RU2809724C2 - Synthetic oncolytic lnp replicon rna and its use for cancer immunotherapy - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following is described: a group of inventions including a synthetic oncolytic virus, a pharmaceutical composition for the treatment of a malignant tumor (variants), and a method of treating a malignant tumor in a subject in need. The synthetic oncolytic virus has a lipid nanoparticle containing N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3) and a self-amplifying RNA replicon containing the sequence encoding the interleukin (IL)-molecule 12.

EFFECT: invention expands the arsenal of agents aimed at treating a malignant tumor in a subject in need.

17 cl, 5 dwg, 1 tbl, 5 ex

Description

RELATED APPLICATIONS

This patent application under 35 U.S.C. § 119(e) claims benefit from U.S. Provisional Patent Application Serial No. 62/815611, filed March 8, 2019, the entire contents of which are incorporated herein by reference.

BACKGROUND OF THE INVENTION

The present invention relates to synthetic oncolytic viruses containing a lipid nanoparticle containing one or more types of lipids and a self-amplifying RNA replicon containing a sequence encoding an immunomodulatory molecule.

SUMMARY OF THE INVENTION

The present invention is based, at least in part, on the unexpected discovery that when injected into a tumor site, a synthetic oncolytic virus successfully triggers an anticancer immune response in local tumors and provides systemic immunity against distant tumors.

Accordingly, in one aspect, the present invention provides a synthetic oncolytic virus comprising a lipid nanoparticle containing one or more types of lipids and a self-amplifying RNA replicon containing a sequence encoding an interleukin (IL)-12 molecule. The lipid nanoparticle is capable of triggering immunogenic cell death. The IL-12 molecule is expressed through a self-amplifying RNA replicon.

The synthetic oncolytic virus contains a lipid nanoparticle. A lipid nanoparticle contains one or more types of lipids. In some embodiments, the one or more types of lipids comprise a cationic lipid. In some embodiments, the cationic lipid is N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3). In some embodiments, the lipid nanoparticle contains TT3, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and C14-PEG2000.

In addition, the synthetic oncolytic virus contains a self-amplifying RNA replicon. In some embodiments, the RNA self-amplicon is derived from an alphavirus or other group IV viruses (single positive-strand RNA viruses, such as hepatitis C virus (HCV)). In some embodiments, the alphavirus may be Venezuelan equine encephalitis virus, Semliki Forest virus, or Sindbis virus.

In some embodiments, the self-amplifying replicon RNA comprises a sequence encoding an IL-12 molecule. In some embodiments, the sequence encoding the IL-12 molecule is located in a subgenomic region of the self-amplifying RNA replicon.

In some embodiments, the self-amplifying RNA replicon contains a nucleotide sequence that is at least 90% identical to a wild-type (WT) RNA replicon having the sequence of SEQ ID NO: 1. In some embodiments, the self-amplifying RNA replicon is not identical to SEQ ID NO: 1 and is capable of expressing an IL-12 molecule at a higher level compared to the self-amplifying RNA replicon comprising SEQ ID NO: 1. In some embodiments, an RNA replicon that is capable of expressing an IL-12 molecule at a higher level level, contains point mutations G3936C and/or A4758G from SEQ ID NO: 1.

In some embodiments, the self-amplifying replicon RNA further comprises a sequence encoding serum albumin. In some embodiments, the self-amplifying replicon RNA further comprises a lumican coding sequence.

In some aspects, the self-amplifying replicon RNA comprises a sequence encoding an IL-12 molecule. In some embodiments, the IL-12 molecule is selected from the group consisting of IL-12, an IL-12 subunit, or a mutant IL-12 molecule retaining immunomodulatory function. In some further embodiments, the IL-12 molecule comprises IL12α and/or IL12β subunits.

In some embodiments, the lipid nanoparticle has a diameter of approximately 100-120 nm. In some embodiments, the lipid nanoparticle has a zeta potential of approximately 3-6 mV.

In some embodiments, the lipid and the self-amplifying replicon RNA have a weight ratio of about 1:2 to 2:1.

The present invention, at least in part, relates to a pharmaceutical composition containing a synthetic oncolytic virus and a pharmaceutically acceptable carrier.

In some embodiments, the pharmaceutical composition is formulated for intratumoral injection.

The present invention, at least in part, relates to a method of treating a malignant tumor in a subject in need thereof, comprising administering to the subject an effective amount of any of the synthetic oncolytic viruses or a pharmaceutical composition containing the synthetic oncolytic virus.

In some embodiments, the subject is a human patient who has or is suspected of having a cancer. Exemplary target malignancies include, but are not limited to, melanoma, breast cancer, and colorectal cancer.

In some embodiments, the pharmaceutical composition is administered to a subject in a single dose. In some embodiments, the pharmaceutical composition is administered to a subject via intratumoral injection.

The present invention also relates to any of the synthetic oncolytic virus-containing pharmaceutical compositions described herein for use in the treatment of any of the target diseases described herein (eg, cancer), as well as pharmaceutical compositions containing the synthetic oncolytic oligonucleotide , for use in the manufacture of a medicinal product for the treatment of a malignant tumor.

Details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will become apparent from the following drawings and detailed description of several embodiments, as well as from the accompanying claims.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A-1H are graphs showing the effects on B16F10 cells transfected with DOTAP, Lipofectamine (Lipo), TT3 nanoparticle (TT3), mutant replicon RNA (RNA), DOTAP, Lipo and TT3 nanoparticle encapsulating the mutant replicon RNA (DOTAP-mtRep, Lipo-mtRep, and TT3-mtRep), electroporation (Electro), and electroporation using mutant RNA replicon (Electro-mtRep). FIG. 1A is a graph showing the viability of B16F10 cells 3 days after transfection. FIG. 1B is a graph showing GFP expression in B16F10 cells transfected with a lipid nanoparticle encapsulating mutant or dead replicon RNA (deRep). FIG. 1C is a graph showing the percentages of PI+ annexin V+ dead B16F10 cells transfected using lipid nanoparticles or using lipid nanoparticles encapsulating replicon RNA. Immunogenic cell death induced by lipid nanoparticles or using lipid nanoparticles encapsulating replicon RNA is shown by the percentage of calreticulin+ (CRT+) cells (FIG. 1D), extracellular ATP (FIG. 1E), and HMGB1 release (FIG. 1F). In FIG. Figure 1G shows the diameter of lipid nanoparticles and lipid nanoparticles loaded with mutant RNA replicons. In FIG. 1H shows the zeta potential of lipid nanoparticles and lipid nanoparticles loaded with mutant RNA replicons.

FIG. 2A-2J are graphs showing that mtRep and deRep trigger TLR3 signaling and induce the ISGF3 complex for necrotic cell death. LNP replicon RNA triggers TLR3 signaling (FIG. 2B and FIG. 2E) and activates expression of the interferon-stimulated genes Stat 1, Stat2, IRF9, IRF3, and cGAS (FIG. 2F-2J), but does not activate TLR2 (FIG. 2A) , TLR7 (FIG. 2C) or TLR9 (FIG. 2D).

FIG. 3A-3K are graphs showing that TT3-mtRep recruits immunocytes and causes regression of tumor growth. In FIG. Figure 3A shows that mtRep recruits more Ly6clo Ly6G+ granulocytes 3 days after injection. In FIG. 3B shows the percentages of mCherry+ cells in CD45+ and CD45− cells in TT3-mtRep-injected tumors 3 days after injection. In FIG. Figure 3C shows the expression of the ISGF3 complex (Stat1/Stat2/IRF9), as well as IRF3 and cGAS, 1 day after TT3-mtRep injection. In FIG. 3D-3F shows the infiltration of immunocytes (granulocytes, M-MDSC, monocytes, macrophages, CD4 T, CD8 T, NK, NKT, conventional DC1 (cDC1) and conventional DC2 (cDC2)) into the tumor on day 1 (FIG. 3D) and on day 3 (FIG. 3E) after one injection of TT3-mtRep, and on day 1 after 3 consecutive injections (FIG. 3F) of TT3-mtRep. In FIG. 3G-3H show that TT3-mtRep induces more cell death (FIG. 3G), more immunocyte infiltration (FIG. 3H), decreased tumor weight (FIG. 3I), tumor area (FIG. 3J), and increased CCL5 expression (FIG. 3J . 3K) one day after 3 consecutive injections of TT3-mtRep.

FIG. 4A-4G are graphs showing that TT3-mtRep encoding IL12-MSA or IL12-MSA-lumican effectively modulates the tumor microenvironment and immunocyte infiltration. In FIG. 4A and 4B show quantification of IFNα2 by ELISA in tumor (FIG. 4A) and serum (FIG. 4B), one day and three days after TT3-mtRep injection. In FIG. 4C shows that B16F10 cells transfected with mtRep-IL12-MSA and mtRep-IL12-MSA-lumican can produce IL-12. In FIG. 4D shows the level of IL-12 in the tumor one day and three days after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA or TT3-mtRep-IL12-MSA-lumican. In FIG. 4E-4F show the infiltration of immunocytes into the tumor after one day (FIG. 4E) and three days (FIG. 4F) after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA or TT3-mtRep-IL12-MSA-lumican. In FIG. 4G shows the numbers of conventional DC1 (cDC1) in the tumor-draining lymph node one day and three days after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA or TT3-mtRep-IL12-MSA-lumican.

FIG. 5A-5E are graphs showing the synergistic in vivo anticancer effects of immunomodulatory IL12 and immunogenic cell death induced by TT3-mtRep. Synergistic anticancer effects were assessed through changes in body weight (FIG. 5A), serum IFNr (FIG. 5B), tumor area (FIG. 5C), and survival curve (FIG. 5D). In FIG. 5E shows that treatment with TT3-mtRep-IL12 can prevent tumor recurrence in cured mice.

DETAILED DESCRIPTION

The present invention is based, at least in part, on the unexpected discovery that, when injected into a tumor site, a synthetic oncolytic virus containing a lipid nanoparticle containing one or more types of lipids and a self-amplifying RNA replicon containing the sequence encoding the IL-12 molecule successfully triggers anticancer immune response of local tumors and provides systemic immunity against distant tumors.

I. Synthetic oncolytic virus

The present invention relates, at least in part, to a synthetic oncolytic virus. As used herein, the term “synthetic” refers to a non-natural or engineered oncolytic virus, as described herein, that includes a lipid nanoparticle and a self-amplifying RNA replicon containing a sequence encoding an IL-12 molecule.

In some aspects, the present invention relates to the use of lipid nanoparticles (LNPs), which themselves are capable of inducing immunogenic cell death, to facilitate delivery of a biologically active agent (eg, a self-amplifying replicon RNA encoding an IL-12 molecule) into tumor cells.

(i) Lipid nanoparticle

The present invention relates, at least in part, to the delivery of biologically active molecules to cells using lipid nanoparticles. Specifically, the invention relates to a synthetic oncolytic virus containing an IL-12 expressing self-amplifying replicon RNA encapsulated by lipid nanoparticles, a composition thereof, and methods of using the synthetic oncolytic virus and composition thereof to treat a subject having or suspected of having a malignant tumor. tumor.

A lipid nanoparticle (LNP), as used herein, refers to a vesicle, such as a spherical vesicle, having a continuous lipid bilayer. Lipid nanoparticles can be used in methods by which pharmaceutical therapeutics are delivered to target sites. Non-limiting examples of LNPs include liposomes, bolaamphiphiles, solid lipid nanoparticles (SLNs), nanostructured lipid carriers (NLCs), and monolayer membrane structures (eg, archaeosomes and micelles).

A lipid nanoparticle, within the scope of the invention, contains one or more types of lipids. Lipid, as used herein, refers to a group of organic compounds that include, but are not limited to, fatty acid esters, and in some embodiments, are characterized by being insoluble in water but soluble in many organic solvents. They are usually divided into at least three classes: (1) "simple lipids", which include fats and oils, as well as waxes; (2) “complex lipids”, which include phospholipids and glycolipids; (3) "lipid derivatives" such as steroids. Non-limiting examples of lipids include triglycerides (eg, tristearin), diglycerides (eg, glycerol behenate), monoglycerides (eg, glycerol monostearate), fatty acids (eg, stearic acid), steroids (eg, cholesterol), and waxes (eg, cetyl palmitate). In some embodiments, one or more types of lipids in the LNP comprises a cationic lipid.

Cationic lipid, as used herein, refers to any of a number of lipid species that can carry a net positive charge at a selected pH, such as physiological pH. Such lipids include, but are not limited to, N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3), N-(2,3-dioleoyloxy)propyl)-N chloride ,N,N-trimethylammonium (DOTAP); lipofectamine; 1,2-Dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), Dioctadecyldimethylammonium (DODMA), Distearyldimethylammonium (DSDMA), N,N-Dioleyl-N,N chloride -dimethylammonium (DODAC); N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA); N,N-distearyl-N,N-dimethylammonium bromide (DDAB); 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol) and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE ).

In some embodiments, the cationic lipid is TT3. TT3, within the scope of the invention, is capable of forming lipid nanoparticles for the delivery of various biological active substances into cells. In addition, the present invention also shows that unloaded TT3-LNP can induce immunogenic cell death (ICD) in cancer cells in vivo and in vitro . Immunogenic cell death, as described herein, refers to a form of cell death that can induce an effective immune response through the activation of dendritic cells (DC) and resulting from the activation of a specific T cell response. In some embodiments, the cells that undergo immunogenic cell death (ICD) are tumor cells. Immunogenic tumor cell death can trigger an effective antitumor immune response. In some embodiments, the synthetic oncolytic virus comprises a TT3-LNP encapsulating a self-amplifying RNA replicon encoding only a reporter gene (TT3-LNP-replicon RNA). Self-amplifying replicon RNA may act synergistically with TT3-LNP to induce increased ICD levels in tumor cells compared with TT3-LNP alone. In other embodiments, the synthetic oncolytic virus comprises a TT3-LNP encapsulating a self-amplifying RNA replicon encoding an IL-12 molecule. IL-12, which is an immunoregulatory cytokine, induces a strong immune response against the local tumor. In addition, the combination of TT3-LNP, self-amplifying replicon RNA, and IL-12 expression is not only effective in synergistically inhibiting tumor cells at the site, but also induces a systemic antitumor immune response to kill distant tumor cells and prevent tumor recurrence.

In some embodiments, the cationic lipid is DOTAP. DOTAP, within the scope of the invention, is also capable of forming lipid nanoparticles. DOTAP can be used for highly efficient transfection of DNA, including yeast artificial chromosomes (YAC), into eukaryotic cells for transient or stable gene expression, and is also suitable for the efficient transfer of other negatively charged molecules such as RNA, oligonucleotides, ribonucleoproteins (RNPs) ) complexes and proteins into mammalian cell samples for research.

In other embodiments, the cationic lipid is lipofectamine. Lipofectamine, as used herein, is a common transfection reagent manufactured and sold by Invitrogen for use in molecular and cellular biology. It is used to increase the efficiency of transfection of RNA (including mRNA and siRNA) or plasmid DNA in in vitro cell cultures through lipofection. Lipofectamine contains lipid subunits that can form liposomes or lipid nanoparticles in an aqueous environment that capture a transfection load, such as a self-amplifying RNA replicon. RNA-containing liposomes (positively charged on their surface) can fuse with the negatively charged plasma membrane of living cells through neutral colipid-mediated fusion of the liposome with the cell membrane, allowing a cargo of nucleic acid molecules to cross into the cytoplasm for replication or expression.

In some embodiments, the LNPs are composed primarily of cationic lipids, along with other lipid ingredients. These typically include other lipid molecules belonging to, but not limited to, the phosphatidylcholine (PC) class (e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and 1,2-dioleoyl-sn -glycero-3-phosphoethanolamine (DOPE), sterols (eg cholesterol) and polyethylene glycol (PEG)-lipid conjugates (eg 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folate(polyethylene glycol)- 2000 (DSPE-PEG2000) and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000).Table 1 shows the composition of two LNPs, TT3-LNP and DOTAP- LNP.

Table 1:

DOTAP-LNP DOTAP DSPC Cholesterol DSPE-PEG2000 Molar ratio 40 10 48 2 TT3-LNP TT3 DOPE Cholesterol C14-PEG2000 Molar ratio 20 thirty 40 0.75

The particle size of lipid nanoparticles can influence drug release rate, biodistribution, mucoadhesion, cellular water uptake and buffer exchange with the nanoparticle interior, and protein diffusion. In some embodiments, the LNP diameter ranges from 30 to 150 nm. In some embodiments, the LNP diameter is in the range of 100 to 120 nm. In some embodiments, the LNP diameter may be 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm , 107 nm, 108 nm, 109 nm, 110 nm, 111 nm, 112 nm, 113 nm, 114 nm, 115 nm, 116 nm, 117 nm, 118 nm, 119 nm or 120 nm.

Zeta potential is a measure of the effective electrical charge on the surface of a lipid nanoparticle. The amplitude of the zeta potential provides information about the stability of the particle. In some embodiments, the zeta potential of the LNP is in the range of -10 millivolts (mV) to 25 mV. In some embodiments, the zeta potential of the LNP is in the range of 3 to 6 mV. In some embodiments, the zeta potential of the LNP may be 3 mV, 3.1 mV, 3.2 mV, 3.3 mV, 3.4 mV, 3.5 mV, 3.6 mV, 3.7 mV, 3 .8 mV, 3.9 mV, 4 mV, 4.1 mV, 4.2 mV, 4.3 mV, 4.4 mV, 4.5 mV, 4.6 mV, 4.7 mV, 4.8 mV, 4.9 mV, 5 mV, 5.1 mV, 5.2 mV, 5.3 mV, 5.4 mV, 5.5 mV, 5.6 mV, 5.7 mV, 5.8 mV, 5.9 mV and 6 mV.

The present invention relates, at least in part, to the encapsulation of replicon RNA using lipid nanoparticles. In some embodiments, the weight ratio between LNP and replicon RNA ranges from 1:2 to 2:1. In some embodiments, the weight ratio between LNP and replicon RNA may be 1:2, 1:1.5, 1:1.2, 1:1, 1.1:1, 1.2:1, 1.3: 1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 and 2:1. In some embodiments, the weight ratio between the LNP and the replicon RNA may be 1:1.

(ii) Self-amplifying RNA replicon

According to the present invention, a self-amplifying RNA replicon encoding the IL-12 molecule under the control of a subgenomic promoter, instead of the structural proteins necessary for viral replication, is of significant interest for the immunotherapy of malignant tumors. As used herein, the term “self-amplifying RNA replicon” refers to a self-replicating genetic element containing RNA that replicates from a single origin of replication. The terms “RNA replicon” and “self-amplifying RNA replicon” are used interchangeably herein. In some embodiments, the self-amplifying RNA replicon is a viral replicon.

A virus is a small pathogen capable of replication only within a living host cell (such as prokaryotic and eukaryotic cells). Outside living cells, viruses exist in the form of independent particles (eg, viral particles or virions) that contain genetic material in the form of DNA or RNA, the latter of which can be single-stranded or double-stranded. Viruses with DNA are designated as DNA viruses, and viruses with RNA are designated as RNA viruses. In some cases, the virus contains nucleic acid-associated proteins, and the combination of the virus and nucleic acid-associated proteins is referred to as a nucleoprotein. In addition to genetic material, viruses have a single or double protein shell, also known as a capsid, which facilitates attachment of the virus to living host cell receptors during infection and protects the viral genetic material from enzymatic degradation. The combination of a nucleoprotein and a capsid is designated a nucleocapsid. In some cases, viruses have a lipid bilayer envelope, with spikes of virus-encoded, glycosylated (transmembrane) membrane-associated proteins. Following infection of a living host cell by a virus, the virus is dependent on the living host cell to provide the machinery for its replication and subsequent propagation. The viral genome encodes some structural proteins and nonstructural regulatory proteins.

As used herein, the term “subgenome” or “subgenomic” refers to a smaller section of the entire replicon genome. Accordingly, subgenomic transcription, as used herein, refers to the transcription of one or more genes in the replicon genome, but not all of the genes that make up the replicon genome. In one embodiment, subgenomic transcription refers to the transcription of genes of experimental or therapeutic interest that are described elsewhere herein.

The term “structural protein”, as used in the context of viruses herein, refers to proteins that constitute the structural components of mature assembled virus particles or virions. Non-limiting examples of such structural proteins include core nucleocapsid proteins (eg, gag proteins), enzymes packaged into the viral particle (eg, pol proteins), and membrane components (eg, env proteins). In contrast, the term “non-structural proteins”, as used in the context of viruses herein, refers to proteins that are expressed within the host cell but do not constitute structural components of the virus particle or virion. Some of the roles of nonstructural proteins include, but are not limited to, replicon formation, immunomodulation, and transactivation of structural protein genes.

In some embodiments, the self-amplifying replicon RNA is derived from an alphavirus. Unlike host mRNAs, alphaviral replicon RNAs encode a set of four nonstructural proteins (nsP 1–4) that are both responsible for genome replication and, when engineered to include genes encoding nonviral products such as IL-12 molecules, provide transcription of such non-viral products under the control of a subgenomic promoter. Alphaviruses are part of group IV of the Togaviridae family of viruses, have a positive sense, single-stranded RNA genome, and are characterized by an icosahedral nucleocapsid. Other non-limiting examples of group IV viruses may include Astroviridae , Caliciviridae , Coronaviridae , Flaviviridae , Picornaviridae , Arteriviridae and Togaviridae . The alphavirus genus includes 26 enveloped viruses that infect eukaryotes. Alphaviruses have a wide host range and are transmitted by mosquitoes and blood-feeding arthropods. Non-limiting examples of alphaviruses include Venezuelan equine encephalitis virus (VEE), Semliki Forest virus (SF), Sindbis virus (SIN), Eastern equine encephalitis virus (EEE), Western equine encephalitis virus (WEE), Everglades virus (EVE), Mucambo virus ( MUC), Pixuna virus (PIX), Semliki Forest virus (SF), Middelburg virus (MID), Chikungunya virus (CHIK), O'Nyong Nyong virus (ONN), Ross River virus (RR), Barmah Forest virus (BF ), Geta virus (GET), Sagiyama virus (SAG), Bebaru virus (BEB), Mayaro virus (MAY), Una virus (UNA), Aura virus (AURA), Babanchi virus (BAB), Highlands G virus (HJ ) and Fort Morgan virus (FM).

In the present invention, at least in part, the alphavirus replicon is a VEE alphavirus replicon. VEE virus is a viral pathogen, typically transmitted by mosquitoes, that causes VEE or encephalomyelitis, primarily in equine species. People, however, can also become infected with VEE, and people with weakened immune systems are at particular risk of having severe complications if they are infected with VEE. The VEE virion is spherical and has a lipid membrane with glycoprotein surface proteins distributed along the outer surface. Typically, VEE has a genome of approximately 11.45 kb, excluding the 5' terminal cap and 3' poly(A) region, and contains 4 nonstructural proteins (nsP) and 5 structural proteins. Non-structural proteins include nsP1, nsP2, nsP3 and nsP4, while the structural region encodes proteins C, E3, E2, 6K and E1. In some cases, the self-amplifying RNA replicon is a WT RNA replicon derived from VEE. The RNA replicon sequence of the WT VEE virus is shown in SEQ ID NO: 1:

ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATGACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGATCCTTGACATTGGAAGTGCGCCCGCCCGCA GAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGATGTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGGAATTGGACAAGAAAATGAAGGAGCTGGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCCACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGCTGTTTACCAGGATGTA TACGCGGTTGACGGACCGACAAGTCTCTATCACCAAGCCAATAAGGGAGTTAGAGTCGCCTACTGGATAGGCTTTGACACCACCCCTTTTATGTTTAAGAACTTGGCTGGAGCATATCCATCATACTCTACCAACTGGGCCGACGAAACCGTGTTAACGGCTCGTAACATAGGCCTATGCAGCTCTGACGTTATGGAGCGGTCACGTAGAGGGATGTCCATTCTTAGAAAGAAGTATTTGAAACCATCCAACAAT GTTCTATTCTCTGTTGGCTCGACCATCTACCACGAGAAGAGGGACTTACTGAGGAGCTGGCACCTGCCGTCTGTATTTCACTTACGTGGCAAGCAAAATTACACATGTCGGTGTGAGACTATAGTTAGTTGCGACGGGTACGTCGTTAAAAGAATAGCTATCAGTCCAGGCCTGTATGGGAAGCCTTCAGGCTATGCTGCTACGATGCACCGCGAGGGATTCTTGTGCTGCAAAGTGACAGACACATTGA ACGGGGAGAGGGTCTCTTTTCCCGTGTGCACGTATGTGCCAGCTACATTGTGTGACCAAATGACTGGCATACTGGCAACAGATGTCAGTGCGGACGACGCGCAAAAACTGCTGGTTGGGCTCAACCAGCGTATAGTCGTCAACGGTCGCACCCAGAGAAACACCAATACCATGAAAAATTACCTTTTGCCCGTAGTGGCCCAGGCATTTGCTAGGTGGGCAAAGGAATATAAGGAAGATCAAGAAGATG AAAGGCCACTAGGACTACGAGATAGACAGTTAGTCATGGGGTGTTGTTGGGCTTTTAGAAGGCACAAGATAACATCTATTTATAAGCGCCCGGATACCCAAACCATCATCAAAGTGAACAGCGATTTCCACTCATTCGTGCTGCCCAGGATAGGCAGTAACACATTGGAGATCGGGCTGAGAACAAGAATCAGGAAAATGTTAGAGGAGCACAAGGAGCCGTCACCTCTCATTACCGCGAGGACGTACAAG AAGCTAAGTGCGCAGCCGATGAGGCTAAGGAGGTGCGTGAAGCCGAGGAGTTGCGCGCAGCTCTACCACCTTTGGCAGCTGATGTTGAGGAGCCCACTCTGGAGGCAGACGTCGACTTGATGTTACAAGAGGCTGGGGCCGGCTCAGTGGAGACACCTCGTGGCTTGATAAAGGTTACCAGCTACGATGGCGAGGACAAGATCGGCTCTTACGCTGTGCTTTCTCCGCAGGCTGTACTCAAGAG TGAAAAATTATCTTGCATCCACCCTCTCGCTGAACAAGTCATAGTGATAACACACTCTGGCCGAAAAGGGCGTTATGCCGTGGAACCATACCATGGTAAAGTAGTGGTGCCAGAGGGACATGCAATACCCGTCCAGGACTTTCAAGCTCTGAGTGAAAGTGCCACCATTGTGTACAACGAACGTGAGTTCGTAAACAGGTACCTGCACCATATTGCCACACATGGAGGAGCGCTGAACACTGATGAAGAATATTAC AAAACTGTCAAGCCCAGCGAGCACGACGGCGAATACCTGTACGACATCGACAGGAAACAGTGCGTCAAGAAAGAACTAGTCACTGGGCTAGGGCTCACAGGCGAGCTGGTGGATCCTCCCTTCCATGAATTCGCCTACGAGAGTCTGAGAACACGACCAGCCGCTCCTTACCAAGTACCAACCATAGGGGTGTATGGCGTGCCAGGATCAGGCAAGTCTGGCATCATTAAAAGCGCAGTCACCCAAAAAAGATC TAGTGGTGAGCGCCAAGAAAGAAAACTGTGCAGAAATTATAAGGGACGTCAAGAAAATGAAAGGGCTGGACGTCAATGCCAGAACTGTGGACTCAGTGCTCTTGAATGGATGCAAACACCCCGTAGAGACCCTGTATATTGACGAAGCTTTTGCTTGTCATGCAGGTACTCTCAGAGCGCTCATAGCCATTATAAGACCTAAAAAGGCAGTGCTCTGCGGGGATCCCAAACAGTGCGGTTTTTT TAACATGATGTGCCTGAAAGTGCATTTTAACCACGAGATTTTGCACACAAGTCTTCCACAAAAGCATCTCTCGCCGTTGCACTAAATCTGTGACTTCGGTCGTCTCAACCTTGTTTTACGACAAAAAAATGAGAACGACGAATCCGAAAGAGACTAAGATTGTGATTGACACTACCGGCAGTACCAAACCTAAGCAGGACGATCTCATTCTCACTTGTTTCAGAGGGTGGGTGAAGCAGTTGCAAATAGATTACAAA CAACGAAATAATGACGGCAGCTGCCTCTCAAGGGCTGACCCGTAAAGGTGTGTATGCCGTTCGGTACAAGGTGAATGAAAATCCTCTGTACGCACCCACCTCAGAACATGTGAACGTCCTACTGACCCGCACGGAGGACCGCATCGTGTGGAAAACACTAGCCGGCGACCCATGGATAAAAACACTGACTGCCAAGTACCCTGGGAATTTCACTGCCACGATAGAGGAGTGGCAAGCAGCATGATGCCATCATGA GGCACATCTTGGAGAGACCGGACCCTACCGACGTCTTCCAGAATAAGGCAAACGTGTGTTGGGCCAAGGCTTTAGTGCCGGTGCTGAAGACCGCTGGCATAGACATGACCACTGAACAATGGAACACTGTGGATTATTTTGAAACGGACAAAGCTCACTCAGCAGAGATAGTATTGAACCAACTATGCGTGAGGTTCTTTGGACTCGATCTGGACTCCGGTCTATTTTCTGCACCCACTGTTCCGTTATCCATTA GGAATAATCACTGGGATAACTCCCCGTCGCCTAACATGTACGGGCTGAATAAAGAAGTGGTCCGTCAGCTCTCTCGCAGGTACCCACAACTGCCTCGGGCAGTTGCCACTGGAAGAGTCTATGACATGAACACTGGTACACTGCGCAATTATGATCCGCGCATAAACCTAGTACCTGTAAACAGAAGACTGCCTCATGCTTTAGTCCTCACCATAATGAACACCCACAGAGTGACTTTTCTTCATTCGTCAG CAAATTGAAGGGCAGAACTGTCCTGGTGGTCGGGGAAAAGTTGTCCGTCCCAGGCAAAATGGTTGACTGGTTGTCAGACCGGCCTGAGGCTACCTTCAGAGCTCGGCTGGATTTAGGCATCCCAGGTGATGTGCCCAAATATGACATAATATTTGTTAATGTGAGGACCCCATATAAATACCATCACTATCAGCAGTGTGAAGACCATGCCATTAAGCTTAGCATGTTGACCAAGAAAGCTTGTCTGCATCT GAATCCCGGCGGAACCTGTGTCAGCATAGGTTATGGTTACGCTGACAGGGCCAGCGAAAGCATCATTGGTGCTATAGCGCGGCAGTTCAAGTTTTCCCGGGTATGCAAACCGAAATCCTCACTTGAAGAGACGGAAGTTCTGTTTGTATTCATTGGGTACGATCGCAAGGCCCGTACGCACAATTCTTACAAGCTTTCATCAACCTTGACCAACATTTATACAGGTTCCAGACTCCACGAAGCCGATGTG CACCCTCATATCATGTGGTGCGAGGGGATATTGCCACGGCCACCGAAGGAGTGATTAAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGCTGTATAAGAAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGACTGGTCAAAGGTGCAGCTAAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTTCGGAGGTTGAAGGTGACAAACAG TTGGCAGAGGCTTATGAGTCCATCGCTAAGATTGTCAACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCATCTTTTCCGGAACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATGCAGATGTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGGCTAGGAGAGAAGCAGTGGAGGAGATATGCATATCCGACG ACTCTTCAGTGACAGAACCTGATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTTCTTTGGCTGGAAGGAAGGGCTACAGCACAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACCAGGCGGCCAAGGATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCATGTATATCCTCGGAGAAAGCATGAGCAGTATTAGGTCGAAATGCCCCGTC GAAGAGTCGGAAGCCTCCACACCACCTAGCACGCTGCCTTGCTTGTGCATCCATGCCATGACTCCAGAAAGAGTACAGCGCCTAAAAGCCTCACGTCCAGAACAAATTACTGTGTGCTCATCCTTTCCATTGCCGAAGTATAGAATCACTGGTGTGCAGAAGATCCAATGCTCCCAGCCTATATTGTTCTCACCGAAAGTGCCTGCGTATATTCATCCAAGGAAGTATCTCGTGGAAACACCACCGGTAGA CGAGACTCCGGAGCCATCGGCAGAGAACCAATCCACAGAGGGGACACCTGAACAACCACCACTTATAACCGAGGATGAGACCAGGACTAGAACGCCTGAGCCGATCATCATCGAAGAGGAAGAAGAGGATAGCATAAGTTTGCTGTCAGATGGCCCGACCCACCAGGTGCTGCAAGTCGAGGCAGACATTCACGGGCCGCCCTTGTATCTAGCTCATCCTGGTCCATTCCTCATGCATCCGACTTTGATGTG GACAGTTTATCCATACTTGACACCCTGGAGGGAGCTAGCGTGACCAGCGGGGCAACGTCAGCCGAGACTAACTCTTACTTCGCAAAGAGTATGGAGTTTCTGGCGCGACCGGTGCCTGCGCCTCGAACAGTATTCAGGAACCCTCCACATCCCGCTCCGCGCACAAGAACACCGTCACTTGCACCAGCAGGGCCTGCTCGAGAACCAGCCTAGTTTCCACCCCGCCAGGCGTGAATAGGGTGATC ACTAGAGAGGAGCTCGAGGCGCTTACCCCGTCACGCACTCCTAGCAGGTCGGTCTCGAGAACCAGCCTGGTCTCCAACCCGCCAGGCGTAAATAGGGTGATTACAAGAGAGGAGTTTGAGGCGTTCGTAGCACAACAACAATGACGGTTTGATGCGGGTGCATACATCTTTTCCTCCGACACCGGTCAAGGGCATTTACAACAAAAATCAGTAAGGCAAACGGTGCTATCCGAAGTGGTGTTGG AGGACCGAATTGGAATTTCGTATGCCCCGCGCCTCGACCAAGAAAAAGAAGAATTACTACGCAAGAAATTACAGTTAAATCCCACACCTGCTAACAGAAGCAGATACCAGTCCAGGAAGGTGGAGAACATGAAAGCCATAACAGCTAGACGTATTCTGCAAGGCCTAGGGCATTATTTGAAGGCAGAAGGAAAAGTGGAGTGCTACCGAACCCTGCATCCTGTTCCTTTGTATTCATCTAGTGTGAACCGTG CCTTTTCAAGCCCCAAGGTCGCAGTGGAAGCCTGTAACGCCATGTTGAAAGAGAACTTTCCGACTGTGGCTTCTTACTGTATTATTCCAGAGTACGATGCCTATTTGGACATGGTTGACGGAGCTTCATGCTGCTTAGACACTGCCAGTTTTTGCCCTGCAAAGCTGCGCAGCTTTCCAAAGAAACACTCCTATTTGGAACCCACAATACGATCGGCAGTGCCTTCAGCGATCCAGAACACGCTCCAGA ACGTCCTGGCAGCTGCCACAAAAAGAAATTGCAATGTCACGCAAATGAGAGAATTGCCCGTATTGGATTCGGCGGCCTTTAATGTGGAATGCTTCAAGAAATATGCGTGTAATAATGAATATTGGGAAACGTTTAAAGAAAACCCCATCAGGCTTACTGAAGAAAACGTGGTAAATTACATTACCAAATTAAAAGGACCAAAAGCTGCTGCTCTTTTTGCGAAGACACATAATTTGAATATGTTGCAGGACATACCAAT GGACAGGTTTGTAATGGACTTAAAGAGAGACGTGAAAGTGACTCCAGGAACAAAACATACTGAAGAACGGCCCAAGGTACAGGTGATCCAGGCTGCCGATCCGCTAGCAACAGCGTATCTGTGCGGAATCCACCGAGAGCTGGTTAGGAGATTAAATGCGGTCCTGCTTCCGAACATTCATACACTGTTTGATATGTCGGCTGAAGACTTTGACGCTATTATAGCCGAGCACTTCCAGCCTGGGGATTGTGTTCT GGAAACTGACATCGCGTCGTTTGATAAAAGTGAGGACGACGCCATGGCTCTGACCGCGTTAATGATTCTGGAAGACTTAGGTGTGGACGCAGAGCTGTTGACGCTGATTGAGGCGGCTTTCGGCGAAATTTCATCAATACATTTGCCCACTAAAACTAAATTTAATTCGGAGCCATGATGAAATCTGGAATGTTCCTCACACTGTTTGTGAACACAGTCATTAACATTGTAATCGCAAGCAGAGTGTTGAGAGAACGG CTAACCGGATCACCATGTGCAGCATTCATTGGAGATGACAATATCGTGAAAGGAGTCAAATCGGACAAATTAATGGCAGACAGGTGCGCCACCTGGTTGAATATGGAAGTCAAGATTATAGATGCTGTGGTGGGCGAGAAAGCGCCTTATTTCTGTGGAGGGTTTATTTTGTGTGACTCCGTGACCGGCACAGCGTGCCGTGTGGCAGACCCCCTAAAAAGGCTGTTTAAGCTTGGCAAACCTCTGGCAG CAGACGATGAACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGAACCGAGTGGGTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAGTC TAGCATATGGGCGCGCCCTCAGCATCGATTGAATTGGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTT CATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCG GATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCAACGAGGACTACACCATCGTGGAACAGTACGAACGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGGAATT GGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTCAAAAAAAAAAAAAAAAAAAAAAAACGCGTCGAGGGGAATTAATTCTTGAAGACGAAAGGGCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAAT GCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTTAAAGTTCTGCTA TGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCG CCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTA TCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAG TTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTA CATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGAGCTCTAATACGACTCACTATAG (SEQ ID NO: 1)

A self-amplifying RNA replicon as described herein contains at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% of the nucleotide sequence , 99% or more identical to SEQ ID NO: 1. In some embodiments, the self-amplifying RNA replicon is at least 90% identical to SEQ ID NO: 1.

Self-amplifying RNA (replicon) represents a promising new platform for gene therapy, but applications are still limited by short persistence of expression in some cell types and low levels of transgene expression in vivo . In vitro evolution of a synthetic RNA replicon provides a potentially powerful way to modify and improve replicon expression both in vitro and in vivo . Using in vitro evolution, mutations were identified in nsP2 and nsP3 from the Venezuelan equine encephalitis (VEE) replicon that promote subgenomic expression in human cells.

In some embodiments, the self-amplifying RNA replicon contains mutations that give the RNA replicon the ability to express an IL-12 molecule at a higher level compared to the RNA replicon containing SEQ ID NO: 1. In some embodiments, the self-amplifying RNA replicon contains at least one point mutation at nucleic acid positions 3936 and/or 4758 of the WT replicon of SEQ ID NO: 1. In some embodiments, the self-amplifying RNA replicon contains at least one of the following point mutations: guanine to cytosine at position 3936 (G3936C) and adenine to guanine at position 4758 (A4758G) of the WT replicon sequence of SEQ ID NO: 1. The G3936C mutation may result in a glycine to arginine substitution at amino acid residue 1309 (G1309R). The A4758G mutation can result in a serine to glycine substitution at amino acid residue 1583 (S1583G). In some embodiments, the sequence of the mutant self-amplifying RNA replicon (mtReplicon RNA) is set forth in SEQ ID NO: 2 with the mutations highlighted (bold, underlined text):

C G (SEQ ID NO: 2)

In other embodiments, the self-amplifying replicon RNA is derived from hepatitis C virus (HCV). HCVs are part of group IV of the Flaviviridae family of viruses, which have single-component, linear, single-stranded RNA genomes of positive polarity, 9.6-12.3 kilobases in length. The 5' ends of flaviviruses bear a methylated nucleotide cap, while other members of this family are uncapped and encode an internal ribosome binding site.

In other embodiments, the alphavirus is an SF virus. SF virus is a viral pathogen, typically transmitted by mosquitoes, that causes encephalitis. Semliki Forest Virus is a positive-strand RNA virus with a genome of approximately 13,000 base pairs that encodes nine proteins. The 5'-terminal two-thirds of the genome encode four nonstructural proteins involved in RNA synthesis, and structural proteins are encoded in the 3'-terminal third. Of the structural proteins, C proteins constitute an icosahedral capsid wrapped by a host cell-derived lipid bilayer. The outermost surface of the virus is almost completely covered with heterodimers of glycoproteins E1 and E2, arranged in interconnected trimers that form the outer shell. The trimers are membrane anchored via a cytoplasmic E2 domain associated with the nucleocapsid.

In other embodiments, the alphavirus is a SIN virus. The virus is carried by mosquitoes. The SIN virus causes Sindbis fever in humans, and symptoms include arthralgia, rash, and discomfort. Sindbis viruses are enveloped particles with an icosahedral capsid. Their genome is a single-stranded RNA approximately 11.7 kb in length. It has a 5' cap and a 3' polyadenylated tail, thus serving directly as messenger RNA (mRNA) in the host cell. The genome encodes four nonstructural proteins at the 5' end, and capsid and two envelope proteins at the 3' end. This is a characteristic of all togaviruses. Replication is cytoplasmic and rapid. Genomic RNA is partially translated at the 5' end to produce nonstructural proteins, which are then involved in genome replication and production of new genomic RNA and shorter strand subgenomic RNA. This subgenomic chain is translated into structural proteins. Viruses assemble on the surfaces of host cells and obtain their envelopes through budding. The non-coding RNA element was found to be essential for replication of the Sindbis virus genome.

Viral replicon RNA is capable of stimulating an immune response through toll-like receptors (TLRs). A subset of TLRs, TLR3, TLR7/8 and TLR9, are involved in antiviral responses by triggering the production of antiviral cytokines such as type I interferons (IFNs). TLR3 responds to double-stranded RNA, a replication intermediate for many viruses. TLR7/8 recognize viral single-stranded RNAs, while TLR9 recognizes unmethylated CpG motifs in viral DNA. TLRs involved in virus recognition are expressed on endosomal membranes and can be separated according to their requirement for the adapter protein MyD88: TLR3 activity is MyD88-independent, while TLR7/8/9 are MyD88-dependent. Activation of TLR3 leads to the production of type I interferon (IFN). Type I interferon signaling through the ISGF3 complex (STAT1/STAT2/IRF9) is required for long-term Rip3 activation and necroptosis.

In some embodiments, LNP RNA replicons are capable of stimulating TLR3 signaling in tumor cells, resulting in necrotic cell death of tumor cells. In some embodiments, LNP replicon RNA may enhance immunogenic cell death (ICD) induced by LNP. In some embodiments, TT3-LNP replicon RNA can cause tumor inhibition by synergistically inducing ICD in tumor cells and triggering an antitumor immune response (e.g., recruiting immunocytes such as granulocytes, monocytes, macrophages, myeloid-derived suppressor cells, dendritic cells, T cells, and NK cells). In some embodiments, the synthetic oncolytic virus comprises TT3-LNP-mt Replicon RNA.

In some embodiments, the replicon RNA contains a coding sequence for a detectable molecule in a subgenomic region. In some embodiments, the detectable molecule is a nucleic acid or polypeptide. In some embodiments, the polypeptide is a fluorescent protein. Fluorescent proteins are known in the art and are a subclass of fluorophores, which are fluorescent chemical compounds with the ability to re-emit light upon excitation. The fluorophore can absorb excitation light energy at a first specific wavelength, and then can re-emit light energy at a second, longer specific wavelength. Each type of fluorophore responds to and emits light of different wavelengths, depending on the nature of its chemical structure and environment. In some embodiments, the fluorescent protein includes, but is not limited to, wt-GFP, green fluorescent protein (e.g., EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, etc. .), blue fluorescent protein, (e.g. EBFP, EBFP2, Azurite, mTagBFP, etc.), blue fluorescent protein (e.g. ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1 (Teal), etc.), yellow fluorescent protein (for example, EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana, etc.), orange fluorescent protein (for example, Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (T1), DsRed-Monomer, mTangerine, etc.), or red fluorescent protein (e.g. mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRed1, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, AQ143, etc.).

In some aspects, as described herein, the self-amplifying replicon RNA contains a coding sequence for expression of IL-12 in a subgenomic region. An exemplary coding sequence for IL-12 is set forth in SEQ ID NO: 3:

ATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCACGATGTGCCATGTGGGAGCTGGAGAAAGACGTTTATGTTGTAGAGGTGGACTGGACTCCCGATGCCCCTGGAGAAACAGTGAACCTCACCTGTGACACGCCTGAAGAAGATGACATCACCTGGACCTCAGACCAGAGACATGGAGTCATAGGCTCTGGAAAGACCCTGACCATCACTGTCAAAGAGTTTCTA GATGCTGGCCAGTACACCTGCCACAAAGGAGGCGAGACTCTGAGCCACTCACATCTGCTGCTCCACAAGAAGGAAAATGGAATTTGGTCCACTGAAATTTTAAAAAATTTCAAAACAAGACTTTCCTGAAGTGTGAAGCACCAAATTACTCCGGACGGTTCACGTGCTCATGGCTGGTGCAAAGAAACATGGACTTGAAGTTCAACATCAAGAGCAGTAGCAGTTCCCCTGACTCTCGGGCAGTGACATGTGGAAT GGCGTCTCTGTCTGCAGAGAAGGTCACACTGGACCAAAGGGACTATGAGAAGTATTCAGTGTCCTGCCAGGAGGATGTCACCTGCCCAACTGCCGAGGAGACCCTGCCCATTGAACTGGCGTTGGAAGCACGGCAGCAGAATAAATATGAGAACTACAGCACCAGCTTCTTCATCAGGGACATCATCAAACCAGACCCGCCCAAGAACTTGCAGATGAAGCCTTTGAAGAACTCACAGGTGGAGGTCAGCT GAGTACCCTGACTCCTGGAGCACTCCCCATTCCTACTTCTCCCTCAAGTTCTTTGTTCGAATCCAGCGCAAGAAAGAAAAGATGAAGGAGACAGAGGAGGGGTGTAACCAGAAAGGTGCGTTCCTCGTAGAGAAGACATCTACCGAAGTCCAATGCAAAGGCGGGAATGTCTGCGTGCAAGCTCAGGATCGCTATTACAATTCCTCATGCAGCAAGTGGGCATGTGTTCCCTGCAGGGTCCGATCCGGA GGTTCCGGTGGTGGATCCGGAGGTGGCTCCGGCGGCGGATCCAGGGTCATTCCAGTCTCTGGACCTGCCAGGTGTCTTAGCCAGTCCCGAAACCTGCTGAAGACCACAGATGACATGGTGAAGACGGCCAGAGAAAAACTGAAACATTATTCCTGCACTGCTGAAGACATCGATCATGAAGACATCACACGGGACCAAACCAGCACATTGAAGACCTGTTTACCACTGGAACTACACAAGAACGAGAGTTGC CTGGCTACTAGAGAGACTTCTTCCACAACAAGAGGGAGCTGCCTGCCCCCACAGAAGACGTCTTTGATGATGACCCTGTGCCTTGGTAGCATCTATGAGGACTTGAAGATGTACCAGACAGAGTTCCAGGCCATCAACGCAGCACTTCAGAATCACAACCATCAGCAGATCATTCTAGACAAGGGCATGCTGGTGGCCATCGATGAGCTGATGCAGTCTCTGAATCATAATGGCGAGACTCTGCGCCAGAAACCTCCT GTGGGAGAAGCAGACCCTTACAGAGTGAAAATGAAGCTCTGCATCCTGCTTCACGCCTTCAGCACCCGCGTCGTGACCATCAACAGGGTGATGGGCTATCTGAGCTCCGCCTGA (SEQ ID NO: 3)

Structurally, IL-12 belongs to the type I cytokines and has a four α-helix knot structure. IL-12 acts as a heterodimeric protein (IL-12-p70; IL-12-p30/p40), consisting of two covalently linked subunits p30 and p40. In contrast to the heterodimeric form, the IL-12-p40/p40 homodimer acts primarily as a competitive suppressor of the actions of IL-12-p70. IL-12 is a pleiotropic cytokine whose action creates a cross-talk between innate and adaptive immunity. IL-12 was first described as a factor secreted from PMA-induced EBV-transformed B cell lines. Based on its actions, IL-12 was originally designated as a “cytotoxic lymphocyte maturation factor” and a “natural killer cell stimulating factor.” By balancing innate and adaptive immunity and potently stimulating the production of IFN-γ, a cytokine that coordinates natural anticancer defense mechanisms, IL-12 appears to be an ideal candidate for immunotherapy of human tumors. However, the severe side effects associated with systemic administration of IL-12 in clinical trials and the very narrow therapeutic index of this cytokine have markedly reduced enthusiasm for the use of this cytokine in patients with malignancies.

Since the discovery of IL-12, three other members (IL-23, IL-27, and IL-35) have been added to the IL-12 family and have been shown to play critical roles in Th1 cell functions. IL-12 is a receptor ligand consisting of two amino acid chains, IL-12R-β1 and IL-12R-β2. The IL-12 receptor is expressed in a constitutive (eg, IL-12R-β1 in B cells) or inducible (IL-12R-β2) manner in a variety of immunocytes, including NK cells, T and B lymphocytes. Ligand-bound IL-12R-β2 becomes phosphorylated at tyrosine residues that provide binding sites for two kinases, JAK2 and TYK2. Among the STAT family of transcription factors, STAT4 is considered the most specific mediator of cellular responses induced by IL-12. The main elements of the actions of IL-12 are the following: increased production of IFN-γ, which is the most powerful mediator of the actions of IL-12, from NK and T cells; stimulation of growth and cytotoxicity of activated NK cells, CD8+ and CD4+ T cells, shift in differentiation of CD4+ Th0 cells towards the Th1 phenotype; enhancement of antibody-dependent cellular cytotoxicity (ADCC) against tumor cells; and induction of IgG production and suppression of IgE production from B cells. The main source of IL-12 in humans is activated antigen presenting cells such as dendritic cells, especially of the CD1c+ phenotype, as well as hematopoietic phagocytes (monocytes, macrophages, as well as neutrophils), but IL-12 can also be produced by other cell types. While IL-12 acts on a variety of immunocytes, a common physiological role for IL-12 appears to be orchestrating a Th1-type immune response against specific pathogens.

The present invention, in one aspect, relates to the local delivery of IL-12 through an LNP encapsulating a viral replicon RNA that encodes an IL-12 molecule in its subgenomic region. In addition to synergistic immunogenic cell death (ICD) of tumor cells induced by LNP replicon RNA, in some embodiments, expression of IL12 in the tumor microenvironment can lead to further immunostimulation and results in an enhanced antitumor immune response. In some embodiments, the combination of LNP-replicon RNA-IL-12 in the tumor microenvironment is capable of inducing a systemic antitumor immune response. In other embodiments, the combination of LNP-replicon RNA-IL-12 in the tumor microenvironment is capable of killing tumor cells and preventing tumor recurrence. In some embodiments, the synthetic oncolytic virus comprises a TT3-LNP-mtRNA-IL12 Replicon.

In some embodiments, the RNA-IL12 replicon further comprises a coding sequence for serum albumin. The half-life of peptides and proteins (e.g., cytokines) in the biological environment (e.g., serum, tumor microenvironment) is influenced by several factors, including size, charge, proteolytic sensitivity, the nature of their biology, the turnover rate of the proteins to which they bind, and other factors. . In some cases, the half-life of proteins in the biological environment can be roughly correlated with their size. Peptides and proteins less than approximately 70 kDa (eg, cytokines) can be removed by renal filtration, so they generally have very short half-lives. Larger proteins, however, can persist for several days. Three types of proteins, IgG, serum albumin, and transferrin, persist much longer than would be predicted by their size alone. In some embodiments, the serum albumin is human serum albumin. In some embodiments, the serum albumin is murine serum albumin (MSA). An exemplary coding sequence for the RNA-IL12-MSA replicon is set forth in SEQ ID NO: 4:

ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATGACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGATCCTTGACATTGGAAGTGCGCCCGCCCGCA GAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGATGTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGGAATTGGACAAGAAAATGAAGGAGCTGGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCCACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGCTGTTTACCAGGATGTA TACGCGGTTGACGGACCGACAAGTCTCTATCACCAAGCCAATAAGGGAGTTAGAGTCGCCTACTGGATAGGCTTTGACACCACCCCTTTTATGTTTAAGAACTTGGCTGGAGCATATCCATCATACTCTACCAACTGGGCCGACGAAACCGTGTTAACGGCTCGTAACATAGGCCTATGCAGCTCTGACGTTATGGAGCGGTCACGTAGAGGGATGTCCATTCTTAGAAAGAAGTATTTGAAACCATCCAACAAT GTTCTATTCTCTGTTGGCTCGACCATCTACCACGAGAAGAGGGACTTACTGAGGAGCTGGCACCTGCCGTCTGTATTTCACTTACGTGGCAAGCAAAATTACACATGTCGGTGTGAGACTATAGTTAGTTGCGACGGGTACGTCGTTAAAAGAATAGCTATCAGTCCAGGCCTGTATGGGAAGCCTTCAGGCTATGCTGCTACGATGCACCGCGAGGGATTCTTGTGCTGCAAAGTGACAGACACATTGA ACGGGGAGAGGGTCTCTTTTCCCGTGTGCACGTATGTGCCAGCTACATTGTGTGACCAAATGACTGGCATACTGGCAACAGATGTCAGTGCGGACGACGCGCAAAAACTGCTGGTTGGGCTCAACCAGCGTATAGTCGTCAACGGTCGCACCCAGAGAAACACCAATACCATGAAAAATTACCTTTTGCCCGTAGTGGCCCAGGCATTTGCTAGGTGGGCAAAGGAATATAAGGAAGATCAAGAAGATG AAAGGCCACTAGGACTACGAGATAGACAGTTAGTCATGGGGTGTTGTTGGGCTTTTAGAAGGCACAAGATAACATCTATTTATAAGCGCCCGGATACCCAAACCATCATCAAAGTGAACAGCGATTTCCACTCATTCGTGCTGCCCAGGATAGGCAGTAACACATTGGAGATCGGGCTGAGAACAAGAATCAGGAAAATGTTAGAGGAGCACAAGGAGCCGTCACCTCTCATTACCGCGAGGACGTACAAG AAGCTAAGTGCGCAGCCGATGAGGCTAAGGAGGTGCGTGAAGCCGAGGAGTTGCGCGCAGCTCTACCACCTTTGGCAGCTGATGTTGAGGAGCCCACTCTGGAAGCCGATGTCGACTTGATGTTACAAGAGGCTGGGGCCGGCTCAGTGGAGACACCTCGTGGCTTGATAAAGGTTACCAGCTACGATGGCGAGGACAAGATCGGCTCTTACGCTGTGCTTTCTCCGCAGGCTGTACTCAAGAG TGAAAAATTATCTTGCATCCACCCTCTCGCTGAACAAGTCATAGTGATAACACACTCTGGCCGAAAAGGGCGTTATGCCGTGGAACCATACCATGGTAAAGTAGTGGTGCCAGAGGGACATGCAATACCCGTCCAGGACTTTCAAGCTCTGAGTGAAAGTGCCACCATTGTGTACAACGAACGTGAGTTCGTAAACAGGTACCTGCACCATATTGCCACACATGGAGGAGCGCTGAACACTGATGAAGAATATTAC AAAACTGTCAAGCCCAGCGAGCACGACGGCGAATACCTGTACGACATCGACAGGAAACAGTGCGTCAAGAAAGAACTAGTCACTGGGCTAGGGCTCACAGGCGAGCTGGTGGATCCTCCCTTCCATGAATTCGCCTACGAGAGTCTGAGAACACGACCAGCCGCTCCTTACCAAGTACCAACCATAGGGGTGTATGGCGTGCCAGGATCAGGCAAGTCTGGCATCATTAAAAGCGCAGTCACCCAAAAAAGATC TAGTGGTGAGCGCCAAGAAAGAAAACTGTGCAGAAATTATAAGGGACGTCAAGAAAATGAAAGGGCTGGACGTCAATGCCAGAACTGTGGACTCAGTGCTCTTGAATGGATGCAAACACCCCGTAGAGACCCTGTATATTGACGAAGCTTTTGCTTGTCATGCAGGTACTCTCAGAGCGCTCATAGCCATTATAAGACCTAAAAAGGCAGTGCTCTGCGGGGATCCCAAACAGTGCGGTTTTTT TAACATGATGTGCCTGAAAGTGCATTTTAACCACGAGATTTTGCACACAAGTCTTCCACAAAAGCATCTCTCGCCGTTGCACTAAATCTGTGACTTCGGTCGTCTCAACCTTGTTTTACGACAAAAAAATGAGAACGACGAATCCGAAAGAGACTAAGATTGTGATTGACACTACCGGCAGTACCAAACCTAAGCAGGACGATCTCATTCTCACTTGTTTCAGAGGGTGGGTGAAGCAGTTGCAAATAGATTACAAA CAACGAAATAATGACGGCAGCTGCCTCTCAAGGGCTGACCCGTAAAGGTGTGTATGCCGTTCGGTACAAGGTGAATGAAAATCCTCTGTACGCACCCACCTCAGAACATGTGAACGTCCTACTGACCCGCACGGAGGACCGCATCGTGTGGAAAACACTAGCCGGCGACCCATGGATAAAAACACTGACTGCCAAGTACCCTGGGAATTTCACTGCCACGATAGAGGAGTGGCAAGCAGCATGATGCCATCATGA GGCACATCTTGGAGAGACCGGACCCTACCGACGTCTTCCAGAATAAGGCAAACGTGTGTTGGGCCAAGGCTTTAGTGCCGGTGCTGAAGACCGCTGGCATAGACATGACCACTGAACAATGGAACACTGTGGATTATTTTGAAACGGACAAAGCTCACTCAGCAGAGATAGTATTGAACCAACTATGCGTGAGGTTCTTTGGACTCGATCTGGACTCCGGTCTATTTTCTGCACCCACTGTTCCGTTATCCATTA GGAATAATCACTGGGATAACTCCCCGTCGCCTAACATGTACGGGCTGAATAAAGAAGTGGTCCGTCAGCTCTCTCGCAGGTACCCACAACTGCCTCGGGCAGTTGCCACTGGAAGAGTCTATGACATGAACACTGGTACACTGCGCAATTATGATCCGCGCATAAACCTAGTACCTGTAAACAGAAGACTGCCTCATGCTTTAGTCCTCACCATAATGAACACCCACAGAGTGACTTTTCTTCATTCGTCAG CAAATTGAAGGGCAGAACTGTCCTGGTGGTCGGGGAAAAGTTGTCCGTCCCAGGCAAAATGGTTGACTGGTTGTCAGACCGGCCTGAGGCTACCTTCAGAGCTCGGCTGGATTTAGGCATCCCAGGTGATGTGCCCAAATATGACATAATATTTGTTAATGTGAGGACCCCATATAAATACCATCACTATCAGCAGTGTGAAGACCATGCCATTAAGCTTAGCATGTTGACCAAGAAAGCTTGTCTGCATCT GAATCCCGGCGGAACCTGTGTCAGCATAGGTTATGGTTACGCTGACAGGGCCAGCGAAAGCATCATTGGTGCTATAGCGCGGCAGTTCAAGTTTTCCCGGGTATGCAAACCGAAATCCTCACTTGAAGAGACGGAAGTTCTGTTTGTATTCATTCGGTACGATCGCAAGGCCCGTACGCACAATTCTTACAAGCTTTCATCAACCTTGACCAACATTTATACAGGTTCCAGACTCCACGAAGCCGATGTG CACCCTCATATCATGTGGTGCGAGGGGATATTGCCACGGCCACCGAAGGAGTGATTAAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGCTGTATAAGAAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGACTGGTCAAAGGTGCAGCTAAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTTCGGAGGTTGAAGGTGACAAACAG TTGGCAGAGGCTTATGAGTCCATCGCTAAGATTGTCAACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCATCTTTTCCGGAACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATGCAGATGTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGGCTAGGAGAGAAGCAGTGGAGGAGATATGCATATCCGACG ACTCTTCAGTGACAGAACCTGATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTTCTTTGGCTGGAAGGAAGGGCTACAGCACAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACCAGGCGGCCAAGGATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCATGTATATCCTCGGAGAAGGCATGAGCAGTATTAGGTCGAAATGCCCCGTC GAAGAGTCGGAAGCCTCCACACCACCTAGCACGCTGCCTTGCTTGTGCATCCATGCCATGACTCCAGAAAGAGTACAGCGCCTAAAAGCCTCACGTCCAGAACAAATTACTGTGTGCTCATCCTTTCCATTGCCGAAGTATAGAATCACTGGTGTGCAGAAGATCCAATGCTCCCAGCCTATATTGTTCTCACCGAAAGTGCCTGCGTATATTCATCCAAGGAAGTATCTCGTGGAAACACCACCGGTAGA CGAGACTCCGGAGCCATCGGCAGAGAACCAATCCACAGAGGGGACACCTGAACAACCACCACTTATAACCGAGGATGAGACCAGGACTAGAACGCCTGAGCCGATCATCATCGAAGAGGAAGAAGAGGATAGCATAAGTTTGCTGTCAGATGGCCCGACCCACCAGGTGCTGCAAGTCGAGGCAGACATTCACGGGCCGCCCTTGTATCTAGCTCATCCTGGTCCATTCCTCATGCATCCGACTTTGATGTG GACAGTTTATCCATACTTGACACCCTGGAGGGAGCTAGCGTGACCAGCGGGGCAACGTCAGCCGAGACTAACTCTTACTTCGCAAAGAGTATGGAGTTTCTGGCGCGACCGGTGCCTGCGCCTCGAACAGTATTCAGGAACCCTCCACATCCCGCTCCGCGCACAAGAACACCGTCACTTGCACCAGCAGGGCCTGCTCGAGAACCAGCCTAGTTTCCACCCCGCCAGGCGTGAATAGGGTGATC ACTAGAGAGGAGCTCGAGGCGCTTACCCCGTCACGCACTCCTAGCAGGTCGGTCTCGAGAACCAGCCTGGTCTCCAACCCGCCAGGCGTAAATAGGGTGATTACAAGAGAGGAGTTTGAGGCGTTCGTAGCACAACAACAATGACGGTTTGATGCGGGTGCATACATCTTTTCCTCCGACACCGGTCAAGGGCATTTACAACAAAAATCAGTAAGGCAAACGGTGCTATCCGAAGTGGTGTTGG AGGACCGAATTGGAATTTCGTATGCCCCGCGCCTCGACCAAGAAAAAGAAGAATTACTACGCAAGAAATTACAGTTAAATCCCACACCTGCTAACAGAAGCAGATACCAGTCCAGGAAGGTGGAGAACATGAAAGCCATAACAGCTAGACGTATTCTGCAAGGCCTAGGGCATTATTTGAAGGCAGAAGGAAAAGTGGAGTGCTACCGAACCCTGCATCCTGTTCCTTTGTATTCATCTAGTGTGAACCGTG CCTTTTCAAGCCCCAAGGTCGCAGTGGAAGCCTGTAACGCCATGTTGAAAGAGAACTTTCCGACTGTGGCTTCTTACTGTATTATTCCAGAGTACGATGCCTATTTGGACATGGTTGACGGAGCTTCATGCTGCTTAGACACTGCCAGTTTTTGCCCTGCAAAGCTGCGCAGCTTTCCAAAGAAACACTCCTATTTGGAACCCACAATACGATCGGCAGTGCCTTCAGCGATCCAGAACACGCTCCAGA ACGTCCTGGCAGCTGCCACAAAAAGAAATTGCAATGTCACGCAAATGAGAGAATTGCCCGTATTGGATTCGGCGGCCTTTAATGTGGAATGCTTCAAGAAATATGCGTGTAATAATGAATATTGGGAAACGTTTAAAGAAAACCCCATCAGGCTTACTGAAGAAAACGTGGTAAATTACATTACCAAATTAAAAGGACCAAAAGCTGCTGCTCTTTTTGCGAAGACACATAATTTGAATATGTTGCAGGACATACCAAT GGACAGGTTTGTAATGGACTTAAAGAGAGACGTGAAAGTGACTCCAGGAACAAAACATACTGAAGAACGGCCCAAGGTACAGGTGATCCAGGCTGCCGATCCGCTAGCAACAGCGTATCTGTGCGGAATCCACCGAGAGCTGGTTAGGAGATTAAATGCGGTCCTGCTTCCGAACATTCATACACTGTTTGATATGTCGGCTGAAGACTTTGACGCTATTATAGCCGAGCACTTCCAGCCTGGGGATTGTGTTCT GGAAACTGACATCGCGTCGTTTGATAAAAGTGAGGACGACGCCATGGCTCTGACCGCGTTAATGATTCTGGAAGACTTAGGTGTGGACGCAGAGCTGTTGACGCTGATTGAGGCGGCTTTCGGCGAAATTTCATCAATACATTTGCCCACTAAAACTAAATTTAATTCGGAGCCATGATGAAATCTGGAATGTTCCTCACACTGTTTGTGAACACAGTCATTAACATTGTAATCGCAAGCAGAGTGTTGAGAGAACGG CTAACCGGATCACCATGTGCAGCATTCATTGGAGATGACAATATCGTGAAAGGAGTCAAATCGGACAAATTAATGGCAGACAGGTGCGCCACCTGGTTGAATATGGAAGTCAAGATTATAGATGCTGTGGTGGGCGAGAAAGCGCCTTATTTCTGTGGAGGGTTTATTTTGTGTGACTCCGTGACCGGCACAGCGTGCCGTGTGGCAGACCCCCTAAAAAGGCTGTTTAAGCTTGGCAAACCTCTGGCAG CAGACGATGAACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGAACCGAGTGGGTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAGTC TAGCATATGGGCGCCCTCAGCATCGATTTGAATTGGCCACCATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCACGATGTGCCATGTGGGAGCTGGAGAAAGACGTTTATGTTGTAGAGGTGGACTGGACTCCCGATGCCCCTGGAGAAACAGTGAACCTCACCTGTGACACGCCTGAAGAAGATGACATCACCTGGACCTCAGACCAGAGACATGGAGTCATAGG CTCTGGAAAGACCCTGACCATCACTGTCAAAGAGTTTCTAGATGCTGGCCAGTACACCTGCCACAAAGGAGGCGAGACTCTGAGCCACTCACATCTGCTGCTCCACAAGAAGGAAAATGGAATTTGGTCCACTGAAATTTTAAAAAATTTCAAAACAAGACTTTCCTGAAGTGTGAAGCACCAAATTACTCCGGACGGTTCACGTGCTCATGGCTGGTGCAAAGAAACATGGACTTGAAGTTCAACATCAAGAGCAG TAGCAGTTCCCCTGACTCTCGGGCAGTGACATGTGGAATGGCGTCTCTGTCTGCAGAGAAGGTCACACTGGACCAAAGGGACTATGAGAAGTATTCAGTGTCCTGCCAGGAGGATGTCACCTGCCCAACTGCCGAGGAGACCCTGCCCATTGAACTGGCGTTGGAAGCACGGCAGCAGAATAAATATGAGAACTACAGCACCAGCTTCTTCATCAGGGACATCATCAAACCAGACCCGCCCAAGAACTTGCA GATGAAGCCTTTGAAGAACTCACAGGTGGAGGTCAGCTGGGAGTACCCTGACTCCTGGAGCACTCCCCATTCCTACTTCTCCCTCAAGTTCTTTGTTCGAATCCAGCGCAAGAAAGAAAAGATGAAGGAGACAGAGGAGGGGTGTAACCAGAAAGGTGCGTTCCTCGTAGAGAAGACATCTACCGAAGTCCAATGCAAAGGCGGGAATGTCTGCGTGCAAGCTCAGGATCGCTATTACAATTCCTCATGC AGCAAGTGGGCATGTGTTCCCTGCAGGGTCCGATCCGGAGGTTCCGGTGGTGGATCCGGAGGTGGCTCCGGCGGCGGATCCAGGGTCATTCCAGTCTCTGGACCTGCCAGGTGTCTTAGCCAGTCCCGAAACCTGCTGAAGACCACAGATGACATGGTGAAGACGGCCAGAGAAAAACTGAAACATTATTCCTGCACTGCTGAAGACATCGATCATGAAGACATCACACGGGACCAAACCAGCACATTGAA GACCTGTTTACCACTGGAACTACACAAGAACGAGAGTTGCCTGGCTACTAGAGAGACTTCTTCCACAACAAGAGGGAGCTGCCTGCCCCCACAGAAGACGTCTTTGATGATGACCCTGTGCCTTGGTAGCATCTATGAGGACTTGAAGATGTACCAGACAGAGTTCCAGGCCATCAACGCAGCACTTCAGAATCACAACCATCAGCAGATCATTCTAGACAAGGGCATGCTGGTGGCCATCGATGAGCTGATGCAG TCTCTGAATCATAATGGCGAGACTCTGCGCCAGAAACCTCCTGTGGGAGAAGCAGACCCTTACAGAGTGAAAATGAAGCTCTGCATCCTGCTTCACGCCTTCAGCACCCGCGTCGTGACCATCAACAGGGTGATGGGCTATCTGAGCTCCGCCGGTTCCGGTGGCGGATCCGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCT TTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTG CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCG TCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGC GATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGA AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC CTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTC TTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTGAGCGATCGCTAAATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTA TTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTCAAAAAAAAAAAAAAAAAAAAAAACGCGTCGAGGGGAATTAATTCTTGAAGACGAAAGGGCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTT ATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCAT ACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGA CACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACAC GACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATC CTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTC GTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATC TTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGAGCTCTAATACGACTCACTATAG (SEQ ID NO: 4)

In some embodiments, the RNA-IL-12 replicon is fused to a serum albumin coding sequence. In some embodiments, the IL-12-albumin fusion molecule has a longer half-life in the tumor microenvironment. In some embodiments, the IL-12-albumin fusion protein may persist in the tumor microenvironment for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days or longer.

In some embodiments, the synthetic oncolytic virus comprises an LNP replicon RNA-IL-12-serum albumin. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-mtReplicon RNA-IL-12-serum albumin. The presence of persistent IL-12 in the tumor microenvironment may prolong the antitumor immune response induced by the synthetic oncolytic virus.

In some embodiments, the RNA-IL12-serum albumin replicon further comprises a coding sequence for lumican. Lumican is one of the major extracellular proteins in the interstitial extracellular matrix (ECM) of the skin, corneal stroma, sclera, aorta, muscle, lung, kidney, bone, cartilage, and intervertebral discs. It is a member of the small leucine-rich proteoglycan (SLRP) family, with a 30-50 kDa core protein containing a signal peptide, a negatively charged N-terminal domain, a highly conserved leucine-rich internal domain, and a carboxy-terminal domain. The protein core and glycan chains of lumican can interact with various cellular effectors, including cytokines, growth factors, and cell surface receptors, to modulate cell adhesion, proliferation, and migration. As an endogenous collagen binding protein, the presence of lumican in the tumor microenvironment may promote local retention of IL-12 to improve the efficacy and safety of tumor immunotherapy as described herein. In some embodiments, the RNA-IL-12-MSA replicon contains a coding sequence for lumican. In other embodiments, mtReplicon RNA-IL-12-MSA (mtRep-IL12-MSA) contains a coding sequence for lumican. An exemplary coding sequence for mtReplicon RNA-IL-12-MSA-lumican (mtRep-IL12-MSA-lumican) is set forth in SEQ ID NO: 5:

ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAATGACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGATCCTTGACATTGGAAGTGCGCCCGCCCGCA GAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGATGTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAGGAATTGGACAAGAAAATGAAGGAGCTGGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTCCACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGCTGTTTACCAGGATGTA TACGCGGTTGACGGACCGACAAGTCTCTATCACCAAGCCAATAAGGGAGTTAGAGTCGCCTACTGGATAGGCTTTGACACCACCCCTTTTATGTTTAAGAACTTGGCTGGAGCATATCCATCATACTCTACCAACTGGGCCGACGAAACCGTGTTAACGGCTCGTAACATAGGCCTATGCAGCTCTGACGTTATGGAGCGGTCACGTAGAGGGATGTCCATTCTTAGAAAGAAGTATTTGAAACCATCCAACAAT GTTCTATTCTCTGTTGGCTCGACCATCTACCACGAGAAGAGGGACTTACTGAGGAGCTGGCACCTGCCGTCTGTATTTCACTTACGTGGCAAGCAAAATTACACATGTCGGTGTGAGACTATAGTTAGTTGCGACGGGTACGTCGTTAAAAGAATAGCTATCAGTCCAGGCCTGTATGGGAAGCCTTCAGGCTATGCTGCTACGATGCACCGCGAGGGATTCTTGTGCTGCAAAGTGACAGACACATTGA ACGGGGAGAGGGTCTCTTTTCCCGTGTGCACGTATGTGCCAGCTACATTGTGTGACCAAATGACTGGCATACTGGCAACAGATGTCAGTGCGGACGACGCGCAAAAACTGCTGGTTGGGCTCAACCAGCGTATAGTCGTCAACGGTCGCACCCAGAGAAACACCAATACCATGAAAAATTACCTTTTGCCCGTAGTGGCCCAGGCATTTGCTAGGTGGGCAAAGGAATATAAGGAAGATCAAGAAGATG AAAGGCCACTAGGACTACGAGATAGACAGTTAGTCATGGGGTGTTGTTGGGCTTTTAGAAGGCACAAGATAACATCTATTTATAAGCGCCCGGATACCCAAACCATCATCAAAGTGAACAGCGATTTCCACTCATTCGTGCTGCCCAGGATAGGCAGTAACACATTGGAGATCGGGCTGAGAACAAGAATCAGGAAAATGTTAGAGGAGCACAAGGAGCCGTCACCTCTCATTACCGCGAGGACGTACAAG AAGCTAAGTGCGCAGCCGATGAGGCTAAGGAGGTGCGTGAAGCCGAGGAGTTGCGCGCAGCTCTACCACCTTTGGCAGCTGATGTTGAGGAGCCCACTCTGGAAGCCGATGTCGACTTGATGTTACAAGAGGCTGGGGCCGGCTCAGTGGAGACACCTCGTGGCTTGATAAAGGTTACCAGCTACGATGGCGAGGACAAGATCGGCTCTTACGCTGTGCTTTCTCCGCAGGCTGTACTCAAGAG TGAAAAATTATCTTGCATCCACCCTCTCGCTGAACAAGTCATAGTGATAACACACTCTGGCCGAAAAGGGCGTTATGCCGTGGAACCATACCATGGTAAAGTAGTGGTGCCAGAGGGACATGCAATACCCGTCCAGGACTTTCAAGCTCTGAGTGAAAGTGCCACCATTGTGTACAACGAACGTGAGTTCGTAAACAGGTACCTGCACCATATTGCCACACATGGAGGAGCGCTGAACACTGATGAAGAATATTAC AAAACTGTCAAGCCCAGCGAGCACGACGGCGAATACCTGTACGACATCGACAGGAAACAGTGCGTCAAGAAAGAACTAGTCACTGGGCTAGGGCTCACAGGCGAGCTGGTGGATCCTCCCTTCCATGAATTCGCCTACGAGAGTCTGAGAACACGACCAGCCGCTCCTTACCAAGTACCAACCATAGGGGTGTATGGCGTGCCAGGATCAGGCAAGTCTGGCATCATTAAAAGCGCAGTCACCCAAAAAAGATC TAGTGGTGAGCGCCAAGAAAGAAAACTGTGCAGAAATTATAAGGGACGTCAAGAAAATGAAAGGGCTGGACGTCAATGCCAGAACTGTGGACTCAGTGCTCTTGAATGGATGCAAACACCCCGTAGAGACCCTGTATATTGACGAAGCTTTTGCTTGTCATGCAGGTACTCTCAGAGCGCTCATAGCCATTATAAGACCTAAAAAGGCAGTGCTCTGCGGGGATCCCAAACAGTGCGGTTTTTT TAACATGATGTGCCTGAAAGTGCATTTTAACCACGAGATTTTGCACACAAGTCTTCCACAAAAGCATCTCTCGCCGTTGCACTAAATCTGTGACTTCGGTCGTCTCAACCTTGTTTTACGACAAAAAAATGAGAACGACGAATCCGAAAGAGACTAAGATTGTGATTGACACTACCGGCAGTACCAAACCTAAGCAGGACGATCTCATTCTCACTTGTTTCAGAGGGTGGGTGAAGCAGTTGCAAATAGATTACAAA CAACGAAATAATGACGGCAGCTGCCTCTCAAGGGCTGACCCGTAAAGGTGTGTATGCCGTTCGGTACAAGGTGAATGAAAATCCTCTGTACGCACCCACCTCAGAACATGTGAACGTCCTACTGACCCGCACGGAGGACCGCATCGTGTGGAAAACACTAGCCGGCGACCCATGGATAAAAACACTGACTGCCAAGTACCCTGGGAATTTCACTGCCACGATAGAGGAGTGGCAAGCAGCATGATGCCATCATGA GGCACATCTTGGAGAGACCGGACCCTACCGACGTCTTCCAGAATAAGGCAAACGTGTGTTGGGCCAAGGCTTTAGTGCCGGTGCTGAAGACCGCTGGCATAGACATGACCACTGAACAATGGAACACTGTGGATTATTTTGAAACGGACAAAGCTCACTCAGCAGAGATAGTATTGAACCAACTATGCGTGAGGTTCTTTGGACTCGATCTGGACTCCGGTCTATTTTCTGCACCCACTGTTCCGTTATCCATTA GGAATAATCACTGGGATAACTCCCCGTCGCCTAACATGTACGGGCTGAATAAAGAAGTGGTCCGTCAGCTCTCTCGCAGGTACCCACAACTGCCTCGGGCAGTTGCCACTGGAAGAGTCTATGACATGAACACTGGTACACTGCGCAATTATGATCCGCGCATAAACCTAGTACCTGTAAACAGAAGACTGCCTCATGCTTTAGTCCTCACCATAATGAACACCCACAGAGTGACTTTTCTTCATTCGTCAG CAAATTGAAGGGCAGAACTGTCCTGGTGGTCGGGGAAAAGTTGTCCGTCCCAGGCAAAATGGTTGACTGGTTGTCAGACCGGCCTGAGGCTACCTTCAGAGCTCGGCTGGATTTAGGCATCCCAGGTGATGTGCCCAAATATGACATAATATTTGTTAATGTGAGGACCCCATATAAATACCATCACTATCAGCAGTGTGAAGACCATGCCATTAAGCTTAGCATGTTGACCAAGAAAGCTTGTCTGCATCT GAATCCCGGCGGAACCTGTGTCAGCATAGGTTATGGTTACGCTGACAGGGCCAGCGAAAGCATCATTGGTGCTATAGCGCGGCAGTTCAAGTTTTCCCGGGTATGCAAACCGAAATCCTCACTTGAAGAGACGGAAGTTCTGTTTGTATTCATTCGGTACGATCGCAAGGCCCGTACGCACAATTCTTACAAGCTTTCATCAACCTTGACCAACATTTATACAGGTTCCAGACTCCACGAAGCCGATGTG CACCCTCATATCATGTGGTGCGAGGGGATATTGCCACGGCCACCGAAGGAGTGATTAAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGCTGTATAAGAAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGACTGGTCAAAGGTGCAGCTAAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTTCGGAGGTTGAAGGTGACAAACAG TTGGCAGAGGCTTATGAGTCCATCGCTAAGATTGTCAACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCATCTTTTCCGGAACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATGCAGATGTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGGCTAGGAGAGAAGCAGTGGAGGAGATATGCATATCCGACG ACTCTTCAGTGACAGAACCTGATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTTCTTTGGCTGGAAGGAAGGGCTACAGCACAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACCAGGCGGCCAAGGATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCATGTATATCCTCGGAGAAGGCATGAGCAGTATTAGGTCGAAATGCCCCGTC GAAGAGTCGGAAGCCTCCACACCACCTAGCACGCTGCCTTGCTTGTGCATCCATGCCATGACTCCAGAAAGAGTACAGCGCCTAAAAGCCTCACGTCCAGAACAAATTACTGTGTGCTCATCCTTTCCATTGCCGAAGTATAGAATCACTGGTGTGCAGAAGATCCAATGCTCCCAGCCTATATTGTTCTCACCGAAAGTGCCTGCGTATATTCATCCAAGGAAGTATCTCGTGGAAACACCACCGGTAGA CGAGACTCCGGAGCCATCGGCAGAGAACCAATCCACAGAGGGGACACCTGAACAACCACCACTTATAACCGAGGATGAGACCAGGACTAGAACGCCTGAGCCGATCATCATCGAAGAGGAAGAAGAGGATAGCATAAGTTTGCTGTCAGATGGCCCGACCCACCAGGTGCTGCAAGTCGAGGCAGACATTCACGGGCCGCCCTTGTATCTAGCTCATCCTGGTCCATTCCTCATGCATCCGACTTTGATGTG GACAGTTTATCCATACTTGACACCCTGGAGGGAGCTAGCGTGACCAGCGGGGCAACGTCAGCCGAGACTAACTCTTACTTCGCAAAGAGTATGGAGTTTCTGGCGCGACCGGTGCCTGCGCCTCGAACAGTATTCAGGAACCCTCCACATCCCGCTCCGCGCACAAGAACACCGTCACTTGCACCAGCAGGGCCTGCTCGAGAACCAGCCTAGTTTCCACCCCGCCAGGCGTGAATAGGGTGATC ACTAGAGAGGAGCTCGAGGCGCTTACCCCGTCACGCACTCCTAGCAGGTCGGTCTCGAGAACCAGCCTGGTCTCCAACCCGCCAGGCGTAAATAGGGTGATTACAAGAGAGGAGTTTGAGGCGTTCGTAGCACAACAACAATGACGGTTTGATGCGGGTGCATACATCTTTTCCTCCGACACCGGTCAAGGGCATTTACAACAAAAATCAGTAAGGCAAACGGTGCTATCCGAAGTGGTGTTGG AGGACCGAATTGGAATTTCGTATGCCCCGCGCCTCGACCAAGAAAAAGAAGAATTACTACGCAAGAAATTACAGTTAAATCCCACACCTGCTAACAGAAGCAGATACCAGTCCAGGAAGGTGGAGAACATGAAAGCCATAACAGCTAGACGTATTCTGCAAGGCCTAGGGCATTATTTGAAGGCAGAAGGAAAAGTGGAGTGCTACCGAACCCTGCATCCTGTTCCTTTGTATTCATCTAGTGTGAACCGTG CCTTTTCAAGCCCCAAGGTCGCAGTGGAAGCCTGTAACGCCATGTTGAAAGAGAACTTTCCGACTGTGGCTTCTTACTGTATTATTCCAGAGTACGATGCCTATTTGGACATGGTTGACGGAGCTTCATGCTGCTTAGACACTGCCAGTTTTTGCCCTGCAAAGCTGCGCAGCTTTCCAAAGAAACACTCCTATTTGGAACCCACAATACGATCGGCAGTGCCTTCAGCGATCCAGAACACGCTCCAGA ACGTCCTGGCAGCTGCCACAAAAAGAAATTGCAATGTCACGCAAATGAGAGAATTGCCCGTATTGGATTCGGCGGCCTTTAATGTGGAATGCTTCAAGAAATATGCGTGTAATAATGAATATTGGGAAACGTTTAAAGAAAACCCCATCAGGCTTACTGAAGAAAACGTGGTAAATTACATTACCAAATTAAAAGGACCAAAAGCTGCTGCTCTTTTTGCGAAGACACATAATTTGAATATGTTGCAGGACATACCAAT GGACAGGTTTGTAATGGACTTAAAGAGAGACGTGAAAGTGACTCCAGGAACAAAACATACTGAAGAACGGCCCAAGGTACAGGTGATCCAGGCTGCCGATCCGCTAGCAACAGCGTATCTGTGCGGAATCCACCGAGAGCTGGTTAGGAGATTAAATGCGGTCCTGCTTCCGAACATTCATACACTGTTTGATATGTCGGCTGAAGACTTTGACGCTATTATAGCCGAGCACTTCCAGCCTGGGGATTGTGTTCT GGAAACTGACATCGCGTCGTTTGATAAAAGTGAGGACGACGCCATGGCTCTGACCGCGTTAATGATTCTGGAAGACTTAGGTGTGGACGCAGAGCTGTTGACGCTGATTGAGGCGGCTTTCGGCGAAATTTCATCAATACATTTGCCCACTAAAACTAAATTTAATTCGGAGCCATGATGAAATCTGGAATGTTCCTCACACTGTTTGTGAACACAGTCATTAACATTGTAATCGCAAGCAGAGTGTTGAGAGAACGG CTAACCGGATCACCATGTGCAGCATTCATTGGAGATGACAATATCGTGAAAGGAGTCAAATCGGACAAATTAATGGCAGACAGGTGCGCCACCTGGTTGAATATGGAAGTCAAGATTATAGATGCTGTGGTGGGCGAGAAAGCGCCTTATTTCTGTGGAGGGTTTATTTTGTGTGACTCCGTGACCGGCACAGCGTGCCGTGTGGCAGACCCCCTAAAAAGGCTGTTTAAGCTTGGCAAACCTCTGGCAG CAGACGATGAACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGAACCGAGTGGGTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAGTC TAGCATATGGGCGCCCTCAGCATCGATTTGAATTGGCCACCATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCACGATGTGCCATGTGGGAGCTGGAGAAAGACGTTTATGTTGTAGAGGTGGACTGGACTCCCGATGCCCCTGGAGAAACAGTGAACCTCACCTGTGACACGCCTGAAGAAGATGACATCACCTGGACCTCAGACCAGAGACATGGAGTCATAGG CTCTGGAAAGACCCTGACCATCACTGTCAAAGAGTTTCTAGATGCTGGCCAGTACACCTGCCACAAAGGAGGCGAGACTCTGAGCCACTCACATCTGCTGCTCCACAAGAAGGAAAATGGAATTTGGTCCACTGAAATTTTAAAAAATTTCAAAACAAGACTTTCCTGAAGTGTGAAGCACCAAATTACTCCGGACGGTTCACGTGCTCATGGCTGGTGCAAAGAAACATGGACTTGAAGTTCAACATCAAGAGCAG TAGCAGTTCCCCTGACTCTCGGGCAGTGACATGTGGAATGGCGTCTCTGTCTGCAGAGAAGGTCACACTGGACCAAAGGGACTATGAGAAGTATTCAGTGTCCTGCCAGGAGGATGTCACCTGCCCAACTGCCGAGGAGACCCTGCCCATTGAACTGGCGTTGGAAGCACGGCAGCAGAATAAATATGAGAACTACAGCACCAGCTTCTTCATCAGGGACATCATCAAACCAGACCCGCCCAAGAACTTGCA GATGAAGCCTTTGAAGAACTCACAGGTGGAGGTCAGCTGGGAGTACCCTGACTCCTGGAGCACTCCCCATTCCTACTTCTCCCTCAAGTTCTTTGTTCGAATCCAGCGCAAGAAAGAAAAGATGAAGGAGACAGAGGAGGGGTGTAACCAGAAAGGTGCGTTCCTCGTAGAGAAGACATCTACCGAAGTCCAATGCAAAGGCGGGAATGTCTGCGTGCAAGCTCAGGATCGCTATTACAATTCCTCATGC AGCAAGTGGGCATGTGTTCCCTGCAGGGTCCGATCCGGAGGTTCCGGTGGTGGATCCGGAGGTGGCTCCGGCGGCGGATCCAGGGTCATTCCAGTCTCTGGACCTGCCAGGTGTCTTAGCCAGTCCCGAAACCTGCTGAAGACCACAGATGACATGGTGAAGACGGCCAGAGAAAAACTGAAACATTATTCCTGCACTGCTGAAGACATCGATCATGAAGACATCACACGGGACCAAACCAGCACATTGAA GACCTGTTTACCACTGGAACTACACAAGAACGAGAGTTGCCTGGCTACTAGAGAGACTTCTTCCACAACAAGAGGGAGCTGCCTGCCCCCACAGAAGACGTCTTTGATGATGACCCTGTGCCTTGGTAGCATCTATGAGGACTTGAAGATGTACCAGACAGAGTTCCAGGCCATCAACGCAGCACTTCAGAATCACAACCATCAGCAGATCATTCTAGACAAGGGCATGCTGGTGGCCATCGATGAGCTGATGCAG TCTCTGAATCATAATGGCGAGACTCTGCGCCAGAAACCTCCTGTGGGAGAAGCAGACCCTTACAGAGTGAAAATGAAGCTCTGCATCCTGCTTCACGCCTTCAGCACCCGCGTCGTGACCATCAACAGGGTGATGGGCTATCTGAGCTCCGCCGGTTCCGGTGGCGGATCCGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCT TTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTG CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCG TCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGC GATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGA AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC CTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTC TTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCGGCGGAGGTTCCGGTGGCGGATCCCAATACTATGACTACGATATACCCCTGTTCATGTACGGGCAATATCTCCAAACTGTGCA CCAGAATGTAACTGCCCTCACTCATACCCCACTGCAATGTACTGTGACGACCTGAAGTTGAAATCCGTGCCAATGGTGCCTCCTGGGATTAAGTACCTGTACCTCCGCAACAATCAGATCGACCATATTGACGAGAAGGCTTTTGAAAACGTCACAGACCTCCAGTGGCTTATCCTGGACCATAACCTGCTTGAAAATAGTAAGATAAAGGGCAAAGTATTTTCCAAACTTAAACAGCTTAAAAACTCCACATCA ACTACAATAACCTTACTGAATCCGTGGGACCATTGCCAAAATCTCTCCAAGATTTGCAGTTGACTAACAACAAGATATCCAAACTCGGCTCCTTCGATGGGCTGGTTAATCTGACTTTCATCTACTTGCAACACAACCAATTGAAGGAGGATGCAGTTTCAGCTAGTCTTAAAGGTCTGAAAAGCCTTGAGTATCTTGATCTGTCATTTAATCAAATGTCCAAGCTCCCTGCTGGGCTCCCAACAAGTCTGCTGA CACTCTATCTCGACAATAACAAGATAAGTAACATTCCCGATGAGTACTTTAAAAGATTTACCGGCCTCCAATACTTGCGGCTTTCTCACAACGAGTTGGCAGACTCTGGTGTACCCGGCAACTCCTTTAATATAAGTTCTCTTCTCGAGCTTGATTTGTCCTATAACAAACTGAAGAGTATCCCTACTGTCAATGAAAATTTGGAGAATTACTACCTCGAAGTCAATGAGCTTGAGAAGTTCGATGTTAAG TCTTTCTGTAAGATACTGGGTCCATTGTCATACAGCAAGATTAAACATCTTCGCTTGGATGGGAATCCCTTGACTCAAAGCTCACTTCCCCCGGACATGTACGAATGCCTGAGGGTAGCCAACGAAATCACAGTAAACGGAGGTGGCTCCTGAGCGATCGCTAAATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAA TCGGATTTTGTTTTTAATATTTCAAAAAAAAAAAAAAAAAAAAAAAACGCGTCGAGGGGAATTAATTCTTGAAGACGAAAGGGCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTT TGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCA ATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACT ATGGATGAACGAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTCTGCGCGTAAT CTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACT CAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCG TTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGAGCTCTAATACGACTCACTATAG (SEQ ID NO: 5)

