RU2808254C2 - New chimeric antigen receptor constructs containing tnfr2 domains - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to a chimeric antigen receptor (CAR) with lower tonic signaling when expressed in immune cells compared to immune cells expressing CAR without the intracellular co-stimulatory signaling domain of TNFR2, as well as a nucleic acid encoding it. An immune cell expressing the above CAR, as well as a population containing it, are also disclosed.

EFFECT: invention is effective for treating a disease or disorder in a human subject, where the disease or disorder is selected from the group consisting of an inflammatory disease, an autoimmune disease, an allergic disease, a post-organ transplant condition, cancer and an infectious disease.

17 cl, 15 dwg, 13 tbl, 5 ex

Description

Cross reference to related applications

This application claims priority to U.S. Provisional Patent Application No. 62/717,234, filed August 10, 2018. The disclosure of this application is incorporated herein by reference in its entirety.

List of sequences

This application contains a sequence listing that has been submitted electronically in ASCII format and is thus incorporated herein by reference in its entirety. The electronic copy of the sequence list, created on August 9, 2019, is called 025297_WO003_SL.txt and has a size of 195,578 bytes.

Field of technology to which the invention relates

The present invention relates to the field of immunotherapy. In particular, the present invention relates to a chimeric antigen receptor (CAR) comprising a TNFR2 transmembrane domain (TM), or a fragment or variant thereof, and/or an intracellular domain of TNFR2, or a fragment or variant thereof. The present invention also relates to a cell population expressing said CAR and its use for treating diseases or disorders.

Prior Art

Chimeric antigen receptor (CAR) technology has recently revolutionized cancer therapy, especially in the context of B-cell lymphoma and leukemia. While CAR-engineered pro-inflammatory T cells have been widely studied and suggested to provide efficacy in the treatment of hematologic malignancies in early-stage clinical trials, CAR-engineered regulatory T cells (Tregs) less appreciated.

Human Tregs play a key role in maintaining immune homeostasis and thus can be used as therapeutic agents in various clinical settings. They also have potent immunosuppressive properties that can be used to provide antigen-specific immunomodulation in therapeutic settings. For these reasons, Treg cell therapy has been developed to treat, for example, chronic inflammatory diseases, autoimmune diseases, allergic diseases and organ transplant conditions such as graft rejection or graft-versus-host disease (GVHD).

In the art, transduction of Treg cells using a CAR construct has been proposed, for example, in PCT patent publication WO 2008/095141.

Various molecular formats of CARs have been developed, differing in their extracellular, transmembrane, and cytoplasmic domains. In the effector T cell domain, the intracellular chimeric antigen receptor (CAR) module typically consists of CD28, ICOS, or 4-1BB domains in tandem with CD3-zeta. However, the use of these prototype modules to generate CAR Treg cells often leads to uncontrolled constitutive signaling, resulting in uncontrolled constitutive activation. This tonic signaling (corresponding to an antigen-independent background of activation) may lead to premature depletion of CAR Treg cells, thereby limiting their therapeutic use.

Thus, there is a need for new CAR constructs with lower tonic signaling when expressed in immune cells, especially Treg cells.

Summary of the invention

The present invention relates to novel CAR constructs containing TNFR2 transmembrane domains, or fragments or variants thereof, and/or TNFR2 intracellular domains, or fragments or variants thereof. As shown herein, engineered T cells and engineered Treg cells expressing these CAR constructs exhibit a strong reduction in tonic signaling compared to these cells expressing conventional CAR. Upon CAR incorporation, the engineered Treg cells exhibited highly effective suppressor activity against T effector cell proliferation, thereby demonstrating the advantage of these Treg cells for cell therapy.

In some embodiments, human Treg cells exhibit one or more of the following characteristics: (a) compared to Tregs expressing CARs having a human CD8 transmembrane domain and a 4-1BB costimulatory intracellular signaling domain, true Treg cells express CARs on the cell surfaces at a lower level but still exhibit comparable levels of CAR-specific activation; (b) true Treg cells maintain their Treg phenotype (eg, high expression levels of FoxP3, Helios, and CD62L and low expression levels of CD127) after more than one week (eg, nine days of culture); and (c) true Treg cells are capable of controlling GVHD in vivo (eg, in a mouse GVHD model).

In some embodiments, the present invention provides a CAR comprising an extracellular binding domain, a transmembrane domain, and an intracellular domain, wherein

- the transmembrane domain includes the transmembrane domain of human tumor necrosis factor receptor 2 (TNFR2) or a fragment or variant thereof, or

- the intracellular domain includes the human TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof, or

- both (i) and (ii).

In some embodiments, the CAR described herein further comprises an extracellular hinge domain, such as a human CD8 or CD28 hinge region. In specific embodiments, the hinge domain comprises the sequence of SEQ ID NO: 14 or a sequence having at least about 70% identity to SEQ ID NO: 14.

In some embodiments, the intracellular domain of a CAR described herein includes a primary intracellular signaling domain of immune cells, for example, a primary intracellular signaling domain of human CD3 T cells. In specific embodiments, the intracellular domain comprises a primary human CD3-zeta intracellular signaling domain, optionally comprising the sequence of SEQ ID NO: 28, 29, 30, or 31 or a sequence having at least about 70% identity to SEQ ID NO: 28, 29 , 30 or 31.

In some embodiments, the CAR comprises:

- extracellular binding domain,

- extracellular hinge domain containing the hinge region of human CD8 or CD28,

- a transmembrane domain comprising the human TNFR2 transmembrane domain, or a fragment or variant thereof, and

- intracellular domain containing the primary intracellular signaling domain of human CD3-zeta.

In some embodiments, the CAR comprises:

- extracellular binding domain,

- extracellular hinge domain containing the hinge region of human CD8 or CD28,

- transmembrane domain, and

- an intracellular domain containing the costimulatory intracellular signaling domain of human TNFR2, or a fragment or variant thereof, and the primary intracellular signaling domain of human CD3-zeta.

In some embodiments, the CAR comprises:

- extracellular binding domain,

- extracellular hinge domain containing the hinge region of human CD8 or CD28,

- a transmembrane domain comprising the human TNFR2 transmembrane domain, or a fragment or variant thereof, and

- an intracellular domain containing the costimulatory intracellular signaling domain of human TNFR2, or a fragment or variant thereof, and the primary intracellular signaling domain of human CD3-zeta.

In some embodiments, the transmembrane domain of a CAR described herein comprises at least eight contiguous amino acids from SEQ ID NO: 22 or a sequence having at least about 70% identity to SEQ ID NO: 22. In some embodiments, the transmembrane domain contains at least eight contiguous amino acid residues from SEQ ID NO: 22 in combination with amino acid residues of the transmembrane domain of a protein that is not TNFR2. In some embodiments, the transmembrane domain comprises the amino acid sequence VNCVIMTQV (SEQ ID NO: 63).

In some embodiments, the intracellular domain of a CAR described herein comprises at least 30 contiguous amino acid residues from SEQ ID NO: 34 or a sequence having at least about 70% identity to SEQ ID NO: 34. In some embodiments, the intracellular the domain contains at least 30 contiguous amino acid residues from SEQ ID NO: 34 in combination with the amino acid residues of a costimulatory intracellular signaling domain of a protein that is not TNFR2. In some embodiments, the intracellular signaling domain comprises residues 1-70, 1-115, or 1-156 of SEQ ID NO: 34.

In some embodiments, the CAR comprises:

- extracellular binding domain,

- an extracellular hinge domain containing the CD8 hinge region of SEQ ID NO: 14,

- a transmembrane domain containing the TNFR2 transmembrane domain of SEQ ID NO: 22, and

- intracellular domain containing:

- the primary intracellular signaling domain of human CD3-zeta from SEQ ID NO: 28, 29, 30 or 31, and

- costimulatory intracellular signaling domain TNFR2 from SEQ ID NO: 34.

In some embodiments, the extracellular binding domain of a CAR described herein is an antibody or an antigen-binding fragment thereof. In specific embodiments, the extracellular binding domain is a single chain variable fragment (scFv). The extracellular binding domain can specifically bind, e.g.

- autoantigen, optionally representing the IL-23 receptor (IL-23R);

- B cell antigen, optionally selected from CD19 and CD20; or

- an allogeneic HLA class I or class II molecule, where the class I molecule is optionally HLA-A2.

The present invention also provides a nucleic acid sequence encoding the CAR described herein, as well as a vector containing the nucleic acid sequence, and a host cell containing the nucleic acid sequence or vector.

The present invention also relates to a population of immune cells expressing the CAR described herein. In some embodiments, the immune cells are selected from the group consisting of T cells, natural killer (NK) cells, αβ T cells, γδ T cells, double negative (DN) cells, regulatory immune cells, regulatory T cells ( Tregs), effector immune cells, effector T cells, B cells and myeloid-derived cells, and any combination thereof, where the immune cells are optionally human cells. In specific embodiments, the population includes Treg cells, wherein the Treg cells are optionally human cells.

In some embodiments, the immune cell population includes human Treg cells expressing a CAR comprising:

- extracellular binding domain,

- hinge domain containing the hinge region of human CD8,

- human TNFR2 transmembrane domain, and

- an intracellular domain containing the costimulatory intracellular signaling domain of human TNFR2 and the primary intracellular signaling domain of human CD3-zeta.

The present invention also provides a pharmaceutical composition comprising an immune cell, host cell or population of immune cells expressing a CAR described herein and a pharmaceutically acceptable excipient. Also provided is a method of treating a disease or disorder in a human subject in need thereof, comprising administering to the subject a pharmaceutical composition.

The present invention also relates to a chimeric antigen receptor population or immune cell population described herein for use in treating a disease or disorder in a human in need thereof.

The present invention also provides the use of a chimeric antigen receptor or population of immune cells described herein to produce a medicament for treating a disease or disorder in a human subject in need thereof.

In some embodiments, the disease or disorder is selected from the group consisting of an inflammatory disease, an autoimmune disease, an allergic disease, an organ transplant condition, cancer, and an infectious disease.

In some embodiments, the human subject is in need of immunosuppression, and the CAR is expressed in Treg cells in the human subject.

In some embodiments, the disease or disorder is an inflammatory disease, an autoimmune disease, an allergic disease, or a post-organ transplant condition (eg, graft rejection or graft-versus-host disease).

The invention also provides a chimeric antigen receptor or population of immune cells described herein for use as a drug.

Brief description of drawings

Figure 1 depicts a schematic view of the CD19-CAR, CD20-CAR and IL-23R-CAR constructs. CARs contain a human CD8 leader sequence (CD8), optionally a hemagglutinin tag (HA), an scFv sequence (anti-CD19, anti-CD20 or anti-IL-23R), optionally a streptavidin tag (Tag), a hinge domain (linker), transmembrane domain (TNFR2 or CD8), costimulatory intracellular signaling domain (4-IBB or TNFR2) and CD3 zeta (CD3ζ). The CAR construct is in frame with the P2A-GFP coding sequence.

Figure 2 presents flow cytometry dot plots showing transduction efficiency and CAR cell surface expression of Tregs. Transduction efficiency was assessed by GFP expression, and CAR expression was assessed by HA expression for CD19-CAR (CD8TM/ 4-1BB or TNFR2) or L protein staining for CD20-CAR (CD8TM/ 4-1BB or TNFR2). MFI: mean fluorescence intensity.

Figure 3 shows Western blot analysis of CAR expression in human Tregs transduced with CD20-CAR (CD8TM/4-1BB or TNFR2) or untransduced (“blank”). Staining with a specific CD3-zeta antibody revealed endogenous CD3-zeta at 16 kDa, CD20-CAR (CD8TM/4-1BB) at ~62 kDa, and CD20-CAR (TNFR2) at 82 kDa (Panel A, top left) . The membrane was then washed and reassayed with anti-β-actin antibody as a loading control (panel A, bottom left). Band intensity was quantified using image J, and the results are shown from two different donors in panel B.

Figure 4 presents histograms showing that TNFR2-derived CARs retain CAR-specific activation. At day 9, transduced FoxP3 Tregs were plated alone or in the presence of anti-CD3/anti-CD28-coated beads or in the presence of freshly thawed autologous B cells. After 24 hours, CD19-CAR (top left), CD20-CAR (top right), and IL-23R-CAR (bottom) were stained for cell surface expression of CD4 and CD69. Error bars represent mean ± SEM. CTRL: Treg cells are not transduced with CAR.

Figure 5 is a graph showing that TNFR2-derived CARs exhibit effective CAR-mediated suppressive activity. Contact-dependent suppression mediated by Treg CD19-CAR (panel A), Treg CD20-CAR (panel B), or Treg IL-23R-CAR (panel C) in the absence of any activation (dashed lines) or after B cell-induced CAR activation (solid lines) was assessed by measuring conventional T cell proliferation (Tconv) using flow cytometry. Circles represent CD8TM/4-1BB CAR constructs and squares represent TNFR2 CAR constructs. Error bars represent mean ± SEM.

Figure 6 is a schematic view of the CD19-CAR constructs of the invention. The CAR includes the human CD8 leader sequence (CD8), scFv sequence (anti-CD19), streptavidin tag (Tag), hinge domain (linker), transmembrane domain (CD8, TNFR2 or hybrid CD8/TNFR2), costimulatory intracellular signaling domain (fragments 4 -IBB, TNFR2 or TNFR2) and CD3-zeta (CD3z). The CAR construct is in frame with the P2A-GFP coding sequence.

Figure 7 is a pair of graphs showing that TNFR2-C-terminal deletion constructs exhibit different levels of surface expression and are functional in CD3z signaling in Jurkat-NFAT cells. Jurkat-NFAT cells were transduced with the indicated constructs. After one week of culture, CAR surface expression was determined by protein staining (panel A), and cells were activated with CD19-expressing Daudi cells in a 1:1 ratio. After 24 hours, NFAT-dependent luciferase secretion was determined using a Glowmax luminometer (panel B).

Figure 8 is a set of scatter plots showing transduction efficiency and cell surface expression of CAR (top and bottom left) and a graph showing the viability of transduced CAR-Treg cells (bottom right). Day 8 transduction efficiency (%) was assessed using GFP expression levels, and CAR density (MFI) was assessed using protein-L labeling. Cell viability was assessed using the propidium iodide exclusion method. Error bars represent mean ± standard deviation.

Figure 9 is a graph showing ligand-independent tonic signaling and activation capacity of anti-CD20 CAR. On day 9, transduced FoxP3 Tregs were plated alone (“None”) in the presence of anti-CD3/anti-CD28-coated beads or in the presence of freshly thawed autologous B cells (“B cells”). After 24 hours, cells were stained for cell surface expression of CD4 and CD69. Error bars represent mean ± standard deviation. For the No condition, statistical analysis was performed using the GFP condition as a control (* p < 0.05, ** p < 0.01, and *** p < 0.001, paired T test).

10 depicts a set of graphs showing that TNFR2-derived CD20 CARs exhibit effective CAR-mediated suppressor activity, but not 4-1BB and TNFR1-derived CD20 CARs. Contact-dependent suppression mediated by CAR Treg cells in the absence of any activation (“None”) or following B cell-induced CAR activation (“B cells”) was assessed by measuring conventional T cell proliferation (Tconv).

11 is a set of graphs showing the effectiveness of CAR-mediated suppressive activity. Contact-dependent suppression (%) following B cell-induced CAR activation using TNFR2 (top) or TNFR1 (bottom)-derived CARs was plotted as a function of the number of CAR-Treg cells in the assay. This representation allows calculation of the number of CAR-Tregs required to trigger 50% suppression.

12 schematically represents the HLA-A2-CAR constructs used in Example 5. The CARs include a human CD8 leader sequence (CD8), an anti-HLA-A2 scFv sequence, a hinge domain (linker), a transmembrane domain (TNFR2 or CD8TM), a cosignal domain (CD28 or TNFR2 or TNFR2+4-1BB) and CD3-zeta (CD3Z). These CAR constructs are in frame with the P2A-GFP coding sequence.

Figure 13 depicts flow cytometry dot plots showing transduction efficiency and CAR cell surface expression of Treg cells. Transduction efficiency was assessed by GFP expression, and cell surface expression of CAR was assessed by Dextramer® expression.

14 depicts flow cytometry dot plots showing the presence of Treg phenotypic markers on HLA*A2 CAR-Treg.

Figure 15 is a set of graphs showing body weight change (top left), GVHD score (top right), and percent disease-free survival (bottom) over time for NSG mice treated with HLA*A2-CAR-Treg containing TNFR2 , CD28 or TNFR2+4-1BB domains.

Detailed Description of the Invention

Definitions

In the present invention, the following terms have the following meanings:

Singular terms refer to one or more than one (that is, at least one) grammatical entity of the subject matter. By way of example, "element" means one or more than one element.

The term "about", when referring to a measurable quantity such as quantity, duration of time, etc., is intended to cover variations of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases in cases ±1%, or in some cases ±0.1% of the specified value if such variations are suitable for carrying out the disclosed methods.

The term “activation” as used herein refers to the state of a T cell (eg, a regulatory T cell) that has been sufficiently stimulated to elicit a detectable cellular response. Activation may also be associated with detectable effector function(s), such as cytokine production or suppressor activity. The term “activated” regulatory T cells refers to, but is not limited to, regulatory T cells that are capable of suppressing an immune response.

The term "affibody" is well known in the art and refers to affinity proteins based on a 58 amino acid residue protein domain derived from one of the IgG binding domains of staphylococcal protein A.

The term "allogeneic" refers to any material obtained from another subject of the same species as the subject to which the material is administered. Two or more entities are said to be allogenic to each other if the genes at one or more loci are not identical. In some aspects, allogeneic material from members of the same species may be genetically dissimilar enough to interact antigenically.

The term "antibody" or "immunoglobulin" (Ig) as used herein refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds an antigen. Antibodies can be polyclonal or monoclonal, multi-chain or single-chain, or intact immunoglobulins, and can be obtained from natural sources or from recombinant sources. The term "antibody" also includes multispecific antibodies (eg, bispecific antibodies) and antibody fragments, provided they exhibit the required biological activity. Antibodies may be multimers of immunoglobulin molecules, such as tetramers of immunoglobulin molecules.

The basic four-chain unit of an antibody is a heterotetrameric glycoprotein consisting of two identical light (L) chains and two identical heavy (H) chains. The L chain of any vertebrate species can be classified into one of two clearly distinct types, called kappa (κ) and lambda (λ), based on the amino acid sequences of their constant domains (CL). Depending on the amino acid sequence of the constant domain of their heavy chains (CH), immunoglobulins can be classified into different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, the heavy chains of which are designated alpha (α), delta (δ), epsilon (ε), gamma (γ) and mu (μ), respectively. The γ and α classes are further divided into subclasses based on relatively minor differences in CH sequence and function, for example, humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. Each L chain is linked to an H chain by a single covalent disulfide bond, while two H chains are linked to each other by one or more disulfide bonds depending on the isotype of the H chain. Each H- and L-chain also has regular intrachain disulfide bridges. Each H chain has a variable domain (VH) at the N-terminus, followed by three constant domains (CH) for each of the α and γ chains and four CH domains for the μ and ε isotypes. Each L chain has a variable domain (VL) at the N terminus, followed by a constant domain (CL) at the other end. VL is aligned with VH and CL is aligned with the first heavy chain constant domain (CH1). Certain amino acid residues are believed to form the interface between the light chain and heavy chain variable domains. The pairing of VH and VL provides a single antigen-binding site. The IgM antibody is composed of five basic heterotetrameric units together with an additional polypeptide called the J chain and therefore contains ten antigen-binding sites, while secreted IgA antibodies can polymerize to form multivalent complexes comprising 2-5 basic 4-chain units along with the J-chain. In the case of IgG, the size of the four-stranded unit is usually about 150,000 daltons. On the structure and properties of various classes of antibodies, see, for example, Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, Conn., 1994, page 71, and Chapter 6.

The term "monoclonal antibody" as used herein refers to an antibody derived from a population of essentially homogeneous antibodies, i.e. The individual antibodies within a population are identical, except for possible naturally occurring mutations that may be present in minute quantities. Monoclonal antibodies are highly specific and directed against a single antigenic site. Additionally, unlike polyclonal antibody preparations, which include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single antigen determinant. In addition to their specificity, monoclonal antibodies have the advantage that they can be synthesized without contamination by other antibodies. The designation "monoclonal" should not be interpreted as requiring the antibody to be produced by any particular method. For example, a monoclonal antibody can be produced by hybridoma methodology first described by Kohler et al., Nature 256: 495 (1975), or can be produced using recombinant DNA techniques in bacterial, eukaryotic animal or plant cells (see, for example, US Pat. No. 4816567). "Monoclonal antibody" can also be isolated from phage antibody libraries using techniques described, for example, in Clackson et al., Nature 352: 624-628 (1991) and Marks et al., J. Mol. Biol. 222:581-597 (1991). Monoclonal antibodies described herein include “chimeric” antibodies that contain one or more regions from one antibody (eg, non-human variable domains) and one or more regions from one or more other antibodies (eg, human constant regions).

The term “antibody fragment” refers to at least one portion of an intact antibody, e.g., an antigen binding region or a variable region of an intact antibody, that retains the ability to specifically interact (e.g., by binding, steric hindrance, stabilization/destabilization, and/or spatial distribution) with epitope of the antigen. Examples of antibody fragments include Fab, Fab', F(ab') ₂ , Fv fragments, scFv antibody fragments, disulfide-linked Fv (sdFv), Fd fragment consisting of VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either VL or VH), camel VHH domains, multispecific antibodies formed from antibody fragments, such as a divalent fragment containing two Fab fragments linked by a disulfide bridge in the hinge region, and an isolated CDR or other epitope-binding fragments of the antibody, but not limited to them. The antigen binding moiety may also be included in single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, tribodies, tetrabodies, v-NAR and bis-scFv (see, for example, Hollinger and Hudson, Nature Biotechnology 23: 1126-1136 (2005 )). Antigen binding moieties can also be grafted onto polypeptide scaffolds such as type III fibronectin (see, for example, US Pat. No. 6,703,199, which describes fibronectin polypeptide minibodies). Digestion of antibodies with papain produces two identical antigen-binding fragments, called “Fab” fragments, and a residual “Fc” fragment, designated to reflect its ability to readily crystallize. The Fab fragment consists of the complete L chain together with the H chain variable domain (VH) and the first single heavy chain constant domain (CH1). Each Fab fragment is monovalent with respect to antigen binding, that is, it has a single antigen-binding site. Treatment of the antibody with pepsin produces one large F(ab') ₂ fragment, which roughly corresponds to two disulfide-linked Fab fragments that have bivalent antigen-binding activity and are still capable of antigen cross-linking. Fab' fragments differ from Fab fragments by the presence of several additional residues at the carboxy terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. Fab'-SH is a designation for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab') ₂ antibody fragments were originally produced as pairs of Fab' fragments containing hinge cysteines between them. Other chemical compounds of antibody fragments are also known.

An "intact antibody" is an antibody that contains an antigen binding region as well as CL and at least the heavy chain constant domains CH1, CH2 and CH3. The constant domains may be native sequence constant domains (eg, human native sequence constant domains) or amino acid sequence variants thereof. A "native sequence" polynucleotide is a polynucleotide that has the same nucleotide sequence as a natural polynucleotide. A "native sequence" polypeptide is a polypeptide that has the same amino acid sequence as a polypeptide (eg, an antibody) obtained from a natural source (eg, any species). Such native sequence polynucleotides and polypeptides may be isolated from natural sources or may be produced by recombinant or synthetic methods.

As used herein, the term “antibody functional fragment or analogue” means a compound that has qualitative biological activity in common with a full-length antibody. For example, a functional fragment or analog of an anti-IgE antibody is a fragment that can bind to an IgE immunoglobulin in such a way as to prevent or significantly reduce the ability of such a molecule to bind to the high affinity receptor FcεRI.

The term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in antibody molecules in their natural conformations, and usually defines the class to which the antibody belongs.

The term "antibody light chain" refers to the smaller of the two types of polypeptide chains present in antibody molecules in their natural conformations. Kappa (κ) and lambda (λ) light chains refer to the two major isotypes of antibody light chain.

"Anticalins" are well known in the art and refer to antibody mimetic technology in which binding specificity is derived from lipocalins. Anticalins can also be formatted as dual-targeting proteins called duocalins.

The term "antigen" or "Ag" refers to a molecule that causes an immune response. This immune response may involve the production of antibodies, the activation of specific immune cells, or both. One skilled in the art will appreciate that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. In addition, antigens can be derived from recombinant or genomic DNA. One skilled in the art will appreciate that any DNA that contains a nucleotide sequence or partial nucleotide sequence encoding a protein that causes an immune response therefore encodes an "antigen" as that term is used herein. In addition, one skilled in the art will appreciate that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It is clear that the present invention includes, without limitation, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to encode polypeptides that cause the desired immune response. In addition, one skilled in the art will appreciate that an antigen does not necessarily have to be encoded by a “gene.” It is clear that the antigen can be synthesized or can be obtained from a biological sample, or can be a macromolecule other than a polypeptide. Such a biological sample may include, for example, but is not limited to a tissue sample, cell, or fluid with other biological components.

The term "antigen presenting cell" or "APC" refers to a cell of the immune system, such as an accessory cell (eg, B cell, dendritic cell, etc.), that presents a foreign antigen in complex with major histocompatibility complexes (MHC) on its surfaces. T cells can recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

The term "autologous" refers to any material obtained from the same subject to whom it will later be reintroduced.

"Avimers" are well known in the art and belong to antibody mimetic technology.

The term "chimeric receptor" or "chimeric antigen receptor" or "CR" or "CAR" refers to a single polypeptide or set of polypeptides, usually two in the simplest embodiments, that in an immune cell provide the cell with target ligand specificity and with generation of an intracellular signal. In some embodiments, the sets of polypeptides are adjacent to each other. In some embodiments, the chimeric receptor is a chimeric fusion protein comprising a set of polypeptides. In some embodiments, the set of polypeptides includes a dimerization switch that, in the presence of a dimerization molecule, can link the polypeptides to each other, for example, can link a ligand binding domain to an intracellular signaling domain. In some embodiments, the chimeric receptor comprises an optional leader sequence at the amino terminus (N-ter) of the chimeric receptor fusion protein. In some embodiments, the chimeric receptor contains a leader sequence at the N-terminus of the extracellular ligand-binding domain, where the leader sequence is optionally cleaved from the ligand-binding domain during cellular processing and localization of the chimeric receptor to the cell membrane.

The term “conservative sequence modifications” refers to amino acid modifications that do not significantly affect or alter the biological function of the protein containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the protein by standard methods known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. "Conservative amino acid substitutions" are substitutions in which an amino acid residue is replaced by an amino acid residue that has similar properties such that one skilled in the art of peptide chemistry would expect that the secondary structure and hydropathic nature of the polypeptide would be preserved without significant changes. Thus, amino acid substitutions are generally based on the relative similarity of the amino acid substituents on the side chain, such as their hydrophobicity, hydrophilicity, charge, size, etc. Examples of substitutions that take into account various of the above characteristics are well known to those skilled in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Amino acid substitutions can further be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; and serine, threonine, phenylalanine and tyrosine. Other groups of amino acids that may represent conservative changes include: (1) Ala, Pro, Gly, Glu, Asp, Gln, Asn, Ser, Thr; (2) Cys, Ser, Tyr, Thr; (3) Val, Ile, Leu, Met, Ala, Phe; (4) Lys, Arg, His; and (5) Phe, Tyr, Trp, His. Other families of amino acid residues having similar side chains have been identified in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine , tryptophan, histidine). Thus, one or more amino acid residues in the chimeric receptor of the invention can be replaced with other amino acid residues from the same side chain family, and the altered chimeric receptor can be tested using the functional assays described herein.

The term "constitutive promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, causes production of the gene product in a cell under most or all physiological conditions in the cell.

The term “costimulatory molecule” refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response of the T cell, such as but not limited to proliferation. Costimulatory molecules are cell surface molecules, other than antigen receptors or their ligands, that promote an effective immune response. The costimulatory signaling domain may be an intracellular portion of a costimulatory molecule. The costimulatory molecule can be represented in the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), and activating NK cell receptors.

"Cytotoxic cell" includes any cell capable of mediating a cytotoxic response.

The term "derived from" as used herein indicates the relationship between the first and second molecules. Typically this refers to the structural similarity between the first molecule and the second molecule, and does not imply or include a process or source limitation on the first molecule being a derivative of the second molecule. For example, in the case of an intracellular signaling domain that is derived from a CD3-zeta molecule, the intracellular signaling domain retains sufficient CD3-zeta structure that it performs the desired function, namely the ability to generate a signal under appropriate conditions. It does not imply or involve restricting the specific process of obtaining the intracellular signaling domain, for example, it does not mean that to provide an intracellular signaling domain one must start with the CD3-zeta sequence and remove the unwanted sequence or introduce mutations to get to the intracellular signaling domain.

The term "diabodies" refers to small antibody fragments made by constructing sFv fragments with short linkers (approximately 5-10 residues) between the VH and VL domains so that interchain but not intrachain pairing of the V domains is achieved, resulting in a divalent fragment , that is, a fragment having two antigen-binding sites. Bispecific diabodies are heterodimers of two “crossover” sFv fragments, in which the VH and VL domains of the two antibodies are present on different polypeptide chains. Diabodies are described more fully, for example, in EP 0404097; WO 93/11161; and Holliger et al., Proc. Natl. Academician Sci. USA, 90: 6444-6448 (1993).

A “domain antibody” is well known in the art and refers to the smallest functional binding unit of an antibody corresponding to the variable region of the heavy or light chain of an antibody.

The term "coding" refers to the inherent property of specific nucleotide sequences in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as templates for the synthesis of other polymers and macromolecules in biological processes having either a specific nucleotide sequence (e.g., rRNA, tRNA, and mRNA) or a certain sequence of amino acids and the resulting biological properties. Thus, a gene, cDNA, or RNA encodes a protein if transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually represented in sequence listings, and the non-coding strand used as a template for transcription of a gene or cDNA may be referred to as encoding a protein or other product of that gene or cDNA. Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "protein or RNA encoding nucleotide sequence" may also include introns to the extent that the protein encoding nucleotide sequence may in some version contain intron(s).

The term "endogenous" refers to any material that naturally occurs or is produced naturally in an organism, cell, tissue, or system.

The term "engineered" or "modified" refers to a cell that has been transfected, transformed, or transduced.

The term "exogenous" refers to any material introduced into or produced outside an organism, cell, tissue or system.

The term "expression" refers to the transcription and/or translation of a specific nucleotide sequence driven by a promoter.

The term "expression vector" refers to a vector comprising a recombinant polynucleotide containing an expression control sequence operably linked to the nucleotide sequence to be expressed. The expression vector contains a sufficient number of cis-acting elements for expression; other expression elements may be supplied by the host cell or in an in vitro expression system. Expression vectors include all known in the art, including cosmids, plasmids (eg, deproteinized or contained in liposomes), transposons (eg, "sleeping beauties") and viruses (eg, lentiviruses, retroviruses, adenoviruses and adeno-associated viruses), which include a recombinant polynucleotide.

The term polynucleotide "fragment" as used herein means a polynucleotide that generally differs from the polynucleotide specifically disclosed herein by one or more deletions. Such fragments may occur naturally or may be produced synthetically, for example, by modifying one or more polynucleotide sequences of the invention and assessing one or more biological activities of the encoded fragment, as described herein, and/or using any of a number of methods, including known in the art. Accordingly, the term “polypeptide fragment” as used herein is a polypeptide that typically differs from the polypeptide specifically described herein by one or more deletions. Such fragments may be naturally occurring or may be produced synthetically, for example, by modifying one or more polypeptide sequences of the invention and assessing one or more biological activities of the polypeptide as described herein, and/or using any of a number of methods, such as known in the art. Modifications can be made to the structure of the polynucleotides and polypeptides of the present invention while resulting in a functional molecule that encodes or is a fragment of a polypeptide with the desired characteristics and without appreciable loss of biological utility or activity. In some embodiments, the polypeptide fragments differ from the native sequence by deleting less than 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid. The fragments can also (or alternatively) be modified, for example, by deleting amino acids that have minimal impact on the immunogenicity, secondary structure and hydropathic nature of the polypeptide.

The "Fc" fragment of an antibody includes the carboxy-terminal portions of both H chains held together by disulfides. The effector functions of antibodies are determined by sequences in the Fc region, which is also the part recognized by Fc receptors (FcRs) found on certain cell types.

"Fv" is the minimal antibody fragment that contains the complete antigen recognition and binding site. This fragment consists of a dimer of one heavy and one light chain variable domain in a tight non-covalent bond. As a result of the folding of these two domains, six hypervariable loops are formed (three loops each from the H- and L-chain), which contribute amino acid residues for antigen binding and give the antibody specificity for antigen binding. However, even a single variable domain (or half of an Fv containing only three antigen-specific CDRs) may have the ability to recognize and bind antigen, albeit with lower affinity than the entire binding site.

"Framework" or "FR" residues are those variable domain residues that differ from the hypervariable region residues defined herein.

The term "graft-versus-host disease" or "GVHD" as used herein refers to a medical complication following receipt of transplanted tissue from a genetically different subject. Immune cells in the donor tissue (graft) recognize the recipient (host) as foreign. The transplanted immune cells then attack the host cells. GVHD is commonly associated with stem cell transplantation; however, the term includes GVHD arising from other forms of tissue graft. GVHD can also develop after a blood transfusion.

The term “homology” or “identity” refers to the identity of a subunit sequence between two polymer molecules, for example, between two nucleic acid molecules, such as two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of two molecules is occupied by the same monomeric subunit; for example, if a position in each of two DNA molecules is occupied by an adenine, then they are homologous or identical at that position. Homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half (e.g., five positions in a ten-subunit-long polymer) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g. 9 out of 10) are the same or homologous, the two sequences are 90% homologous. Thus, the term "homologous" or "identical", when used in a relationship between the sequences of two or more polypeptides, or two or more nucleic acid molecules, refers to the degree of sequence relatedness between the polypeptide or nucleic acid molecules, as determined by the number of matches between the strands of two or more amino acid or nucleotide residues. "Identity" measures the percentage of identical matches between the smaller of two or more gap-aligned sequences (if any) that are accounted for by a particular mathematical model or computer program (i.e., "algorithms"). The identity of related polypeptides can be easily calculated by known methods. Such methods include those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM J. Applied Math. 48:1073 (1988), but not limited to them. Preferred methods for determining identity are designed to ensure maximum agreement between the sequences being tested. Methods for determining identity are described in publicly available computer programs. Examples of computer program methods for determining the identity of two sequences include the GCG software package, including GAP (Devereux et al., Nucl. Acid. Res. 12: 387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP , BLASTN and FASTA (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)). The BLASTX program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB/NLM/NIH Bethesda, Md. 20894; Altschul et al., supra). The well-known Smith-Waterman algorithm can also be used to determine identity.

The term "humanized", as it refers to forms of non-human (e.g., murine) antibodies, refers to chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') ₂ or other antigen-binding antibody subsequences) , which contain minimal sequence derived from non-human immunoglobulins. In general, humanized antibodies and fragments thereof are human immunoglobulins (recipient antibody or antibody fragment) in which residues from the hypervariable region (CDR) of the recipient are replaced by residues from the CDR of a non-human species (donor antibody), such as a mouse, rat or rabbit , having the necessary specificity, affinity and capacity. In some cases, framework region (FR) residues of human immunoglobulin Fv are replaced with corresponding residues of non-human origin. In addition, the humanized antibody/antibody fragment may contain residues that are not present in either the recipient antibody or the imported CDR or framework sequences. These modifications can further improve and optimize the characteristics of the antibody or antibody fragment. Typically, a humanized antibody or antibody fragment thereof will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to non-human immunoglobulin regions, and all or a substantial portion of the FR regions are immunoglobulin sequence person. The humanized antibody or antibody fragment may also comprise at least a portion of an immunoglobulin constant region (Fc), typically human immunoglobulin. For more information, see, for example, Jones et al., Nature 321:522-525 (1986); Reichmann et al., Nature, 332:323-329 (1988); Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).

As used herein, the term “immune cells” generally includes white blood cells (leukocytes) that are derived from hematopoietic stem cells (HSC) produced in the bone marrow. Examples of immune cells include, but are not limited to, lymphocytes (T cells, B cells, and natural killer (NK) cells) and myeloid-derived cells (neutrophils, eosinophils, basophils, monocytes, macrophages, and dendritic cells).

As used herein, the term “immune effector cell” refers to a cell of the immune system that is in a form capable of eliciting a specific immune response.

As used herein, the term “immune regulatory cell” refers to an immune cell that acts in a “regulatory” manner to suppress immune system activation and thereby maintain immune system homeostasis and tolerance to self-antigens. “Regulatory immune cells” can also influence non-immune cells, resulting in improved clinical conditions, such as tissue repair or regeneration. Regulatory immune cells may include regulatory T cells (eg, regulatory CD4+ T cells, regulatory CD8+ T cells, regulatory γδ T cells, and/or regulatory DN T cells), regulatory B cells, regulatory NK cells, regulatory macrophages, and regulatory dendritic cells, but are not limited to them.

As used herein, the term “immune response” includes immune responses mediated by T cells and/or B cells. Typical immune responses include T cell responses such as proliferation, cytokine production, and cellular cytotoxicity. In addition, the term “immune response” includes immune responses that are indirectly affected by T cell activation, such as antibody production (humoral responses) and activation of cytokine-sensitive cells, such as macrophages. Immune cells involved in the immune response include lymphocytes such as B cells and T cells (CD4+, CD8+, Th1 and Th2 cells); antigen presenting cells (eg, professional antigen presenting cells such as dendritic cells, macrophages, B lymphocytes, Langerhans cells, and non-professional antigen presenting cells such as keratinocytes, endothelial cells, astrocytes, fibroblasts, oligodendrocytes); natural killer cells; and myeloid cells such as macrophages, eosinophils, mast cells, basophils and granulocytes.

As used herein, the term “immune accommodation” refers to a condition in a transplant recipient in which the organ or tissue graft functions normally despite the presence of organ or tissue graft-specific antibodies in the recipient.

As used herein, the term “immunological tolerance” or “immune tolerance” refers to (a) a reduced level of specific immunological response (believed to be mediated, at least in part, by antigen-specific effector T lymphocytes, B lymphocytes, antibodies or their equivalents); (b) delaying the onset or progression of a specific immunological response; or (c) a reduced risk of the onset or progression of a specific immunological response in one population of subjects (eg, subjects who have undergone treatment, such as the treatment described herein) compared to another population of subjects (eg, subjects who have not undergone treatment). "Specific" immunological or immune tolerance occurs when immunological or immune tolerance is preferentially induced against certain antigens over others.

As used herein, the term “in vitro transcribed RNA” refers to RNA, eg, mRNA, that has been synthesized in vitro. Typically, in vitro transcribed RNA is generated from an in vitro transcription vector. An in vitro transcription vector contains a template that is used to create in vitro transcribed RNA.

The term “inducible” promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes production of the gene product in a cell, substantially only when an inducer corresponding to the promoter is present in the cell.

As used herein, a "5' cap" (also referred to as an RNA cap, 7-methylguanosine RNA cap, or m7G RNA cap) means a modified guanine nucleotide that has been added to the "front" or 5' end of a eukaryotic messenger RNA shortly after the start of transcription. . The 5' cap consists of a terminal group that is linked to the first transcribed nucleotide. Its presence is critical for recognition by the ribosome and protection against RNases. Cap addition is transcriptionally coupled and occurs in concert with transcription, so that one influences the other. Shortly after transcription begins, the 5' end of the resulting mRNA is bound by a cap synthesis complex associated with RNA polymerase. This enzymatic complex catalyzes the chemical reactions required to cap the mRNA. Synthesis proceeds as a multi-stage biochemical reaction. The capping moiety can be modified to modulate the functionality of the mRNA, such as its stability or translation efficiency.

In the context of the present invention, the following abbreviations for commonly occurring nucleic acid bases are used. "A" refers to adenine, "C" refers to cytosine, "G" refers to guanine, "T" refers to thymine, and "U" refers to uracil.

