenyl]-3-carboxylate (0.1145 g, 0.299 mmol) obtained in step 2, and 1 N sodium hydroxide, a hydrolysis reaction was carried out to obtain the desired product. (Yield: 32.1%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.33 (s, 1H), 8.09 (d, J=7.8 Hz, 1H), 7.81 (d, J=7.8 Hz, 1H), 7.53 (t, J=7.8 Hz, 1H), 7.48 (d, J=7.8 Hz, 1H), 7.42 (s, 1H), 7.35 ( t, J=7.8 Hz, 1H), 7.19 (d, J=7.8 Hz, 1H), 2.91 (s, 2H), 1.42 (s, 9H), 1.18 ( d, J=6.4 Hz, 6H)

Step 4. Tert-butyl 3-(3′-(chlorocarbonyl)-[1,1′-biphenyl]-3-yl)-2,2-dimethylpropanoate

Using 3'-(3-(tert-butoxy)-2,2-dimethyl-3-oxopropyl)-[1,1'-biphenyl]-3-carboxylic acid (0.0341 g, 0.096 mmol) obtained in step 3, the desired product was obtained by amidation reaction using the same method as in step 4 of synthesis example 10. (Yield: 99%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.08-7.93 (m, 1H), 7.75 (dt, J=7.8, 1.4 Hz, 1H), 7.73 -7.68 (m, 1H), 7.48 (t, J=7.8 Hz, 1H), 7.44 (dd, J=7.8, 1.4 Hz, 1H), 7.37 ( d, J=6.4 Hz, 1H), 7.33 (t, J=7.8 Hz, 1H), 7.16 (d, J=7.8 Hz, 1H), 6.07 (d, J=135.4 Hz, 2H), 2.89 (s, 2H), 1.50-1.36 (m, 9H), 1.15 (s, 6H)

Synthesis example 79. Tert-butyl 3-(3'-(chlorocarbonyl)-[1,1'-biphenyl]-4-yl)-2,2-dimethylpropanoate

Step 1. Tert-butyl 3-(4-bromophenyl)-2,2-dimethylpropanoate

1-Bromo-4-(bromomethyl)benzene (2.311 g, 9.25 mmol) and tert-butyl isobutyrate (2.0 g, 13.87 mmol) were used in the same manner as in Step 1 of Synthesis Example 33 to obtain the required product. (Yield: 79%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.36 (d, J=8.2 Hz, 2H), 7.02 (d, J=8.2 Hz, 2H), 2.76 ( s, 2H), 1.41 (d, J=0.9 Hz, 9H), 1.10 (s, 6H)

Step 2. Tert-butyl 3-(3′-(chlorocarbonyl)-[1,1′-biphenyl]-4-yl)-2,2-dimethylpropanoate

Tert-butyl 3-(4-bromophenyl)-2,2-dimethylpropanoate (2.27 g, 7.265 mmol) obtained in Step 1 was used in the same manner as Synthesis Example 78 to obtain the desired product. (Yield: 26.3%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.04 (t, J=1.6 Hz, 1H), 7.82-7.61 (2H), 7.46 (t, J=8 .7 Hz, 3H), 7.21 (d, J=8.2 Hz, 2H), 6.68-6.16 (m, 2H), 2.84 (s, 2H), 1.43 (s , 9H), 1.15-1.10 (6H)

Example 1: (R)-1-(3,5-bis(trifluoromethyl)phenyl)-3-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)urea

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.49 g, 1.57 mmol) prepared in the synthesis example of 2, 3,5-bis(trifluoromethyl )phenyl cyanate (0.44 g, 1.73 mmol) and diisopropylethylamine (0.55 ml, 3.14 mmol) were added to 30 ml of dichloromethane and stirred at room temperature for 6 hours. After confirming the completion of the reaction by TLC, the resulting product was diluted with dichloromethane and washed with an aqueous sodium carbonate solution and brine, and the organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 1: 1) to obtain the desired product. (Yield: 31%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 11.40 (s, 1H), 8.48 (s, 1H), 7.99 (s, 2H), 7.82 (s, 1H), 7 .55 (s, 1H), 7.53 (s, 1H), 6.69-6.89 (m, 4H), 4.46 (m, 1H), 3.95 (m, 3H), 3. 78 (m, 2H), 3.65 (m, 1H), 2.07-2.17 (m, 3H), 1.73 (m, 1H), 1.30 (t, 3H)

Example 2. ((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)-L-phenylalanine

Step 1. Methyl ((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)-L-phenylalanate

(S)-Methyl 2-amino-3-phenylpropanate (32.5 mg, 0.1 mmol) was mixed with 1 ml of dichloromethane and stirred at 0°C. After adding 1 ml of saturated aqueous sodium carbonate solution to this solution, triphosgene (56.6 mg, 0.191 mmol) was added, and then (R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin- 2-amine (50 mg, 0.159 mmol) obtained in Synthesis Example 2. After separating the organic layer, the solvent was changed to THF and the reaction mixture was stirred at 70°C for 12 hours. After removing the organic solvent under reduced pressure, the resulting product was purified by a silica gel column (acetone:dichloromethane=1:3) to obtain the desired ether product. (Yield: 18%)

m/z (M+Na) ⁺ calculated for C ₂₈ H ₃₃ N ₅ O ₅ Na: 542.6, detected 542.3

^1H NMR (300 MHz, CHLOROFORM-D): δ 9.07 (d, 1H), 7.74 (s, 1H), 7.68 (s, 1H), 7.44 (s, 1H), 7 .25 (m, 3H), 7.09-7.11 (2H, m), 6.87-6.96 (m, 4H), 5.04 (m, 1H), 4.26 (m, 1H ), 3.98-4.03 (m, 2H), 3.73 (m, 1H), 3.71 (s, 3H), 3.45-3.50 (m, 2H), 3.17 ( d, 2H), 2.98 (t, 1H), 2.07 (m, 1H), 1.80 (m, 2H), 1.58 (br.s, 1H), 1.48 (m, 1H ), 1.40 (t, 3H), 1.26 (m, 1H)

Step 2. ((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)-L-phenylalanine

The ether compound (15 mg, 0.029 mmol) obtained in step 1 was dissolved in 0.3 ml THF and 0.3 ml water. Lithium hydroxide (3 mg, 0.1 mmol) was then added and the reaction mixture was stirred at 40°C for 12 hours. After cooling to room temperature, the reaction mixture was adjusted to pH 4.5 with 1 N hydrochloric acid and diluted with ethyl acetate. After removing the aqueous layer, the resulting product was dried over magnesium sulfate, and the organic solvent was removed under reduced pressure to obtain the desired product.

^1H NMR (300 MHz, CHLOROFORM-D): δ 9.21 (s, 1H), 8.99 (s, 1H), 7.68 (s, 1H), 7.45 (s, 1H), 7 .14 (m, 5H), 6.90 (m, 4H), 5.02 (m, 1H), 4.17 (m, 1H), 4.05 (m, 2H), 3.90 (d, 1H), 3.68 (m, 1H), 3.47 (m, 1H), 3.30 (m, 1H), 3.20 (m, 3H), 2.96 (m, 1H), 2. 05 (m, 3H), 1.73 (m, 2H), 1.25-1.42 (m, 5H)

Example 3: (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)morpholine-4-carboxamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine obtained in Synthesis Example 2 and morpholine were used in the same method as in Step 1 of Example 2 to obtain the desired product .

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.54 (s, 1H), 7.82 (s, 1H), 6.86-6.99 (m, 4H), 6.57 (s, 1H), 4.31 (m, 1H), 4.00 (m, 3H), 3.75 (m, 5H), 3.57 (m, 1H), 3.50 (m, 4H), 3. 39 (m, 1H), 2.13 (m, 1H), 1.93-1.96 (m, 2H), 1.60-1.63 (m, 2H), 1.39 (t, 3H) , 1.26 (m, 1H)

Example 4: (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)pyrrolidin-1-carboxamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine obtained in Synthesis Example 2 and pyrrolidine were used in the same method as in Step 1 of Example 2 to obtain the desired product .

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.63 (s, 1H), 7.78 (s, 1H), 6.87-6.98 (m, 4H), 6.45 (s, 1H), 4.29 (m, 1H), 3.96-4.10 (m, 3H), 3.77 (m, 1H), 3.48 (m, 5H), 3.34 (m, 1H ), 2.13 (m, 1H), 1.89-1.99 (m, 7H), 1.61 (m, 1H), 1.39 (t, 3H)

Example 5 1-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)pyrrolidine-3-carboxylic acid

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine prepared in Synthesis Example 2 and methyl pyrrolidine-3-carboxylate were used in the same method as in Example 2, with obtaining the required product.

^1H NMR (300 MHz, Methanol-D): δ 8.27 (s, 1H), 7.69 (s, 1H), 7.00 (d, 1H), 6.93 (br.s, 3H) , 4.47 (br.s, 1H), 3.92 (m, 2H), 3.71 (m, 2H), 3.68 (m, 3H), 3.57 (m, 4H), 3, 21 (m, 1H), 2.25 (m, 2H), 2.03 (m, 5H), 2.61 (br.s, 2H), 1.28 (m, 10H), 0.92 (m 2H)

Example 6: (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)benzamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.15 g, 0.5 mmol) obtained in Synthesis Example 2, and triethylamine (0.35 ml , 2.5 mmol) was dissolved in 10 ml of dichloromethane at 0°C, and benzoyl chloride (0.07 ml, 0.5 mmol) was slowly added dropwise. After stirring at 0°C for 2 hours, completion of the reaction was confirmed by TLC, and the resulting product was washed with saline. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 3: 1) to obtain the desired product. (Yield: 38%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.86 (s, 1H), 8.09 (m, 4H), 7.61 (m, 1H), 7.50 (m, 2H), 6 .98 (m, 1H), 6.89 (m, 3H), 4.36 (m, 1H), 3.92-4.03 (m, 3H), 3.74 (m, 1H), 3. 66 (m, 1H), 3.49 (m, 1H), 2.11 (m, 1H), 2.01 (m, 1H), 1.94 (m, 1H), 1.62 (m, 1H ), 1.36 (t, 3H)

Example 7 (R)-4-chloro-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)benzamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.09 g, 0.25 mmol) obtained in synthesis example 2, and 4-chlorobenzoyl chloride (0. 04 g, 0.25 mmol) was used in the same manner as in Example 6 to obtain the desired product. (Yield: 19%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.83 (s, 1H), 7.95 (s, 1H), 7.82 (m, 3H), 7.45 9m, 2H), 6, 97 (m, 1H), 6.88 (m, 3H), 4.36 (m, 1H), 3.90-4.35 (m, 3H), 3.72 (m, 2H), 3.52 (m, 1H), 2.12 (m, 1H), 2.01 (m, 1H), 1.96 (m, 1H), 1.63 (m, 1H), 1.37 (t, 3H)

Example 8 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-3-methoxybenzamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol), obtained in the synthesis example of 1, 3-methoxybenzamide (0.03 g, 0.17 mmol), tris(dibenzylideneacetone)-dipalladium(0) (8.2 mg, 0.009 mmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthine (7.7 mg, 0.01 mmol) and cesium carbonate (0.12 g, 0.38 mmol) were added to 5 ml of dioxane and stirred at reflux for 4 hours. After completion of the reaction, the resulting product mixture was cooled to room temperature, diluted with ethyl acetate and washed with aqueous sodium carbonate and brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 3: 1) to obtain the desired product. (Yield: 52%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.85 (s, 1H), 7.92 (s, 1H), 7.90 (s, 1H), 7.47 (m, 1H), 7.41 (m, 2H), 7.12 (m, 1H), 6.99 (m, 1H), 6.92-6.84 (m, 3H), 4.34 (m, 1H), 4 .03-3.91 (m, 3H), 3.89 (s, 3H), 3.75 (m, 1H), 3.67 (m, 1H), 3.48 (m, 1H), 2. 13 (m, 1H), 2.02 (m, 1H), 1.94 (m, 1H), 1.62 (m, 1H), 1.36 (t, 3H)

Example 9 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-4-methoxybenzamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) obtained in synthesis example 1, and 4-methoxybenzamide (0. 03 g, 0.17 mmol) was used in the same manner as in Example 8 to obtain the desired product. (Yield: 54%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.84 (s, 1H), 7.91 (s, 1H), 7.84 (m, 3H), 6.99 (m, 3H), 6.92-6.83 (m, 3H), 4.34 (m, 1H), 4.03-3.90 (m, 3H), 3.88 (s, 3H), 3.75 (m, 1H), 3.66 (m, 1H), 3.45 (m, 1H), 2.12 (m, 1H), 2.04 (m, 1H), 1.93 (m, 1H), 1. 61 (m, 1H), 1.37 (t, 3H)

Example 10 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-4-nitrobenzamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) obtained in synthesis example 1, and 4-nitrobenzamide (0. 03 g, 0.17 mmol) was used in the same manner as in Example 8 to obtain the desired product. (Yield: 55%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.81 (s, 1H), 8.37 (d, 2H), 8.06 (d, 2H), 7.97 (s, 1H), 7.88 (s, 1H), 6.95 (m, 1H), 6.87 (m, 3H), 4.37 (m, 1H), 4.02-3.88 (m, 3H), 3 .79 (m, 1H), 3.70 (m, 1H), 3.56 (m, 1H), 2.12 (m, 1H), 2.05 (m, 1H), 1.97 (m, 1H), 1.62 (m, 1H), 1.36 (t, 3H)

Example 11 (R)-2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)benzoic acid

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine obtained in Synthesis Example 2 and phthalic anhydride were used in the same method as in Example 6 to obtain the desired product.

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.71 (s, 1H), 8.03 (s, 1H), 7.92 (m, 2H), 7.56 (m, 3H), 6 .95 (m, 1H), 6.84 (s, 3H), 4.31 (br.s, 1H), 3.95 (m, 3H), 3.78 (m, 1H), 3.64 ( m, 3H), 3.40 (br.s, 1H), 1.94-2.25 (m, 4H), 1.50 (m, 1H), 1.27-1.42 (m, 5H) , 0.90 (m, 2H)

Example 12 (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)acetic acid

Step 1. Methyl (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)acetate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.864 g, 2.59 mmol) prepared in Synthesis Example 1 and methyl 2-(4-carbamoylphenyl) acetate (0.6 g, 3.11 mmol) obtained in Synthesis Example 3 was used in the same manner as in Example 8 to obtain the desired product. (Yield: 37%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.85 (s, 1H), 7.92 (s, 1H), 7.89 (s, 1H), 7.85 (d, 2H), 7 .43 (d, 2H), 6.99-6.85 (m, 4H), 4.34 (m, 1H), 4.13-4.10 (m, 3H), 4.01-3.94 (m, 3H), 3.68-3.65 (m, 4H), 3.47 (m, 1H), 2.13 (m, 1H), 1.95 (m, 2H), 1.61 ( m, 1H), 1.38-1.35 (t, 3H)

Step 2. (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)phenyl)acetic acid

The ether compound obtained in Step 1 was used in a 1 N aqueous solution of lithium hydroxide by the same method as in Step 2 of Example 2 to obtain the desired product. (Yield: 50%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.83 (s, 1H), 7.95 (s, 1H), 7.92 (s, 1H), 7.86 (d, 2H), 7 .44 (d, 2H), 6.96 (m, 1H), 6.92-6.83 (m, 3H), 4.35-4.34 (m, 1H), 4.02-3.89 (m, 3H), 3.75 (s, 2H), 3.72-3.68 (m, 2H), 3.51-3.46 (m, 1H), 2.1 (m, 1H), 2.02-1.93 (m, 2H), 1.62-1.59 (m, 1H), 1.37-1.33 (t, 3H)

Example 13 (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)phenyl)-2-methylpropanoic acid

Step 1. Methyl (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)-2-Methylpropanoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine prepared in Synthesis Example 1 and methyl 2-(4-carbamoylphenyl)-2-methylpropanate prepared in Synthesis Example 4 was used in the same way as in example 8 to obtain the desired product. (Yield: 82%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.85 (s, 1H), 7.92 (s, 1H), 7.88 (s, 1H), 7.85 (d, J=8 Hz , 2H), 7.47 (d, J=8 Hz, 2H), 6.97-6.87 (m, 4H), 4.38 (m, 1H), 3.98-3.96 (m, 3H), 3.79-3.48 (m, 3H), 3.68 (s, 3H), 2.15-1.95 (m, 3H), 1.63 (s, 6H), 1.63 (m, 1H), 1.37 (t, J=8 Hz, 3H)

Step 2. (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)phenyl)-2-methylpropanoic acid

The ether compound obtained in Step 1 was used in a 2N aqueous sodium hydroxide solution in the same manner as in Step 2 of Example 2 to obtain the desired product. (Yield: 70%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.82 (s, 1H), 7.93 (s, 1H), 7.92 (s, 1H), 7.85 (d, J=8 Hz , 2H), 7.54 (d, J=8.4Hz, 2H), 6.97-6.83 (m, 4H), 4.34 (m, 1H), 3.99-3.90 (m , 3H), 3.70-3.65 (m, 2H), 3.47 (m, 1H), 2.09 (m, 1H), 2.04-1.92 (m, 2H), 1. 65 (s, 6H), 1.65 (m, 1H), 1.35 (t, J=6.8 Hz, 3H)

Example 14 (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenoxy)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 2-(4- carbamoylphenoxy)-2-methylpropanoate (0.08 g, 0.30 mmol) obtained in Synthesis Example 5 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 43%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.72 (s, 1H), 8.04 (s, 1H), 7.86 (s, 1H), 7.76 (d, 2H), 6.93-6.79 (m, 6H), 4.31 (m, 1H), 4.13-3.88 (m, 3H), 3.68 (m, 2H), 3.48 (m, 1H), 2.07 (m, 1H), 1.97 (m, 2H), 1.67 (s, 6H), 1.57 (m, 1H), 1.33 (t, 3H)

Example 15 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-1-(methylsulfonyl)piperidine)-4-carboxamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) prepared in Synthesis Example 1 and 1-(methylsulfonyl)piperidine -4-carboxamide (0.03 g, 0.17 mmol) was used in the same manner as Example 8 to obtain the desired product. (Yield: 46%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.88 (s, 1H), 7.35 (s, 1H), 6.96 (m, 2H), 6.87 (m, 2H), 4.30 (m, 1H), 4.03-3.89 (m, 3H), 3.80 (m, 2H), 3.69 (m, 1H), 3 .62 (m, 1H), 3.45 (m, 1H), 2.88 (m, 2H), 2.80 (s, 3H), 2.40 (m, 1H), 2.12 (m, 1H), 2.07-1.87 (m, 6H), 1.59 (m, 1H), 1.35 (t, 3H)

Example 16 (R)-1-acetyl-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)piperidine)-4-carboxamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) obtained in Synthesis Example 1, and 1-acetylpiperidin-4- carboxamide (0.03 g, 0.17 mmol) was used in the same manner as in Example 8 to obtain the desired product. (Yield: 43%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.88 (s, 1H), 7.33 (s, 1H), 6.94 (m, 2H), 6.88 (m, 2H), 4.65 (m, 1H), 4.31 (m, 1H), 4.03-3.88 (m, 4H), 3.71 (m, 1H), 3 .62 (m, 1H), 3.44 (m, 1H), 3.15 (m, 1H), 2.71 (m, 1H), 2.48 (m, 1H), 2.11 (m, 4H), 2.05-1.88 (m, 4H), 1.85-1.65 (m, 2H), 1.60 (m, 1H), 1.36 (t, 3H)

Example 17 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-1-(isopropylsulfonyl)piperidine-4-carboxamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) prepared in Synthesis Example 1 and 1-(isopropylsulfonyl)piperidine -4-carboxamide (0.04 g, 0.17 mmol) was used in the same manner as Example 8 to obtain the desired product. (Yield: 53%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.88 (s, 1H), 7.28 (s, 1H), 6.94 (m, 2H), 6.88 (m, 2H), 4.31 (m, 1H), 4.03-3.90 (m, 3H), 3.87 (m, 2H), 3.70 (m, 1H), 3 .62 (m, 1H), 3.44 (m, 1H), 3.18 (m, 1H), 3.00 (m, 2H), 2.41 (m, 1H), 2.12 (m, 1H), 2.00 (m, 2H), 1.95-1.82 (m, 3H), 1.60 (m, 2H), 1.35 (m, 9H)

Example 18

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) obtained in Synthesis Example 1, and 1-(5-ethylpyrimidine -2-yl)piperidin-4-carboxamide (0.04 g, 0.17 mmol) obtained from Synthesis Example 35 was used in the same manner as Example 8 to obtain the desired product. (Yield: 54%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 8.17 (s, 2H), 7.86 (s, 1H), 7.33 (s, 1H), 6.94 (m, 2H), 6.87 (m, 2H), 4.80 (m, 2H), 4.30 (m, 1H), 4.03-3.90 (m, 3H), 3 .73 (m, 1H), 3.60 (m, 1H), 3.43 (m, 1H), 2.94 (m, 2H), 2.55-2.42 (m, 3H), 2. 13 (m, 1H), 1.99 (m, 3H), 1.93 (m, 1H), 1.80 (m, 2H), 1.59 (m, 1H), 1.35 (t, 3H ), 1.20 (t, 3H)

Example 19 (R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-4-oxobutanoic acid

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine obtained in Synthesis Example 2 and succinic anhydride were used in the same manner as in Example 6 to obtain the desired product.

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.63 (s, 1H), 7.88 (s, 1H), 7.51 (s, 1H), 7.30 (s, 1H), 6 .88-7.00 (m, 4H), 4.34 (m, 1H), 4.12 (m, 1H), 3.96 (m, 3H), 3.70 (m, 2H), 3. 69 (m, 1H), 2.78 (d, 2H), 2.68 (d, 2H), 2.15 (d, 2H), 1.96-2.10 (m, 3H), 1.61 (m, 1H), 1.44 (t, 3H), 0.89 (m, 1H)

Example 20

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine obtained in Synthesis Example 2 was used in the same method as Example 6 to obtain the desired product.