In some embodiments, the synthetic oncolytic virus comprises an RNA-IL-12-serum albumin-lumican LNP replicon. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin-lumican. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-mtReplicon RNA-IL-12-serum albumin-lumican. Retention of IL-12 in the tumor microenvironment may improve the efficacy and safety of synthetic oncolytic virus.

In some cases, the replicon RNA may contain one or more gene(s) of experimental or therapeutic interest. In some embodiments, the gene(s) of experimental or therapeutic interest encode cytokines, chemokines, or growth factors other than IL-12. Cytokines are known in the art, and the term refers to a generalized group of small proteins that are secreted by specific cells in the immune system and have an effect on other cells. Cytokines are known to enhance the cellular immune response and, within the scope of the invention, may include, but are not limited to, TNFα, IFN-γ, IFN-α, TGF-β, IL-1, IL-2, IL-4, IL- 10, IL-13, IL-17, IL-18 and chemokines. Chemokines are useful for studies studying response to infection, immune responses, inflammation, trauma, sepsis, cancer, and reproduction, among other applications. Chemokines are known in the art and are a type of cytokine that induces chemotaxis of neighboring responding cells, typically leukocytes, to sites of infection. Non-limiting examples of chemokines include CCL14, CCL19, CCL20, CCL21, CCL25, CCL27, CXCL12, CXCL13, CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL11 and CXCL10. Growth factors are known in the art, and the term itself is sometimes used interchangeably with the term cytokines. As used herein, the term "growth factors" refers to natural substances capable of transmitting signals between cells and stimulating cell growth. While cytokines can be growth factors, specific types of cytokines can also have an inhibitory effect on cell growth, thus distinguishing the two terms. Non-limiting examples of growth factors include adrenomedullin (AM), angiopoietin (Ang), autocrine migration factor, bone morphogenetic proteins (BMP), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), interleukin-6 (IL-6), macrophage colony-stimulating factor (m-CSF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), epidermal growth factor (EGF), ephrin A1, ephrin A2, ephrin A3, ephrin A4, ephrin A5, ephrin B1, ephrin B2, ephrin B3, erythropoietin (EPO), fibroblast growth factor 1 (FGF1), fibroblast growth factor 2 (FGF2), fibroblast growth factor 3 (FGF3), fibroblast growth factor 4 (FGF4), fibroblast growth factor 5 (FGF5), fibroblast growth factor 6 (FGF6), fibroblast growth factor 7 (FGF7), fibroblast growth factor 8 (FGF8), fibroblast growth factor 9 (FGF9), fibroblast growth factor 10 (FGF10), fibroblast growth factor 11 (FGF11 ), fibroblast growth factor 12 (FGF12), fibroblast growth factor 13 (FGF13), fibroblast growth factor 14 (FGF14), fibroblast growth factor 15 (FGF15), fibroblast growth factor 16 (FGF16), fibroblast growth factor 17 (FGF17), fibroblast growth factor 18 (FGF18), fibroblast growth factor 19 (FGF19), fibroblast growth factor 20 (FGF20), fibroblast growth factor 21 (FGF21), fibroblast growth factor 22 (FGF22), fibroblast growth factor 23 (FGF23), fetal bovine somatotropin (FBS), glial cell line-derived neurotrophic factor (GDNF), neurturin, persefin, artemin, growth and differentiation factor-9 (GDF9), hepatocyte growth factor (HGF), hepatoma-derived growth factor (HDGF), insulin, insulin-like growth factor-1 (IGF-1), insulin-like growth factor-2 (IGF-2), interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6 , IL-7, keratinocyte growth factor (KGF), migration stimulating factor (MSF), macrophage stimulating protein (MSP), myostatin (GDF-8), neuroregulin 1 (NRG1), neuroregulin 2 (NRG2), neuroregulin 3 (NRG3) , neuroregulin 4 (NRG4), brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neutrophin-3 (NT-3), neutrophin-4 (NT-4), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-β), tumor necrosis factor-alpha (TNF -α) and vascular endothelial growth factor (VEGF).

II. Pharmaceutical compositions

In some aspects, the present invention, at least in part, relates to a pharmaceutical composition containing a synthetic oncolytic virus, as described herein. The pharmaceutical composition described herein may further comprise a pharmaceutically acceptable carrier (excipient) to form a pharmaceutical composition for use in treating the target disease. "Acceptable" means that the carrier must be compatible with the active ingredient of the composition (and preferably capable of stabilizing the active ingredient) and must not be harmful to the subject being treated. Pharmaceutically acceptable excipients (carriers) include buffers well known in the art. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. K.E. Hoover.

Pharmaceutical compositions intended for use for in vivo administration must be sterile. This is easily achieved, for example, by filtration through sterile filtration membranes. The compositions containing the synthetic oncolytic virus can be placed in a container having a sterile access opening, such as an intravenous solution bag or a vial having a stopper pierced by a hypodermic needle.

In some embodiments, a pharmaceutical composition for use in the present invention may be formulated for intratumoral injection. Intratumoral injection, within the scope of the invention, refers to direct injections into a tumor of an antitumor composition (eg, an immunostimulating synthetic oncolytic virus). High concentrations of the composition can be achieved in situ , while using small quantities of drugs. Local delivery of immunotherapies allows multiple combinations of therapies while preventing significant systemic exposure and nonspecific toxicity.

In other embodiments, the pharmaceutical composition can be formulated for intramuscular injection, intravenous injection, or subcutaneous injection.

Pharmaceutical compositions for use in the methods of the present invention may contain pharmaceutically acceptable carriers, buffers, excipients, salts or stabilizers in the form of lyophilized formulations or aqueous solutions. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. K.E. Hoover). Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the doses and concentrations used, and may contain buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride; hexamethetonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight polypeptides (less than about 10 residues); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates, including glucose, mannose or dextrans; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (eg Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).

In some examples, the pharmaceutical composition described herein contains lipid nanoparticles, which can be prepared by methods known in the art, such as those described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980); and US Patent No. 4,485,045 and 4,544,545. Extended circulation time liposomes are described in US Pat. No. 5,013,556 Particularly useful liposomes can be prepared by a reverse phase evaporation process using a lipid composition containing phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of specific pore sizes to obtain liposomes with the desired diameter.

In other examples, the pharmaceutical composition described herein can be formulated in a sustained release format. Suitable examples of sustained release formulations include semi-permeable matrices of solid hydrophobic polymers containing a synthetic oncolytic virus, where the matrices are in the form of molded articles, for example films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (eg, poly(2-hydroxyethyl methacrylate), or poly(vinyl alcohol)), polylactides (US Pat. No. 3,773,919), copolymers of L-glutamic acid and 7-ethyl-L- glutamate, non-degradable ethylene vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres consisting of lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate and poly-D-(-)- 3-hydroxybutyric acid.

Suitable surfactants include, in particular, non-ionic agents such as polyoxyethylene sorbitans (eg TWEEN™ 20, 40, 60, 80 or 85) and other sorbitans (eg SPAN™ 20, 40, 60, 80 or 85). Surfactant compositions may conveniently contain between 0.05 and 5% surfactant, and this may be between 0.1 and 2.5%. It will be understood that other ingredients, such as mannitol or other pharmaceutically acceptable carriers, can be added as necessary.

The pharmaceutical compositions described herein can be formulated in unit dosage forms, such as tablets, pills, capsules, powders, granules, solutions or suspensions, or suppositories, for oral, parenteral or rectal administration, or administration by inhalation or insufflation.

To prepare solid compositions such as tablets, the main active ingredient can be mixed with a pharmaceutical carrier, for example with conventional tabletting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium or gum phosphate, and with other pharmaceutical diluents, for example with water, to form a preliminary solid composition containing a homogeneous mixture of a compound of the present invention or a non-toxic pharmaceutically acceptable salt thereof. By referring to these pre-formulations as homogeneous, it is meant that the active ingredient is uniformly distributed throughout the composition such that the composition can be readily divided into equally effective unit dosage forms such as tablets, pills and capsules. This solid preformulation is then divided into unit dosage forms of the type described above, containing from 0.1 to about 500 mg of the active ingredient of the present invention. Tablets or pills of the novel composition may be coated or otherwise mixed to provide a dosage form that provides extended-release benefits. For example, a tablet or pill may comprise an inner dosage component and an outer dosage component, the latter being in the form of a shell over the former. These two components may be separated by an enteric layer, which serves to resist disintegration in the stomach and allow the internal component to pass intact into the duodenum or delay its release. A variety of materials can be used for such enteric layers or coatings, where such materials include a number of polymer acids and mixtures of polymer acids with materials such as shellac, cetyl alcohol and cellulose acetate.

Suitable emulsions can be prepared using commercially available fat emulsions such as INTRALIPID™, LIPOSYN™, INFONUTROL™, LIPOFUNDIN™ and LIPIPHYSAN™. The active ingredient can either be dissolved in the premixed emulsion composition, or alternatively, it can be dissolved in an oil (eg soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil or almond oil) and an emulsion can be formed by mixing with a phospholipid (eg egg phospholipids, soy phospholipids or soy lecithin) and water. It should be understood that other ingredients, such as glycerin or glucose, can be added to adjust the tonicity of the emulsion. Suitable emulsions may generally contain up to 20% oil, for example between 5 and 20%. The fat emulsion may contain fat droplets of suitable size and may have a pH in the range of 5.5-8.0.

Pharmaceutical compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents or mixtures thereof, and powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described above. In some embodiments, the compositions are administered through the oral or nasal respiratory route for local or systemic effect.

The compositions in preferably sterile pharmaceutically acceptable solvents can be nebulized using gases. Nebulized solutions may be inhaled directly from the nebulization device, or the nebulization device may be attached to a face mask, tent, or intermittent positive pressure breathing apparatus. The solution, suspension or powder compositions can be administered, preferably orally or nasally, from devices that deliver the composition in an appropriate manner.

III. Therapeutic Applications

The pharmaceutical compositions described herein containing a synthetic oncolytic virus can be used for the treatment of a malignant tumor, for example, for immunotherapy of malignant tumors.

To practice the method described herein, an effective amount of any of the pharmaceutical compositions described herein can be administered to a subject in need of treatment (e.g., a human) by a suitable route, e.g., by intratumoral administration, by intravenous administration, e.g. in bolus form or by continuous infusion over a period of time, via intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, intrathecal, oral, inhalation or topical routes. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, can be used for administration. Liquid formulations can be sprayed directly, and lyophilized powder can be sprayed after dilution. Alternatively, the synthetic oncolytic virus-containing pharmaceutical composition can be aerosolized using a fluorocarbon formulation and a metered dose inhaler, or administered by inhalation in the form of a lyophilized and milled powder. In some examples, the pharmaceutical composition described herein is formulated for intratumoral injection. In specific examples, the pharmaceutical composition can be administered to a subject (eg, a human patient) via a local route, for example, injection into a local site, such as a tumor site or an infection site.

As used herein, an “effective amount” refers to the amount of each active ingredient required to produce a therapeutic effect in a subject, either alone or in combination with one or more other active ingredients. In some embodiments, the therapeutic effect is a decrease in tumor burden, a decrease in the number of cancer cells, or increased immune activity. Determining whether a quantity of a synthetic oncolytic virus achieves a therapeutic effect will be apparent to one skilled in the art. Effective amounts will vary, as will be known to one skilled in the art, depending on the specific condition being treated, the severity of the condition, individual patient characteristics including age, physical condition, height, sex and weight, duration of treatment, nature of concomitant therapy (if present) , the specific route of administration and similar factors within the knowledge and competence of the healthcare professional. These factors are well known to one of ordinary skill in the art and can be taken into account using no more than conventional experimentation. Generally, it is preferable that the maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose, in accordance with the informed physician's judgment.

Empirical considerations such as half-life may generally contribute to dose determination. The frequency of administration can be determined and adjusted during therapy, and is typically, but not necessarily, based on treatment and/or suppression and/or alleviation and/or delay of the target disease/disorder. Alternatively, compositions for sustained continuous release of synthetic oncolytic virus may be suitable. Various formulations and devices for achieving sustained release are known in the art.

In some embodiments, the treatment is a single injection of a pharmaceutical composition containing a synthetic oncolytic virus. In some embodiments, a single injection is administered intratumorally to a subject in need thereof.

In some examples, dosages for a synthetic oncolytic virus as described herein can be determined empirically in individuals who have received one or more administration(s) of the synthetic oncolytic virus. Individuals are administered stepwise increasing doses of a pharmaceutical composition containing a synthetic oncolytic virus. To evaluate the effectiveness of a synthetic oncolytic virus, a disease/impairment score can be monitored. For repeated administrations over several days or longer, depending on the condition, treatment is continued until the desired suppression of symptoms occurs or until sufficient therapeutic levels are achieved to relieve the target disease or disorder or symptom thereof.

In some embodiments, the dosing frequency is once every week, every 2 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once every month, every 2 months or every 3 months, or longer. The progress of this therapy is easily monitored by conventional methods and assays. The synthetic oncolytic virus dosing regimen used can be changed over time.

In some embodiments, the method described herein includes administering to a subject in need of treatment (eg, a human patient) single or multiple doses of a synthetic oncolytic virus-containing pharmaceutical composition.

For purposes of the present invention, the appropriate dose of the synthetic oncolytic virus as described herein may depend on the specific synthetic oncolytic virus, the type and severity of the disease/disorder, whether the synthetic oncolytic virus is administered for prophylactic or therapeutic purposes, prior therapy, clinical the patient's medical history and response to the synthetic oncolytic virus, and the decision of the treating physician. The health care professional may administer the synthetic oncolytic virus until a dose is reached that achieves the desired result. In some embodiments, the desired result is a decrease in tumor burden, a decrease in the number of cancer cells, or an increase in immune activity. Methods for determining whether a dose has produced the desired result will be apparent to one skilled in the art. Administration of one or more synthetic oncolytic viruses may be continuous or intermittent, depending, for example, on the physiological state of the recipient, whether the purpose of administration is therapeutic or prophylactic, and other factors known to one skilled in the art. Administration of the synthetic oncolytic virus may be substantially continuous over a preselected period of time, or may be administered in a series of spaced doses, for example, before, during, or after the development of the target disease or disorder.

As used herein, the term “treatment” refers to the application or administration of a composition comprising one or more active ingredients to a subject having the target disease or disorder, a symptom of the disease/disorder, or a predisposition to the disease/disorder, for the purpose of curing, healing, alleviating, mitigating, modifying, eliminating, reducing, improving or influencing a disorder, a symptom of a disease, or a predisposition to a disease or disorder.

Alleviation of the target disease/disorder includes delaying the development or progression of the disease, or reducing the severity of the disease. Alleviation of disease does not necessarily require curative results. As used herein, “delaying” the development of a target disease or disorder means shifting, inhibiting, slowing, containing, stabilizing, and/or delaying the progression of the disease. This delay may be of varying lengths of time depending on the medical history and/or the individuals being treated. A method that “delays” or facilitates the development of a disease, or delays the onset of a disease, is a method that reduces the likelihood of developing one or more symptoms of a disease in a given time frame and/or reduces the severity of symptoms in a given time frame, compared to not using the method . Such comparisons are typically based on clinical studies using a sufficient number of subjects to obtain a statistically significant result.

“Development” or “progression” of a disease refers to the initial manifestations and/or subsequent progression of the disease. Disease progression can be detected and assessed using standard clinical techniques, as is well known in the art. However, development also refers to progression that may not be detectable. For purposes of the present invention, development or progression refers to the biological course of symptoms. “Development” includes occurrence, relapse and onset. For purposes of the invention, “onset” or “occurrence” of a target disease or disorder includes initial onset and/or relapse.

In some embodiments, a synthetic oncolytic virus-containing pharmaceutical composition as described herein is administered to a subject in need of treatment in an amount sufficient to reduce tumor burden or cancer cell growth by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more) in vivo . In other embodiments, synthetic oncolytic virus-containing pharmaceutical compositions as described herein can be administered in an amount effective to increase immune activity by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more.

The subject to be treated by the methods described herein may be a mammal such as humans, farm animals, sporting animals, pets, primates, horses, dogs, cats, mice and rats. In one embodiment, the subject is a human. A synthetic oncolytic virus-containing composition as described herein can be used to enhance immune activity, eg, T cell activity, in a subject in need of such treatment.

In some embodiments, the subject may be a human patient suspected of having, or at risk of, cancer. Non-limiting examples of malignant tumors include melanoma, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung carcinoma, peritoneal malignancy, hepatic cell carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer , liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, prostate cancer, cancer of the female external genitalia, thyroid cancer, liver carcinoma, stomach cancer and various types of head and neck cancer, including squamous cell carcinoma of the head and neck. In some embodiments, the cancer may be melanoma, lung cancer, colorectal cancer, renal cell cancer, urothelial carcinoma, or Hodgkin's lymphoma.

A subject having a target disease or disorder (eg, cancer) can be identified through routine medical testing, such as laboratory tests, organ function tests, CT scans, or ultrasound studies. A subject suspected of having any of such target diseases/disorders may exhibit one or more symptoms of the disease/disorder. A subject at risk for a disease/disorder may be a subject having one or more of the risk factors associated with that disease/disorder. Such a subject may also be identified through conventional medical practice.

In some embodiments, the synthetic oncolytic virus-containing pharmaceutical composition may be used in conjunction with another suitable drug (e.g., an anticancer agent, an antiviral agent, or an antibacterial agent) and/or other agents that serve to enhance and/or complement the immunostimulatory effect of the synthetic oncolytic virus . In such a combination therapy, the synthetic oncolytic virus-containing composition and an additional drug (eg, an anticancer drug or others described herein) can be administered to a subject in need of treatment in a sequential manner, i.e., each drug is administered at a different time . Alternatively, these drugs, or at least two of the drugs, are administered to the subject in a substantially simultaneous manner.

Combination therapy may also include the administration of agents described herein (eg, a synthetic oncolytic virus-containing pharmaceutical composition and an anticancer agent) in additional combination with other biologically active ingredients (eg, an excellent anticancer agent) and non-drug therapies (eg, surgery).

It should be understood that any combination of a synthetic oncolytic virus-containing composition and another anticancer agent (eg, a chemotherapeutic agent) can be used in any sequence to treat a cancer. The combinations described herein may be selected based on a number of factors, which include, but are not limited to, effectiveness in reducing tumor formation or tumor growth, reducing the number of malignant tumor cells, increasing immune activity, and/or alleviating at least one symptom associated with with a malignant tumor, or effectiveness in reducing the side effects of another drug in the combination. For example, the combination therapy described herein may reduce any of the side effects associated with each of the individual members of the combination, for example, a side effect associated with an anticancer agent.

In some embodiments, the other anticancer drug is chemotherapy, radiotherapy, surgical therapy, and/or immunotherapy. Examples of chemotherapeutic agents include, but are not limited to, carboplatin or cisplatin, docetaxel, gemcitabine, Nab-paclitaxel, paclitaxel, pemetrexed and vinorelbine. Examples of radiotherapy include, but are not limited to, ionizing radiation, gamma irradiation, neutron beam radiotherapy, electron beam radiotherapy, proton therapy, brachytherapy, systemic radioactive isotopes and radiosensitizing agents. Examples of surgical therapy include, but are not limited to, curative surgery (eg, surgery to remove a tumor), prophylactic surgery, laparoscopic surgery, and laser surgery. Examples of immunotherapies include, but are not limited to, adoptive cell transfer and therapeutic cancer vaccines.