The term "information material" includes publication, record, diagram or any other medium of expression that can be used to communicate the usefulness or use of the compositions and methods of the invention. The kit information material of the invention may, for example, be attached to a container that contains a nucleic acid, vector, cell population, or composition of the invention, or may be shipped with a container that contains a nucleic acid, vector, cell population, or composition of the invention . Alternatively, the information material may be delivered separately from the container with the intention that the container and information material will be used together by the recipient.

The term "intracellular signaling domain" as used herein refers to the intracellular portion of the molecule. The intracellular signaling domain generates a signal that promotes the immune effector function of the cell containing the chimeric receptor. Examples of immune effector function in a chimeric receptor T cell may include cytolytic activity, suppressor activity, regulatory activity and helper activity, including cytokine secretion.

The term "isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide, partially or completely isolated from coexisting materials in their natural state, is “isolated.” The isolated nucleic acid or peptide may exist in substantially purified form or may exist in a non-native environment, such as, for example, a host cell. Typically, an isolated nucleic acid or peptide preparation contains a nucleic acid or peptide that is at least 80% pure, at least 85% pure, at least 90% pure, at least 95% pure, greater than 95% pure, greater than greater than about 96% pure, greater than about 97% pure, greater than about 98% pure, or greater than about 99% pure. An "isolated polypeptide" is a polypeptide that has been identified and isolated and/or recovered from a component of its natural environment.

An "isolated nucleic acid" or "isolated nucleic sequence" is a nucleic acid that is substantially separated from other genomic DNA sequences, as well as from proteins or complexes, such as ribosomes and polymerases, that naturally accompany the native sequence. The term covers a nucleic acid sequence that has been removed from its natural environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogues, or analogues biologically synthesized by heterologous systems. Substantially pure nucleic acid includes isolated forms of nucleic acid. Of course, this refers to the originally isolated nucleic acid and does not exclude genes or sequences later added to the isolated nucleic acid by human hand. In some embodiments, the isolated nucleic acid or isolated nucleic sequence does not occur in nature.

An "isolated polypeptide" is a polypeptide that has been identified and isolated and/or recovered from a component of its natural environment. In some embodiments, the isolated polypeptide will be purified (1) to greater than 95% by weight of the polypeptide, as determined by the Lowry method, and in certain embodiments, to greater than 99% by weight; (2) to an extent sufficient to obtain at least 15 residues of the N-terminal or internal amino acid sequence using a rotating beaker sequencer; or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or, in some embodiments, silver staining. An isolated polypeptide includes the polypeptide in situ in recombinant cells, since at least one component of the polypeptide's natural environment will not be present. In some embodiments, the isolated polypeptide will be obtained in at least one purification step. In some embodiments, the isolated polypeptide is not naturally occurring.

The term "lentivirus" refers to a genus in the family Retroviridae. Lentiviruses are unique among retroviruses in that they are able to infect nondividing cells. Because they can deliver a significant amount of genetic information into the host cell's DNA, they are among the most efficient gene delivery vectors. HIV, SIV and FIV are all examples of lentiviruses.

The term “lentiviral vector” refers to a vector derived from at least a portion of a lentiviral genome, including, for example, the self-inactivating lentiviral vector proposed by Milone et al., Mol. Ther. 17 (8): 1453-1464 (2009). Other examples of lentiviral vectors that can be used clinically include, but are not limited to, LENTIVECTOR® gene delivery technology from Oxford BioMedica and the LENTIMAX™ vector system from Lentigen. Preclinical types of lentiviral vectors are also available and known to one skilled in the art.

The term "ligand" refers to a member of a ligand/receptor pair that binds to another member of the pair (the receptor).

The term "nucleic acid" or "polynucleotide" refers to a polymer of nucleotides covalently linked by phosphodiester bonds, such as deoxyribonucleic acids (DNA) or ribonucleic acids (RNA), in single-stranded or double-stranded form. Unless specifically limited, the term covers nucleic acids containing known analogs of natural nucleotides that have the same binding properties as the reference nucleic acid and are metabolized similarly to natural nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly includes conservatively modified variants thereof (eg, degenerate codon substitutions), alleles, orthologues, SNPs and complementary sequences, as well as the explicitly stated sequence. In particular, degenerate codon substitutions can be achieved by creating sequences in which the third position of one or more selected (or all) codons is replaced by mixed base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991) ; Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)).

“Nanobody” is well known in the art and refers to an antibody-derived therapeutic protein that has the unique structural and functional properties of natural heavy chain antibodies. These heavy chain antibodies contain one variable domain (VHH) and two constant domains (CH2 and CH3).

A "native sequence" polynucleotide is a polynucleotide that has the same nucleotide sequence as a naturally occurring polynucleotide. A "native sequence" polypeptide is a polypeptide that has the same amino acid sequence as a polypeptide (eg, antibody) obtained from nature (eg, any species). Such native sequence polynucleotides and polypeptides may be isolated from natural sources or may be produced by recombinant or synthetic methods.

The term "operably linked" or "transcriptional control" refers to the functional relationship between a regulatory sequence and a heterologous nucleic acid sequence leading to expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is operably linked to a second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Functionally related DNA sequences may be adjacent to each other and, for example, if it is necessary to connect two protein coding regions, may be in the same reading frame.

The terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limitation on the maximum number of amino acids that can comprise a protein or peptide sequence. Polypeptides include any peptide or protein consisting of two or more amino acids linked to each other by peptide bonds. As used herein, the term refers, for example, to both short chains, which are also commonly referred to in the art as peptides, oligopeptides and oligomers, and longer chains, which are commonly referred to in the art as proteins of many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs and fusion proteins, among others. The polypeptide includes a naturally occurring peptide, a recombinant peptide, or a combination thereof.

The term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to an excipient that does not cause an adverse, allergic or other undesirable reaction when administered to an animal, such as a human. It includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption retarding agents, and the like. For human administration, drugs must meet the standards of sterility, pyrogenicity, general safety and purity required by regulatory authorities such as the FDA Office or EMA.

The term "poly(A)" refers to a series of adenosine monophosphate attached to the mRNA. In some embodiments, the transient polyA expression construct is 50 to 5000 adenosine monophosphates, such as 64 or more, 100 or more, or 300 or 400 or more adenosine monophosphates. Poly(A) sequences can be modified chemically or enzymatically to modulate mRNA functionality, such as localization, stability, or translational efficiency.

The term "polyadenylation" refers to the covalent bonding of a polyadenylyl moiety or a modified variant thereof to a messenger RNA molecule. In eukaryotic organisms, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to pre-mRNA by the enzyme polyadenylate polymerase. In higher eukaryotes, a poly(A) tail is added to transcripts that contain a specific sequence, the polyadenylation signal. The poly(A) tail and its associated protein help protect the mRNA from destruction by exonucleases. Polyadenylation is also important for transcription termination, nuclear export of mRNA, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but may also occur later in the cytoplasm. After transcription is complete, the mRNA strand is cleaved by an endonuclease complex associated with RNA polymerase. A cleavage site is typically characterized by the presence of the base sequence AAUAAA adjacent to the cleavage site. After mRNA cleavage, adenosine residues are added to the free 3' end at the cleavage site.

The term "promoter" refers to a DNA sequence recognized by a cell's synthetic machinery or introduced by a synthetic machinery necessary to initiate specific transcription of a polynucleotide sequence.

The term “promoter/regulatory sequence” refers to a nucleic acid sequence that is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in other cases, this sequence may also include an enhancer sequence and other regulatory elements that are required for expression of the gene product. The promoter/regulatory sequence may, for example, be a sequence that expresses a gene product in a tissue-specific manner.

The term “recombinant protein or peptide” refers to a protein or peptide (eg, antibody) that is generated using recombinant DNA technology, such as, for example, a protein or peptide (eg, antibody) expressed by a bacteriophage or yeast expression system. The term should also be interpreted to mean a protein or peptide (e.g., antibody) that has been produced by synthesizing a DNA molecule encoding a protein or peptide (e.g., an antibody), wherein the DNA molecule expresses a protein or peptide (e.g., an antibody), or an amino acid sequence, defining a protein or peptide (eg, an antibody), wherein the DNA or amino acid sequence was obtained using recombinant DNA or amino acid sequence technology that is available and well known in the art.

The terms "regulatory T lymphocyte", "regulatory T cell", "T regulatory cell", "Treg cell" and "Treg" as used in the present invention are synonymous and are intended to be used in the standard definition as adopted in this field of technology. Treg cells are a specialized subpopulation of T cells that act in a “regulatory” manner to suppress immune system activation and thereby maintain immune system homeostasis and tolerance to self-antigens. Tregs are sometimes called suppressor T cells. Treg cells are often, but not always, characterized by the expression of the Forkhead family transcription factor FoxP3 (Forkhead box P3). They may also express CD4 or CD8 surface proteins. They usually also express CD25. Tregs often have the CD4 ⁺ CD25 ⁺ CD127 ^lo FoxP3 ⁺ phenotype. In some embodiments, Tregs are also CD45RA ⁺ , CD62L ^hi and/or GITR ⁺ . In specific embodiments, Tregs are also CD4 ⁺ CD25 ⁺ CD127 ^lo CD62L ⁺ or CD4 ⁺ CD45RA ⁺ CD25 ^hi CD127 ^lo . As used herein, and unless otherwise noted, Tregs include “natural” Tregs that develop in the thymus, induced/adaptive/peripheral Tregs that arise from a differentiation process occurring outside the thymus (e.g., in tissues or secondary lymphoid organs , or in laboratory settings under certain culture conditions), and Tregs, which were created using recombinant DNA technology. Naturally occurring Treg cells (CD4 ⁺ CD25 ⁺ FoxP3 ⁺ ) arise like all other T cells in the thymus. In contrast, induced/adaptive/peripheral Tregs (which include CD4 ⁺ CD25 ⁺ FoxP3 ⁺ Tregs, Tr1 cells, Th3 cells, and others) arise outside the thymus. One way to induce Tregs is by targeting effector T cells with IL-10 or TGF-β. T cells can also be converted to Treg cells by transfecting or transducing the FoxP3 gene into a mixed population of T cells. A T cell that is induced to express FoxP3 adopts a Treg phenotype, and such recombinant Tregs are also defined herein as "Tregs".

The term "rejection" refers to a condition in which a transplanted organ or tissue is not accepted by the recipient's body. Rejection occurs when the recipient's immune system attacks the transplanted organ or tissue. Rejection can occur several days or weeks after transplantation (acute) or several months or years after transplantation (chronic).

As used herein, an antibody or CAR is said to be “immunospecific for,” “specific for,” or “specifically binds” an antigen if it reacts at a detectable level with the antigen, e.g., with an affinity constant Ka of about 10 ⁴ M ^-1 or greater, about 10 ⁵ M ^-1 or more, about 10 ⁶ M ^-1 or more, about 10 ⁷ M ^-1 or more, 10 ⁸ M ^-1 or more, 10 ⁹ M ^-1 or more, or 10 ¹⁰ M ^-1 or more. The affinity of an antibody for its cognate antigen is also typically expressed as a dissociation constant, Kd, and in some embodiments, an antibody binds specifically to an antigen if it binds to a Kd of 10 ^-4 M or less, about 10 ^-5 M or less, about 10 ^-6 M or less, 10 ^-7 M or less, 10 ^-8 M or less, 5 × 10 ^-9 M or less, or 10 ^-9 M or less, 5 × 10 ^-10 M or less, or 10 ^-10 M or less. The affinities of antibodies or CARs can be easily determined using conventional techniques, such as those described by Scatchard et al. (Ann. NY Acad. Sci. USA 51: 660 (1949)). The binding properties of an antibody to antigens, cells or their tissues can generally be determined and assessed using immunodetection methods, including, for example, immunofluorescence-based assays such as immunohistochemistry (IHC) and/or fluorescence-activated cell sorting (FACS). In some embodiments, the term “specifically binds” refers to an antibody, CAR, or ligand that recognizes and binds to a binding partner present in a sample, but that does not substantially recognize or bind other molecules in the sample.

The term "signal transduction pathway" refers to the biochemical relationships between various signal transduction molecules that play a role in transmitting a signal from one part of the cell to another part of the cell.

The term "signaling domain" refers to the functional portion of a protein that acts to convey information within a cell to regulate cellular activity through specific signaling pathways, by generating second messengers or functioning as effectors in response to such messengers.

As used herein, the term “stem cells” generally includes pluripotent or multipotent stem cells. “Stem cells” include embryonic stem (ES) cells; mesenchymal stem cells (MSC); induced pluripotent stem cells (iPS); and committed progenitor cells (but not limited to, hematopoietic stem cells (HSC), bone marrow-derived cells, etc.).

The term "stimulation" refers to the primary response induced by the binding of a stimulatory molecule (eg, a TCR/CD3 complex or a chimeric receptor) to its cognate ligand, thereby mediating a signal transduction event, such as signaling through the TCR/CD3 complex or signaling through signaling chimeric receptor domains, but not limited to. Stimulation can mediate altered expression of certain molecules.

The term "stimulatory molecule" refers to a molecule expressed by an immune cell (eg, a T cell, NK cell, or B cell) that provides cytoplasmic signal sequence(s) that regulates activation of the immune cell in the stimulatory pathway in at least some aspects of the immune cell signaling pathway. In one aspect, the signal is a primary signal that is initiated, for example, by the binding of a TCR/CD3 complex to a peptide-loaded MHC molecule, and which results in mediating a T cell response, including proliferation, activation, differentiation, suppression, etc. The primary cytoplasmic signal sequence (also called the “primary signaling domain”) that acts in a stimulatory manner may contain a signaling motif that is known as an immunoreceptor tyrosine-based activation motif or ITAM.

The term "subject" is intended to include living organisms in which an immune response can be elicited (eg, mammals such as humans). In some embodiments, the subject may be a “patient,” that is, a warm-blooded animal, such as a human, who is awaiting or receiving medical care, or has been/is/will be the subject of a medical procedure, or is being monitored for the development of a target disease or condition, such as , such as an inflammatory or autoimmune condition. In some embodiments, the subject is an adult (eg, a subject over 18 years of age). In some embodiments, the subject is a child (eg, a subject under 18 years of age). In some embodiments, the subject is a man. In some embodiments, the subject is a woman. In some embodiments, the subject suffers from (eg, is diagnosed with) an autoimmune disease, such as an autoantibody-mediated autoimmune disease. In some embodiments, the subject is at risk of developing an autoimmune disease, such as an autoantibody-mediated autoimmune disease. Examples of risk factors include, but are not limited to, genetic predisposition and family history of autoimmune disease mediated by autoantibodies.

The term "substantially purified cell" refers to a cell that is substantially free of other cell types. Essentially, a purified cell also means a cell that has been separated from the other types of cells with which it is typically associated in its natural state. In some embodiments, a substantially purified cell means a cell that is at least 75% free, 80% free, or 85% free, or about 90%, 95%, 96%, 97%, 98%, or 99 free. % of other cell types with which it is normally associated in its natural state. In some cases, the population of essentially purified cells refers to a homogeneous population of cells. In some embodiments, a population of substantially purified cells refers to a population of cells that is at least about 75% homogeneous, 80% homogeneous, or 85% homogeneous, and in particular embodiments, about 90% homogeneous, 95% homogeneous, 96% homogeneous, 97%, 98% or 99%. In some cases, largely purified cells simply refer to cells that have been separated from the cells with which they are naturally associated in their natural state. In some aspects, the cells are cultured in vitro. In other aspects, the cells are not cultured in vitro. In some embodiments, a cell described herein cannot be used to create a multicellular organism.

The term "T cell" includes all types of immune cells that express CD3, including CD4+ cells (eg, T helper cells), CD8+ T cells (eg, cytotoxic CD8+ T cells and regulatory CD8+ T cells), T regulatory cells (Tregs), gamma delta T cells and double negative T cells.

The term “therapeutically effective amount” refers to an amount of an agent (eg, CAR-expressing cells as described herein) effective to achieve a particular biological result. Thus, the term “therapeutically effective amount” means a level or amount of an agent that is intended, without inducing significant negative or adverse side effects to the target, to (1) delay or prevent the occurrence of the target disease or condition; (2) slowing or stopping the progression, exacerbation or worsening of one or more symptoms of the target disease or condition; (3) improving symptoms of the target disease or condition; (4) reducing the severity or incidence of the target disease or condition; or (5) treating the target disease or condition. In some embodiments, a therapeutically effective amount may be administered prior to the onset of the target disease or condition for prophylactic or preventative effect. Alternatively or additionally, a therapeutically effective amount may be administered after the onset of the target disease or condition for therapeutic effect.

The term "transfected" or "transformed" or "transduced" refers to the process by which an exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid. A cell includes a primary subject cell and its progeny.

The term "transport vector" refers to a composition of material that includes an isolated nucleic acid and which can be used to deliver the isolated nucleic acid into a cell. A variety of vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector vector" includes an autonomously replicating plasmid or virus. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acid into cells, such as, for example, polylysine compound, liposomes and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, and the like.

As used herein, "transient" refers to the expression of a non-integrated transgene over a period of hours, days or weeks, where the period of time of expression is less than the period of time for expression of the gene if it is integrated into the genome or contained in a stable plasmid replicon in the cell -the owner.

The term "graft" as used herein refers to the cells, tissue or organ that is administered to an individual. The source of the transplanted material may be cultured cells, cells from another person, or cells from the same person (for example, after the cells have been cultured in vitro and, if necessary, modified). Examples of organ transplants include kidneys, liver, heart, lungs, and pancreas. An example of a tissue graft is pancreatic islets. An example of a cell transplant is an allogeneic hematopoietic stem cell transplant.

As used herein, the terms “treat,” “treating,” and “therapeutic” refer to reducing or attenuating the progression, severity, and/or duration of a target disease or condition, such as an autoimmune condition, or alleviating one or more symptoms (such as one or more several distinguishable symptoms) of the target disease or condition, for example an autoimmune condition, wherein said improvement results from the use of one or more therapeutic agents (for example, one or more therapeutic agents, such as the Treg cell of the invention). In specific embodiments, the terms “treat,” “treating,” and “therapeutic” refer to improving at least one measurable physical parameter of the target disease or condition, such as an autoimmune condition. In some embodiments, the terms “treat,” “treating,” and “therapeutic” refer to inhibiting the progression of a target disease or condition, such as an autoimmune condition, either physically, such as by stabilizing a discernible symptom, physiologically, such as by stabilizing a physical parameter, or both. In some embodiments, the terms “treat,” “cure,” and “therapeutic” refer to reducing or slowing the progression, severity and/or duration of a target disease or condition, such as an autoimmune disease, or alleviating one or more symptoms of a target disease or condition. for example, an autoimmune disease. “Treatment” refers to both therapeutic treatment and prophylactic or preventive measures; the goal being to prevent or slow down (relieve) the target disease or condition. Those who need treatment include those who already have the condition, as well as those who are prone to it, or those in whom the condition should be prevented. A subject is successfully "treated" for a disease or condition if, after administration of a therapeutic amount of an agent (e.g., a population of cells containing a chimeric receptor of the present invention), the subject exhibits observable and/or measurable improvement in one or more of the following: a decrease in the number of pathogenic cells; reducing the percentage of the total number of pathogenic cells; relief to some extent of one or more symptoms associated with a specific condition; reduction in morbidity and mortality and/or improvement in quality of life. The above parameters for assessing successful treatment and improvement can be easily measured using routine procedures familiar to the physician.

The term "Treg cell" refers to a cell capable of suppressing, inhibiting or preventing excessive or unwanted inflammatory responses, such as, for example, autoimmune or allergic reactions. In some embodiments, the Treg cell population of the invention is capable of suppressor activity. In some embodiments, said suppressor activity is independent of contact. In some embodiments, said suppressor activity is contact dependent. In some embodiments, the Treg cell population of the invention has a suppressive effect on effector T cells; in some embodiments, said suppressive effect is dependent on TCR expression and/or activation.

“Unitelo” is well known in the art and refers to an antibody fragment lacking the hinge region of IgG4 antibodies. Deletion of the hinge region results in a molecule that is essentially half the size of traditional IgG4 antibodies and has a monovalent binding region rather than the divalent binding region of IgG4 antibodies.

The term "variable" refers to the fact that certain segments of the variable (V) domains vary greatly in sequence among antibodies. The V domain mediates antigen binding and determines the specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed over the range from 110 to 130 amino acids of the variable domain. Instead, V regions are composed of relatively invariant regions called framework regions (FR), of 15-30 amino acids, separated by shorter regions of extreme variability called "hypervariable regions" or "CDRs", each of which is 9-12 amino acids long . Each of the variable domains of the native heavy and light chains contains four FRs, largely in a β-sheet configuration, connected by three hypervariable regions that form loops connecting and in some cases forming part of the β-sheet structure. The hypervariable regions on each chain are held together in close proximity by FR, and together with the hypervariable regions from the other chain contribute to the formation of the antigen-binding region of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service , National Institutes of Health, Bethesda, Md. (1991)). Constant domains are not directly involved in antibody-antigen binding but exhibit various effector functions, such as the antibody's involvement in antibody-dependent cellular cytotoxicity (ADCC).

The term polynucleotide "variant" as used herein is a polynucleotide that generally differs from the polynucleotide specifically disclosed herein by one or more substitutions, deletions, additions and/or insertions. Such variants may occur naturally or may be produced synthetically, for example, by modifying one or more polynucleotide sequences of the invention and assessing one or more biological activities of the encoded polypeptide, as described herein, and/or using any of a number of methods, such as known in the art. Accordingly, the term “polypeptide variant” as used herein is a polypeptide that generally differs from the polypeptide specifically disclosed herein by one or more substitutions, deletions, additions and/or insertions. Such variants may occur naturally or may be produced synthetically, for example, by modifying one or more polypeptide sequences of the invention and assessing one or more biological activities of the polypeptide as described herein, and/or using any of a number of techniques well known. in this field of technology. Modifications can be made to the structure of the polynucleotides and polypeptides of the present invention to provide a functional molecule that encodes, or is a variant or derivative of, a polypeptide with the desired characteristics. When it is necessary to change the amino acid sequence of a polypeptide to create an equivalent or even improved variant or portion of the polypeptide of the present invention, one of ordinary skill in the art will typically change one or more codons of the DNA coding sequence. For example, certain amino acids can be replaced by other amino acids in the structure of a protein without noticeable loss of its function (eg, the ability to bind other polypeptides (eg, antigens) or cells). Since it is the binding capacity and nature of a protein that determines its biological functional activity, certain substitutions of the amino acid sequence can be made in the protein sequence and, of course, in the DNA base sequence encoding it, resulting in a protein with a similar characteristic. Thus, it is contemplated that various changes can be made to the peptide sequences of the present invention or the corresponding DNA sequences that encode the peptides without appreciable loss of their biological utility or activity. In many cases, a polypeptide variant will contain one or more conservative substitutions. The variant may also or alternatively contain non-conservative substitutions. In some embodiments, variant polypeptides differ from the native sequence by substitution, deletion, or addition of six, five, four, three, two, or one amino acid(s). Variants may also (or alternatively) be modified, for example, by deletion or addition of amino acids that have minimal impact on the immunogenicity, secondary structure and hydropathic nature of the polypeptide.

Versatelas are well known in the art and belong to another antibody mimetic technology. They are small proteins of 3–5 kDa with >15% cysteines that form a high disulfide density scaffold, replacing the hydrophobic core of typical proteins.

The term "xenogeneic" refers to any material obtained from an individual of another species. The term "xenograft" refers to a graft obtained from an individual of another species.

The term "zeta" or alternatively "zeta chain", "CD3 zeta" or "TCR zeta" is defined as a protein reported as GenBank Acc. No. BAG36664.1, or equivalent residues from non-human species, for example, mouse, rodent, marmoset, ape, etc., and “zeta stimulatory domain” or, alternatively, “CD3 zeta stimulatory domain” or “ TCR zeta stimulatory domain" is defined as amino acid residues from the cytoplasmic zeta chain domain or functional derivatives thereof that are sufficient to functionally transmit the initial signal required for T cell activation. In some embodiments, the cytoplasmic zeta domain comprises residues 52 to 164 from GenBank Acc. No. BAG36664.1 or equivalent residues from non-human species, eg mouse, rodent, monkey, ape, etc., which are functional orthologues thereof.

Chimeric antigen receptors (CARs)

The present invention provides a chimeric receptor comprising:

- at least one extracellular binding domain,

- optionally at least one extracellular hinge domain,

- at least one transmembrane domain (for example, a human TNFR2 transmembrane domain, or a fragment or variant thereof, any transmembrane domain, or a fragment or variant thereof, or any combination thereof), and

- at least one intracellular domain (containing at least one primary intracellular signaling domain and optionally containing at least one costimulatory intracellular signaling domain, where at least one costimulatory intracellular signaling domain is a human TNFR2 costimulatory intracellular signaling domain, or its fragment or variant, any costimulatory intracellular signaling domain or fragment thereof or variant thereof, or any combination thereof), wherein the transmembrane domain is a TNFR2 transmembrane domain or fragment or variant thereof, and/or the costimulatory intracellular signaling domain is a costimulatory intracellular signaling domain of TNFR2 or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises one or more polypeptides.

In some embodiments, the extracellular binding domain is an antigen binding domain, and therefore the chimeric receptor may also be referred to as a chimeric antigen receptor (or CAR).

I. Extracellular binding domains

In some embodiments, the extracellular domain includes an antigen-binding domain, such as an antibody or an antigen-binding fragment thereof. The portion of the chimeric receptor of the invention containing the antibody or antigen binding fragment thereof may exist in various forms where the ligand binding domain is expressed as part of a continuous polypeptide chain including, for example, a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody or a bispecific antibody (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988); Bird et al., Science 242:423-426 (1988)). In some aspects, the antigen binding domain of a chimeric receptor described herein comprises an antibody fragment. In some aspects, the chimeric receptor comprises an antibody fragment that includes scFv.

In some embodiments, said antibody is an antibody molecule selected from the group consisting of whole antibody, humanized antibody, single chain antibody, dimeric single chain antibody, Fv, scFv, Fab, F(ab)' ₂ , defucosylated antibody, bispecific antibody, diabody , tri-bodies and tetra-bodies.

In some embodiments, the antibody is an antibody fragment selected from the group consisting of a unitbody, a single domain antibody, and a nanobody.

In some embodiments, said antibody is an antibody mimetic selected from the group consisting of affitel, affilin, affitin, adnectin, atrimer, evasin, DARPin, anticalin, avimer, finomer, versatel, and duocalin.

DARPins (designed ankyrin repeat proteins) are well known in the art and refer to antibody-mimicking DRP (designed repeat protein) technology designed to exploit the binding capacity of non-antibody polypeptides.

Antibody fragments and derivatives of the present invention (which are encompassed by the term "antibody" as used in this application unless otherwise indicated or clearly contrary to context) can be prepared by methods known in the art. "Fragments" include a portion of an intact antibody, typically an antigen binding site or variable region. Examples of antibody fragments include Fab, Fab', Fab'-SH, F(ab') ₂ and Fv fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of one contiguous sequence of contiguous amino acid residues (referred to herein as a “single-chain antibody fragment” or “single-chain polypeptide”), including, without limitation, (1) single-chain Fv molecules, (2) single chain polypeptides containing only one light chain variable domain, or a fragment thereof, that contains three CDRs from the light chain variable domain, without an associated heavy chain fragment, and (3) single chain polypeptides containing only one heavy chain variable region or its a fragment containing three CDRs of the heavy chain variable region, without the associated light chain fragment; and polyspecific antibodies formed from antibody fragments. Fragments of the presented antibodies can be obtained by standard methods. The precise boundaries of the amino acid sequence of a given CDR can be determined using any of a number of well known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Maryland ("Kabat" numbering scheme), Al-Lazikani et al., JMB 273: 927-948 (1997) ("Chothia" numbering scheme) or a combination thereof.

In some embodiments, the antigen binding domain of a CAR of the present invention comprises or consists of an antibody fragment, such as, for example, a scFv. In specific embodiments, the antigen binding domain is a scFv.

In some embodiments, the antigen binding domain of a CAR of the invention recognizes a specific antigen or fragment thereof (eg, associated with a target cell). Thus, the antigen binding domain of a CAR can recognize target cells, such as, for example, infected cells, damaged cells or dysfunctional cells. Examples of such target cells may include cells involved in dysfunctional immune responses (eg, cells involved in autoimmune diseases or allergies), dysfunctionally activated inflammatory cells (eg, inflammatory endothelial cells), cancer cells, and infected cells (eg, infected with viruses, bacteria or parasites) cells.

As used herein, the term "fragment" of an antigen refers to any subpopulation of an antigen as a shorter peptide. In some embodiments, the antigen fragment is a peptide of at least 6 amino acids in length. In some embodiments, the antigen fragment is a peptide that is 6 to 50 amino acids long, 6 to 30 amino acids long, or 6 to 20 amino acids long.

The term "variant" antigen as used herein refers to an antigen that is nearly identical to a naturally occurring antigen and that has the same biological activity. The minimal difference between a natural antigen and a variant thereof may be, for example, substitution, deletion and/or addition of amino acids. Such variants may contain, for example, conservative amino acid substitutions. In some embodiments, the variant antigen has at least or about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the natural antigen sequence.

In some embodiments, the antigen is a self-antigen. Examples of autoantigens include an antigen associated with an inflammatory condition of the nervous system (eg, multiple sclerosis-associated antigen), a joint-associated antigen, an eye-associated antigen, a human HSP antigen, a skin-associated antigen, or an antigen involved in rejection transplant or GVHD, but are not limited to them.

Examples of antigens associated with multiple sclerosis include myelin basic protein (MBP), myelin-associated glycoprotein (MAG), myelin oligodendrocyte glycoprotein (MOG), proteolipid protein (PLP), oligodendrocyte myelin oligoprotein (OMGP), myelin-associated oligodendrocyte basic protein (MOBP), oligodendrocyte specific protein (OSP/Claudin-11), heat shock proteins, oligodendrocyte specific proteins (OSP), NOGO A, Po glycoprotein, peripheral myelin protein 22 (PMP22), 2'3'-cyclic nucleotide-3' -phosphodiesterase (CNPase) or any fragments, variants or mixtures thereof, but are not limited to them.

Examples of joint-associated antigens include citrullinated cyclic and linear filaggrin peptides, type II collagen peptides, citrullinated vimentin, citrullinated type II collagen, citrullinated fibrinogen, human cartilage glycoprotein 39 (HCgp39) peptides, HSPs, heterogeneous nuclear ribonucleoprotein (hnRNP) A2 peptides , hnRNP B1, hnRNP D, Ro60/52, HSP60, HSP65, HSP70 and HSP90, BiP, keratin, vimentin, fibrinogen, type I, III, IV and V collagen peptides, annexin V, glucose-6-phosphate isomerase (GPI ), acetyl-calpastatin, pyruvate dehydrogenase (PDH), aldolase, topoisomerase I, snRNP, PARP, Scl-70, Scl-100, phospholipid antigens including anionic cardiolipin and phosphatidylserine, neutrally charged phosphatidylethanolamine and phosphatidylcholine, matrix metalloproteinase, fibrillin, aggrecan, and, but not limited to, fragments, variations and mixtures thereof.

Examples of eye-associated antigens include collagen type II, citrullinated vimentin, citrullinated collagen type II, citrullinated fibrinogen, retinal arrestin, S-arrestin, interphotoreceptor retinoid binding proteins (IRBP1), beta-crystallin B1, retinal proteins, choroidal proteins, and their fragments, variants and mixtures, but not limited to.

Examples of human HSP antigens include, but are not limited to, human HSP60, HSP70, HSP90, and fragments, variants, and mixtures thereof.

In some embodiments, the antigen is an antigen associated with an inflammatory condition of the nervous system, such as an antigen associated with multiple sclerosis. Examples of antigens associated with inflammatory conditions of the nervous system (eg, antigens associated with multiple sclerosis) include myelin basic protein (MBP), myelin-associated glycoprotein (MAG), myelin oligodendrocyte protein (MOG), proteolipid protein (PLP), oligodendrocyte myelin oligoprotein (OMGP), myelin-associated oligodendrocyte basic protein (MOBP), oligodendrocyte-specific protein (OSP/Claudin-11), heat shock proteins, oligodendrocyte-specific proteins (OSP), NOGO A, glycoprotein Po, peripheral myelin protein 22 (PMP22), 2'3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) and fragments, variants and mixtures thereof, but not limited to.

In some embodiments, the antigen is a joint-associated antigen. Examples of joint-associated antigens include citrulline-substituted cyclic and linear filaggrin peptides, type II collagen peptides, human cartilage glycoprotein 39 (HCgp39) peptides, HSP, heterogeneous nuclear ribonucleoprotein (hnRNP) A2 peptides, hnRNP B1, hnRNP D, Ro60/52, HSP60, 65, 70 and 90, BiP, keratin, vimentin, fibrinogen, type I, III, IV and V collagen peptides, annexin V, glucose-6-phosphate isomerase (GPI), acetyl-calpastatin, pyruvate dehydrogenase (PDH), aldolase, topoisomerase I, snRNP, PARP, Scl-70, Scl-100, phospholipid antigen including, but not limited to, anionic cardiolipin and phosphatidylserine, neutrally charged phosphatidylethanolamine and phosphatidylcholine, matrix metalloproteinase, fibrillin, aggrecan, and fragments, variants and mixtures thereof them.

In some embodiments, the antigen is an eye-associated antigen. Examples of eye-associated antigens include, but are not limited to, type II collagen, retinal arrestin, S-arrestin, interphotoreceptor retinoid binding proteins (IRBP1), betaB1-crystallin, retinal proteins, choroid proteins, and fragments, variants, and mixtures thereof. .

In some embodiments, the antigen is a human HSP antigen. Examples of human HSP antigens include, but are not limited to, human HSP60, HSP70, HSP90, and fragments, variants, and mixtures thereof.

In some embodiments, the antigen is a skin-associated antigen. Examples of skin-associated antigens include keratinocyte antigens, antigen present in the dermis or epidermis, melanocyte antigen (such as, for example, melanin or tyrosinase), desmoglein (for example, desmoglein 1 or 3, which may also be called Dsg1/3), BP180, BP230, plectin, integrins (eg integrin α4β6), collagens (eg collagen type VII), laminins (eg laminin 332 or laminin γ1), plakins (eg envoplakin, periplakin or desmoplakins), keratins (eg KRT5, KRT8 , KRT15, KRT17 and KRT31), but are not limited to keratin filament associated proteins, filaggrin, corneodesmosin and elastin.

In some embodiments, the antigen is an antigen involved in graft rejection or GVHD. Examples of such antigens include, but are not limited to, graft-specific or host-specific MHC, β2-microglobulin, ABO antigens, Rh antigens (eg, C, c, E, e, and D antigens), and isohemagglutinins. Other examples of antigens that may be involved in graft rejection or GVHD include, but are not limited to, HLA-DR (particularly during the first six months after transplant), HLA-B (particularly during the first two years after transplant), HLA-A, minor histocompatibility antigens (miHA, e.g. HLA-E, HLA-F and HLA-G), HLA corresponding to MHC class I (A, B and C), HLA corresponding to MHC class II (DP, DM, DOA, DOB, DQ and DR) and HLA, corresponding to MHC class III (for example, components of the complement system).

In some embodiments, the antigen is an HLA-A2 cell surface protein. In some embodiments, the extracellular binding domain includes an antibody directed to HLA-A2 or an antigen-binding fragment thereof. In some embodiments, the HLA-A2 binding domain comprises a scFv directed to HLA-A2.

The term “HLA-A2” as used herein refers to human leukocyte antigen (HLA) proteins, including cell surface proteins encoded by the HLA-A*02 family of alleles in the HLA-A locus of the HLA gene complex. HLA proteins covered by the term “HLA-A2” include HLA proteins identified as belonging to the HLA-A*02 antigen type through serological testing or genotyping. Additional names for the HLA-A*02 antigen type include "HLA-A2", "HLA-A02" and "HLA-A*2". Various naming systems have been developed that identify the HLA proteins encoded by this family of alleles, including the HLA naming system developed in 2010 by the WHO Committee on HLA System Factors. The term "HLA-A2" refers to HLA proteins encoded by alleles designated under this naming system that begin with "HLA-A*02", including designations beginning with "HLA-A*02:01", " HLA-A*02:02", "HLA-A*02:03", "HLA-A*02:04", "HLA-A*02:05", "HLA-A*02:06", " HLA-A*02:07", "HLA-A*02:08", "HLA-A*02:09", "HLA-A*02:10" and "HLA-A*02:11", but not limited to them. Allele designations may be in italics. Allele designations beginning with "HLA-A*02:" followed by 2 or 3 additional digits may constitute the entire designation or the initial part of the designation. The term "HLA-A2" also refers to HLA proteins identified with designations that begin with "HLA-A*02" according to this naming system, including the designations "HLA-A*02:01", "HLA-A* 02:02", "HLA-A*02:03", "HLA-A*02:04", "HLA-A*02:05", "HLA-A*02:06", "HLA-A* 02:07", "HLA-A*02:08", "HLA-A*02:09", "HLA-A*02:10" and "HLA-A*02:11", but not limited to.

In some embodiments, the HLA-A2 binding domain includes an antibody directed against HLA-A2 or an antigen binding fragment thereof. In some embodiments, the HLA-A2 binding domain comprises a scFv directed to HLA-A2. Examples of scFvs targeting HLA-A2 include, but are not limited to, scFvs consisting of or containing a sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO : 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96 , SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, and fragments or variations thereof; and scFv against HLA-A2, disclosed in PCT patent publications WO 2018/183293 and WO 2019/056099. For example, the anti-HLA-A2 scFv used in the CAR described herein may consist of or contain the amino acid sequence of SEQ ID NO: 68. In yet another example, the anti-HLA-A2 scFv used in the CAR described herein may consist of or contain the amino acid sequence of SEQ ID NO: 70. In yet another example, the anti-HLA-A2 scFv used in the CAR described herein may consist of or contain the amino acid sequence of SEQ ID NO: 92. In yet another example, the anti-HLA-A2 scFv used in the CAR described herein may consist of or contain the amino acid sequence of SEQ ID NO: 103. In yet another example, the anti-HLA-A2 scFv used in the CAR described herein may consist of or contain the amino acid sequence of SEQ ID NO: 107.

Other examples of autoantigens include aquaporin water channels (such as, for example, aquaporin water channel-4 (AQP4)), Hu, Ma2, collapsin response mediator protein 5 (CRMP5), amphiphysin, voltage-gated potassium channel (VGKC), receptor N-methyl-d-aspartate (NMDAR), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR), thyroid peroxidase, thyroglobulin, anti-N-methyl-D-aspartate receptor (subunit NR1), Rh blood antigens, antigen I, desmoglein 1 or 3 (Dsg1/3), BP180, BP230, acetylcholine postsynaptic receptors, thyrotropin receptors, platelet integrin, GpIIb:IIIa, collagen (such as alpha-3 ( IV) collagen chain), rheumatoid factor, calpastatin, citrullinated proteins, myelin basic protein (MBP), myelin oligodendrocyte glycoprotein (MOG) peptides, alpha-beta crystallin, DNA, histones, ribosomes, RNP, tissue transglutaminase (TG2), internal factor, 65 kDa antigen, phosphatidylserine, ribosomal phosphoproteins, antineutrophil cytoplasmic antibody, Scl-70, U1-RNP, ANA, SSA SSB, antinuclear antibodies (ANA), antineutrophil cytoplasmic antibodies (ANCA), Jo-1, antimitochondrial antibodies, gp210, p62, sp100, antiphospholipid antibodies, U1-70 kd snRNP, GQ1b ganglioside, GM1, asialo-GM1, GD1b, anti-smooth muscle antibody (ASMA), anti-liver and kidney microsome-1 antibody (ALKM-1), anti-liver cytosol antibody -1 (ALC-1), anti-endomysial IgA antibodies, neutrophil granule proteins, streptococcal cell wall antigen, gastric parietal cell intrinsic factor, insulin (IAA), glutamic acid decarboxylase (GAA or GAD), protein tyrosine phosphatase (eg, IA2 or ICA512), PLA2R1 and THSD7A1, but are not limited to them.