^1H NMR (300 MHz, Methanol-D): δ 8.26 (s, 1H), 7.69 (s, 1H), 6.89-7.02 (m, 5H), 4.48 (m, 2H), 3.79-3.96 (m, 8H), 3.53-3.65 (m, 6H), 3.22 (sq, 2H), 2.30 (m, 2H), 2.09 (m, 10H), 1.61 (br.s, 3H), 1.35 (m, 12H), 0.89 (m, 1H)

Example 21

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) prepared in Synthesis Example 1 and methyl 4-carbamoylbicyclo[2 ,2,2]octane-1-carboxylate (0.04 g, 0.17 mmol) was used in the same manner as Example 34 to obtain the desired product. (Yield: 34%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 7.87 (s, 1H), 7.35 (s, 1H), 6.96 (m, 2H), 6.88 (m, 2H), 4.29 (m, 1H), 4.07-3.93 (m, 3H), 3.75 (m, 1H), 3.57 (m, 1H), 3 .41 (m, 1H), 2.15 (m, 1H), 2.04-1.86 (m, 14H), 1.59 (m, 1H), 1.37 (t, 3H)

Example 22 (R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2,2-dimethyl-4-oxobutanoic acid

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine prepared in Synthesis Example 2 and 3,3-dimethylsuccinic anhydride were used in the same manner as in Example 6, with obtaining the required product. (Yield: 51%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.87 (s, 1H), 7.85 (s, 1H), 6.86-6.98 (m, 4H), 4.3 (m, 1H), 3.94-4.03 (m, 3H), 3.7 (m, 1H), 3.57 (dd, 1H), 3.35 (m, 1H ), 2.68 (s, 2H), 2.04 (m, H), 1.93 (m, 2H), 1.5 (m, 1H), 1.33 (m+6H s, 10H)

Example 23 (R)-1-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-3,3-dimethylpyrrolidine-2,5-dione

A by-product was obtained from the synthesis process in Example 22, and the desired product was obtained by performing separation and purification.

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.11 (s, 1H), 7.77 (s, 1H), 6.87-7.01 (m, 4H), 4.30 (m, 1H), 4.15 (dd, 1H), 4.03 (sq, 2H), 3.85 (m, 1H), 3.50 (m, 2H), 2.10 (m, 1H), 1, 97 (m, 2H), 1.60 (m, 1H), 1.45 (s, 6H), 1.38 (t, 3H), 1.27 (m, 2H), 0.90 (m, 1H )

Example 24 (R)-5-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2,2-dimethyl-5-oxopentanoic acid

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine prepared in Synthesis Example 2 and 3,3-dimethylglutaric anhydride were used in the same method as in Example 6, with obtaining the required product.

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 7.89 (s, 1H), 7.66 (s, 1H), 6.87-6.98 (m, 4H), 4.20 (m, 1H), 3.95 (m, 3H), 3.70 (m, 1H), 3.58 (dd, 1H), 3.40 (m, 1H), 2, 44 (m, 2H), 1.99-2.16 (m, 6H), 1.39 (t, 3H), 0.90 (m, 2H)

Example 25 (R)-5-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3,3-dimethyl-5-oxopentanoic acid

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine prepared in Synthesis Example 2 and 4,4-dimethylglutaric anhydride were used in the same manner as in Example 6, with obtaining the required product.

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 8.13 (s, 1H), 7.92 (s, 1H), 6.87-7.00 (m, 4H), 4.31 (m, 1H), 4.00 (m, 3H), 3.72 (m, 1H), 3.62 (dd, 1H), 3.45 (m, 1H), 2. 45 (s, 2H), 2.00 (m, 3H), 1.60 (m, 2H), 1.38 (t, 3H), 1.28 (s, 2H), 1.20 (s, 3H ), 1.92 (s, 3H), 0.90 (m, 2H)

Example 26 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-2-(3-trifluoromethyl)phenyl)acetamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine prepared in Synthesis Example 2 and 2-(3-trifluoromethyl)phenylacetyl chloride were used in the same manner as in Example 6, obtaining the required product. (Yield: 54%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.83 (s, 1H), 7.55 (m, 4H), 7.38 (s, 1H), 6 .85-6.96 (m, 4H), 4.28 (m, 1H), 3.94 (m, 3H), 3.77 (s, 2H), 3.65 (m, 2H), 3. 42 (m, 1H), 1.93-2.11 (m, 3H), 1.56 (m, 1H), 1.94 (t, 3H)

Example 27 (R)-2-(3,5-bis(trifluoromethyl)phenyl)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine prepared in Synthesis Example 2 and 3,5-bis(trifluoromethyl)phenylacetyl chloride were used in the same manner as in example 6, obtaining the required product. (Yield: 38%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.92 (s, 1H), 7.84 (s, 1H), 7.82 (s, 2H), 7 .50 (s, 1H), 6.68-7.00 (m, 4H), 4.35 (m, 1H), 3.95 (m, 3H), 3.84 (s, 2H), 3. 70 (m, 2H), 3.50 (m, 1H), 1.97-2.13 (m, 3H), 1.61 (m, 1H), 1.61 (t, 3H)

Example 28 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-2-phenylacetamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.17 g, 0.50 mmol) obtained in Synthesis Example 2, and phenylacetyl chloride (0.078 g, 0 .50 mmol) was used in the same way as in example 6 to obtain the desired product. (Yield: 23%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 7.78 (s, 1H), 7.29-7.41 (m, 5H), 6.97 (m, 2H), 6.85 (m, 2H), 4.27 (m, 1H), 3.91-4.00 (m, 3H), 3.72 (s, 2H), 3.68 (m, 1H ), 3.52 (m, 1H), 3.37 (m, 1H), 2.09 (m, 1H), 1.96 (m, 1H), 1.86 (m, 1H), 1.56 (m, 1H), 1.34 (t, 3H)

Example 29 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-3-phenylpropanamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.17 g, 0.50 mmol) obtained in synthesis example 2, and 3-phenylpropanoyl chloride (0. 08 g, 0.50 mmol) was used in the same manner as in Example 6 to obtain the desired product. (Yield: 46%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 7.86 (s, 1H), 7.30 (t, J=7.6 Hz, 2H), 7. 22 (dd, J=17.1, 7.3 Hz, 3H), 7.12 (s, 1H), 6.98-6.90 (m, 2H), 6.88-6.70 (m, 2H), 4.35-4.27 (m, 1H), 4.02-3.85 (m, 3H), 3.72-3.59 (2H), 3.46-3.38 (m, 1H), 3.09-3.01 (m, 2H), 2.66 (t, J=7.6 Hz, 2H), 2.09 (d, J=12.2 Hz, 1H), 2, 02-1.87 (m, 2H), 1.57 (kv, J=4.3 Hz, 1H), 1.33 (t, J=7.0 Hz, 3H)

Example 30 (R)-2-(3-chlorophenyl)-N-(6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)acetamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.17 g, 0.50 mmol) obtained in synthesis example 2, and 3-chlorophenylacetyl chloride (0. 08 g, 0.50 mmol) was used in the same manner as in Example 6 to obtain the desired product. (Yield: 30%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.86 (s, 1H), 7.29-7.33 (m, 3H), 7.21 (m, 1H), 6.97 (m, 2H), 6.86 (m, 2H), 4.29 (m, 1H), 3.90-4.00 (m, 3H), 3.72 (m, 3H ), 3.59 (m, 1H), 3.41 (m, 1H), 2.09 (m, 1H), 1.96 (m, 1H), 1.86 (m, 1H), 1.56 (m, 1H), 1.36 (t, 3H)

Example 31 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-2-methyl-2-phenylpropanamide

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.17 g, 0.50 mmol) obtained in Synthesis Example 2, and 2-methyl-2- Phenylpropanoyl chloride (0.08 g, 0.50 mmol) was used in the same manner as Example 6 to obtain the desired product. (Yield: 30%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 8.75 (s, 1H), 7.82 (s, 1H), 7.33-7.43 (m, 4H), 7.31 (m, 1H), 7.02 (s, 1H), 6.79-6.93 (m, 4H), 4.23 (m, 1H), 3.91-4.00 (m, 3H), 3.69 (m, 1H), 3.41 (m, 1H), 3.27 (m, 1H), 2.08 (m, 1H), 1.91 (m, 1H), 1.85 (m, 1H) , 1.66 (s, 6H), 1.55 (m, 1H), 1.34 (t, 3H)

Example 32 (R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid

Step 1. Methyl (R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoate

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.40 g, 1.27 mmol) obtained in Synthesis Example 2 and methyl 4-(2- Chloro-2-oxoethyl)benzoate (0.74 g, 3.82 mmol) was used in the same manner as in Example 6 to obtain the desired ester compound. (Yield: 51%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 8.05 (d, J=8.6 Hz, 2H), 7.86 (s, 1H), 7. 40 (d, J=8.6 Hz, 2H), 7.22 (s, 1H), 6.93 (kv, J=7.9 Hz, 2H), 6.83 (kv, J=7.1 Hz, 2H), 4.34-4.19 (m, 1H), 4.04-3.85 (m, 6H), 3.76 (s, 2H), 3.71-3.64 (m, 1H), 3.57 (kv, J=6.9 Hz, 1H), 3.45-3.33 (m, 1H), 2.09 (td, J=7.9, 4.1 Hz, 1H ), 2.03-1.94 (m, 1H), 1.92-1.80 (m, 1H), 1.56 (kV, J=4.3 Hz, 1H), 1.33 (t, J=7.0 Hz, 3H)

Step 2. (R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid

The desired product was obtained by hydrolysis of the ester compound (0.32 g, 0.65 mmol) obtained in step 1 using 2 N sodium hydroxide solution. (Yield: 16%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 8.09 (d, J=7.9 Hz, 2H), 7.89 (s, 1H), 7. 52 (s, 1H), 7.41 (d, J=7.9 Hz, 2H), 6.92 (kv, J=7.7 Hz, 2H), 6.86-6.65 (m, 2H ), 4.42-4.13 (m, 1H), 4.11-3.86 (m, 3H), 3.78 (s, 2H), 3.70-3.55 (m, 2H), 3.44-3.36 (m, 1H), 2.33-2.02 (m, 1H), 1.96 (td, J=6.7, 3.7 Hz, 1H), 1.89 ( kv, J=4.1 Hz, 1H), 1.65-1.48 (m, 1H), 1.31 (t, J=7.0 Hz, 3H)

Example 33 (R)-3-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid

Step 1. Methyl (R)-3-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoate

(R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (0.40 g, 1.27 mmol) obtained in Synthesis Example 2 and methyl 3-(2- Chloro-2-oxoethyl)benzoate (0.74 g, 3.82 mmol) was used in the same manner as Example 6 to obtain the desired ester compound. (Yield: 20%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 8.00 (d, J=6.7 Hz, 2H), 7.86 (s, 1H), 7. 55 (d, J=7.3 Hz, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.21 (s, 1H), 6.94 (kv, J=7.9 Hz, 2H), 6.87-6.77 (m, 2H), 4.34-4.24 (m, 1H), 4.05-3.84 (m, 6H), 3.76 (s, 2H), 3.73-3.64 (m, 1H), 3.58 (kv, J=6.7 Hz, 1H), 3.39 (td, J=8.9, 4.1 Hz, 1H ), 2.19-2.05 (m, 1H), 1.98 (kv, J=3.3 Hz, 1H), 1.90 (kv, J=4.1 Hz, 1H), 1.68 -1.58 (1H), 1.33 (t, J=6.7 Hz, 3H)

Step 2. (R)-3-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid

The desired product was obtained by hydrolysis of the ester compound (0.12 g, 0.25 mmol) obtained in step 1 by the same method as in step 2 of Example 32 using 2 N sodium hydroxide solution. (Yield: 26%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 8.06 (s, 1H), 8.02 (d, J=7.3 Hz, 1H), 7, 87 (s, 1H), 7.81 (s, 1H), 7.56 (d, J=7.3 Hz, 1H), 7.47-7.41 (m, 1H), 6.95-6 .85 (m, 2H), 6.84-6.71 (m, 2H), 4.35-4.21 (m, 1H), 3.98-3.84 (m, 3H), 3.77 (s, 2H), 3.67-3.54 (m, 2H), 3.43-3.35 (m, 1H), 2.05 (kv, J=4.1 Hz, 1H), 1, 94 (td, J=6.7, 3.3 Hz, 1H), 1.90-1.80 (m, 1H), 1.64-1.47 (m, 1H), 1.30 (t, J=7.0 Hz, 3H)

Example 34 (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid

Step 1. Methyl (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl) acetate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.98 g, 2.93 mmol) obtained in Synthesis Example 1, and methyl 2-(4- (2-amino-2-oxoethyl)phenyl)acetate (0.61 g, 2.93 mmol) obtained in synthesis example 6, tris(dibenzylideneacetone)-dipalladium(0) (0.16 g, 0.18 mmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthine (0.15 g, 0.26 mmol) and cesium carbonate (2.39 g, 7.33 mmol) were added to 50 ml of dioxane and stirred at reflux refrigerator for 4 hours. After completion of the reaction, the resulting product mixture was cooled to room temperature, diluted with ethyl acetate and washed with aqueous sodium carbonate and brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (ethyl acetate: hexane = 3: 1) to obtain the desired product. (Yield: 68%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.67 (s, 1H), 7.85 (s, 1H), 7.32-7.28 (m, 4H), 7.24 (s, 1H), 6.97-6.89 (m, 2H), 6.88-6.77 (m, 2H), 4.31-4.24 (m, 1H), 4.03-3.89 ( m, 3H), 3.69 (m, 3H), 3.67 (d, J=7.9 Hz, 3H), 3.63 (s, 2H), 3.54 (sq, J=6.9 Hz, 1H), 3.41-3.33 (m, 1H), 2.08 (kv, J=4.1 Hz, 1H), 2.00-1.93 (m, 1H), 1.88 (kv, J=4.1 Hz, 1H), 1.55 (t, J=4.6 Hz, 1H), 1.34 (t, J=7.0 Hz, 3H)

Step 2. (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxo ethyl)phenyl)acetic acid

The ether obtained in step 1 (1.0 g, 1.98 mmol) was dissolved in THF-methanol (40 ml, 3:1) and 2 N sodium hydroxide solution (10 ml, 19.8 mmol) was slowly added dropwise. . After stirring at room temperature for 4 hours, the resulting product was diluted with water, neutralized with 2 N hydrochloric acid solution and extracted with ethyl acetate. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column (acetone: dichloromethane = 1: 1) to obtain the desired product. (Yield: 29%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.62 (s, 1H), 7.84 (s, 1H), 7.42 (s, 1H), 7.36-7.17 (m , 4H), 6.95-6.87 (m, 2H), 6.87-6.78 (m, 2H), 4.30-4.21 (m, 1H), 4.00-3.86 (m, 3H), 3.67 (s, 2H), 3.63 (t, J=14.7 Hz, 3H), 3.51 (td, J=14.4, 7.4 Hz, 1H) , 3.39-3.29 (m, 1H), 2.06 (kv, J=3.5 Hz, 1H), 1.93 (td, J=6.7, 3.1 Hz, 1H), 1.85 (kv, J=4.1 Hz, 1H), 1.53 (kv, J=4.5 Hz, 1H), 1.31 (t, J=7.0 Hz, 3H)

Example 35 (R)-2-(4-(2-amino-2-oxoethyl)phenyl-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide

(R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid (0, 27 g, 0.55 mmol) obtained in Example 34 was dissolved in dichloromethane (10 ml) and thionyl chloride (0.08 ml, 1.1 mmol) was slowly added dropwise at room temperature. After stirring at room temperature for 4 hours, the organic solvent was removed under reduced pressure, and the resulting product was diluted with THF and slowly added dropwise to a 25% aqueous ammonia solution at 0°C. The resulting solid was filtered and dried to obtain the desired product. (Yield: 82%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.92-7.77 (1H), 7.36-7.27 (m, 5H), 6.99 -6.90 (m, 2H), 6.89-6.80 (m, 2H), 5.39 (s, 2H), 4.31-4.24 (m, 1H), 4.03-3 .89 (3H), 3.70 (s, 2H), 3.69-3.65 (m, 1H), 3.58 (s, 2H), 3.56-3.50 (1H), 3. 41-3.33 (1H), 2.13-2.06 (m, 1H), 1.96 (td, J=6.7, 3.5 Hz, 1H), 1.88 (sq, J= 4.1 Hz, 1H), 1.59-1.51 (m, 1H), 1.35 (t, J=6.7 Hz, 3H)

Example 36 (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-2-(4-hydroxyphenyl)acetamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.25 g, 0.75 mmol) obtained in Synthesis Example 1, and 2-(4-hydroxyphenyl) )acetamide (0.11 g, 0.75 mmol) was used in the same manner as Example 34 to obtain the desired product. (Yield: 54%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 7.82 (s, 1H), 7.31 (m, 1H), 7.14 (d, 2H), 6.98 (m, 2H), 6.84 (m, 4H), 4.27 (m, 1H), 3.95 (m, 3H), 3.63 (m, 3H), 3.55 (m , 1H), 3.37 (m, 1H), 2.04 (m, 1H), 1.98-1.83 (m, 2H), 1.55 (m, 1H), 1.34 (t, 3H)

Example 37

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.05 g, 0.15 mmol) obtained in Synthesis Example 1, and ethyl 4-(4- (2-amino-2-oxoethyl)phenoxy)butanoate (0.04 g, 0.17 mmol) obtained in Synthesis Example 7 was used in the same manner as Example 34 to obtain the desired product. (Yield: 44%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 7.85 (s, 1H), 7.29 (s, 1H), 7.22 (d, 2H), 6.97-6.80 (m, 6H), 4.26 (m, 1H), 4.02 (t, 2H), 3.94 (m, 3H), 3.67 (m, 3H), 3 .52 (m, 1H), 3.37 (m, 1H), 2.57 (t, 2H), 2.13 (m, 3H), 1.98-1.83 (m, 2H), 1. 56 (m, 1H), 1.35 (t, 3H)

Example 38 methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.30 g, 0.90 mmol) obtained in Synthesis Example 1, and ethyl 2-(4- (2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate (0.24 g, 0.90 mmol) obtained in Synthesis Example 8 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 52%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.62 (s, 1H), 7.85 (s, 1H), 7.50 (s, 1H), 7.17 (d, 2H), 6.96-6.82 (m, 6H), 4.29 (m, 1H), 4.01-3.89 (m, 3H), 3.62 (m, 3H), 3.55 (m, 1H), 3.37 (m, 1H), 2.07 (m, 1H), 1.93 (m, 1H), 1.88 (m, 1H), 1.58 (m, 7H), 1. 34 (t, 3H)

Example 39 2-yl)phenyl)-2-methylpropanoic acid

Step 1. Methyl (R)-2-(4-(1-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-1- Oxopropan-2-yl)-phenyl)-2-methylpropanoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine obtained in Synthesis Example 1 and methyl 2-(4-(1-amino-2-methyl-1- Oxopropan-2-yl)phenyl)-2-methylpropanoate obtained in Synthesis Example 9 was used in the same manner as in Step 1 of Example 34 to obtain the desired product. (Yield: 45%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.73 (s, 1H), 7.81 (d, J=4.3 Hz, 1H), 7.41-7.27 (m, 4H ), 7.06 (s, 1H), 6.98-6.86 (m, 2H), 6.85-6.69 (m, 2H), 4.33-4.16 (m, 1H), 4.04-3.85 (m, 3H), 3.66 (td, J=9.0, 3.7 Hz, 1H), 3.61 (d, J=4.9 Hz, 3H), 3 .43 (dd, J=13.1, 7.6 Hz, 1H), 3.37-3.21 (m, 1H), 2.13-2.04 (m, 1H), 1.98-1 .78 (m, 2H), 1.62 (s, 6H), 1.58-1.44 (m, 7H), 1.32 (t, J=7.0 Hz, 3H)

Step 2. (R)-2-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan- 2-yl)phenyl)-2-methylpropanoic acid

The ester compound obtained in step 1 was hydrolyzed in the same manner as in step 2 of Example 34 to obtain the desired product. (Yield: 48%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 7.83 (s, 1H), 7.44-7.26 (m, 4H), 7.06 (s , 1H), 6.94-6.88 (m, 2H), 6.83-6.77 (m, 2H), 4.23-4.21 (m, 1H), 4.13-3.91 (m, 3H), 3.63 (m, 1H), 3.46 (m, 1H), 3.28 (m, 1H), 2.05 (m, 1H), 1.98-1.78 ( m, 2H), 1.64 (s, 3H), 1.59 (s, 3H), 1.58-1.44 (m, 1H), 1.32 (t, J=7.0 Hz, 3H )

Example 40 (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.51 g, 1.53 mmol) obtained in Synthesis Example 1 and methyl 4-(3- amino-3-oxopropyl)benzoate (0.32 g, 1.53 mmol) obtained in Synthesis Example 10 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 62%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 8.02 (d, 2H), 7.89 (s, 1H), 7.33 (m, 3H), 6.93 (m, 2H), 6.84 (m, 2H), 4.31 (m, 1H), 4.00-3.86 (m, 3H), 3.64 (m, 2H), 3 .43 (m, 1H), 3.12 (t, 2H), 2.71 (t, 2H), 2.11 (m, 1H), 1.98 (m, 1H), 1.90 (m, 1H), 1.58 (m, 1H), 1.34 (t, 3H)

Example 41 -yl)benzoic acid

Step 1. Methyl (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1-ene -1-yl)benzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.09 g, 0.28 mmol) prepared in Synthesis Example 1 and methyl (E)-4 -(3-amino-3-oxoprop-1-en-1-yl)benzoate (0.07 g, 0.33 mmol) obtained in Synthesis Example 11 was used in the same manner as in Step 1 of Example 34, with obtaining the required product. (Yield: 63%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.82 (s, 1H), 8.08-7.94 (3H), 7.88 (d, J=4.3 Hz, 1H), 7 ,81-7.69 (m, 1H), 7.54 (t, J=4.0 Hz, 2H), 7.26 (d, J=4.9 Hz, 0H), 7.01-6, 90 (2H), 6.88-6.78 (m, 2H), 6.66 (d, J=15.3 Hz, 1H), 4.36-4.18 (m, 1H), 4.10 (kvd, J=7.0, 4.7 Hz, 3H), 4.05-3.94 (m, 3H), 3.93-3.84 (m, 4H), 3.83-3.64 (m, 1H), 3.55 (dt, J=12.8, 3.7 Hz, 1H), 3.37 (td, J=8.9, 3.9 Hz, 1H), 2.19- 2.07 (m, 1H), 2.03 (d, J=4.3 Hz, 5H), 1.94 (s, 2H), 1.90-1.78 (m, 1H), 1.63 -1.48 (m, 1H), 1.41-1.30 (m, 3H), 1.28-1.10 (m, 6H)

Step 2. (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1-ene-1 -yl)benzoic acid