Additional examples of chemotherapy include, but are not limited to, platinum-containing agents such as carboplatin, oxaliplatin, cisplatin, nedaplatin, satraplatin, lobaplatin, triplatin, tetranitrate, picoplatin, prolindac, aroplatin and other derivatives; topoisomerase I inhibitors such as camptothecin, topotecan, irinotecan/SN38, rubitecan, belotecan and other derivatives; topoisomerase II inhibitors such as etoposide (VP-16), daunorubicin, doxorubicin agent (eg, doxorubicin, doxorubicin HCl, doxorubicin analogs, or doxorubicin and its salts or liposome analogs), mitoxantrone, aclarubicin, epirubicin, idarubicin, amrubicin, amsacrine , pirarubicin, valrubicin, zorubicin, teniposide and other derivatives; antimetabolites such as the folic acid family (methotrexate, pemetrexed, raltitrexide, aminopterin and related compounds); purine antagonists (thioguanine, fludarabine, cladribine, 6-mercaptopurine, pentostatin, clofarabine and related compounds) and pyrimidine antagonists (cytarabine, floxuridine, azacitidine, tegafur, carmofur, capacitabine, gemcitabine, hydroxyurea, 5-fluorouracil (5FU) and related compounds) ; alkylating agents such as nitrogen mustards (eg, cyclophosphamide, melphalan, chlorambucil, mechlorethamine, ifosfamide, trofosfamide, prednemustine, bendamustine, uramustine, estramustine and related compounds); nitrosourea (eg, carmustine, lomustine, semustine, fotemustine, nimustine, ranimustine, streptozocin and related compounds); triazenes (eg, decarbazine, altretamine, temozololmide, and related compounds); alkylsulfonates (eg busulfan, mannosulfan, threosulfan and related compounds); procarbazine; mitobronitol and aziridines (eg, carboquone, triaziquone, thiotepa, triethylenemelamine and related compounds); antibiotics such as hydroxyurea, anthracyclines (eg doxorubicin, daunorubicin, epirubicin and other derivatives); anthracenediones (eg mitoxantrone and related compounds); Streptomyces family (eg, bleomycin, mitomycin C, actinomycin, plicamycin); and ultraviolet light.

III. Kits for use in therapy

The present invention also provides kits for use in immunotherapy against a malignant tumor (eg, melanoma, lung cancer, colorectal cancer or renal cell cancer), and/or in the treatment or reduction of the risk of a malignant tumor. Such kits may include one or more containers containing a pharmaceutical composition containing a synthetic oncolytic virus, for example, any of the compositions described herein.

In some embodiments, the kit may contain instructions for use in accordance with any of the methods of the invention described herein. For example, the included instructions may describe the administration of a synthetic oncolytic virus-containing composition to treat, delay the onset of, or alleviate a target disease, such as those described herein. The kit may further comprise a description of selecting an individual suitable for treatment based on identifying whether the individual has the target disease. In other embodiments, the instructions include a description of administering the synthetic oncolytic virus-containing composition to an individual at risk of the target disease.

Instructions related to the use of the synthetic oncolytic virus-containing composition generally include information regarding dosage, dosing schedule, and method of administering the intended treatment. Containers may be unit doses, bulk packages (eg, multiple dose packages), or subunit doses. The instructions provided in the kits of the invention are typically written instructions on a label or package insert (eg, a piece of paper included in the kit), however, machine-readable instructions (eg, instructions printed on a magnetic or optical storage device) are also are acceptable.

The label or package insert states that the composition is intended to treat, delay the onset of, and/or alleviate a disease or disorder associated with cancer, such as those described herein. Instructions may be provided for the practice of any of the methods described herein.

The kits of the present invention are provided in suitable packaging. Suitable packaging includes, but is not limited to, vials, carboys, jars, flexible packaging (eg, sealed mylar or plastic bags), and the like. Packages are also provided for use in combination with a specific device, such as an inhaler, a nasal administration device (eg, a nebulizer), or an infusion device such as a mini-pump. The kit may have a sterile access port (eg, the container may be an intravenous solution bag or a vial having a stopper pierced by a hypodermic needle). The container may also have a sterile access opening (eg, the container may be an intravenous solution bag or a vial having a stopper pierced by a hypodermic needle). At least one active ingredient in the composition is a synthetic oncolytic virus-containing composition such as those described herein.

Sets may optionally provide additional components, such as buffers, and explanatory information. Typically the kit contains a container and a label or package insert(s) on or associated with the container. In some embodiments, the invention relates to articles containing the contents of the kits described above.

IV. General methods

In the practical implementation of the present invention, unless otherwise indicated, conventional methods of molecular biology (including recombinant methods), microbiology, cell biology, biochemistry and immunology, which are within the competence of a person skilled in the art, are used. Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., 1998) Academic Press; Animal Cell Culture (R.I. Freshney, ed., 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J.D. Capra, eds., Harwood Academic Publishers, 1995). It is believed that, without further clarification, a person skilled in the art can, based on the above description, use the present invention to its fullest extent.The following specific embodiments, therefore, should be considered only as illustrative, and not at all limiting the remainder of the description in any way.

The contents of all publications cited herein are provided by reference for the purpose or subject matter referred to herein.

It is believed that, without further elaboration, one skilled in the art can, based on the above description, use the present invention to its fullest extent. The following specific embodiments are, therefore, to be considered as illustrative only, and not at all limiting the remainder of the description in any way. The contents of all publications cited herein are provided by reference for the purpose or subject matter referred to herein.

EXAMPLES

Materials and methods

Cell lines and animals

The cell lines were B16F10 (ATCC® CRL-6475™), HEK-blue-TLR2 (Invivogen), HEK-blue-TLR3 (Invivogen), HEK-blue-TLR7 (Invivogen), HEK-blue-TLR9 (Invivogen), Raw-Lucia ISG (Invivogen) and were cultured following the supplier's instructions (37°C, 5% CO ₂ ). Female C57BL/6J mice (JAX Stock No. 000664) 6–8 weeks old were purchased and maintained in the animal facility at the Massachusetts Institute of Technology (MIT). All studies and animal procedures were conducted following federal, state, and local guidelines and the MIT Institutional Animal Care and Use Committee's IACUC-approved animal protocol.

Antibodies, staining and FACS analysis

Antibodies against mouse Ly6c (HK1.4), CD11b (M1/70), CD11c (N418), F4/80 (BM8), MHC-II (M5/114.15.2), CD45 (30-F11), CD3 (17A2 ), CD4 (GK1.5), CD8 (53-6.7), NK1.1 (PK136), CD45.2 (104), CD24 (30-F1), XCR1 (ZET), CD64 (X54-5/7.1) were from Biolegend. Antibodies against mouse Ly6G (1A8), CD16/32 (2.4G2), and CD103 (M290) were from BD Biosciences. Anti-mouse calreticulin antibody (ab2907) was from Abcam. Live/dead cell dye (L34966) was from ThermoFisher.

B16F10 melanoma tumor-bearing mice were sacrificed and necropsied following federal, state, and local guidelines and the MIT Animal Care and Use Committee's IACUC-approved animal handling protocol. Tumor-draining lymph nodes were then minced, and tumors were cut and digested using collagenase IV (1 mg/ml) for one hour to obtain a single-cell suspension. Single cell suspensions were filtered through a 70 μm nylon stopper and stained as described ¹⁰ .

Stained samples were analyzed using a FACS analyzer (LSR-II or LSR-II-Fortessa) from BD Biosciences. Analyzed using a BD-LSRII Fortessa analyzer. All flow cytometry data were analyzed using FlowJo (Flowjo LLC), and graphs were generated using GraphPad Prism.

Constructions, transcription in vitro , capping/methylation for replicon RNA and Neon transfection

The backbones of the mutant replicon constructs were derived from in vitro evolution in a previous study (edited). IL12-MSA and IL12-MSA-lumican were amplified from plasmids from the laboratory of Prof. Dane Wittrup, and constructed in the subgenomic region of the mutant replicon.

RNA replicons were in vitro transcribed (IVT) from the templates of the linearized VEE constructs above using the MEGAscript™ T7 Transcription Kit (ThermoFisher) following the manufacturer's instructions. The resulting RNA replicons were capped and methylated using the ScriptCap™ m7G capping system and the ScriptCap™ 2'-O-methyltransferase kit (Cellscript), according to the manufacturer's instructions. RNA purity was assessed by gel electrophoresis.

In vitro transfections were performed using 5 μg of RNA per 500,000 cells in 100 μl of buffer R from the NEON electroporation kit (ThermoFisher) under conditions of 1200 volts, 20 milliseconds, and 1 pulse.

Lipid Nanoparticle Formulations and Replicon RNA Encapsulation

To encapsulate 10 μg replicon RNA into a DOTAP nanoparticle, a lipid mixture consisting of 16.9375 μl DOTAP (Avanti, cat. #890890, 10 mg/ml), 15.965 μl DSPC (Avanti, cat. #850365, 3 mg/ml ), 18.7675 µl cholesterol (Sigma-Aldrich, cat. #C8667, 6 mg/ml), 13.6 µl DSPE-PEG2000 (Avanti, cat. #880128, 2.5 mg/ml) in a molar ratio of 40: 10:48:2 was prepared in ethanol and evaporated under N ₂ until one third of the total starting volume remained. Then, 10 μg replicon RNA (1 mg/ml) in 11.8 μl 0.1 M citrate buffer (PH 6.0) was added using pipetting, followed by a second addition of an additional 22 μl 0.1 M citrate buffer (PH 6. 0) using pipetting. The mixture was shaken for an hour and then dialyzed against PBS for a further hour at 25°C in a 3500 MWCO dialysis cassette.

Encapsulation of the RNA replicon into a Lipofectamine nanoparticle was carried out following the instructions for the Lipofectamine™ MessengerMAX™ transfection reagent (thermofisher.com/order/catalog/product/LMRNA008).

To encapsulate 10 μg replicon RNA into a TT3 nanoparticle, a lipid mixture consisting of 10 μl TT3 (10 mg/ml) ¹¹ , 8.04 μl DOPE (Avanti, cat. # 850725, 10 mg/ml), 5.572 μl cholesterol ( Sigma-Aldrich, cat. #C8667, 10 mg/ml), 3.452 µl C14-PEG2000 (Avanti, cat. # 880150, 2 mg/ml) in a molar ratio of 20:30:40:0.75, was prepared in 10.437 µl ethanol 4.167 μl of citrate buffer (PH 3.0, 10 mM) was added to the mixture. Then, 10 μg of replicon RNA (1 mg/ml) in 31.667 μl of citrate buffer (PH 3.0, 10 mM) was added using pipetting. The mixture was dialyzed against PBS for 80 min at 25°C in a 3500 MWCO dialysis cassette.

The resulting replicon-loaded lipid nanoparticles were aliquoted in appropriate doses for intratumoral injection (10 μg/mouse) and in vitro transfection (5 μg/0.5 million cells in 500 μl media).

Annexin V/PI staining, ATP and Elisa assay

For Annexin V/PI staining, instructions from the Biolegend kit (cat. #640932) were followed. Extracellular ATP was analyzed using the ENLITEN ^® ATP Assay System (Promega). HMGB1, CCL5, IFNα2, IL12, IFNγ were measured using ELISA kits from Chondrex (cat. #6010, HMGB1), R&D System (cat. #DY478, CCL5), Abcam (cat. #ab215409, IFNα2) and Biolegend ( Cat #88-7121-88, IL12, Cat #88-7314-88, IFNγ) and following their guidelines.

RNA extraction and quantitative PCR analysis

To quantify RNA transcript levels, total RNA was isolated from cells or tumors transfected with LNP replicon RNA as indicated and reverse transcribed using the TaqMan™ Reverse Transcription Reagent Kit (ABI, Cat. No. N8080234), followed by amplification using ready-mix Sybr Green (Roche) and specific primers for Stat1 (cat. #MP215434), Stat2 (cat. #MP215434), IRF9 (cat. #MP206708), IRF3 (cat. #MP206702), cGAS (cat. # MP214711) and detected using a Roche LightCycler 480. Ct values were normalized using the mouse actin B housekeeping gene for comparison.

Example 1: Synthetic “all-in-one” LNP-replicon RNA for immunotherapy of a malignant tumor

Therapeutic modalities can be simplified and therapeutic efficacy can be multiplied by synthetic multifunctional lipid nanoparticles (LNPs) encapsulating replicon RNA, with a lipid component and an RNA component each playing multiple roles: a lipid composition that both stimulates cellular uptake/cytosolic delivery of RNA and and also at the same time directly triggers immunogenic cell death. In tandem, this LNP delivers a self-amplifying replicon RNA that both encodes immunomodulatory therapeutic proteins and directly provides immunostimulation, enhancing the subsequent immune response. Functionally, this synthetic LNP replicon RNA should induce local immunogenic cell death in the tumor and also express an immunomodulatory agent well in transfected cells. Immunogenic cell death may enhance tumor infiltration by immunocytes and provide a reservoir of tumor-specific antigens that can be cross-presented to prime new T cell responses. LNP formulations containing the cationic lipid TT3 have been identified as particularly suitable for these purposes: 3 cationic lipid nanoparticles, each containing the key cationic lipid DOTAP, Lipofectamine (Lipo) or TT3. An alphavirus replicon derived from the Venezuelan equine encephalitis virus, where the structural proteins are replaced by a gene of interest cargo inserted under a subgenomic promoter, was used as an RNA carrier. When formulated with this self-amplifying RNA replicon (LNP-mtRep), the lipid compounds DOTAP, Lyrl, and TT3 formed particles with average nanoparticle diameters of 97, 46, and 105 nm, with zeta potentials of +22.9, -6.7, and +4. 3 mV, respectively (Fig. 1G-1H). The toxicity of empty versus RNA-loaded (mtRep) LNPs was assessed by incubating each formulation with B16F10 melanoma tumor cells in vitro . This analysis revealed that viability was significantly reduced for cells treated with TT3-LNP, and mtRep synergized with TT3 to promote additional tumor cell killing at 3 days post-transfection (Fig. 1A). TT3-LNP was more effective than DOTAP or Lipo in promoting tumor cell death. Notably, electroporation of the replicon directly into tumor cells was relatively nontoxic, indicating that cell killing was stimulated by LNP delivery. To determine whether TT3-delivered LNP replicons can drive cargo gene expression prior to cell death, we assessed GFP reporter gene expression following LNP(mtRep) treatment. TT3-mtRep treatment resulted in GFP expression in ~35.4% of B16F10 cells 12 hours post-transfection, lower than electroporation (~90%) but significantly better than DOTAP-mtRep treatments (~0.05%) or Lipo-mtRep (~7.6%) (Fig. 1B). Consistent with Figure 1A, cells transfected with TT3 nanoparticles showed a large population of annexin V+/PI+ dead cells, and mtRep again synergized with the death of these cells (Figure 1C).

To determine whether cell death triggered by TT3(mtRep) is a type of immunogenic cell death (ICD), calreticulin (CRT), which normally remains on the endoplasmic reticulum (ER) and migrates to the cell surface as an “eat me” signal, was measured » during ICD1. TT3 and mtRep synergized to stimulate CRT transport to cell surfaces ( Figure 1D ). Extracellular ATP activates NLRP3 inflammasome 2 and extracellular HMGB1 mediates inflammasome 3 during ICD. TT3, TT3-mtRep, and TT3-deRep effectively induced the release of ATP and HMGB1. (Figs. 1E and 1F). Considering this together, TT3-mtRep RNA represents a promising oncolytic compound that can induce immunogenic cell death while also leading to transient expression of the replicon-encoded gene cargo.

Example 2: Replicon RNA Triggers TLR3 Signaling and Induces the ISGF3 Complex Associated with Necrotic Cell Death

To determine the mechanisms underlying the synergism of cell death by replicon and TT3-LNP, DOTAP-, Lipo-, or TT3 nanoparticles in the presence or absence of encapsulated mtRep encoding a reporter gene (or encapsulated mutant “dead” replicon (deRep) lacking functional gene expression) were transfected into HEK-TLR2, HEK-TLR3, HEK-TLR7, or HEK-TLR9 reporter cells (invivogen.com). Both Lipo- and TT3-LNPs carrying mtRep or deRep activated TLR3 signaling, but none of the other TLRs tested were stimulated (Fig. 2A-D). When tested in Raw-Lucia-ISG reporter cells (invivogen.com), interferon-stimulated genes were significantly induced by the same LNP formulations (Fig. 2E). These data suggest that TLR3 recognizes replicon RNA and induces interferon responses in response to LNP-mediated delivery.

Because replicon RNA activates TLR3 signaling through TRIF to produce type I interferon ⁴ , which leads to activation of the ISGF3 complex (Stat 1/Stat 2/IRF9) for necrotic cell death ⁵ , we analyzed the levels of mRNA transcripts for the components of the ISGF3 complex, Stat1 , Stat2 and IRF9, as well as STING pathway genes, IRF3 and cGAS, by qPCR. TT3 nanoparticles encapsulating mtRep or deRep increased levels of Stat1, Stat2, and IRF9 by ∼6-, ∼16-, and ∼3-fold compared to untreated controls ( Figure 2F-H ), respectively. In contrast, they had no effect on IRF3 or cGAS transcription (Fig. 2I-J). The DOTAP and Lipo formulations failed to induce the ISGF3 complex, likely due to the low replicon RNA transfection efficiency of these nanoparticles (Figure 1B). These data suggested that mtRep and deRep likely activate TLR3 signaling and induce the ISGF3 complex to promote necrotic cell death, a type of immunogenic cell death.

Example 3: TT3-mtRep recruits immunocytes and causes regression of established tumors

Of interest was whether TT3-mtRep had effects on immunogenic cell death and gene cargo expression in vivo . The absolute abundance of Ly6c ^lo Ly6G ⁺ granulocyte populations, which are associated with necrotic cell death responses ⁶ , was measured in tumors on day 3 after intratumoral injection of TT3 nanoparticles encapsulating a wild-type RNA replicon (wtRep) with another mutant RNA replicon (mt2Rep). and the mutant replicon (mtRep) used above. Surprisingly, mtRep showed significantly higher (~2-fold higher) recruitment of this granulocyte population to tumors (Figure 3A), and better expression of the mCherry reporter gene encoded through the subgenomic promoter (Figure 3B). Thus, TT3-mtRep induces immunogenic cell death with sufficient gene cargo expression. An in vivo study was then performed using TT3-mtRep.

The expression level of Stat1/Stat2/IRF9, as well as the STING signaling genes IRF3 and cGAS in vivo was measured after intratumoral delivery of replicons via LNP. According to FIG. 2F-J in vitro , tumors injected with TT3-mtRep expressed significantly higher levels of Stat1/Stat2/IRF9 (ISGF3 complex), but with comparable levels of IRF3 and cGAS (Figure 3C), suggesting that TT3-injection mtRep also initiates necrotic cell death in vivo .

To better understand the effects of TT3-mtRep on the immune composition in the tumor, immunocytes such as granulocytes (CD45 ⁺ CD11b ⁺ Ly6c ^lo Ly6G ⁺ ), M-MDSC (CD45 ⁺ CD11b ⁺ Ly6c ^hi Ly6G ⁺ ), monocytes (D45 ⁺ CD11b ⁺ Ly6c ^lo Ly6G ^- ), macrophages (CD45 ⁺ CD11b ⁺ Ly6c ^- Ly6G ^- F4/80 ⁺ ), CD4 T (CD45 ⁺ CD3ε ⁺ CD4 ⁺ ), CD8 T (CD45 ⁺ CD3ε ⁺ CD8 ⁺ ), NK (CD45 ⁺ CD3ε ^- NK1 .1 ⁺ ), NKT (CD45 ⁺ CD3ε ⁺ NK1.1 ⁺ ), conventional DC1 (cDC1, CD45 ⁺ CD11c ⁺ MHC-II ⁺ CD24 ⁺ CD64 ^- CD103 ⁺ CD11b ^- XCR1 ^hi ), and conventional DC2 (cDC2, CD45 ⁺ CD11c ⁺ MHC-II ⁺ CD24 ⁺ CD64 ^- CD103 ⁺ CD11b ⁺ XCR1 ^lo ) were mapped and quantified in tumors on day 1 (Fig. 3D) and day 3 (Fig. 3E) after one injection, and on day 1 (Fig. 3F) after three consecutive injections of LNP replicon RNA. In this dynamic analysis of tumor immune composition, granulocytes and cDC1 were rapidly recruited and downregulated on day 1 after replicon RNA injection, respectively (Figure 3C), suggesting that granulocytes may represent an early event and cDC1 likely begins to migrate to tumor-draining lymph node (TDLN) in response to LNP replicon RNA. On day 3 after replicon RNA injection, CD4 T, CD8 T, NK and NKT cells were also recruited (Figure 3D). With 3 consecutive injections of LNP replicon RNA, monocytes increased and macrophages decreased, but less significant changes were observed in lymphoid cells such as CD4 T, NK, and NKT cells (Figure 3E). The effects of these ~3 sequential injections were ~10% more cell death (Figure 3F), ~4-fold higher levels of tumor-infiltrating immunocytes (Figure 3G), and a 2-fold decrease in tumor mass (Figure 3H) in the samples from the TT3-mtRep group, which resulted in significant regression of tumor growth (Figure 3I). Consistent with both NK and NKT cells emerging with TT3-mtRep treatments, expression of CCL5 was significantly induced (Figure 3I), which is primarily secreted by NK ⁷ and activates CD8 T cells (rstats.immgen.org/Skyline /skyline.html). These data indicate that TT3-mtRep induced immunogenic cell death in tumors with gene cargo expression as observed in FIG. 1 and fig. 2 in vitro . Most importantly, TT3-mtRep significantly modulated the tumor microenvironment and resulted in tumor recruitment of CD8 T cells and NK cells.

Example 4: TT3-mtRep Encoding IL12-MSA or IL12-MSA-Lumican Effectively Modulates Tumor Microenvironment and Immune Composition

While intratumoral injection of TT3(mtRep), encoding only reporter genes, led to a delay in tumor growth, encoding immunomodulatory proteins in the replicon could lead to additional immunostimulation and enhanced antitumor immunity. An attractive candidate is IL-12, which can polarize CD4 helper T cells to Th1 and enhance the cytotoxicity effects of NK and CD8 T cells ⁸ . One of the IL12 subunits, also named IL12b or IL12p40, is primarily secreted from antigen presenting cells (CD8 ⁺ DC) (rstats.immgen.org/Skyline/skyline.html), which can be functionally inactivated by type I interferon ⁹ . However, the level of interferon α2 (IFNα2), the major form of type I interferon, is low in either serum (Fig. 4A) or tumors (Fig. 4B) on days 1 and 3 after TT3-mtRep injections, suggesting that the level of IL-12 secreted by DCs may still be low in the tumor microenvironment (TME). Thus, IL12-MSA or IL12-MSA-lumican was constructed in which IL12α (P30), IL12β (P40) are fused to mouse serum albumin (MSA), or MSA and lumican. Lumican is an endogenous collagen binding protein that we conclude may stimulate retention of expressed IL-12 in the TME to enhance the efficacy and safety of replicon therapy. The replicon constructs were transfected into B16F10 cells in vitro by NEON transfection, and we confirmed the secretion of IL12 in these transfected cells by ELISA (Fig. 4C).

Consistently, tumors injected with TT3-mtRep encoding IL12-MSA (TT3-mtRep-IL12-MSA) or IL12-MSA-lumican (TT3-mtRep-IL12-MSA-lumican) expressed high levels of IL12 in vivo , reaching 40 ng/mg in tumors (Fig. 4D). Compared with the immune composition in the tumor on day 1 post-injection, granulocyte levels were 1.5-3-fold increased in tumors treated with TT3-mtRep expressing IL12-MSA and IL12-MSA-lumican, in contrast to the TT3-treated group -mtRep, encoding the mCherry reporter gene (Fig. 4E). At day 3, the IL12-MSA and IL12-MSA-lumican groups recruited ∼2- to 3-fold higher levels of granulocytes, CD8 T cells, and cDC2 cells to tumors compared to replicons encoding an irrelevant reporter gene (Fig. 4F). Interestingly, all tumors treated with TT3-mtRep encoding reporter genes, IL12-MSA, or IL12-MSA-lumican showed decreased levels of cDC1 cells compared to the untreated group (Figures 4E-4F) . To determine whether cDC1 migrated to the TDLN, we counted the cDC1 cells therein and showed that the number of cDC1 cells in the lymph nodes was significantly increased after TT3-mtRep treatment, regardless of which gene cargo was encoded (Figure 4G). . The increase in cDC1 cells continued in the IL12-MSA group (Figure 4G).

Example 5: Immunomodulatory IL12 and ICD Induced by TT3-mtRep Effectively Eliminate B16F10 Tumor

Since administration of IL12 protein has severe side effects in clinical studies, we measured changes in body weight of tumor-bearing mice treated with replicon-encoded IL-12. The mtRep-IL12-MSA group had ~5% body weight loss that lasted a week. In contrast, the mtRep and mtRep-IL12-MSA-lumican groups had only ∼2% body weight loss and recovered within a few days (Figure 5A). Accordingly, the present inventors were unable to measure IL-6 or TNFα in serum on day 1 or day 3 after injection of mtRep-IL12-MSA or mtRep-IL12-MSA-lumican (data not shown). However, we observed a significant increase in serum IFN-γ levels in the mtRep-IL12-MSA group (FIG. 5B), consistent with the weight loss in FIG. 5A. Interestingly, replicons expressing IL12-MSA or IL12-MSA-lumican showed very strong tumor regression, even for large established tumors, with treatment sizes of 50 mm ² (Fig. 5C). Tumor-bearing mice treated with TT3-mtRep, encoding IL12-MSA and IL12-MSA-lumican, were 60% and 80% tumor-free 75 days after B16F10 injection, respectively. To determine whether these cured mice induced a systemic immune response that could prevent B16F10 tumor recurrence, these mice were infected with 0.1 million B16F10 cells in the contralateral flank. As expected, all of the cured mice rejected the B16F10 tumor, in contrast to the naïve mice, which rapidly developed the B16F10 tumor. These data indicate that the synergy of immunomodulatory IL12 and ICD (immunogenic cell death) could effectively eradicate B16F10 tumor and induce systemic immune responses to prevent B16F10 tumor recurrence.

Bibliography:

1 Yun, YR et al. Fibroblast growth factors: biology, function, and application for tissue regeneration. J Tissue Eng 2010 , 218142, doi:10.4061/2010/218142 (2010).

2 Zha, QB et al. ATP-Induced Inflammasome Activation and Pyroptosis Is Regulated by AMP-Activated Protein Kinase in Macrophages. Front Immunol 7 , 597, doi:10.3389/fimmu.2016.00597 (2016).

3 Magna, M. & Pisetsky, D.S. The role of HMGB1 in the pathogenesis of inflammatory and autoimmune diseases. Mol Med 20 , 138-146, doi:10.2119/molmed.2013.00164 (2014).

4 Kawai, T. & Akira, S. TLR signaling. Cell Death Differ 13 , 816–825, doi:10.1038/sj.cdd.4401850 (2006).

5 McComb, S. et al. Type-I interferon signaling through ISGF3 complex is required for sustained Rip3 activation and necroptosis in macrophages. Proc Natl Acad Sci USA 111 , E3206-3213, doi:10.1073/pnas.1407068111 (2014).