In some embodiments, the antigen is an IL-23 receptor (IL-23R) expressed on the surface of a cell. In some embodiments, the extracellular binding domain is an antibody directed against IL-23R or an antigen-binding fragment thereof.

In some embodiments, the antigen is a soluble IL-23R. In some embodiments, the extracellular binding domain is an antibody directed against soluble IL-23R, or an antigen-binding fragment thereof.

In some embodiments, the antigen is a variant of IL-23R. In some embodiments, the extracellular binding domain is an antibody directed against an IL-23R variant, or an antigen-binding fragment thereof.

In some embodiments, the variant IL-23R peptide is a modified IL-23R peptide in which 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are deleted, added, or replaced from the parent peptide .

In some embodiments, the antigen is a splice variant of IL-23R. In some embodiments, the extracellular binding domain is an antibody directed to an IL-23R splice variant or an antigen binding fragment thereof.

In some embodiments, the CAR of the present invention recognizes and is capable of binding to human IL-23R. In some embodiments, the CAR of the present invention recognizes and is capable of binding to murine IL-23R.

In some embodiments, the IL-23R binding domain comprises an antibody directed to IL-23R or an antigen binding fragment thereof. In some embodiments, the IL-23R binding domain comprises a scFv targeting IL-23R. Examples of scFvs targeting IL-23R include, but are not limited to, scFvs containing or consisting of a sequence selected from the group consisting of SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67 and fragments or variants thereof them.

In some embodiments, the antigen is an inhalant allergen, an ingestible allergen, or a contact allergen.

In some embodiments, the antigen is a food antigen from a person's normal diet.

The term "food antigen from the normal human diet" refers to an immunogenic peptide that is derived from foods common to humans, for example, a food antigen from the following non-limiting list: ovalbumin, bovine antigens such as lipocalin, Ca-binding S100, alpha- lactalbumin, lactoglobulins such as beta-lactoglobulin, bovine serum albumin and caseins. Food antigens may also be Atlantic salmon antigens such as parvalbumin, chicken antigens such as ovomucoid, Ag22, conalbumin, lysozyme or chicken serum albumin, peanut, shrimp antigens such as tropomyosin, wheat antigens such as agglutinin or gliadin, antigens celery such as celery profilin, carrot antigens such as carrot profilin, apple antigens such as thaumatin, apple lipid transfer protein, apple profilin, pear antigens such as pear profilin, isoflavone reductase, avocado antigens such as endochitinase, apricot antigens , such as apricot lipid transfer protein, peach antigens, such as peach lipid transfer protein or peach profilin, soy antigens, such as HPS, soy profilin or (SAM22) PR-10 prot, and fragments, variants and mixtures thereof.

In some embodiments, the antigen is a tissue-specific protein. Examples of tissue-specific proteins include integrins and selectins, the expression of which is limited to, but not limited to, a particular tissue or organ.

In some embodiments, the antigen is a B cell surface marker expressed on the surface of a B cell. Examples of B cell (eg human B cell) surface markers include CD19, CD20, BCMA, IgM, IgA, IgG, IgE, IgD, CD1, CD5, CD21, CD22, CD23, CD24, CD25, CD27, CD30, CD38 , CD40, CD78, CD80, CD138, CD319, PDL-2, CXCR3, CXCR4, CXCR5, CXCR6, Notch2, TLR4, IL-6, IL-10 and TGFβ. In some embodiments, the B cell surface marker is selected from CD19, CD20, BCMA, IgM, IgA, IgG, IgE, IgD, CD1, CD21, CD22, CD138. In specific embodiments, the B cell surface marker is selected from CD19 and CD20.

In some embodiments, the antigen is a proB cell surface marker expressed on the surface of a proB cell. Examples of proB cell (eg, human proB cell) surface markers include, but are not limited to, CD10, CD19, CD24, CD34, and CD38.

In some embodiments, the antigen is a preB cell surface marker expressed on the surface of the preB cell. Examples of surface markers of preB cells (eg, human preB cells) are, but are not limited to, CD5, CD10, CD19, CD20 and CD34, CD38.

In some embodiments, the antigen is an immature (or transitional) B cell marker expressed on the surface of the B cell. Examples of immature (or transitional) B cell surface markers (eg, human immature B cells) include, but are not limited to, CD5, CD10, CD19, CD20, CD22, CD24, CD38, and IgG.

In some embodiments, the antigen is a marginal zone B cell surface marker expressed on the surface of the B cell. Examples of marginal zone B cell surface markers (eg, human marginal zone B cells) include, but are not limited to, CD1, CD19, CD20, CD21, CD22, CD23, CD27, IgG, and Notch2.

In some embodiments, the antigen is a plasma cell surface marker expressed on the surface of a B cell. Examples of plasma cell surface markers (eg, human plasma cells) include, but are not limited to, CD19, CD27, CD38, CD138, IgG, MHCII, and IL-6.

In some embodiments, the antigen is a plasmablast cell surface marker expressed on the surface of a B cell. Examples of surface markers of plasmablasts (eg, human plasmablasts) include, but are not limited to, CD19, CD20, CD27, CD38, IgG, and MHCII.

In some embodiments, the antigen is a memory B cell surface marker expressed on the surface of a B cell. Examples of memory B cell surface markers (eg, human memory B cells) include CD19, CD20, CD22, CD24, CD27, CD38, CD40, CD80, PD-L2, IgG, CXCR3, CXCR4, CXCR5, CXCR6, IgA, IgG and IgE, but are not limited to them.

In some embodiments, the antigen is a germinal center B cell surface marker expressed on the surface of the B cell. Examples of surface markers of germinal center B cells (eg, human germinal center B cells) include, but are not limited to, CD10, CD19, CD20, CD22, CD38, and IgG.

In some embodiments, the antigen is a surface marker of activated B cells expressed on the surface of the B cell. Examples of surface markers of activated B cells (eg, human activated B cells) include, but are not limited to, CD19, CD25, and CD30.

In some embodiments, the antigen is a B cell surface regulatory marker expressed on the surface of a B cell. Examples of regulatory B cell (Breg) cell surface markers include CD1, CD1d, CD5, CD19, CD21, CD23, CD24, CD40, Fas ligand, IL-10, TLR4, TGFβ, IgD, IgM, PD-L1, PD-L2 , TIM-1, TNFSF18 and TRAIL, but are not limited to them. In specific embodiments, examples of human Breg cell surface markers include, but are not limited to, CD1, CD1d, CD5, CD19, CD21, CD24, CD40, IL-10, TLR4, TGFβ, IgD, and IgM.

In some embodiments, the antigen is a B cell surface marker with a nonsecreted Ig expressed on the surface of the B cell. Examples of surface markers of B cells (eg, human B cells) with nonsecreted Ig include, but are not limited to, CD138 and Notch2.

In some embodiments, the B cell surface marker is CD19. In some embodiments, the CD19-binding domain comprises an antibody directed to CD19, or an antigen-binding fragment thereof. In some embodiments, the CD19 binding domain comprises a scFv directed to CD19. Examples of scFvs targeting CD19 include, but are not limited to, SEQ ID NO: 1 and FMC63 (SEQ ID NO: 2).

In some embodiments, the B cell surface marker is CD20. In some embodiments, the CD20-binding domain comprises an antibody directed to CD20, or an antigen-binding fragment thereof. Examples of anti-CD20 antibodies include, but are not limited to, rituximab or a fragment or variant thereof (eg, SEQ ID NO: 3 or a fragment or variant thereof). Examples of scFvs targeting CD20 include, but are not limited to, scFvs containing or consisting of a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and fragments or variants thereof.

In some embodiments, the antigen is a cancer antigen.

As used herein, the term “cancer antigen” refers to an antigen that is differentially expressed by cancer cells and, therefore, can be used to target cancer cells. Cancer antigens are antigens that have the potential to stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells; these antigens can be characterized as antigens that are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation, and those that are expressed at specific times, such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (eg, the activated ras oncogene), suppressor genes (eg, mutant p53), and fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens may be encoded by viral genes, such as those found in the RNA and DNA of tumor viruses. Many tumor antigens have been defined in terms of multiple solid tumors: MAGE 1, 2 and 3 (immune-defined), MART-1/Melan-A, gp100, carcinoembryonic antigen (CEA), HER2, mucins (i.e. MUC-1 ), prostate-specific antigen (PSA) and prostate acid phosphatase (PAP). In addition, viral proteins, such as some of those encoded by hepatitis B virus (HBV), Epstein-Barr virus (EBV), and human papillomavirus (HPV), have been shown to play important roles in the development of hepatocellular carcinoma, lymphoma, and cervical cancer , respectively.

Other cancer antigens include 707-AP (707 alanine proline), AFP (alpha(a)fetoprotein), ART-4 (adenocarcinoma antigen recognized by T4 cells), BAGE (B antigen; b-catenin/m, b-catenin /mutant), BCMA (B-cell maturation antigen), Bcr-abl (breakpoint-Abelson cluster region), CAIX (carbonic anhydrase IX), CD19 (cluster of differentiation 19), CD20 (cluster of differentiation 20), CD22 (cluster of differentiation 22 ), CD30 (cluster of differentiation 30), CD33 (cluster of differentiation 33), CD44v7/8 (cluster of differentiation 44, exons 7/8), CAMEL (CTL recognition antigen on melanoma), CAP-1 (carcinoembryonic antigen peptide-1) , CASP-8 (caspase-8), CDC27m (cell division cycle mutant 27), CDK4/m (mutant cyclin-dependent kinase 4), CEA (carcinoembryonic antigen), CT (cancer/testis (antigen)), Cyp-B (cyclophilin B), DAM (melanoma differentiation antigen), EGFR (epidermal growth factor receptor), EGFRvIII (epidermal growth factor receptor variant III), EGP-2 (epithelial glycoprotein 2), EGP-40 (epithelial glycoprotein 40), Erbb2 , 3, 4 (erythroblastic leukemia viral oncogene homolog-2, -3, -4), ELF2M (mutant elongation factor 2), ETV6-AML1 (Ets variant gene 6/acute myeloid leukemia gene 1 ETS), FBP (folate binding protein), fAchR (fetal acetylcholine receptor), G250 (glycoprotein 250), GAGE (G antigen), GD2 (disialoganglioside 2), GD3 (disialoganglioside 3), GnT-V (N-acetylglucosaminyltransferase V), Gp100 (glycoprotein 100 kDa ), HAGE (helicose antigen), HER-2/neu (human epidermal receptor-2/neurological; also known as EGFR2), HLA-A (human leukocyte antigen-A), HPV (human papillomavirus), HSP70-2M (mutant heat shock protein 70-2), HST-2 (human signet ring cell carcinoma-2), hTERT or hTRT (human telomerase reverse transcriptase), iCE (intestinal carboxylesterase), IL-13R-a2 (interleukin-13 receptor alpha-2 subunit), KIAA0205, KDR (kinase insertion domain receptor), κ-light chain, LAGE (L-antigen ), LDLR/FUT (low density lipid receptor/GDP-L-fucose; bD-galactosidase 2-a-L-fucosyltransferase), LeY (Lewis-Y antibody), L1 CAM (L1 cell adhesion molecule), MAGE (melanoma antigen), MAGE-A1 (melanoma-associated antigen 1), mesothelin, murine CMV-infected cells, MART-1/melan-A (melanoma antigen recognized by T cells - I/melanoma antigen A), MC1 R (melanocortin receptor 1) , myosin/m (mutant myosin), MUC1 (mucin 1), MUM-1, -2, -3 (melanoma common mutant-1, -2, -3), NA88-A (NA cDNA clone of patient M88), NKG2D (natural killer group 2, member D) ligands, NY-BR-1 (New York breast differentiation antigen 1), NY-ESO-1 (New York esophageal squamous cell carcinoma antigen-1), oncofetal antigen (h5T4), P15 (protein 15), minor bcr-abl p190 (190 kDa bcr-abl protein), Pml/RARa (promyelocytic leukemia/retinoic acid receptor a), PRAME (predominantly expressed melanoma antigen), PSA (prostate-specific antigen), PSCA (antigen prostate stem cell), PSMA (prostate-specific membrane antigen), RAGE (renal antigen), RU1 or RU2 (renal common 1 or 2), SAGE (sarcoma antigen), SART-1 or SART-3 (squamous cell carcinoma antigen 1 or 3) , synovial sarcoma antigen X-1, -2, -3, -4 (SSX-1, -2, -3, -4), TAA (tumor-associated antigen), TAG-72 (tumor-associated glycoprotein 72), TEL/AML1 (Ets family leukemia/acute myeloid leukemia 1 translocations), TPI/m (mutant triose phosphate isomerase), TRP-1 (tyrosinase-related protein 1 or gp75), TRP-2 (tyrosinase-related protein 2), TRP-2/INT2 (TRP-2/intron 2), VEGF-R2 (vascular endothelial growth factor receptor 2) or WT1 (Wilms tumor gene), but are not limited to.

In some embodiments, the antigen is associated with infected cells.

As used herein, the term “infected cells” refers to cells that are contaminated with something that adversely affects their quality, character or condition.

In some embodiments, the antigen is associated with virus-infected cells. In some embodiments, the antigen is associated with bacterially infected cells. In some embodiments, the antigen is associated with fungal-infected cells. In some embodiments, the antigen is associated with parasite-infected cells.

In some embodiments, the extracellular binding domain is a protein, fragment or variant thereof.

In some embodiments, the extracellular binding domain recognizes an autoantibody on a B cell.

In some embodiments, the extracellular binding domain is a self-antigen.

In some embodiments, the chimeric receptor contains a self-antigen (which may also be referred to as a self-antigen) or a fragment or variant thereof and thus can recognize antibodies directed to the self-antigen. As used herein, the term “autoantigen” or “self-antigen” refers to an endogenous antigen that stimulates the production of autoantibodies. In some embodiments, the autoantigen is involved in an autoimmune disease. In some embodiments, the immune cells of the invention are cytotoxic to B cells producing antibodies directed to the self-antigen.

The term “autoantigen variant” as used herein refers to an autoantigen that is nearly identical to a naturally occurring autoantigen and has the same biological activity. The minimal difference between a natural autoantigen and a variant thereof may be, for example, substitution, deletion and/or addition of amino acids. Such variants may contain, for example, conservative amino acid substitutions in which amino acid residues are replaced by amino acid residues having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine and cysteine), non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine and tryptophan), beta-branched side chains (e.g. threonine, valine and isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan and histidine). In some embodiments, the variant autoantigen has at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the natural autoantigen.

Examples of autoantigens include aquaporin water channels (such as, for example, aquaporin water channel-4 (AQP4)), Hu, Ma2, collapsin response mediator protein 5 (CRMP5), amphiphysin, voltage-gated potassium channel (VGKC), N receptor -methyl-d-aspartate (NMDAR), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR), thyroid peroxidase, thyroglobulin, anti-N-methyl-D-aspartate receptor (NR1 subunit ), blood group antigens Rh, antigen I, desmoglein 1 or 3 (Dsg1/3), BP180, BP230, nicotinic acetylcholine postsynaptic receptors, thyrotropin receptors, platelet integrin, GpIIb:IIIa, collagen (such as alpha-3 ( IV) collagen chain), rheumatoid factor, calpastatin, citrullinated proteins, myelin basic protein (MBP), myelin oligodendrocyte glycoprotein (MOG) peptides, alpha-beta crystallin, DNA, histone, ribosomes, RNP, tissue transglutaminase (TG2), internal factor, 65 kDa antigen, phosphatidylserine, ribosomal phosphoproteins, antineutrophil cytoplasmic antibody, Scl-70, U1-RNP, ANA, SSA, anti-SSB, antinuclear antibodies (ANA), antineutrophil cytoplasmic antibodies (ANCA), Jo-1, antimitochondrial antibodies , gp210, p62, sp100, antiphospholipid antibodies, U1-70 kDa snRNP, ganglioside GQ1b, GM1, asialo-GM1, GD1b, anti-smooth muscle antibodies (ASMA), anti-liver and kidney microsome-1 antibodies (ALKM-1), antibodies anti-liver cytosol-1 (ALC-1), anti-endomysial IgA antibodies, neutrophil granule proteins, streptococcal cell wall antigen, gastric parietal cell intrinsic factor, insulin (IAA), glutamic acid decarboxylase (GAA or GAD), protein tyrosine phosphatase (eg, IA2 or ICA512), PLA2R1 and THSD7A1, but are not limited to them.

Other examples of autoantigens are listed herein and include antigens associated with multiple sclerosis (such as, for example, myelin basic protein (MBP), myelin-associated glycoprotein (MAG), myelin oligodendrocyte glycoprotein (MOG), proteolipid protein (PLP), myelin Oligodendrocyte oligoprotein (OMGP), myelin-associated oligodendrocyte basic protein (MOBP), oligodendrocyte specific protein (OSP/Claudin-11), heat shock proteins, oligodendrocyte specific proteins (OSP), NOGO A, Po glycoprotein, peripheral myelin protein 22 (PMP22 ), 2'3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) and fragments, variants and mixtures thereof); joint-associated antigens (such as, for example, citrulline-substituted cyclic and linear filaggrin peptides, type II collagen peptides, human cartilage glycoprotein 39 (HCgp39) peptides, HSP, heterogeneous nuclear ribonucleoprotein (hnRNP) peptides A2, hnRNP B1, hnRNP D, Ro60/52, HSP60, HSP65, HSP70 and HSP90, BiP, keratin, vimentin, fibrinogen, type I, III, IV and V collagen peptides, annexin V, glucose-6-phosphate isomerase (GPI), acetyl-calpastatin, pyruvate dehydrogenase (PDH), aldolase, topoisomerase I, snRNP, PARP, Scl-70, Scl-100, phospholipid antigens including anionic cardiolipin and phosphatidylserine, neutrally charged phosphatidylethanolamine and phosphatidylcholine, matrix metalloproteinase, fibrillin, aggrecan, citrullinated vimentin, citrullinated type II collagen , citrullinated fibrinogen and their fragments, variants and mixtures); eye-associated antigens (such as, for example, collagen type II, retinal arrestin, S-arrestin, interphotoreceptor retinoid binding proteins (IRBP1), beta-crystallin B1, retinal proteins, choroid proteins, citrullinated vimentin, citrullinated collagen type II, citrullinated fibrinogen and their fragments, variants and mixtures); and human HSP antigens (such as, for example, human HSP60, HSP70, HSP90 and fragments, variants and mixtures thereof), but are not limited to them.

In some embodiments, the autoantigen is desmoglein 1 or desmoglein 3, or a variant or fragment thereof, such as, for example, the extracellular domains of desmoglein 1 or 3. In some embodiments, the chimeric receptor comprises extracellular domains 1-4 of desmoglein 3, such as, for example, the sequence containing or consisting of SEQ ID NO: 7.

In some embodiments, the CAR of the present invention comprises an extracellular binding domain against a first antigen and at least one other extracellular binding domain against another antigen. Such a CAR is capable of binding to at least 2 different antigens. In some embodiments, the at least one other extracellular binding domain is an antibody directed against a specific antigen or an antigen-binding fragment thereof. In some embodiments, said at least one other extracellular binding domain comprises or consists of an antibody fragment, such as, for example, scFv.

In some embodiments, the antibody contained in a CAR of the present invention is a multispecific antibody molecule, for example, it contains a plurality of immunoglobulin variable domain sequences, wherein the first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and the second immunoglobulin variable domain sequence of the set has binding specificity for the second epitope. In some embodiments, the multispecific antibody molecule is a bispecific antibody molecule. The bispecific antibody has specificity for two antigens and is characterized by a first immunoglobulin variable domain sequence that has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.

II. Spacer and hinge domains

In some embodiments, the extracellular binding domain is linked to the transmembrane domain by a spacer domain or hinge domain. Examples of linkers include, but are not limited to, GS linkers as described herein. In some embodiments, the linker may contain or consist of the sequence GGGGSGGGGSGGGGS (SEQ ID NO: 111).

In some embodiments, a short oligo- or polypeptide linker having a length ranging from, for example, 2 to 10 amino acids, may form a hinge domain. In some embodiments, the term “linker” refers to a flexible polypeptide linker.

For example, a glycine-serine doublet may provide a suitable hinge domain (GS linker). In some embodiments, the hinge domain is a Gly/Ser linker. Examples of Gly/Ser linkers include, but are not limited to, GS linkers, G2S linkers, G3S linkers, and G4S linkers.

Examples of G2S linkers include, but are not limited to, GGS.

G3S linkers contain the amino acid sequence (Gly-Gly-Gly-Ser)n, also referred to as (GGGS)n or (SEQ ID NO: 112)n, where n is a positive integer equal to 1 or more (e.g., n = l, n = 2, n = 3, n = 4, n = 5, n = 6, n = 7, n = 8, n = 9 or n = 10). Examples of G3S linkers include, but are not limited to, GGSGGGSGGGSGGGS (SEQ ID NO: 113).

Examples of G4S linkers include (Gly ₄ Ser) corresponding to GGGGS (SEQ ID NO: 114); (Gly ₄ Ser) ₂ corresponding to GGGGSGGGGS (SEQ ID NO: 115); (Gly ₄ Ser) ₃ corresponding to GGGGSGGGGSGGGGS (SEQ ID NO: 116); and (Gly ₄ Ser) ₄ corresponding to, but not limited to, GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 117).

In some embodiments, the spacer domain may be up to 300 amino acids in length, such as 10-100 amino acids, 25-50 amino acids, or 2-10 amino acids.

In some embodiments, the hinge domain is a short oligo- or polypeptide linker, for example, having a length of 2 to 10 amino acids, as described herein. An example of a hinge domain that can be used in the present invention is described in PCT patent publication WO2012/138475, incorporated herein by reference.

In some embodiments, the hinge domain comprises an amino acid sequence selected from the group consisting of the amino acid sequence AGSSSSGGSTTGGSTT (SEQ ID NO: 8), the amino acid sequence GTTAASGSSGGSSSGA (SEQ ID NO: 9), the amino acid sequence SSATATAGTGSSTGST (SEQ ID NO: 10), and the amino acid sequence sequence TSGSTGTAASSTSSTT (SEQ ID NO: 11).

In some embodiments, the hinge domain is encoded by the nucleotide sequence GGTGGCGGAGGTTCTGGAGGTGGAGGTTCC (SEQ ID NO: 12).

In some embodiments, the hinge domain is a KIR2DS2 hinge domain corresponding to KIRRDSS (SEQ ID NO: 13).

In some embodiments, the hinge domain comprises or consists of a CD8 hinge amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 14) or an amino acid sequence having at least about 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 14. In embodiments of the invention, the hinge domain is a CD8 hinge encoded by a nucleic acid sequence of SEQ ID NO: 15 or a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99% identity to SEQ ID NO: 15.

In some embodiments, the hinge domain includes or consists of an IgG4 hinge amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 16) or an amino acid sequence having at least about 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 16. In some embodiments, the hinge domain is an IgG4 hinge encoded by a nucleic acid sequence of SEQ ID NO: 17 or a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99% identity to SEQ ID NO: 17.

In some embodiments, the hinge domain includes or consists of an IgD hinge amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 18) or an amino acid sequence having at least about 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 18. In embodiments of the invention, the hinge domain is an IgD hinge encoded by a nucleic acid sequence of SEQ ID NO: 19 or a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99% identity to SEQ ID NO: 19.

In some embodiments, the hinge region includes or consists of a CD28 hinge amino acid sequence (eg, comprising or consisting of the amino acid sequence of SEQ ID NO: 20) or an amino acid sequence having at least about 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 20. In some embodiments, the hinge domain is a CD28 hinge domain, encoded by a nucleic acid sequence of SEQ ID NO: 21 or a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% identity , 97%, 98% or 99% with SEQ ID NO: 21.

III. Transmembrane domains

Examples of transmembrane domains that can be used in a chimeric receptor of the invention include TNFR2, CD28, CD8 or T cell receptor alpha, beta or zeta chain transmembrane domains, or CD3 gamma, CD3 delta, CD3 epsilon, CD3 zeta , CD45, CD4, CD5, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278) , 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D , ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, PD1, ITGAX, CDl1c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CDIOO (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG/Cbp, NKp44, NKp30, NKp46, NKG2D and/or NKG2C.

In some embodiments, the transmembrane domain may include the entire transmembrane domain of the molecule from which it is derived, or it may contain a functional fragment or variant thereof.

In some embodiments, the chimeric receptor comprises at least one transmembrane domain selected from a TNFR2 transmembrane domain, a CD8 transmembrane domain, and a CD28 transmembrane domain.

In some embodiments, the transmembrane domain comprises or consists of an amino acid sequence of a TNFR2 transmembrane domain (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 22) or an amino acid sequence having at least about 70%, 75%, 80%, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 22. In some embodiments, the transmembrane domain includes or consists of an amino acid a sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 22 or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 22.

In some embodiments, the transmembrane domain of TNFR2 is encoded by the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 23.

In some embodiments, the TNFR2 transmembrane domain includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids from the sequence SEQ ID NO: 22 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 22, e.g., at least 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 adjacent amino acids from the sequence SEQ ID NO: 22. In some embodiments, the transmembrane domain of TNFR2 comprises an amino acid sequence selected from the group consisting of CVIMTQV (SEQ ID NO: 62), VNCVIMTQV (SEQ ID NO: 63), or TALGLLIIGVVNCVIMTQV (SEQ ID NO: 64) . In specific embodiments, the transmembrane domain of TNFR2 comprises the amino acid sequence VNCVIMTQV (SEQ ID NO: 63).

In some embodiments, the transmembrane domain of TNFR2 is encoded by a nucleotide sequence of at least 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, or 87 nucleotides from SEQ ID NO: 23 or from a sequence having at least about 70%, 75%, 80%, 85%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 23, e.g., at least 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, or 87 contiguous nucleotides from SEQ ID NO: 23.

In some embodiments, the transmembrane domain comprises or consists of an amino acid sequence of a CD8 transmembrane domain (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 24) or an amino acid sequence having at least about 70%, 75%, 80%, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 24. In some embodiments, the transmembrane domain contains or consists of an amino acid a sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 24 or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 24.

In some embodiments, the CD8 transmembrane domain is encoded by the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 25.

In some embodiments, the CD8 transmembrane domain comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23 or 24 amino acids from the sequence SEQ ID NO: 24 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 24, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 contiguous amino acids from the sequence SEQ ID NO: 24.

In some embodiments, the transmembrane domain of CD8 is encoded by a nucleotide sequence of at least 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, or 72 nucleotides from the sequence SEQ ID NO: 25 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 25, e.g., at least 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, or 72 contiguous nucleotides from SEQ ID NO: 25.

In some embodiments, the transmembrane domain comprises or consists of an amino acid sequence of a CD28 transmembrane domain (e.g., contains or consists of the amino acid sequence of SEQ ID NO: 26) or an amino acid sequence having at least about 70%, 75%, 80%, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 26. In some embodiments, the transmembrane domain contains or consists of an amino acid a sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 26, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 26.

In some embodiments, the transmembrane domain is a CD28 transmembrane domain encoded by the nucleic acid sequence of SEQ ID NO: 27 or a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 27. In some embodiments, the CD28 transmembrane domain includes at least 2, 3, 4, 5, 6, 7 , 8,10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 amino acids from the sequence SEQ ID NO: 26 or from the sequence, having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 26, for example at least 3, 4, 5, 6, 7, 8,10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 contiguous amino acids from the sequence SEQ ID NO: 26.

In some embodiments, the CD28 transmembrane domain is encoded by a nucleotide sequence of at least 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, or 81 nucleotides from SEQ ID NO: 27 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 27, e.g., at least 6, 9, 12, 15, 18, 21, 24 , 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, or 81 contiguous nucleotides from SEQ ID NO: 27.

In some embodiments, the chimeric receptor may include a combination of at least two transmembrane domains, for example, selected from the TNFR2 transmembrane domain, the CD8 transmembrane domain, and the CD28 transmembrane domain. Said transmembrane domains may be entire transmembrane domains, or fragments or variants thereof, and may be associated with each other in a random or specific order. In certain embodiments, the combination of at least two transmembrane domains, or fragments or variants thereof, includes at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 amino acids.

In some embodiments, the chimeric receptor comprises a TNFR2 transmembrane domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 22) or a fragment or variant thereof, and a CD8 transmembrane domain amino acid sequence (e.g., comprising the amino acid sequence of SEQ ID NO: 24 or consisting of it) or its fragment or variant. In some embodiments, the chimeric receptor comprises a hybrid transmembrane domain comprising the amino acid sequences of SEQ ID NOs: 59 and 62, SEQ ID NOs: 60 and 63, or SEQ ID NOs: 61 and 64.

In some embodiments, the chimeric receptor comprises a TNFR2 transmembrane domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 22) or a fragment or variant thereof, and a CD28 transmembrane domain amino acid sequence (e.g., comprising the amino acid sequence of SEQ ID NO: 26 or consisting of it) or its fragment or variant.

In some embodiments, the chimeric receptor comprises a CD8 transmembrane domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 24) or a fragment or variant thereof, and a CD28 transmembrane domain amino acid sequence (e.g., comprising the amino acid sequence of SEQ ID NO: 26 or consisting of it) or a fragment or variant thereof.

In some embodiments, the chimeric receptor may include a combination of at least three transmembrane domains, for example, selected from the TNFR2 transmembrane domain, the CD8 transmembrane domain, and the CD28 transmembrane domain. Said transmembrane domains may be entire transmembrane domains, or a fragment or variant thereof. In some embodiments, the combination of at least three transmembrane domains, fragment or variant thereof includes at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 amino acids.

In some embodiments, the chimeric receptor comprises a TNFR2 transmembrane domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain amino acid sequence, e.g., comprising or consisting of the amino acid sequence (SEQ ID NO: 24), or a fragment or variant thereof, and a CD28 transmembrane domain amino acid sequence (eg, containing or consisting of the amino acid sequence of SEQ ID NO: 26) or a fragment or variant thereof.

Thus, in some embodiments, the nucleic acid sequence encoding the CAR transmembrane domain of the invention includes a TNFR2 transmembrane domain nucleic acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 23) or a fragment or variant thereof, and/or a nucleic acid sequence a CD8 transmembrane domain (e.g., containing or consisting of the amino acid sequence of SEQ ID NO: 25) or a fragment or variant thereof, and/or a CD28 transmembrane domain nucleic acid sequence (e.g., containing or consisting of the amino acid sequence of SEQ ID NO: 27) or its fragment or variant.

In some embodiments, the CAR transmembrane domain of the present invention comprises a TNFR2 transmembrane domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 22) or a fragment or variant thereof, and/or a CD8 transmembrane domain amino acid sequence (e.g., comprising an amino acid sequence of or consisting of SEQ ID NO: 24) or a fragment or variant thereof, and/or an amino acid sequence of the CD28 transmembrane domain (eg, containing or consisting of the amino acid sequence SEQ ID NO: 26) or a fragment or variant thereof; where the sequences contained in the transmembrane domain are expressed in the same frame and as a single polypeptide chain.

In some embodiments, the transmembrane domain of a CAR of the present invention includes at least two different domains (e.g., a TNFR2 domain, or a fragment or variant thereof, and at least one other transmembrane domain (e.g., a CD8 or CD28 transmembrane domain) or fragment thereof, or option), which can be connected to each other randomly or in a specific order.

If desired, a short oligo- or polypeptide linker, for example 2 to 10 amino acids in length (eg 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids) can form a link between the individual transmembrane domains.

In some embodiments, the transmembrane domain may be recombinant. In some embodiments, the recombinant transmembrane domain comprises predominantly hydrophobic amino acids such as valine or leucine.

IV. Intracellular domains

In some embodiments, the intracellular domain of a CAR of the present invention comprises a primary T cell signaling domain (or sequence(s) derived therefrom) and optionally one or more intracellular domains from a T cell costimulatory molecule (or sequence(s) derived therefrom) .

In some embodiments, the intracellular domain may include all of the intracellular portion or all of the native intracellular signaling domain of the molecule from which it is derived, or a functional fragment or variant thereof.

In some embodiments, the intracellular signaling domain consists of at least one primary signaling domain (eg, a T cell primary signaling domain) or a fragment or variant thereof.

In some embodiments, the intracellular signaling domain consists of at least one costimulatory signaling domain (eg, the intracellular domain of a T cell costimulatory molecule) or a fragment or variant thereof.

In some embodiments, the intracellular signaling domain comprises one or more intracellular domains of a T cell costimulatory molecule, or a fragment or variant thereof. In some embodiments, the intracellular signaling domain consists of one or more intracellular domains of a T cell costimulatory molecule, or a fragment or variant thereof.

In another embodiment, the intracellular signaling domain of a CAR of the present invention comprises at least one costimulatory domain, or fragment or variant thereof, and at least one primary signaling domain, or fragment or variant thereof.

In another embodiment, the intracellular signaling domain of the CAR of the present invention consists of one costimulatory domain, or a fragment or variant thereof, and one primary signaling domain, or a fragment or variant thereof.

In some embodiments, the intracellular signaling domain of a CAR of the invention includes at least one, two, three or four costimulatory domains or a fragment or variant thereof, and at least one primary signaling domain or a fragment or variant thereof. In some embodiments, the one or more costimulatory domains are intracellular domains of a T cell costimulatory molecule. In some embodiments, the at least one primary signaling domain is a T cell primary signaling domain.

In some embodiments, the primary signaling domain includes a protein signaling domain selected from the group consisting of CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, common FcR gamma (FCER1G), FcR beta (Fc epsilon Rib), CD79a, CD79b, Fc gamma RIIa, DAP10 and DAP1, and sequences derived from them.

In some embodiments, the primary signaling domain is a T cell primary signaling domain that contains or consists of at least one functional CD3 zeta signaling domain or fragment or variant thereof.

In some embodiments, the primary T cell signaling domain comprises or consists of the amino acid sequence CD3 zeta of SEQ ID NO: 28, 29, 30, or 31, or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 28, 29, 30, or 31.

In some embodiments, the CD3 zeta primary signaling domain comprises or consists of an amino acid sequence having at least one, two, or three modifications, but not more than 20, 10, or 5 modifications, compared to the amino acid sequence of SEQ ID NO: 28, 29 , 30 or 31, or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 28, 29, 30 or 31.

Thus, in some embodiments, the nucleic acid sequence encoding the primary T cell signaling domain includes or consists of a CD3 zeta domain nucleic acid sequence of SEQ ID NO: 32 or SEQ ID NO: 33, or a nucleotide sequence having at least about 70 %, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 32 or SEQ ID NO: 33.

In some embodiments, the CD3 zeta primary signaling domain comprises at least 2, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 112 amino acids of SEQ ID NO: 28, 29. 30 or 31, or from a sequence having at least about 70% identity to SEQ ID NO: 28, 29, 30 or 31, such as at least 2, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 112 contiguous amino acids from SEQ ID NO: 28, 29, 30, or 31.

In some embodiments, the primary CD3 zeta signaling domain is encoded by a nucleotide sequence of at least 6, 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, or 336 nucleotides from SEQ ID NO: 32 or SEQ ID NO: 33, or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98%, or 99% identity to SEQ ID NO: 32 or SEQ ID NO: 33, e.g., at least 6, 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330 or 336 contiguous nucleotides from SEQ ID NO: 32 or SEQ ID NO: 33.

In some embodiments, primary T cell signaling domains that act in a stimulatory manner may include signaling motifs known as immunoreceptor tyrosine activation motifs (ITAMS). Examples of ITAM-containing primary intracellular T cell signaling domains that are particularly useful in the invention include or are derived from the CD3 zeta domain, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc epsilon R1b), CD3-gamma, CD3-delta, CD3-epsilon, CD5, CD22, CD66b, CD79a, CD79b, DAP10 and DAP12, but are not limited to.

In some embodiments, the primary T cell signaling domain includes a modified ITAM domain, for example, a mutant ITAM domain that has altered (eg, increased or decreased) activity compared to the native ITAM domain. In some embodiments, the primary signaling domain includes a modified ITAM-containing primary intracellular signaling domain, such as an optimized and/or truncated ITAM-containing primary intracellular signaling domain. In some embodiments, the primary signaling domain may contain one, two, three, four or more ITAM motifs.

In some embodiments, the intracellular signaling domain of a CAR of the invention comprises a primary T cell signaling domain (such as, for example, a CD3 zeta signaling domain or a fragment or variant thereof) in combination with one or more costimulatory signaling domains, wherein said costimulatory signaling domains are are entire costimulatory intracellular signaling domains or their fragment or variant.

Examples of intracellular domains of a T cell costimulatory molecule include signaling domains of proteins selected from the group consisting of TNFR2 (CD120b/TNFRSF1B), 4-1BB (CD137), ICOS (CD278), CD27, CD28, CTLA-4 (CD152), PD -1, MHC class I molecules, BTLA, Toll ligand receptor, OX40, CD30, CD40, lymphocyte function associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligand that specifically binds to CD83, CDS, ICAM-1, GITR, ARHR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160 (BY55), CD19, CD19a, CD4, CD8 alpha, CD8 -beta, IL2ra, IL6Ra, IL2R-beta, IL2R-gamma, IL7R-alpha, IL-13RA1/RA2, IL-33R (IL1RL1), IL-10RA/RB, IL-4R, IL-5R (CSF2RB), IL -21R, ITGA4, VLA1, CD49a, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a/CD18, ITGAM, CD11b, ITGAX, CD11c , ITGB1, CD29, ITGB2, CD18, ITGB7, NKG2D, NKG2C, CD95, TNFR1 (CD120a/TNFRSF1A), TGFbR1/2/3, TRANCE/RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 ( Tactile), CEACAM1, CRTAM, Ly9 (CD229), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162) , LTBR, LAT, GADS, SLP-76, PAG/Cbp, common gamma chain, a ligand that specifically binds to CD83, NKp44, NKp30, NKp46, NKG2D, and any combination thereof, but is not limited to.

In some embodiments, the chimeric receptor comprises at least one T cell costimulatory molecule intracellular domain selected from the group consisting of TNFR2, 4-1BB, ICOS, CD27, OX40, CD28, CTLA4, and PD-1.

In some embodiments, the chimeric receptor comprises at least one costimulatory signaling domain, which is the entire costimulatory signaling domain or a fragment or variant thereof.

In some embodiments, the T cell costimulatory signaling domain comprises or consists of an amino acid sequence of a TNFR2 costimulatory intracellular signaling domain (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or an amino acid sequence having at least about 70% 75 %, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 34. In some embodiments, costimulatory the signal domain contains or consists of an amino acid sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 34.

In some embodiments, the T cell costimulatory signaling domain is encoded by a TNFR2 costimulatory intracellular signaling domain nucleotide sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 35) or a nucleotide sequence having at least 70%, 75%, 80 identity %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEQ ID NO: 35.

In some embodiments, the TNFR2 intracellular costimulatory signaling domain comprises at least 2, 6, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170 or 174 amino acids from the sequence SEQ ID NO: 34 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99% identity with SEQ ID NO: 34, for example, at least 2, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130 , 140, 150, 160, 170, or 174 contiguous amino acids from SEQ ID NO: 34.

In some embodiments, the TNFR2 intracellular costimulatory signaling domain is encoded by a nucleotide sequence of at least 6, 18, 30, 60, 90, 120, 150, 180, 210, 240, 260, 270, 300, 330, 360, 390, 420, 450, 480, 510, or 522 nucleotides from the sequence SEQ ID NO: 35 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 35, for example, at least 6, 18, 30, 60, 90, 120, 150, 180, 210, 240, 260, 270, 300, 330, 360, 390, 420, 450, 480, 510 or 522 contiguous nucleotides from SEQ ID NO: 35.

In some embodiments, the intracellular costimulatory signaling domain includes domains I and II, domains I-III, domains I-IV, or domains I-V of the TNFR2 intracellular costimulatory signaling domain (eg, SEQ ID NO: 34). In some embodiments, the intracellular costimulatory signaling domain includes domains I and II of the TNFR2 intracellular costimulatory domain.