The ether compound (0.07 g, 0.14 mmol) obtained in step 1 was hydrolyzed in the same manner as in step 2 of Example 34 to obtain the desired product. (Yield: 64%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.80 (s, 1H), 8.12 (d, J=7.9 Hz, 2H), 7.93 (s, 1H), 7.80 (d, J=15.1 Hz, 1H), 7.64 (d, J=7.8 Hz, 2H), 7.48 (d, J=18.3 Hz, 1H), 6.96 (t , J=7.6 Hz, 2H), 6.88 (dd, J=14.2, 8.1 Hz, 2H), 6.62 (d, J=15.9 Hz, 1H), 4.35 (s, 1H), 4.08-3.85 (m, 3H), 3.79-3.62 (m, 2H), 3.49 (s, 1H), 2.15 (d, J=26 ,9 Hz, 2H), 2.01 (s, 1H), 1.94 (d, J=7.9 Hz, 1H), 1.58 (d, J=38.5 Hz, 2H), 1, 44-1.33 (m, 4H), 1.23 (dd, J=38.5, 15.9 Hz, 3H), 0.96-0.75 (m, 2H)

Example 42. (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxoprop-1 -en-1-yl)benzoic acid

Step 1. Methyl (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxoprop -1-en-1-yl)benzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.66 g, 1.99 mmol) prepared in Synthesis Example 1 and methyl (E)-4 -(3-amino-2-methyl-3-oxoprop-1-en-1-yl)benzoate (0.52 g, 2.39 mmol) obtained in Synthesis Example 12 was used in the same manner as in Step 1 example 34, obtaining the desired product. (Yield: 67%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.81-8.77 (1H), 8.08 (d, J=7.9 Hz, 2H), 7.92 (d, J=4, 3 Hz, 1H), 7.67 (s, 1H), 7.51-7.42 (m, 3H), 7.00-6.95 (m, 1H), 6.95-6.90 (1H ), 6.87 (d, J=7.9 Hz, 2H), 4.37-4.29 (m, 1H), 4.06-3.96 (m, 2H), 3.94 (s, 3H), 3.81-3.71 (1H), 3.66 (kv, J=6.7 Hz, 1H), 3.52-3.42 (m, 1H), 2.21 (d, J =1.8 Hz, 3H), 2.19-2.08 (m, 1H), 2.03-1.87 (m, 2H), 1.61 (kvd, J=8.9, 4.7 Hz, 1H), 1.36 (kv, J=6.5 Hz, 3H)

Step 2. (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxoprop-1 -en-1-yl)benzoic acid

The ether compound (0.69 g, 1.34 mmol) obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 34 to obtain the desired product. (Yield: 41%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.79 (s, 1H), 8.13 (s, 2H), 7.93 (s, 1H), 7.69 (s, 1H), 7 .48 (s, 3H), 7.02-6.67 (m, 5H), 4.33 (s, 1H), 4.00 (d, J=9.2 Hz, 3H), 3.81- 3.59 (2H), 2.21 (s, 3H), 2.13 (s, 1H), 2.03 (s, 1H), 1.96-1.87 (1H), 1.65 (d , J=31.2 Hz, 7H), 1.36 (s, 5H), 1.30-1.16 (1H)

Example 43 4-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxopropyl)benzoic acid

Step 1. Methyl 4-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxopropyl)benzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.95 g, 2.83 mmol) obtained in Synthesis Example 1 and methyl 4-(3- amino-2-methyl-3-oxopropyl)benzoate (0.75 g, 3.40 mmol) obtained in Synthesis Example 13 was used in the same manner as in Step 1 of Example 34 to obtain the desired product. (Yield: 92%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.81-8.77 (1H), 8.08 (d, J=7.9 Hz, 2H), 7.92 (d, J=4, 3 Hz, 1H), 7.67 (s, 1H), 7.51-7.42 (m, 3H), 7.00-6.95 (m, 1H), 6.95-6.90 (1H ), 6.87 (d, J=7.9 Hz, 2H), 4.37-4.29 (m, 1H), 4.06-3.96 (m, 2H), 3.94 (s, 3H), 3.81-3.71 (1H), 3.66 (kv, J=6.7 Hz, 1H), 3.52-3.42 (m, 1H), 2.21 (d, J =1.8 Hz, 3H), 2.19-2.08 (m, 1H), 2.03-1.87 (m, 2H), 1.61 (kvd, J=8.9, 4.7 Hz, 1H), 1.36 (kv, J=6.5 Hz, 3H)

Step 2. 4-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-3-oxopropyl)benzoic acid

The ether compound (1.35 g, 2.60 mmol) obtained in step 1 was hydrolyzed in the same manner as in step 2 of Example 34 to obtain the desired product. (Yield: 39%)

¹ H-NMR (500 MHz, CHLOROFORM-D) δ 8.67 (d, J=3.4 Hz, 1H), 7.98 (dd, J=12.5, 8.1 Hz, 2H), 7 .86 (s, 1H), 7.30 (d, J=10.7 Hz, 2H), 7.18 (s, 0H), 7.04 (s, 0H), 6.98-6.89 ( m, 2H), 6.85 (d, J=7.8 Hz, 2H), 6.79 (d, J=8.3 Hz, 0H), 4.29 (s, 1H), 4.05- 3.86 (m, 3H), 3.67 (s, 1H), 3.61-3.51 (m, 1H), 3.44-3.29 (m, 1H), 3.21-3, 08 (m, 1H), 2.88-2.75 (m, 1H), 2.64 (t, J=6.3 Hz, 1H), 2.13 (d, J=35.2 Hz, 1H ), 1.96 (s, 1H), 1.91-1.76 (m, 1H), 1.64-1.49 (m, 1H), 1.34 (kv, J=6.3 Hz, 3H), 1.29 (d, J=6.8 Hz, 3H)

Example 44 (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-fluorobenzoic acid

Step 1. Methyl (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-fluorobenzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.39 g, 1.15 mmol) obtained in Synthesis Example 1 and methyl 4-(3- amino-3-oxopropyl)-2-fluorobenzoate (0.26 g, 1.15 mmol) obtained in Synthesis Example 14 was used in the same manner as in Step 1 of Example 34 to obtain the desired product. (Yield: 68%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.87 (t, J=7.6 Hz, 2H), 7.24-7.15 (1H), 7.08 (d, J=7.9 Hz, 1H), 7.02 (d, J=12.2 Hz, 1H), 6.93 (t, J=7.3 Hz, 2H), 6, 84 (kv, J=7.9 Hz, 2H), 4.40-4.24 (m, 1H), 3.96 (dd, J=15.0, 8.3 Hz, 2H), 3.91 (s, 3H), 3.88 (d, J=2.4 Hz, 1H), 3.67 (t, J=3.1 Hz, 1H), 3.62 (t, J=6.4 Hz , 1H), 3.44 (t, J=4.6 Hz, 1H), 3.08 (t, J=7.6 Hz, 2H), 2.68 (t, J=7.3 Hz, 2H ), 2.15-2.06 (m, 1H), 1.97 (t, J=3.4 Hz, 1H), 1.91 (kv, J=4.1 Hz, 1H), 1.57 (kv, J=4.3 Hz, 1H), 1.33 (t, J=7.0 Hz, 3H)

Step 2. (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)-2-fluorobenzoic acid

The ether compound (0.41 g, 0.79 mmol) obtained in step 1 was hydrolyzed in the same manner as in step 2 of Example 34 to obtain the desired product. (Yield: 50%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.93 (d, J=7.3 Hz, 1H), 7.89 (s, 1H), 7. 44-7.30 (1H), 7.09 (d, J=7.9 Hz, 1H), 7.03 (d, J=11.9 Hz, 1H), 6.92 (t, J=7 .3 Hz, 2H), 6.84 (kv, J=7.1 Hz, 2H), 4.31 (d, J=3.1 Hz, 1H), 4.05-3.82 (m, 3H ), 3.71-3.57 (m, 2H), 3.55-3.37 (m, 1H), 3.09 (t, J=7.4 Hz, 2H), 2.77-2, 53 (2H), 2.09 (d, J=4.3 Hz, 1H), 1.98 (s, 1H), 1.90 (d, J=8.6 Hz, 1H), 1.57 ( kv, J=4.3 Hz, 1H), 1.33 (t, J=7.0 Hz, 3H)

Example 45

Step 1. Methyl (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-methylbenzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.35 g, 1.05 mmol) obtained in Synthesis Example 1 and methyl 4-(3- amino-3-oxopropyl)-2-methylbenzoate (0.23 g, 1.05 mmol) obtained in Synthesis Example 15 was used in the same manner as in Step 1 of Example 34 to obtain the desired product. (Yield: 63%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.85 (d, J=7.3 Hz, 2H), 7.23 (s, 1H), 7. 10 (d, J=6.1 Hz, 2H), 7.03-6.90 (m, 2H), 6.89-6.73 (m, 2H), 4.45-4.24 (m, 1H), 4.09-3.80 (m, 6H), 3.80-3.57 (2H), 3.42 (dd, J=8.9, 3.4 Hz, 1H), 3.03 (t, J=7.9 Hz, 2H), 2.66 (t, J=7.6 Hz, 2H), 2.57 (s, 3H), 2.09 (d, J=4.9 Hz , 1H), 1.97 (td, J=6.7, 3.7 Hz, 1H), 1.91 (kv, J=4.1 Hz, 1H), 1.57 (t, J=4, 3 Hz, 1H), 1.44-1.29 (m, 3H)

Step 2. (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)-2-methylbenzoic acid

The ether compound (0.33 g, 0.64 mmol) obtained in step 1 was hydrolyzed in the same manner as in step 2 of Example 34 to obtain the desired product. (Yield: 22%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.98 (d, J=8.8 Hz, 1H), 7.87 (s, 1H), 7. 14 (s, 3H), 6.95-6.91 (m, 2H), 6.88-6.83 (m, 2H), 4.31 (m, 1H), 3.98-3.92 ( m, 3H), 3.65 (2H), 3.45 (m, 1H), 3.06 (m, 2H), 2.68 (m, 2H), 2.61 (s, 3H), 2. 09 (m, 1H), 1.97 (m, 1H), 1.91 (m, 1H), 1.57 (m, 1H), 1.35 (t, 3H)

Example 46

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1 and methyl 4-(3- amino-3-oxopropyl)-2-methoxybenzoate (0.07 g, 0.30 mmol) obtained in Synthesis Example 16 was used in the same method as Example 34 to obtain the desired product. (Yield: 38%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 8.09 (d, 1H), 7.88 (s, 1H), 7.38 (s, 1H), 7.02-6.83 (m, 6H), 4.31 (m, 1H), 4.05-3.89 (m, 6H), 3.63 (m, 2H), 3.44 (m, 1H), 3.12 (t, 2H), 2.73 (t, 2H), 2.08 (m, 1H), 1.94 (m, 2H), 1.58 (m, 1H), 1. 35 (t, 3H)

Example 47 (R)-2-chloro-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid

Step 1. Methyl (R)-2-chloro-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine prepared in Synthesis Example 1 and methyl 4-(3-amino)-3-oxopropyl)-2-chlorobenzoate , obtained in synthesis example 17, was used in the same way as in step 1 of example 34 to obtain the desired product. (Yield: 42%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.65 (s, 1H), 7.87 (s, 1H), 7.78 (d, J=8 Hz, 1H), 7.36-7 .33 (m, 2H), 7.18 (d, J=8 Hz, 1H), 7.36-7.33 (m, 2H), 7.18 (d, J=8 Hz, 1H), 6 .95-6.91 (m, 2H), 6.87-6.82 (m, 2H), 4.31-4.30 (m, 1H), 3.99-3.92 (m, 3H) , 3.91 (s, 3H), 3.66-3.61 (m, 2H), 3.42 (m, 1H), 3.05 (t, J=7.4 Hz, 2H), 2, 67 (t, J=7.4 Hz, 2H), 2.09-2.07 (m, 1H), 1.96-1.89 (m, 2H), 1.58 (m, 1H), 1 .33 (t, J=7 Hz, 3H)

Step 2. (R)-2-chloro-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid

The ester compound obtained in step 1 was hydrolyzed in the same manner as in step 2 of Example 34 to obtain the desired product. (Yield: 18%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.64 (s, 1H), 7.88 (s, 1H), 7.79 (m, 1H), 7.64 (m, 1H), 7 .11 (m, 1H), 6.91-6.89 (m, 2H), 6.85-6.81 (m, 2H), 4.29 (m, 1H), 3.98-3.88 (m, 3H), 3.62 (m, 2H), 3.40 (m, 1H), 3.00 (m, 2H), 2.66 (m, 2H), 2.04 (m, 1H) , 1.94 (m, 1H), 1.88 (m, 1H), 1.56 (m, 1H), 1.31 (t, J=6 Hz, 3H)

Example 48 (R)-3-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1 and methyl 3-(3- amino-3-oxopropyl)benzoate (0.06 g, 0.30 mmol) obtained in Synthesis Example 18 was used in the same manner as Example 34 to obtain the desired product. (Yield: 35%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 8.01 (s, 1H), 7.98 (d, 1H), 7.90 (s, 1H), 7.60 (s, 1H), 7.49 (d, 1H), 7.45 (t, 1H), 7.02-6.80 (m, 4H), 4.32 (m, 1H), 4 .02-3.85 (m, 3H), 3.67 (m, 2H), 3.46 (m, 1H), 3.14 (t, 2H), 2.74 (t, 2H), 2. 12-1.92 (m, 3H), 1.60 (m, 1H), 1.37 (t, 3H)

Example 49

Step 1. Methyl (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl) acetate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (1.00 g, 3.00 mmol) obtained in Synthesis Example 1, and methyl 2-(4- (3-Amino-3-oxopropyl)phenyl)acetate (0.66 g, 3.00 mmol) obtained in Synthesis Example 19 was used in the same manner as Step 1 of Example 34 to obtain the desired product. (Yield: 80%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 7.90-7.81 (1H), 7.35 (d, J=7.3 Hz, 1H), 7.18 (td, J=8.9, 2.6 Hz, 4H), 6.96-6.88 (m, 2H), 6.86-6.75 (m, 2H), 4.37- 4.24 (m, 1H), 4.00-3.86 (m, 3H), 3.69 (t, J=2.4 Hz, 1H), 3.66 (s, 3H), 3.61 (t, J=6.7 Hz, 1H), 3.58 (s, 2H), 3.40 (td, J=8.7, 3.9 Hz, 1H), 3.09-2.94 ( m, 2H), 2.64 (t, J=7.6 Hz, 2H), 2.08 (kv, J=4.1 Hz, 1H), 1.96 (td, J=6.7, 3 ,1 Hz, 1H), 1.92-1.83 (m, 1H), 1.56 (kv, J=4.5 Hz, 1H), 1.32 (t, J=6.7 Hz, 3H )

Step 2. (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid

The ether compound (1.24 g, 2.39 mmol) obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 34 to obtain the desired product. (Yield: 57%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.94-7.77 (1H), 7.40 (s, 1H), 7.19 (dd, J =19.9, 8.3 Hz, 4H), 6.95-6.88 (m, 2H), 6.87-6.73 (2H), 4.35-4.26 (m, 1H), 4.04-3.84 (m, 3H), 3.69-3.60 (m, 2H), 3.59 (s, 2H), 3.41 (t, J=4.6 Hz, 1H) , 3.00 (t, J=7.3 Hz, 2H), 2.63 (t, J=7.6 Hz, 2H), 2.07 (kv, J=4.1 Hz, 1H), 1 .96 (kv, J=3.3 Hz, 1H), 1.89 (kv, J=4.1 Hz, 1H), 1.55 (kv, J=4.3 Hz, 1H), 1.31 (t, J=6.7 Hz, 3H)

Example 50

(R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid (0, 21 g, 0.42 mmol) obtained in Example 49 was used in the same manner as in Example 35 to obtain the desired product. (Yield: 62%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.86 (s, 1H), 7.21 (sq, J=7.5 Hz, 5H), 6, 98-6.90 (m, 2H), 6.89-6.80 (m, 2H), 5.38 (s, 2H), 4.35-4.25 (m, 1H), 4.02- 3.87 (m, 3H), 3.68 (kvd, J=6.5, 4.0 Hz, 1H), 3.61 (kvd, J=6.9 Hz, 1H), 3.54 (s , 2H), 3.46-3.37 (1H), 3.03 (t, J=7.6 Hz, 2H), 2.66 (t, J=7.6 Hz, 2H), 2.15 -2.05 (m, 1H), 2.04-1.94 (m, 1H), 1.94-1.83 (m, 1H), 1.57 (kV, J=4.5 Hz, 1H ), 1.34 (t, J=7.0 Hz, 3H)

Example 51 -methylpropanoic acid

Step 1. Methyl (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl) -2-methylpropanoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.48 g, 1.44 mmol) obtained in Synthesis Example 1, and methyl 2-(4- (3-amino-3-oxopropyl)phenyl)-2-methylpropanoate 0.36 g, 1.44 mmol) obtained in Synthesis Example 20 was used in the same method as in Step 1 of Example 34 to obtain the desired product. (Yield: 91%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 7.86 (s, 1H), 7.27 (d, J=7.9 Hz, 2H), 7. 20 (d, J=8.6 Hz, 2H), 7.16 (s, 1H), 6.93 (kvd, J=7.3, 1.5 Hz, 2H), 6.85 (td, J =7.6, 1.4 Hz, 1H), 6.80 (d, J=7.9 Hz, 1H), 4.45-4.24 (m, 1H), 4.06-3.80 ( m, 3H), 3.78-3.65 (m, 2H), 3.64-3.57 (3H), 3.45 (kV, J=3.9 Hz, 1H), 3.15-2 .93 (2H), 2.65 (t, J=7.6 Hz, 2H), 2.21-2.07 (1H), 1.99 (td, J=6.7, 3.1 Hz, 1H), 1.92 (kv, J=4.1 Hz, 1H), 1.59 (t, J=4.0 Hz, 1H), 1.55 (s, 6H), 1.33 (t, J=7.0 Hz, 3H)

Step 2. (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2 -methylpropanoic acid

The ether compound (0.72 g, 1.32 mmol) obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 34 to obtain the desired product. (Yield: 14%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.86 (s, 1H), 7.33 (d, J=8.6 Hz, 2H), 7. 19 (d, J=7.9 Hz, 3H), 6.98-6.89 (m, 2H), 6.88-6.76 (m, 2H), 4.29 (sq, J=3, 7 Hz, 1H), 4.08-3.81 (m, 3H), 3.65 (d, J=2.4 Hz, 1H), 3.60 (kv, J=6.7 Hz, 1H) , 3.40 (s, 1H), 3.01 (t, J=7.3 Hz, 2H), 2.65 (t, J=4.0 Hz, 2H), 2.08 (kv, J= 4.1 Hz, 1H), 1.96 (kv, J=3.5 Hz, 1H), 1.89 (kv, J=4.3 Hz, 1H), 1.57 (s, 7H), 1 .32 (t, J=7.0 Hz, 3H)

Example 52 1-carboxylic acid

Step 1. Methyl (R)-1-(4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl) cyclopropane-1-carboxylate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.48 g, 1.44 mmol) obtained in Synthesis Example 1, and methyl 1-(4- (3-amino-3-oxopropyl)phenyl)cyclopropane-1-carboxylate (0.36 g, 1.44 mmol) obtained in Synthesis Example 21 was used in the same manner as Step 1 of Example 34 to obtain the desired product . (Yield: 76%)

¹ H-NMR (500 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 7.86 (s, 1H), 7.35-7.24 (m, 2H), 7.21-7 .10 (m, 3H), 6.98-6.89 (m, 2H), 6.86 (dd, J=7.6, 1.5 Hz, 1H), 6.81 (dd, J=7 ,6, 1.5 Hz, 1H), 4.37-4.26 (m, 1H), 4.06-3.83 (m, 3H), 3.72-3.62 (m, 2H), 3.60 (s, 3H), 3.48-3.38 (m, 1H), 3.03 (td, J=7.6, 3.3 Hz, 2H), 2.66 (t, J= 7.3 Hz, 2H), 2.15-2.06 (m, 1H), 2.02-1.95 (m, 1H), 1.92 (kv, J=4.1 Hz, 1H), 1.60-1.51 (m, 3H), 1.33 (t, J=7.0 Hz, 3H), 1.15 (kv, J=3.5 Hz, 2H)

Step 2. (R)-1-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)cyclopropane- 1-carboxylic acid

The ether compound (0.6 g, 1.10 mmol) obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 34 to obtain the desired product. (Yield: 34%)

^1H -NMR (500 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.86 (s, 1H), 7.36-7.27 (3H), 7.17 (d, J =7.9 Hz, 2H), 6.92 (t, J=7.0 Hz, 2H), 6.84 (kv, J=7.9 Hz, 2H), 4.30 (kv, J=3 .5 Hz, 1H), 4.07-3.82 (m, 3H), 3.76-3.55 (m, 2H), 3.42 (t, J=4.6 Hz, 1H), 3 .01 (t, J=7.6 Hz, 2H), 2.64 (t, J=7.6 Hz, 2H), 2.08 (kv, J=4.1 Hz, 1H), 2.04 -1.94 (m, 1H), 1.90 (kv, J=4.1 Hz, 1H), 1.63 (kv, J=3.3 Hz, 2H), 1.56 (kv, J= 4.3 Hz, 1H), 1.33 (t, J=7.0 Hz, 3H), 1.21 (kv, J=3.3 Hz, 2H)

Example 53 acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1 and methyl 4-(3- amino-3-oxopropyl)phenyl)-2,6-difluorobenzoate (0.07 g, 0.30 mmol) obtained in Synthesis Example 22 was used in the same manner as Example 34 to obtain the desired product. (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.61 (s, 1H), 7.90 (s, 1H), 7.44 (s, 1H), 7.05-6.80 (m , 6H), 4.33 (m, 1H), 4.06-3.85 (m, 3H), 3.68 (m, 2H), 3.47 (m, 1H), 3.04 (t, 2H), 2.67 (t, 2H), 2.15-1.84 (m, 3H), 1.60 (m, 1H), 1.34 (t, 3H)

Example 54 (R)-2,6-dichloro-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) benzoic acid

Step 1. 2-(Trimethylsilyl)ethyl (R)-2,6-dichloro-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino) -3-oxo-propyl)benzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine obtained in Synthesis Example 1, and 2-(trimethylsilyl)ethyl 4-(3-amino-3-oxopropyl) The 2,6-dichlorobenzoate obtained in Synthesis Example 23 was used in the same manner as in Example 8 to obtain the desired product. (Yield: 76%)

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.89 (s, 1H), 7.32 (s, 1H), 7.22 (s, 2H), 6 .97-6.84 (m, 4H), 4.50-4.44 (m, 2H), 4.41-4.33 (m, 1H), 3.98-3.89 (m, 1H) , 3.98-3.89 (m, 2H), 3.73-3.66 (m, 2H), 3.51-3.38 (m, 1H), 3.04-2.66 (m, 4H), 2.13-2.06 (m, 4H), 1.34 (t, J=7.2 Hz, 3H), 1.19-1.13 (m, 2H), 0.09 (s , 9H)

Step 2. (R)-2,6-dichloro-4-(3-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) benzoic acid

The ether compound obtained in step 1 was dissolved in 1 ml THF in the presence of nitrogen, and 1.0 M tetrabutylammonium fluoride (0.063 ml, 0.063 mmol) was added at 0°C, then stirred at room temperature for 12 hours. After confirming the disappearance of the starting materials by TLC, THF was concentrated under reduced pressure, adjusted to pH 2 with a solution of 1 N hydrochloric acid along with 3 ml of water. The resulting solid was filtered to obtain the title compound.