6 Haverkamp, JM et al. Myeloid-derived suppressor activity is mediated by monocytic lineages maintained by continuous inhibition of extrinsic and intrinsic death pathways. Immunity 41 , 947-959, doi:10.1016/j.immuni.2014.10.020 (2014).

7 Bottcher, JP et al. NK Cells Stimulate Recruitment of cDC1 into the Tumor Microenvironment Promoting Cancer Immune Control. Cell 172 , 1022-1037 e1014, doi:10.1016/j.cell.2018.01.004 (2018).

8 Lasek, W., Zagozdzon, R. & Jakobisiak, M. Interleukin 12: still a promising candidate for tumor immunotherapy? Cancer Immunol Immunother 63 , 419-435, doi:10.1007/s00262-014-1523-1 (2014).

9 Montoya, M. et al. Type I interferons produced by dendritic cells promote their phenotypic and functional activation. Blood 99 , 3263-3271, doi:DOI 10.1182/blood.V99.9.3263 (2002).

10 Li, Y. et al. Persistent Antigen and Prolonged AKT-mTORC1 Activation Underlie Memory CD8 T Cell Impairment in the Absence of CD4 T Cells. J Immunol 195 , 1591-1598, doi:10.4049/jimmunol.1500451 (2015).

11 Li, B. et al. An Orthogonal Array Optimization of Lipid-like Nanoparticles for mRNA Delivery in vivo . Nano Lett 15 , 8099-8107, doi:10.1021/acs.nanolett.5b03528 (2015).

OTHER IMPLEMENTATION OPTIONS

All of the features described herein can be combined in any combination. Each feature described herein may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature described is only an example of a general series of equivalent or similar features.

From the above description, one skilled in the art can easily recognize the essential characteristics of the present invention, and without departing from its spirit and scope, can make various changes and modifications according to the invention to adapt it to various applications and conditions. Thus, other embodiments are also included in the claims.

EQUIVALENTS

While several inventive embodiments are described and illustrated herein, one of ordinary skill in the art may readily envision many other means and/or structures to perform the function and/or obtain the results and/or one or more of the benefits described herein. description, and each of such variations and/or modifications are considered to be included within the scope of the inventive embodiments described in the present description. More generally, one skilled in the art will appreciate that all parameters, measurements, materials, and configurations described herein are understood to be illustrative, and that actual parameters, measurements, materials, and/or configurations may depend on the particular application. or applications for which the inventive explanations are/are used. One skilled in the art will know, or be able to determine, using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. Thus, it is to be understood that the foregoing embodiments are presented by way of example only, and that, to the extent of the appended claims and their equivalents, the inventive embodiments may be practiced in a manner other than as specifically described and claimed. Inventive embodiments herein relate to each individual feature, system, article, material, kit and/or method described herein. In addition, any combination of two or more such features, systems, products, materials, kits and/or methods, unless such features, systems, products, materials, kits and/or methods are mutually incompatible, is included within the scope of the invention herein. .

All definitions, as defined and used herein, should be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of certain terms.

The contents of all references, patents and patent applications described herein are incorporated by reference to the subject matter to which they are cited, which, in some cases, may include the entire document.

The indefinite articles "a" and "an", as used herein, in the description and in the claims, unless expressly stated to the contrary, are to be understood to mean "at least one". The phrase "and/or", within the scope of the invention, in the description and in the claims, should be understood as meaning "either or both" of the elements so combined, i.e., the elements present together, in some cases, and separately present in other cases. The plurality of elements listed with "and/or" should be treated in the same way, i.e., "one or more" elements connected in this way. Other elements may optionally be present other than the elements specifically identified by the “and/or” condition, whether related or unrelated to the elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with a non-limiting expression such as "comprising", may refer, in one embodiment, to A only (optionally including elements other than from B); in another embodiment, to B only (optionally including elements other than A); in another embodiment, to both A and B (optionally including other elements); etc.

Within the scope of the invention, in the description and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, "or" or "and/or" should be interpreted as being inclusive, i.e., including at least one, but also including more than one, of a series or list of items, and, optionally, additional items not listed. Only terms expressly indicating the contrary, such as “only one of” or “exactly one of,” or, when used in a claim, “consisting of,” refer to the inclusion of exactly one element from a series or list of elements. Generally, the term "or", for the purposes of the invention, should be interpreted as indicating exclusive alternatives (i.e. "one or the other, but not both") only when preceded by exclusive terms such as "either", "one" of", "only one of" or "exactly one of". “Consisting essentially of,” when used in a claim, shall have its ordinary meaning as used in the field of patent law.

Within the scope of the invention, in the description and in the claims, the phrase "at least one", when applied to a list of one or more elements, is to be understood to mean at least one element selected from any one or more elements in the list of elements, but optionally including at least one of each and every element specifically listed in the list of elements, and not excluding any combinations of elements in the list of elements. This definition also allows that elements other than the elements specifically identified in the list of elements to which the phrase “at least one” refers may optionally be present, whether related or unrelated to the elements specifically identified. Thus, by way of non-limiting example, "at least one of A and B" (or equivalently "at least one of A or B" or equivalently "at least one of A and/or B" ), may denote, in one embodiment, at least one, optionally including more than one, A, without the presence of B (and optionally including elements other than B); in another embodiment, at least one, optionally including more than one, B, without the presence of A (and optionally including elements other than A); in another embodiment, at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

It should also be understood that, unless expressly stated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are listed.