In some embodiments, the intracellular costimulatory signaling domain comprises residues 1-20 (δ151), 1-70 (δ104), 1-115 (δ59), or 1-156 (δ18) of SEQ ID NO: 34.

In some embodiments, the T cell costimulatory signaling domain comprises or consists of an amino acid sequence of a 4-1BB costimulatory intracellular signaling domain (e.g., contains or consists of the amino acid sequence of SEQ ID NO: 36) or an amino acid sequence having an identity of at least about 70 %, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with SEQ ID NO: 36. In some embodiments embodiment, the T cell costimulatory signaling domain comprises or consists of an amino acid sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 36.

In some embodiments, the T cell costimulatory signaling domain is encoded by a 4-1BB costimulatory intracellular signaling domain nucleotide sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 37) or a nucleotide sequence comprising at least about 70%, 75% 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 37.

In some embodiments, the 4-1BB costimulatory intracellular signaling domain comprises at least 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, or 42 amino acids of SEQ ID NO : 36 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 36, e.g., at least 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, or 42 contiguous amino acids from SEQ ID NO : 36.

In some embodiments, the costimulatory intracellular signaling domain 4-1BB is encoded by a nucleotide sequence of at least 6, 18, 27, 36, 45, 54, 63, 72, 81, 96, 99, 108, 117, or 126 nucleotides from SEQ ID. NO: 37 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 37, such as at least 6, 18, 27, 36, 45, 54, 63, 72, 81, 96, 99, 108, 117, or 126 contiguous nucleotides of SEQ ID NO : 37.

In some embodiments, the T cell costimulatory signaling domain comprises or consists of an amino acid sequence of a CD27 costimulatory intracellular signaling domain (e.g., contains or consists of the amino acid sequence of SEQ ID NO: 38) or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 38. In some embodiments, a costimulatory signaling domain The T cell contains or consists of an amino acid sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 38.

In some embodiments, the T cell costimulatory signaling domain is encoded by a CD27 costimulatory intracellular signaling domain nucleotide sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 39) or a nucleotide sequence having at least about 70%, 75%, 80 %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 39.

In some embodiments, the CD27 costimulatory intracellular signaling domain comprises at least 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, or 48 amino acids of SEQ ID NO: 38 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identity to SEQ ID NO: 38, for example, at least 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45 or 48 contiguous amino acids from SEQ ID NO: 38.

In some embodiments, the costimulatory intracellular signaling domain of CD27 is encoded by a nucleotide sequence of at least 6, 18, 27, 36, 45, 54, 63, 72, 81, 96, 99, 108, 117, 126, 135, or 144 nucleotides from the sequence SEQ ID NO: 39 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 39, e.g., at least 6, 18, 27, 36, 45, 54, 63, 72, 81, 96, 99, 108, 117, 126, 135, or 144 contiguous nucleotide from SEQ ID NO: 39.

In some embodiments, the T cell costimulatory signaling domain comprises or consists of an amino acid sequence of a CD28 costimulatory intracellular signaling domain (e.g., contains or consists of the amino acid sequence of SEQ ID NO: 40) or an amino acid sequence having at least about 70% 75 %, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 40. In some embodiments, costimulatory The T cell signaling domain contains or consists of an amino acid sequence having at least one, two or three modifications, but not more than 20, 10 or 5 modifications compared to the amino acid sequence of SEQ ID NO: 40.

In some embodiments, the T cell costimulatory signaling domain is encoded by a CD28 costimulatory intracellular signaling domain nucleotide sequence (e.g., comprising or consisting of SEQ ID NO: 41) or a nucleotide sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 41.

In some embodiments, the CD28 costimulatory intracellular signaling domain comprises at least 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, or 41 amino acids of SEQ ID NO: 40 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 40, for example, at least 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39 or 41 contiguous amino acids from SEQ ID NO: 40 .

In some embodiments, the costimulatory intracellular signaling domain of CD28 is encoded by a nucleotide sequence of at least 6, 18, 27, 36, 45, 54, 63, 72, 81, 96, 99, 108, 117, or 123 nucleotides from SEQ ID NO: 41 or from a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 % identity to SEQ ID NO: 41, e.g., at least 6, 18, 27, 36, 45, 54, 63, 72, 81, 96, 99, 108, 117, or 123 contiguous nucleotides from SEQ ID NO: 41 .

In some embodiments, the chimeric receptor comprises a combination of at least two intracellular domains of a T cell costimulatory molecule. In some embodiments, the at least two intracellular domains may be selected from a TNFR2 intracellular domain, a 4-1BB intracellular domain, a CD27 intracellular domain, and a CD28 intracellular domain. In specific embodiments, said costimulatory intracellular signaling domains are entire costimulatory intracellular signaling domains or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising amino acid sequence of or consisting of SEQ ID NO: 36) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a CD27 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising the amino acid sequence sequence SEQ ID NO: 38 or consisting of it) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a CD28 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising the amino acid sequence SEQ ID NO: 40 or consisting of) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 36) or a fragment or variant thereof, and a CD27 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising amino acid sequence of or consisting of SEQ ID NO: 38) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 36) or a fragment or variant thereof, and a CD28 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising amino acid sequence of or consisting of SEQ ID NO: 40) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a CD27 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising the amino acid sequence sequence SEQ ID NO: 40 or consisting of it) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a combination of at least three intracellular domains of a T cell costimulatory signaling domain, for example, selected from a TNFR2 intracellular domain, a 4-1BB intracellular domain, a CD27 intracellular domain, and a CD28 intracellular domain.

In some embodiments, the chimeric receptor may comprise at least three costimulatory intracellular signaling domains, wherein said domains are entire costimulatory intracellular signaling domains, or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 36) or a fragment or variant thereof, and the amino acid sequence of a CD27 costimulatory intracellular signaling domain (eg, containing or consisting of the amino acid sequence of SEQ ID NO: 38) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising the amino acid sequence of or consisting of SEQ ID NO: 36) or a fragment or variant thereof, and the amino acid sequence of the CD28 costimulatory intracellular signaling domain (eg, containing or consisting of the amino acid sequence SEQ ID NO: 40) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a CD27 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising the amino acid sequence SEQ ID NO: 38 or consisting of it) or a fragment or variant thereof, and a CD28 costimulatory intracellular signaling domain amino acid sequence (eg, containing or consisting of the amino acid sequence SEQ ID NO: 40) or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 36), or a fragment or variant thereof, and a CD27 costimulatory intracellular signaling domain amino acid sequence, (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 40) or a fragment or variant thereof.

In some embodiments, the chimeric receptor includes a combination of at least four intracellular domains of a T cell costimulatory molecule, for example, selected from a TNFR2 intracellular domain, a 4-1BB intracellular domain, a CD27 intracellular domain, and a CD28 intracellular domain.

In some embodiments, the chimeric receptor may comprise a combination of at least four intracellular domains of a T cell costimulatory molecule, wherein said costimulatory intracellular signaling domains are entire costimulatory intracellular signaling domains or a fragment or variant thereof.

In some embodiments, the chimeric receptor comprises a TNFR2 costimulatory intracellular signaling domain amino acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 34) or a fragment or variant thereof, and a 4-1BB costimulatory intracellular signaling domain amino acid sequence (e.g., comprising the amino acid sequence of SEQ ID NO: 36) or a fragment or variant thereof, and the amino acid sequence of the CD27 costimulatory intracellular signaling domain (e.g., containing or consisting of the amino acid sequence SEQ ID NO: 38) or a fragment or variant thereof, and the amino acid a CD28 costimulatory intracellular signaling domain sequence (eg, comprising or consisting of the amino acid sequence of SEQ ID NO: 40) or a fragment or variant thereof.

Thus, in some embodiments, the nucleic acid sequence encoding a T cell costimulatory signaling domain includes a TNFR2 costimulatory intracellular signaling domain nucleic acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 35) or a fragment or variant thereof, and/ or a 4-1BB costimulatory intracellular signaling domain nucleic acid sequence (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 37) or a fragment or variant thereof, and/or a CD27 costimulatory intracellular signaling domain nucleic acid sequence (e.g., comprising the amino acid sequence of SEQ ID NO: 39 or consisting of) or a fragment or variant thereof, and/or a CD28 costimulatory intracellular signaling domain nucleic acid sequence (eg, containing or consisting of the amino acid sequence of SEQ ID NO: 41) or a fragment or variant thereof.

In some embodiments, the intracellular signaling domain of the CAR of the present invention comprises:

- costimulatory intracellular signaling domain TNFR2 with amino acid sequence SEQ ID NO: 34, or a fragment or variant thereof, and/or costimulatory intracellular signaling domain 4-1BB with amino acid sequence SEQ ID NO: 36, or a fragment or variant thereof, and/or costimulatory a CD27 intracellular signaling domain having the amino acid sequence SEQ ID NO: 38, and/or a CD28 costimulatory intracellular signaling domain having the amino acid sequence SEQ ID NO: 40; and/or

- a primary intracellular signaling domain CD3-zeta with the amino acid sequence SEQ ID NO: 28, 29, 30 or 31, or a fragment or variant thereof;

where the sequences contained in the intracellular domain are expressed in the same frame and as a single polypeptide chain.

Thus, in some embodiments, the nucleic acid sequence encoding the intracellular signaling domain of the CAR of the invention includes:

- nucleic acid sequence of the costimulatory intracellular signaling domain TNFR2 SEQ ID NO: 35 or a fragment or variant thereof, and/or nucleic acid sequence of the costimulatory intracellular signaling domain 4-1BB SEQ ID NO: 37 or a fragment or variant thereof, and/or nucleic acid sequence of the costimulatory intracellular signaling domain the CD27 domain SEQ ID NO: 39 or a fragment or variant thereof, and/or the nucleic acid sequence of the costimulatory intracellular signaling domain CD28 SEQ ID NO: 41 or a fragment or variant thereof; and/or

- the primary intracellular signaling domain CD3-zeta of SEQ ID NO: 32 or SEQ ID NO: 33 or a fragment or variant thereof.

In some embodiments, the intracellular signaling domain of a CAR of the invention includes at least two different domains (e.g., a primary signaling domain or fragment or variant thereof, and at least one intracellular T cell costimulatory molecule domain or fragment or variant thereof) that may be related to each other in a random or specific order.

If desired, a short oligo- or polypeptide linker, for example 2 to 10 amino acids in length (eg 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids) can form a link between the individual signaling domains. In some embodiments, a glycine-serine (GS) doublet is used as a suitable linker. In some embodiments, a single amino acid is used as a suitable linker, eg, alanine (A), glycine (G). Other examples of linker are described herein.

In some embodiments, the intracellular signaling domain of a CAR of the invention comprises two or more (eg, 2, 3, 4, 5 or more) costimulatory intracellular signaling domains. In some embodiments, any or all of two or more (eg, 2, 3, 4, 5 or more) costimulatory signaling domains are separated by a linker molecule, such as a linker molecule as described herein.

In some embodiments, the intracellular signaling domain of a chimeric receptor of the invention includes a CD3-zeta primary intracellular signaling domain (e.g., SEQ ID NO: 28, 29, 30, or 31) and a TNFR2 costimulatory intracellular signaling domain (e.g., SEQ ID NO: 34).

In some embodiments, the intracellular signaling domain of a chimeric receptor of the invention comprises a CD3-zeta primary intracellular signaling domain (e.g., SEQ ID NO: 28, 29, 30, or 31) and a 4-1BB costimulatory intracellular signaling domain (e.g., SEQ ID NO: 36 ).

In some embodiments, the intracellular signaling domain of a chimeric receptor of the invention comprises a CD3-zeta primary intracellular signaling domain (e.g., SEQ ID NO: 28, 29, 30, or 31) and a CD27 costimulatory intracellular signaling domain (e.g., SEQ ID NO: 38).

In some embodiments, the intracellular signaling domain of a chimeric receptor of the invention includes a CD3-zeta primary intracellular signaling domain (e.g., SEQ ID NO: 28, 29, 30, or 31) and a CD28 costimulatory intracellular signaling domain (e.g., SEQ ID NO: 40).

In some embodiments, a CAR of the present invention comprises any combination of an extracellular binding domain as described herein, a transmembrane domain as described herein, an intracellular signaling domain as described herein, and, optionally, a spacer or hinge domain, as described in this application.

In some embodiments, the CAR of the present invention further comprises a leader sequence located at the N-terminus of the specific extracellular binding domain. A non-limiting example is the CD8 leader sequence, which may contain or consist of the sequence SEQ ID NO: 42.

In some embodiments, the CAR of the present invention further comprises a label, such as, for example, a label for quality control, enrichment, in vivo tracking, or the like. The specified tag can be localized at the N-terminus, C-terminus and/or inside. Examples of labels that can be used in the CAR of the present invention are well known to those skilled in the art. For example, used in the invention may be a label selected from the group consisting of a streptavidin tag (eg, SEQ ID NO: 47), a hemagglutinin tag, a polyarginine tag, a polyhistidine tag, a Myc tag, a strep tag, an S tag, a HAT tag. tags, 3x flag tags, calmodulin binding peptide tags, SBP tags, chitin binding domain tags, GST tags, maltose binding protein tags, fluorescent protein tags, T7 tags, V5 tags and Xpress-tags. tags, but not limited to this. Other examples of labels include, but are not limited to, NWSHPQFEK (SEQ ID NO: 43) or SAWSHPQFEK (SEQ ID NO: 44).

In some embodiments, the CAR of the present invention further comprises P2A (SEQ ID NO: 45) and/or GFP (SEQ ID NO: 46) sequences.

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- if necessary, an extracellular hinge domain;

- at least one transmembrane domain of TNFR2 or a fragment or variant thereof; And

- at least one intracellular primary signaling domain or fragment or variant thereof.

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- at least one transmembrane domain of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof; And

- at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof.

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least one transmembrane domain of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof; And

- at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain or fragment or variant thereof; And

- at least one costimulatory intracellular signaling domain or a fragment or variant thereof, where at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular domain or a fragment or variant thereof.

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- at least one transmembrane domain selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof; And

- at least one costimulatory intracellular signaling domain selected from the group consisting of a TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, a 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (for example, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (for example, SEQ ID NO: 40) or a fragment or variant thereof,

wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least one transmembrane domain selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof; And

- at least one costimulatory intracellular signaling domain selected from the group consisting of a TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, a 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain or fragment or variant thereof;

- at least one intracellular costimulatory signaling domain or fragment or variant thereof; And

- at least one primary T cell intracellular signaling domain or fragment or variant thereof;

wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one transmembrane domain selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least one costimulatory intracellular signaling domain selected from the group consisting of a TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, a 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least one transmembrane domain selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a transmembrane domain a CD28 domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

at least one costimulatory intracellular signaling domain selected from the group consisting of a TNFR2 intracellular domain (e.g., SEQ ID NO: 34) or a fragment or variant thereof, a 4-1BB intracellular domain (e.g., SEQ ID NO: 36) or a fragment thereof, or a variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain or fragment or variant thereof;

- at least two intracellular costimulatory signaling domains, or fragments or variants thereof; And

- optionally at least one primary T cell signaling domain or a fragment or variant thereof, wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment thereof, or option.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one transmembrane domain selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a transmembrane domain a CD28 domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least two costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domains and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least one transmembrane domain selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a transmembrane domain a CD28 domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least two costimulatory intracellular signaling domains selected from the group consisting of a TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, a 4-1BB intracellular domain (for example, SEQ ID NO: 36) or a fragment or a variant thereof, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and/or the costimulatory intracellular signaling domain is a transmembrane TNFR2 or a costimulatory intracellular signaling domain of TNFR2, or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- optionally with at least one extracellular hinge domain;

- at least one transmembrane domain or fragment or variant thereof;

- at least three costimulatory intracellular signaling domains, or fragments or variants thereof; And

- optionally at least one primary intracellular signaling domain of a T cell or a fragment or variant thereof;

wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a transmembrane TNFR2 or a costimulatory intracellular signaling domain of TNFR2, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one transmembrane domain selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a transmembrane domain a CD28 domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least three costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane or costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least one transmembrane domain selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a transmembrane domain a CD28 domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least three costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane or costimulatory intracellular signaling domain, or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain or fragment or variant thereof;

- at least four costimulatory intracellular signaling domains, or fragments or variants thereof; And

- optionally at least one primary intracellular signaling domain of a T cell or a fragment or variant thereof;

wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one transmembrane domain selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a transmembrane domain a CD28 domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least four costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a transmembrane or costimulatory intracellular signaling domain of TNFR2 or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least one transmembrane domain selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment or variant thereof, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least four costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 36) or thereof a fragment or variant, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domains and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least 1, 2 or 3 transmembrane domains or fragments or variants thereof; And

- optionally at least one primary intracellular signaling domain of a T cell or a fragment or variant thereof;

wherein at least one of the transmembrane domains is a TNFR2 transmembrane domain or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least 1, 2 or 3 transmembrane domains selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or thereof a fragment or variant, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof; And

- optionally at least one primary CD3-zeta signaling domain (eg, SEQ ID NO: 28, 29, 30 or 31) or fragment or variant thereof;

wherein at least one of the transmembrane domains is a TNFR2 transmembrane domain or a fragment or variant thereof.

In some embodiments, the CAR of the present invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least 1, 2 or 3 transmembrane domains selected from the group consisting of TNFR2 (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or a fragment thereof, or variant, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof; And

- optionally at least one primary intracellular signaling domain CD3-zeta (for example, SEQ ID NO: 28, 29, 30 or 31) or a fragment or variant thereof;

wherein at least one of the transmembrane domains is a TNFR2 transmembrane domain or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least 1, 2 or 3 transmembrane domains, or fragments or variants thereof;

- at least 1, 2, 3 or 4 intracellular costimulatory signaling domains, or fragments or variants thereof; And

- optionally at least one primary T cell signaling domain or fragment or variant thereof;

wherein at least one of the transmembrane domain and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least 1, 2 or 3 transmembrane domains selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or thereof a fragment or variant, and a CD28 transmembrane domain (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least 1, 2, 3 or 4 costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 34) NO: 36) or a fragment or variant thereof, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary CD3-zeta signaling domain (eg, SEQ ID NO: 28, 29, 30 or 31) or fragment or variant thereof;

wherein at least one of the transmembrane domains and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane domain or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof.

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- at least one hinge domain selected from the group consisting of CD8 (for example, SEQ ID NO: 14) or a fragment or variant thereof, CD28 (for example, SEQ ID NO: 20) or a fragment or variant thereof, IgG4 (for example, SEQ ID NO: 16) or a fragment or variant thereof, and IgD (eg, SEQ ID NO: 18) or a fragment or variant thereof;

- at least 1, 2 or 3 transmembrane domains selected from the group consisting of a TNFR2 transmembrane domain (for example, SEQ ID NO: 22) or a fragment or variant thereof, a CD8 transmembrane domain (for example, SEQ ID NO: 24) or thereof a fragment or variant or transmembrane domain of CD28 (eg, SEQ ID NO: 26) or a fragment or variant thereof;

- at least 1, 2, 3 or 4 costimulatory intracellular signaling domains selected from the group consisting of the TNFR2 intracellular domain (for example, SEQ ID NO: 34) or a fragment or variant thereof, the 4-1BB intracellular domain (for example, SEQ ID NO: 34) NO: 36) or a fragment or variant thereof, a CD27 intracellular domain (eg, SEQ ID NO: 38) or a fragment or variant thereof, and a CD28 intracellular domain (eg, SEQ ID NO: 40) or a fragment or variant thereof; And

- optionally at least one primary CD3-zeta signaling domain (eg, SEQ ID NO: 28, 29, 30 or 31) or fragment or variant thereof;

wherein at least one of the transmembrane domains and/or costimulatory intracellular signaling domains is a TNFR2 transmembrane or a TNFR2 costimulatory intracellular signaling domain, or a fragment or variant thereof. In specific embodiments, the at least one hinge domain is a CD8 hinge domain (eg, SEQ ID NO: 14).

In some embodiments, the CAR of the invention comprises:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain;

- at least one intracellular domain comprising at least one primary intracellular signaling domain and, optionally, at least one costimulatory intracellular signaling domain;

and wherein the at least one transmembrane domain is a human TNFR2 transmembrane domain or a fragment or variant thereof, or any transmembrane domain or fragment or variant thereof, or a combination thereof, and/or the at least one costimulatory intracellular signaling domain is a costimulatory a human TNFR2 intracellular signaling domain, or a fragment or variant thereof, or any costimulatory intracellular signaling domain, or fragment or variant thereof, or a combination thereof, and wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a fragment or variant, or a costimulatory intracellular signaling domain of TNFR2, or a fragment or variant thereof.

In some embodiments, a CAR of the invention comprises a sequence comprising a human CD8 hinge region, a human TNFR2 transmembrane domain, a human TNFR2 costimulatory intracellular signaling domain, and a human CD3ζ chain primary intracellular signaling domain, wherein said sequence corresponds to the amino acid sequence of SEQ ID NO: 48 or the amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 48.

In some embodiments, the CAR of the present invention comprises an anti-HLA-A2 scFv (e.g., containing or consisting of the binding domain sequence SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 , 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 , 104, 105, 106 or 107) associated with the amino acid sequence of SEQ ID NO: 48 or a sequence having at least about 70%, 75%, 80%, 85%, 90% 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 48.

In some embodiments, the CAR of the present invention includes an anti-IL-23R scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 65, 66, or 67) linked to the amino acid sequence of SEQ ID NO: 48 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO : 48.

In some embodiments, the CAR of the present invention comprises an anti-CD19 scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 1 or 2) linked to the amino acid sequence of SEQ ID NO: 48 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 48.

In some embodiments, a CAR of the invention comprises an anti-CD20 scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 4, 5, or 6) linked to an amino acid sequence of SEQ ID NO: 48 or an amino acid sequence having at least at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 48.

In some embodiments, the CAR of the present invention includes a sequence comprising a human CD8 hinge region, a human TNFR2 transmembrane domain, a human TNFR2 costimulatory intracellular signaling domain, and a human CD3ζ chain primary intracellular signaling domain, wherein said sequence corresponds to the amino acid sequence of SEQ ID NO: 49, 50 , 51 or 110 or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identity to SEQ ID NO: 49, 50, 51 or 110.

In some embodiments, the CAR of the present invention comprises an anti-HLA-A2 scFv (e.g., comprising the binding domain sequence SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106 or 107, or consisting thereof) associated with the amino acid sequence of SEQ ID NO: 49, 50, 51 or 110 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 49, 50, 51, or 110.

In some embodiments, the CAR of the present invention includes an anti-IL-23R scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 65, 66, or 67) linked to the amino acid sequence of SEQ ID NO: 49, 50, 51 or 110 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99 % identity to SEQ ID NO: 49, 50, 51 or 110.

In some embodiments, a CAR of the present invention comprises an anti-CD19 scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 1 or 2) linked to an amino acid sequence of SEQ ID NO: 49, 50, 51, or 110 or sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 49, 50, 51 or 110.

In some embodiments, the CAR of the present invention comprises an anti-CD20 scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 4, 5, or 6) linked to the amino acid sequence of SEQ ID NO: 49, 50, 51, or 110 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 49, 50, 51 or 110.

In some embodiments, a CAR of the invention comprises a sequence comprising a human CD8 hinge region, a human TNFR2 transmembrane domain, and a human CD3ζ primary intracellular signaling domain, wherein said sequence corresponds to an amino acid sequence of SEQ ID NO: 52 or an amino acid sequence having at least about 70 %, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 52.

In some embodiments, the CAR of the invention comprises an anti-HLA-A2 scFv (e.g., containing or consisting of the binding domain sequence SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106 or 107) associated with the amino acid sequence of SEQ ID NO: 52 or a sequence having at least about 70%, 75%, 80%, 85%, 90% 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 52.

In some embodiments, the CAR of the present invention comprises an anti-IL-23R scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 65, 66, or 67) linked to the amino acid sequence of SEQ ID NO: 52 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO : 52.

In some embodiments, the CAR of the present invention includes an anti-CD19 scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 1 or 2) linked to the amino acid sequence of SEQ ID NO: 52 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 52.

In some embodiments, the CAR of the present invention includes an anti-CD20 scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 4, 5, or 6) linked to the amino acid sequence of SEQ ID NO: 52 or a sequence having at least at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 52.

In some embodiments, a CAR of the invention comprises a sequence comprising a human CD8 hinge region, a human CD8 transmembrane domain, a human CD3ζ chain primary intracellular signaling domain, and a human TNFR2 costimulatory intracellular signaling domain, wherein said sequence corresponds to the amino acid sequence of SEQ ID NO: 5 or the amino acid sequence sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 53.

In some embodiments, the CAR of the present invention comprises an anti-HLA-A2 scFv (e.g., comprising the binding domain sequence SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106 or 107, or consisting thereof) linked to the amino acid sequence of SEQ ID NO: 53 or a sequence having at least about 70%, 75%, 80%, 85%, 90% 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 53.

In some embodiments, the CAR of the present invention comprises an anti-IL-23R scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 65, 66, or 67) linked to the amino acid sequence of SEQ ID NO: 53 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO : 53.

In some embodiments, a CAR of the invention comprises an anti-CD19 scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 1 or 2) linked to the amino acid sequence of SEQ ID NO: 53, or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 53.

In some embodiments, the CAR of the present invention comprises an anti-CD20 scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 4, 5, or 6) linked to the amino acid sequence of SEQ ID NO: 53 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 53.

In some embodiments, the CAR of the present invention comprises a sequence comprising a human CD8 hinge region, a human CD8 transmembrane domain, a human TNFR2 costimulatory intracellular signaling domain, and a human CD3ζ chain primary intracellular signaling domain, wherein said sequence corresponds to the amino acid sequence of SEQ ID NO: 54 or the amino acid sequence sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 54.

In some embodiments, the CAR of the invention comprises an anti-HLA-A2 scFv (e.g., comprising the binding domain sequence SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106 or 107, or consisting thereof) associated with the amino acid sequence of SEQ ID NO: 54 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93% 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 54.

In some embodiments, a CAR of the invention comprises an anti-IL-23R scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 65, 66, or 67) linked to the amino acid sequence of SEQ ID NO: 54 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 54.

In some embodiments, the CAR of the present invention comprises an anti-CD19 scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 1 or 2) linked to the amino acid sequence of SEQ ID NO: 54 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 54.

In some embodiments, a CAR of the invention comprises an anti-CD20 scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 4, 5, or 6) linked to an amino acid sequence of SEQ ID NO: 54 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 54.

In some embodiments, the CAR of the invention includes a sequence comprising a human CD8 hinge region, a combination of a human CD8 transmembrane domain and a human TNFR2 transmembrane domain, a human TNFR2 costimulatory intracellular signaling domain, and a human CD3ζ chain primary intracellular signaling domain, wherein said sequence corresponds to the amino acid sequence of SEQ ID NO: 55, 56 or 57 or an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99% identity to SEQ ID NO: 55, 56 or 57.

In some embodiments, the CAR of the present invention comprises an anti-HLA-A2 scFv (e.g., comprising the binding domain sequence SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106 or 107, or consisting thereof) associated with the amino acid sequence of SEQ ID NO: 55, 56 or 57 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 55, 56, or 57.

In some embodiments, the CAR of the invention comprises an anti-IL-23R scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 65, 66, or 67) linked to the amino acid sequence of SEQ ID NO: 55, 56, or 57, or sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 55, 56 or 57.

In some embodiments, a CAR of the present invention comprises an anti-CD19 scFv (e.g., comprising or consisting of a binding domain sequence of SEQ ID NO: 1 or 2) linked to an amino acid sequence of SEQ ID NO: 55, 56, or 57 or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO : 55, 56 or 57.

In some embodiments, a CAR of the invention comprises an anti-CD20 scFv (e.g., containing or consisting of a binding domain sequence of SEQ ID NO: 4, 5, or 6) linked to an amino acid sequence of SEQ ID NO: 55, 56, or 57, or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO : 55, 56 or 57.

In some embodiments, a CAR of the present invention (e.g., any CAR described herein containing a TNFR2 transmembrane domain or fragment or variant thereof, and/or an intracellular domain containing a TNFR2 costimulatory intracellular signaling domain or fragment or variant thereof) has at least one of the following properties:

(a) exhibits less cell surface expression than a CAR with the same sequence, except that the transmembrane domain is the CD8 transmembrane domain and the costimulatory intracellular signaling domain is the 4-1BB costimulatory intracellular signaling domain;

(b) exhibits comparable levels of CAR-specific activation as a CAR with the same sequence, except that the transmembrane domain is the CD8 transmembrane domain and the costimulatory intracellular signaling domain is the 4-1BB costimulatory intracellular signaling domain;

(c) does not reduce cell surface levels of regulatory T cell markers, such as any one or more (e.g., all) of FoxP3, Helios, and CD62L, in at least 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more days of culture; And

(d) does not increase cell surface levels of a non-regulatory T cell marker such as CD127 after at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20 or more days of culture.

Immune cells

The present invention also relates to an immune cell expressing a CAR, as described herein, and a population of such immune cells.

In some embodiments, a nucleic acid encoding a CAR of the present invention is introduced into an immune cell, thereby generating an engineered cell expressing the CAR on the cell surface.

As used herein, the term “immune cells” generally includes white blood cells (leukocytes) that are derived from hematopoietic stem cells (HSC) produced in the bone marrow. Examples of immune cells include, but are not limited to, lymphocytes (T cells, B cells, and natural killer (NK) cells) and myeloid-derived cells (neutrophils, eosinophils, basophils, monocytes, macrophages, dendritic cells).

In some embodiments, an immune cell of the invention is genetically modified to express a chimeric receptor comprising a TNFR2 transmembrane domain or fragment or variant thereof, and/or a TNFR2 costimulatory intracellular signaling domain or fragment or variant thereof.

In some embodiments, the immune cell of the invention is a mammalian immune cell, such as a human immune cell, a farm animal immune cell (eg, a cow, pig, or horse), or a domestic animal immune cell (eg, a cat or dog).

In some embodiments, the immune cell is selected from the group consisting of lymphocytes, myeloid-derived cells, and any combination thereof. In some embodiments, the immune cell is a lymphocyte, for example, selected from the group consisting of T cells, B cells, natural killer (NK) cells, and any combination thereof. In specific embodiments, the immune cell is a T cell, which in certain embodiments is selected from the group consisting of CD4+ T cells, CD8+ T cells, γδ T cells, double negative (DN) T cells, and any combination thereof . In some embodiments, the immune cell is a CD4+ T cell, such as, for example, a T helper cell, a regulatory T cell, an effector T cell, and any combination thereof. In some embodiments, the immune cell is a CD8+ T cell, such as, for example, a cytotoxic CD8+ T cell or a CD8+ regulatory T cell. In some embodiments, the immune cell is a γδ T cell. In some embodiments, the immune cell is a T cell engineered to express certain TCR gamma delta (TEGγδ) cells. In some embodiments, the immune cell is a DN T cell. In some embodiments, the immune cell is a B cell. In some embodiments, the immune cell is an NK cell.

In some embodiments, the immune cell is a cell of myeloid origin, for example, selected from the group consisting of neutrophils, eosinophils, basophils, monocytes, macrophages, dendritic cells, or any combination thereof. In some embodiments, the immune cell is a macrophage. In some embodiments, the immune cell is a dendritic cell.

In some embodiments, the immune cell is a regulatory immune cell, such as, for example, any regulatory immune cell suitable for use in cell therapy. In some embodiments, the regulatory immune cell is selected from the group consisting of a regulatory T cell, a CD4+ regulatory T cell, a CD8+ regulatory T cell, a γδ regulatory T cell, a DN regulatory T cell, a regulatory B cell, a regulatory NK- cell, regulatory macrophage, regulatory dendritic cell, and any combination thereof.

In some embodiments, the regulatory immune cell is a regulatory T cell (Treg), particularly a thymus-derived Treg or an adaptive or induced Treg cell. In some embodiments, the immune cell is a CD4+ regulatory T cell (Treg). In some embodiments, the Treg is a thymus-derived Treg or an adaptive or induced Treg cell. In some embodiments, the Treg is a CD4 ⁺ FoxP3 ⁺ regulatory T cell or a CD4 ⁺ FoxP3 ^- regulatory T cell (Tr1 cell). In specific embodiments, the immune cell is a CD4 ⁺ FoxP3 ⁺ regulatory T cell.

In some embodiments, the immune cell is a CD8 ⁺ regulatory T cell. Examples of CD8 ⁺ regulatory T cells include CD8 ⁺ CD28 ^- regulatory T cells, CD8 ⁺ CD103 ⁺ regulatory T cells, CD8 ⁺ FoxP3 ⁺ regulatory T cells, CD8 ⁺ CD122 ⁺ regulatory T cells, and any combination thereof, but not limited to them.

In some embodiments, the regulatory immune cell is a regulatory γδ T cell.

In some embodiments, the regulatory immune cell is a DN regulatory T cell.

In some embodiments, the regulatory immune cell is a regulatory B cell. An example of a regulatory B cell includes, but is not limited to, a CD19 ⁺ CD24 ^hi CD38 ^hi B cell.

In some embodiments, the regulatory immune cell is a regulatory NK cell.

In some embodiments, the regulatory immune cell is a regulatory macrophage.

In some embodiments, the regulatory immune cell is a regulatory dendritic cell.

In some embodiments, the immune cell is an effector immune cell, such as, for example, any effector immune cell suitable for use in cell therapy. In some embodiments, the effector immune cell is selected from the group consisting of an effector T cell, a CD4 ⁺ effector T cell, a CD8 ⁺ effector T cell, an effector γδ T cell, an effector DN T cell, an effector B cell, an effector NK cells, effector macrophages, effector dendritic cells, and any combination thereof.

In some embodiments, the immune cell is an effector T cell. In some embodiments, the effector immune cell is a CD4 ⁺ effector T cell. Examples of CD4 ⁺ effector T cells include, but are not limited to, Th1 cells, Th2 cells, Th9 cells, Th17 cells, Th22 cells, CD4 ⁺ T follicular helper (Tfh) cells, and any combination thereof. In some embodiments, the effector immune cell is a CD8 ⁺ effector T cell. Examples of CD8 ⁺ effector T cells include, but are not limited to, CD8 ⁺ CD45RO ⁺ CCR7 ^- CD62L ^- effector T cells, CD8 ⁺ CD45RA ⁺ CCR7 ^- CD62L ^- effector T cells, and any combination thereof.

In one embodiment, the immune cell is an effector γδ T cell.

In one embodiment, the immune cell is an effector DN T cell.

In one embodiment, the immune cell is an effector B cell. Examples of effector B cells include, but are not limited to, CD19 ⁺ CD25 ^hi B cells, activated B cells and plasma cells, and any combination thereof.

In some embodiments, the immune cell is an effector NK cell.

In some embodiments, the immune cell is an effector macrophage.

In some embodiments, the immune cell is an effector dendritic cell.

In some embodiments, the immune cell is selected from the group consisting of T cells, natural killer (NK) cells, γδ T cells, double negative (DN) cells, regulatory immune cells, regulatory T cells, effector immune cells, effector T cells cells, B cells and cells of myeloid origin, and any combination thereof.

In some embodiments, a nucleic acid encoding a CAR of the present invention is introduced into a pluripotent stem cell (PSC), which can then be differentiated into a T cell. PSCs are cells capable of giving rise to any cell type in the body and include, for example, embryonic stem cells (ESCs), somatic cell nuclear transfer PSCs, and induced PSCs (iPSCs). As used herein, the term “embryonic stem cells” refers to pluripotent stem cells derived from early embryos; in some embodiments, the term refers to ESCs derived from a previously established embryonic stem cell line, and excludes stem cells derived from recent destruction of a human embryo.

In some embodiments, a nucleic acid encoding a CAR of the present invention is introduced into a multipotent cell, such as a hematopoietic stem cell (HSC, such as those isolated from bone marrow or umbilical cord blood), hematopoietic progenitor cells (for example, lymphoid progenitor cells), or mesenchymal stem cells (MSC). Multipotent cells are capable of developing into more than one cell type, but they have more limited cell type potential than pluripotent cells. Multipotent cells can be obtained from established cell lines or isolated from human bone marrow or umbilical cord. For example, HSCs can be isolated from a patient or healthy donor following G-CSF-induced mobilization, plerixafor-induced mobilization, or a combination thereof. To isolate HSCs from blood or bone marrow, cells in the blood or bone marrow can be panned with antibodies that bind unwanted cells, such as antibodies to CD4 and CD8 (T cells), CD45 (B cells), GR- 1 (granulocytes) and Iad (differentiated antigen presenting cells). HSCs can then be positively selected with anti-CD34 antibodies.

In some embodiments, a nucleic acid encoding a CAR of the present invention is introduced into a non-Treg lymphoid cell that differentiates into a Treg cell after genome editing. The edited non-Treg cells can be differentiated into Treg cells before transplantation into the patient as described above. Alternatively, edited non-Treg cells can be induced to differentiate into Treg cells after implantation into a patient.

In some embodiments, the expression level of the molecules is determined using flow cytometry, immunofluorescence, or image analysis, such as high content analysis. In some embodiments, the expression level of the molecules is determined using flow cytometry. In certain embodiments, cells are fixed and permeabilized prior to flow cytometry analysis to allow detection of intracellular proteins.

In some embodiments, determining the level of expression of a molecule in a population of cells includes determining the percentage of cells in the population of cells that express the molecule (ie, "+" cells for the molecule). In some embodiments, said percentage of cells expressing the molecule is measured using FACS.

The terms "expressing", "positive" or "+" and "non-expressing", "negative" or "-" are well known in the art and refer to the level of expression of the cellular marker of interest, indicating that the level of expression of the cellular marker corresponding to " +" is high or intermediate (also called "+/-"), and the cell marker expression level corresponding to "-" is zero.

The term "low" or "lo" or "lo/-" is well known in the art and refers to the level of expression of a cellular marker of interest when the level of expression of the cellular marker is low compared to the level of expression of that cellular marker in the population of cells being analyzed generally. More specifically, the term "lo" refers to a distinct population of cells that express a cellular marker at a lower level than one or more other distinct populations of cells.

The term "high", "hi" or "bright" is well known in the art, and refers to the level of expression of a cellular marker of interest if the level of expression of the cellular marker is high compared to the level of expression of that cellular marker in the population of cells being analyzed as a whole.

Typically, cells in the highest 2, 3, 4, or 5% of staining intensity are designated “hi,” and cells falling in the top half of the population are classified as “+.” Those cells whose fluorescence intensity is below 50% are designated as “lo” cells, and those less than 5% are referred to as “-” cells.

The level of expression of a cellular marker of interest is determined by comparing the median fluorescence intensity or mean fluorescence intensity (MFI) of cells from a population of cells stained with a fluorescently labeled antibody specific for that marker with the fluorescence intensity (FI) of cells from the same population of cells stained fluorescently labeled with an antibody of irrelevant specificity, but with the same isotype, the same fluorescent probe, and originating from the same species (so-called isotype control). Cells from a population stained with a fluorescently labeled antibody specific for that marker and showing an equivalent MFI value or a lower MFI value than cells stained with the isotype control are considered not to express that marker and are designated as (-) or negative. Cells from a population that are stained with a fluorescently labeled antibody specific for that marker and show an MFI value higher than cells stained with the isotype control are considered to express that marker and are designated as (+) or positive.

The invention also relates to an isolated and/or substantially purified population of immune cells, as defined herein.

Thus, the invention provides an isolated and/or substantially purified population of immune cells, wherein the cells of the population contain CARs as described herein, for example, a CAR that includes the TNFR2 transmembrane domain, or a fragment or variant thereof, and/or a costimulatory intracellular signaling TNFR2 domain, or a fragment or variant thereof.

As used herein, an "isolated population" refers to a cell population that is removed from its natural environment (such as peripheral blood) and that is isolated, purified, or separated, and is at least about 75%, 80%, 85% free, and in some embodiments, is about 90%, 95%, 96%, 97%, 98%, 99% free from other cells with which it is naturally present but lacking the cell surface markers on which the cells were isolated.