^1H NMR (300 MHz, CHLOROFORM-D): δ 8.58 (s, 1H), 7.88 (s, 1H), 7.47 (s, 1H), 7.18 (s, 2H), 6 .96-6.86 (m, 4H), 4.41-4.35 (m, 1H), 4.00-3.88 (m, 1H), 4.00-3.88 (m, 2H) , 3.73-3.69 (m, 2H), 3.67-3.54 (m, 1H), 3.01-2.66 (m, 4H), 2.14-1.42 (m, 4H), 1.00 (t, J=7.2 Hz, 3H)

Example 55 acid

Step 1. 2-(Trimethylsilyl)ethyl (R)-4-(3-((6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl )-2,6-dimethylbenzoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.35 g, 1.05 mmol) obtained in Synthesis Example 1, and 2-(trimethylsilyl)ethyl 4-(3-amino-3-oxopropyl)-2,6-dimethylbenzoate (0.34 g, 1.05 mmol) obtained in Synthesis Example 24 was used in the same manner as Example 8 to obtain the desired product. (Yield: 45%)

^1H NMR (400 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 7.87 (s, 1H), 7.13 (s, 1H), 6.81-6.96 (m, 6H), 4.37-4.41 (m, 2H), 4.31 (m, 1H), 3.94 (m, 2H), 3.66-3.75 (m, 2H), 3.45 (m, 1H), 2.99 (m, 2H), 2.63 (m, 2H), 2.30 (s, 6H), 2.15 (m, 1H), 2.02 (m, 1H) , 1.85 (m, 1H), 1.34 (t, 3H), 1.12 (m, 2H)

Step 2. (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)-2,6-dimethylbenzoic acid

The ether compound obtained in Step 1 (0.29 g, 0.47 mmol) was used in the same manner as in Step 2 of Example 54 to obtain the desired product. (Yield: 48%).

^1H NMR (400 MHz, CHLOROFORM-D): δ 8.63 (s, 1H), 7.86 (s, 1H), 7.19 (s, 1H), 6.82-6.95 (m, 6H), 4.31 (m, 1H), 3.91-3.78 (m, 3H), 3.65 (m, 2H), 3.43 (m, 1H), 2.97 (m, 2H ), 2.64 (m, 2H), 2.38 (s, 6H), 2.08 (m, 1H), 1.92 (m, 1H), 1.89 (m, 1H), 1.59 (m, 1H), 1.34 (t, 3H)

Example 56 4-carboxylic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 1-(4- (3-amino-3-oxopropyl)phenyl)piperidine-4-carboxylate (0.09 g, 0.30 mmol) obtained in Synthesis Example 25 was used in the same manner as Example 34 to obtain the desired product. (Yield: 44%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.67 (s, 1H), 7.87 (s, 1H), 7.14 (s, 1H), 7.14 (d, 2H), 6.95-6.82 (m, 6H), 4.31 (m, 1H), 4.15-3.89 (m, 3H), 3.70-3.58 (m, 4H), 3. 46 (m, 1H), 2.98 (t, 2H), 2.76 (t, 2H), 2.65 (t, 2H), 2.47 (m, 1H), 2.17-1.91 (m, 7H), 1.59 (m, 1H), 1.36 (t, 3H)

Example 57

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 1-(4- Carbamoyl-2,6-difluorophenyl)piperidine-4-carboxylate (0.09 g, 0.30 mmol) obtained in Synthesis Example 26 was used in the same manner as Example 34 to obtain the desired product. (Yield: 38%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.77 (s, 1H), 7.94 (s, 1H), 7.80 (s, 1H), 7.39 (d, 2H), 6.98-6.84 (m, 4H), 4.36 (m, 1H), 4.04-3.91 (m, 3H), 3.80-3.68 (m, 2H), 3. 53 (m, 1H), 3.49 (m, 2H), 3.21 (t, 2H), 2.57 (m, 1H), 2.11-1.88 (m, 7H), 1.63 (m, 1H), 1.36 (t, 3H)

Example 58 -yl)-acetic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 2-(1- (4-carbamoyl-2,6-difluorophenyl)piperidin-4-yl)acetate (0.10 g, 0.30 mmol) obtained in Synthesis Example 27 was used in the same manner as Example 34 to obtain the desired product . (Yield: 36%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.77 (s, 1H), 7.93 (s, 1H), 7.81 (s, 1H), 7.40 (d, 2H), 6.98-6.83 (m, 4H), 4.36 (m, 1H), 4.04-3.90 (m, 3H), 3.78-3.68 (m, 2H), 3. 52 (m, 1H), 3.49 (m, 2H), 3.17 (t, 2H), 2.36 (m, 2H), 2.21 (m, 1H), 1.99 (m, 3H ), 1.85 (m, 2H), 1.62 (m, 1H), 1.45 (m, 2H), 1.36 (t, 3H)

Example 59

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 4-(4- Carbamoylpiperidin-1-yl)benzoate (0.08 g, 0.30 mmol) obtained in Synthesis Example 34 was used in the same method as Example 34 to obtain the desired product. (Yield: 34%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 7.98-7.90 (m, 3H), 7.54 (s, 1H), 7.02-6 .86 (m, 6H), 4.32 (m, 1H), 4.13-3.87 (m, 5H), 3.69 (m, 1H), 3.63 (m, 1H), 3. 43 (m, 1H), 2.94 (m, 2H), 2.50 (m, 1H), 2.09-1.92 (m, 7H), 1.60 (m, 1H), 1.39 (t, 3H)

Example 60 -methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 2-(4- (3-Amino-3-oxopropyl)phenoxy)-2-methylpropanoate (0.08 g, 0.30 mmol) obtained in Synthesis Example 28 was used in the same manner as Example 34 to obtain the desired product. (Yield: 32%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.62 (s, 1H), 7.85 (s, 1H), 7.36 (s, 1H), 7.09 (d, 2H), 6.95-6.80 (m, 6H), 4.30 (m, 1H), 4.00-3.87 (m, 3H), 3.63 (m, 2H), 3.42 (m, 1H), 2.98 (t, 2H), 2.2.64 (t, 2H), 2.08 (m, 1H), 1.96 (m, 1H), 1.90 (m, 1H), 1.56 (m, 7H), 1.33 (t, 3H)

Example 61

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 3-(4- (3-Amino-3-oxopropyl)phenyl)propanoate (0.08 g, 0.30 mmol) obtained in Synthesis Example 29 was used in the same manner as Example 34 to obtain the desired product. (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.85 (s, 1H), 7.43 (s, 1H), 7.15 (m, 4H), 6.93 (m, 2H), 6.82 (m, 2H), 4.30 (m, 1H), 3.94 (m, 3H), 3.64 (m, 2H), 3.43 (m , 1H), 2.99 (t, 2H), 2.92 (t, 2H), 2.64 (m, 4H), 2.08 (m, 1H), 1.96 (m, 1H), 1 .90 (m, 1H), 1.57 (m, 1H), 1.33 (t, 3H)

Example 62 (R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)phenoxy)benzoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and ethyl 4-(4- Carbamoylphenoxy)benzoate (0.09 g, 0.30 mmol) obtained in Synthesis Example 30 was used in the same manner as Example 34 to obtain the desired product. (Yield: 40%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.84 (s, 1H), 8.14 (d, 2H), 7.93 (m, 4H), 7.16 (d, 2H), 7.10 (d, 2H), 6.97 (m, 1H), 6.88 (m, 3H), 4.36 (m, 1H), 4.00 (m, 3H), 3.73 (m , 2H), 3.52 (m, 1H), 2.12 (m, 1H), 2.04 (m, 1H), 1.95 (m, 1H), 1.62 (m, 1H), 1 .45 (t, 3H)

Example 63 phenyl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) prepared in Synthesis Example 1 and methyl (R)-3 -(4-(2-amino-2-oxoethyl)phenyl)-2-methylpropenoate (0.07 g, 0.30 mmol) obtained in Synthesis Example 31 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 56%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.83 (s, 1H), 7.49 (s, 1H), 7.21 (m, 4H), 6.89 (m, 2H), 6.83 (m, 2H), 4.25 (m, 1H), 3.95 (m, 3H), 3.66 (m, 3H), 3.50 (m , 1H), 3.33 (m, 1H), 3.02 (m, 1H), 2.74 (m, 2H), 2.04 (m, 1H), 1.92 (m, 1H), 1 .85 (m, 1H), 1.54 (m, 1H), 1.32 (t, 3H), 1.17 (d, 3H)

Example 64 phenyl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) prepared in Synthesis Example 1 and methyl (S)-3 -(4-(2-amino-2-oxoethyl)phenyl)-2-methylpropenoate (0.07 g, 0.30 mmol) obtained in Synthesis Example 32 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 48%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.83 (s, 1H), 7.52 (s, 1H), 7.22 (m, 4H), 6.89 (m, 2H), 6.83 (m, 2H), 4.25 (m, 1H), 3.94 (m, 3H), 3.66 (m, 3H), 3.53 (m , 1H), 3.35 (m, 1H), 3.04 (m, 1H), 2.73 (m, 2H), 2.06 (m, 1H), 1.92 (m, 1H), 1 .86 (m, 1H), 1.53 (m, 1H), 1.32 (t, 3H), 1.16 (d, 3H)

Example 65 ,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and methyl 3-(4- (2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.08 g, 0.30 mmol) obtained in Synthesis Example 33 was used in the same manner as Example 34 to obtain the desired product. (Yield: 47%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.62 (s, 1H), 7.85 (s, 1H), 7.36 (s, 1H), 7.09 (d, 2H), 6.91 (m, 2H), 6.85 (m, 4H), 4.30 (m, 1H), 3.92 (m, 3H), 3.63 (m, 2H), 3.42 (m , 1H), 2.98 (t, 2H), 2.64 (t, 2H), 2.08 (m, 1H), 1.96 (m, 1H), 1.90 (m, 1H), 1 .56 (m, 7H), 1.33 (t, 3H)

Example 66

Step 1. Methyl (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyridin-2-yl)amino)-2-oxoethyl)phenyl) acetate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridine prepared in Synthesis Example 71 and methyl 2-(4-(2-amino-2-oxoethyl)phenyl) The acetate obtained in Synthesis Example 6 was used in the same manner as in Example 8 to obtain the desired product. (Yield: 74.2%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.78 (d, J=27.0 Hz, 1H), 7.52-7.36 (m, 2H), 7.30-7.19 ( 4H), 6.99-6.90 (m, 2H), 6.89-6.78 (m, 2H), 6.40-6.28 (m, 1H), 4.28-4.18 ( m, 1H), 4.18-4.07 (1H), 4.05-3.91 (m, 2H), 3.86-3.74 (m, 1H), 3.65 (d, J= 8.2 Hz, 3H), 3.64-3.60 (m, 2H), 3.59 (s, 2H), 3.31-3.19 (1H), 3.15-3.02 (m , 1H), 2.20-2.05 (m, 1H), 1.86 (kvd, J=8.6, 4.5 Hz, 1H), 1.81-1.69 (m, 1H), 1.60-1.46 (m, 1H), 1.41-1.31 (m, 3H)

Step 2. (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridin-2-yl)amino)-2-oxo ethyl)phenyl)acetic acid

The desired product was obtained by hydrolysis of the ester compound obtained in step 1 using 5 N aqueous sodium hydroxide solution. (Yield: 61.7%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 7.64 (s, 1H), 7.47-7.37 (m, 2H), 7.27 (s, 4H), 7.00-6, 91 (m, 2H), 6.91-6.78 (m, 2H), 6.34 (t, J=4.6 Hz, 1H), 4.30-4.12 (m, 2H), 4 .08-3.95 (m, 2H), 3.83-3.72 (1H), 3.66 (s, 2H), 3.63-3.56 (2H), 3.15 (dd, J =12.8, 8.2 Hz, 1H), 3.10-2.97 (m, 1H), 2.22-2.08 (m, 1H), 1.86 (kv, J=4.4 Hz, 1H), 1.79-1.65 (m, 1H), 1.61-1.48 (m, 1H), 1.42-1.31 (m, 3H)

Example 67 (R)-2-(4-(3-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)ureido)phenyl)acetic acid

Step 1. Methyl (R)-2-(4-(3-(6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)ureido)phenyl)acetate

Methyl 2-(4-aminophenyl) acetate (0.2 g, 1.211 mmol) was dissolved in DCM (18 ml) and triphosgene (0.119 g, 0.400 mmol) and TEA (0.338 ml, 2.421 mmol) were added at 0°C. After stirring for 3 hours, the solvent was removed under reduced pressure. The resulting compound and (R)-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-amine (190 mg, 0.606 mmol) obtained in Synthesis Example 2 were mixed with THF (20 ml), and DIPEA (0.317 mL, 1.817 mmol) was added. The reaction was stopped by adding water and extracted with ethyl acetate. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification was carried out on a silica gel column to obtain the desired product. (Yield: 29.2%).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 10.86 (s, 1H), 9.15-9.09 (1H), 7.74 (d, J=12.3 Hz, 1H), 7 .61 (s, 1H), 7.51-7.41 (m, 2H), 7.15 (t, J=9.1 Hz, 2H), 7.03-6.72 (m, 4H), 4.44-4.36 (m, 1H), 4.06-3.85 (m, 3H), 3.73 (kv, J=6.7 Hz, 1H), 3.68 (s, 3H) , 3.67-3.63 (m, 1H), 3.56 (s, 2H), 3.54 (s, 1H), 2.16-2.01 (m, 2H), 2.01-1 .86 (m, 1H), 1.74-1.60 (m, 1H), 1.31 (kV, J=7.3 Hz, 3H)

Step 2. (R)-2-(4-(3-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)ureido)phenyl)acetic acid

Methyl (R)-2-(4-(3-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)ureido)phenyl)acetate (11 mg, 0.022 mmol), obtained in step 1 was used in the same manner as in step 2 of Synthesis Example 34 to obtain the desired product. (Yield: 15.9%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 7.83 (s, 1H), 7.70 (s, 1H), 7.68-7.64 (1H), 7.35 (d, J= 8.7 Hz, 2H), 7.15 (d, J=8.7 Hz, 2H), 6.90-6.78 (m, 2H), 6.75-6.68 (m, 1H), 4.51 (d, J=2.7 Hz, 1H), 4.00-3.90 (1H), 3.90-3.72 (m, 4H), 3.60-3.53 (1H) , 3.51 (s, 2H), 2.11-2.00 (m, 2H), 1.95 (s, 1H), 1.25-1.14 (m, 3H), 0.79-0 .68 (m, 1H)

Example 68 -methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridine (0.120 g, 0.361 mmol) prepared in Synthesis Example 71 and methyl 2-(4-(2-amino -2-oxoethyl)phenyl)2-methylpropanoate (0.102 g, 0.433 mmol) obtained in Synthesis Example 36 was used in the same manner as in Example 34 to obtain the desired product. (2 steps yield: 37.2%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.23 (s, 1H), 7.54-7.39 (m, 2H), 7.36 (d, J=7.8 Hz, 2H) , 7.31-7.25 (m, 2H), 7.02-6.90 (m, 2H), 6.90-6.76 (m, 2H), 6.40-6.26 (m, 1H), 4.31-4.16 (m, 1H), 4.10-4.04 (m, 1H), 4.04-3.90 (m, 2H), 3.83-3.70 ( m, 1H), 3.66 (d, J=11.9 Hz, 2H), 3.19 (dd, J=12.6, 8.5 Hz, 1H), 3.11-2.98 (m , 1H), 2.20-2.06 (m, 1H), 1.85 (kv, J=4.4 Hz, 1H), 1.79-1.65 (m, 1H), 1.63- 1.54 (m, 6H), 1.54-1.44 (m, 1H), 1.42-1.30 (m, 3H)

Example 69 -methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.118 g, 0.354 mmol) prepared in Synthesis Example 1 and methyl 2-(4-(2-amino -2-oxoethyl)phenyl)2-methylpropanoate (0.1 g, 0.425 mmol) obtained in Synthesis Example 36 was used in the same manner as in Example 34 to obtain the desired product. (2 steps yield: 20.1%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.62 (s, 1H), 7.82 (d, J=16.0 Hz, 1H), 7.55-7.43 (1H), 7 .43-7.33 (m, 2H), 7.26 (dd, J=23.8, 15.1 Hz, 2H), 6.91 (dd, J=14.8, 6.5, 1, 7 Hz, 2H), 6.86-6.75 (m, 2H), 4.31-4.20 (m, 1H), 4.02-3.84 (m, 3H), 3.68 (d , J=14.2 Hz, 2H), 3.62 (kv, J=4.3 Hz, 1H), 3.52 (kv, J=6.9 Hz, 1H), 3.41-3.28 (m, 1H), 2.11-2.04 (m, 1H), 1.99-1.78 (m, 2H), 1.61 (t, J=15.3 Hz, 6H), 1, 56-1.46 (m, 1H), 1.31 (kv, J=7.2 Hz, 3H)

Example 70 -methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridine (0.50 g, 1.50 mmol) obtained in Synthesis Example 71 and methyl 2-(4- (3-Amino-3-oxopropyl)phenyl-2-methylpropanoate (0.38 g, 1.50 mmol) obtained in Synthesis Example 20 was used in the same manner as Example 34 to obtain the desired product (Yield: 26%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.84 (s, 1H), 7.46 (d, J=4.6 Hz, 2H), 7.32 (d, J=8.2 Hz, 2H), 7.17 (d, J=8.2 Hz, 2H), 6.83-6.99 (m, 4H), 6.36 (t, J=4.3 Hz, 1H), 4.25 (td, J=8.2, 4.0 Hz, 1H), 4.08-4.13 (m, 1H), 3.96-4.04 (m, 2H), 3.79 ( td, J=8.7, 4.1 Hz, 1H), 3.28 (dd, J=12.8, 8.2 Hz, 1H), 3.10-3.16 (m, 1H), 2 .99 (t, J=7.8 Hz, 2H), 2.61 (t, J=7.5 Hz, 2H), 2.15 (dd, J=12.6, 4.3 Hz, 1H) , 1.89 (kv, J=4.4 Hz, 1H), 1.74-1.83 (m, 1H), 1.53-1.61 (m, 7H), 1.37 (t, J =7.1 Hz, 3H)

Example 71 (R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridin-2-yl)amino-2-oxoethyl)phenyl)-2, 2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridine (0.15 g, 0.45 mmol) obtained in Synthesis Example 71 and methyl 3-(4- (2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropenoate (0.11 g, 0.45 mmol) obtained in Synthesis Example 33 was used in the same method as Example 34 to obtain the desired product. (Yield: 50%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 7.87 (s, 1H), 7.51-7.38 (m, 2H), 7.18 (dd, J=22.9, 8, 2 Hz, 4H), 7.02-6.78 (m, 4H), 6.34 (d, J=8.7 Hz, 1H), 4.27-4.17 (m, 1H), 4, 16-4.04 (m, 1H), 4.04-3.92 (m, 2H), 3.79 (td, J=8.7, 4.3 Hz, 1H), 3.65 (s, 2H), 3.21 (dd, J=12.8, 8.7 Hz, 1H), 3.12-3.02 (m, 1H), 2.87 (s, 2H), 2.18-2 .07 (m, 1H), 1.92-1.69 (m, 2H), 1.61-1.46 (m, 1H), 1.37 (t, J=6.9 Hz, 3H), 1.19 (s, 6H)

Example 72 )phenyl)-2,2-dimethylpropanoic acid

K tert-butyl (R)-3-(4-(2-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-6-(trifluoromethyl)pyrimidin-2-yl)amino)-2-oxoethyl )phenyl)-2,2-dimethylpropanoate prepared by using (R)-2-chloro-4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-6-(trifluoromethyl)pyrimidine (0.18 g, 0.45 mmol) obtained in Synthesis Example 72, and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.13 g, 0.45 mmol) obtained in In synthesis example 63, using the same method as in example 8, DCM (0.30 ml) and TFA (0.45 ml) were slowly added and stirred at room temperature for 1 hour. The reaction mixture was neutralized by adding 1N HCl, extracted with ethyl acetate and washed with water and brine. The mixed solution was dried over magnesium sulfate, and the solvent was removed under reduced pressure. Purification was carried out by column chromatography to obtain the title compound. (Yield: 59%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 7.24-7.04 (m, 4H), 6.97-6.07 (m, 5H), 4.46 (s, 1H), 4 ,12-3.49 (m, 5H), 3.49-3.31 (m, 1H), 3.28 (s, 2H), 2.81 (d, J=9.6 Hz, 2H), 1.96 (d, J=2.3 Hz, 3H), 1.54 (s, 1H), 1.17 (t, J=7.1 Hz, 3H), 1.09 (d, J=15 ,1 Hz, 6H)

Example 73 2-yl)phenyl)-propanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.15 g, 0.45 mmol) obtained in Synthesis Example 1, and methyl 3-(4- (1-amino-2-methyl-1-oxopropan-2-yl)phenyl)propanoate (0.11 g, 0.45 mmol) obtained in synthesis example 37 was used in the same way as in example 34 to obtain the required product. (Yield: 63%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.71 (s, 1H), 7.83 (s, 1H), 7.33 (d, J=8.2 Hz, 2H), 7. 24 (d, J=8.2 Hz, 2H), 7.07 (s, 1H), 6.96-6.73 (m, 4H), 4.27-4.17 (m, 1H), 4 .03-3.86 (m, 3H), 3.73-3.59 (m, 1H), 3.42 (dd, J=13.0, 7.5 Hz, 1H), 3.36-3 .23 (m, 1H), 2.97 (t, J=7.8 Hz, 2H), 2.66 (t, J=7.8 Hz, 2H), 2.08 (m, 1H), 1 .97-1.74 (m, 2H), 1.63 (s, 6H), 1.54 (m, 1H), 1.33 (t, J=6.9 Hz, 3H)

Example 74

Step 1. Ethyl (R)-3-(4-((2-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)carbamoyl)allyl)amino)phenyl) -propanoate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (20.13 mg, 0.060 mmol) obtained in Synthesis Example 1, and ethyl-3-(4-( 3-Carbamoyl azetidin-1-yl)phenyl)propanoate (20 mg, 0.072 mmol) obtained in Synthesis Example 38 was used in the same manner as in Example 8 to obtain the desired product. (Yield: 37%).