--->

LIST OF SEQUENCES

<110> Massachusetts Institute of Technology

<120> SYNTHETIC ONCOLYTIC LNP REPLICON RNA AND APPLICATIONS FOR

IMMUNOTHERAPY OF MALIGNANT TUMORS

<130> M0656.70464WO00

<140> Not assigned yet

<141> Simultaneously with

<150> US 62/815611

<151> 2019-03-08

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 10276

<212> DNA

<213> Unknown

<220>

<223> VEE virus

<400> 1

atgggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg

60

ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg

120

aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc

180

tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa

240

gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt ccgatgagat

300

gtgcggaaga tccggacaga ttgtataagt atgcaactaa gctgaagaaa aactgtaagg

360

aaataactga taaggaattg gacaagaaaa tgaaggagct ggccgccgtc atgagcgacc

420

ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc

480

aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc gacaagtctc tatcaccaag

540

ccaataaggg agttagagtc gcctactgga taggctttga caccacccct tttatgttta

600

agaacttggc tggagcatat ccatcatact ctaccaactg ggccgacgaa accgtgttaa

660

cggctcgtaa cataggccta tgcagctctg acgttatgga gcggtcacgt agagggatgt

720

ccattcttag aaagaagtat ttgaaaccat ccaacaatgt tctattctct gttggctcga

780

ccatctacca cgagaagagg gacttactga ggagctggca cctgccgtct gtatttcact

840

tacgtggcaa gcaaaattac acatgtcggt gtgagactat agttagttgc gacgggtacg

900

tcgttaaaag aatagctatc agtccaggcc tgtatgggaa gccttcaggc tatgctgcta

960

cgatgcaccg cgagggattc ttgtgctgca aagtgacaga cacattgaac ggggagaggg

1020

tctcttttcc cgtgtgcacg tatgtgccag ctacattgtg tgaccaaatg actggcatac

1080

tggcaacaga tgtcagtgcg gacgacgcgc aaaaactgct ggttgggctc aaccagcgta

1140

tagtcgtcaa cggtcgcacc cagagaaaca ccaataccat gaaaaattac cttttgcccg

1200

tagtggccca ggcatttgct aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa

1260

ggccactagg actacgagat agacagttag tcatggggtg ttgttgggct tttagaaggc

1320

acaagataac atctatttat aagcgcccgg atacccaaac catcatcaaa gtgaacagcg

1380

atttccactc attcgtgctg cccaggatag gcagtaacac attggagatc gggctgagaa

1440

caagaatcag gaaaatgtta gaggagcaca aggagccgtc acctctcatt accgccgagg

1500

acgtacaaga agctaagtgc gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt

1560

tgcgcgcagc tctaccacct ttggcagctg atgttgagga gcccactctg gaggcagacg

1620

tcgacttgat gttacaagag gctggggccg gctcagtgga gacacctcgt ggcttgataa

1680

aggttaccag ctacgatggc gaggacaaga tcggctctta cgctgtgctt tctccgcagg

1740

ctgtactcaa gagtgaaaaa ttatcttgca tccaccctct cgctgaacaa gtcatagtga

1800

taacacactc tggccgaaaa gggcgttatg ccgtggaacc ataccatggt aaagtagtgg

1860

tgccagaggg acatgcaata cccgtccagg actttcaagc tctgagtgaa agtgccacca

1920

ttgtgtacaa cgaacgtgag ttcgtaaaca ggtacctgca ccatattgcc acacatggag

1980

gagcgctgaa cactgatgaa gaatattaca aaactgtcaa gcccagcgag cacgacggcg

2040

aatacctgta cgacatcgac aggaaacagt gcgtcaagaa agaactagtc actgggctag

2100

ggctcacagg cgagctggtg gatcctccct tccatgaatt cgcctacgag agtctgagaa

2160

cacgaccagc cgctccttac caagtaccaa ccataggggt gtatggcgtg ccaggatcag

2220

gcaagtctgg catcattaaa agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga

2280

aagaaaactg tgcagaaatt ataagggacg tcaagaaaat gaaagggctg gacgtcaatg

2340

ccagaactgt ggactcagtg ctcttgaatg gatgcaaaca ccccgtagag accctgtata

2400

ttgacgaagc ttttgcttgt catgcaggta ctctcagagc gctcatagcc attataagac

2460

ctaaaaaggc agtgctctgc ggggatccca aacagtgcgg tttttttaac atgatgtgcc

2520

tgaaagtgca ttttaaccac gagatttgca cacaagtctt ccacaaaagc atctctcgcc

2580

gttgcactaa atctgtgact tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa

2640

cgacgaatcc gaaagagact aagattgtga ttgacactac cggcagtacc aaacctaagc

2700

aggacgatct cattctcact tgtttcagag ggtgggtgaa gcagttgcaa atagattaca

2760

aaggcaacga aataatgacg gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg

2820

ccgttcggta caaggtgaat gaaaatcctc tgtacgcacc cacctcagaa catgtgaacg

2880

tcctactgac ccgcacggag gaccgcatcg tgtggaaaac actagccggc gacccatgga

2940

taaaaacact gactgccaag taccctggga atttcactgc cacgatagag gagtggcaag

3000

cagagcatga tgccatcatg aggcacatct tggagagacc ggaccctacc gacgtcttcc

3060

agaataaggc aaacgtgtgt tgggccaagg ctttagtgcc ggtgctgaag accgctggca

3120

tagacatgac cactgaacaa tggaacactg tggattattt tgaaacggac aaagctcact

3180

cagcagagat agtattgaac caactatgcg tgaggttctt tggactcgat ctggactccg

3240

gtctattttc tgcacccact gttccgttat ccattaggaa taatcactgg gataactccc

3300

cgtcgcctaa catgtacggg ctgaataaag aagtggtccg tcagctctct cgcaggtacc

3360

cacaactgcc tcgggcagtt gccactggaa gagtctatga catgaacact ggtacactgc

3420

gcaattatga tccgcgcata aacctagtac ctgtaaacag aagactgcct catgctttag

3480

tcctccacca taatgaacac ccacagagtg acttttcttc attcgtcagc aaattgaagg

3540

gcagaactgt cctggtggtc ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt

3600

tgtcagaccg gcctgaggct accttcagag ctcggctgga tttaggcatc ccaggtgatg

3660

tgcccaaata tgacataata tttgttaatg tgaggacccc atataaatac catcactatc

3720

agcagtgtga agaccatgcc attaagctta gcatgttgac caagaaagct tgtctgcatc

3780

tgaatcccgg cggaacctgt gtcagcatag gttatggtta cgctgacagg gccagcgaaa

3840

gcatcattgg tgctatagcg cggcagttca agttttcccg ggtatgcaaa ccgaaatcct

3900

cacttgaaga gacggaagtt ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc

3960

acaattctta caagctttca tcaaccttga ccaacattta tacaggttcc agactccacg

4020

aagccggatg tgcaccctca tatcatgtgg tgcgagggga tattgccacg gccaccgaag

4080

gagtgattat aaatgctgct aacagcaaag gacaacctgg cggaggggtg tgcggagcgc

4140

tgtataagaa attcccggaa agcttcgatt tacagccgat cgaagtagga aaagcgcgac

4200

tggtcaaagg tgcagctaaa catatcattc atgccgtagg accaaacttc aacaaagttt

4260

cggaggttga aggtgacaaa cagttggcag aggcttatga gtccatcgct aagattgtca

4320

acgataacaa ttacaagtca gtagcgattc cactgttgtc caccggcatc ttttccggga

4380

acaaagatcg actaacccaa tcattgaacc atttgctgac agctttagac accactgatg

4440

cagatgtagc catatactgc agggacaaga aatgggaaat gactctcaag gaagcagtgg

4500

ctaggagaga agcagtggag gagatatgca tatccgacga ctcttcagtg acagaacctg

4560

atgcagagct ggtgagggtg catccgaaga gttctttggc tggaaggaag ggctacagca

4620

caagcgatgg caaaactttc tcatatttgg aagggaccaa gtttcaccag gcggccaagg

4680

atatagcaga aattaatgcc atgtggcccg ttgcaacgga ggccaatgag caggtatgca

4740

tgtatatcct cggagaaagc atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg

4800

aagcctccac accacctagc acgctgcctt gcttgtgcat ccatgccatg actccagaaa

4860

gagtacagcg cctaaaagcc tcacgtccag aacaaattac tgtgtgctca tcctttccat

4920

tgccgaagta tagaatcact ggtgtgcaga agatccaatg ctcccagcct atattgttct

4980

caccgaaagt gcctgcgtat attcatccaa ggaagtatct cgtggaaaca ccaccggtag

5040

acgagactcc ggagccatcg gcagagaacc aatccacaga ggggacacct gaacaaccac

5100

cacttataac cgaggatgag accaggacta gaacgcctga gccgatcatc atcgaagagg

5160

aagaagagga tagcataagt ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg

5220

aggcagacat tcacggggccg ccctctgtat ctagctcatc ctggtccatt cctcatgcat

5280

ccgactttga tgtggacagt ttatccatac ttgacaccct ggagggagct agcgtgacca

5340

gcggggcaac gtcagccgag actaactctt acttcgcaaa gagtatggag tttctggcgc

5400

gaccggtgcc tgcgcctcga acagtattca ggaaccctcc acatcccgct ccgcgcacaa

5460

gaacaccgtc acttgcaccc agcagggcct gctcgagaac cagcctagtt tccaccccgc

5520

caggcgtgaa tagggtgatc actagagagg agctcgaggc gcttaccccg tcacgcactc

5580

ctagcaggtc ggtctcgaga accagcctgg tctccaaccc gccaggcgta aataggtga

5640

ttacaagaga ggagtttgag gcgttcgtag cacaacaaca atgacggttt gatgcgggtg

5700

catacatctt ttcctccgac accggtcaag ggcatttaca acaaaaatca gtaaggcaaa

5760

cggtgctatc cgaagtggtg ttggagagga ccgaattgga gatttcgtat gccccgcgcc

5820

tcgaccaaga aaaagaagaa ttactacgca agaaattaca gttaaatccc acacctgcta

5880

acagaagcag ataccagtcc aggaaggtgg agaacatgaa agccataaca gctagacgta

5940

ttctgcaagg cctagggcat tatttgaagg cagaaggaaa agtggagtgc taccgaaccc

6000

tgcatcctgt tcctttgtat tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg

6060

cagtggaagc ctgtaacgcc atgttgaaag agaactttcc gactgtggct tcttactgta

6120

ttattccaga gtacgatgcc tatttggaca tggttgacgg agcttcatgc tgcttagaca

6180

ctgccagttt ttgccctgca aagctgcgca gctttccaaa gaaacactcc tatttggaac

6240

ccacaatacg atcggcagtg ccttcagcga tccagaacac gctccagaac gtcctggcag

6300

ctgccacaaa aagaaattgc aatgtcacgc aaatgagaga attgcccgta ttggattcgg

6360

cggcctttaa tgtggaatgc ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt

6420

ttaaagaaaa ccccatcagg cttactgaag aaaacgtggt aaattacatt accaaattaa

6480

aaggaccaaa agctgctgct ctttttgcga agacacataa tttgaatatg ttgcaggaca

6540

taccaatgga caggtttgta atggacttaa agagagacgt gaaagtgact caggaacaa

6600

aacatactga agaacggccc aaggtacagg tgatccaggc tgccgatccg ctagcaacag

6660

cgtatctgtg cggaatccac cgagagctgg ttaggagatt aaatgcggtc ctgcttccga

6720

acattcatac actgtttgat atgtcggctg aagactttga cgctattata gccgagcact

6780

tccagcctgg ggattgtgtt ctggaaactg acatcgcgtc gtttgataaa agtgaggacg

6840

acgccatggc tctgaccgcg ttaatgattc tggaagactt aggtgtggac gcagagctgt

6900

tgacgctgat tgaggcggct ttcggcgaaa tttcatcaat acatttgccc actaaaacta

6960

aatttaaatt cggagccatg atgaaatctg gaatgttcct cacactgttt gtgaacacag

7020

tcattaacat tgtaatcgca agcagagtgt tgagagaacg gctaaccgga tcaccatgtg

7080

cagcattcat tggagatgac aatatcgtga aaggagtcaa atcggacaaa ttaatggcag

7140

acaggtgcgc cacctggttg aatatggaag tcaagattat agatgctgtg gtgggcgaga

7200

aagcgcctta tttctgtgga gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc

7260

gtgtggcaga ccccctaaaa aggctgttta agcttggcaa acctctggca gcagacgatg

7320

aacatgatga tgacaggaga agggcattgc atgaagagtc aacacgctgg aaccgagtgg

7380

gtattctttc agagctgtgc aaggcagtag aatcaaggta tgaaaccgta ggaacttcca

7440

tcatagttat ggccatgact actctagcta gcagtgttaa atcattcagc tacctgagag

7500

gggcccctat aactctctac ggctaacctg aatggactac gacatagtct agtccgccaa

7560

gtctagcata tgggcgcgcc ctcagcatcg attgaattgg cccacatggt gagcaagggc

7620

gaggaggata acatggccat catcaaggag ttcatgcgct tcaaggtgca catggagggc

7680

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc

7740

acccagaccg ccaagctgaa ggtgaccaag ggtggccccc tgcccttcgc ctgggacatc

7800

ctgtcccctc agttcatgta cggctccaag gcctacgtga agcaccccgc cgacatcccc

7860

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag

7920

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac

7980

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc

8040

atgggctggg aggcctcctc cgagcggatg taccccgagg acggcgccct gaagggcgag

8100

atcaagcaga ggctgaagct gaaggacggc ggccactacg acgctgaggt caagaccacc

8160

tacaaggcca agaagcccgt gcagctgccc ggcgcctaca acgtcaacat caagttggac

8220

atcacctccc acaacgagga ctacaccatc gtggaacagt acgaacgcgc cgagggccgc

8280

cactccaccg gcggcatgga cgagctgtac aagtaggaat tggcaagctg cttacataga

8340

actcgcggcg attggcatgc cgccttaaaa tttttatttt atttttcttt tcttttccga

8400

atcggatttt gtttttaata tttcaaaaaa aaaaaaaaaa aaaaaaaaaa cgcgtcgagg

8460

ggaattaatt cttgaagacg aaagggccag gtggcacttt tcggggaaat gtgcgcggaa

8520

cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac

8580

cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg

8640

tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc

8700

tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg

8760

atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga

8820

gcacttttaa agttctgcta tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc

8880

aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag

8940

aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga

9000

gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg

9060

cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga

9120

atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt

9180

tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact

9240

ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt

9300

ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg

9360

ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta

9420

tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac

9480

tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat ttttaattta

9540

aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt

9600

tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt

9660

tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt

9720

gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc

9780

agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg

9840

tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg

9900

ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt

9960

cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac

10020

tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg

10080

acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg

10140

gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat

10200

ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcgagctcta

10260

atacgactca ctatag

10276

<210> 2

<211> 10276

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 2

atgggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg

60

ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg

120

aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc

180

tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa

240

gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt ccgatgagat

300

gtgcggaaga tccggacaga ttgtataagt atgcaactaa gctgaagaaa aactgtaagg

360

aaataactga taaggaattg gacaagaaaa tgaaggagct ggccgccgtc atgagcgacc

420

ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc

480

aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc gacaagtctc tatcaccaag

540

ccaataaggg agttagagtc gcctactgga taggctttga caccacccct tttatgttta

600

agaacttggc tggagcatat ccatcatact ctaccaactg ggccgacgaa accgtgttaa

660

cggctcgtaa cataggccta tgcagctctg acgttatgga gcggtcacgt agagggatgt

720

ccattcttag aaagaagtat ttgaaaccat ccaacaatgt tctattctct gttggctcga

780

ccatctacca cgagaagagg gacttactga ggagctggca cctgccgtct gtatttcact

840

tacgtggcaa gcaaaattac acatgtcggt gtgagactat agttagttgc gacgggtacg

900

tcgttaaaag aatagctatc agtccaggcc tgtatgggaa gccttcaggc tatgctgcta

960

cgatgcaccg cgagggattc ttgtgctgca aagtgacaga cacattgaac ggggagaggg

1020

tctcttttcc cgtgtgcacg tatgtgccag ctacattgtg tgaccaaatg actggcatac

1080

tggcaacaga tgtcagtgcg gacgacgcgc aaaaactgct ggttgggctc aaccagcgta

1140

tagtcgtcaa cggtcgcacc cagagaaaca ccaataccat gaaaaattac cttttgcccg

1200

tagtggccca ggcatttgct aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa

1260

ggccactagg actacgagat agacagttag tcatggggtg ttgttgggct tttagaaggc

1320

acaagataac atctatttat aagcgcccgg atacccaaac catcatcaaa gtgaacagcg

1380

atttccactc attcgtgctg cccaggatag gcagtaacac attggagatc gggctgagaa

1440

caagaatcag gaaaatgtta gaggagcaca aggagccgtc acctctcatt accgccgagg

1500

acgtacaaga agctaagtgc gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt

1560

tgcgcgcagc tctaccacct ttggcagctg atgttgagga gcccactctg gaggcagacg

1620

tcgacttgat gttacaagag gctggggccg gctcagtgga gacacctcgt ggcttgataa

1680

aggttaccag ctacgatggc gaggacaaga tcggctctta cgctgtgctt tctccgcagg

1740

ctgtactcaa gagtgaaaaa ttatcttgca tccaccctct cgctgaacaa gtcatagtga

1800

taacacactc tggccgaaaa gggcgttatg ccgtggaacc ataccatggt aaagtagtgg

1860

tgccagaggg acatgcaata cccgtccagg actttcaagc tctgagtgaa agtgccacca

1920

ttgtgtacaa cgaacgtgag ttcgtaaaca ggtacctgca ccatattgcc acacatggag

1980

gagcgctgaa cactgatgaa gaatattaca aaactgtcaa gcccagcgag cacgacggcg

2040

aatacctgta cgacatcgac aggaaacagt gcgtcaagaa agaactagtc actgggctag

2100

ggctcacagg cgagctggtg gatcctccct tccatgaatt cgcctacgag agtctgagaa

2160

cacgaccagc cgctccttac caagtaccaa ccataggggt gtatggcgtg ccaggatcag

2220

gcaagtctgg catcattaaa agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga

2280

aagaaaactg tgcagaaatt ataagggacg tcaagaaaat gaaagggctg gacgtcaatg

2340

ccagaactgt ggactcagtg ctcttgaatg gatgcaaaca ccccgtagag accctgtata

2400

ttgacgaagc ttttgcttgt catgcaggta ctctcagagc gctcatagcc attataagac

2460

ctaaaaaggc agtgctctgc ggggatccca aacagtgcgg tttttttaac atgatgtgcc

2520

tgaaagtgca ttttaaccac gagatttgca cacaagtctt ccacaaaagc atctctcgcc

2580

gttgcactaa atctgtgact tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa

2640

cgacgaatcc gaaagagact aagattgtga ttgacactac cggcagtacc aaacctaagc

2700

aggacgatct cattctcact tgtttcagag ggtgggtgaa gcagttgcaa atagattaca

2760

aaggcaacga aataatgacg gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg

2820

ccgttcggta caaggtgaat gaaaatcctc tgtacgcacc cacctcagaa catgtgaacg

2880

tcctactgac ccgcacggag gaccgcatcg tgtggaaaac actagccggc gacccatgga

2940

taaaaacact gactgccaag taccctggga atttcactgc cacgatagag gagtggcaag

3000

cagagcatga tgccatcatg aggcacatct tggagagacc ggaccctacc gacgtcttcc

3060

agaataaggc aaacgtgtgt tgggccaagg ctttagtgcc ggtgctgaag accgctggca

3120

tagacatgac cactgaacaa tggaacactg tggattattt tgaaacggac aaagctcact

3180

cagcagagat agtattgaac caactatgcg tgaggttctt tggactcgat ctggactccg

3240

gtctattttc tgcacccact gttccgttat ccattaggaa taatcactgg gataactccc

3300

cgtcgcctaa catgtacggg ctgaataaag aagtggtccg tcagctctct cgcaggtacc

3360

cacaactgcc tcgggcagtt gccactggaa gagtctatga catgaacact ggtacactgc

3420

gcaattatga tccgcgcata aacctagtac ctgtaaacag aagactgcct catgctttag

3480

tcctccacca taatgaacac ccacagagtg acttttcttc attcgtcagc aaattgaagg

3540

gcagaactgt cctggtggtc ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt

3600

tgtcagaccg gcctgaggct accttcagag ctcggctgga tttaggcatc ccaggtgatg

3660

tgcccaaata tgacataata tttgttaatg tgaggacccc atataaatac catcactatc

3720

agcagtgtga agaccatgcc attaagctta gcatgttgac caagaaagct tgtctgcatc

3780

tgaatcccgg cggaacctgt gtcagcatag gttatggtta cgctgacagg gccagcgaaa

3840

gcatcattgg tgctatagcg cggcagttca agttttcccg ggtatgcaaa ccgaaatcct

3900

cacttgaaga gacggaagtt ctgtttgtat tcattcggta cgatcgcaag gcccgtacgc

3960

acaattctta caagctttca tcaaccttga ccaacattta tacaggttcc agactccacg

4020

aagccggatg tgcaccctca tatcatgtgg tgcgagggga tattgccacg gccaccgaag

4080

gagtgattat aaatgctgct aacagcaaag gacaacctgg cggaggggtg tgcggagcgc

4140

tgtataagaa attcccggaa agcttcgatt tacagccgat cgaagtagga aaagcgcgac

4200

tggtcaaagg tgcagctaaa catatcattc atgccgtagg accaaacttc aacaaagttt

4260

cggaggttga aggtgacaaa cagttggcag aggcttatga gtccatcgct aagattgtca

4320

acgataacaa ttacaagtca gtagcgattc cactgttgtc caccggcatc ttttccggga

4380

acaaagatcg actaacccaa tcattgaacc atttgctgac agctttagac accactgatg

4440

cagatgtagc catatactgc agggacaaga aatgggaaat gactctcaag gaagcagtgg

4500

ctaggagaga agcagtggag gagatatgca tatccgacga ctcttcagtg acagaacctg

4560

atgcagagct ggtgaggtg catccgaaga gttctttggc tggaaggaag ggctacagca

4620

caagcgatgg caaaactttc tcatatttgg aagggaccaa gtttcaccag gcggccaagg

4680

atatagcaga aattaatgcc atgtggcccg ttgcaacgga ggccaatgag caggtatgca

4740

tgtatatcct cggagaaggc atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg

4800

aagcctccac accacctagc acgctgcctt gcttgtgcat ccatgccatg actccagaaa

4860

gagtacagcg cctaaaagcc tcacgtccag aacaaattac tgtgtgctca tcctttccat

4920

tgccgaagta tagaatcact ggtgtgcaga agatccaatg ctcccagcct atattgttct

4980

caccgaaagt gcctgcgtat attcatccaa ggaagtatct cgtggaaaca ccaccggtag

5040

acgagactcc ggagccatcg gcagagaacc aatccacaga ggggacacct gaacaaccac

5100

cacttataac cgaggatgag accaggacta gaacgcctga gccgatcatc atcgaagagg

5160

aagaagagga tagcataagt ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg

5220

aggcagacat tcacggggccg ccctctgtat ctagctcatc ctggtccatt cctcatgcat

5280

ccgactttga tgtggacagt ttatccatac ttgacaccct ggagggagct agcgtgacca

5340

gcggggcaac gtcagccgag actaactctt acttcgcaaa gagtatggag tttctggcgc

5400

gaccggtgcc tgcgcctcga acagtattca ggaaccctcc acatcccgct ccgcgcacaa

5460

gaacaccgtc acttgcaccc agcagggcct gctcgagaac cagcctagtt tccaccccgc

5520

caggcgtgaa tagggtgatc actagagagg agctcgaggc gcttaccccg tcacgcactc

5580

ctagcaggtc ggtctcgaga accagcctgg tctccaaccc gccaggcgta aataggtga

5640

ttacaagaga ggagtttgag gcgttcgtag cacaacaaca atgacggttt gatgcgggtg

5700

catacatctt ttcctccgac accggtcaag ggcatttaca acaaaaatca gtaaggcaaa

5760

cggtgctatc cgaagtggtg ttggagagga ccgaattgga gatttcgtat gccccgcgcc

5820

tcgaccaaga aaaagaagaa ttactacgca agaaattaca gttaaatccc acacctgcta

5880

acagaagcag ataccagtcc aggaaggtgg agaacatgaa agccataaca gctagacgta

5940

ttctgcaagg cctagggcat tatttgaagg cagaaggaaa agtggagtgc taccgaaccc

6000

tgcatcctgt tcctttgtat tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg

6060

cagtggaagc ctgtaacgcc atgttgaaag agaactttcc gactgtggct tcttactgta

6120

ttattccaga gtacgatgcc tatttggaca tggttgacgg agcttcatgc tgcttagaca

6180

ctgccagttt ttgccctgca aagctgcgca gctttccaaa gaaacactcc tatttggaac

6240

ccacaatacg atcggcagtg ccttcagcga tccagaacac gctccagaac gtcctggcag

6300

ctgccacaaa aagaaattgc aatgtcacgc aaatgagaga attgcccgta ttggattcgg

6360

cggcctttaa tgtggaatgc ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt

6420

ttaaagaaaa ccccatcagg cttactgaag aaaacgtggt aaattacatt accaaattaa

6480

aaggaccaaa agctgctgct ctttttgcga agacacataa tttgaatatg ttgcaggaca

6540

taccaatgga caggtttgta atggacttaa agagagacgt gaaagtgact caggaacaa

6600

aacatactga agaacggccc aaggtacagg tgatccaggc tgccgatccg ctagcaacag

6660

cgtatctgtg cggaatccac cgagagctgg ttaggagatt aaatgcggtc ctgcttccga

6720

acattcatac actgtttgat atgtcggctg aagactttga cgctattata gccgagcact

6780

tccagcctgg ggattgtgtt ctggaaactg acatcgcgtc gtttgataaa agtgaggacg

6840

acgccatggc tctgaccgcg ttaatgattc tggaagactt aggtgtggac gcagagctgt

6900

tgacgctgat tgaggcggct ttcggcgaaa tttcatcaat acatttgccc actaaaacta

6960

aatttaaatt cggagccatg atgaaatctg gaatgttcct cacactgttt gtgaacacag

7020

tcattaacat tgtaatcgca agcagagtgt tgagagaacg gctaaccgga tcaccatgtg

7080

cagcattcat tggagatgac aatatcgtga aaggagtcaa atcggacaaa ttaatggcag

7140

acaggtgcgc cacctggttg aatatggaag tcaagattat agatgctgtg gtgggcgaga

7200

aagcgcctta tttctgtgga gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc

7260

gtgtggcaga ccccctaaaa aggctgttta agcttggcaa acctctggca gcagacgatg

7320

aacatgatga tgacaggaga agggcattgc atgaagagtc aacacgctgg aaccgagtgg

7380

gtattctttc agagctgtgc aaggcagtag aatcaaggta tgaaaccgta ggaacttcca

7440

tcatagttat ggccatgact actctagcta gcagtgttaa atcattcagc tacctgagag

7500

gggcccctat aactctctac ggctaacctg aatggactac gacatagtct agtccgccaa

7560

gtctagcata tgggcgcgcc ctcagcatcg attgaattgg cccacatggt gagcaagggc

7620

gaggaggata acatggccat catcaaggag ttcatgcgct tcaaggtgca catggagggc

7680

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc

7740

acccagaccg ccaagctgaa ggtgaccaag ggtggccccc tgcccttcgc ctgggacatc

7800

ctgtcccctc agttcatgta cggctccaag gcctacgtga agcaccccgc cgacatcccc

7860

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag

7920

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac

7980

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc

8040

atgggctggg aggcctcctc cgagcggatg taccccgagg acggcgccct gaagggcgag

8100

atcaagcaga ggctgaagct gaaggacggc ggccactacg acgctgaggt caagaccacc

8160

tacaaggcca agaagcccgt gcagctgccc ggcgcctaca acgtcaacat caagttggac

8220

atcacctccc acaacgagga ctacaccatc gtggaacagt acgaacgcgc cgagggccgc

8280

cactccaccg gcggcatgga cgagctgtac aagtaggaat tggcaagctg cttacataga

8340

actcgcggcg attggcatgc cgccttaaaa tttttatttt atttttcttt tcttttccga

8400

atcggatttt gtttttaata tttcaaaaaa aaaaaaaaaa aaaaaaaaaa cgcgtcgagg

8460

ggaattaatt cttgaagacg aaagggccag gtggcacttt tcggggaaat gtgcgcggaa

8520

cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac

8580

cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg

8640

tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc

8700

tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg

8760

atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga

8820

gcacttttaa agttctgcta tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc

8880

aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag

8940

aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga

9000

gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg

9060

cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga

9120

atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt

9180

tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact

9240

ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt

9300

ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg

9360

ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta

9420

tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac

9480

tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat ttttaattta

9540

aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt

9600

tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt

9660

tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt

9720

gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc

9780

agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg

9840

tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg

9900

ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt

9960

cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac

10020

tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg

10080

acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg

10140

gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat

10200

ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcgagctcta

10260

atacgactca ctatag

10276

<210> 3

<211> 1629

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 3

atgaggtcc ccgctcagct cctggggctc ctgctgctct ggctcccagg tgcacgatgt

60

gccatgtggg agctggagaa agacgtttat gttgtagagg tggactggac tcccgatgcc

120

cctggagaaa cagtgaacct cacctgtgac acgcctgaag aagatgacat cacctggacc

180

tcagaccaga gacatggagt cataggctct ggaaagaccc tgaccatcac tgtcaaagag

240

tttctagatg ctggccagta cacctgccac aaaggaggcg agactctgag ccactcacat

300

ctgctgctcc acaagaagga aaatggaatt tggtccactg aaattttaaa aaatttcaaa

360

aacaagactt tcctgaagtg tgaagcacca aattactccg gacggttcac gtgctcatgg

420

ctggtgcaaa gaaacatgga cttgaagttc aacatcaaga gcagtagcag ttcccctgac

480

tctcgggcag tgacatgtgg aatggcgtct ctgtctgcag agaaggtcac actggaccaa

540

agggactatg agaagtattc agtgtcctgc caggaggatg tcacctgccc aactgccgag

600

gagaccctgc ccattgaact ggcgttggaa gcacggcagc agaataaata tgagaactac

660

agcaccagct tcttcatcag ggacatcatc aaaccagacc cgcccaagaa cttgcagatg

720

aagcctttga agaactcaca ggtggaggtc agctgggagt accctgactc ctggagcact

780

ccccattcct acttctccct caagttcttt gttcgaatcc agcgcaagaa agaaaagatg

840

aaggagacag aggaggggtg taaccagaaa ggtgcgttcc tcgtagagaa gacatctacc

900

gaagtccaat gcaaaggcgg gaatgtctgc gtgcaagctc aggatcgcta ttacaattcc

960

tcatgcagca agtgggcatg tgttccctgc agggtccgat ccggaggttc cggtggtgga

1020

tccggaggtg gctccggcgg cggatccagg gtcattccag tctctggacc tgccaggtgt

1080

cttagccagt cccgaaacct gctgaagacc acagatgaca tggtgaagac ggccagagaa

1140

aaactgaaac attattcctg cactgctgaa gacatcgatc atgaagacat cacacgggac

1200

caaaccagca cattgaagac ctgtttacca ctggaactac acaagaacga gagttgcctg

1260

gctactagag agacttcttc cacaacaaga gggagctgcc tgcccccaca gaagacgtct

1320

ttgatgatga ccctgtgcct tggtagcatc tatgaggact tgaagatgta ccagacagag

1380

ttccaggcca tcaacgcagc acttcagaat cacaaccatc agcagatcat tctagacaag

1440

ggcatgctgg tggccatcga tgagctgatg cagtctctga atcataatgg cgagactctg

1500

cgccagaaac ctcctgtggg agaagcagac ccttacagag tgaaaatgaa gctctgcatc

1560

ctgcttcacg ccttcagcac ccgcgtcgtg accatcaaca gggtgatggg ctatctgagc

1620

tccgcctga

1629

<210> 4

<211> 12985

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 4

atgggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg

60

ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg

120

aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc

180

tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa

240

gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt ccgatgagat

300

gtgcggaaga tccggacaga ttgtataagt atgcaactaa gctgaagaaa aactgtaagg

360

aaataactga taaggaattg gacaagaaaa tgaaggagct ggccgccgtc atgagcgacc

420

ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc

480

aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc gacaagtctc tatcaccaag

540

ccaataaggg agttagagtc gcctactgga taggctttga caccacccct tttatgttta

600

agaacttggc tggagcatat ccatcatact ctaccaactg ggccgacgaa accgtgttaa

660

cggctcgtaa cataggccta tgcagctctg acgttatgga gcggtcacgt agagggatgt

720

ccattcttag aaagaagtat ttgaaaccat ccaacaatgt tctattctct gttggctcga

780

ccatctacca cgagaagagg gacttactga ggagctggca cctgccgtct gtatttcact

840

tacgtggcaa gcaaaattac acatgtcggt gtgagactat agttagttgc gacgggtacg

900

tcgttaaaag aatagctatc agtccaggcc tgtatgggaa gccttcaggc tatgctgcta

960

cgatgcaccg cgagggattc ttgtgctgca aagtgacaga cacattgaac ggggagaggg

1020

tctcttttcc cgtgtgcacg tatgtgccag ctacattgtg tgaccaaatg actggcatac

1080

tggcaacaga tgtcagtgcg gacgacgcgc aaaaactgct ggttgggctc aaccagcgta

1140

tagtcgtcaa cggtcgcacc cagagaaaca ccaataccat gaaaaattac cttttgcccg

1200

tagtggccca ggcatttgct aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa

1260

ggccactagg actacgagat agacagttag tcatggggtg ttgttgggct tttagaaggc

1320

acaagataac atctatttat aagcgcccgg atacccaaac catcatcaaa gtgaacagcg

1380

atttccactc attcgtgctg cccaggatag gcagtaacac attggagatc gggctgagaa

1440

caagaatcag gaaaatgtta gaggagcaca aggagccgtc acctctcatt accgccgagg

1500

acgtacaaga agctaagtgc gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt

1560

tgcgcgcagc tctaccacct ttggcagctg atgttgagga gcccactctg gaagccgatg

1620

tcgacttgat gttacaagag gctggggccg gctcagtgga gacacctcgt ggcttgataa

1680

aggttaccag ctacgatggc gaggacaaga tcggctctta cgctgtgctt tctccgcagg

1740

ctgtactcaa gagtgaaaaa ttatcttgca tccaccctct cgctgaacaa gtcatagtga

1800

taacacactc tggccgaaaa gggcgttatg ccgtggaacc ataccatggt aaagtagtgg

1860

tgccagaggg acatgcaata cccgtccagg actttcaagc tctgagtgaa agtgccacca

1920

ttgtgtacaa cgaacgtgag ttcgtaaaca ggtacctgca ccatattgcc acacatggag

1980

gagcgctgaa cactgatgaa gaatattaca aaactgtcaa gcccagcgag cacgacggcg

2040

aatacctgta cgacatcgac aggaaacagt gcgtcaagaa agaactagtc actgggctag

2100

ggctcacagg cgagctggtg gatcctccct tccatgaatt cgcctacgag agtctgagaa

2160

cacgaccagc cgctccttac caagtaccaa ccataggggt gtatggcgtg ccaggatcag

2220

gcaagtctgg catcattaaa agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga

2280

aagaaaactg tgcagaaatt ataagggacg tcaagaaaat gaaagggctg gacgtcaatg

2340

ccagaactgt ggactcagtg ctcttgaatg gatgcaaaca ccccgtagag accctgtata

2400

ttgacgaagc ttttgcttgt catgcaggta ctctcagagc gctcatagcc attataagac

2460

ctaaaaaggc agtgctctgc ggggatccca aacagtgcgg tttttttaac atgatgtgcc

2520

tgaaagtgca ttttaaccac gagatttgca cacaagtctt ccacaaaagc atctctcgcc

2580

gttgcactaa atctgtgact tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa

2640

cgacgaatcc gaaagagact aagattgtga ttgacactac cggcagtacc aaacctaagc

2700

aggacgatct cattctcact tgtttcagag ggtgggtgaa gcagttgcaa atagattaca

2760

aaggcaacga aataatgacg gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg

2820

ccgttcggta caaggtgaat gaaaatcctc tgtacgcacc cacctcagaa catgtgaacg

2880

tcctactgac ccgcacggag gaccgcatcg tgtggaaaac actagccggc gacccatgga

2940

taaaaacact gactgccaag taccctggga atttcactgc cacgatagag gagtggcaag

3000

cagagcatga tgccatcatg aggcacatct tggagagacc ggaccctacc gacgtcttcc

3060

agaataaggc aaacgtgtgt tgggccaagg ctttagtgcc ggtgctgaag accgctggca

3120

tagacatgac cactgaacaa tggaacactg tggattattt tgaaacggac aaagctcact

3180

cagcagagat agtattgaac caactatgcg tgaggttctt tggactcgat ctggactccg

3240

gtctattttc tgcacccact gttccgttat ccattaggaa taatcactgg gataactccc

3300

cgtcgcctaa catgtacggg ctgaataaag aagtggtccg tcagctctct cgcaggtacc

3360

cacaactgcc tcgggcagtt gccactggaa gagtctatga catgaacact ggtacactgc

3420

gcaattatga tccgcgcata aacctagtac ctgtaaacag aagactgcct catgctttag

3480

tcctccacca taatgaacac ccacagagtg acttttcttc attcgtcagc aaattgaagg

3540

gcagaactgt cctggtggtc ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt

3600

tgtcagaccg gcctgaggct accttcagag ctcggctgga tttaggcatc ccaggtgatg

3660

tgcccaaata tgacataata tttgttaatg tgaggacccc atataaatac catcactatc

3720

agcagtgtga agaccatgcc attaagctta gcatgttgac caagaaagct tgtctgcatc

3780

tgaatcccgg cggaacctgt gtcagcatag gttatggtta cgctgacagg gccagcgaaa

3840

gcatcattgg tgctatagcg cggcagttca agttttcccg ggtatgcaaa ccgaaatcct