The present invention also relates to an enriched population of immune cells, as defined herein.

In some embodiments, the isolated, purified and/or enriched population of immune cells of the present invention has been frozen and thawed.

In some embodiments, T cells from the immune cell population of the invention express a chimeric receptor (CAR) as described herein and thus can be defined as CAR monospecific (i.e., all Treg cells recognize the same same antigen with the CAR they express). In some embodiments, the Treg cell population is TCR-monospecific (ie, all Treg cells recognize the same antigen with their TCR). In some embodiments, the Treg cell population is TCR-multispecific (ie, Treg cells can recognize different antigens using their TCRs).

In some embodiments, the T cell population is TCR monospecific, and the TCR recognizes an antigen, a fragment of an antigen, a variant antigen, or a mixture thereof.

In some embodiments, the T cell population is TCR monospecific and the TCR is specific for a food antigen from the normal human diet.

In some embodiments, the T cell population is TCR-monospecific, and the TCR is specific for a self-antigen, such as, for example, multiple sclerosis-associated antigen, joint-associated antigen, eye-associated antigen, human HSP antigen, with the skin, or an antigen involved in transplant rejection or GVHD. This application provides examples of such autoantigens.

In some embodiments, the T cell population is TCR monospecific and the TCR is specific for an inhalant allergen, an ingestible allergen, or a contact allergen.

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for an antigen selected from the group consisting of ovalbumin, MOG, type II collagen, citrullinated vimentin, citrullinated type II collagen, citrullinated fibrinogen, and fragments, variants, and mixtures.

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for ovalbumin or a fragment, variant, or mixture thereof.

In some embodiments, the T cell population is TCR monospecific and the TCR is specific for MOG or a fragment, variant, or mixture thereof.

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for type II collagen or a fragment, variant, or mixture thereof.

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for citrullinated vimentin, citrullinated type II collagen, citrullinated fibrinogen, or a fragment, variant, or mixture thereof.

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for HLA-A2 or a fragment, variant, or mixture thereof (eg, as described herein).

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for IL-23R or a fragment, variant, or mixture thereof (eg, as described herein).

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for a B cell surface marker, such as, for example, CD19 or CD20, or a fragment, variant, or mixture thereof (eg, as described herein).

In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for a cancer antigen or a fragment, variant, or mixture thereof, as described herein.

In some embodiments, the T cell population is TCR monospecific and the TCR recognizes infected cells. In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for a bacterial antigen or a fragment, variant, or mixture thereof. In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for a viral antigen or a fragment, variant, or mixture thereof. In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for a fungal antigen or a fragment, variant, or mixture thereof. In some embodiments, the T cell population is TCR monospecific, and the TCR is specific for a parasitic antigen or a fragment, variant, or mixture thereof.

In some embodiments, immune cells expressing a CAR of the invention are suppressive of cells recognized by the CAR. In some embodiments, the immune cells are T cells. In specific embodiments, the immune cells are Treg cells. In some embodiments, Treg cells are obtained by in vitro differentiation of naïve T cells.

In some embodiments, the immune cells of the invention are non-cytotoxic. In some embodiments, the immune cells are T cells. In specific embodiments, the immune cells are Treg cells.

In some embodiments, the regulatory immune cells of the invention may be selected from the group consisting of CD4 ⁺ CD25 ⁺ FoxP3 ⁺ Tregs, Tr1 cells, TGF-β secreting Th3 cells, regulatory NK T cells, regulatory γδ T cells, regulatory CD8 ⁺ T cells and double negative regulatory T cells.

In some embodiments, the immune cells of the invention are cytotoxic. In some embodiments, the immune cells are cytotoxic to cells expressing a cancer antigen or fragment or variant thereof, as described herein. In specific embodiments, the immune cells of the present invention are cytotoxic to cancer cells. In specific embodiments, the immune cells of the present invention are cytotoxic to infected cells.

In some embodiments, the immune cells of the invention are cytotoxic immune cells. Cytotoxic immune cells include, for example, cytotoxic T cells, CD8+ T cells, natural killer (NK) cells, cytotoxic B cells, macrophages and monocytes. Once activated, each of these cytotoxic immune cells triggers the destruction of target cells. For example, cytotoxic immune cells trigger the destruction of target cancer cells in one or both of the following ways. First, when activated, immune cells release cytotoxins such as perforin, granzymes, and granulysin. Perforin and granulysin create pores in the target cell, and granzymes enter the cell and trigger a caspase cascade in the cytoplasm, which causes apoptosis (programmed death) of the cell. Second, apoptosis can be induced through FAS-FAS ligand interaction between immune cells and target tumor cells.

In some embodiments, the cytotoxic immune cells are autologous cells.

In some embodiments, the cytotoxic immune cells are heterologous cells.

In some embodiments, the cytotoxic immune cells are allogeneic cells.

In some embodiments, the immune cells of the invention are cytotoxic to proB cells, preB cells, immature (or transitional) B cells, mature naïve B cells, activated B cells, memory B cells, plasma cells, lymphoblasts, B -marginal zone cells, germinal center B cells, plasmablasts and/or regulatory B cells (Breg cells).

In some embodiments, the immune cell of the invention is not cytotoxic to Breg cells.

In some embodiments, the population of monospecific Treg cells of the invention is cytotoxic to B cells expressing and presenting immunoglobulin on their surface. Examples of B cells expressing and presenting immunoglobulin on their surface include preB cells, immature (or transitional) B cells, mature naïve B cells, activated B cells, memory B cells, marginal zone B cells, germinal center cells, and regulatory B cells (Breg cells), but are not limited to them.

In some embodiments, the monospecific Treg cell population of the invention is cytotoxic to mature B cells, for example, mature activated B cells. In some embodiments, the monospecific Treg cell population of the invention is cytotoxic to mature B cells (e.g., mature activated B cells) expressing on their surface a B cell surface marker recognized by a chimeric receptor expressed by cells of the monospecific Treg cell population .

In some embodiments, the population of monospecific Treg cells of the invention is cytotoxic to at least one cell type selected from proB cells, preB cells, immature (or transitional) B cells, mature naïve B cells, activated B cells cells, memory B cells, plasma cells, lymphoblasts, marginal zone B cells, germinal center B cells, plasmablasts and regulatory B cells (Breg cells). In specific embodiments, the population of monospecific Treg cells is cytotoxic to at least one cell type selected from preB cells, immature (or transitional) B cells, mature naive B cells, activated B cells, memory B cells, Marginal zone B cells, germinal center B cells, and regulatory B cells (Breg cells).

In some embodiments, the population of monospecific Treg cells of the invention is cytotoxic to at least one cell type selected from proB cells, preB cells, immature (or transitional) B cells, mature naïve B cells, activated B cells cells, memory B cells, plasma cells, lymphoblasts, marginal zone B cells, germinal center B cells and plasmablasts. In specific embodiments, the population of monospecific Treg cells is cytotoxic to at least one cell type selected from preB cells, immature (or transitional) B cells, mature naive B cells, activated B cells, memory B cells, Marginal zone B cells and germinal center B cells.

In some embodiments, a population of immune cells of the present invention express on their cell surface a CAR of the present invention (herein referred to as the "first receptor") and another receptor (herein referred to as the "second receptor") that binds to a different, different ligand . In some embodiments, the second receptor comprises an extracellular ligand binding domain, optionally a hinge domain, at least one transmembrane domain, and at least one intracellular signaling domain, for example, as described herein.

In some embodiments, the second receptor is endogenous (such as, for example, an endogenous TCR). In some embodiments, the second receptor is exogenous and its expression is induced in a population of immune cells of the present invention by transformation or transduction of the nucleic acid encoding it. Said exogenous receptor may be an exogenous TCR or a CAR. Therefore, in some embodiments, the immune cell population of the present invention expresses two CARs, the first and second each recognizing a different ligand. In some embodiments, a population of immune cells of the invention expresses two CARs, the first recognizing a first epitope on an antigen and the second recognizing a second distinct epitope on the same antigen. In some embodiments, a population of immune cells of the invention expresses two CARs, the first recognizing an antigen and the second recognizing a second distinct antigen (such as, for example, a variant antigen).

In some embodiments, at least one of the CARs of the present invention and the second receptor (eg, the second CAR) is inducible, that is, its cell surface expression can be induced.

In some embodiments, expression of at least one of the CARs of the invention and a second receptor (eg, a second CAR) is induced by activation of the other receptor. In some embodiments, expression of a CAR of the invention is induced by activation of a second receptor. In some embodiments, expression of the second receptor is induced by activation of a CAR of the present invention. Inducible CARs have been described in the art, for example, Roybal et al. (Cell 167(2):419-432 (2016)).

In some embodiments, the second receptor (eg, the second CAR) is specific for an antigen, a fragment of an antigen, a variant of an antigen, or a mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for a food antigen from a person's normal diet.

In some embodiments, the second receptor (e.g., the second CAR) is specific for a self-antigen (e.g., an autoantigen described herein), such as, for example, multiple sclerosis-associated antigen, joint-associated antigen, eye-associated antigen, human HSP antigen, skin-associated antigen, or antigen involved in transplant rejection or GVHD. In some embodiments, the antigen is a skin-associated antigen. In some embodiments, the antigen is an antigen involved in graft rejection or GVHD.

In some embodiments, the second receptor (eg, the second CAR) is specific for an inhalant allergen, an ingestible allergen, or a contact allergen.

In some embodiments, the second receptor (e.g., a second CAR) is specific for an antigen selected from the group consisting of ovalbumin, MOG, type II collagen fragments, citrullinated vimentin, citrullinated type II collagen, citrullinated fibrinogen, and fragments, variants, and mixtures thereof .

In some embodiments, the second receptor (eg, the second CAR) is specific for ovalbumin or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for MOG or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for type II collagen or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for citrullinated vimentin, citrullinated type II collagen, citrullinated fibrinogen, or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for HLA-A2 or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for IL-23R or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for a B cell surface marker, such as, for example, CD19 or CD20, or a fragment, variant, or mixture thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for a cancer antigen or a fragment, variant, or mixture thereof, as described herein.

In some embodiments, a second receptor (eg, a second CAR) recognizes infected cells. In some embodiments, the second receptor (eg, the second CAR) is specific for a bacterial antigen or a fragment, variant, or mixture thereof. In some embodiments, the second receptor (eg, the second CAR) is specific for a viral antigen or a fragment, variant, or mixture thereof. In some embodiments, the second receptor (eg, the second CAR) is specific for a fungal antigen or a fragment, variant, or mixture thereof.

In some embodiments, the extracellular binding domain of the second receptor is a protein, or a fragment or variant thereof, such as, for example, an autoantigen or a fragment or variant thereof.

In some embodiments, the second receptor (eg, the second CAR) is specific for an autoantibody, such as, for example, an autoantibody expressed on a B cell, or a fragment, variant, or mixtures thereof.

In some embodiments, the CAR of the present invention comprises a first intracellular signaling domain and the second receptor comprises a separate second intracellular signaling domain. In some embodiments, the CAR of the invention comprises a primary T cell signaling domain (such as, for example, CD3 zeta), and the second receptor includes a costimulatory signaling domain (such as, for example, a TNFR2 or CD8 costimulatory domain, or a combination of TNFR2 costimulatory signaling domain and CD8). In some embodiments, the CAR of the present invention comprises a costimulatory intracellular signaling domain (such as, for example, a TNFR2, 4-1BB, CD27 or CD28 costimulatory intracellular signaling domain, or a combination of a TNFR2 and 4-1BB costimulatory intracellular signaling domain), and the second receptor comprises primary intracellular signaling domain of a T cell (such as CD3 zeta). In these embodiments, full activation of the immune cell population of the invention requires both binding of the CAR of the invention to the ligand to which it is directed and binding of a second receptor to the ligand to which it is targeted.

In some embodiments, the ligand recognized by the second receptor is expressed or present in the affected tissue or organ, or at the site of the autoimmune response. Therefore, suppressor activity for cells expressing the ligand of the first CAR of the present invention will only be induced in the affected tissue or organ, or at the site of an autoimmune response, when said ligand is present and recognized by a second receptor on cells from the immune cell population (e.g., Tregs) .

In some embodiments, the second chimeric receptor further comprises an extracellular ligand-binding domain that recognizes a ligand different from the ligand recognized by the first chimeric receptor of the invention. In some embodiments, said ligand binding domain is an antibody or an antigen binding fragment thereof. In some embodiments, the second chimeric receptor further comprises an extracellular ligand-binding domain that recognizes a distinct epitope of the same antigen recognized by the first chimeric receptor.

In some embodiments, the chimeric receptor of the present invention comprises an extracellular ligand-binding domain including a first ligand-binding domain that binds to a first ligand and a second ligand-binding domain that binds to a second ligand other than the first ligand. In some embodiments, said ligand binding domain is a bifunctional antibody that recognizes both the first and second ligand. In some embodiments, said ligand binding domain is a bifunctional antibody that recognizes two different epitopes of the same antigen.

Nucleic acids, vectors and CAR production

The present invention also provides a nucleic acid sequence encoding a CAR as described herein, wherein said nucleic acid sequence includes:

- at least one nucleic acid sequence of an extracellular binding domain;

- optionally at least one nucleic acid sequence of an extracellular hinge domain, at least one nucleic acid sequence of a transmembrane domain;

- at least one intracellular domain nucleic acid sequence, including at least one primary intracellular signaling domain nucleic acid sequence and, optionally, at least one costimulatory intracellular signaling domain nucleic acid sequence;

wherein the transmembrane domain nucleic acid sequence is the nucleic acid sequence of a human TNFR2 transmembrane domain or a fragment or variant thereof, or the nucleic acid sequence of any transmembrane domain or fragment or variant thereof, or a combination thereof, and/or the costimulatory intracellular signaling domain nucleic acid sequence is the nucleic acid sequence of a costimulatory intracellular signaling domain of human TNFR2 or a fragment or variant thereof, or the nucleic acid sequence of any costimulatory intracellular signaling domain or fragment or variant thereof, or a combination thereof, wherein the nucleic acid sequence of the transmembrane domain is a nucleic acid sequence of the transmembrane domain of TNFR2 or a fragment or variant thereof and/or nucleic acid sequence costimulatory intracellular signaling domain is the sequence of the costimulatory intracellular signaling domain of TNFR2 or a fragment or variant thereof.

The invention also provides a vector containing a nucleic acid sequence encoding a CAR, as described herein. Examples of vectors that can be used in the present invention include, but are not limited to, DNA vector, RNA vector, plasmid, phagemid, phage derivative, virus and cosmid.

Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and other manuals on virology and molecular biology. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, suitable restriction endonuclease sites, and one or more selectable markers (see, for example, PCT patent publications WO 01/96584 and WO 01/29058 and US Pat. No. 6,326,193, incorporated herein by reference).

A number of virus-based systems have been developed to transfer genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into retroviral particles using methods known in the art. The recombinant virus can then be isolated and delivered to the subject's cells in vivo or ex vivo. A number of retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. In addition, a number of adenoviral vectors are known in the art. In some embodiments, lentiviral vectors are used.

Additional transcriptionally active elements, such as promoters and enhancers, regulate the frequency of transcription initiation. Typically, core promoters are located in the region of 30-110 bp. upstream of the start site, although it has recently been shown that a number of promoters contain functional elements downstream of the start site, and enhancer elements are usually located 500-2000 bp. above the start site. The spacing between promoter elements is often flexible so that promoter function is maintained when elements are inverted or moved relative to each other. In the thymidine kinase (tk) promoter, the distance between promoter elements can be increased to 50 bp before activity begins to decline. Depending on the promoter, it appears that individual elements may act together or independently to activate transcription.

One example of a suitable promoter is the cytomegalovirus (CMV) immediate early promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked to it. Another example of a suitable promoter is elongation growth factor-la (EF-la). Another example of a suitable promoter is the phosphoglycerate kinase (PGK) promoter. However, other constitutive promoter sequences may also be used, including, but not limited to, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr virus immediate early promoter and the Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Moreover, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence to which it is operably linked when such expression is desired, or turning off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, a metallothionein promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. In addition, bidirectional promoters that provide efficient and coordinated expression of two or more genes may also be of interest in the present invention. Examples of bidirectional promoters include those described by Luigi Naldini in US Patent Publication 2006/200869, incorporated herein by reference, disclosing a bidirectional promoter comprising (i) a first minimal promoter sequence derived from cytomegalovirus (CMV) or mouse mammary tumor virus (MMTV) ), and (ii) the complete effective promoter sequence derived from the animal gene; but are not limited to them.

To assess the expression of a CAR polypeptide or portions thereof, the expression vector to be introduced into a T cell may also contain either a selectable marker gene such as CD34, CD271, or a reporter gene, or both, to facilitate the identification and selection of expressors. cells from a population of cells intended for transfection or infection with viral vectors. In other aspects, the selectable marker may be on a separate DNA fragment and used in a co-transfection procedure. Both selectable markers and reporter genes can be flanked by appropriate regulatory sequences to allow expression in host cells. Suitable selectable markers include, for example, antibiotic resistance genes such as neomycin and the like.

In some embodiments, suicide gene technology may be used. Various suicide gene technologies have been described in the field depending on their mechanism of action (see, for example, Jones et al., Frontiers in Pharmacology 5: 254 (2014)). Examples of gene-directed enzyme prodrug therapy (GDEPT) that convert a nontoxic drug into a toxic one include herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD). Other examples are chimeric proteins consisting of a drug binding domain coupled to apoptotic components, such as, for example, the inducible Fas (iFas) or inducible caspase 9 (iCasp9) systems. Other examples include therapeutic antibody-mediated systems, such as stimulating c-myc overexpression on the surface of an engineered cell to induce its deletion by administering an anti-c-myc antibody. The use of EGFR is described as a system similar to the c-myc system.

Reporter genes are used to identify potentially transfected cells and to assess the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present or expressed in the body or tissues of the recipient and that encodes a polypeptide whose expression exhibits some easily detectable property, such as enzymatic activity. Expression of the reporter gene is analyzed at an appropriate time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or green fluorescent protein gene (see, for example, Ui-Tei et al., FEBS Letters 479: 79-82 (2000)) . Suitable expression systems are well known and can be prepared using known techniques or purchased commercially. In general, the construct with the minimal 5' flanking region showing the highest level of reporter gene expression is identified as a promoter. Such promoter regions can be linked to a reporter gene and used to assess the ability of agents to modulate promoter-driven transcription.

Methods for introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, for example a mammalian, bacterial, yeast or insect cell, by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells containing vectors and/or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). In some embodiments, the polynucleotide is introduced into a host cell using calcium phosphate transfection.

Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, US Patents 5,350,674 and 5,585,362.

Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, granules and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles and liposomes. A typical colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (eg, an artificial membrane vesicle). "Liposome" is a general term covering a variety of single- and multilayer lipid carriers formed by the generation of closed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an internal aqueous environment. Multilamellar liposomes have multiple lipid layers separated by an aqueous medium. They form spontaneously when phospholipids are suspended in excess aqueous solution. Lipid components undergo self-organization to form closed structures and trap water and solutes between lipid bilayers (Ghosh et al., Glycobiology 5: 505-10 (1991)). However, compositions that have a structure in solution other than the normal vesicular structure are also covered. For example, lipids can have a micellar structure or simply exist in the form of heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also considered.

It is contemplated that lipid formulations may be used to introduce nucleic acids into a host cell (in vitro, ex vivo or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The lipid-bound nucleic acid may be encapsulated in the aqueous interior of the liposome, embedded in the lipid bilayer of the liposome, attached to the liposome through a linking molecule that is associated with both the liposome and the oligonucleotide, enclosed in the liposome, or complexed with the liposome , dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, suspended in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Compositions associated with a lipid, lipid/DNA or lipid/expression vector are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or in a “compressed” structure. They may also simply be mixed into the solution, possibly forming aggregates of heterogeneous size or shape. Lipids are fatty substances that can be natural or synthetic lipids. For example, lipids include fat droplets that occur naturally in the cytoplasm, as well as a class of compounds containing long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

Suitable lipids can be obtained from commercial sources. For example, dimyristylphosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MA; Dicetyl phosphate (“DCP”) is available from K&K Laboratories (Plainview, NY); cholesterol (“Choi”) is available from Calbiochem-Behring; and dimyristylphosphatidylglycerol (“DMPG”) and other lipids can be obtained from Avanti Polar Lipids, Inc. (Birmingham, Alabama). Lipid stock solutions in chloroform or chloroform/methanol can be stored at approximately -20°C. Chloroform is used as the only solvent because it evaporates more easily than methanol.

Regardless of the method used to introduce exogenous nucleic acids into a host cell, various assays can be performed to confirm the presence of a recombinant DNA sequence in the host cell. Such assays include, for example, “molecular biology” assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR, and PCR; "biochemical" assays, such as detecting the presence or absence of a specific peptide, for example, by immunological methods (ELISA and Western blotting) or assays described herein, to identify agents within the scope of the invention.

In some embodiments, immune cells of the invention are modified by introducing RNA. In some embodiments, the in vitro transcribed CAR RNA can be introduced into a cell as a transient transfection. RNA is produced by in vitro transcription using a template generated by polymerase chain reaction (PCR). DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase. The source of DNA may be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence, or any other suitable DNA source. In some embodiments, the in vitro transcription template is a CAR of the present invention.

In some embodiments, the DNA used for PCR contains an open reading frame. The DNA may be, for example, a naturally occurring DNA sequence from the genome of an organism. In some embodiments, the DNA is a full-length gene or portion of a gene of interest. A gene may include some or all of the 5' and/or 3' untranslated regions (UTRs). A gene may include exons and introns. In some embodiments, the DNA that will be used for PCR is a human gene. In some embodiments, the DNA that will be used for PCR is a human gene, including 5' and 3' UTRs. Alternatively, the DNA may be an artificial DNA sequence that is not typically expressed in a natural organism. An exemplary artificial DNA sequence is a sequence that contains portions of genes that are ligated together to form an open reading frame encoding a fusion protein. The DNA fragments stitched together can come from a single organism or from multiple organisms.

PCR can be used to create a template for in vitro transcription of mRNA used for transfection. Methods for performing PCR are well known in the art. Primers for use in PCR are designed to have regions that are substantially complementary to regions of DNA that will be used as a template for PCR. “Substantially complementary” as used herein refers to nucleotide sequences in which most or all of the bases in the primer sequence are complementary, or one or more bases are not complementary or incompatible. As such, complementary sequences are capable of annealing or hybridizing to the intended target DNA under the annealing conditions used for PCR. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers may be designed to amplify the portion of a gene normally transcribed in cells (open reading frame), which may include the 5' and 3' UTRs. Primers can also be designed to amplify the portion of a gene that encodes a specific domain of interest. In some embodiments, the primers are designed to amplify the coding region of a human cDNA, including all or portions of the 5' and 3' UTRs. Primers useful for PCR are prepared by synthetic methods well known in the art.

"Forward primers" are primers that contain a region of nucleotides substantially complementary to nucleotides on the DNA template located upstream of the DNA sequence to be amplified. “Upstream” is used here to refer to the location 5' of the DNA sequence to be amplified relative to the coding strand. "Reverse primers" are primers containing a region of nucleotides substantially complementary to the double-stranded DNA template located downstream of the DNA sequence to be amplified. “Located below” is used in this application to indicate the position 3′ of the DNA sequence to be amplified relative to the coding strand.

Any DNA polymerase suitable for PCR can be used in the methods disclosed herein. The reagents and polymerase are commercially available from a number of sources.

Chemical structures capable of providing stability and/or translation efficiency can also be used. In some embodiments, the RNA may have 5' and 3' UTRs. In some embodiments, the 5' UTR is between zero and 3000 nucleotides in length. The length of the 5' and 3' UTR sequences added to the coding region can be changed in various ways, including, but not limited to, designing PCR primers that hybridize to different regions of the UTR. Using this approach, one skilled in the art can modify the 5' and 3' UTR lengths required to achieve optimal translation efficiency after transfection of the transcribed RNA. The 5' and 3' UTRs may be natural endogenous 5' and 3' UTRs for the gene of interest. Alternatively, UTR sequences that are not endogenous to the gene of interest can be added by including UTR sequences in the forward and reverse primers or through any other modifications to the template. The use of UTR sequences that are not endogenous to the gene of interest may be useful for altering the stability and/or translational efficiency of RNA. For example, it is known that AU-rich elements in 3' UTR sequences can reduce mRNA stability. Therefore, 3' UTRs can be selected or designed to enhance the stability of the transcribed RNA based on properties of the UTRs that are well known in the art.

In some embodiments, the 5'UTR may comprise a Kozak sequence of an endogenous gene. Alternatively, when a 5' UTR that is not endogenous to the gene of interest is added by PCR as described above, the Kozak consensus sequence can be modified by adding the 5' UTR sequence. Kozak sequences can improve the translational efficiency of some RNA transcripts, but do not appear to be required for all RNAs to ensure efficient translation. The requirement for Kozak sequences for many mRNAs is known in the art. In other embodiments, the 5' UTR may be derived from the RNA of a virus whose RNA genome is stable in cells. In other embodiments, various nucleotide analogues can be used in the 3' or 5' UTR to interfere with exonuclease degradation of the mRNA.

To enable the synthesis of RNA from a DNA template without the need for gene cloning, a transcription promoter must be attached to the DNA template before the transcribed sequence. When a sequence that functions as a promoter for RNA polymerase is added to the 5' end of the forward primer, the RNA polymerase promoter is included in the PCR product before the open reading frame that is to be transcribed. In some embodiments, the promoter is a T7 polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, the T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for the T7, T3 and SP6 promoters are known in the art.

In some embodiments, the mRNA has both a cap at the 5' end and a 3' poly(A) tail, which determine ribosome binding, translation initiation, and stability of the mRNA in the cell. On a circular DNA template, such as plasmid DNA, RNA polymerase produces a long concatemeric product that is not suitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the 3' UTR produces normal-sized mRNA that is not effective in eukaryotic transfection, even if it is polyadenylated after transcription.

On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13: 6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J Biochem., 270: 1485-65 (2003).

The usual way to integrate polyA/T regions into a DNA template is molecular cloning. However, polyA/T sequences integrated into plasmid DNA can cause plasmid instability, so plasmid DNA templates obtained from bacterial cells are often heavily contaminated with deletions and other aberrations. This makes cloning procedures not only labor-intensive and time-consuming, but also often unreliable. This is why a method that allows the construction of DNA templates with polyA/T 3' extension without cloning is urgently needed.

The polyA/T segment of the transcription DNA template may be generated by PCR using a reverse primer containing a poly(T) tail, such as a 100T tail (size may be 50-5000 T), or by PCR by any other method, including but not limited to: DNA ligation or in vitro recombination. Poly(A) tails also provide RNA stability and reduce degradation. In general, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In some embodiments, the poly(A) tail is from 100 to 5000 adenosines.

Poly(A) RNA tails can be further extended following in vitro transcription using a poly(A) polymerase such as E. coli poly-A polymerase (E-PAP). In some embodiments, increasing the length of the poly(A) tail from 100 nucleotides to 300-400 nucleotides results in an approximately twofold increase in RNA translation efficiency. In addition, the addition of various chemical groups to the 3' end can increase the stability of the mRNA. Such attachment may contain modified/artificial nucleotides, aptamers and other compounds. For example, ATP analogues can be incorporated into the poly(A) tail using poly(A) polymerase. ATP analogues can further enhance RNA stability.

5' caps on RNA can also provide stability to RNA molecules. In some embodiments, the RNAs produced by the methods described herein include a 5' cap. The 5' cap is prepared using techniques known in the art and described herein (Cougot et al., Trends in Biochem. Sci. 29: 436-444 (2001); Stepinski et al., RNA 7: 1468- 95 (2001); Elango, et al., Biochim. Biophys. Res. Commun. 330:958-966 (2005)).

RNAs produced by the methods described herein may also contain an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral, chromosomal, or man-made sequence that initiates cap-independent binding of the ribosome to the mRNA and facilitates translation initiation. Any solutes suitable for cell electroporation may be included, which may contain factors promoting cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants and surfactants.

RNA can be introduced into target cells using any of a number of different methods, for example, commercially available methods that include electroporation (eg, Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany), ECM 830 (BTX) (Harvard Instruments, Boston, MA), Gene Pulser II (BioRad, Denver, CO), or Multiporator (Eppendort, Hamburg, Germany), cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, or biolistic particle delivery systems such as "gene guns" (see, for example, Nishikawa et al. Hum Gene Ther. 12 (8): 861-70 (2001)); but are not limited to this.

In some embodiments, the CAR sequences described herein are delivered to immune cells of the invention using a retroviral or lentiviral vector. CAR-expressing retroviral and lentiviral vectors can be delivered into various types of eukaryotic cells, as well as tissues and whole organisms, using transduced cells as carriers, or cell-free local or systemic delivery of encapsulated, bound or deproteinized vectors. The method used may be for any purpose where stable expression is necessary or sufficient.

In some embodiments, CAR sequences are delivered to immune cells of the present invention using in vitro transcribed mRNA. In vitro transcribed CAR mRNAs can be delivered into various types of eukaryotic cells, as well as tissues and whole organisms, using transfected cells as carriers, or cell-free local or systemic delivery of encapsulated, bound, or deproteinized mRNA. The method used may be intended for any purpose where transient expression is necessary or sufficient.

In some embodiments, the desired CAR may be expressed in cells via transposons.

In some embodiments, the immune cell of the invention is, for example, a T cell. Before expansion and genetic modification of T cells (such as Treg cells) as described herein, the cells are obtained from a subject. T cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, tissue from the site of infection, ascitic fluid, pleural effusion, splenic tissue, and tumors. In some embodiments of the present invention, any number of T cell lines available in the art can be used. In some embodiments of the present invention, T cells can be obtained from a unit of blood collected from a subject using any number of methods known to one skilled in the art, such as Ficoll™ separation, PERCOLL™ gradient centrifugation after red blood cell lysis and depletion monocytes, flow elutriation centrifugation, leukapheresis and subsequent isolation based on cell surface markers using magnetic or flow cytometry. In some embodiments, cells are obtained from circulating human blood by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells, and platelets. In some embodiments, cells are obtained from the subject's circulating blood by leukapheresis.

In some embodiments, cells collected by leukapheresis may be washed to remove the plasma fraction and place the cells in an appropriate buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with phosphate-buffered saline (PBS). In some embodiments, the rinsing solution is free of calcium and magnesium, or may be free of many if not all divalent cations. After washing, the cells can be resuspended in any of a variety of biocompatible buffers, such as, for example, PBS without Ca ²⁺ , without Mg ²⁺ , PlasmaLyte A or other saline solutions with or without buffer. Alternatively, unwanted components of the leukapheresis sample can be removed and the cells directly resuspended in culture medium.

A specific subpopulation of T cells can be further isolated by positive or negative selection methods. For example, in some embodiments, T cells are isolated by incubating with anti-CD3/anti-CD28 conjugated beads (i.e., 3x28), such as DYNABEADS® M-450 CD3/CD28 T, for a period of time sufficient for positive selection of the required T cells. In some embodiments, the time period is approximately 30 minutes. In a further embodiment, the time period is from 30 minutes to 36 hours or more, and all integer values in between. In another embodiment, the time period is at least 1, 2, 3, 4, 5 or 6 hours. In some embodiments, the time period is from 10 to 24 hours. In some embodiments, the incubation period is 24 hours. Longer incubation times can be used to isolate T cells in any situation where T cells are scarce compared to other cell types. Thus, by simply shortening or lengthening the time that T cells are allowed to bind to anti-CD3/anti-CD28 beads, and/or by increasing or decreasing the ratio of beads to T cells (as described later herein), a subpopulation T cells may preferably be subjected to positive or negative selection at the initiation of culture or at other times during the process. In addition, by increasing or decreasing the ratio of anti-CD3 and/or anti-CD28 antibodies on beads or other surfaces, T cell subsets can be preferentially subjected to positive or negative selection at culture initiation or at other appropriate times. One skilled in the art will appreciate that multiple rounds of selection may also be used in the context of this invention.

In some embodiments, it may be necessary to perform a selection procedure and use "unselected" cells during the activation and propagation process. "Unselected" cells can also be subjected to further selection steps. Enrichment of the T cell population by negative selection can be achieved using a combination of antibodies directed to surface markers unique to the negatively selected cells. One method is cell sorting and/or selection by negative magnetic immunoadhesion or flow cytometry, which uses a cocktail of monoclonal antibodies directed to cell surface markers present on cells undergoing negative selection. For example, to enrich CD4+ cells by negative selection, the monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR, and CD8. In some embodiments, T regulatory cells are depleted with CD25-conjugated beads or other similar selection method.

To isolate the desired population of cells by positive or negative selection, the concentration of cells and surface (eg, particles such as beads) can be varied. In some embodiments, it may be necessary to significantly reduce the volume in which the beads and cells are mixed together (ie, increase the cell concentration) to ensure maximum contact of the cells and beads. For example, in some embodiments, a concentration of 2 billion cells/ml is used. In some embodiments, a concentration of 1 billion cells/ml is used. In a further embodiment, more than 100 million cells/ml is used. In a further embodiment, a cell concentration of 10, 15, 20, 25, 30, 35, 40, 45 or 50 million cells/ml is used. In some embodiments, a cell concentration of 75, 80, 85, 90, 95, or 100 million cells/ml is used. In additional embodiments, concentrations of 125 or 150 million cells/ml may be used. Use of high concentrations may result in increased cell yield, cell activation, and cell proliferation. In addition, the use of high cell concentrations allows for more efficient capture of cells that may weakly express target antigens of interest, such as CD28-negative T cells, or from samples where many tumor cells are present (eg, leukemic blood, tumor tissue, etc.) .P.). Such cell populations may have therapeutic value and may be necessary to obtain.

Stimulation T cells can also be frozen after the washing step. Without wishing to get too technical, the freezing and thawing step provides a more uniform product by removing granulocytes and to some extent monocytes from the cell population. After a washing step that removes plasma and platelets, the cells can be suspended in a freezing solution. Although many freezing solutions and parameters are known in the art and will be useful in this context, one method involves the use of PBS containing 20% DMSO and 8% human serum albumin, or culture media containing 10% dextran-40 and 5% dextrose. 20% human serum albumin and 7.5% DMSO or 31.25% Plasmalit-A, 31.25% dextrose 5%; 0.45% NaCl, 10% dextran-40 and 5% dextrose, 20% human serum albumin and 7.5% DMSO or other suitable cell freezing media containing, for example, Hespan and PlasmaLyte A; the cells are then frozen to -80°C at a rate of 1°C per minute and stored in a vapor phase storage tank with liquid nitrogen. Other controlled freezing methods can be used, as well as uncontrolled freezing directly at -20°C or in liquid nitrogen.

In some embodiments, cryopreserved cells are thawed and washed as described herein and left for one hour at room temperature before activation.

Also contemplated by the invention is the collection of blood samples or leukapheresis product from a subject at a time before expanded cells may be required, as described herein. In this way, the source of cells to be expanded can be collected at any time needed, and the required cells, such as T cells, isolated and frozen for later use in T cell therapy for any number of diseases or conditions that would benefit T cell therapy such as described herein. In some embodiments, the blood sample or leukapheresis product is collected from a substantially healthy subject. In some embodiments, a blood sample or leukapheresis product is collected from an apparently healthy subject who is at risk of developing the disease, but who has not yet developed the disease, and the cells of interest are isolated and frozen for later use. In some embodiments, the T cells may be expanded, frozen, and used at a later time.

Before or after genetic modification of Treg cells to express the desired CAR, T cells can be activated and expanded, typically using methods as described, for example, in US patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041; and US Patent Publication 2006/0121005, incorporated herein by reference.

Typically, T cells (eg, Treg cells) of the invention are propagated by contacting a surface to which is attached an agent, a stimulating signal associated with the CD3/TCR complex, and a ligand stimulating a costimulatory molecule on the cell surface. In particular, T cells (eg, Treg cells) can be stimulated as described herein, for example, by contact with an anti-CD3 antibody or antigen-binding fragment thereof or a surface-immobilized anti-CD2 antibody, or by contact with an activator protein kinase C (eg, bryostatin) in combination with a calcium ionophore. To co-stimulate an accessory molecule on the surface of T cells, a ligand is used that binds the accessory molecule. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody under conditions suitable to stimulate T cell proliferation. To stimulate the proliferation of CD4+ T cells, an anti-CD3 antibody and an anti-CD28 antibody can be used. Examples of anti-CD28 antibodies include, but are not limited to, 9.3, B-T3, XR-CD28 (Diaclone, Besançon, France). Other propagation methods generally known in the art may be used (Berg et al., Transplant Proc. 30 (8): 3975-3977 (1998); Haanen et al., J. Exp. Med. 190 (9): 1319-1328 (1999); Garland et al., J. Immunol Meth. 227 (1-2): 53-63 (1999)).

In some embodiments, the primary stimulatory signal and the costimulatory signal for T cells (eg, Tregs) of the present invention may be provided by different protocols. For example, the agents providing each signal may be in solution and/or bound to the surface. When bound to a surface, agents can be bound to the same surface (ie, in a "cis" formation) or to separate surfaces (ie, in a "trans" formation). Alternatively, one agent may be bound to the surface and the other agent may be in solution. In some embodiments, the agent providing the costimulatory signal is bound to the cell surface and the agent providing the primary activation signal is in solution or bound to the surface. In some embodiments, both agents may be in solution. In some embodiments, the agents may be in soluble form and then cross-linked to a surface, such as a cell expressing Fc receptors, or an antibody or other binding agent that will bind to the agents. In this regard, see, for example, US Patent Publications 2004/0101519 and 2006/0034810, incorporated herein by reference, for artificial antigen presenting cells (aAPCs) that are contemplated to be used to activate and expand T cells in the present invention.

In some embodiments, the two agents are immobilized on the beads, either on the same bead, that is, in "cis" form, or on separate beads, that is, in "trans" form. As an example, the agent providing the primary activation signal is an anti-CD3 antibody or an antigen binding fragment thereof, and the agent providing the costimulatory signal is an anti-CD28 antibody or an antigen binding fragment thereof; and both agents are co-immobilized on the same bead in equivalent molecular amounts. In some embodiments, a 1:1 ratio of each antibody bound to the beads is used for CD4+ T cell expansion and T cell growth. In some aspects of the present invention, a ratio of anti-CD3:anti-CD28 antibodies bound to the beads is used such that an increase in T cell growth is observed compared to the increase observed when using a 1:1 ratio. In some embodiments, an increase of about 1 to 3 times the increase observed at a 1:1 ratio is observed. In some embodiments, the ratio of anti-CD3:anti-CD28 antibodies bound to the beads is from 100:1 to 1:100, and all integers in between. In some embodiments, more anti-CD28 antibody is associated with the particles than anti-CD3 antibody, i.e. the CD3:CD28 ratio is less than one. In some embodiments, the ratio of anti-CD28 antibody to anti-CD3 antibody bound to the beads is greater than 2:1. In one particular embodiment, a ratio of CD3:CD28 antibodies bound to the beads is 1:100. In some embodiments, a bead-bound CD3:CD28 antibody ratio of 1:75 is used. Another embodiment uses a ratio of CD3:CD28 antibodies bound to the beads of 1:50. In some embodiments, a bead-bound CD3:CD28 antibody ratio of 1:30 is used. In some embodiments, a bead-bound CD3:CD28 antibody ratio of 1:10 is used. In some embodiments, a ratio of CD3:CD28 antibodies bound to the beads is 1:3. In some embodiments, a ratio of CD3:CD28 antibodies bound to the beads is 3:1.