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.78-8.63 (m, 1H), 8.42 (s, 1H), 7.94-7.78 (m, 1H), 7, 01 (dd, J=8.7, 2.7 Hz, 2H), 6.91 (td, J=7.8, 2.4 Hz, 2H), 6.86-6.72 (m, 2H) , 6.62 (dd, J=8.2, 2.7 Hz, 2H), 6.01 (d, J=2.7 Hz, 1H), 5.72 (s, 1H), 4.28 ( kv, J=3.5 Hz, 1H), 4.11 (td, J=7.1, 2.9 Hz, 5H), 4.03-3.81 (m, 4H), 3.81-3 .63 (m, 1H), 3.63-3.48 (m, 1H), 3.50-3.29 (m, 1H), 2.92-2.72 (m, 2H), 2.54 (td, J=7.8, 2.7 Hz, 2H), 2.19-2.02 (m, 1H), 2.02-1.78 (m, 2H), 1.47-1.29 (m, 3H), 1.29-1.09 (m, 3H)

Step 2. (R)-3-(4-((2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)allyl)amino)phenyl)propanoic acid

The ether compound obtained in step 1 was hydrolyzed using a 1 N aqueous solution of lithium hydroxide to obtain the title compound. (Yield: 51%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.70 (s, 1H), 8.42 (s, 1H), 7.86 (s, 1H), 7.02 (d, J=8, 2 Hz, 2H), 6.91 (t, J=7.5 Hz, 2H), 6.83 (d, J=6.4 Hz, 2H), 6.62 (d, J=8.2 Hz , 2H), 6.01 (s, 1H), 5.72 (s, 1H), 4.28 (d, J=3.7 Hz, 1H), 4.10 (d, J=12.3 Hz , 2H), 4.02-3.80 (m, 4H), 3.77-3.63 (m, 1H), 3.58 (kV, J=6.9 Hz, 1H), 3.52- 3.29 (m, 1H), 3.00-2.74 (m, 2H), 2.60 (t, J=7.5 Hz, 2H), 2.18-2.02 (m, 1H) , 2.01-1.77 (m, 2H), 1.57 (td, J=8.6, 4.1 Hz, 2H), 1.33 (t, J=7.1 Hz, 2H), 0.84 (kv, J=6.6 Hz, 3H)

Example 75 acid

Step 1. Methyl (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)pyrimidine-5-carboxylate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (20.13 mg, 0.060 mmol) obtained in Synthesis Example 1 and methyl 2-(4-carbamoylpiperidin- 1-yl)pyrimidin-5-carboxylate (95 mg, 0.359 mmol) obtained in Synthesis Example 39 was used in the same manner as Example 8 to obtain the desired product. (Yield: 61%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.84 (d, J=9.1 Hz, 2H), 8.66 (s, 1H), 7.87 (s, 1H), 7.03 -6.78 (m, 5H), 4.94 (d, J=14.2 Hz, 2H), 4.39-4.22 (1H), 4.04-3.89 (m, 4H), 3.87 (s, 3H), 3.77-3.66 (m, 1H), 3.60 (kv, J=6.9 Hz, 1H), 3.51-3.33 (m, 1H) , 3.19-2.98 (m, 2H), 2.64-2.47 (m, 1H), 2.15-2.07 (m, 1H), 2.02-1.88 (m, 2H), 1.83 (t, J=12.3 Hz, 2H), 1.67-1.56 (m, 1H), 1.35 (t, J=6.9 Hz, 3H)

Step 2. (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)pyrimidin-5-carboxylic acid

The ether compound obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 2 to obtain the title compound. (Yield: 69%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.84 (d, J=9.1 Hz, 2H), 8.66 (s, 1H), 7.87 (s, 1H), 7.03 -6.78 (m, 5H), 4.94 (d, J=14.2 Hz, 2H), 4.39-4.22 (1H), 4.04-3.89 (m, 4H), 3.87 (s, 3H), 3.77-3.66 (m, 1H), 3.60 (kv, J=6.9 Hz, 1H), 3.51-3.33 (m, 1H) , 3.19-2.98 (m, 2H), 2.64-2.47 (m, 1H), 2.15-2.07 (m, 1H), 2.02-1.88 (m, 2H), 1.83 (t, J=12.3 Hz, 2H), 1.67-1.56 (m, 1H), 1.35 (t, J=6.9 Hz, 3H)

Example 76 )carbamoyl)piperidin-1-yl)phenyl-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 70, and tert-butyl (R)-3-(3-(3-carbamoylpiperidin-1-yl)phenyl)-2,2-dimethylpropanoate (0.11 g, 0.30 mmol) obtained in Synthesis Example 64 was used by the same method , as in example 72, to obtain the required product. (Yield: 28%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 8.44 (s, 1H), 7.75 (d, J=4.1 Hz, 1H), 7.66-7.58 (m, 1H ), 7.18-7.05 (m, 2H), 6.94-6.75 (m, 3H), 6.70 (d, J=7.3 Hz, 1H), 5.16 (sq, J=2.7 Hz, 1H), 4.14-3.93 (m, 1H), 3.94-3.70 (m, 4H), 3.65-3.50 (m, 2H), 3 .49-3.40 (m, 1H), 3.05-2.94 (m, 1H), 2.90-2.69 (m, 4H), 2.18-1.90 (m, 4H) , 1.90-1.65 (m, 3H), 1.60 (d, J=9.1 Hz, 1H), 1.24-1.16 (m, 3H), 1.12 (d, J =2.3 Hz, 6H)

Example 77 (R)-3-(4-(1-((4-(3-(2-ethoxyphenoxy) piperidin-1-yl)pyrimidin-2-yl)amino)-2-methyl-1-oxopropan 2-yl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-4-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.10 g, 0.30 mmol) obtained in synthesis example 69, and tert-butyl 3-(4- (1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.096 g, 0.30 mmol) prepared in Synthesis Example 59 was used in the same manner as in example 72, obtaining the required product. (Yield: 66%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 11.51 (s, 1H), 8.34 (s, 1H), 7.89-7.76 (m, 1H), 7.29 (d , J=7.3 Hz, 2H), 7.10 (d, J=7.3 Hz, 2H), 7.01-6.87 (m, 2H), 6.87-6.74 (m, 2H), 6.07 (d, J=5.9 Hz, 1H), 4.24 (s, 1H), 4.02-3.42 (m, 6H), 2.75 (s, 2H), 2.12-1.80 (m, 3H), 1.67-1.45 (m, 7H), 1.32 (td, J=6.9, 1.4 Hz, 3H), 1.10 ( s, 6H)

Example 78. (R)-3-(4-(1-((4-(3-((3-ethoxypyridin-2-yl)oxy)-piperidin-1-yl)pyrimidin-2-yl)amino)- 2-methyl-1-oxopropan-2-yl)-phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-4-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidine (0.10 g, 0.30 mmol) obtained in Synthesis Example 66, and tert-butyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.095 g, 0.30 mmol) obtained in Synthesis Example 59 was used as follows the same method as in example 72, obtaining the desired product. (Yield: 71%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 11.71-10.30 (br.s, 1H), 7.80 (d, J=5.5 Hz, 1H), 7.73-7 .61 (m, 1H), 7.28 (d, J=7.8 Hz, 2H), 7.11 (d, J=8.2 Hz, 2H), 6.96 (d, J=7, 8 Hz, 1H), 6.82-6.69 (m, 1H), 6.10 (d, J=6.4 Hz, 1H), 5.13-5.03 (m, 1H), 4, 01-3.48 (m, 6H), 2.76 (dd, J=17.2, 13.5 Hz, 2H), 2.14-2.02 (m, 1H), 1.99-1, 86 (m, 2H), 1.59 (s, 7H), 1.33-1.17 (m, 3H), 1.11 (s, 6H)

Example 79 acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.032 g, 0.097 mmol) obtained in Synthesis Example 1, and tert-butyl 2-(4-(4-carbamoylpiperidine -1-yl)phenyl)acetate (0.031 g, 0.097 mmol) obtained in Synthesis Example 40 was used in the same manner as Example 72 to obtain the desired product. (Yield in 2 stages: 9.0%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.68 (s, 1H), 7.87 (s, 1H), 7.46 (s, 1H), 7.17 (d, J=8, 7 Hz, 2H), 6.99-6.81 (m, 6H), 4.35-4.25 (m, 1H), 4.03-3.88 (m, 3H), 3.78-3 .67 (m, 3H), 3.60 (kv, J=6.6 Hz, 1H), 3.55 (s, 2H), 3.46-3.37 (1H), 2.82-2, 66 (2H), 2.43-2.29 (m, 1H), 2.19-2.06 (1H), 2.02-1.82 (m, 6H), 1.58 (td, J= 8.8, 4.4 Hz, 1H), 1.35 (t, J=7.1 Hz, 3H)

Example 80 2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.12 g, 0.36 mmol) obtained in Synthesis Example 1, and methyl 2-(4- (4-carbamoylpiperidin-1-yl)phenyl)-2-methylpropanoate (0.11 g, 0.36 mmol) obtained in Synthesis Example 41 was used in the same manner as Example 34 to obtain the desired product. (Yield: 26%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.68 (s, 1H), 7.87 (s, 1H), 7.40 (s, 1H), 7.32-7.26 (m , 2H), 6.99-6.81 (m, 6H), 4.35-4.25 (m, 1H), 4.04-3.88 (m, 3H), 3.79-3.66 (m, 3H), 3.59 (kv, J=6.9 Hz, 1H), 3.47-3.36 (m, 1H), 2.75 (t, J=11.4 Hz, 2H) , 2.37 (t, J=11.2 Hz, 1H), 2.18-2.06 (m, 1H), 2.02-1.83 (m, 6H), 1.65-1.48 (m, 7H), 1.35 (t, J=7.1 Hz, 3H)

Example 81 -yl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.080 g, 0.24 mmol) obtained in Synthesis Example 1 and methyl 2-(6-(4 α-carbamoylpiperidin-1-yl)pyridin-3-yl)-2-methylpropanoate (0.073 g, 0.24 mmol) obtained in Synthesis Example 42 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 8.23 (d, J=2.3 Hz, 1H), 7.86 (s, 1H), 7. 57-7.41 (m, 2H), 6.98-6.89 (m, 2H), 6.89-6.78 (m, 2H), 6.65 (d, J=9.1 Hz, 1H), 4.31 (d, J=11.9 Hz, 3H), 4.03-3.87 (m, 3H), 3.69 (d, J=13.7 Hz, 1H), 3, 59 (kv, J=6.9 Hz, 1H), 3.41 (t, J=9.6 Hz, 1H), 2.88 (t, J=12.6 Hz, 2H), 2.46 ( t, J=10.7 Hz, 1H), 2.16-2.04 (1H), 2.02-1.73 (m, 6H), 1.64-1.48 (7H), 1.34 (dd, J=7.5, 6.6 Hz, 3H)

Example 82 tetrazol-2-yl)-acetic acid

Step 1. Ethyl (R)-2-(5-(4-((6-(3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)- 2H-tetrazol-2-yl)acetate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (167 mg, 0.499 mmol) obtained in Synthesis Example 1, and ethyl 2-(5-(4-carbamoylpiperidine -1-yl)-2H-tetrazol-2-yl)acetate (141 mg, 0.499 mmol) obtained in Synthesis Example 43 was used in the same manner as Example 8 to obtain the desired product. (Yield: 17%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.66 (s, 1H), 7.87 (s, 1H), 7.35-7.27 (1H), 7.05-6.90 ( m, 2H), 6.90-6.77 (2H), 5.19 (s, 2H), 4.31 (t, J=3.7 Hz, 1H), 4.29-4.23 (2H ), 4.19 (d, J=14.2 Hz, 2H), 4.11 (kv, J=7.0 Hz, 2H), 4.06-3.84 (4H), 3.81-3 .66 (m, 1H), 3.60 (dd, J=13.5, 7.5 Hz, 1H), 3.42 (t, J=9.6 Hz, 1H), 3.02 (t, J=11.9 Hz, 2H), 2.43 (d, J=11.0 Hz, 1H), 2.20-2.05 (m, 2H), 2.02-1.79 (m, 7H ), 1.60 (kv, J=4.6 Hz, 1H), 1.36 (kv, J=6.9 Hz, 5H), 1.28 (t, J=7.1 Hz, 3H), 1.23 (d, J=7.3 Hz, 3H)

Step 2. (R)-2-(5-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)-2H- tetrazol-2-yl)-acetic acid

The ether compound obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 2 to obtain the title compound. (Yield: 33%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 8.45 (s, 1H), 7.73 (s, 1H), 7.04-6.76 (m, 4H), 4.99 (s, 2H), 4.42 (s, 1H), 4.07 (kv, J=7.2 Hz, 3H), 4.00-3.86 (m, 1H), 3.86-3.80 (m , 3H), 3.80-3.68 (m, 1H), 3.62-3.50 (m, 1H), 3.32 (s, 1H), 3.08-2.86 (m, 2H ), 2.62 (t, J=11.4 Hz, 1H), 2.13-2.00 (m, 2H), 1.97-1.68 (m, 6H), 1.57 (s, 1H), 1.25 (t, J=6.4 Hz, 3H)

Example 83

Step 1. (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)piperidin-4-carboxamide

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.50 g, 1.50 mmol) prepared in Synthesis Example 1 and tert-butyl 4-carbamoylpiperidine-1 β-carboxylate (0.41 g, 1.80 mmol) was used in the same manner as Example 72 to obtain the desired product. (Yield: 45%)

Step 2. (R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)-4-oxobutanoic acid

To (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-piperidin-4-carboxamide (0.095 g, 0.22 mmol) obtained in step 1 , in DCM (2 ml), DIPEA (0.078 ml, 0.45 mmol) and succinic anhydride (0.034 g, 0.34 mmol) were slowly added and stirred at room temperature for 30 minutes. The reaction mixture was washed with 2 N HCl and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure, and purification was carried out by column chromatography to obtain the title compound. (Yield: 55%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.89 (s, 1H), 7.53 (s, 1H), 7.01-6.80 (m , 4H), 4.58 (d, J=11.4 Hz, 1H), 4.31 (kv, J=3.5 Hz, 1H), 4.07-3.87 (m, 4H), 3 .71 (d, J=13.7 Hz, 1H), 3.60 (kv, J=6.7 Hz, 1H), 3.43 (t, J=9.6 Hz, 1H), 3.23 -3.07 (1H), 2.88-2.61 (m, 5H), 2.51 (d, J=10.5 Hz, 1H), 2.20-2.05 (m, 1H), 2.05-1.66 (m, 6H), 1.66-1.48 (m, 1H), 1.36 (t, J=6.9 Hz, 3H)

Example 84

Step 1. Ethyl (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl) acetate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (232 mg, 0.696 mmol) obtained in Synthesis Example 1, and ethyl 2-(4-carbamoylpiperidin-1- yl)acetate (179 mg, 0.835 mmol) obtained in Synthesis Example 44 was used in the same manner as Example 8 to obtain the desired product. (Yield: 91%)

¹ H-NMR (CHLOROFORM-D) δ 8.70 (s, 1H), 7.89 (s, 1H), 7.33 (s, 1H), 7.04-6.92 (m, 2H), 6.92-6.83 (m, 2H), 4.39-4.27 (m, 1H), 4.21 (kV, J=7.2 Hz, 2H), 4.09-3.90 ( m, 4H), 3.79-3.69 (m, 1H), 3.61 (dd, J=13.4, 7.3 Hz, 1H), 3.49-3.36 (m, 1H) , 3.27 (s, 2H), 3.04 (dd, J=10.4, 2.7 Hz, 2H), 2.42-2.30 (m, 2H), 2.30-2.21 (m, 1H), 2.21-2.10 (m, 1H), 2.05-1.85 (m, 7H), 1.68-1.55 (m, 1H), 1.36-1 .21 (m, 6H)

Step 2. (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)acetic acid

The ester compound obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 2 to obtain the title compound. (Yield: 41%)

¹ H-NMR (MeOD) δ 8.50 (s, 1H), 7.85 (s, 1H), 7.02-6.82 (m, 5H), 4.52 (s, 1H), 4, 12 (s, 2H), 4.08-3.92 (m, 3H), 3.92-3.84 (m, 1H), 3.81 (dd, J=13.7, 2.4 Hz, 1H), 3.79-3.70 (1H), 3.56 (s, 1H), 2.17 (s, 3H), 2.10-1.93 (m, 2H), 1.62 (d , J=3.1 Hz, 1H), 1.28 (t, J=7.0 Hz, 3H)

Example 85 yl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) prepared in Synthesis Example 1 and tert-butyl (R)-3 -(3-(3-carbamoylpiperidin-1-yl)phenyl)-2,2-dimethylpropanoate (0.11 g, 0.30 mmol) obtained in Synthesis Example 64 was used in the same manner as in Example 72, with obtaining the required product. (Yield: 61%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 9.33 (s, 1H), 8.67 (s, 1H), 7.91-7.79 (m, 1H), 7.15 (t , J=7.8 Hz, 1H), 7.00-6.75 (m, 6H), 6.65 (d, J=7.3 Hz, 1H), 4.34-4.21 (m, 1H), 4.04-3.86 (m, 3H), 3.78-3.57 (m, 2H), 3.51 (dd, J=12.8, 7.3 Hz, 2H), 3 .42-3.29 (m, 1H), 3.22 (dd, J=13.3, 8.7 Hz, 1H), 3.17-3.03 (m, 1H), 3.03-2 .91 (m, 1H), 2.68 (d, J=13.3 Hz, 2H), 2.16-2.04 (m, 1H), 2.01-1.80 (m, 4H), 1.78-1.65 (m, 2H), 1.65-1.49 (m, 1H), 1.35 (td, J=7.0, 3.5 Hz, 3H), 1.25 ( s, 3H), 1.09 (s, 3H)

Example 86 2-yl)phenyl)-piperidine-4-carboxylic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.12 g, 0.36 mmol) obtained in Synthesis Example 1, and ethyl 1-(4- (1-amino-2-methyl-1-oxopropan-2-yl)phenyl)piperidine-4-carboxylate (0.11 g, 0.36 mmol) obtained in Synthesis Example 45 was used in the same manner as in Example 34, obtaining the required product. (Yield: 38%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.72 (s, 1H), 7.81 (s, 1H), 7.27 (d, J=8.7 Hz, 2H), 7. 09 (s, 1H), 6.97-6.73 (m, 6H), 4.26-4.15 (m, 1H), 4.03-3.87 (m, 3H), 3.72- 3.59 (m, 3H), 3.39 (dd, J=13.3, 7.8 Hz, 1H), 3.33-3.19 (m, 1H), 2.87-2.73 ( m, 2H), 2.53-2.41 (m, 1H), 2.07 (d, J=3.7 Hz, 3H), 1.97-1.74 (m, 4H), 1.66 -1.46 (m, 7H), 1.33 (t, J=7.1 Hz, 3H)

Example 87

Step 1. Methyl 6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)pyrrolidin-1-yl)nicotinate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (34.8 mg, 0.104 mmol) obtained in Synthesis Example 1 and methyl 6-(3-carbamoylpyrrolidine- 1-yl)nicotinate (26 mg, 0.104 mmol) obtained in Synthesis Example 46 was used in the same manner as Example 8 to obtain the desired product. (Yield: 31%)

¹ H-NMR (CHLOROFORM-D) δ 8.83 (d, J=2.4 Hz, 1H), 8.68 (s, 1H), 8.05 (d, J=8.8 Hz, 1H) , 7.92 (s, 1H), 7.40 (d, J=3.7 Hz, 1H), 6.94 (dd, J=39.5, 8.7 Hz, 5H), 6.39 ( dd, J=8.8, 3.1 Hz, 1H), 4.35 (kv, J=3.6 Hz, 1H), 4.02 (kv, J=7.2 Hz, 1H), 3, 99-3.91 (m, 3H), 3.89 (s, 4H), 3.88-3.77 (m, 2H), 3.71 (s, 2H), 3.60 (d, J= 8.8 Hz, 1H), 3.49 (s, 1H), 3.29-3.13 (1H), 2.49-2.35 (m, 2H), 2.13 (s, 1H), 2.06-1.89 (2H), 1.61 (s, 11H), 1.38 (t, J=7.0 Hz, 3H)

Step 2. 6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)pyrrolidin-1-yl)nicotinic acid

The ether compound obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 2 to obtain the title compound. (Yield: 59%)

¹ H-NMR (MeOD) δ 8.71 (s, 1H), 8.51 (s, 1H), 8.06 (d, J=9.2 Hz, 1H), 8.00 (s, 1H) , 7.85-7.74 (1H), 7.00 (d, J=7.6 Hz, 1H), 6.98-6.83 (m, 3H), 6.57 (d, J=8 .8 Hz, 1H), 4.48 (s, 1H), 4.03-3.90 (m, 1H), 3.90-3.86 (m, 3H), 3.84 (d, J= 14.3 Hz, 2H), 3.80-3.68 (m, 2H), 3.68-3.52 (m, 2H), 3.48-3.35 (1H), 2.45-2 .28 (2H), 2.13-2.02 (2H), 1.96 (d, J=9.2 Hz, 1H), 1.63 (s, 1H), 1.29 (td, J= 7.0, 1.5 Hz, 3H)

Example 88 N-(6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-3-methylpyrrolidin-3-carboxamide