3900

cacttgaaga gacggaagtt ctgtttgtat tcattcggta cgatcgcaag gcccgtacgc

3960

acaattctta caagctttca tcaaccttga ccaacattta tacaggttcc agactccacg

4020

aagccggatg tgcaccctca tatcatgtgg tgcgagggga tattgccacg gccaccgaag

4080

gagtgattat aaatgctgct aacagcaaag gacaacctgg cggaggggtg tgcggagcgc

4140

tgtataagaa attcccggaa agcttcgatt tacagccgat cgaagtagga aaagcgcgac

4200

tggtcaaagg tgcagctaaa catatcattc atgccgtagg accaaacttc aacaaagttt

4260

cggaggttga aggtgacaaa cagttggcag aggcttatga gtccatcgct aagattgtca

4320

acgataacaa ttacaagtca gtagcgattc cactgttgtc caccggcatc ttttccggga

4380

acaaagatcg actaacccaa tcattgaacc atttgctgac agctttagac accactgatg

4440

cagatgtagc catatactgc agggacaaga aatgggaaat gactctcaag gaagcagtgg

4500

ctaggagaga agcagtggag gagatatgca tatccgacga ctcttcagtg acagaacctg

4560

atgcagagct ggtgagggtg catccgaaga gttctttggc tggaaggaag ggctacagca

4620

caagcgatgg caaaactttc tcatatttgg aagggaccaa gtttcaccag gcggccaagg

4680

atatagcaga aattaatgcc atgtggcccg ttgcaacgga ggccaatgag caggtatgca

4740

tgtatatcct cggagaaggc atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg

4800

aagcctccac accacctagc acgctgcctt gcttgtgcat ccatgccatg actccagaaa

4860

gagtacagcg cctaaaagcc tcacgtccag aacaaattac tgtgtgctca tcctttccat

4920

tgccgaagta tagaatcact ggtgtgcaga agatccaatg ctcccagcct atattgttct

4980

caccgaaagt gcctgcgtat attcatccaa ggaagtatct cgtggaaaca ccaccggtag

5040

acgagactcc ggagccatcg gcagagaacc aatccacaga ggggacacct gaacaaccac

5100

cacttataac cgaggatgag accaggacta gaacgcctga gccgatcatc atcgaagagg

5160

aagaagagga tagcataagt ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg

5220

aggcagacat tcacggggccg ccctctgtat ctagctcatc ctggtccatt cctcatgcat

5280

ccgactttga tgtggacagt ttatccatac ttgacaccct ggagggagct agcgtgacca

5340

gcggggcaac gtcagccgag actaactctt acttcgcaaa gagtatggag tttctggcgc

5400

gaccggtgcc tgcgcctcga acagtattca ggaaccctcc acatcccgct ccgcgcacaa

5460

gaacaccgtc acttgcaccc agcagggcct gctcgagaac cagcctagtt tccaccccgc

5520

caggcgtgaa tagggtgatc actagagagg agctcgaggc gcttaccccg tcacgcactc

5580

ctagcaggtc ggtctcgaga accagcctgg tctccaaccc gccaggcgta aataggtga

5640

ttacaagaga ggagtttgag gcgttcgtag cacaacaaca atgacggttt gatgcgggtg

5700

catacatctt ttcctccgac accggtcaag ggcatttaca acaaaaatca gtaaggcaaa

5760

cggtgctatc cgaagtggtg ttggagagga ccgaattgga gatttcgtat gccccgcgcc

5820

tcgaccaaga aaaagaagaa ttactacgca agaaattaca gttaaatccc acacctgcta

5880

acagaagcag ataccagtcc aggaaggtgg agaacatgaa agccataaca gctagacgta

5940

ttctgcaagg cctagggcat tatttgaagg cagaaggaaa agtggagtgc taccgaaccc

6000

tgcatcctgt tcctttgtat tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg

6060

cagtggaagc ctgtaacgcc atgttgaaag agaactttcc gactgtggct tcttactgta

6120

ttattccaga gtacgatgcc tatttggaca tggttgacgg agcttcatgc tgcttagaca

6180

ctgccagttt ttgccctgca aagctgcgca gctttccaaa gaaacactcc tatttggaac

6240

ccacaatacg atcggcagtg ccttcagcga tccagaacac gctccagaac gtcctggcag

6300

ctgccacaaa aagaaattgc aatgtcacgc aaatgagaga attgcccgta ttggattcgg

6360

cggcctttaa tgtggaatgc ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt

6420

ttaaagaaaa ccccatcagg cttactgaag aaaacgtggt aaattacatt accaaattaa

6480

aaggaccaaa agctgctgct ctttttgcga agacacataa tttgaatatg ttgcaggaca

6540

taccaatgga caggtttgta atggacttaa agagagacgt gaaagtgact caggaacaa

6600

aacatactga agaacggccc aaggtacagg tgatccaggc tgccgatccg ctagcaacag

6660

cgtatctgtg cggaatccac cgagagctgg ttaggagatt aaatgcggtc ctgcttccga

6720

acattcatac actgtttgat atgtcggctg aagactttga cgctattata gccgagcact

6780

tccagcctgg ggattgtgtt ctggaaactg acatcgcgtc gtttgataaa agtgaggacg

6840

acgccatggc tctgaccgcg ttaatgattc tggaagactt aggtgtggac gcagagctgt

6900

tgacgctgat tgaggcggct ttcggcgaaa tttcatcaat acatttgccc actaaaacta

6960

aatttaaatt cggagccatg atgaaatctg gaatgttcct cacactgttt gtgaacacag

7020

tcattaacat tgtaatcgca agcagagtgt tgagagaacg gctaaccgga tcaccatgtg

7080

cagcattcat tggagatgac aatatcgtga aaggagtcaa atcggacaaa ttaatggcag

7140

acaggtgcgc cacctggttg aatatggaag tcaagattat agatgctgtg gtgggcgaga

7200

aagcgcctta tttctgtgga gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc

7260

gtgtggcaga ccccctaaaa aggctgttta agcttggcaa acctctggca gcagacgatg

7320

aacatgatga tgacaggaga agggcattgc atgaagagtc aacacgctgg aaccgagtgg

7380

gtattctttc agagctgtgc aaggcagtag aatcaaggta tgaaaccgta ggaacttcca

7440

tcatagttat ggccatgact actctagcta gcagtgttaa atcattcagc tacctgagag

7500

gggcccctat aactctctac ggctaacctg aatggactac gacatagtct agtccgccaa

7560

gtctagcata tgggcgcgcc ctcagcatcg atttgaattg gccaccatga gggtccccgc

7620

tcagctcctg gggctcctgc tgctctggct cccaggtgca cgatgtgcca tgtgggagct

7680

ggagaaagac gtttatgttg tagaggtgga ctggactccc gatgcccctg gagaaacagt

7740

gaacctcacc tgtgacacgc ctgaagaaga tgacatcacc tggacctcag accagagaca

7800

tggagtcata ggctctggaa agaccctgac catcactgtc aaagagtttc tagatgctgg

7860

ccagtacacc tgccacaaag gaggcgagac tctgagccac tcacatctgc tgctccacaa

7920

gaaggaaaat ggaatttggt ccactgaaat tttaaaaaat ttcaaaaaca agactttcct

7980

gaagtgtgaa gcaccaaatt actccggacg gttcacgtgc tcatggctgg tgcaaagaaa

8040

catggacttg aagttcaaca tcaagagcag tagcagttcc cctgactctc gggcagtgac

8100

atgtggaatg gcgtctctgt ctgcagagaa ggtcacactg gaccaaaggg actatgagaa

8160

gtattcagtg tcctgccagg aggatgtcac ctgcccaact gccgaggaga ccctgcccat

8220

tgaactggcg ttggaagcac ggcagcagaa taaatatgag aactacagca ccagcttctt

8280

catcagggac atcatcaaac cagacccgcc caagaacttg cagatgaagc ctttgaagaa

8340

ctcacaggtg gaggtcagct gggagtaccc tgactcctgg agcactcccc attcctactt

8400

ctccctcaag ttctttgttc gaatccagcg caagaaagaa aagatgaagg agacagagga

8460

ggggtgtaac cagaaaggtg cgttcctcgt agagaagaca tctaccgaag tccaatgcaa

8520

aggcgggaat gtctgcgtgc aagctcagga tcgctattac aattcctcat gcagcaagtg

8580

ggcatgtgtt ccctgcaggg tccgatccgg aggttccggt ggtggatccg gaggtggctc

8640

cggcggcgga tccagggtca ttccagtctc tggacctgcc aggtgtctta gccagtcccg

8700

aaacctgctg aagaccacag atgacatggt gaagacggcc agagaaaaac tgaaacatta

8760

ttcctgcact gctgaagaca tcgatcatga agacatcaca cgggaccaaa ccagcacatt

8820

gaagacctgt ttaccactgg aactacacaa gaacgagagt tgcctggcta ctagagagac

8880

ttcttccaca acaagaggga gctgcctgcc cccacagaag acgtctttga tgatgaccct

8940

gtgccttggt agcatctatg aggacttgaa gatgtaccag acagagttcc aggccatcaa

9000

cgcagcactt cagaatcaca accatcagca gatcattcta gacaagggca tgctggtggc

9060

catcgatgag ctgatgcagt ctctgaatca taatggcgag actctgcgcc agaaacctcc

9120

tgtggggagaa gcagaccctt acagagtgaa aatgaagctc tgcatcctgc ttcacgcctt

9180

cagcacccgc gtcgtgacca tcaacagggt gatgggctat ctgagctccg ccggttccgg

9240

tggcggatcc gaagcacaca agagtgagat cgcccatcgg tataatgatt tggggagaaca

9300

acatttcaaa ggcctagtcc tgattgcctt ttcccagtat ctccagaaat gctcatacga

9360

tgagcatgcc aaattagtgc aggaagtaac agactttgca aagacgtgtg ttgccgatga

9420

gtctgccgcc aactgtgaca aatcccttca cactcttttt ggagataagt tgtgtgccat

9480

tccaaacctc cgtgaaaact atggtgaact ggctgactgc tgtacaaaac aagagcccga

9540

aagaaacgaa tgtttcctgc aacacaaaga tgacaacccc agcctgccac catttgaaag

9600

gccagaggct gaggccatgt gcacctcctt taaggaaaac ccaaccacct ttatgggaca

9660

ctatttgcat gaagttgcca gaagacatcc ttatttctat gccccagaac ttctttacta

9720

tgctgagcag tacaatgaga ttctgaccca gtgttgtgca gaggctgaca aggaaagctg

9780

cctgaccccg aagcttgatg gtgtgaagga gaaagcattg gtctcatctg tccgtcagag

9840

aatgaagtgc tccagtatgc agaagtttgg agagagagct tttaaagcat gggcagtagc

9900

tcgtctgagc cagacattcc ccaatgctga ctttgcagaa atcaccaaat tggcaacaga

9960

cctgaccaaa gtcaacaagg agtgctgcca tggtgacctg ctggaatgcg cagatgacag

10020

ggcggaactt gccaagtaca tgtgtgaaaa ccaggcgact atctccagca aactgcagac

10080

ttgctgcgat aaaccactgt tgaagaaagc ccactgtctt agtgaggtgg agcatgacac

10140

catgcctgct gatctgcctg ccattgctgc tgattttgtt gaggaccagg aagtgtgcaa

10200

gaactatgct gaggccaagg atgtcttcct gggcacgttc ttgtatgaat attcaagaag

10260

acaccctgat tactctgtat ccctgttgct gagacttgct aagaaatatg aagccactct

10320

ggaaaagtgc tgcgctgaag ccaatcctcc cgcatgctac ggcacagtgc ttgctgaatt

10380

tcagcctctt gtagaagagc ctaagaactt ggtcaaaacc aactgtgatc tttacgagaa

10440

gcttggagaa tatggattcc aaaatgccat tctagttcgc tacacccaga aagcacctca

10500

ggtgtcaacc ccaactctcg tggaggctgc aagaaaccta ggaagagtgg gcaccaagtg

10560

ttgtacactt cctgaagatc agagactgcc ttgtgtggaa gactatctgt ctgcaatcct

10620

gaaccgtgtg tgtctgctgc atgagaagac cccagtgagt gagcatgtta ccaagtgctg

10680

tagtggatcc ctggtggaaa ggcggccatg cttctctgct ctgacagttg atgaaacata

10740

tgtccccaaa gagtttaaag ctgagacctt caccttccac tctgatatct gcacacttcc

10800

agagaaggag aagcagatta agaaacaaac ggctcttgct gagctggtga agcacaagcc

10860

caaggctaca gcggagcaac tgaagactgt catggatgac tttgcacagt tcctggatac

10920

atgttgcaag gctgctgaca aggacacctg cttctcgact gagggtccaa accttgtcac

10980

tagatgcaaa gacgccttag cctgagcgat cgctaaatac agcagcaatt ggcaagctgc

11040

ttacatagaa ctcgcggcga ttggcatgcc gccttaaaat ttttatttta tttttctttt

11100

cttttccgaa tcggattttg tttttaatat ttcaaaaaaa aaaaaaaaaa aaaaaaaaac

11160

gcgtcgaggg gaattaattc ttgaagacga aagggccagg tggcactttt cggggaaatg

11220

tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga

11280

gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac

11340

atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc

11400

cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca

11460

tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc

11520

caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgacgccg

11580

ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac

11640

cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca

11700

taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg

11760

agctaaccgc ttttttgcac aacatgggg atcatgtaac tcgccttgat cgttgggaac

11820

cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg

11880

caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat

11940

taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg

12000

ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg

12060

cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc

12120

aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc

12180

attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt

12240

tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt

12300

aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt

12360

gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag

12420

cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca

12480

gcagagcgca gataccaaat actngtccttc tagtgtagcc gtagttaggc caccacttca

12540

agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg

12600

ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg

12660

cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct

12720

acaccgaact gagataccta cagcgtgagc attgagaaag cgccacgctt cccgaaggga

12780

gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc

12840

ttccagggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg

12900

agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg

12960

cgagctctaa tacgactcac tatag

12985

<210> 5

<211> 13981

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 5

atgggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg

60

ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg

120

aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc

180

tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa

240

gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt ccgatgagat

300

gtgcggaaga tccggacaga ttgtataagt atgcaactaa gctgaagaaa aactgtaagg

360

aaataactga taaggaattg gacaagaaaa tgaaggagct ggccgccgtc atgagcgacc

420

ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc

480

aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc gacaagtctc tatcaccaag

540

ccaataaggg agttagagtc gcctactgga taggctttga caccacccct tttatgttta

600

agaacttggc tggagcatat ccatcatact ctaccaactg ggccgacgaa accgtgttaa

660

cggctcgtaa cataggccta tgcagctctg acgttatgga gcggtcacgt agagggatgt

720

ccattcttag aaagaagtat ttgaaaccat ccaacaatgt tctattctct gttggctcga

780

ccatctacca cgagaagagg gacttactga ggagctggca cctgccgtct gtatttcact

840

tacgtggcaa gcaaaattac acatgtcggt gtgagactat agttagttgc gacgggtacg

900

tcgttaaaag aatagctatc agtccaggcc tgtatgggaa gccttcaggc tatgctgcta

960

cgatgcaccg cgagggattc ttgtgctgca aagtgacaga cacattgaac ggggagaggg

1020

tctcttttcc cgtgtgcacg tatgtgccag ctacattgtg tgaccaaatg actggcatac

1080

tggcaacaga tgtcagtgcg gacgacgcgc aaaaactgct ggttgggctc aaccagcgta

1140

tagtcgtcaa cggtcgcacc cagagaaaca ccaataccat gaaaaattac cttttgcccg

1200

tagtggccca ggcatttgct aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa

1260

ggccactagg actacgagat agacagttag tcatggggtg ttgttgggct tttagaaggc

1320

acaagataac atctatttat aagcgcccgg atacccaaac catcatcaaa gtgaacagcg

1380

atttccactc attcgtgctg cccaggatag gcagtaacac attggagatc gggctgagaa

1440

caagaatcag gaaaatgtta gaggagcaca aggagccgtc acctctcatt accgccgagg

1500

acgtacaaga agctaagtgc gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt

1560

tgcgcgcagc tctaccacct ttggcagctg atgttgagga gcccactctg gaagccgatg

1620

tcgacttgat gttacaagag gctggggccg gctcagtgga gacacctcgt ggcttgataa

1680

aggttaccag ctacgatggc gaggacaaga tcggctctta cgctgtgctt tctccgcagg

1740

ctgtactcaa gagtgaaaaa ttatcttgca tccaccctct cgctgaacaa gtcatagtga

1800

taacacactc tggccgaaaa gggcgttatg ccgtggaacc ataccatggt aaagtagtgg

1860

tgccagaggg acatgcaata cccgtccagg actttcaagc tctgagtgaa agtgccacca

1920

ttgtgtacaa cgaacgtgag ttcgtaaaca ggtacctgca ccatattgcc acacatggag

1980

gagcgctgaa cactgatgaa gaatattaca aaactgtcaa gcccagcgag cacgacggcg

2040

aatacctgta cgacatcgac aggaaacagt gcgtcaagaa agaactagtc actgggctag

2100

ggctcacagg cgagctggtg gatcctccct tccatgaatt cgcctacgag agtctgagaa

2160

cacgaccagc cgctccttac caagtaccaa ccataggggt gtatggcgtg ccaggatcag

2220

gcaagtctgg catcattaaa agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga

2280

aagaaaactg tgcagaaatt ataagggacg tcaagaaaat gaaagggctg gacgtcaatg

2340

ccagaactgt ggactcagtg ctcttgaatg gatgcaaaca ccccgtagag accctgtata

2400

ttgacgaagc ttttgcttgt catgcaggta ctctcagagc gctcatagcc attataagac

2460

ctaaaaaggc agtgctctgc ggggatccca aacagtgcgg tttttttaac atgatgtgcc

2520

tgaaagtgca ttttaaccac gagatttgca cacaagtctt ccacaaaagc atctctcgcc

2580

gttgcactaa atctgtgact tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa

2640

cgacgaatcc gaaagagact aagattgtga ttgacactac cggcagtacc aaacctaagc

2700

aggacgatct cattctcact tgtttcagag ggtgggtgaa gcagttgcaa atagattaca

2760

aaggcaacga aataatgacg gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg

2820

ccgttcggta caaggtgaat gaaaatcctc tgtacgcacc cacctcagaa catgtgaacg

2880

tcctactgac ccgcacggag gaccgcatcg tgtggaaaac actagccggc gacccatgga

2940

taaaaacact gactgccaag taccctggga atttcactgc cacgatagag gagtggcaag

3000

cagagcatga tgccatcatg aggcacatct tggagagacc ggaccctacc gacgtcttcc

3060

agaataaggc aaacgtgtgt tgggccaagg ctttagtgcc ggtgctgaag accgctggca

3120

tagacatgac cactgaacaa tggaacactg tggattattt tgaaacggac aaagctcact

3180

cagcagagat agtattgaac caactatgcg tgaggttctt tggactcgat ctggactccg

3240

gtctattttc tgcacccact gttccgttat ccattaggaa taatcactgg gataactccc

3300

cgtcgcctaa catgtacggg ctgaataaag aagtggtccg tcagctctct cgcaggtacc

3360

cacaactgcc tcgggcagtt gccactggaa gagtctatga catgaacact ggtacactgc

3420

gcaattatga tccgcgcata aacctagtac ctgtaaacag aagactgcct catgctttag

3480

tcctccacca taatgaacac ccacagagtg acttttcttc attcgtcagc aaattgaagg

3540

gcagaactgt cctggtggtc ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt

3600

tgtcagaccg gcctgaggct accttcagag ctcggctgga tttaggcatc ccaggtgatg

3660

tgcccaaata tgacataata tttgttaatg tgaggacccc atataaatac catcactatc

3720

agcagtgtga agaccatgcc attaagctta gcatgttgac caagaaagct tgtctgcatc

3780

tgaatcccgg cggaacctgt gtcagcatag gttatggtta cgctgacagg gccagcgaaa

3840

gcatcattgg tgctatagcg cggcagttca agttttcccg ggtatgcaaa ccgaaatcct

3900

cacttgaaga gacggaagtt ctgtttgtat tcattcggta cgatcgcaag gcccgtacgc

3960

acaattctta caagctttca tcaaccttga ccaacattta tacaggttcc agactccacg

4020

aagccggatg tgcaccctca tatcatgtgg tgcgagggga tattgccacg gccaccgaag

4080

gagtgattat aaatgctgct aacagcaaag gacaacctgg cggaggggtg tgcggagcgc

4140

tgtataagaa attcccggaa agcttcgatt tacagccgat cgaagtagga aaagcgcgac

4200

tggtcaaagg tgcagctaaa catatcattc atgccgtagg accaaacttc aacaaagttt

4260

cggaggttga aggtgacaaa cagttggcag aggcttatga gtccatcgct aagattgtca

4320

acgataacaa ttacaagtca gtagcgattc cactgttgtc caccggcatc ttttccggga

4380

acaaagatcg actaacccaa tcattgaacc atttgctgac agctttagac accactgatg

4440

cagatgtagc catatactgc agggacaaga aatgggaaat gactctcaag gaagcagtgg

4500

ctaggagaga agcagtggag gagatatgca tatccgacga ctcttcagtg acagaacctg

4560

atgcagagct ggtgagggtg catccgaaga gttctttggc tggaaggaag ggctacagca

4620

caagcgatgg caaaactttc tcatatttgg aagggaccaa gtttcaccag gcggccaagg

4680

atatagcaga aattaatgcc atgtggcccg ttgcaacgga ggccaatgag caggtatgca

4740

tgtatatcct cggagaaggc atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg

4800

aagcctccac accacctagc acgctgcctt gcttgtgcat ccatgccatg actccagaaa

4860

gagtacagcg cctaaaagcc tcacgtccag aacaaattac tgtgtgctca tcctttccat

4920

tgccgaagta tagaatcact ggtgtgcaga agatccaatg ctcccagcct atattgttct

4980

caccgaaagt gcctgcgtat attcatccaa ggaagtatct cgtggaaaca ccaccggtag

5040

acgagactcc ggagccatcg gcagagaacc aatccacaga ggggacacct gaacaaccac

5100

cacttataac cgaggatgag accaggacta gaacgcctga gccgatcatc atcgaagagg

5160

aagaagagga tagcataagt ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg

5220

aggcagacat tcacggggccg ccctctgtat ctagctcatc ctggtccatt cctcatgcat

5280

ccgactttga tgtggacagt ttatccatac ttgacaccct ggagggagct agcgtgacca

5340

gcggggcaac gtcagccgag actaactctt acttcgcaaa gagtatggag tttctggcgc

5400

gaccggtgcc tgcgcctcga acagtattca ggaaccctcc acatcccgct ccgcgcacaa

5460

gaacaccgtc acttgcaccc agcagggcct gctcgagaac cagcctagtt tccaccccgc

5520

caggcgtgaa tagggtgatc actagagagg agctcgaggc gcttaccccg tcacgcactc

5580

ctagcaggtc ggtctcgaga accagcctgg tctccaaccc gccaggcgta aataggtga

5640

ttacaagaga ggagtttgag gcgttcgtag cacaacaaca atgacggttt gatgcgggtg

5700

catacatctt ttcctccgac accggtcaag ggcatttaca acaaaaatca gtaaggcaaa

5760

cggtgctatc cgaagtggtg ttggagagga ccgaattgga gatttcgtat gccccgcgcc

5820

tcgaccaaga aaaagaagaa ttactacgca agaaattaca gttaaatccc acacctgcta

5880

acagaagcag ataccagtcc aggaaggtgg agaacatgaa agccataaca gctagacgta

5940

ttctgcaagg cctagggcat tatttgaagg cagaaggaaa agtggagtgc taccgaaccc

6000

tgcatcctgt tcctttgtat tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg

6060

cagtggaagc ctgtaacgcc atgttgaaag agaactttcc gactgtggct tcttactgta

6120

ttattccaga gtacgatgcc tatttggaca tggttgacgg agcttcatgc tgcttagaca

6180

ctgccagttt ttgccctgca aagctgcgca gctttccaaa gaaacactcc tatttggaac

6240

ccacaatacg atcggcagtg ccttcagcga tccagaacac gctccagaac gtcctggcag

6300

ctgccacaaa aagaaattgc aatgtcacgc aaatgagaga attgcccgta ttggattcgg

6360

cggcctttaa tgtggaatgc ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt

6420

ttaaagaaaa ccccatcagg cttactgaag aaaacgtggt aaattacatt accaaattaa

6480

aaggaccaaa agctgctgct ctttttgcga agacacataa tttgaatatg ttgcaggaca

6540

taccaatgga caggtttgta atggacttaa agagagacgt gaaagtgact caggaacaa

6600

aacatactga agaacggccc aaggtacagg tgatccaggc tgccgatccg ctagcaacag

6660

cgtatctgtg cggaatccac cgagagctgg ttaggagatt aaatgcggtc ctgcttccga

6720

acattcatac actgtttgat atgtcggctg aagactttga cgctattata gccgagcact

6780

tccagcctgg ggattgtgtt ctggaaactg acatcgcgtc gtttgataaa agtgaggacg

6840

acgccatggc tctgaccgcg ttaatgattc tggaagactt aggtgtggac gcagagctgt

6900

tgacgctgat tgaggcggct ttcggcgaaa tttcatcaat acatttgccc actaaaacta

6960

aatttaaatt cggagccatg atgaaatctg gaatgttcct cacactgttt gtgaacacag

7020

tcattaacat tgtaatcgca agcagagtgt tgagagaacg gctaaccgga tcaccatgtg

7080

cagcattcat tggagatgac aatatcgtga aaggagtcaa atcggacaaa ttaatggcag

7140

acaggtgcgc cacctggttg aatatggaag tcaagattat agatgctgtg gtgggcgaga

7200

aagcgcctta tttctgtgga gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc

7260

gtgtggcaga ccccctaaaa aggctgttta agcttggcaa acctctggca gcagacgatg

7320

aacatgatga tgacaggaga agggcattgc atgaagagtc aacacgctgg aaccgagtgg

7380

gtattctttc agagctgtgc aaggcagtag aatcaaggta tgaaaccgta ggaacttcca

7440

tcatagttat ggccatgact actctagcta gcagtgttaa atcattcagc tacctgagag

7500

gggcccctat aactctctac ggctaacctg aatggactac gacatagtct agtccgccaa

7560

gtctagcata tgggcgcgcc ctcagcatcg atttgaattg gccaccatga gggtccccgc

7620

tcagctcctg gggctcctgc tgctctggct cccaggtgca cgatgtgcca tgtgggagct

7680

ggagaaagac gtttatgttg tagaggtgga ctggactccc gatgcccctg gagaaacagt

7740

gaacctcacc tgtgacacgc ctgaagaaga tgacatcacc tggacctcag accagagaca

7800

tggagtcata ggctctggaa agaccctgac catcactgtc aaagagtttc tagatgctgg

7860

ccagtacacc tgccacaaag gaggcgagac tctgagccac tcacatctgc tgctccacaa

7920

gaaggaaaat ggaatttggt ccactgaaat tttaaaaaat ttcaaaaaca agactttcct

7980

gaagtgtgaa gcaccaaatt actccggacg gttcacgtgc tcatggctgg tgcaaagaaa

8040

catggacttg aagttcaaca tcaagagcag tagcagttcc cctgactctc gggcagtgac

8100

atgtggaatg gcgtctctgt ctgcagagaa ggtcacactg gaccaaaggg actatgagaa

8160

gtattcagtg tcctgccagg aggatgtcac ctgcccaact gccgaggaga ccctgcccat

8220

tgaactggcg ttggaagcac ggcagcagaa taaatatgag aactacagca ccagcttctt

8280

catcagggac atcatcaaac cagacccgcc caagaacttg cagatgaagc ctttgaagaa

8340

ctcacaggtg gaggtcagct gggagtaccc tgactcctgg agcactcccc attcctactt

8400

ctccctcaag ttctttgttc gaatccagcg caagaaagaa aagatgaagg agacagagga

8460

ggggtgtaac cagaaaggtg cgttcctcgt agagaagaca tctaccgaag tccaatgcaa

8520

aggcgggaat gtctgcgtgc aagctcagga tcgctattac aattcctcat gcagcaagtg

8580

ggcatgtgtt ccctgcaggg tccgatccgg aggttccggt ggtggatccg gaggtggctc

8640

cggcggcgga tccagggtca ttccagtctc tggacctgcc aggtgtctta gccagtcccg

8700

aaacctgctg aagaccacag atgacatggt gaagacggcc agagaaaaac tgaaacatta

8760

ttcctgcact gctgaagaca tcgatcatga agacatcaca cgggaccaaa ccagcacatt

8820

gaagacctgt ttaccactgg aactacacaa gaacgagagt tgcctggcta ctagagagac

8880

ttcttccaca acaagaggga gctgcctgcc cccacagaag acgtctttga tgatgaccct

8940

gtgccttggt agcatctatg aggacttgaa gatgtaccag acagagttcc aggccatcaa

9000

cgcagcactt cagaatcaca accatcagca gatcattcta gacaagggca tgctggtggc

9060

catcgatgag ctgatgcagt ctctgaatca taatggcgag actctgcgcc agaaacctcc

9120

tgtggggagaa gcagaccctt acagagtgaa aatgaagctc tgcatcctgc ttcacgcctt

9180

cagcacccgc gtcgtgacca tcaacagggt gatgggctat ctgagctccg ccggttccgg

9240

tggcggatcc gaagcacaca agagtgagat cgcccatcgg tataatgatt tggggagaaca

9300

acatttcaaa ggcctagtcc tgattgcctt ttcccagtat ctccagaaat gctcatacga

9360

tgagcatgcc aaattagtgc aggaagtaac agactttgca aagacgtgtg ttgccgatga

9420

gtctgccgcc aactgtgaca aatcccttca cactcttttt ggagataagt tgtgtgccat

9480

tccaaacctc cgtgaaaact atggtgaact ggctgactgc tgtacaaaac aagagcccga

9540

aagaaacgaa tgtttcctgc aacacaaaga tgacaacccc agcctgccac catttgaaag

9600

gccagaggct gaggccatgt gcacctcctt taaggaaaac ccaaccacct ttatgggaca

9660

ctatttgcat gaagttgcca gaagacatcc ttatttctat gccccagaac ttctttacta

9720

tgctgagcag tacaatgaga ttctgaccca gtgttgtgca gaggctgaca aggaaagctg

9780

cctgaccccg aagcttgatg gtgtgaagga gaaagcattg gtctcatctg tccgtcagag

9840

aatgaagtgc tccagtatgc agaagtttgg agagagagct tttaaagcat gggcagtagc

9900

tcgtctgagc cagacattcc ccaatgctga ctttgcagaa atcaccaaat tggcaacaga

9960

cctgaccaaa gtcaacaagg agtgctgcca tggtgacctg ctggaatgcg cagatgacag

10020

ggcggaactt gccaagtaca tgtgtgaaaa ccaggcgact atctccagca aactgcagac

10080

ttgctgcgat aaaccactgt tgaagaaagc ccactgtctt agtgaggtgg agcatgacac

10140

catgcctgct gatctgcctg ccattgctgc tgattttgtt gaggaccagg aagtgtgcaa

10200

gaactatgct gaggccaagg atgtcttcct gggcacgttc ttgtatgaat attcaagaag

10260

acaccctgat tactctgtat ccctgttgct gagacttgct aagaaatatg aagccactct

10320

ggaaaagtgc tgcgctgaag ccaatcctcc cgcatgctac ggcacagtgc ttgctgaatt

10380

tcagcctctt gtagaagagc ctaagaactt ggtcaaaacc aactgtgatc tttacgagaa

10440

gcttggagaa tatggattcc aaaatgccat tctagttcgc tacacccaga aagcacctca

10500

ggtgtcaacc ccaactctcg tggaggctgc aagaaaccta ggaagagtgg gcaccaagtg

10560

ttgtacactt cctgaagatc agagactgcc ttgtgtggaa gactatctgt ctgcaatcct

10620

gaaccgtgtg tgtctgctgc atgagaagac cccagtgagt gagcatgtta ccaagtgctg

10680

tagtggatcc ctggtggaaa ggcggccatg cttctctgct ctgacagttg atgaaacata

10740

tgtccccaaa gagtttaaag ctgagacctt caccttccac tctgatatct gcacacttcc

10800

agagaaggag aagcagatta agaaacaaac ggctcttgct gagctggtga agcacaagcc

10860

caaggctaca gcggagcaac tgaagactgt catggatgac tttgcacagt tcctggatac

10920

atgttgcaag gctgctgaca aggacacctg cttctcgact gagggtccaa accttgtcac

10980

tagatgcaaa gacgccttag ccggcggagg ttccggtggc ggatcccaat actatgacta

11040

cgatataccc ctgttcatgt acgggcaaat atctccaaac tgtgcaccag aatgtaactg

11100

ccctcactca taccccactg caatgtactg tgacgacctg aagttgaaat ccgtgccaat

11160

ggtgcctcct gggattaagt acctgtacct ccgcaacaat cagatcgacc atattgacga

11220

gaaggctttt gaaaacgtca cagacctcca gtggcttatc ctggaccata acctgcttga

11280

aaatagtaag ataaagggca aagtattttc caaacttaaa cagcttaaaa aactccacat

11340

caactacaat aaccttactg aatccgtggg accattgcca aaatctctcc aagatttgca

11400

gttgactaac aacaagatat ccaaactcgg ctccttcgat gggctggtta atctgacttt

11460

catctacttg caacacaacc aattgaagga ggatgcagtt tcagctagtc ttaaaggtct

11520

gaaaagcctt gagtatcttg atctgtcatt taatcaaatg tccaagctcc ctgctgggct

11580

cccaacaagt ctgctgacac tctatctcga caataacaag ataagtaaca ttcccgatga

11640

gtactttaaa agatttaccg gcctccaata cttgcggctt tctcacaacg agttggcaga

11700

ctctggtgta cccggcaact cctttaatat aagttctctt ctcgagcttg atttgtccta

11760

taacaaactg aagagtatcc ctactgtcaa tgaaaatttg gagaattact acctcgaagt

11820

caatgagctt gagaagttcg atgttaagtc tttctgtaag atactgggtc cattgtcata

11880

cagcaagatt aaacatcttc gcttggatgg gaatcccttg actcaaagct cacttccccc

11940

cgacatgtac gaatgcctga gggtagccaa cgaaatcaca gtaaacggag gtggctcctg

12000

agcgatcgct aaatacagca gcaattggca agctgcttac atagaactcg cggcgattgg

12060

catgccgcct taaaattttt attttatttt tcttttcttt tccgaatcgg attttgtttt

12120

taatatttca aaaaaaaaaa aaaaaaaaaa aaaaacgcgt cgaggggaat taattcttga

12180

agacgaaagg gccaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat

12240

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc

12300

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct

12360

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag

12420

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta

12480

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc

12540

tgctatgtgg cgcggtatta tcccgtgttg acgccgggca agagcaactc ggtcgccgca

12600

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg

12660

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg

12720

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca

12780

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa

12840

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa

12900

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata

12960

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat

13020

ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc

13080

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata

13140

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt

13200

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga

13260

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag

13320

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa

13380

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag

13440

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg

13500

tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat

13560

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta

13620

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg

13680

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc

13740

gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa

13800

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc

13860

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt

13920

caggggggcg gagcctatgg aaaaacgcca gcaacgcgag ctctaatacg actcactata

13980

g

13981

<---

Claims (29)

1. Synthetic oncolytic virus containing: (i) a lipid nanoparticle containing N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3); And (ii) a self-amplifying RNA replicon containing a sequence encoding an interleukin (IL)-12 molecule; And where the IL-12 molecule is expressed through a self-amplifying RNA replicon. 2. Synthetic oncolytic virus according to claim 1, where the lipid nanoparticle is capable of triggering immunogenic cell death. 3. Synthetic oncolytic virus according to claim 1 or 2, where the lipid nanoparticle additionally contains 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). 4. Synthetic oncolytic virus according to any one of paragraphs. 1-3, where the lipid nanoparticle further contains cholesterol. 5. Synthetic oncolytic virus according to any one of paragraphs. 1-4, where the self-amplifying replicon RNA is derived from an alphavirus or hepatitis C virus. 6. A synthetic oncolytic virus according to claim 5, wherein the alphavirus is Venezuelan equine encephalitis virus, Semliki Forest virus or Sindbis virus. 7. Synthetic oncolytic virus according to any one of paragraphs. 1-6, where the sequence encoding the IL-12 molecule is localized in the subgenomic region of the self-amplifying RNA replicon. 8. Synthetic oncolytic virus according to any one of paragraphs. 1-7, wherein the self-amplifying RNA replicon contains a nucleotide sequence that has at least 90% identity to the sequence represented by SEQ ID NO: 1. 9. Synthetic oncolytic virus according to claim 8, where the self-amplifying RNA replicon contains point mutations G3936C and/or A4758G from SEQ ID NO: 1. 10. Synthetic oncolytic virus according to any one of paragraphs. 1-9, wherein the IL-12 molecule is IL-12, a subunit of IL-12, or a mutant IL-12 molecule retaining immunomodulatory function. 11. Synthetic oncolytic virus according to claim 10, where the IL-12 molecule contains IL-12α and/or IL-12β subunits. 12. Synthetic oncolytic virus according to any one of paragraphs. 1-11, where the lipid nanoparticle has a diameter of approximately 100-120 nm and/or a zeta potential of approximately 3-6 mV. 13. Pharmaceutical composition for the treatment of a malignant tumor, containing: synthetic oncolytic virus according to any one of paragraphs. 1-12 and a pharmaceutically acceptable carrier. 14. Pharmaceutical composition according to claim 13, additionally containing C14-PEG2000. 15. A pharmaceutical composition for the treatment of a malignant tumor, containing a synthetic oncolytic virus and a pharmaceutically acceptable carrier; where the synthetic oncolytic virus contains: (i) lipid nanoparticle containing N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE ) and cholesterol; And (ii) a self-amplifying RNA replicon containing a sequence encoding an interleukin (IL)-12 molecule; wherein the self-amplifying RNA replicon contains a nucleotide sequence that has at least 90% identity to the sequence represented by SEQ ID NO: 1; wherein the lipid nanoparticle is capable of triggering immunogenic cell death; wherein the IL-12 molecule is expressed through a self-amplifying RNA replicon; And where the pharmaceutical composition further contains C14-PEG2000. 16. A method of treating a malignant tumor in a subject in need thereof, comprising: administering to a subject an effective amount of a synthetic oncolytic virus according to any one of claims. 1-12. 17. The method of claim 16, wherein the subject is a human patient having or suspected of having a malignant tumor, wherein the malignant tumor is melanoma, breast cancer, colorectal cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma lung, squamous cell carcinoma of the lung, peritoneal malignancy, hepatic cell carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometrial or uterine carcinoma, carcinoma salivary gland, kidney cancer, prostate cancer, female external genital cancer, thyroid cancer, liver carcinoma, stomach cancer, squamous cell carcinoma of the head and neck, renal cell carcinoma, urothelial carcinoma or Hodgkin's lymphoma.