Particle-to-cell ratios of 1:500 to 500:1 and any integer values in between can be used to stimulate T cells or other target cells. As will be readily appreciated by those skilled in the art, the particle to cell ratio may depend on the size of the particles relative to the target cell. For example, small granules may bind only a few cells, while larger granules may bind many cells. In some embodiments, T cells can be stimulated using a cell to particle ratio ranging from 1:100 to 100:1 and any integer values in between. In specific embodiments, the ratio is from 1:9 to 9:1 and any integers in between. The ratio of anti-CD3- and anti-CD28-bound particles to T cells, which leads to T cell stimulation, can vary as described above; however, some embodiments of the values include 1:100, 1:50, 1:40, 1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10: 1, and 15:1 with one particular particle ratio of at least 1:1 per T cell. In some embodiments, a particle to cell ratio of 1:1 or less is used. In some embodiments, the particle to cell ratio is 1:5. In additional embodiments, the particle to cell ratio may vary depending on the day of stimulation. For example, in some embodiments, the particle-to-cell ratio is from 1:1 to 10:1 on the first day, and additional particles are added to the cells every day or every other day thereafter for up to 10 days in final ratios of 1:1 to 1 :10 (based on cell count on day of addition). In one particular embodiment, the particle to cell ratio is 1:1 on the first day of stimulation, and is adjusted to 1:5 on the third and fifth days of stimulation. In some embodiments, particles are added daily or every other day to a final ratio of 1:1 on the first day and 1:5 on the third and fifth days of stimulation. In some embodiments, the particle to cell ratio is 2:1 on the first day of stimulation and is adjusted to 1:10 on the third and fifth days of stimulation. In some embodiments, particles are added daily or every other day to a final ratio of 1:1 on the first day and 1:10 on the third and fifth days of stimulation. One skilled in the art will appreciate that many other ratios may be suitable for use in the present invention. In particular, the ratios will vary depending on the particle size and the size and type of cells.

In further embodiments of the present invention, immune cells are combined with agent-coated beads, the beads and cells are then separated, and then the cells are cultured. In alternative embodiments, the agent-coated beads and cells are not separated but cultured together prior to culturing. In some embodiments, the beads and cells are first concentrated by applying a force, such as a magnetic force, resulting in increased ligation of cell surface markers, thereby causing stimulation of the cells.

As an example, cell surface proteins can be ligated, allowing paramagnetic beads to which anti-CD3 and anti-CD28 antibodies are attached (3x28 beads) to bind to Treg cells of the invention. In some embodiments, cells (e.g., 10 ⁴ to 10 ⁹ T cells) and beads (e.g., DYNABEADS® M-450 CD3/CD28 T paramagnetic beads in a 1:1 ratio) are combined in a buffer such as PBS (e.g., free of divalent cations such as calcium and magnesium). Again, those skilled in the art will readily understand that any concentration of cells can be used depending on the circumstances. For example, the target cell may be very rare in the sample and constitute only 0.01% of the sample, or the entire sample (i.e., 100%) may include the target cell of interest. Accordingly, any number of cells is within the scope of the present invention. In some embodiments, it may be necessary to significantly reduce the volume in which particles and cells are mixed together (ie, increase cell concentration) to ensure maximum cell-particle contact. For example, in one embodiment, a concentration of approximately 2 billion cells/ml is used. In another embodiment, more than 100 million cells/ml is used. In a further embodiment, a cell concentration of 10, 15, 20, 25, 30, 35, 40, 45 or 50 million cells/ml is used. In yet another embodiment, a cell concentration of 75, 80, 85, 90, 95 or 100 million cells/ml is used. In additional embodiments, concentrations of 125 or 150 million cells/ml may be used. Use of high concentrations may result in increased cell yield, cell activation, and/or cell proliferation. In addition, the use of high cell concentrations allows for more efficient capture of cells that may poorly express target antigens of interest, such as CD28-negative T cells. Such cell populations may have therapeutic value and may be required to be produced in certain embodiments.

In some embodiments of the present invention, the mixture can be cultured for anywhere from a few hours (eg, about 3 hours) to about 14 days, or any integer hours in between. In some embodiments, the mixture can be cultured for 21 days. In some embodiments, the beads and T cells are cultured together for about eight days. In some embodiments, the beads and T cells are cultured together for 2-3 days. Multiple cycles of stimulation may also be necessary, so that T cell culture times may be 60 days or more. Conditions suitable for culture of T cells include a suitable medium (eg, minimal essential medium or RPMI medium 1640 or, X-vivo 15, (Lonza)), which may contain factors necessary for proliferation and viability, including serum (eg, fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGFβ and TNF- α or any other cell growth additives known to one skilled in the art. Other cell growth additives include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetylcysteine and 2-mercaptoethanol. The media may include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15 and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate and vitamins, or without serum. or with the addition of an appropriate amount of serum (or plasma), or a specific set of hormones, and/or an amount of cytokine(s) sufficient for the growth and proliferation of T cells. Antibiotics, such as penicillin and streptomycin, are included only in the experimental cultures and not in the cell cultures that are to be administered to the subject. The target cells are maintained under conditions necessary to support growth, for example, at an appropriate temperature (eg, 37°C) and atmosphere (eg, air plus 5% CO ₂ ).

T cells that have been stimulated for different times may exhibit different characteristics. For example, typical blood or peripheral blood mononuclear cell products contain a population of helper T cells (Th, CD4+) that is larger than a population of cytotoxic or suppressor T cells (Tc, CD8+). Ex vivo expansion of T cells through stimulation of CD3 and CD28 receptors produces a T cell population that, until about 8–9 days, consists predominantly of Th cells, and after about 8–9 days, the T cell population includes an increasingly larger population of T cells. cells. Depending on the purpose of treatment, in some embodiments it may be preferable to administer to the subject a population of T cells comprising predominantly Th cells. In some embodiments, if an antigen-specific subset of Tc cells has been isolated, it may be useful to expand that subset to a greater extent.

In addition, in addition to the CD4 and CD8 markers, other phenotypic markers vary significantly but are largely reproducible during the cell proliferation process. This reproducibility makes it possible to tailor the activated T cell product for specific purposes.

In some embodiments, T cells can be cultured in the presence of rapamycin to produce regulatory T cells, as described, for example, in PCT patent publication WO 2007/110785 (incorporated herein by reference). Another method for generating regulatory T cells is described in US Patent Publication 2016/024470 (incorporated herein by reference), where T cells are cultured with a T cell receptor (TCR)/CD3 activator, such as, for example, anti-TCR antibodies /CD3, TCR costimulator activator such as, for example, CD28, CD137 (4-1BB), GITR, B7-1/2, CD5, ICOS, OX40, anti-CD40 or CD137 antibodies, and rapamycin.

In some embodiments, T cells genetically modified by expressing a CAR as described herein may also be genetically modified by expressing at least one intracellular factor, such as ROR-C, FoxP3, Foxo1, T-bet, or Gata 3, c-Maf or AhR. In some embodiments, the genetically modified immune cell of the invention expresses FoxP3. In some embodiments, the genetically modified immune cell of the invention expresses Foxo1.

In some embodiments, the genetically modified immune cell of the invention may be an allogeneic immune cell. In such cases, the cell can be engineered to reduce the cell's rejection by the host (graft rejection) and/or the cell's potential attack on the host (graft-versus-host disease). As an example, a cell may be engineered to have a null genotype for one or more of the following: (i) T cell receptor (TCR alpha chain or beta chain); (ii) a major histocompatibility complex (MHC) class I or II polymorphic molecule (e.g., HLA-A, HLA-B, or HLA-C; HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, or HLA-DR; or β2-microglobulin (B2M)); (iii) a transporter associated with antigen processing (eg, TAP-1 or TAP-2); (iv) MHC class II transactivator (CIITA); (v) minor histocompatibility antigen (MiHA; e.g., HA-1/A2, HA-2, HA-3, HA-8, HB-1H, or HB-1Y); and (vi) any combination thereof. Allogeneic engineered cells can also express invariant HLA or CD47 to protect the engineered Treg cells from host rejection. These additional genetic modifications can be performed by gene editing techniques known in the art and described herein.

Further edited allogeneic cells are particularly useful because they can be used in multiple patients without compatibility issues. Thus, allogeneic cells can be called "universal" and can be used without modification. The use of “universal” cells significantly increases the effectiveness and reduces the cost of adoptive cell therapy.

In some embodiments, an allogeneic immune cell can be engineered so that it does not express any functional TCR on its surface, is engineered so that it does not express one or more subunits that make up a functional TCR, or is engineered so that it produces very little functional TCR on its surface. For example, the immune cell described herein can be engineered such that the expression of TCR molecules on the cell surface is suppressed. Alternatively, the T cell may express a substantially disrupted TCR, for example, by expressing mutant or truncated forms of one or more TCR subunits. The term "substantially disrupted TCR" means that the TCR will not cause an adverse immune response in the host.

In some embodiments, allogeneic immune cells can be engineered so that they do not express functional HLA on their surface. For example, an immune cell described herein can be engineered such that cell surface expression of HLA, eg, HLA class 1 and/or HLA class II, and/or non-classical HLA molecules, is suppressed.

In some embodiments, the T cell may lack a functional TCR and functional HLA, such as HLA class I and/or HLA class II.

Modified immune cells that lack expression of a functional TCR and/or HLA can be generated by any suitable means, including knockout or knockdown of one or more TCR and/or HLA subunits. For example, a Treg cell may involve TCR and/or HLA knockdown using siRNA, shRNA, clustered regularly interspaced short palindromic repeats (CRISPR), transcription activator-like effector nuclease (TALEN), zinc finger endonuclease (ZFN), meganuclease (mn, also known as homing endonuclease) or megaTAL (combinations of a TAL effector with an mn cleavage domain).

In some embodiments, a nucleic acid encoding a CAR, as described herein, is inserted into a specific locus of the immune cell's genome, such as, for example, a gene locus that is to be deleted. In some embodiments, a nucleic acid encoding a CAR as described herein is inserted into the TCR and/or HLA locus, thereby resulting in inhibition of TCR and/or HLA expression.

In some embodiments, TCR and/or HLA expression can be inhibited using siRNA or shRNA that targets the nucleic acid encoding the TCR and/or HLA in the T cell. Expression of siRNAs and shRNAs in T cells can be achieved using any conventional expression system, such as the lentiviral expression system. Examples of siRNAs and shRNAs that suppress the expression of HLA class I and/or HLA class II genes are described, for example, in US Patent Publication 2007/0036773. Exemplary shRNAs that suppress the expression of TCR components are described, for example, in US Patent Publication 2012/0321667.

"CRISPR" or "TCR and/or HLA CRISPR" or "TCR and/or HLA inhibition CRISPR" as used herein refers to a set of clustered, regularly interspaced short palindromic repeats, or a system containing such a set of repeats. "Cas" as used herein refers to a CRISPR associated protein. The "CRISPR/Cas" system refers to a system derived from CRISPR and Cas that can be used to silence or mutate the TCR and/or HLA gene.

Naturally occurring CRISPR/Cas systems are found in approximately 40% of sequenced eubacterial genomes and 90% of sequenced archaea. See, for example, Grissa et al. (BMC Bioinformatics 8: 172 (2007)). This system is a type of prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. See, for example, Barrangou et al., Science 315:1709-1712 (2007); Marragini et al., Science 322:1843-1845 (2008). The CRISPR/Cas system has been modified for use in gene editing (silencing, enhancing, or changing specific genes) in eukaryotes such as mice or primates. See, for example, Wiedenheft et al., Nature 482: 331-8 (2012). This is achieved by introducing into a eukaryotic cell a plasmid containing a specially designed CRISPR and one or more suitable Cas coding sequences. A CRISPR sequence, sometimes called a CRISPR locus, consists of alternating repeats and spacers. In natural CRISPR, spacers typically contain sequences foreign to the bacterium, such as a plasmid or phage sequence; in the TCR and/or HLA CRISPR/Cas system, spacers are derived from the TCR and/or HLA gene sequence. RNA from the CRISPR locus is constitutively expressed and processed by Cas proteins into small RNAs. They contain a spacer flanked by a repeating sequence. RNAs direct other Cas proteins to silence exogenous genetic elements at the RNA or DNA level. See, for example, Horvath et al., Science 327:167-170 (2010); Makarova et al., Biology Direct 1:7 (2006). Thus, spacers serve as templates for RNA molecules, just like siRNA. See, for example, Pennisi, Science 341: 833-836 (2013). Thus, the CRISPR/Cas system can be used to edit the TCR and/or HLA gene (adding or deleting a base pair) or introduce a premature stop that reduces TCR and/or HLA expression. The CRISPR/Cas system can alternatively or additionally be used as RNA interference, disabling the TCR and/or HLA gene in a reversible manner. In a mammalian cell, for example, RNA can direct the Cas protein to the TCR and/or HLA promoter, sterically blocking RNA polymerases.

It is possible to create artificial CRISPR/Cas systems that inhibit TCR and/or HLA using technology known in the art, for example, described in US patent publication 2014/0068797 and Cong, Science 339: 819-823 (2013). Other artificial CRISPR/Cas systems known in the art can also be designed to inhibit TCR and/or HLA, such as those described in Tsai, Nature Biotechnol. 32: 6569-576 (2014) and US Patents 8,871,445; 8,865,406; 8,795,965; 8,771,945; and 8,697,359.

It is understood that the above procedures can also be performed by CRISPR systems that use endonucleases other than Cas, such as Cpf1 and C2c1/2/3.

"TALEN" or "TCR and/or HLA TALEN" or "TCR and/or HLA Inhibition TALEN" refers to a transcription activator-like effector nuclease, an artificial nuclease that can be used to edit the TCR and/or HLA gene . TALEN is produced artificially by fusing the effector DNA binding domain of TAL with the DNA cleavage domain. Transcription activator-like effectors (TALEs) can be designed to bind any desired DNA sequence, including part of the TCR and/or HLA gene. By combining an engineered TALE with a DNA cleavage domain, it is possible to obtain a restriction enzyme that is specific for any desired DNA sequence, including the TCR and/or HLA sequence. They can then be introduced into a cell, where they can be used to edit the genome. See, for example, Boch, Nature Biotech. 29: 135-6 (2011); Boch et al., Science 326: 1509-12 (2009); and Moscou et al., Science 326: 3501 (2009).

TALEs are proteins secreted by Xanthomonas bacteria. The DNA binding domain contains a 33-34 amino acid repeat sequence that is highly conserved except for the 12th and 13th amino acids. These two positions vary greatly, showing a strong correlation with the recognition of specific nucleotides. Thus, they can be designed to bind to the desired DNA sequence. To produce TALEN, the TALE protein is hybridized with a nuclease (N), which is a wild-type or mutant Fokl endonuclease. Several mutations of Fokl have been made for use in TALEN; they, for example, improve the specificity or activity of cleavage. See, for example, Cermak et al., Nucl. Acids Res. 39:e82 (2011); Miller et al., Nature Biotech. 29:143-8 (2011); Hockemeyer et al., Nature Biotech. 29:731-734 (2011); Wood et al., Science 333:307 (2011); Doyon et al., Nature Methods 8:74-79 (2010); Szczepek et al., Nature Biotech. 25:786-793 (2007); and Guo et al., J. Mol. Biol. 200:96 (2010). The Fokl domain functions as a dimer, requiring two constructs with unique DNA-binding domains for sites in the target genome with the correct orientation and spacing. Both the number of amino acid residues between the TALE DNA binding domain and the Fokl cleavage domain and the number of bases between two distinct TALEN binding sites appear to be important parameters for achieving high levels of activity (Miller et al., Nature Biotech. 29: 143 -8 (2011)). TCR and/or HLA TALEN can be used inside the cell to create a double-strand break (DSB). A mutation can be introduced at a break site if repair mechanisms do not properly repair the break through nonhomologous end joining. For example, improper repair can lead to a frameshift mutation. Alternatively, foreign DNA may be introduced into the cell along with TALEN; depending on the foreign DNA sequences and chromosomal sequence, this process can be used to correct a defect in the TCR and/or HLA gene or to introduce such a defect into the wild-type HLA gene, thereby reducing TCR and/or HLA expression. TALENs specific for sequences in the TCR and/or HLA can be constructed using any method known in the art, including various designs using modular components (Zhang et al., Nature Biotech.29: 149-53 (2011) ; Geibler et al., PLoS ONE 6: el9509 (2011)).

"ZFN" or "zinc finger nuclease" or "ZFN for TCR and/or HLA" or "ZFN for TCR and/or HLA inhibition" refers to zinc finger nuclease, an artificial nuclease that can be used to edit the TCR gene and /or HLA. Like TALEN, ZFN contains a Fokl nuclease domain (or its derivative) fused to a DNA-binding domain. In the case of ZFN, the DNA binding domain contains one or more zinc fingers. See, for example, Carroll et al., Genetics Society of America 188: 773-782 (2011); and Kim et al., Proc. Natl. Academician Sci. USA 93: 1156-1160 (1996). A zinc finger is a small structural motif of a protein stabilized by one or more zinc ions. The zinc finger may contain, for example, Cys ₂ His ₂ and can recognize a sequence of approximately 3 bp in length. Various zinc fingers of known specificity can be combined to produce multi-finger polypeptides that recognize sequences of approximately 6, 9, 12, 15, or 18 base pairs. Various selection and modular assembly methods are available to create zinc fingers (and combinations thereof) that recognize specific sequences, including phage display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells.

Like TALEN, ZFN must dimerize to cleave DNA. Thus, the ZFN pair is required for targeting non-palindromic DNA regions. Two separate ZFNs must bind to opposite DNA strands with their nucleases properly separated from each other (Bitinaite et al., Proc. Natl. Acad. Sci. USA 95: 10570-5 (1998)). Also like TALEN, ZFN can create a double-strand break in DNA, which can create a frameshift mutation upon misrepair, resulting in decreased TCR and/or HLA expression and abundance in the cell. ZFN can also be used with homologous recombination to mutate the TCR and/or HLA gene. ZFNs specific for sequences in the TCR and/or HLA can be designed using any method known in the art. See, for example, Provasi, Nature Med. 18: 807-815 (2011); Torikai, Blood 122: 1341-1349 (2013); Cathomen et al., Mol. Ther. 16: 1200-7 (2008); Quo et al., J. Mol. Biol. 400:96 (2010); and US Patent Publications 2011/0158957 and 2012/0060230.

"Meganuclease" or "TCR and/or HLA meganuclease" or "TCR and/or HLA inhibition meganuclease" refers to a monomeric endonuclease with large (>14 bp) recognition sites that can be used to edit the TCR and/or HLA gene . Meganucleases (mn) are monomeric proteins with intrinsic nuclease activity that are derived from bacterial homing endonucleases and engineered to a unique target site. Homing endonucleases are DNA cleaving enzymes that can generate double-strand breaks at discrete loci in host genomes and thereby drive site-specific gene conversion events (Stoddard, Structure 19 (1): 7-15 (2011)). Despite their small size, homing endonucleases recognize long DNA sequences (usually 20 to 30 base pairs). Homing endonucleases are extremely widespread and are found in microbes, as well as phages and viruses. LAGLIDADG and His-Cys box enzymes (which are the most sequence-specific of these enzymes) are located on antiparallel β-sheets that attach to the major grooves of their DNA target sites (Flick et al., Nature 394 (6688): 96-101 (1998); Jurica et al., Mol. Cell. 2 (4): 469-76 (1998) There they establish a set of sequence-specific and non-specific contacts that are unevenly distributed between several successive base pairs (Chevalier et al., J Mol Biol 329 (2): 253-269 (2003); Scalley-Kim et al., J Mol Biol. 372 (5): 1305-19 (2007).

The LAGLIDADG (LHE) family of homing endonucleases is a major source of engineered enzymes used for gene targeting. The LHE family is primarily encoded in archaea and in the chloroplast and mitochondrial genomes of algae and fungi (Chevalier et al., Homing Endonucases and Inteins. Nucleic Acids and Molecular Biology, vol. 16 (2005); Dalgaard et al., Nucleic Acids Res.25 (22): 4626-38 (1997);Sethuraman et al., Mol Biol Evol. 26(10): 2299-315 (2009) Meganucleases containing a single conserved LAGLIDADG motif (SEQ ID NO: 58) on protein chain, form homodimeric proteins that cleave palindromic and near-palindromic DNA target sequences, whereas those containing two such motifs per protein chain form larger pseudosymmetric monomers that can target completely asymmetric DNA sequences.

Meganucleases can be engineered to target TCRs and/or HLAs and thereby create a double-strand break in DNA that can cause a frameshift mutation upon misrepair, resulting in decreased expression and quantity of TCRs and/or HLAs in the cell .

"MegaTAL" or "megaTAL for TCR and/or HLA" or "megaTAL for TCR and/or HLA inhibition" refers to an artificial nuclease that can be used to edit the TCR and/or HLA gene. MegaTALs are hybrid monomeric nucleases produced by fusing the minimal effector domains of TAL (transcription activator-like) with the N-terminus of meganucleases derived from the LAGLIDADG family of homing endonucleases (Boissel et al., Nucleic Ac ids Res. 42 (4): 2591- 601 (2014); Takeuchi et al., Methods Mol Biol. 1239: 105-32 (2015)). Thus, MegaTALs consist of a site-specific meganuclease cleavage head with additional affinity and specificity provided by a TAL effector DNA-binding domain.

MegaTALs can be engineered to target the TCR and/or HLA and thus form a double-strand break in the DNA, which can create a frameshift mutation upon misrepair, resulting in decreased TCR and/or HLA expression and abundance in cage. The meganuclease I-OnuI (mn) variant was used to generate TCRα-megaTAL to knock out the T cell receptor alpha (TCRα) gene. TCRα mn was hybridized to a 10.5-repeat TALE array designed to bind the DNA sequence upstream of the TCRα mn binding site. megaTAL targeting TCRα was found to produce extremely high gene disruption without detectable off-target cleavage in primary human T cells (Boissel et al, Nucleic Acids Res 42 (4): 2591-601 (2014)).

In some embodiments, the T cell population expressing the CAR of the present invention is a population that lacks an endogenous T cell receptor (TCR) or has been altered to reduce or eliminate the expression or activity of an endogenous TCR. It is understood that any of the methods described herein for inhibiting or eliminating HLA expression can also be used to target one or more components of the endogenous TCR.

In some embodiments, transfection with a telomerase gene can lengthen T cell telomeres and improve T cell persistence in a patient. See, for example, June, Journal of Clinical Investigation 117: 1466–1476 (2007). Thus, in some embodiments, a genetically modified Treg cell of the present invention ectopically expresses a telomerase subunit, e.g., a telomerase catalytic subunit, e.g., TERT, e.g., hTERT. In some aspects, the present invention provides a method of producing a cell of the invention expressing a chimeric receptor, comprising contacting the cell with a nucleic acid encoding a telomerase subunit, for example, a telomerase catalytic subunit, for example, TERT, for example, hTERT. The cell may be contacted with the nucleic acid before, simultaneously with, or after contact with a construct encoding a chimeric receptor (eg, a CAR, as described herein).

The present invention also provides a method for producing an immune cell of the present invention, comprising transducing at least one immune cell with a nucleic acid encoding a CAR as described herein, and optionally propagating the transduced cells. In some embodiments, the method is an ex vivo method.

In some embodiments, a method for producing immune cells of the invention includes:

- the stage of isolation/enrichment of immune cells from the PBMC population (for example, extracted using leukapheresis);

- if necessary, the activation stage;

- the step of transduction with a vector containing a nucleic acid sequence encoding a CAR, as described in this application;

- if necessary, the reproduction stage;

- if necessary, the washing stage; And

- if necessary, the freezing stage.

In some embodiments, engineered Treg cells of the present invention can be cultured in tissue culture medium containing rapamycin and/or a high concentration of IL-2 to maintain the Treg phenotype and/or to increase FoxP3 and transgene expression.

Compositions

Another object of the invention is a composition containing, consisting of or consisting essentially of at least one immune cell or population of immune cells according to the invention, as described in this application. In some embodiments, said immune cell or population of immune cells of the invention is selected from the group consisting of T cells, natural killer (NK) cells, γδ T cells, double negative (DN) cells, regulatory immune cells, regulatory T cells, effector immune cells, effector T cells, B cells and myeloid-derived cells, and any combination thereof.

As used herein, the term “consisting essentially of” in relation to a pharmaceutical composition or drug means that at least one immune cell or population of cells of the invention is the only therapeutic agent or agent with biological activity within the specified pharmaceutical composition or drug.

In some embodiments, said composition comprises, consists of, or consists essentially of at least one isolated and/or substantially purified population of immune cells of the invention, as described herein.

In some embodiments, said composition comprises, consists of, or consists essentially of at least one population of immune cells of the present invention, as described herein, engineered to express on the cell surface a CAR described herein (e.g., a CAR comprising: at least one extracellular binding domain, optionally at least one extracellular hinge domain, at least one transmembrane domain and at least one intracellular domain, wherein the at least one intracellular domain contains at least one primary intracellular signaling domain and optionally at least one at least one costimulatory intracellular signaling domain), wherein the at least one transmembrane domain is a human TNFR2 transmembrane domain or fragment or variant thereof, or any transmembrane domain or fragment or variant thereof, or a combination thereof, and/or at least one costimulatory intracellular signaling domain the signaling domain is a human TNFR2 costimulatory intracellular signaling domain or fragment or variant thereof, or any costimulatory intracellular signaling domain or fragment or variant thereof, or a combination thereof, wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a fragment or variant thereof, or the costimulatory intracellular signaling domain of TNFR2 or a fragment or variant thereof.

In some embodiments, the composition has been frozen and thawed.

Another object of the invention is a pharmaceutical composition containing, consisting of or consisting essentially of at least one immune cell or population, as described in this application, and at least one pharmaceutically acceptable excipient.

Another object of the invention is to provide a medicinal product containing, consisting of, or consisting essentially of at least one population of immune cells as described herein.

In some embodiments, the pharmaceutical composition or drug contains at least one isolated and/or substantially purified population of immune cells according to the invention, as described herein.

In some embodiments, the pharmaceutical composition or drug includes a combination of immune cell populations as described herein (ie, at least two separate immune cell populations of the invention).

In some embodiments, the composition, pharmaceutical composition or drug of the invention further comprises at least a second, distinct population of immune cells, wherein cells of said second population of immune cells express on the cell surface a second, distinct CAR specific for an antigen, a fragment of an antigen, a variant of an antigen or mixtures thereof. In some embodiments, the second CAR is specific for a food antigen from a person's normal diet. In some embodiments, the second CAR is specific for a self-antigen, such as, for example, multiple sclerosis-associated antigen, joint-associated antigen, eye-associated antigen, human HSP antigen, skin-associated antigen, or antigen involved in transplant rejection or GVHD. In some embodiments, the second CAR is specific for an inhalant allergen, an ingestible allergen, or a contact allergen. In some embodiments, the second CAR is specific for an antigen selected from the group consisting of ovalbumin, MOG, type II collagen, citrullinated vimentin, citrullinated type II collagen, citrullinated fibrinogen, and fragments, variants and mixtures thereof.

In some embodiments, the second CAR is specific for ovalbumin or a fragment, variant, or mixture thereof. In some embodiments, the second CAR is specific for MOG or a fragment, variant, or mixture thereof. In some embodiments, the second CAR is specific for type II collagen or a fragment, variant, or mixture thereof. In some embodiments, the second CAR is specific for citrullinated vimentin, citrullinated type II collagen, or citrullinated fibrinogen, or fragments, variants, and mixtures thereof. In some embodiments, the second CAR is specific for HLA-A2 or a fragment, variant, or mixture thereof. In some embodiments, the second CAR is specific for IL-23R or a fragment, variant, or mixture thereof. In some embodiments, the second CAR is specific for a B cell surface marker, such as, for example, CD19, CD20, or fragments, variants, and mixtures thereof. In some embodiments, the second CAR is specific for a cancer antigen, as described herein, or a fragment, variant, or mixture thereof.

In some embodiments, the second CAR recognizes infected cells. In some embodiments, the second CAR is specific for a viral antigen or a fragment, variant, or mixture thereof; a bacterial antigen or a fragment, variant or mixture thereof; or a fungal antigen, or a fragment, variant or mixture thereof.

In some embodiments, cells from said second population of immune cells express a CAR on the cell surface, wherein the extracellular binding domain of said CAR is a protein or a fragment or variant thereof, such as, for example, a self-antigen or a fragment or variant thereof.

In some embodiments, cells from said other immune cell population express on the cell surface a CAR specific for an autoantibody, such as, for example, an autoantibody expressed on a B cell.

The compositions and drugs described herein may include, for example, buffers such as sterilized water, saline, neutral buffer, phosphate buffer, and the like; salt; antibiotics; isotonic agents; carbohydrates such as glucose, mannose, sucrose, dextrans and mannitol; proteins such as human serum albumin; polypeptides; amino acids such as glycine and arginine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (eg aluminum hydroxide); and preservatives. The compositions and medicaments may further contain factors that support Treg phenotype and growth (eg, IL-2 and rapamycin or derivatives thereof), anti-inflammatory cytokines (eg, IL-10, TGF-β, and IL-35), and other cells to cell therapy (for example, CAR T effector cells for cancer treatment or cells for regenerative therapy). For storage and transportation, cells can be cryopreserved if necessary. Before use, the cells can be thawed and reconstituted in a pharmaceutically acceptable vehicle.

The compositions of the present invention, in some embodiments, are formulated for intravenous administration.

In some embodiments, cells expressing a CAR of the present invention exhibit reduced tonic signaling compared to cells expressing a CAR without the TNFR2 transmembrane domain or fragment or variant thereof and/or without the intracellular costimulatory signaling domain of TNFR2 or fragment or variant thereof.

The term "tonic signaling" as used herein refers to an antigen-independent background activation.

Methods for measuring tonic signaling are well known to one skilled in the art and include measuring the metabolic activity of CAR-expressing cells; measuring one or more indicators of cell activation in the absence of stimulation by an antigen recognized by the receptor; measuring one or more phenotypic changes associated with cell maturation or cell aging; determination of cell cycle progression in the absence of antigenic stimulation; and measuring the size of cells expressing the receptor compared to the size of unmodified cells; but are not limited to this.

In some embodiments, CAR-engineered immune cells expressing the TNFR2 transmembrane domain or fragment or variant thereof and/or the TNFR2 intracellular costimulatory signaling domain or fragment or variant thereof have reduced tonic signaling compared to CAR-engineered immune cells. that do not express the TNFR2 transmembrane domain or fragment or variant thereof and/or the TNFR2 intracellular costimulatory domain or fragment or variant thereof when measured under TEST A conditions.

TEST A:

An indicator of T cell activation is used to measure tonic signaling. In the conditions of TEST A, the level of CD69-positive cells is measured in a population of cells before and after activation of the CAR of the invention. Activation analysis is carried out on day 9 of immune cell culture. Briefly, 0.05 x 10 ⁶ immune cells were seeded into a 96-well round bottom plate alone or in the presence of anti-CD28/anti-CD3 coated beads (at a 1:1 ratio of immune cells to beads) or in the presence of freshly thawed autologous B-cells. cells (1:1 ratio of immune cells to B cells) in a final volume of 200 μl. After 24 hours at 37°C, 5% CO _{2 ,} cells are stained for CD69 and a marker related to a specific immune cell population (eg, CD19 for B cells, or CD4 or CD8 for T cells) and then analyzed by flow cytometry. Monitoring spontaneous expression of CD69 (i.e., without any antigenic simulation) by cells expressing a CAR described herein (e.g., containing a TNFR2 transmembrane domain or fragment or variant thereof, and/or an intracellular costimulatory signaling domain of TNFR2, or a fragment or variant thereof ), compared with non-transduced cells, allows one to determine the intensity of tonic signaling. Cells transduced with CAR lacking the TNFR2 transmembrane domain or the TNFR2 intracellular costimulatory signaling domain were used as controls.

In some embodiments, the CAR constructs of the present invention can be used to produce engineered immune cells with reduced tonic signaling. In some embodiments, the present invention provides a method for producing an engineered immune cell (ie, a cell expressing a CAR) with reduced tonic signaling. Currently available CAR constructs, especially those used in the CAR effector field, are often associated with high tonic signaling, limiting the effectiveness of engineered CAR cells. Indeed, such tonic signaling is associated with constitutive activation of CAR-engineered cells, leading to their premature exhaustion or even death. The CAR constructs of the present invention (comprising the TNFR2 transmembrane domain or fragment or variant thereof, and/or the TNFR2 costimulatory intracellular signaling domain or fragment or variant thereof) provide reduced tonic signaling and constitutive cell activation.

Therapeutic Use

The invention relates to a method of treating one or more diseases, disorders, symptoms or conditions in a subject in need thereof, wherein the method comprises administering to the subject a CAR engineered immune cell or composition as described herein. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use as a drug. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in the preparation of a drug. Diseases that can be treated with the engineered immune cells of the present invention include, but are not limited to, inflammatory diseases, autoimmune diseases, allergic diseases, organ transplant conditions, cancer and infectious diseases.

In some embodiments, a method of treating a disease or disorder in a subject in need thereof comprises administering to the subject at least one population of immune cells as described herein, for example, an engineered population of regulatory immune cells (such as a population of Treg cells), wherein said disease or disorder is an inflammatory disease, an autoimmune disease, an allergic disease, or a post-organ transplant condition. In some embodiments, the disease or disorder is graft rejection or graft-versus-host disease.

In some embodiments, a method of treating a disease or disorder in a subject in need thereof comprises administering to the subject at least one population of immune cells as described herein, for example, an engineered population of effector immune cells (such as a population of Treg cells), wherein said disease or disorder is cancer or an infectious disease.

In some embodiments, a method of treating a disease or disorder in a subject in need thereof comprises administering to the subject at least one population of immune cells as described herein, for example, an engineered population of effector immune cells (such as a population of Treg cells), wherein wherein said subject is in need of gene therapy (eg, AAV-based gene therapy) for said disease or disorder.

In some embodiments, the method is a cell therapy method.

In some embodiments, the cell therapy is autologous.

In some embodiments, the cell therapy is heterologous.

In some embodiments, the cell therapy is allogeneic.

In some embodiments, the method is a gene therapy method and includes administering a nucleic acid or vector as described herein.

1. Inflammatory diseases.

In some embodiments, the CAR engineered immune cells of the invention can be used to treat one or more inflammatory diseases, disorders, symptoms or conditions in a subject in need thereof. In certain embodiments, the CAR-generated immune cells of the present invention can be used to promote immune tolerance in this context. The present invention provides a method of treating an inflammatory disease or disorder in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one population of immune cells as described herein. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in treating an inflammatory disease or disorder. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in the preparation of a medicament for treating an inflammatory disease or disorder.

The terms "inflammatory disorder" and "inflammatory disease" are used interchangeably and as used herein refer to any abnormality associated with inflammation.

In some embodiments, the inflammatory condition includes inflammatory diseases and inflammation associated with infection or cancer.

In some embodiments, the inflammatory condition includes inflammatory diseases and inflammation associated with autoimmune diseases.

Examples of inflammatory diseases, disorders or conditions include arthritis, rheumatoid arthritis, ankylosing spondylitis, osteoarthritis, psoriatic arthritis, juvenile idiopathic arthritis, juvenile rheumatoid arthritis, urate arthritis, gout, chronic polyarthritis, glenohumeral periarthritis, cervical arthritis, lumbosacral arthritis, enteropathic arthritis and ankylosing spondylitis, asthma, dermatitis, psoriasis, scleroderma, polymyositis, dermatomyositis, juvenile dermatomyositis, primary biliary cirrhosis, fibrosis, cystic fibrosis, pulmonary fibrosis, cirrhosis, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, nephrogen fibrosis, keloids, scleroderma, arthrofibrosis, late and chronic solid organ rejection after transplantation, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, pemphigus, pemphigus vulgaris, pemphigus herpetiformis, pemphigus vegetans, IgA-dependent pemphigus, erythrematous pemphigus, bullous pemphigoid, gestational pemphigoid, dermatitis matosis of the mucous membranes, nodular pemphigoid, linear IgA-dependent bullous dermatosis, lichen planus bullosa, epidermolysis bullosa acquisita, autoimmune diabetes, diabetic retinopathy, diabetic nephropathy, diabetic vasculopathy, eye inflammation, uveitis, rhinitis, ischemia-reperfusion syndrome, restenosis after angioplasty, chronic obstructive pulmonary disease (COPD), glomerulonephritis, Graves' disease, gastrointestinal allergies, conjunctivitis, atherosclerosis, coronary heart disease, coronary heart disease, small artery disease, acute disseminated encephalomyelitis, idiopathic thrombocytopenic purpura, multiple sclerosis, systemic sclerosis, antiphospholipid syndrome, Sjögren's syndrome, autoimmune hemolytic anemia, colitis, Crohn's disease, ulcerative colitis, inflammatory bowel disease (IBD), embolism, pulmonary embolism, arterial embolism, venous embolism, allergic inflammation, cardiovascular disease, graft-related diseases, graft-versus-graft disease (GVHD), disorders associated with graft rejection, chronic rejection, and tissue or cellular allograft or xenograft, autoimmune diseases, degeneration after trauma, stroke, graft rejection, allergic conditions and hypersensitivity, for example, allergic rhinitis, allergic eczema and the like, skin diseases, skin inflammatory disorders, and any combination thereof, but are not limited to them.

Examples of skin conditions include acne; actinic keratosis; atopic dermatitis; contact dermatitis; bedsores; eczema; erythroderma; hemangioma, such as, for example, infantile hemangioma; hypertrophic scarring; lichen planus; lichenoid disorders; lymphangiogenesis; psoriasis; pyogenic granulomas; molluscum contagiosum; neurofibromatosis; rosacea; recessive dystrophic epidermolysis bullosa; scars (keloids); scleroderma; seborrheic keratosis; skin cancer such as angiosarcoma, basal cell carcinoma, hemangioendothelioma, Kaposi's sarcoma, malignant melanoma, melanoma, squamous cell carcinoma; skin ulcers; skin damage after skin grafting, such as autografting and allografting; Steven-Johnson syndromes and toxic epidermal necrolysis; Sturge-Weber syndrome; tuberous sclerosis; venous ulcers; simple warts; papillomas, such as, for example, viral papillomas; wounds; and the like, but are not limited to them.

Examples of skin inflammatory diseases include psoriasis, guttate psoriasis, inverse psoriasis, pustular psoriasis, erythrodermal psoriasis, acute febrile neutrophilic dermatosis, eczema, asteatous eczema, dyshidrotic eczema, vesicular palmoplantar eczema, acne vulgaris, atopic dermatitis, contact dermatitis matitis, allergic contact dermatitis, dermatomyositis, exfoliative dermatitis, hand eczema, pompholyx, rosacea, rosacea due to sarcoidosis, rosacea due to scleroderma, rosacea due to Sweet's syndrome, rosacea due to systemic lupus erythematosus, rosacea due to urticaria, rosacea due to pain associated with shingles lichen, Sweet's disease, hidradenitis neutrophilus, sterile pustulosis, drug eruptions, seborrheic dermatitis, pityriasis rosea, Kikuchi skin disease, pruritic urticarial papules and plaques of pregnancy, Stevens-Johnson syndrome and toxic epidermal necrolysis, tattoo reactions, Wells syndrome (eosinophilic cellulitis) , reactive arthritis (Reiter's syndrome), intestinal-associated dermatosis-arthritis syndrome, rheumatoid neutrophilic dermatosis, neutrophilic eccrine hidradenitis, neutrophilic dermatosis of the dorsum of the hand, plasmacellular balanitis, balanoposthitis, Behçet's disease, ring-shaped centrifugal erythema, persistent dyschromic erythema, erythema multiforme, colic cylindrical granuloma, hand dermatitis, lichen planus, lichen planus, lichen sclerosus, lichen simplex chronicus, lichen spinosa, nummular dermatitis, pyoderma gangrenosum, sarcoidosis, subcorneal pustular dermatosis, urticaria and transient acantholytic dermatosis, but are not limited to.

2. Autoimmune diseases.

In some embodiments, the CAR engineered immune cells of the present invention can be used to treat one or more autoimmune diseases, disorders, symptoms or conditions in a subject in need thereof. In some embodiments, the CAR-modified immune cells of the present invention can be used to promote immune tolerance in this context. Thus, the present invention provides a method of treating an autoimmune disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one population of immune cells as described herein. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in treating an autoimmune disease. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or medicament as described herein) for use in the manufacture of a medicament for treating an autoimmune disease.