Step 1. Tert-butyl 3-((6-((R)-3-(2-ethoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)carbamoyl)-3-methylpyrrolidine-1-carboxylate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (59.5 mg, 0.178 mmol) prepared in Synthesis Example 1 and tert-butyl 3-carbamoyl-3-methylpyrrolidine -1-carboxylate (26 mg, 0.104 mmol) obtained in Synthesis Example 47 was used in the same manner as Example 8 to obtain the desired product. (Yield: 99%)

¹ H-NMR (CHLOROFORM-D) δ 8.71 (s, 1H), 7.91 (s, 1H), 7.41 (s, 1H), 7.04-6.83 (m, 4H), 4.33 (kv, J=3.7 Hz, 1H), 4.10-3.91 (m, 3H), 3.87-3.70 (m, 2H), 3.69-3.24 ( m, 5H), 2.52-2.24 (1H), 2.13 (d, J=8.2 Hz, 1H), 2.02 (s, 1H), 1.99-1.81 (m , 2H), 1.62 (kvd, J=8.8, 4.3 Hz, 4H), 1.49 (s, 10H), 1.46 (s, 3H), 1.39 (t, J= 7.0 Hz, 3H)

Step 2. N-(6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)-3-methylpyrrolidin-3-carboxamide

The ester compound obtained in step 1 was dissolved in DCM and trifluoroacetic acid (0.31 ml, 4.04 mmol) was added, then stirred at room temperature for 2 hours. After completion of the reaction, the resulting product was distilled under reduced pressure to remove excess organic solvent, and then neutralized with 1 N aqueous sodium hydroxide solution. After extraction with an organic solvent, the resulting product was dried over magnesium sulfate and purified by column chromatography (hexane:ethyl acetate) to obtain the desired compound. (Yield: 99%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 8.45 (s, 1H), 7.78 (s, 1H), 7.03-6.76 (m, 4H), 4.51-4, 34 (m, 1H), 3.97-3.71 (m, 6H), 3.64-3.50 (m, 1H), 3.50-3.37 (m, 1H), 3.03 ( dd, J=11.9, 1.4 Hz, 1H), 2.62-2.43 (m, 1H), 2.17-1.99 (m, 3H), 1.99-1.83 ( m, 2H), 1.66-1.55 (m, 1H), 1.53 (s, 3H), 1.33-1.22 (m, 4H)

Example 89

Step 1. Methyl 6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-3-methylpyrrolidin-1-yl)nicotinate

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (138 mg, 0.414 mmol) obtained in Synthesis Example 1 and methyl 6-(3-carbamoyl-3- Methylpyrrolidin-1-yl)nicotinate (99 mg, 0.376 mmol) obtained in Synthesis Example 48 was used in the same manner as Example 8 to obtain the desired product. (Yield: 33%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 8.64 (d, J=2.3 Hz, 1H), 8.42 (s, 1H), 8.06-7.91 (1H), 7 .78-7.67 (1H), 7.02-6.75 (m, 5H), 6.50 (d, J=9.1 Hz, 1H), 4.42 (s, 1H), 4. 01-3.84 (m, 3H), 3.82 (s, 4H), 3.81-3.71 (m, 3H), 3.70-3.37 (m, 5H), 2.55 ( t, J=6.4 Hz, 1H), 2.17-1.99 (m, 3H), 1.98-1.83 (m, 2H), 1.64-1.51 (m, 1H) , 1.51-1.41 (3H), 1.25-1.21 (3H)

Step 2. 6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)-3-methylpyrrolidin-1-yl)nicotinic acid

The ether compound obtained in step 1 was hydrolyzed by the same method as in step 2 of Example 2 to obtain the title compound. (Yield: 14%)

¹ H-NMR (400 MHz, METHANOL-D4) δ 8.66 (d, J=2.3 Hz, 1H), 8.42 (s, 1H), 8.01 (dd, J=9.1, 2.3 Hz, 1H), 7.74 (d, J=3.2 Hz, 1H), 6.95 (d, J=7.3 Hz, 1H), 6.92-6.77 (m, 3H), 6.51 (d, J=9.1 Hz, 1H), 4.43 (s, 1H), 4.16-3.97 (m, 2H), 3.97-3.86 (m , 2H), 3.86-3.70 (m, 3H), 3.70-3.49 (m, 3H), 3.46 (d, J=11.0 Hz, 1H), 2.56 ( t, J=6.4 Hz, 1H), 2.18-2.04 (1H), 2.04-1.87 (m, 6H), 1.54 (d, J=23.3 Hz, 1H ), 1.49 (s, 3H), 1.34-1.24 (m, 2H), 1.21 (dd, J=7.3, 6.4 Hz, 3H)

Example 90 acid

Step 1. Methyl (R)-2-(4-(2-((6-(3-(2-isopropoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl) acetate

(R)-2-chloro-6-(3-(2-isopropoxyphenoxy)piperidin-1-yl)pyrazine (70 mg, 0.201 mmol) prepared in Synthesis Example 73 and methyl 2-(4-(2-amino -2-oxoethyl)phenyl)acetate (50 mg, 0.241 mmol) obtained in Synthesis Example 6 was used in the same manner as in Example 8 to obtain the desired product. (Yield: 77%)

m/z (M+H) ⁺ calculated for C ₂₉ H ₃₄ N ₄ O ₅ : 518.6, detected 519.3

Step 2. (R)-2-(4-(2-((6-(3-(2-isopropoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid

The ether compound obtained in Step 1 was hydrolyzed using 5 N aqueous sodium hydroxide solution in the same manner as in Step 2 of Example 2 to obtain the desired product. (Yield: 64%)

^1H NMR (500 MHz, CHLOROFORM-D) δ 8.67 (s, 1H), 7.93 (s, 1H), 7.74 (s, 1H), 7.33-7.21 (m, 3H ), 7.01-6.85 (m, 4H), 4.4 (td, 1H), 4.25 (m, 1H), 4.02 (dd, 1H), 3.71 (cvd, 3H) , 3.65 (m, 2H), 3.39 (m, 1H), 3.31 (m, 1H), 2.12-2.05 (m, 1H), 2.03-1.85 (m , 2H), 1.61 (kvd, J=8.7, 4.3 Hz, 1H), 1.32-1.18 (m, 6H)

Example 91 -methylpropanoic acid

(R)-2-chloro-6-(3-(2-methoxyphenoxy)piperidin-1-yl)pyrazine (0.13 g, 0.40 mmol) obtained in Synthesis Example 74 and methyl 2-(4- (3-Amino-3-oxopropyl)phenyl-2-methylpropanoate (0.10 g, 0.40 mmol) obtained in Synthesis Example 20 was used in the same manner as Example 34 to obtain the desired product. Stage 2: 12%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.68 (s, 1H), 7.88 (s, 1H), 7.32 (t, J=8.7 Hz, 2H), 7.26 -7.09 (m, 3H), 7.01-6.76 (m, 4H), 4.40-4.21 (m, 1H), 4.05 (d, J=13.3 Hz, 1H ), 3.89-3.58 (m, 4H), 3.57-3.39 (m, 1H), 3.39-3.21 (m, 1H), 3.02 (t, J=7 .3 Hz, 2H), 2.77-2.56 (2H), 2.16-2.06 (m, 1H), 2.03-1.78 (m, 2H), 1.72-1, 46 (m, 7H)

Example 92 yl)amino)propyl)phenyl)-propanoic acid

(R)-2-chloro-6-(3-(2-(trifluoromethoxy)phenoxy)piperidin-1-yl)-pyrazine (0.15 g, 0.40 mmol) prepared in Synthesis Example 75 and methyl 2 -(4-(3-amino-3-oxopropyl)phenyl-2-methylpropanoate (0.10 g, 0.40 mmol) obtained in Synthesis Example 20 was used in the same method as Example 34 to obtain the desired product (Exit in 2 stages: 10%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.68 (s, 1H), 7.88 (s, 1H), 7.43 (s, 1H), 7.33 (d, J=8, 2 Hz, 2H), 7.25-7.10 (m, 4H), 7.10-6.86 (m, 2H), 4.44-4.26 (m, 1H), 4.07 (dd , J=13.3, 2.7 Hz, 1H), 3.83-3.58 (m, 1H), 3.48 (dd, J=13.3, 7.8 Hz, 1H), 3, 41-3.25 (m, 1H), 2.97 (dt, J=32.6, 7.9 Hz, 2H), 2.66 (t, J=7.5 Hz, 2H), 2.23 -2.05 (m, 1H), 2.02-1.76 (m, 2H), 1.76-1.37 (m, 7H)

Example 93 oxopropyl)phenyl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)-pyrazine (0.14 g, 0.40 mmol) prepared in Synthesis Example 76, and Methyl 2-(4-(3-amino-3-oxopropyl)phenyl-2-methylpropanoate (0.10 g, 0.40 mmol) obtained in Synthesis Example 20 was used in the same manner as in Example 34 to obtain required product (yield in 2 stages: 12%)

¹ H-NMR (400 MHz, CHLOROFORM-D) δ 8.66 (s, 1H), 7.86 (s, 1H), 7.33 (d, J=8.2 Hz, 3H), 7.18 (dd, J=14.6, 8.2 Hz, 2H), 7.04-6.77 (m, 4H), 4.64 (dt, J=47.6, 4.1 Hz, 2H), 4.38-4.23 (m, 1H), 4.23-4.00 (m, 2H), 3.96 (dd, J=13.3, 2.7 Hz, 1H), 3.68- 3.53 (m, 2H), 3.53-3.34 (m, 1H), 3.02 (t, J=7.5 Hz, 2H), 2.65 (t, J=7.5 Hz , 2H), 2.13-2.05 (m, 1H), 2.04-1.79 (m, 2H), 1.68-1.46 (m, 7H)

Example 94 oxoethyl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)-pyrazine (0.080 g, 0.23 mmol) prepared in Synthesis Example 76 and methyl 3 -(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.057 g, 0.23 mmol) obtained in Synthesis Example 33 was used in the same manner as in Example 34 to obtain the required product. (Yield: 39%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.83 (s, 1H), 7.56 (s, 1H), 7.23-7.08 (m , 4H), 6.99-6.82 (m, 4H), 4.69 (t, J=4.1 Hz, 1H), 4.58 (t, J=4.1 Hz, 1H), 4 .30-4.21 (m, 1H), 4.20-3.99 (m, 2H), 3.94 (dd, J=13.0, 3.0 Hz, 1H), 3.66 (s , 2H), 3.64-3.57 (m, 1H), 3.52 (kv, J=6.9 Hz, 1H), 3.42-3.30 (m, 1H), 2.91- 2.81 (m, 2H), 2.12-2.05 (m, 1H), 1.99-1.78 (m, 2H), 1.53 (kvd, J=8.6, 4.5 Hz, 1H), 1.22-1.13 (s, 6H)

Example 95 2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-cyclopropoxyphenoxy)piperidin-1-yl)-pyrazine (0.14 g, 0.41 mmol) obtained in synthesis example 77, and tert-butyl 3-(4 -(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.12 g, 0.41 mmol) obtained in Synthesis Example 63 was used in the same manner as Example 72 to obtain the desired product . (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.87-7.79 (m, 1H), 7.60 (s, 1H), 7.24-7 .10 (m, 5H), 7.01-6.78 (m, 3H), 4.23-4.14 (m, 1H), 4.01-3.92 (m, 1H), 3.73 -3.60 (m, 4H), 3.45-3.34 (m, 1H), 3.32-3.20 (m, 1H), 2.87 (t, J=14.0 Hz, 2H ), 2.11-1.99 (m, 1H), 1.96-1.72 (m, 2H), 1.61-1.44 (m, 1H), 1.21-1.12 (m , 6H), 0.75-0.63 (m, 4H)

Example 96 2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazine (0.14 g, 0.39 mmol) obtained in synthesis example 57, and tert-butyl 3-(4 -(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.11 g, 0.39 mmol) obtained in Synthesis Example 63 was used in the same manner as Example 72 to obtain the desired product . (Yield: 59%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.66 (s, 1H), 7.86 (d, J=20.1 Hz, 1H), 7.65-7.47 (m, 1H ), 7.18 (kv, J=8.1 Hz, 4H), 6.97-6.84 (m, 2H), 6.84-6.74 (m, 1H), 6.71 (d, J=7.8 Hz, 1H), 4.53 (td, J=14.6, 7.6 Hz, 1H), 4.29-4.18 (m, 1H), 3.93 (dd, J =13.3, 3.2 Hz, 1H), 3.73-3.58 (m, 3H), 3.48 (dd, J=13.0, 7.5 Hz, 1H), 3.39- 3.27 (m, 1H), 2.87 (t, J=14.2 Hz, 2H), 2.42-2.27 (m, 2H), 2.17-2.04 (m, 3H) , 1.98-1.70 (m, 3H), 1.68-1.44 (m, 2H), 1.21-1.11 (m, 6H)

Example 97 2-methylpropanoic acid

K benzyl (R, E)-2-(4-(3-((6-(3-(2-cyclopropoxyphenoxy)-piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1- en-1-yl)phenyl)-2-methylpropanoate prepared by using (R)-2-chloro-6-(3-(2-cyclopropoxyphenoxy)piperidin-1-yl)pyrazine (0.14 g, 0.41 mmol) obtained in synthesis example 77, and benzyl (E)-2-(4-(3-amino-3-oxoprop-1-en-1-yl)phenyl)-2-methylpropanoate (0.13 g, 0 .41 mmol) obtained in synthesis example 65, methanol (1.82 ml) and palladium on carbon (12 mg) were added using the same method as in example 8 and stirred at room temperature for 4 hours under an atmosphere of hydrogen gas . The reaction mixture was filtered through celite and the solvent was removed under reduced pressure. Purification was carried out by column chromatography to obtain the title compound. (Yield: 59%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.88-7.81 (m, 1H), 7.56-7.39 (m, 1H), 7 .32 (d, J=8.2 Hz, 2H), 7.22-7.12 (m, 3H), 7.00-6.79 (m, 3H), 4.22 (s, 1H), 4.00-3.90 (m, 1H), 3.73-3.60 (m, 2H), 3.49 (ddd, J=13.0, 7.5, 2.7 Hz, 1H), 3.40-3.27 (m, 1H), 3.00 (t, J=7.3 Hz, 2H), 2.65 (t, J=7.5 Hz, 2H), 2.12-2 .04 (m, 1H), 1.98-1.76 (m, 2H), 1.63-1.46 (m, 7H), 0.75-0.62 (m, 4H)

Example 98 2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazine (0.14 g, 0.39 mmol) obtained in Synthesis Example 57, and benzyl (E)- 2-(4-(3-amino-3-oxoprop-1-en-1-yl)phenyl)-2-methylpropanoate (0.13 g, 0.39 mmol) obtained in Synthesis Example 65 was used as follows the same method as in example 97, obtaining the required product. (Yield: 53%).

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.88-7.81 (m, 1H), 7.46 (d, J=32.5 Hz, 1H ), 7.32 (d, J=8.2 Hz, 2H), 7.20-7.12 (m, 2H), 6.94-6.78 (m, 3H), 6.69 (dd, J=7.8, 1.4 Hz, 1H), 4.55-4.45 (m, 1H), 4.32-4.22 (m, 1H), 3.92 (dd, J=13, 3, 3.2 Hz, 1H), 3.71-3.52 (m, 2H), 3.45-3.33 (m, 1H), 3.05-2.94 (m, 2H), 2 .70-2.58 (m, 2H), 2.44-2.27 (m, 2H), 2.17-2.04 (m, 3H), 2.01-1.70 (m, 3H) , 1.69-1.47 (m, 8H)

Example 99

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and tert-butyl 2-(4- (2-Amino-2-oxoethyl)phenoxy)acetate (0.079 g, 0.30 mmol) obtained in Synthesis Example 49 was used in the same manner as Example 72 to obtain the desired product. (Yield: 72%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 8.42 (s, 1H), 7.71 (s, 1H), 7.23 (d, J=8.2 Hz, 2H), 6, 97-6.78 (m, 6H), 4.58 (s, 2H), 4.40 (s, 1H), 4.00-3.66 (m, 4H), 3.62 (d, J= 7.8 Hz, 3H), 3.58-3.46 (m, 1H), 2.08-1.78 (m, 3H), 1.63-1.48 (m, 1H), 1.21 (t, J=7.1 Hz, 3H)

Example 100

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.15 g, 0.45 mmol) obtained in Synthesis Example 1, and methyl 2-(4- (2-Amino-2-oxoethoxy)phenyl)acetate (0.10 g, 0.45 mmol) obtained in Synthesis Example 50 was used in the same manner as Example 34 to obtain the desired product. (Yield: 35%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.71 (s, 1H), 8.37 (s, 1H), 7.93 (s, 1H), 7.28 (m, 2H), 7.04-6.88 (4H), 6.88-6.78 (m, 2H), 4.59 (s, 2H), 4.35-4.25 (m, 1H), 4.08- 3.85 (m, 3H), 3.73 (m, 1H), 3.65-3.54 (m, 3H), 3.49-3.39 (m, 1H), 2.17-2, 06 (m, 1H), 2.03-1.85 (m, 2H), 1.59 (m, 1H), 1.34 (kv, J=7.3 Hz, 3H)

Example 101 2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethoxy)phenyl)propanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.70 g, 2.1 mmol) obtained in Synthesis Example 1 and methyl 2-(4- (2-Amino-2-oxoethoxy)phenyl)propanoate (0.50 g, 2.1 mmol) obtained in Synthesis Example 51 was used in the same manner as Example 34 to obtain the desired product. (Yield: 26%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 8.36 (s, 1H), 7.91 (s, 1H), 7.42-7.26 (m , 2H), 7.04-6.75 (m, 6H), 4.57 (s, 2H), 4.36-4.22 (m, 1H), 4.09-3.83 (m, 3H ), 3.71 (kV, J=7.2 Hz, 2H), 3.66-3.53 (m, 1H), 3.52-3.35 (m, 1H), 2.29-1, 76 (m, 3H), 1.67-1.52 (m, 1H), 1.49 (d, J=6.9 Hz, 3H), 1.39-1.26 (m, 3H)

Example 102 (R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy-2, 2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.12 g, 0.36 mmol) obtained in Synthesis Example 1, and methyl 3-(4- (2-amino-2-oxoethyl)phenoxy)-2,2-dimethylpropanoate (0.095 g, 0.36 mmol) obtained in Synthesis Example 52 was used in the same manner as Example 34 to obtain the desired product. (Yield: 38%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.65 (s, 1H), 7.84 (s, 1H), 7.38-7.27 (1H), 7.19 (d, J =8.7 Hz, 2H), 6.99-6.76 (m, 6H), 4.29-4.20 (m, 1H), 4.01-3.86 (m, 5H), 3, 71-3.59 (m, 3H), 3.51 (dd, J=13.0, 7.5 Hz, 1H), 3.40-3.28 (m, 1H), 2.13-2, 04 (m, 1H), 2.00-1.80 (m, 2H), 1.61-1.47 (m, 1H), 1.32 (t, J=6.6 Hz, 9H)

Example 103 )phenoxy)propanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.18 g, 0.54 mmol) prepared in Synthesis Example 1 and ethyl (R)-2 -(4-(2-amino-2-oxoethyl)phenoxy)propanoate (0.14 g, 0.54 mmol) obtained in Synthesis Example 53 was used in the same manner as Example 34 to obtain the desired product. (Yield: 24%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 8.42 (s, 1H), 7.71 (s, 1H), 7.21 (d, J=8.7 Hz, 2H), 6, 99-6.77 (m, 6H), 4.69 (kv, J=6.7 Hz, 1H), 4.39 (dd, J=8.5, 3.4 Hz, 1H), 3.95 -3.70 (m, 5H), 3.60 (s, 2H), 3.56-3.45 (m, 1H), 2.07-1.82 (m, 3H), 1.53 (d , J=6.9 Hz, 4H), 1.21 (t, J=7.1 Hz, 3H)

Example 104 )phenoxy)propanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.354 g, 1.061 mmol) obtained in Synthesis Example 1, and methyl (S)-2-(4- (2-amino-2-oxoethyl)phenoxy)propanoate (0.277 g, 1.168 mmol) obtained in Synthesis Example 54 was used in the same manner as in Example 34 to obtain the desired product. (2 stage yield: 3.7%)

¹ H-NMR (CHLOROFORM-D) δ 8.61 (s, 1H), 7.85 (s, 1H), 7.42 (d, J=8.2 Hz, 1H), 7.25-7, 15 (2H), 7.01-6.88 (m, 4H), 6.88-6.77 (m, 2H), 4.78 (kv, J=6.8 Hz, 1H), 4.28 (td, J=7.2, 3.8 Hz, 1H), 4.01-3.82 (m, 3H), 3.72-3.49 (m, 4H), 3.46-3.31 (m, 1H), 2.09-2.05 (m, 1H), 1.96 (td, J=6.7, 3.4 Hz, 1H), 1.91-1.80 (m, 1H ), 1.68 (d, J=6.7 Hz, 3H), 1.61-1.47 (1H), 1.37-1.29 (3H)

Example 105. (R)-2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazin-2-yl)amino)- 2-oxoethyl)phenoxy)-2-methylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (0.060 g, 0.18 mmol) prepared in Synthesis Example 70 and ethyl 2-(4-(2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate (0.048 g, 0.18 mmol) obtained in Synthesis Example 55 was used in the same method as Example 34 to obtain the desired product . (Yield: 29%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.56 (s, 1H), 7.85 (s, 1H), 7.70-7.66 (m, 1H), 7.35 (d , J=13.3 Hz, 1H), 7.21-7.11 (m, 2H), 6.98-6.87 (m, 3H), 6.79-6.75 (m, 1H), 5.15-5.05 (m, 1H), 3.93-3.71 (m, 4H), 3.61 (d, J=11.0 Hz, 3H), 3.50-3.39 ( m, 1H), 2.14-2.04 (m, 1H), 1.92 (t, J=5.0 Hz, 2H), 1.60 (s, 7H), 1.25 (t, J =7.0 Hz, 3H)

Example 106 -methylpropanoic acid

(R)-4-chloro-2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.060 g, 0.18 mmol) obtained in Synthesis Example 68, and ethyl 2-(4-(2 -Amino-2-oxoethyl)phenoxy)-2-methylpropanoate (0.048 g, 0.18 mmol) obtained in Synthesis Example 55 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 29%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.18 (d, J=5.5 Hz, 1H), 7.68 (s, 1H), 7.34-7.21 (m, 1H ), 7.11 (d, J=6.4 Hz, 2H), 7.04-6.77 (m, 6H), 4.41-4.13 (m, 2H), 4.09-3, 85 (m, 3H), 3.58 (s, 2H), 3.55-3.44 (m, 1H), 3.44-3.30 (m, 1H), 2.12-1.99 ( m, 1H), 1.95-1.74 (m, 2H), 1.67-1.40 (m, 7H), 1.35 (t, J=7.2 Hz, 3H)

Example 107 )phenoxy)methyl)-phenyl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.18 g, 0.54 mmol) obtained in Synthesis Example 1, and methyl 2-(4- ((4-(2-amino-2-oxoethyl)phenoxy)methyl)phenyl)-2-methylpropanoate (0.18 g, 0.54 mmol) obtained in Synthesis Example 56 was used in the same manner as in Example 34 , obtaining the required product. (Yield: 39%)

^1H -NMR (400 MHz, METHANOL-D4): δ 8.42 (s, 1H), 7.71 (s, 1H), 7.41-7.30 (m, 4H), 7.21 (d , J=8.7 Hz, 2H), 7.18-7.11 (m, 1H), 6.95-6.76 (m, 5H), 5.01 (s, 2H), 4.43- 4.34 (m, 1H), 4.01-3.68 (m, 5H), 3.60 (s, 2H), 3.55-3.49 (m, 1H), 2.08-1, 80 (m, 3H), 1.58-1.45 (m, 7H), 1.24-1.15 (m, 3H)

Example 108. (R)-2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazin-2-yl)amino)- 3-oxopropyl)phenoxy)-2-methylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)-pyrazine (0.050 g, 0.15 mmol) prepared in Synthesis Example 70, and Ethyl 2-(4-(3-amino-3-oxopropyl)phenoxy)-2-methylpropanoate (0.042 g, 0.15 mmol) obtained in Synthesis Example 28 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.57 (s, 1H), 7.85 (s, 1H), 7.69 (dd, J=5.0, 1.4 Hz, 1H ), 7.18 (d, J=5.5 Hz, 1H), 7.08 (d, J=8.2 Hz, 2H), 6.86 (t, J=8.5 Hz, 3H), 6.74 (dd, J=7.8, 5.0 Hz, 1H), 5.19-5.08 (m, 1H), 3.91-3.71 (m, 4H), 3.66- 3.44 (m, 2H), 3.04-2.86 (m, 2H), 2.58 (dd, J=7.3, 5.5 Hz, 2H), 2.08 (dd, J= 9.6, 3.7 Hz, 1H), 2.02-1.87 (m, 2H), 1.68-1.47 (m, 7H), 1.24 (t, J=7.1, 3H)

Example 109 -methylpropanoic acid

(R)-4-chloro-2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.050 g, 0.15 mmol) obtained in Synthesis Example 68, and ethyl 2-(4-(3 -Amino-3-oxopropyl)phenoxy)-2-methylpropanoate (0.042 g, 0.15 mmol) obtained in Synthesis Example 28 was used in the same manner as in Example 34 to obtain the desired product. (Yield: 34%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.19 (d, J=5.9 Hz, 1H), 7.61-7.48 (m, 1H), 7.30-7.20 (m, 1H), 7.11-6.74 (m, 8H), 4.32-4.09 (m, 2H), 4.07-3.86 (m, 3H), 3.68-3 .52 (m, 1H), 3.53-3.19 (m, 1H), 2.92 (t, J=7.3 Hz, 2H), 2.59 (t, J=7.3 Hz, 2H), 2.18-2.04 (m, 1H), 1.98-1.75 (m, 2H), 1.52 (s, 7H), 1.35 (t, J=7.1, 3H)

Example 110 2-yl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.50 g, 1.50 mmol) obtained in Synthesis Example 1, and tert-butyl 3-(4- (1-Amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.48 g, 1.50 mmol) obtained in Synthesis Example 59 was used in the same manner as as in example 72, obtaining the required product. (Yield: 49%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.68 (d, J=10.5 Hz, 1H), 7.80 (s, 1H), 7.29 (d, J=8.2 Hz, 2H), 7.18 (d, J=8.2 Hz, 2H), 7.04 (s, 1H), 6.95-6.72 (m, 4H), 4.21 (t, J =3.0 Hz, 1H), 4.01-3.77 (m, 3H), 3.58 (td, J=9.7, 3.7 Hz, 1H), 3.47 (dd, J= 13.0, 7.5 Hz, 1H), 3.38-3.26 (m, 1H), 2.87 (s, 2H), 2.08-1.96 (m, 1H), 1.96 -1.74 (m, 2H), 1.63 (t, J=6.4 Hz, 6H), 1.56-1.41 (m, 1H), 1.30 (t, J=7.1 Hz, 3H), 1.16 (s, 6H)

Example 111 (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2,2-dimethyl-3- oxopropyl)phenyl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.50 g, 1.50 mmol) obtained in Synthesis Example 1, and methyl 2-(4- (3-amino-2,2-dimethyl-3-oxopropyl)phenyl)-2-methylpropanoate (0.48 g, 1.50 mmol) obtained in Synthesis Example 58 was used in the same manner as in Example 34, with obtaining the required product. (Yield: 54%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.70 (s, 1H), 7.86 (s, 1H), 7.36-7.22 (m, 3H), 7.09 (d , J=8.7 Hz, 2H), 6.97-6.71 (m, 4H), 4.33-4.23 (m, 1H), 4.00-3.82 (m, 3H), 3.70-3.55 (m, 2H), 3.43 (t, J=9.1 Hz, 1H), 2.88 (dd, J=24.2, 13.3 Hz, 2H), 2 .12-1.80 (m, 3H), 1.59-1.47 (m, 7H), 1.35-1.21 (m, 9H)

Example 112 ,2-dimethylpropanoic acid

(R)-4-chloro-2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (1.35 g, 4.04 mmol) obtained in synthesis example 68, and tert-butyl 3-(4- (2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (1.07 g, 3.67 mmol) obtained in Synthesis Example 63 was used in the same manner as Example 72 to obtain the desired product. (Yield: 67%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 8.09 (d, J=5.5 Hz, 1H), 7.29-7.16 (m, 3H), 7.13 (d, J =8.2 Hz, 2H), 7.04-6.74 (m, 4H), 4.39-4.22 (m, 1H), 4.12 (dd, J=13.5, 3.4 Hz, 1H), 4.00-3.81 (m, 3H), 3.75 (kv, J=6.7 Hz, 1H), 3.69-3.55 (m, 3H), 2.82 (s, 2H), 2.11-2.00 (m, 1H), 1.96-1.76 (m, 2H), 1.61-1.42 (m, 1H), 1.32-1 .23 (m, 3H), 1.12 (s, 6H)

Example 113 ,2-dimethylpropanoic acid

(R)-2-chloro-4-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.18 g, 0.54 mmol) obtained in synthesis example 69, and tert-butyl 3-(4- (2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.16 g, 0.54 mmol) obtained in Synthesis Example 63 was used in the same manner as Example 72 to obtain the desired product. (Yield: 59%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 7.77 (d, J=64.5 Hz, 1H), 7.22 (d, J=7.3 Hz, 2H), 7.15 ( d, J=7.8 Hz, 2H), 6.99-6.44 (m, 5H), 4.64 (s, 1H), 4.33-3.31 (m, 8H), 2.83 (s, 2H), 2.10-1.85 (m, 3H), 1.65 (s, 1H), 1.30-1.14 (m, 3H), 1.12 (s, 6H)

Example 114. (R)-3-(4-(2-((4-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrimidin-2-yl)amino)- 2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-4-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidine (0.18 g, 0.54 mmol) obtained in Synthesis Example 66, and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.16 g, 0.54 mmol) obtained in Synthesis Example 63 was used by the same method as in example 72, obtaining the desired product. (Yield: 42%)

¹ H-NMR (400 MHz, METHANOL-D4): δ 8.06-7.51 (m, 2H), 7.29-7.07 (m, 5H), 7.02-6.46 (m, 2H), 5.35 (d, J=44.8 Hz, 1H), 4.65-3.49 (m, 8H), 2.83 (s, 2H), 2.06 (s, 3H), 1.71 (s, 1H), 1.14 (t, J=6.6 Hz, 9H)

Example 115. (R)-3-(4-(2-((2-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrimidin-4-yl)amino)- 2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid

Using (R)-3-ethoxy-2-(piperidin-3-yloxy)pyridine hydrochloride (0.40 g, 1.55 mmol) obtained in step 3 of Synthesis Example 70 and tert-butyl 3-(4-(2- ((2-chloropyrimidin-4-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.62 g, 1.55 mmol) prepared in Synthesis Example 67, using the methods from Step 3 of Example sequentially synthesis 1 and step 2 of example 88 to obtain the desired product. (Yield: 63%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.15 (d, J=5.5 Hz, 1H), 7.74 (dd, J=5.0, 1.4 Hz, 1H), 7.49 (s, 1H), 7.28-7.00 (m, 5H), 6.96 (dd, J=7.5, 1.6 Hz, 1H), 6.82-6.69 ( m, 1H), 5.09 (s, 1H), 4.01-3.47 (m, 8H), 2.99-2.70 (m, 2H), 2.12-1.83 (m, 3H), 1.64-1.56 (m, 1H), 1.33-1.09 (m, 9H)

Example 116. (R)-3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazin-2-yl)amino)- 2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (1.50 g, 4.48 mmol) prepared in Synthesis Example 70, and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (1.31 g, 4.48 mmol) obtained in Synthesis Example 63 was used by the same method as in example 72, obtaining the desired product. (Yield: 52%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.60 (s, 1H), 7.86 (s, 1H), 7.77-7.70 (m, 1H), 7.30 (s , 1H), 7.18 (s, 4H), 6.96 (dd, J=7.8, 1.4 Hz, 1H), 6.78 (dd, J=7.5, 5.3 Hz, 1H), 5.11 (td, J=6.4, 3.2 Hz, 1H), 3.97-3.77 (m, 3H), 3.72 (d, J=12.3 Hz, 1H ), 3.64 (s, 2H), 3.61-3.42 (m, 2H), 2.99-2.89 (m, 1H), 2.82 (d, J=13.3 Hz, 1H), 2.13-1.87 (m, 3H), 1.69-1.53 (m, 1H), 1.27 (t, J=7.1 Hz, 3H), 1.20 (d , J=12.8 Hz, 6H)

Example 117 ]octane-1-carboxylic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.20 g, 0.60 mmol) obtained in Synthesis Example 1, and benzyl (E)-4 -(3-amino-3-oxoprop-1-en-1-yl)bicyclo[2,2,2]octane-1-carboxylate (0.19 g, 0.60 mmol) obtained in Synthesis Example 60 was used using the same method as in example 97 to obtain the desired product. (Yield: 45%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.86 (s, 1H), 7.28 (s, 1H), 6.99-6.82 (m , 4H), 4.36-4.24 (m, 1H), 4.05-3.87 (m, 3H), 3.77-3.65 (m, 1H), 3.60 (sq, J =6.9 Hz, 1H), 3.47-3.35 (m, 1H), 2.27 (t, J=8.5 Hz, 2H), 2.17-2.05 (m, 1H) , 2.01-1.85 (m, 2H), 1.81 (t, J=7.8 Hz, 6H), 1.68-1.50 (m, 3H), 1.42 (t, J =7.8 Hz, 6H), 1.36 (t, J=7.0, 3H)

Example 118 ]octane-1-carboxylic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.50 g, 1.50 mmol) obtained in Synthesis Example 1 and methyl 4-(2- amino-2-oxoethyl)bicyclo[2,2,2]octane-1-carboxylate (0.48 g, 1.50 mmol) obtained in Synthesis Example 61 was used in the same manner as in Example 34 to obtain the required product. (Yield: 47%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.67 (d, J=7.3 Hz, 1H), 7.86 (s, 1H), 7.14 (s, 1H), 7. 00-6.92 (m, 2H), 6.89-6.83 (m, 2H), 4.33-4.24 (m, 1H), 4.05-3.91 (m, 3H), 3.79-3.68 (m, 1H), 3.63 (s, 2H), 3.55 (dd, J=13.3, 7.8 Hz, 1H), 3.44-3.34 ( m, 1H), 2.16-2.07 (m, 1H), 2.02-1.92 (m, 1H), 1.92-1.85 (m, 1H), 1.85-1. 75 (m, 6H), 1.67-1.56 (m, 7H), 1.36 (td, J=6.9, 2.7 Hz, 3H)

Example 119 ]octane-1-carboxylic acid

(R)-4-chloro-2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.20 g, 0.60 mmol) prepared in Synthesis Example 68 and benzyl (E)-4 -(3-amino-3-oxoprop-1-en-1-yl)bicyclo[2,2,2]octane-1-carboxylate (0.19 g, 0.60 mmol) obtained in Synthesis Example 60 was used using the same method as in example 97 to obtain the desired product. (Yield: 24%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.20 (d, J=5.5 Hz, 1H), 7.66 (s, 1H), 7.26 (s, 1H), 7. 01-6.81 (m, 4H), 4.36-4.20 (m, 2H), 4.06-3.88 (m, 3H), 3.58 (dd, J=12.8, 7 .8 Hz, 1H), 3.50-3.39 (m, 1H), 2.29-2.17 (m, 2H), 2.11 (kV, J=4.9 Hz, 1H), 1 .97-1.82 (m, 2H), 1.82-1.72 (m, 6H), 1.60-1.47 (m, 3H), 1.46-1.30 (m, 9H)

Example 120 )bicyclo[2,2,2]-octane-1-carboxylic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (0.20 g, 0.60 mmol) prepared in Synthesis Example 70, and benzyl (E)-4-(3-amino-3-oxoprop-1-en-1-yl)bicyclo[2,2,2]octane-1-carboxylate (0.19 g, 0.60 mmol), obtained in Synthesis Example 60 was used in the same manner as in Example 97 to obtain the desired product. (Yield: 41%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.60 (s, 1H), 7.88 (s, 1H), 7.71 (sq, J=2.3 Hz, 1H), 7. 21 (s, 1H), 7.03-6.94 (m, 1H), 6.79 (dd, J=7.5, 4.8 Hz, 1H), 5.23-5.12 (m, 1H), 4.00-3.76 (m, 4H), 3.75-3.69 (m, 1H), 3.56-3.44 (m, 1H), 2.24 (t, J= 8.2 Hz, 2H), 2.15 (kvd, J=9.2, 4.5 Hz, 1H), 2.02-1.90 (m, 2H), 1.87-1.73 (m , 6H), 1.70-1.59 (m, 1H), 1.58-1.49 (m, 2H), 1.45-1.39 (m, 6H), 1.31 (t, J =6.8 Hz, 3H)

Example 121 -yl)bicyclo[2,2,2]octane-1-carboxylic acid

The title compound was obtained as a by-product during the synthesis of Example 117.

¹ H-NMR (400 MHz, CHLOROFORM-D): 8.72 (s, 1H), 7.88 (d, J=7.8 Hz, 1H), 6.99-6.90 (m, 3H) , 6.90-6.81 (m, 3H), 5.74 (d, J=15.6 Hz, 1H), 4.37-4.27 (m, 1H), 4.03-3.86 (m, 3H), 3.75-3.67 (m, 1H), 3.63 (kv, J=6.9 Hz, 1H), 3.49-3.38 (m, 1H), 2, 16-2.05 (m, 1H), 2.02-1.77 (m, 7H), 1.70-1.53 (m, 8H), 1.34 (t, J=7.0, 3H )

Example 122 -methylpropanoic acid

(R)-4-chloro-2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.20 g, 0.60 mmol) prepared in Synthesis Example 68 and benzyl (E)-2 -(4-(3-amino-3-oxoprop-1-en-1-yl)phenyl)-2-methylpropanoate (0.19 g, 0.60 mmol) obtained in Synthesis Example 65 was used in the same manner as as in example 97, obtaining the desired product. (Yield: 28%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.23-8.17 (m, 1H), 7.69 (d, J=11.4 Hz, 1H), 7.35-7.26 (m, 3H), 7.15 (d, J=8.2 Hz, 2H), 6.99-6.77 (m, 4H), 4.30-4.18 (m, 2H), 4, 03-3.85 (m, 3H), 3.59 (dd, J=13.7, 8.2 Hz, 1H), 3.52-3.41 (m, 1H), 2.96 (t, J=7.5 Hz, 2H), 2.61 (t, J=7.8 Hz, 2H), 2.14-2.04 (m, 1H), 1.95-1.79 (m, 2H ), 1.60-1.44 (m, 7H), 1.32 (t, J=6.9 Hz, 3H)

Example 123. (R)-2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazin-2-yl)amino)- 3-oxopropyl)phenyl)-2-methylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (0.20 g, 0.60 mmol) prepared in Synthesis Example 70, and benzyl (E)-2-(4-(3-amino-3-oxoprop-1-en-1-yl)phenyl)-2-methylpropanoate (0.19 g, 0.60 mmol) obtained in the synthesis example 65 was used in the same manner as in Example 97 to obtain the desired product. (Yield: 47%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.60 (s, 1H), 7.86 (s, 1H), 7.69 (dd, J=5.0, 1.4 Hz, 1H ), 7.32 (d, J=8.2 Hz, 2H), 7.24-7.13 (m, 3H), 6.84 (dd, J=8.0, 1.6 Hz, 1H) , 6.73 (dd, J=7.8, 5.0 Hz, 1H), 5.19-5.08 (m, 1H), 3.95-3.70 (m, 4H), 3.66 -3.55 (m, 1H), 3.55-3.44 (m, 1H), 3.07-2.89 (m, 2H), 2.60 (dt, J=20.4, 7. 3 Hz, 2H), 2.15-2.04 (m, 1H), 2.01-1.87 (m, 2H), 1.68-1.50 (m, 7H), 1.24 (t , J=7.1 Hz, 3H)

Example 124 2-yl)phenyl)-2,2-dimethylpropanoic acid

(R)-4-chloro-2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidine (0.10 g, 0.30 mmol) obtained in synthesis example 68, and tert-butyl 3-(4- (1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.096 g, 0.30 mmol) obtained in Synthesis Example 59 was used in the same manner as in Example 72 , obtaining the required product. (Yield: 60%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.18 (d, J=5.9 Hz, 1H), 7.36-7.26 (m, 3H), 7.22-7.07 (m, 3H), 6.97-6.75 (m, 4H), 4.29 (d, J=12.8 Hz, 1H), 4.21-4.11 (m, 1H), 4, 06-3.88 (m, 3H), 3.40 (d, J=5.0 Hz, 2H), 2.87 (dd, J=22.4, 13.3 Hz, 2H), 2.12 -2.04 (m, 1H), 1.91-1.72 (m, 2H), 1.61 (s, 6H), 1.47 (dd, J=9.4, 3.9 Hz, 1H ), 1.32 (t, J=6.9 Hz, 3H), 1.18 (d, J=3.7 Hz, 6H)

Example 125. (R)-3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazin-2-yl)amino)- 2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 70, and tert-butyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.095 g, 0.30 mmol) obtained in Synthesis Example 59 was used as follows the same method as in example 72, obtaining the desired product. (Yield: 77%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.61 (s, 1H), 7.82 (s, 1H), 7.75-7.67 (m, 1H), 7.28 (d , J=8.7 Hz, 2H), 7.23-7.11 (m, 2H), 6.95 (dd, J=8.0, 1.1 Hz, 1H), 6.87 (s, 1H), 6.78 (dd, J=7.8, 5.0 Hz, 1H), 5.14-5.02 (m, 1H), 3.95-3.65 (m, 4H), 3 .59-3.37 (m, 2H), 3.00-2.75 (m, 2H), 2.05 (t, J=4.1 Hz, 1H), 2.00-1.84 (m , 2H), 1.59 (dd, J=18.3, 2.7 Hz, 7H), 1.34-1.25 (m, 3H), 1.23-1.12 (m, 6H)

Example 126 -2-yl)-phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazine (0.080 g, 0.22 mmol) obtained in Synthesis Example 57, and tert-butyl 3-(4-( 1-Amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.071 g, 0.22 mmol) obtained in Synthesis Example 59 was used in the same manner as in Example 72. to obtain the required product. (Yield: 62%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.69 (s, 1H), 7.80 (s, 1H), 7.29 (d, J=8.2 Hz, 2H), 7. 18 (d, J=8.2 Hz, 2H), 7.04 (s, 1H), 6.91-6.81 (m, 2H), 6.81-6.72 (m, 1H), 6 .72-6.63 (m, 1H), 4.58-4.43 (m, 1H), 4.25-4.14 (m, 1H), 3.90 (dd, J=13.3, 2.7 Hz, 1H), 3.67-3.54 (m, 1H), 3.43 (dd, J=13.0, 7.5 Hz, 1H), 3.36-3.20 (m , 1H), 2.87 (dd, J=15.1, 13.3 Hz, 2H), 2.42-2.26 (m, 2H), 2.16-2.03 (m, 3H), 1.97-1.68 (m, 3H), 1.67-1.40 (m, 8H), 1.20-1.09 (m, 6H)

Example 127 ,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 1, and tert-butyl 3-(3- (3-Amino-3-oxopropyl)phenyl)-2,2-dimethylpropanoate (0.091 g, 0.30 mmol) obtained in Synthesis Example 62 was used in the same manner as Example 72 to obtain the desired product. (Yield: 61%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.64 (s, 1H), 7.84 (s, 1H), 7.66 (s, 1H), 7.15 (t, J=8 .0 Hz, 1H), 7.03 (d, J=6.9 Hz, 2H), 6.98 (d, J=7.3 Hz, 1H), 6.94-6.87 (m, 2H ), 6.87-6.76 (m, 2H), 4.27 (td, J=7.2, 3.5 Hz, 1H), 4.00-3.83 (m, 3H), 3, 69-3.51 (m, 2H), 3.45-3.32 (m, 1H), 2.95 (t, J=7.5 Hz, 2H), 2.83 (s, 2H), 2 .59 (t, J=7.8 Hz, 2H), 2.10-2.00 (m, 1H), 2.00-1.80 (m, 2H), 1.53 (td, J=8 .5, 4.3 Hz, 1H), 1.31 (t, J=7.1 Hz, 3H), 1.16 (s, 6H)