Examples of autoimmune diseases include lupus (eg, lupus erythematosus, lupus nephritis, etc.), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (eg, insulin-dependent diabetes mellitus, diabetes mellitus I type, diabetes mellitus type II, etc.), Goodpasture's syndrome, myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (eg, rheumatoid arthritis), polymyositis, scleroderma, psoriasis, mixed connective tissue disease and the like, but are not limited to.

3. Allergic diseases.

In some embodiments, the CAR engineered immune cells of the present invention can be used to treat one or more allergic diseases, disorders, symptoms or conditions in a subject in need thereof. In some embodiments, the CAR-modified immune cells of the present invention can be used to promote immune tolerance in this context. Thus, the present invention provides a method of treating an allergic disease, disorder, symptom or condition in a subject in need thereof, wherein the method comprises administering a therapeutically effective amount of at least one population of immune cells as described herein. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition or drug as described herein) for use in the treatment of an allergic disease, disorder, symptom or condition. The present invention also provides at least one population of immune cells as described herein (e.g., in a composition, pharmaceutical composition, or drug as described herein) for use in the manufacture of a medicament for treating an allergic disease, disorder, symptom or states.

Examples of allergic diseases include, but are not limited to, allergic diseases caused by an inhalant allergen, an ingested allergen, or a contact allergen. Other examples of allergic diseases include, but are not limited to, allergic asthma, hypersensitivity-related pulmonary diseases, food allergies, atopic dermatitis, allergic rhinitis, allergic rhinoconjunctivitis, chronic urticaria, delayed-type hypersensitivity disorders and systemic anaphylaxis.

4. Transplantation

In some embodiments, the CAR engineered immune cells of the invention may be used to treat one or more diseases, disorders, symptoms, or conditions associated with organ or tissue transplantation (e.g., organ or tissue rejection/dysfunction, GVHD and/or related states). Graft rejection involves the destruction of transplanted donor tissue by the recipient's immune cells through an immune response. The immune response is also involved in GVHD; however, in this case, the recipient's tissue is destroyed by the donor's immune cells, which are transferred to the recipient through the graft. Accordingly, CAR-mediated redirection and activation of immune cells provides a method for inhibiting the rejection of incompatible cells and/or tissues by immune effector cells in transplant recipients or inhibiting the pathogenic effects of transplanted immunocompetent cells in the case of GVHD. In some embodiments, the incompatible cells and/or tissues comprise HLA-A2 incompatible cells and/or tissues. The CAR-modified immune cells of the invention can be used to stimulate immune tolerance, functional tolerance and/or immune accommodation in a subject, particularly after organ or tissue transplantation. Thus, the present invention provides a method of promoting immune tolerance, functional tolerance and/or immune accommodation in a subject, comprising administering to the subject a CAR engineered immune cell or a pharmaceutical composition as described herein. In some embodiments, the method may be aimed at promoting immune tolerance, functional tolerance, and/or immune accommodation to a transplanted organ or tissue in a subject. The present invention also provides at least one population of immune cells as described herein (e.g., in a composition, pharmaceutical composition, or drug as described herein) for use in promoting immune tolerance, functional tolerance, and/or immune accommodation to a transplanted organ or tissue in a subject. The present invention also provides at least one population of immune cells as described herein (e.g., in a composition, pharmaceutical composition, or drug as described herein) for use in the manufacture of a medicament for promoting immune tolerance, functional tolerance, and/or or immune accommodation to a transplanted organ or tissue in the subject.

In some embodiments, a CAR-engineered immune cell (eg, a CAR-engineered Treg cell) of the present invention is administered concomitantly, before or after organ or tissue transplantation.

In some embodiments, a CAR-engineered immune cell (eg, a CAR-engineered Treg cell) of the present invention can be used to prevent or treat rejection of a transplanted organ or tissue. Examples of organ or tissue transplant rejection include, but are not limited to, hyperacute organ or tissue transplant rejection and antibody-mediated organ or tissue transplant rejection.

In some embodiments, the method of the present invention includes administering CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention to a subject undergoing a transplanted organ or tissue.

In some embodiments, the transplanted organ or tissue may include a bone marrow graft, an organ graft, a blood transfusion, or any other foreign tissue or cell that is specifically administered to a subject.

In some embodiments, CAR-engineered immune cells (e.g., CAR-engineered Treg cells) of the present invention can be used as a therapy for inhibiting graft rejection after transplantation, including but not limited to allograft rejection or xenograft rejection .

Another aspect of the invention is a method of preventing or treating organ or tissue transplant rejection in a subject, comprising administering to the subject CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the invention or a pharmaceutical composition containing said immune cells.

Another aspect of the invention is a method of increasing the period of graft survival in a subject, comprising administering to the subject CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention, or a pharmaceutical composition containing these cells.

In some embodiments, the method provides a graft survival time of 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months , 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 20 years, 30 years, 40 years, 50 years, 60 years, 70 years, 80 years, 90 years, 100 years or during the life of the subject.

In some embodiments, administration of an immune cell or composition of the invention allows the amount of immunosuppressive therapy agent received by the subject to be reduced. In some embodiments, the subject does not require immunosuppressive therapy and/or is not being treated with any immunosuppressant.

In some embodiments, the graft is an allograft. In some embodiments, the graft may be exposed to CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention concurrently, before, or after transplantation of the graft into the recipient. In some embodiments, the organ or tissue graft may be a heart, heart valve, lung, kidney, liver, pancreas, intestine, skin, blood vessels, bone marrow, stem cells, bone, or islet cells. However, the invention is not limited to a particular type of transplantation.

In some embodiments, the donor graft may be "preconditioned" or "preconditioned" by treating the organ or tissue graft prior to transplantation into the recipient using CAR engineered immune cells of the invention to reduce the immunogenicity of the graft against the recipient, thereby reducing or preventing rejection transplant.

In some embodiments, the host or transplant recipient is HLA-A2 negative. In some embodiments, the host or transplant recipient is HLA-A2 negative, and positive for an HLA-A subtype selected from the group consisting of HLA-A25, HLA-A29, and HLA-A30.

In some embodiments, the graft is HLA-A2 positive.

In some embodiments, CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention can be used to prevent or treat graft-versus-host disease (GVHD). In some embodiments, GVHD may occur following a hematopoietic stem cell transplant. In some embodiments, the method includes administering CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention to a subject undergoing a transplanted organ or tissue. In some embodiments, the transplanted organ or tissue may include a bone marrow graft, an organ graft, a blood transfusion, or any other foreign tissue or cell that is specifically administered to a subject. For example, GVHD can occur after transplantation of the heart, heart valve, lung, kidney, liver, pancreas, intestine, skin, blood vessels, bone marrow, stem cells, bone, or islet cells. However, the invention is not limited to a particular type of transplantation.

Another aspect of the invention is a method of preventing or treating graft-versus-host disease (GVHD) in a subject, comprising administering to the subject CAR-engineered immune cells (eg, CAR-engineered Treg cells) or a pharmaceutical as described herein. .

In some embodiments, the invention provides a method of contacting a donor graft, e.g., a biocompatible lattice structure or donor tissue, organ, or cell, with CAR-engineered immune cells (e.g., CAR-engineered Treg cells) of the present invention. simultaneously, before or after transplantation of the graft to the recipient.

In some embodiments, CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention can be used to improve, suppress, or reduce an adverse graft response of a donor against a recipient, thereby preventing or treating GVHD.

Another aspect of the present invention is a method of preventing or delaying the onset of GVHD in a subject, comprising administering to the subject CAR-engineered immune cells (eg, CAR-engineered Treg cells) or a pharmaceutical composition as described herein.

In some embodiments, the onset of GVHD is delayed by 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months , 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 20 years, 30 years, 40 years, 50 years, 60 years, 70 years, 80 years, 90 years, 100 years or for the life of the subject.

In some embodiments, administration of an immune cell or composition of the invention allows the amount of immunosuppressive therapy agent received by the subject to be reduced. In some embodiments, the subject does not require immunosuppressive therapy and/or is not being treated with any immunosuppressive agent.

In some embodiments, the GVHD may be acute GVHD or chronic GVHD.

In some embodiments, the donor graft may be "preconditioned" or "pretreated" by treating the graft prior to transplantation into the recipient with CAR-engineered immune cells (e.g., CAR-engineered Treg cells) of the present invention to reduce the immunogenicity of the graft against the recipient, thereby reducing or preventing GVHD. In some embodiments, the graft may be contacted with cells or tissue of the recipient prior to transplantation to activate T cells that may be associated with the graft. After the graft has been treated with the recipient's cells or tissue, the cells or tissue may be removed from the graft. The treated graft may then be contacted with CAR-engineered immune cells (eg, CAR-engineered Treg cells) of the present invention to reduce, inhibit, or eliminate the activity of immune effector cells that have been activated by the cell or tissue treatment from the recipient. After this treatment, the CAR-engineered immune cells can be removed from the graft before transplantation into the recipient. However, some CAR-engineered immune cells can attach to the graft and therefore can be administered to the graft recipient. In this situation, CAR-engineered immune cells administered to the recipient can suppress the immune response against the recipient caused by the graft-associated cell.

In some embodiments, the host or transplant recipient is HLA-A2 negative. In some embodiments, the host or transplant recipient is HLA-A2 negative, and positive for an HLA-A subtype selected from the group consisting of HLA-A25, HLA-A29, and HLA-A30.

In some embodiments, the graft is HLA-A2 positive.

Immune cells can be obtained from any source. For example, in some embodiments, immune cells may be obtained from a tissue donor, transplant recipient, or other unrelated source (eg, another individual or species as a whole) to generate the CAR-modified immune cells of the present invention. Accordingly, the CAR-modified immune cells of the present invention may be autologous, allogeneic, or xenogeneic to the transplant recipient, or from another unrelated source. In some embodiments, the CAR-modified immune cells are CAR-Treg cells, which may be autologous, allogeneic, or xenogeneic to the transplant recipient. In some embodiments, the CAR-Treg cells may be autologous to the transplant recipient.

5. Types of cancer

In some embodiments, the CAR-engineered immune cells of the present invention can be used to treat one or more types of cancer in a subject in need thereof. In some embodiments, immune cells of the invention engineered with CARs can be used to stimulate a specific immune response against cancer cells. Thus, the present invention provides a method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of at least one population of immune cells as described herein. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in the treatment of cancer. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in the manufacture of a drug for the treatment of cancer.

As used herein, the term “cancer” can mean any cancer associated with a surface antigen or cancer marker.

Examples of cancer include acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adenoid cystic carcinoma, adrenocortical carcinoma, AIDS-associated cancer, anal cancer, appendix cancer, astrocytomas, atypical teratoid/rhabdoid tumor, B-cell leukemia, lymphoma, or others B-cell neoplasia, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, osteosarcoma and malignant fibrous histiocytoma, brain stem glioma, brain tumors, breast cancer, bronchial tumors, Burkitt's lymphoma, carcinoid tumors, malignant tumors of the central nervous system, cervical cancer, chordoma, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative disorders, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, embryonal tumors, endometrial cancer, ependymoblastoma, ependymoma , esophageal cancer, esthesioneuroblastoma, tumors of the Ewing sarcoma family, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, fibrous histiocytoma of bone and osteosarcoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumors -intestinal tract (GIST), soft tissue sarcoma, germ cell tumor, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular carcinoma, histiocytosis, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet tumors ( endocrine pancreas), Kaposi's sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer (primary), lobular carcinoma in situ (LCIS), lung cancer, lymphoma, macroglobulinemia, breast cancer glands in men, malignant fibrous histiocytoma of bone, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous cell carcinoma of the neck with occult primary midline carcinoma having a NUT rearrangement, oral cancer, multiple endocrine neoplasia syndromes, multiple myeloma/plasma cell tumor , mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative neoplasms, myelogenous leukemia, chronic myeloid leukemia (CML), acute myeloid leukemia (AML), multiple myeloma, myeloproliferative disorders, cancer of the nasal cavity and paranasal sinus, nasopharyngeal cancer, neuroblastoma, neoplasia Zhkin's lymphoma, non-small cell lung cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, papillomatosis, paraganglioma, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, parenchymal tumors of the pineal gland of intermediate differentiation , pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell tumor/multiple myeloma, pleuropulmonary blastoma and breast cancer, primary central nervous system (CNS) lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvic cancer and ureter, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Sezary syndrome, small cell lung cancer, small bowel cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell carcinoma of the neck, gastric cancer, supratentorial primitive neuroectodermal tumors, T-cell lymphoma, skin cancer, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and urethra, trophoblastic tumor, cancer of the urethra and renal pelvis, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, Vulvar cancer, Waldenström's macroglobulinemia and Wilms' tumor, but not limited to.

In some aspects, the cancer is a B cell neoplasia. Examples of B-cell neoplasias include non-Hodgkin's lymphoma (NHL), diffuse large B-cell lymphoma (DLBCL), small cell lymphocytic lymphoma (SLL/CLL), mantle cell lymphoma (MCL), follicular lymphoma (FL), marginal zone lymphoma (MZL) ), extranodal (eg, MALT) lymphoma, nodal (eg, monocytoid B-cell) lymphoma, splenic lymphoma, diffuse large cell lymphoma, B-cell chronic lymphocytic leukemia/lymphoma, Burkitt's lymphoma, and lymphoblastic lymphoma.

6. Infectious diseases

In some embodiments, immune cells engineered with the CARs of the present invention can be used to treat one or more infectious diseases, disorders, symptoms, or conditions in a subject in need thereof. In some embodiments, the CAR-modified immune cells of the present invention can be used to promote immune tolerance in this context. In some embodiments, the present invention provides a method of treating an infectious disease in a subject in need thereof, comprising administering a therapeutically effective amount of at least one population of immune cells as described herein. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in the treatment of an infectious disease. The present invention also provides at least one population of immune cells as described herein (eg, in a composition, pharmaceutical composition, or drug as described herein) for use in the manufacture of a drug for treating an infectious disease.

In some embodiments, the infectious disease is a viral infectious disease. As used herein, the term “viral infectious disease” can mean an infection caused by any virus that causes a disease or condition in the host.

Examples of viral infectious diseases include viral infection caused by Epstein-Barr virus (EBV); a viral infection caused by the hepatitis A virus, hepatitis B virus or hepatitis C virus; a viral infection caused by herpes simplex virus type 1, herpes simplex virus type 2 or herpes simplex virus type 8; viral infection caused by cytomegalovirus (CMV); viral infection caused by the human immunodeficiency virus (HIV); viral infection caused by influenza virus; a viral infection caused by the measles or mumps virus; viral infection caused by the human papillomavirus (HPV); viral infection caused by parainfluenza virus; viral infection caused by rubella virus; viral infection caused by respiratory syncytial virus (RSV); or a viral infection caused by the varicella zoster virus, but is not limited to. In some aspects, a viral infection may cause or be associated with the development of cancer in a subject with a viral infection (e.g., HPV infection may cause or be associated with the development of several types of cancer, including cancer of the cervix, vulva, vagina, penis, anal canal, and oropharynx, and HIV infection can cause the development of Kaposi's sarcoma).

In some embodiments, the infectious disease is a bacterial infectious disease. As used herein, a “bacterial infectious disease” can be an infection caused by any bacteria that causes a disease or condition in the host.

Examples of bacterial infectious diseases include pneumonia, otitis media, sinusitis, bronchitis, tonsillitis and mastoiditis associated with infection with Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus or the genus Peptostreptococcus; pharyngitis, rheumatic fever and glomerulonephritis caused by infection with Streptococcus pyogenes, group C and G streptococci, Clostridium diptheriae or Actinobacillus haemolyticum; respiratory tract infections associated with infection with Mycoplasma pneumoniae, Legionella pneumophila, Streptococcus pneumoniae, Haemophilus influenzae or Chlamydia pneumoniae; non-complex skin and soft tissue infections, boils, osteomyelitis and puerperal fever associated with infection with Staphylococcus aureus, coagulase-positive staphylococci (for example, S. epidermidis, S. hemolyticus, etc.), Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus group CF (microcolonies of Streptococcus), Viridans streptococcus, Corynebacterium minutissimum, Clostridium genus or Bartonella henselae; non-complex acute urinary tract infection; urethritis and cervicitis associated with infection with Staphylococcus saprophyticus or the genus Enterococcus; and sexually transmitted disease associated with infection with Chlamydia trachomatis, Haemophilus ducreyi, Treponema pallidum, Ureaplasma urealyticum, or Neiserria gonorrheae; toxic diseases associated with infection with S. aureus (food poisoning and toxic shock syndrome), streptococci of groups A, B and C; ulcers associated with Helicobacter pylori infection; systemic fever syndrome associated with Borrelia recurrentis infection; Lyme disease associated with infection with Borrelia burgdorferi; conjunctivitis, keratitis and dacryocystitis associated with infection with Chlamydia trachomatis, Neisseria gonorrhoeae, S. aureus, S. pneumoniae, S. pyogenes, H. influenzae or Listeria genus; diffuse Mycobacterium avium syndrome (MAC), associated with infection with Mycobacterium avium, Mycobacterium intracellulare; gastroenteritis associated with Campylobacter jejuni infection; dental infection associated with infection with Viridans streptococcus; persistent cough associated with Bordetella pertussis infection; gas gangrene associated with infection with Clostridium perfringens or Bacteroides genus; and atherosclerosis, accompanied by, but not limited to, Helicobacter pylori or Chlamydia pneumoniae infection. In some embodiments, the bacterial infection may be caused by, for example, Escherichia genus, Listeria genus, Salmonella genus, or Staphylococcus genus.

In some embodiments, the infectious disease is a fungal infectious disease. As used herein, “fungal infectious disease” can mean an infection caused by any fungus that causes a disease or condition in the host.

Examples of fungal infections include, but are not limited to, local, mucosal and/or systemic fungal infections caused by, for example, Candida albicans, Cryptococcus neoformans, Aspergillus flavus, Aspergillus fumigatus, Coccidioides, Paracoccidioides, Histoplasma or Blastomyces. Other common fungal diseases include oral thrush, vaginal candidiasis, aspergillosis, candidiasis, chromomycosis, coccidioidomycosis, cryptococcosis, entomophthromycosis, epizootic lymphangitis, geotrichosis, histoplasmosis, mucormycosis, mycetoma, North American blastomycosis, oomycosis, pecilomycosis, penicia liosis, rhinosporidiosis and sporotrichiasis in animals ( for example, people).

In some embodiments, the infectious disease is a parasitic infectious disease. As used herein, a “parasitic infectious disease” can be an infection caused by any protozoan, helminth or ectoparasite that causes a disease or pathological condition in the host.

Examples of protozoa that may be infectious to humans include, but are not limited to, Entamoeba, Giardia, Leishmania balantidium, Plasmodium, and Cryptosporidium.

Examples of helminths that can be infectious to humans include Filariasis, Onchocerciasis, Ascariasis, Trichuriasis, Necatoriasis, Trichostrongyliasis, Dracunculiasis, Baylisascaris, Echinococcosis, Hymenolepiasis, Taeniasis, Cysticercosis, Coenurosis, Amphistomiasis, Clonorchiasis, Fascioliasis, Fasciolopsis asis, Opisthorchiasis, Paragonimiasis, Schistosomiasis and Bilharziasis, but not limited to them.

Examples of ectoparasites that can be infective to humans include, but are not limited to, insects (six-legged arthropods) and arachnids (eight-legged arthropods).

Application of CAR

The CAR-engineered immune cells of the present invention can be administered either alone or as a pharmaceutical composition as described herein (e.g., in combination with diluents and/or other components, including IL-2 or other cytokines or cell populations, but not limited to them).

The pharmaceutical compositions of the present invention can be administered to a subject by any suitable route, including aerosol inhalation, injection, oral administration, transfusion, implantation or transplantation. In some embodiments, the pharmaceutical compositions described herein can be administered to a subject parenterally. In some embodiments, the pharmaceutical compositions described herein can be administered to a subject by subcutaneous, intradermal, intratumoral, intranodal, intramedullary, intramuscular, intrasternal, intravenous (IV) injection, infusion, or intraperitoneal route. In specific embodiments, the CAR-modified immune cell compositions of the present invention can be administered to a subject by intradermal or subcutaneous injection. In some embodiments, the CAR-modified immune cell compositions of the present invention can be administered by intravenous injection. In some embodiments, the CAR-modified immune cell compositions can be administered directly to a lymph node, site of infection, site of inflammation, or site of tissue or organ rejection. In some embodiments, CAR-modified immune cell compositions can be administered directly to the site of an autoimmune and/or inflammatory disease.

In some embodiments, the subject is (or should be) administered autologous cells.

In some embodiments, the subject is (or should be) administered allogeneic cells.

In some embodiments, the subject may be a mammal. In specific embodiments, the subject may be a human.

The pharmaceutical compositions of the present invention can be administered in a manner appropriate to the disease to be prevented or treated. The amount and frequency of administration will be determined by factors such as the subject's condition and the type and severity of the subject's disease, although appropriate dosages may be determined by clinical trials.

When an "effective amount" or a "therapeutic amount" is indicated, the exact amount of the compositions of the present invention to be administered may be determined taking into account individual differences in the age, body weight, antibody titer and condition of the subject. In general, it can be stated that a pharmaceutical composition containing CAR engineered immune cells as described herein can be administered in a dosage of at least 1×10 ² , 1×10 ³ , 1×10 ⁴ , 1×10 ⁵ , 1×10 ⁶ , 1×10 ⁷ , 1×10 ⁸ or 1×10 ⁹ cells/kg body weight or from 1×10 ⁵ to 100×10 ⁵ cells/kg body weight, including all integer values in these ranges. The CAR engineered immune cell compositions may also be administered multiple times at any of these dosages or any combination thereof. CAR-engineered immune cells can be administered using infusion techniques that are widely known in immunotherapy. The optimal dosage and treatment regimen for a particular subject can be easily determined by assessing the subject for signs of disease and adjusting treatment accordingly.

In some embodiments, the CAR engineered immune cells of the present invention may be administered to a subject in combination (e.g., before, concurrently, or after) any number of suitable treatments, including treatment with agents such as antiviral agents, chemotherapy (i.e. .chemotherapeutic agent), alkylating agents, radiation, immunosuppressants, antibodies, immunoablative agents, cytokines, radiation and anti-infective agents, but not limited to.

In some embodiments, the CAR-engineered immune cells of the present invention may be administered along with a chemotherapeutic agent. Any chemotherapeutic agent known in the art may be used. Examples of chemotherapeutic agents include an anthracycline (eg, doxorubicin (eg, liposomal doxorubicin)), vinca alkaloid (eg, vinblastine, vincristine, vindesine, or vinorelbine), an alkylating agent (eg, cyclophosphamide, dacarbazine, melphalan, ifosfamide, or temozolomide), immune cell antibodies (eg, alemtuzumab, gemtuzumab, rituximab, ofatumumab, tositumomab, or brentuximab), antimetabolite (including, for example, folate antagonists, pyrimidine analogs, purine analogs, and adenosine deaminase inhibitors (eg, fludarabine)), mTOR inhibitor, glucocorticoid-induced receptor agonist ( GITR) to tumor necrosis factor TNFR, a proteasome inhibitor (eg, aclacinomycin A, gliotoxin, or bortezomib), an immunomodulator such as, but not limited to, thalidomide or a thalidomide derivative (eg, lenalidomide).

Other chemotherapeutic agents considered for use in the combination therapy of the invention include anastrozole (Arimidex®), bicalutamide (Casodex®), bleomycin sulfate (Blenoxane®), busulfan (Myleran®), busulfan injection (Busulfex®), capecitabine (Xeloda ®), N4-pentoxycarbonyl-5-deoxy-5-fluorocytidine, carboplatin (Paraplatin®), carmustine (BiCNU®), chlorambucil (Leukeran®), cisplatin (Platinol®), cladribine (Leustatin®), cyclophosphamide (Cytoxan® or Neosar®), cytarabine, cytosine arabinoside (Cytosar-U®), cytarabine liposomes for injection (DepoCyt®), dacarbazine (DTIC-Dome®), dactinomycin (Actinomycin D, Cosmegan), daunorubicin hydrochloride (Cerubidine®), daunorubicin citrate liposomes for injection (DaunoXome®), dexamethasone, docetaxel (Taxotere®), doxorubicin hydrochloride (Adriamycin®, Rubex®), etoposide (Vepesid®), fludarabine phosphate (Fludara®), 5-fluorouracil (Adrucil®, Efudex®), flutamide (Eulexin®), tezacitibine, gemcitabine (difluorodeoxycytidine), hydroxyurea (Hydrea®), idarubicin (Idamycin®), ifosfamide (IFEX®), irinotecan (Camptosar®), L-asparaginase (ELSPAR®), leucovorin calcium, melphalan (Alkeran) ®), 6-mercaptopurine (Purinethol®), methotrexate (Folex®), mitoxantrone (Novantrone®), mylotarg, paclitaxel (Taxol®), Phoenix (Yttrium90/MX-DTPA), pentostatin, polypheprozan 20 with carmustine implant (Gliadel® ), tamoxifen citrate (Nolvadexe®), teniposide (Vumon®), 6-thioguanine, thiotepa, tirapazamine (Tirazone®), topotecan hydrochloride injection (Hycamptin®), vinblastine (Velban®), vincristine (Oncovin®), and vinorelbine (Navelbine®), but not limited to them.

The CAR-engineered immune cells of the present invention can be administered to a subject before, after, or simultaneously with a chemotherapeutic agent.

In some embodiments, the CAR-engineered immune cells of the present invention may be administered along with an alkylating agent. Any alkylating agent known in the art can be used. Examples of alkylating agents include nitrogen mustards, ethyleneimine derivatives, alkyl sulfonates, nitrosoureas and triazenes, uracil mustard (Aminouracil Mustard®, Chlorethaminacil®, Demethyldopan®, Desmethyldopan®, Haemanthamine®, Nordopan®, Uracil nitrogen mustard®, Uracillost®, Uracilmostaza®, Uramustin ®, and Uramustine®), chlormethine (Mustargen®), cyclophosphamide (Cytoxan®, Neosar®, Clafen®, Endoxan®, Procytox®, and Revimmune™), ifosfamide (Mitoxana®), melphalan (Alkeran®), chlorambucil (Leukeran ®), pipobromane (Amedel®, Vercyte®), triethylenemelamine (Hemel®, Hexalen® and Hexastat®), triethylene thiophosphoramine, temozolomide (Temodar®), thiotepa (Thioplex®), busulfan (Busilvex® and Myleran®), carmustine (BiCNU ®), lomustine (CeeNU®), streptozocin (Zanosar®), and dacarbazine (DTIC-Dome®), but are not limited to. Additional exemplary alkylating agents include oxaliplatin (Eloxatin®); temozolomide (Temodar® and Temodal®); dactinomycin (also known as actinomycin-D, Cosmegen®); melphalan (also known as L-PAM, L-sarcolysine and phenylalanine mustard, Alkeran®); altretamine (also known as hexamethylmelamine (HMM), Hexalen®); carmustine (BiCNU®); bendamustine (Treanda®); busulfan (Busulfex® and Myleran®); carboplatin (Paraplatin®); lomustine (also known as CCNU, CeeNU®); cisplatin (also known as CDDP, Platinol® and Platinol®-AQ); chlorambucil (Leukeran®); cyclophosphamide (Cytoxan® and Neosar®); dacarbazine (also known as DTIC, DIC and imidazole carboxamide, DTIC-Dome®); altretamine (also known as hexamethylmelamine (HMM), Hexalen®); ifosfamide (Ifex®); prenumustine; procarbazine (Matulane®); mechlorethamine (also known as nitrogen mustard, mustine and mechlorethamine hydrochloride, Mustargen®); streptozocin (Zanosar®); thiotepa (also known as thiophosphamide, TESPA and TSPA and Thioplex®); cyclophosphamide (Endoxan®, Cytoxan®, Neosar®, Procytox®, and Revimmune®); and bendamustine HC1 (Treanda®), but not limited to.

The CAR-engineered immune cells of the present invention can be administered to a subject before, after, or simultaneously with the alkylating agent.

In some embodiments, the CAR-engineered immune cells of the present invention may be administered along with an immunosuppressive agent. Any immunosuppressant known in the art can be used. Examples of immunosuppressants include cyclosporine, azathioprine, methotrexate, methoxalen, rapamycin, mycophenolate mofetil, mycophenolic acid, rituximab, sirolimus, basiliximab, daclizumab, muromonab-CD3, tacrolimus, glucocorticosteroids, adrenocorticosteroids such as prednisone and prednisolone , and any combinations thereof, but not limited to them.

The CAR-engineered immune cells of the present invention can be administered to a subject before, after, or simultaneously with an immunosuppressive agent.

The CAR-engineered immune cells of the present invention and/or the immunosuppressant(s) can be administered to a subject after transplantation. Alternatively or in addition, the CAR-engineered immune cells of the present invention and/or immunosuppressive agent(s) may be administered to the subject prior to transplantation. In some embodiments, the CAR-engineered immune cells of the present invention and/or an immunosuppressive agent may be administered to a subject during a transplant operation.

In some embodiments, administration of CAR-engineered immune cells to the subject occurs after immunosuppressive therapy has been initiated.

In some embodiments, the method is performed more than once, for example, to monitor a transplant recipient over time and, if applicable, under different immunosuppressive therapy regimens.

In some embodiments, immunosuppressive therapy is reduced if the transplant recipient is expected to be tolerant to the transplant. In some embodiments, immunosuppressive therapy is not administered, for example, immunosuppressive therapy is discontinued if the transplant recipient is expected to be tolerant to the graft.

The CAR-engineered immune cells of the present invention can be administered following diagnosis of organ or tissue transplant rejection, followed by dosing of both the CAR-engineered immune cells of the invention and immunosuppressants until the symptoms of organ or tissue rejection are reduced.

In a further embodiment, immune cell compositions engineered with the CARs of the present invention may be administered to a subject in combination (eg, before, concurrently, or after) a bone marrow transplant.

In some embodiments, the CAR engineered immune cells of the present invention can be administered following B cell ablation therapy, such as agents that react with CD20, such as rituximab. For example, in some embodiments, subjects may receive standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. In some embodiments, after transplantation, subjects may receive an infusion of expanded CAR-engineered immune cells of the present invention. In some embodiments, expanded CAR-engineered immune cells may be administered before or after surgery.

In some embodiments, the CAR-engineered immune cells of the present invention may be administered along with an anti-infective agent. Any anti-infective agent known in the art can be used. Examples of anti-infectives include amebicides, aminoglycosides, anthelmintics, antiparasitics, antifungals (azole antifungals, echinocandins, mixed antifungals, and polyenes), antimalarials (antimalarial combinations, antimalarial quinolines, and mixed antimalarials), antituberculosis agents (aminosalicylates, antituberculosis useful combinations , diarylquinolines, hydrazide derivatives, various anti-tuberculosis agents, nicotinic acid derivatives, rifamycin derivatives and streptomycete derivatives), antiviral agents (adamantane antivirals, antiviral boosters, antiviral combinations, antiviral interferons, chemokine receptor antagonists, integrase strand transfer inhibitor, mixed antivirals, neuraminidase inhibitors, NNRTIs, NS5A inhibitors, nucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors and purine nucleosides), carbapenems, carbapenems/beta-lactamase inhibitors, cephalosporins (cephalosporins/beta-lactamase inhibitors, first generation cephalosporins, fourth generation cephalosporins, cephalosporins next generation, second generation cephalosporins and third generation cephalosporins), antibiotics, glycopeptide antibiotics, glycylcyclines, leprostatic agents, lincomycin derivatives, macrolide derivatives (ketolides and macrolides), mixed antibiotics, oxazolidinone antibiotics, penicillins (aminopenicillins, antipseudomonal penicillins, beta-lactamase inhibitors , natural penicillins, penicillinase and resistant penicillins), quinolones, sulfonamides, tetracyclines and urinary tract anti-infectives, but not limited to.

In some embodiments, a subject (e.g., a human) receives an initial administration of an immune cell or population of the invention, and one or more subsequent administrations, wherein the one or more subsequent administrations occur less than 15 days later, e.g., 14, 13, 12, 11. 10, 9, 8, 7, 6, 5, 4, 3 or 2 days after previous administration.

In some embodiments, a therapeutically effective amount of immune cells of the invention is or is intended to be administered to a subject.

In some embodiments, the number of immune cells in the population of immune cells of the invention administered to a subject is at least 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ cells.

In some embodiments, the number of immune cells in the population of immune cells of the invention administered to a subject ranges from about 10 ² to 10 ⁹ , about 10 ³ to 10 ⁸ , about 10 ⁴ to 10 ⁷ , or about 10 ⁵ to 10 ⁶ cells.

In some embodiments, the number of immune cell populations in the immune cell population of the invention administered to a subject ranges from about 10 ² to 10 ⁹ , about 10 ² to 10 ⁸ , about 10 ² to 10 ⁷ , about 10 ² to 10 ⁶ , about 10 ² to 10 ⁵ , about 10 ² to 10 ⁴ , or about 10 ² to 10 ³ cells. In some embodiments, the number of immune cells in the immune population of the invention administered to a subject is about 10 ² , about 10 ³ , about 10 ⁴ , about 10 ⁵ , about 10 ⁶ , about 10 ⁷ , about 10 ⁸ , or about 10 ⁹ cells.

In some embodiments, the number of immune cells in the population of immune cells of the invention administered to a subject is at least 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ cells/kg body weight.

In some embodiments, the number of immune cells in the population of immune cells of the invention administered to a subject is in the range of about 10 ² to 10 ⁹ cells/kg body weight, or from 10 ³ to 10 ⁸ cells/kg body weight, including all integers within these ranges.

In some embodiments, a subject receives more than one administration of the immune cell population of the present invention per week; for example, 2, 3 or 4 administrations of the Treg cell population of the present invention are administered to a subject per week.

In some embodiments, the Treg cell population is administered to a subject in need thereof in combination with an active agent. In some embodiments, the population of immune cells is administered before, simultaneously with, or after administration of the active agent.

In some embodiments, it may be necessary to administer activated immune cells of the present invention to a subject, and then retest the blood (or perform apheresis), activate immune cells from it in accordance with the present invention, and reintroduce these activated and expanded immune cells to the subject. This process can be done several times every few weeks. In some embodiments, immune cells can be activated by drawing blood from 10 cc ^to 400 ^cc . In some embodiments, immune cells are activated by drawing 20 cc ^, 30 ^cc , 40 ^cc , 50 ^cc , 60 ^cc , 70 ^cc , 80 ^cc , 90 cc ^, or 100 ^cc of blood. Without wishing to be too theoretical, the use of this multiple blood draw/multiple reinfusion protocol may serve to select for specific populations of immune cells.

It is intended that the CARs, cell populations and compositions described herein may be used in a treatment as described herein, may be used as a drug as described herein, may be used in a treatment as described herein. in this application, and/or can be used in the manufacture of a medicinal product for treatment as described in this application.

Finished product and kits

The present invention also relates to finished articles containing any of the nucleic acids, vectors, cell populations or compositions described herein, as well as methods for producing these articles.

In addition, the present invention provides kits containing in a suitable container any of the nucleic acids, vectors, cell populations or compositions described herein.

Embodiments

Specific embodiments of the invention are listed below:

1. Chimeric antigen receptor (CAR) containing:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain;

- at least one intracellular domain;

wherein the at least one intracellular domain optionally includes at least one costimulatory intracellular signaling domain and at least one primary intracellular signaling domain; and where

- at least one transmembrane domain is a human TNFR2 transmembrane domain or fragment or variant thereof, or any transmembrane domain or fragment or variant thereof, or a combination thereof, and/or

- the at least one costimulatory intracellular signaling domain is a human TNFR2 costimulatory intracellular signaling domain or fragment or variant thereof, or any costimulatory intracellular signaling domain or fragment or variant thereof, or a combination thereof, and

wherein at least one of the transmembrane domain and the costimulatory intracellular signaling domain is a TNFR2 transmembrane domain or a fragment or variant thereof, or a TNFR2 costimulatory intracellular signaling domain or a fragment or variant thereof.

2. The CAR of Embodiment 1, wherein said human TNFR2 transmembrane domain comprises at least 2 amino acids from SEQ ID NO: 22 or from a sequence having at least about 70% identity to SEQ ID NO: 22, preferably at least 2 contiguous amino acids from SEQ ID NO: 22 or from a sequence having at least about 70% identity to SEQ ID: 22

3. A CAR according to embodiment 1 or embodiment 2, wherein said human TNFR2 transmembrane domain is combined with at least one other transmembrane domain.

4. The CAR according to any one of embodiments 1 to 3, wherein said human TNFR2 costimulatory intracellular signaling domain comprises at least 2 amino acids from the sequence of SEQ ID NO: 34 or from a sequence having at least about 70% identity to SEQ ID NO: : 34, preferably at least 2 contiguous amino acids from SEQ ID NO: 34 or from a sequence having at least about 70% identity to SEQ ID: 34.

5. The CAR according to any one of embodiments 1-4, wherein said TNFR2 costimulatory intracellular signaling domain is combined with at least one other costimulatory intracellular signaling domain.

6. The CAR according to any one of embodiments 1-5, wherein the primary intracellular signaling domain comprises an immune cell primary intracellular signaling domain, preferably a human CD3 T cell primary intracellular signaling domain, more preferably a human CD3 T cell primary intracellular signaling domain, having the sequence of SEQ ID NO: 28, 29, 30 or 31, or a sequence having at least about 70% identity with SEQ ID: 28, 29, 30 or 31.

7. The CAR according to any one of embodiments 1-6, wherein the hinge domain is a human CD8 hinge region, preferably SEQ ID NO: 14 or a sequence having at least about 70% identity to SEQ ID NO: 14.

8. The CAR according to any one of embodiments 1-7, wherein the CAR comprises at least one TNFR2 transmembrane domain and at least one intracellular domain, wherein said intracellular domain optionally includes at least one costimulatory intracellular signaling domain and at least one primary intracellular signaling domain of an immune cell.

9. A CAR according to any one of embodiments 1-7, comprising at least one transmembrane domain and at least one intracellular domain, wherein said intracellular domain comprises at least one TNFR2 costimulatory intracellular signaling domain and at least one primary intracellular signaling domain immune cell.

10. A nucleic acid sequence encoding a CAR according to any one of embodiments 1-9.

11. A vector containing the nucleic acid sequence according to embodiment 10.

12. A population of immune cells comprising a nucleic acid sequence according to embodiment 10, or a vector according to embodiment 11, or expressing a CAR according to any of embodiments 1-9.

13. The immune cell population of embodiment 12 selected from the group consisting of T cells, natural killer (NK) cells, γδ T cells, double negative (DN) cells, regulatory immune cells, regulatory T cells, effector immune cells , effector T cells, B cells and myeloid-derived cells, and any combination thereof.

14. A composition comprising at least one population of cells according to any one of embodiments 12-13.

15. The composition according to embodiment 14, which is a pharmaceutical composition and further contains at least one pharmaceutically acceptable excipient.

16. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject at least one population of immune cells according to embodiments 12 or 13 or a composition according to embodiments 14 or 15.

17. The method according to embodiment 16, which is a cell therapy method.

18. The method of embodiments 16 or 17, wherein said disease or disorder includes inflammatory diseases, autoimmune diseases, allergic diseases, organ transplant conditions, cancer and infectious diseases.

19. The method of any one of embodiments 16-18, wherein the immune cell population is a regulatory immune cell population or a Treg cell population, and wherein said disease or disorder is an inflammatory disease, an autoimmune disease, an allergic disease, or a post-organ transplant condition , preferably selected from graft rejection and graft-versus-host disease.

20. The method as in any one of embodiments 16-18, wherein the immune cell population is an effector T cell population, an NK cell population, or a γδ T cell population, and wherein said disease or disorder is a cancer or an infectious disease.