Example 128. (R)-3-(3-(3-((6-(3-((3-ethoxypyridin-2-yl)-oxy)piperidin-1-yl)pyrazin-2-yl)amino)- 3-oxopropyl)phenyl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazine (0.10 g, 0.30 mmol) obtained in Synthesis Example 70, and tert-butyl 3-(3-(3-amino-3-oxopropyl)phenyl)-2,2-dimethylpropanoate (0.091 g, 0.30 mmol) obtained in Synthesis Example 62 was used by the same method as in Example 72, obtaining the required product. (Yield: 58%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.58 (s, 1H), 7.86 (s, 1H), 7.73 (dd, J=5.0, 1.4 Hz, 2H ), 7.15 (t, J=7.5 Hz, 1H), 7.04 (d, J=9.1 Hz, 2H), 7.00-6.90 (m, 2H), 6.80 (dd, J=7.8, 5.0 Hz, 1H), 5.20-5.11 (m, 1H), 3.97-3.72 (m, 4H), 3.71-3.60 (m, 1H), 3.56-3.42 (m, 1H), 2.96 (t, J=7.1 Hz, 2H), 2.82 (dd, J=19.2, 13.3 Hz, 2H), 2.62 (t, J=7.3 Hz, 2H), 2.19-2.07 (m, 1H), 2.02-1.90 (m, 2H), 1.71 -1.55 (m, 1H), 1.28 (t, J=7.1 Hz, 3H), 1.17 (s, 3H), 1.14 (s, 3H)

Example 129 -yl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.029 g, 0.086 mmol) prepared in Synthesis Example 1, and tert-butyl 3-(3′-(chlorocarbonyl) -[1,1′-biphenyl]-3-yl)-2,2-dimethylpropanoate (0.034 g, 0.095 mmol) obtained in Synthesis Example 79 was used in the same manner as Example 72 to obtain the desired product . (Yield: 55%)

^1H -NMR (400 MHz, CHLOROFORM-D): δ 8.80 (s, 1H), 8.09-7.93 (m, 2H), 7.86 (s, 1H), 7.77 (dd , J=30.2, 8.2 Hz, 2H), 7.59-7.41 (m, 3H), 7.35 (t, J=7.5 Hz, 1H), 7.22-7, 11 (1H), 7.01-6.87 (m, 1H), 6.87-6.70 (m, 3H), 4.31 (td, J=7.1, 3.5 Hz, 1H) , 4.03-3.79 (m, 3H), 3.77-3.56 (m, 2H), 3.52-3.32 (m, 1H), 2.96 (s, 2H), 2 .17-2.04 (m, 1H), 2.01-1.79 (m, 2H), 1.56 (kvd, J=8.5, 4.2 Hz, 1H), 1.32 (t , J=7.1 Hz, 3H), 1.24-1.06 (m, 6H)

Example 130 -yl)-2,2-dimethylpropanoic acid

(R)-2-chloro-6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazine (0.052 g, 0.154 mmol) obtained in Synthesis Example 1, and tert-butyl 3-(3'-(chlorocarbonyl) -[1,1'-Biphenyl]-4-yl)-2,2-dimethylpropanoate (0.060 g, 0.170 mmol) obtained in Synthesis Example 80 was used in the same manner as Example 72 to obtain the desired product . (Yield: 69%)

¹ H-NMR (400 MHz, CHLOROFORM-D): δ 8.86 (s, 1H), 8.08 (d, J=12.3 Hz, 2H), 7.93 (s, 1H), 7. 78 (dd, J=22.0, 7.8 Hz, 2H), 7.62-7.43 (m, 3H), 7.29 (d, J=8.2 Hz, 2H), 7.03 -6.89 (m, 1H), 6.88-6.72 (3H), 4.41-4.23 (m, 1H), 4.04-3.80 (m, 3H), 3.69 (kv, J=6.7 Hz, 2H), 3.57-3.37 (m, 1H), 2.97 (d, J=8.7 Hz, 2H), 2.18-2.05 ( m, 1H), 2.03-1.81 (m, 2H), 1.58 (kvd, J=8.4, 4.5 Hz, 1H), 1.33 (t, J=7.1 Hz , 3H), 1.26 (s, 6H)

Example of a biological activity test. Measurement of inhibitory effect on DGAT2 enzymatic activity

The inhibitory effect on the enzymatic activity of DGAT2 was examined by performing the following experiment using the compounds of formula (1) of the present invention.

1. Preparation of DGAT2 expression vector

To generate pBacPAK9-DGAT2, which is a DGAT2 expression vector, the polymerase chain reaction (PCR)-amplified human DGAT2 gene was cloned into the EcoR1 and Xho1 sites of the pBacPAK9 vector (Clonctech). The nucleotide sequence of the primers used in PCR were forward primer 5′ CTATAAATACGGATCCCGGGAATTCATGGACTACAAGGACGACGATGACAAGCTTAAGACCCTCATAGCCGCC and reverse primer 5′ TAAGCGGCCGCCCTGCAGGCCTCGAGTCAGTTCACCTCCAGGAC. The reaction solution composition included 50 ng cDNA clone (OriGene), 200 μM dATP, dCTP, dTTP, dGTP, 200 nM each primer, 1 unit Tag DNA polymerase (Toyobo), 1x PCR buffer, and the final volume was adjusted to 20 μl. The reaction mixture was denatured at 95°C for 5 minutes, then 30 times at 94°C for 20 seconds, at 60°C for 20 seconds, and at 72°C for 90 seconds, then further reacted at 72°C C for 7 minutes.

2. DGAT2 Expression and Membrane Protein Preparation

Recombinant human DGAT2 protein was expressed in Sf-21 cells, which are insect cells, using the BacPack baculovirus expression system (Clontech). Briefly, the preparation process is carried out as follows. First, the pBacPAK9-DGAT2 expression vector was transfected with BacPAK6 virus DNA (Bsu36I digestion) in sf21 cells using a transfection reagent to obtain recombinant DGAT2 basilovirus expression. The thus obtained bacillovirus was infected with Sf-21 cells at 10 MOI (multiplicity of infection), and after 72 hours, the infected insect cells were collected and membrane proteins were isolated. To separate membrane proteins, the cell conglomerate was dissolved in a sucrose solution containing 250 mM sucrose, 10 mM Tris (pH 7.4) and 1 mM ethylenediaminetetraacetic acid (EDTA), and then homogenized using a Dounce homogenizer, and the resulting supernatant centrifugation at 600×g for 15 minutes, then centrifuged at 100,000×g for 1 hour, and the supernatant was discarded and the remaining pellet was resuspended in 20 mM HEPES buffer (pH 7.4). The resulting membrane protein overexpressing DGAT2 was transferred into 100 μl and stored at -80°C until use. Protein concentration was determined using the BCA Protein Assay Kit (Thermo Scientific).

3. Measurement of inhibitory effect on DGAT2 enzymatic activity

In vitro analysis of DGAT2 was performed using a phospholipid-coated plate (Phospholipid Flash Plate (PerkinElmer)) based on the SPA (scintillation non-contact assay) principle. First, DGAT2 inhibitory compounds were serially diluted 5-fold from 3 nM to 10 μM (final concentration, 1% DMSO), mixed in a buffer solution containing 2 μg DGAT2 membrane protein and 20 mM HEPES, 20 mM MgCl ₂ , 1 mg/ml BSA, 50 µM 1,2 sn-oleoylglycerol (Sigma) was placed in a 96-well coated plate (FlashPlate) and reacted at 37°C for 20 minutes, and then 1 µM [ ¹⁴ C]ole was added oil CoA (PerkinElmer, NEC651050UC) to adjust the final volume to 100 μl, and further reacted at 37°C for 15 minutes. After completion of the enzymatic reaction, 100 μl of isopropanol was added, the plate was sealed with film, and the plate was shaken slowly on a plate shaker. The next day, the amplified scintillation signal (cpm) was measured using a Topcounter scintillation counter (Packard) to determine the extent of production of [ ¹⁴ C]-labeled triacylglycerol (TG) as a reaction product. The measured value in the case of no treatment with the compound was used as a positive control, and the measured value in the case of treatment with the compound was calculated as a relative % to measure the inhibitory effect of the compound on TG production. The IC ₅₀ value, which is the concentration of a compound that inhibits TG production by 50%, was determined by applying a nonlinear regression curve to the effect size versus compound concentration using PRISM software (Graphpad Inc.).

The specific IC ₅₀ values obtained by measuring the inhibitory effect of the compound of formula (1) on the enzymatic activity of DGAT2 for examples of individual compounds are shown in Table 1 below.

Table 1

Example IC ₅₀ (µM) Example IC ₅₀ (µM) Example IC ₅₀ (µM) Example IC ₅₀ (µM) 1 0.045 34 1.10 67 6.1 100 0.59 2 16 35 0.03 68 0.63 101 0.32 3 2.3 36 0.012 69 0.97 102 0.45 4 1.6 37 0.46 70 0.35 103 0.62 5 51 38 0.2 71 0.25 104 0.66 6 0.053 39 0.77 72 1.8 105 0.09 7 0.045 40 0.16 73 0.31 106 0.73 8 0.23 41 3.1 74 1.3 107 0.07 9 0.09 42 1.3 75 1.2 108 0.078 10 0.019 43 0.33 76 0.13 109 1.1 eleven 16 44 0.17 77 0.41 110 0.076 12 4 45 0.15 78 2.5 111 0.69 13 9.1 46 0.51 79 0.93 112 0.06 14 12 47 0.31 80 1.3 113 0.15 15 0.025 48 0.71 81 0.74 114 0.14 16 0.39 49 0.10 82 6.8 115 0.14 17 0.01 50 0.0096 83 >10 116 0.038 18 0.008 51 0.033 84 >10 117 0.14 19 ~15 52 0.066 85 0.042 118 0.17 20 4 53 0.39 86 >10 119 1.2 21 4.8 54 0.088 87 0.16 120 0.25 22 1.3 55 0.28 88 6.2 121 0.098 23 7.4 56 0.82 89 0.59 122 0.06 24 0.3 57 5.3 90 >10 123 0.035 25 1.8 58 7.5 91 0.37 124 0.33 26 0.054 59 1 92 >10 125 0.035 27 0.049 60 0.42 93 0.19 126 3.8 28 0.032 61 0.15 94 0.11 127 0.083 29 0.018 62 2.1 95 0.15 128 0.1 thirty 0.029 63 0.14 96 0.2 129 0.54 31 0.18 64 0.12 97 0.059 130 0.38 32 6.9 65 0.035 98 0.081 33 4.5 66 2.7 99 2.9

Claims (147)

1. A compound of the following formula (1) or a pharmaceutically acceptable salt or stereoisomer thereof: Formula 1) , where A, B and E are each independently CH and N; D is N, CH or C-halo-C ₁ -C ₇ alkyl; R ₁ represents C ₁ -C ₇ alkyl, C ₃ -C ₁₀ cycloalkyl or halogen-C ₁ -C ₇ alkyl; R ₂ represents hydrogen or C ₁ -C ₇ alkyl; R ₃ represents -GJL; where G represents -NH- or a direct chemical bond; J represents C ₁ -C ₇ alkylene, C ₂ -C ₇ alkenylene, C ₁ -C ₇ alkylene-C ₆ -C ₁₀ arylene, C ₁ -C ₇ alkylene-amino-C ₆ -C ₁₀ arylene, C ₁ - C ₇ alkylene-C ₆ -C ₁₀ -aryloxylene-C ₁ -C ₇ alkylene, C ₁ -C ₇ alkylene-C ₃ -C ₁₀ cycloalkyl, C ₂ -C ₇ alkenylene-C ₃ -C ₁₀ cycloalkyl, C ₁ - C ₇ alkoxylene-C ₆ -C ₁₀ arylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₀ cycloalkyl, C ₆ -C ₁₀ arylene-C ₁ -C ₇ alkylene, 5-12-membered heterocycloalkylene, 5-12- membered heterocycloalkylene-C ₆ -C ₁₀ arylene or 5-12 membered heterocycloalkylene-5-12 membered heteroarylene; L represents hydrogen, halogen, nitro, carboxy (-COOH), aminocarbonyl-C ₁ -C ₇ alkyl, carboxy-C ₁ -C ₇ alkyl, carboxy-C ₁ -C ₇ alkoxy, carboxy-C ₁ -C ₇ alkyl -C ₆ -C ₁₀ aryl, C ₃ -C ₁₀ cycloalkyl, C6-C10 aryl, C ₆ -C ₁₀ aryloxy, 5-12 membered heterocycloalkyl or 5-12 membered heteroaryl; or R ₂ and R ₃ together with the nitrogen atom to which they are attached can form a 5-12 membered heterocycloalkyl; wherein alkyl, alkylene, alkylene-arylene, alkenyl, alkenylene, cycloalkyl, carboxyalkyl, carboxyalkoxy, alkoxyalkyl, aminocarbonyl, aryl, aryl-alkyl, arylene, aryloxy, heterocycloalkyl or heteroaryl is optionally substituted with 1-4 substituents selected from hydroxy, halogen , oxo, nitro, -COOH, -CH ₂ COOH, C ₁ -C ₇ alkyl, methylidene, C ₂ -C ₇ alkenyl, C ₁ -C ₇ alkoxy, halogen-C ₁ -C ₇ alkyl, C ₁ -C ₇ alkylsulfonyl, C ₁ -C ₇ alkylcarbonyl, C ₁ -C ₇ alkoxycarbonyl and 5-12 membered heteroaryl-C ₁ -C ₇ alkyl; And heterocycloalkylene, heterocycloalkyl, heteroarylene or heteroaryl contains from 1 to 5 heteroatoms selected from N, O and S. 2. A compound or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the compound is selected from the following group: (R)-1-(3,5-bis(trifluoromethyl)phenyl)-3-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)urea; ((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)-L-phenylalanine; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-morpholine-4-carboxamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-pyrrolidin-1-carboxamide; 1-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)pyrrolidine-3-carboxylic acid; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-benzamide; (R)-4-chloro-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)benzamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3-methoxybenzamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-4-methoxybenzamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-4-nitrobenzamide; (R)-2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)benzoic acid; (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)acetic acid; (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenyl)-2-methylpropanoic acid; (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenoxy)-2-methylpropanoic acid; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-1-(methylsulfonyl)piperidine)-4-carboxamide; (R)-1-acetyl-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)piperidine)-4-carboxamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-1-(isopropylsulfonyl)piperidine-4-carboxamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-1-(5-ethylpyrimidin-2-yl)piperidin-4-carboxamide; (R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-4-oxobutanoic acid; (1R)-2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)cyclopentane-1-carboxylic acid; (R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-carbamoyl)bicyclo[2,2,2]octane-1-carboxylic acid; (R)-4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-2,2-dimethyl-4-oxobutanoic acid; (R)-1-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3,3-dimethylpyrrolidine-2,5-dione; (R)-5-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-2,2-dimethyl-5-oxopentanoic acid; (R)-5-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-amino)-3,3-dimethyl-5-oxopentanoic acid; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-(3-trifluoromethyl)phenyl)acetamide; (R)-2-(3,5-bis(trifluoromethyl)phenyl)-N-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-phenylacetamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3-phenylpropanamide; (R)-2-(3-chlorophenyl)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-methyl-2-phenylpropanamide; (R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid; (R)-3-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)benzoic acid; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid; (R)-2-(4-(2-amino-2-oxoethyl)phenyl-N-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)acetamide; (R)-N-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-2-(4-hydroxyphenyl)acetamide; (R)-4-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy)butanoic acid; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino-2-oxoethyl)phenoxy)-2-methylpropanoic acid; (R)-2-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl )phenyl)-2-methylpropanoic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid; (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1-en-1-yl) benzoic acid; (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxoprop-1-ene- 1-yl)benzoic acid; 4-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-3-oxopropyl)benzoic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-fluorobenzoic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-methylbenzoic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2-methoxybenzoic acid; (R)-2-chloro-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid; (R)-3-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid; (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid; (R)-3-(4-(2-amino-2-oxoethyl)phenyl-N-(6-(3-(2-ethoxy-phenoxy)piperidin-1-yl)pyrazin-2-yl)propanamide; (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid ; (R)-1-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)cyclopropane-1-carboxylic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2,6-difluorobenzoic acid; (R)-2,6-dichloro-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)benzoic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)-2,6-dimethylbenzoic acid; (R)-1-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)piperidine-4-carboxylic acid; (R)-1-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl-2,6-difluorophenyl)piperidine-4-carboxylic acid; (R)-2-(1-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl-2,6-difluorophenyl)piperidin-4-yl) acetic acid; (R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)benzoic acid; (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid ; (R)-3-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)propanoic acid; (R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)phenoxy)benzoic acid; (R)-3-(4-(3-((6-(R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)- 2-methylpropanoic acid; (S)-3-(4-(3-((6-(R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)- 2-methylpropanoic acid; (R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2- dimethylpropanoic acid; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid; (R)-2-(4-(3-(6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)ureido)phenyl)acetic acid; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridin-2-yl)amino)-2-oxoethyl)phenyl)-2-methylpropanoic acid ; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2-methylpropanoic acid ; (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid ; (R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyridin-2-yl)amino-2-oxoethyl)phenyl)-2,2-dimethylpropane acid; (R)-3-(4-(2-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-6-(tri-fluoromethyl)pyrimidin-2-yl)amino-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid; (R)-3-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl )phenyl)propanoic acid; (R)-3-(4-((2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)allyl)amino)phenyl)propanoic acid; (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)pyrimidin-5-carboxylic acid; 3-(3-((R)-3-((6-((R)-3-((3-ethoxypyridin-2-yl)oxy)-piperidin-1-yl)pyrazin-2-yl)carbamoyl) piperidin-1-yl)phenyl-2,2-dimethylpropanoic acid; (R)-3-(4-(1-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid; (R)-3-(4-(1-((4-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidin-2-yl)amino)-2-methyl- 1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid; (R)-2-(4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)phenyl)acetic acid; (R)-2-(4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)phenyl)-2-methylpropane acid; (R)-2-(6-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)pyridin-3-yl) -2-methylpropanoic acid; (R)-2-(5-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)-2H-tetrazol-2 -yl)acetic acid; (R)-4-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)-4-oxobutanoic acid; (R)-2-(4-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)piperidin-1-yl)acetic acid; 3-(3-((R)-3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)carbamoyl)piperidin-1-yl)phenyl )-2,2-dimethylpropanoic acid; (R)-1-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl )phenyl)piperidine-4-carboxylic acid; 6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)pyrrolidin-1-yl)nicotinic acid; N-(6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)-3-methylpyrrolidine-3-carboxamide; 6-(3-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-3-methylpyrrolidin-1-yl)nicotinic acid; (R)-2-(4-(2-((6-(3-(2-isopropoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid; (R)-2-(4-(3-((6-(3-(2-methoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid; (R)-2-methyl-2-(4-(3-oxo-3-((6-(3-(2-(trifluoromethoxy)phenoxy)piperidin-1-yl)pyrazin-2-yl)amino) propyl)phenyl)propanoic acid; (R)-2-(4-(3-((6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl) -2-methylpropanoic acid; (R)-3-(4-(2-((6-(3-(2-(2-fluoroethoxy)phenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl) -2,2-dimethylpropanoic acid; (R)-3-(4-(2-((6-(3-(2-cyclopropoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid; (R)-3-(4-(2-((6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid; (R)-2-(4-(3-((6-(3-(2-cyclopropoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid; (R)-2-(4-(3-((6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid ; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino-2-oxoethyl)phenoxy)acetic acid; (R)-2-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethoxy)phenyl)acetic acid; 2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethoxy)phenyl)propanoic acid; (R)-3-(4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy-2,2-dimethylpropane acid; (R)-2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy) propanoic acid; (S)-2-(4-(2-((6-((R)-3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy) propanoic acid; (R)-2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl) phenoxy)-2-methylpropanoic acid; (R)-2-(4-(2-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-2-oxoethyl)phenoxy)-2-methylpropane acid; (R)-2-(4-((4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-oxoethyl)phenoxy) methyl)phenyl)-2-methylpropanoic acid; (R)-2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) phenoxy)-2-methylpropanoic acid; (R)-2-(4-(3-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropane acid; (R)-3-(4-(1-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl )phenyl)-2,2-dimethylpropanoic acid; (R)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2,2-dimethyl-3-oxopropyl)phenyl )-2-methylpropanoic acid; (R)-3-(4-(2-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid; (R)-3-(4-(2-((4-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-2-yl)amino)-2-oxoethyl)phenyl)-2,2 -dimethylpropanoic acid; (R)-3-(4-(2-((4-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidin-2-yl)amino)-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid; (R)-3-(4-(2-((2-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid; (R)-3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl) phenyl)-2,2-dimethylpropanoic acid; (R)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)bicyclo[2,2,2]octane- 1-carboxylic acid; (R)-4-(2-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-oxoethyl)bicyclo[2,2,2]octane- 1-carboxylic acid; (R)-4-(3-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-3-oxopropyl)bicyclo[2,2,2]octane- 1-carboxylic acid; (R)-4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)-pyrazin-2-yl)amino)-3-oxopropyl)bicyclo[ 2,2,2]octane-1-carboxylic acid; (R, E)-4-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxoprop-1-en-1-yl) bicyclo[2,2,2]octane-1-carboxylic acid; (R)-2-(4-(3-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-3-oxopropyl)phenyl)-2-methylpropane acid (R)-2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) phenyl)-2-methylpropanoic acid; (R)-3-(4-(1-((2-(3-(2-ethoxyphenoxy)piperidin-1-yl)-pyrimidin-4-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid; (R)-3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-2-methyl- 1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid; (R)-3-(4-(1-((6-(3-(2-cyclobutoxyphenoxy)piperidin-1-yl)-pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2- yl)phenyl)-2,2-dimethylpropanoic acid; (R)-3-(3-(3-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2,2- dimethylpropanoic acid; (R)-3-(3-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)piperidin-1-yl)pyrazin-2-yl)amino)-3-oxopropyl) phenyl)-2,2-dimethylpropanoic acid; (R)-3-(3'-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-[1,1'-biphenyl]-3-yl) -2,2-dimethylpropanoic acid; And (R)-3-(3'-((6-(3-(2-ethoxyphenoxy)piperidin-1-yl)pyrazin-2-yl)carbamoyl)-[1,1'-biphenyl]-4-yl) -2,2-dimethylpropanoic acid. 3. A pharmaceutical composition having an inhibitory effect on diacylglycerol O-acyltransferase 2 (DGAT2), comprising a compound of formula (1) or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1 or 2 as an active ingredient together with a pharmaceutically acceptable carrier. 4. A pharmaceutical composition for the treatment of diseases associated with DGAT2 selected from the group consisting of fatty liver disease, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), diabetes, obesity, hyperlipidemia, atherosclerosis and hypercholesterolemia, where the composition includes a compound of the formula (1) or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1 or 2 as an active ingredient together with a pharmaceutically acceptable carrier.