The present invention relates to a chimeric antigen receptor (CAR) comprising:

- at least one extracellular binding domain;

- optionally at least one extracellular hinge domain;

- at least one transmembrane domain (for example, a human TNFR2 transmembrane domain or fragment or variant thereof, any transmembrane domain or fragment or variant thereof, or any combination thereof); And

- at least one intracellular domain (comprising at least one primary intracellular signaling domain and optionally containing at least one costimulatory intracellular signaling domain or fragment or variant thereof, wherein the at least one costimulatory intracellular signaling domain is a costimulatory intracellular signaling domain human TNFR2, or a fragment or variant thereof, any costimulatory intracellular signaling domain or fragment or variant thereof, or any combination thereof),

wherein the transmembrane domain is a TNFR2 transmembrane domain or a fragment or variant thereof, and/or the costimulatory intracellular signaling domain is a TNFR2 costimulatory intracellular signaling domain or a fragment or variant thereof.

In some embodiments, said human TNFR2 transmembrane domain or fragment or variant thereof comprises at least 2 amino acids (e.g., at least 2 contiguous amino acids) from the sequence SEQ ID NO: 22 or from a sequence having at least about 70% identity with SEQ ID NO: 22.

In some embodiments, said human TNFR2 transmembrane domain or fragment or variant thereof is combined with at least one other transmembrane domain or fragment or variant thereof.

In some embodiments, said human TNFR2 costimulatory intracellular signaling domain or variant or fragment thereof comprises at least 2 amino acids (e.g., at least 2 contiguous amino acids) from the sequence of SEQ ID NO: 34 or from a sequence having at least about 70% identical to SEQ ID NO: 34.

In some embodiments, said TNFR2 costimulatory intracellular signaling domain or variant or fragment thereof is combined with at least one other costimulatory intracellular signaling domain or fragment or variant thereof.

In some embodiments, the primary intracellular signaling domain comprises a primary intracellular signaling domain of an immune cell. In some embodiments, the primary intracellular signaling domain is a human CD3 T cell primary intracellular signaling domain. In specific embodiments, the primary intracellular signaling domain is a human CD3-zeta T cell primary intracellular signaling domain having the sequence of SEQ ID NO: 28, 29, 30, or 31 or a sequence having at least about 70% identity to SEQ ID: 28, 29, 30 or 31.

In some embodiments, the hinge domain is a human CD8 hinge region, preferably SEQ ID NO: 14, or a sequence having at least about 70% identity to SEQ ID NO: 14.

In some embodiments, the CAR comprises at least one TNFR2 transmembrane domain or fragment or variant thereof, and at least one intracellular domain, wherein said intracellular domain comprises at least one primary intracellular immune cell signaling domain and optionally comprises at least one costimulatory intracellular signaling domain.

In some embodiments, the CAR comprises at least one transmembrane domain and at least one intracellular domain, wherein said intracellular domain comprises at least one TNFR2 costimulatory intracellular signaling domain or fragment or variant thereof, and at least one primary intracellular signaling domain immune cell.

The present invention further relates to a nucleic acid sequence encoding a CAR according to the present invention.

The present invention also relates to a vector containing a nucleic acid sequence according to the present invention.

The present invention also relates to a population of immune cells containing a nucleic acid sequence according to the present invention, or a vector according to the present invention, or expressing a CAR according to the present invention. In some embodiments, the immune cell population is selected from the group consisting of T cells, natural killer (NK) cells, γδ T cells, double negative (DN) cells, regulatory immune cells, regulatory T cells, effector immune cells, effector T cells, B cells and myeloid-derived cells, and any combination thereof.

The present invention also relates to a composition containing at least one population of cells according to the present invention. In some embodiments, the composition is a pharmaceutical composition and further comprises at least one pharmaceutically acceptable excipient.

The present invention further provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject at least one cell population or composition according to the present invention. In some embodiments, the method is a cell therapy method. In some embodiments, said diseases or disorders include inflammatory diseases, autoimmune diseases, allergic diseases, organ transplant conditions, cancer, and infectious diseases. In some embodiments, the cell population is a population of regulatory immune cells or a population of Treg cells, and the disease or disorder is an inflammatory disease, an autoimmune disease, an allergic disease, or a post-organ transplant condition (e.g., graft rejection or graft-versus-host disease ). In some embodiments, the immune cell population is a T effector cell population, an NK cell population, or a γδ T cell population, and the disease or disorder is a cancer or an infectious disease.

Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by those skilled in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. In the event of any conflict, this specification, including definitions, governs. In general, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization, and methods of their use, are well known and widely used in the art. Enzymatic reactions and purification procedures are carried out in accordance with the manufacturer's specifications, as is generally done in the art or as described in this application. In addition, unless the context otherwise requires, terms in the singular shall include the plural and terms in the plural shall include the singular. In this description and embodiments, the words “have” and “contain” or variants such as “has”, “having”, “contains” or “comprising” will be understood to include the specified integer or group of integers, but not exclusion of any other integer or group of integers. It is understood that aspects and variations of the invention described herein include “consisting of” and/or “consisting essentially of” aspects and variations. All publications and other references mentioned in this application are incorporated by reference in their entirety. Although a number of documents are cited here, this reference is not an admission that any of these documents form part of the general knowledge in the field

EXAMPLES

The present invention is further illustrated by the following examples.

Example 1: TNFR2-Derived CAR-Tregs

Materials and methods

Isolation of MNKPK

Blood cells from anonymous healthy donors were collected by the Etablissement Français du Sang (EFS) in accordance with EFS guidelines and informed consent from the donors. The day after blood collection, peripheral blood mononuclear cells (PBMCs) were isolated from leukocytes using Ficoll gradient centrifugation, which removes unwanted blood product fractions such as granulocytes, platelets, and remaining contaminants from red blood cells. Cells of interest were then isolated as described below.

Isolation of FoxP3 Treg

CD4 ⁺ CD2 ⁵⁺ CD127 ^low Tregs were isolated using the CD4 ⁺ CD127 ^low CD2 ⁵⁺ Human Regulatory T Cell Isolation Kit (StemCell) following the manufacturer's instructions. Briefly, CD25 ⁺ cells were first isolated from 400-500×10 ⁶ PBMCs by column-free immunomagnetic positive selection using EasySep™ Releasable RapidSpheres™. Bound magnetic particles were then removed from isolated EasySep™ CD25 ⁺ cells and unwanted non-Tregs were depleted. The final isolated fraction contained highly purified CD4 ⁺ CD127 ^low CD25 ⁺ cells that express high levels of FoxP3 and was immediately used for downstream applications.

Isolation of autologous B cells

Autologous CD19 ⁺ CD20 ⁺ B cells were isolated using a human B cell isolation kit (StemCell) following the manufacturer's instructions. Briefly, CD19 ⁺ CD20 ⁺ B cells were isolated from 200×10 ⁶ PBMCs using immunomagnetic negative selection. After isolation, the cells were immediately frozen for later use as CD19 ⁺ CD20 ⁺ presenting cells.

Isolation of conventional CD4 ⁺ CD25 ^- T cells

CD4 ⁺ CD25 ⁻ T cells were isolated by performing an optional protocol from the Regulatory T Cell Isolation Kit (StemCell), allowing the isolation of CD4 ⁺ CD25 ⁻ T cells for use in functional studies in parallel with Tregs.

Activation and cultivation of isolated Tregs

Isolated Treg cells were activated and cultured for 9 days. Briefly, on day 0, Treg cells (0.5 x 10 ⁶ ) were cultured in a 24-well plate (Costar) in serum-free Xvivo15 medium containing human transferrin (OZYME), supplemented with 1000 U/ml IL-2 (Euromedex) and 100 nM rapamycin (Sigma-Aldrich). Polyclonal activation was performed using anti-CD3/anti-CD28 Dynabeads from Life Technology (0.5 x 10 ⁶ beads per well). On days 2, 4 or 5, and 7 or 8, fresh culture medium supplemented with 1000 U/ml IL-2 was added to the cells. Finally, on day 8 or 9, cells were collected, counted, and reactivated.

Transduction protocol

Tregs were transduced with chimeric antigen receptor (see below) 2 days after their activation. Briefly, transduction was performed by loading 0.5×10 ⁷ transduction units (TU) per ml into each well. After 6 hours at 37°C, viral particles were removed by washing. The plates were then incubated at 37°C with 5% CO ₂ . After five days, transduction efficiency was analyzed by measuring the percentage of GFP-positive cells by flow cytometry.

Quantification of CAR expression

Quantification of cell surface expression of CARs was performed by tagging CARs with APC-conjugated protein-L or APC-conjugated anti-hemagglutinin (HA) antibody for HA-tagged CARs and analyzed by flow cytometry.

Quantification of total CAR expression was performed by Western blotting. Briefly, 5 x 10 ⁴ transduced Tregs or non-transduced (blank) Tregs were lysed in RIPA buffer, subjected to SDS-PAGE under denaturing conditions and blotted onto a PVDF membrane. CARs expressing CD3-zeta as well as endogenous CD3-zeta were then stained with a CD3-zeta-specific antibody (anti-CD247, BD Pharmingen). Finally, the membrane was washed and reassayed with anti-β-actin antibody as a loading control. Image J software was used to quantify band intensities.

CAR constructs used for transduction

CARs were constructed consisting of transmembrane (TM) TNFR2, TNFR1 or CD8 and costimulatory intracellular signaling domains in tandem with CD3-zeta, and associated with a prototypical scFv directed against CD19 (FMC63), CD20 (B9E9) and/or IL-23R (14-11-D07; PCT patent publication WO 2016/184570; SEQ ID NO: 65). The constructs used in this study are listed and described in Table 1 and Figure 1.

Table 1: CAR designs

Name CAR scFv TM Costimulatory intracellular signaling domain CD3z CD19-CAR (CD8TM/4-1BB) FMC63 CD8 4-1BB Yes CD19-CAR (TNFR2) FMC63 TNFR2 TNFR2 Yes CD20-CAR (CD8TM/4-1BB) B9E9 CD8 4-1BB Yes CD20-CAR (TNFR2) B9E9 TNFR2 TNFR2 Yes CD20-CAR (TNFR1) B9E9 TNFR1 TNFR1 Yes IL-23R-CAR (CD8TM/4-1BB) 14-11-D07 CD8 4-1BB Yes IL-23R-CAR (TNFR2) 14-11-D07 TNFR2 TNFR2 Yes

More specifically, the anti-CD19 CARs consist of a human CD8 leader sequence (aa1-22), a hemagglutinin tag, scFv FMC63 directed against human CD19, and a linker derived from human CD8alpha (aa138-182).

Following the linker, the CD19-CAR construct (CD8TM/4-1BB) consists of the transmembrane (TM) domain of human CD8-alpha (aa183-206) and the costimulatory intracellular signaling domain of human 4-1BB (aa214-255) and CD3-zeta (aa52 -164); while the CD19-CAR (TNFR2) construct consists of the TM and intracellular domain of human TNFR2 (aa258-461) and CD3-zeta.

Anti-CD20 CARs consist of a human CD8 leader sequence (aa1-22), scFv B9E9 directed against human CD20, a streptavidin tag, and a linker derived from human CD8 alpha (aa138-182).

Following the linker, the CD20-CAR construct (CD8TM/4-1BB) consists of the TM domain of human CD8-alpha (aa183-206) and the costimulatory intracellular signaling domain of human 4-1BB (aa214-255) and CD3-zeta (aa52-164 ); Where:

- the CD20-CAR (TNFR2) construct consists of TM and costimulatory intracellular signaling domains of human TNFR2 (aa258-461) and CD3-zeta; And

- CD20-CAR (TNFR1) consists of the TM and costimulatory intracellular signaling domains of human TNFR1 (aa212-455) and CD3-zeta.

Anti-IL-23R CARs consist of a human CD8 leader sequence (aa1-22), a scFv directed against human IL-23R, and a linker derived from human CD8 alpha (aa138-182).

Following the linker, the IL-23R-CAR construct (CD8TM/4-1BB) consists of the transmembrane domain of human CD8-alpha (aa183-206) and the costimulatory intracellular signaling domain of human 4-1BB (aa214-255) and CD3-zeta (aa52- 164); while the IL-23R-CAR (TNFR2) construct consists of the transmembrane and costimulatory intracellular signaling domain of human TNFR2 (aa258-461) and CD3-zeta.

All CAR constructs were cloned in phase with the P2A linker and enhanced green fluorescent protein (GFP) open reading frame.

Phenotypic analysis of transduced Treg cells

At day 9 of culture, Treg phenotype was analyzed by flow cytometry to ensure that the transduction procedure did not affect Treg status. The markers used for this analysis are listed in Table 2.

Table 2: Materials and reagents

Reagents Manufacturer Cat.No. CD4 VioGreen Miltenyi 130-096-900 Helios eF450 (HamIgG) eBioscience 48-9883-42 CD25 PE Miltenyi 130-109-020 CD152 (CTLA-4) PE/Cy7 (mIgG2a) Biolegend 369614 FoxP3 AF647 (mIgG1; 2 µl) BD 560045 CD127-APC-Vio770 Miltenyi 130-109-438

CAR activation assay

CAR activation was assessed in either the Jurkat-Lucia-NFAT cell line (Invivogen) or primary human Tregs. For the reporter cell line, after CAR interaction with CD19 ⁺ Daudi cells (1:1 ratio), NFAT activation was assessed by monitoring Lucia luciferase activity (see manufacturer's instructions) and using a GloMax luminometer (Promega).

For Tregs, activation analysis was performed on day 9 of culture. Briefly, 0.05 x 10 ⁶ Tregs were seeded into a 96-well round bottom plate alone or in the presence of anti-CD28/anti-CD3 coated beads (at a 1:1 ratio of Tregs to beads) or in the presence of freshly thawed autologous B cells or CD19 ⁺ Daudi B cells (at a 1:1 ratio of Treg to B cells) in a final volume of 200 μl. After 24 hours at 37°C, 5% CO ₂ cells were stained for CD4 and CD69 and then analyzed by flow cytometry. Monitoring the spontaneous expression of CD69 CAR Treg cells compared with non-transduced Treg cells allows us to determine the intensity of tonic signaling.

T Cell Proliferation Suppression Assay

Suppression analysis was performed on day 9 of cultivation. Briefly, Tregs were retrieved, enumerated, and activated either via TCR using anti-CD28/anti-CD3-coated beads (1:1 Treg to bead ratio) or via CAR using fresh-thawed autologous B cells (1:1 ratio Tregs to granules) or were left without activation to assess their spontaneous suppressive activity.

In parallel, allogeneic Tconv (conventional T cells) were thawed, stained with Dye 450, and activated with anti-CD28/anti-CD3-coated beads (3:1 Tconv to bead ratio). The next day, beads were removed from Tconvs before being co-cultured with non-activated or activated Treg cells (non-transduced or transduced).

On day 3, cells were harvested and Tconv proliferation was assessed by flow cytometry by determining a 450 dye dilution. The percentage inhibition of Tconv proliferation was calculated as follows:

results

Transduction efficiency and cell surface expression of CARs

Transduction efficiency was determined by assessing the percentage of GFP-positive cells, and CAR expression was monitored by assessing recombinant kappa light chain-binding immunoglobulin protein L for CD20-CAR (CD8TM/4-1BB and TNFR2) and IL-23R CAR (CD8TM/4 -1BB and TNFR2) or an antibody directed against the HA tag for CD19-CAR (CD8TM/4-1BB and TNFR2).

Results for the percentage of transduction efficiency and the percentage of transduced cells that expressed CAR on the cell surface are shown in Table 3 (Figure 2 shows an example of raw data) as an overview of all donors tested in this example (n = 5).

Table 3: Transduction efficiency and cell surface expression of CAR

CAR designs CD19-CAR (CD8TM/
4-1BB) CD19-CAR (TNFR2) CD20-CAR (CD8TM/
4-1BB) CD20-CAR (TNFR2) IL-23R-CAR (CD8TM/
4-1BB) IL-23R-CAR (TNFR2) TU/ml for transduction 5x10 ⁶ 2x10 ⁶ 2x10 ⁶ 5x10 ⁶ Transduction efficiency, % 71.4 ± 2.4 65.3 ± 2.0 62 ± 2.7 66 ± 0.1 54.4 ± 7.7 47.2 ± 4.1 Expression of CAR on the cell surface, % 96.2 ± 0.15 46.8 ± 2.5 98 ± 0.1 74.3 ± 8 97.2 ± 1.4 74.1 ± 8.9 MFI CAR 47.9 ± 0.3 3.2 ± 0.4 92.5 ± 13.5 16.5 ± 6.4 191.1 ± 53.2 20.5 ± 3.4

As shown in Figure 2 and/or Table 3, CD19-CAR (CD8TM/4-1BB), CD20-CAR (CD8TM/4-1BB), and IL-23R-CAR (CD8TM/4-1BB) transduced cells contained more 95% CAR at the cell surface, whereas cells transduced with CD19-CAR (TNFR2), CD20-CAR (TNFR2), and IL-23R-CAR (TNFR2) expressed 46% to 75% CAR at the cell surface. Additionally, mean fluorescence intensity (MFI), representing the number of CARs per cell, was reduced by approximately 15-fold for CD19-CAR (TNFR2), approximately 6-fold for CD20-CAR (TNFR2), and approximately 9-fold for IL-23R -CAR (TNFR2). This strong reduction in cell surface CAR expression was not a consequence of lower transduction efficiency, since GFP expression was comparable in all experimental conditions.

In addition, as shown in Figure 3, panel A, cells transduced with CD20-CAR (CD8TM/4-1BB) expressed a 62 kDa protein corresponding to CAR after staining with anti-CD3-zeta antibody, and an 82 kDa protein for cells transduced CD20-CAR (TNFR2), while non-transduced cells were labeled only by the 16 kDa band corresponding to endogenous CD3-zeta. Interestingly, quantification of band intensity revealed lower expression of CD20-CAR (TNFR2) compared to CD20-CAR (CD8TM/4-1BB) (Figure 3, panel B), as observed by flow cytometry (Figure 2).

In summary, the results demonstrated that the intracellular domain of TNFR2 and the transmembrane domain of TNFR2 unexpectedly led to decreased global CAR expression, especially at the cell surface.

CAR-specific activation

A complete reduction in antigen-independent tonic signaling was observed in Treg cells transduced with CARs containing TNFR2 domains for three different scFv targets (CD19, CD20, and IL-23R), compared with classical 4-1BB/CD3-zeta constructs (Figure 4 , AC panels). Moreover, despite the strong reduction in cell surface expression of TNFR2-derived CARs (CD19, CD20, or IL-23R) (Table 3), CAR-specific activation persists.

In summary, these results demonstrate that the presence of transmembrane TNFR2 and the intracellular domain of TNFR2 unexpectedly led to a strong reduction in background activation in CAR Treg cells and consequently to an increase in the ratio between CAR-specific activation and ligand-independent tonic signaling. This phenomenon is independent of the scFv of interest, as three different scFvs were tested and behaved similarly (CD19, CD20, and IL-23R).

CAR-mediated suppressor activity

For the CD19-CAR construct harboring TNFR2-derived domains, CAR-specific triggering of suppressor activity comparable to that of the 4-1BB-derived construct was observed even with a 15-fold reduction in cell surface CAR expression. (Figure 5, panel A).

Most interestingly, in the case of the CD20-CAR and IL-23R-CAR constructs, while the spontaneous suppressor activity of the 4-1BB-derived construct was too strong to isolate the CAR-mediated suppressor activity of the TNFR2-derived construct CAR provided a greatly reduced background of suppressor activity, allowing the observation of specific CAR-mediated suppressor activity for the first time (Figure 5, panels B and 5C).

In conclusion, reduction of ligand-independent tonic signaling in TNFR2/CD3-zeta-derived CARs allowed for the first observation of CD20-CAR and IL-23R-CAR-mediated suppressive activity while the same scFvs hybridized to domain 4 -1BB/CD3 zeta did not show noticeable activity compared to background.

Example 2: Comparison of TNFR2-Derived CD19-CARs

Materials and methods

Except for the CAR constructs, materials and methods are the same as described in Example 1. Here, two cell types were transduced with CAR constructs: human Tregs and Jurkat-Lucia-NFAT cells.

CAR constructs used for transduction

The CAR constructs used in this study are listed and described in Table 4 and Figure 6 .

Table 4: CD19-CAR constructs

Name CAR scFv TM Costimulatory intracellular signaling domain CD3z CD19-CAR (CD8TM/4-1BB) FMC63 CD8 4-1BB Yes CD19-CAR (TNFR2) FMC63 TNFR2 TNFR2 Yes CD19-CAR (TNFR2 δ18) FMC63 TNFR2 TNFR2δ18 Yes CD19-CAR (TNFR2 δ59) FMC63 TNFR2 TNFR2δ59 Yes CD19-CAR (TNFR2 δ104) FMC63 TNFR2 TNFR2δ104 Yes CD19-CAR (TNFR2 δ151) FMC63 TNFR2 TNFR2δ151 Yes CD19-CAR (without) FMC63 TNFR2 Absent Yes CD19-CAR (CD8TM/TNFR2) FMC63 CD8 TNFR2 Yes CD19-CAR (Hybrid 1+ TNFR2) FMC63 Hybrid 1 CD8/TNFR2 TNFR2 Yes CD19-CAR (Hybrid 2+ TNFR2) FMC63 Hybrid 2 CD8/TNFR2 TNFR2 Yes CD19-CAR (Hybrid 3 +TNFR2) FMC63 Hybrid 3 CD8/TNFR2 TNFR2 Yes

Anti-CD19 CARs consist of a human CD8 leader sequence (aa1-22), scFv FMC63 directed against human CD19, a streptavidin tag, and a linker derived from human CD8 alpha (aa138-182).

In some cases, the TNFR2 costimulatory intracellular signaling domain is a fragment of the TNFR2 domain from which 18, 59, 104, or 151 amino acid residues have been removed at the C terminus (δ18, δ59, δ104, or δ151, respectively). The TNFR2 signaling domain can be divided into 5 domains, each of which is important for interacting with different signaling molecules to trigger different signaling pathways. In addition, specific domains have been described to modulate TNFR2 endocytosis (Ji et al., Arterioscler Thromb Vasc Biol. 32 (9): 2271-9 (2012). To analyze whether a specific domain is responsible for the corresponding phenotype, several deletion mutants were constructed Deletions were performed in conjunction with mapped intracellular domains, removing TNFR2 domains from the C terminus. Specifically, domain V was deleted in the TNFR2 δ18 construct; domains V and IV in TNFR2 δ59; domains V, IV, and III in TNFR2 δ104, and domains V , IV, III and II in TNFR2 δ151. The putative functions of these domains are listed in Table 5:

Table 5: TNFR2 Domains

Domain Intended function I Unknown II Activation, localization of JNK III Activation, localization of JNK; TRAF2 degradation IV TRAF1/2/3 binding V Bmx, tyrosine kinases/ Akt activation/ contribution to Traf2 binding/ NFkb signaling

To further analyze the influence of the TNFR2 transmembrane domain, a construct containing CD8 TM followed by the TNFR2 transmembrane domain was generated, as well as constructs containing only TNFR2 TM followed by CD3 zeta or membrane hybrids consisting of varying amounts of CD8-derived amino acids and TNFR2.

Transmembrane domain hybrids consist of the entire domain or part of the human CD8alpha transmembrane domain fused to part of the human TNFR2 transmembrane domain. The hybrid amino acid sequences used in Example 2 are described in Table 6.

Table 6: CD19-CAR transmembrane fusion sequence

Hybrid sequence name CD8 sequence TNFR2 sequence Hybrid 1 IYIWAPLAGTCGVLLLSLVIT (SEQ ID NO: 59) CVIMTQV
(SEQ ID NO: 62) Hybrid 2 IYIWAPLAGTCGVLLLSLVIT
(SEQ ID NO: 60) VNCVIMTQV
(SEQ ID NO: 63) Hybrid 3 IYIWAPLAG
(SEQ ID NO: 61) TALGLLIIGVVNCVIMTQV
(SEQ ID NO: 64)

results

Expression of CD19-CAR on human Treg cell surface

CD19-CARs containing the TNFR2 transmembrane domain and, optionally, the complete TNFR2 costimulatory intracellular signaling domain or fragments thereof were used to determine whether the TNFR2 costimulatory intracellular signaling domain is involved in the reduction of cell surface CAR expression. CD19-CARs containing the CD8 transmembrane domain and the 4-1BB intracellular domain were used as controls.

CD19-CARs containing the TNFR2 costimulatory intracellular signaling domain and, optionally, the TNFR2 transmembrane domain or the CD8/TNFR2 hybrid transmembrane domain were used to determine whether the TFNR2 transmembrane domain is involved in the reduction of cell surface CAR expression. CD19-CARs containing the costimulatory intracellular signaling domain of TNFR2 and the transmembrane domain of CD8 were used as controls.

As shown in Table 7, decreased cell surface expression of CARs was observed with CARs containing the TNFR2 transmembrane domain as well as with CARs containing the TNFR2 intracellular domain, but was not observed with CARs containing the CD8 transmembrane domain and the 4-1BB intracellular domain in the absence of either -or TNFR2 domains.

Table 7: CD19-CAR Cell Surface Expression of Human Tregs Without Activation

CAR designs Transduced cells (%GFP ⁺ ) Surface expression of CAR, % (MFI) CD19-CAR (CD8TM/4-1BB) 52% 76% (33) CD19-CAR (TNFR2) 59% 22% (2) CD19-CAR (TNFR2 δ18) 73% 30% (3) CD19-CAR (TNFR2 δ59) 73% 25% (2) CD19-CAR (TNFR2 δ104) 78% 23% (3) CD19-CAR (TNFR2 δ151) 82% 52% (12) CD19-CAR (without) 84% 70% (17) CD19-CAR (CD8TM/TNFR2) 74% 80% (25) CD19-CAR (Hybrid 1+ TNFR2) 73% 78% (19) CD19-CAR (Hybrid 2+TNFR2) 64% 28% (2) CD19-CAR (Hybrid 3+TNFR2) 70% 27% (2)

Overall, these results demonstrate that the transmembrane and costimulatory intracellular signaling domains of TNFR2 are involved in the downregulation of CAR cell surface expression of human Treg cells.

CD19-CAR-specific activation of human Tregs

CD19-CARs containing the TNFR2 transmembrane domain and, optionally, the complete TNFR2 costimulatory intracellular signaling domain or fragments thereof were used to determine whether the TNFR2 costimulatory intracellular signaling domain is involved in CAR activation. CD19-CARs containing the 4-1BB costimulatory intracellular signaling domain and the CD8 transmembrane domain were used as controls.

CD19-CARs containing the TNFR2 costimulatory intracellular signaling domain and, optionally, a TNFR2 transmembrane domain or a hybrid CD8/TNFR2 transmembrane domain were used to determine whether the TFNR2 transmembrane domain is involved in CAR activation. CD19-CARs containing the 4-1BB costimulatory intracellular signaling domain and the CD8 transmembrane domain were used as controls.

As shown in Table 8, decreased tonic signaling, as assessed by expression levels of the early activation marker CD69, was observed with CARs containing the TNFR2 costimulatory intracellular signaling domain and hybrid CD8/TNFR2 transmembrane domains, but not with CARs containing the CD8 transmembrane domain/costimulatory intracellular domain. signaling domain 4-1BB. Despite their low expression levels, TNFR2-derived CARs were efficiently activated by CD19 ⁺ Daudi cells. In non-transduced cells, the CD69 expression background is 9% in the absence or 32% in the presence of Daudi cells.

Table 8: CD19-CAR activation in human Tregs.

CAR designs %CD69 ⁺ before/after CAR ligand binding CD19-CAR (CD8TM/4-1BB) 20% / 79% CD19-CAR (TNFR2) 12% / 59% CD19-CAR (TNFR2 δ18) 11% / 59% CD19-CAR (TNFR2 δ59) 16% / 65% CD19-CAR (TNFR2 δ104) 19% / 81% CD19-CAR (TNFR2 δ151) 23% / 74% CD19-CAR (without) 20% / 75% CD19-CAR (CD8TM/TNFR2) 13% / 70% CD19-CAR (Hybrid 1+ TNFR2) 14% / 70% CD19-CAR (Hybrid 2+TNFR2) 8% / 67% CD19-CAR (Hybrid 3+TNFR2) 11% / 61%

Expression of CD19-CAR on the surface of Jurkat-T cells

As with human Treg cells, CD19-CAR expression was also analyzed in Jurkat-Lucia-NFAT cells using the CAR constructs described in Table 5. This reporter cell line is derived from immortalized human Jurkat T cells.

As shown in Table 9, decreased cell surface expression of CARs was also observed in Jurkat-T cells with CARs containing the TNFR2 transmembrane domain, as well as with CARs containing the TNFR2 costimulatory intracellular signaling domain, but not with CARs containing the costimulatory intracellular signaling domain construct CD8/4-1BB transmembrane domain.

Table 9: CD19-CAR expression on the surface of Jurkat-T cells without activation

CAR designs Transduced cells (%GFP ⁺ ) CAR labeling among GFP ⁺ cells, % (MFI) CD19-CAR (CD8TM/4-1BB) 88% 81% (104) CD19-CAR (TNFR2) 89% 31% (7) CD19-CAR (TNFR2 δ19) 83% 20% (6) CD19-CAR (TNFR2 δ59) 90% 34% (5) CD19-CAR (TNFR2 δ104) 95% 29% (10) CD19-CAR (TNFR2 δ151) 94% 52% (37) CD19-CAR (without) 95% 77% (53) CD19-CAR (CD8TM/TNFR2) 80% 54% (51) CD19-CAR (Hybrid 1+ TNFR2) 77% 45% (34) CD19-CAR (Hybrid 2+TNFR2) 75% 19% (6) CD19-CAR (Hybrid 3+TNFR2) 72% 16% (5)

These results demonstrate that the transmembrane domain of TNFR2 and the costimulatory intracellular signaling domain of TNFR2 are involved in the downregulation of CAR expression on the surface of Jurkat T cells.

TNFR-c-terminal deletion constructs exhibit different surface expression patterns and are functional in CD3z signaling in Jurkat-NFAT cells.

To verify the integrity of the generated CD19-CAR constructs, surface expression levels and NFAT signaling were analyzed in the Jurkat NFAT-Lucia T cell line.

A strong reduction in cell surface expression was observed with the full TNFR2 CAR compared to the CD8TM-41BB CAR (Figure 7). This reduction in expression levels was partially reversed when the TNFR2-TM domain was replaced by the CD8 TM domain. In addition, deletion of domains V, IV, and III of TNFR2 did not alter the cell surface expression detected from the complete TNFR2 domain. However, after deletion of domains II and I, expression levels increased to half the levels observed with the 4-1BB construct. At the same time, all constructs continued to demonstrate target-dependent NFAT signaling. These results together indicate that domains I and II of TNFR2 contribute to the reduced cell surface expression of TNFR2-derived CARs and that the reduced effect of the deletion mutant is not due to the unfolded protein, since the CAR can still exhibit CD3z-dependent signaling NFAT.

CD19-CAR-specific activation in Jurkat-T cells

CD19-CAR-specific activation was also analyzed in Jurkat-Lucia-NFAT cells by measuring NFAT activation upon interaction with CAR ligand after incubation with CD19+ Daudi cells.

As shown in Table 10, despite low expression levels, all TNFR2-derived CARs are efficiently activated by CD19+ Dowdy cells.

Table 10: CD19-CAR activation of Jurkat-Lucia-NFAT cells

CAR designs NFAT activation following CAR ligand binding (normalized light units) CD19-CAR (CD8TM /4-1BB) 100 CD19-CAR (TNFR2) 73 CD19-CAR (TNFR2 δ19) 72 CD19-CAR (TNFR2 δ59) 73 CD19-CAR (TNFR2 δ104) 114 CD19-CAR (TNFR2 δ151) 103 CD19-CAR (without) 96 CD19-CAR (CD8TM/TNFR2) 101 CD19-CAR (Hybrid 1+ TNFR2) 74 CD19-CAR (Hybrid 2+TNFR2) 51 CD19-CAR (Hybrid 3+TNFR2) 64

Example 3: Evaluation of anti-CD20 CARs carrying different transmembrane and intracellular signaling domains derived from different TNFR receptors (4-1BB, TNFR1 and TNFR2)

Materials and methods

The materials and methods used were the same as described in Example 1.

results

Expression level of anti-CD20 CARs carrying different intracellular TNFR domains

Previously and in the present study, a decrease in anti-CD20 CAR expression was observed for the construct bearing the transmembrane and intracellular domain of TNFR2 compared with the construct bearing the intracellular domain of 4-1BB (Fig. 8). In this study, novel CARs containing TNFR-derived signaling domains were constructed using the transmembrane and intracellular domain of human TNFR1 (the nucleotide and amino acid sequences of CD20-CAR (TNFR1TM-TNFR1-CD3z)-P2A-GFP are SEQ ID NO: 108 and 109, respectively). As shown in Figure 8, these novel CARs are also expressed at low levels on the cell surface compared to the 4-1BB-derived CARs. However, a CAR containing a TNFR1-derived sequence is toxic and strongly affects FoxP3 Treg survival (63% survival). In addition, live/apoptotic cells expressed TNFR1-derived CAR in a diffuse pattern (Figure 8, lower left panel).

Ligand-independent tonic signaling and activation capacity of anti-CD20 CARs bearing different intracellular TNFR domains

By monitoring CD69 marker expression on non-activated CAR-Treg cells, strong ligand-independent tonic signaling was previously observed with an anti-CD20 CAR construct bearing the 4-1BB intracellular domain. In contrast, this tonic signaling was strongly reduced for the anti-CD20 CAR bearing the transmembrane and intracellular domain of TNFR2. The present study shows that among all TNFR-derived CARs (Figure 9), only TNFR2-derived CAR was able to strongly reduce tonic signaling (15% compared to 11% in control), while constructs containing the 4-1BB and TNFR1 sequences provide tonic signaling of approximately 40% and 32%, respectively. This result highlights the ability of TNFR2-derived CARs to specifically reduce ligand-independent tonic signaling.

To assess CAR activation, CAR-Treg cells were incubated for 24 hours with autologous B cells expressing CD20 CAR ligand. As shown in Figure 9 , the strongest CAR activation was observed for TNFR2-derived CARs (2.5-fold), while all other CAR-Tregs were weakly activated (less than 1.8-fold).

The suppressor activity of CAR-Treg cells was assessed by monitoring the proliferation of Tconv cells co-cultured with CAR-Tregs in the absence or presence of B cells (B cells) (Figure 10). Again, the spontaneous suppressive activity of the classical anti-CD20 CAR construct (CD8 TM/4-1BB) was too strong to isolate CAR-mediated suppressive activity. In contrast, TNFR2-derived anti-CD20 CAR allowed observation of CAR-mediated suppressive activity. The TNFR1-derived anti-CD20 CAR exhibited very weak suppressive activity.

To better define and compare the potency of different TNFR-derived CARs, the ability to suppress Tconv proliferation was plotted as a function of the absolute number of CAR-Treg cells present in the coculture. As shown in Figure 11, TNFR1-derived CAR was extremely ineffective (14,750 CAR-Tregs to trigger 50% suppression).

These results demonstrate that among various human TNFR candidates, the use of transmembrane TNFR2 and TNFR2 costimulatory intracellular signaling domains in CARs is the optimal combination to generate CAR-Tregs with very low ligand-independent tonic signaling and optimal CAR-dependent Treg activation and suppressive activity.

Example 4: Treg Markers/Phenotype

Materials and methods

The materials and methods used were the same as described in Example 1.

results

Anti-IL-23R CAR-Treg phenotype in culture

The results for the IL-23R CAR-Treg phenotype on day 9 are presented in the following table (Table 11). Results are expressed as the percentage of cells positive for each marker.

Table 11: IL-23R CAR-Treg Phenotype at Day 9

Treg Transduction CD4 CD25 FoxP3 Helios CD62L CD127 1132 GFP 85.8 96.2 93.9 72.2 89.5 3.7 CAR
(4-1BB/CD3z) 47.62 95.5 81.9 18.2 75.9 23.9 1133 GFP 65.6 95.0 87.9 68.3 89.5 3.6 CAR
(4-1BB/CD3z) 57.7 97.8 89.2 59.8 71.2 15.2 1137 GFP 94.48 97.8 94.8 55.1 93.9 3.1 CAR (TNFR2/CD3z) 94.25 98.5 96.3 66.6 93.3 3.3 1139 GFP 90.53 97.6 94.9 51.4 95.4 2.1 CAR (TNFR2/CD3z) 92.73 97.8 95.3 54.5 94.1 2.8 1142 GFP 93.9 94.8 85.8 30.6 82.6 eleven CAR
(4-1BB/CD3z) 88.7 96.0 64.8 34.6 76.4 22 CAR (TNFR2/CD3z) 93.7 65.6 74.9 38.0 79.5 14.5 1144 GFP 93.2 96.4 78.0 31.8 96.6 10.8 CAR
(4-1BB/CD3z) 86.7 95.9 50.8 23.7 70.7 25.9 CAR (TNFR2/CD3z) 92.7 96.0 62.5 31.1 89.0 10.7 1148 GFP 89.4 95 95.3 63.4 ND 3.7 CAR
(4-1BB/CD3z) 81.1 94.1 95.1 60.4 5.1 CAR (TNFR2/CD3z) 90 94.7 95.0 64.6 4.2 1149 GFP 89.5 95.2 95.1 66.3 3.4 CAR
(4-1BB/CD3z) 73.3 93.3 92.8 66.0 9.8 CAR (TNFR2/CD3z) 91.2 95.5 92.5 61.2 5.7

Interestingly, we observed that Tregs transduced with IL-23R-CAR (4-1BB/CD3z), which is highly expressed on the cell surface, exhibited loss of stability, highlighted by a decrease in FoxP3, Helios, and CD62L (bold) and an increase in CD127 (bold). font). However, Tregs transduced with IL-23R-CAR (TNFR2/CD3z) exhibited a 9-fold reduction in cell surface expression (191.1 ± 53.2 for 4-1BB-derived CAR vs. 20.5 ± 3. 4 for TNFR2-derived CAR; see Table 3), highlighting the robust Treg phenotype after 9 days of culture.

Anti-CD20 CAR-Treg phenotype in culture

The results for the anti-CD20 CAR-Treg phenotype at day 15 are presented in the following table (Table 12). Results are expressed as percentage or mean fluorescence of positive cells for each marker.

Table 12: Anti-CD20 CAR-Treg Phenotype

Day 15 (n=3) CD25% (in CD4+ population) CD127% (in the CD4+CD25+ population) FoxP3 MFI (in CD4+ population) %Helios+
(in the FoxP3+ population) % CTLA-4+ (in CD4+CD25+ population) UT 79.5 ± 6.4 0.8±0.1 11.5 ± 1.5 62.1 ± 4.4 75.4 ± 7.3 GFP 80.6 ± 3.8 0.9 ± 0.1 11.1 ± 1.3 61.3 ± 2.7 74.7 ± 9.1 4-1BB 69.9 ± 4.9 0.9 ± 0.1 10.9 ± 1.0 67.2 ± 1.2 60.4 ± 5.3 TNFR2 72.9 ± 2.5 0.8±0.0 11.3 ± 1.3 72.9 ± 2.4 63.0 ± 5.4

Interestingly, the Treg phenotype is not statistically different between different CAR-Treg constructs and controls transduced with GFP alone.

Example 5: Use of CAR-Treg in Vivo

Materials and methods

GVHD

The day before injection of human HLA-A2 ⁺ PBMCs, a total of 23 NSG mice (8 weeks old) were conditioned with an intraperitoneal injection of busulfan 30 mg/kg to promote human cell engraftment. Every other day (day 0), mice were intravenously injected with human HLA-A*02 ⁺ PBMCs (5×10 ⁶ PBMCs per mouse) and human HLA-A2 CAR Tregs in a 1:1 ratio of PBMCs: CAR-Tregs. Three times a week, mice were weighed (BW) and GVHD was assessed. Blood samples were taken every week. At sacrifice, the spleen and lungs were also analyzed. Human Tregs were isolated from HLA-A2-negative healthy volunteers and transduced as previously described.

results

CAR Tregs containing CD28, TNFR2, or TNFR2+ 4-1BB co-signaling domains were tested for their activity in vivo in a mouse model of GVHD. Three different CAR constructs (Figure 12) were transduced into CD4 ⁺ CD25 ⁺ CD127 ^low , CD45RA ⁺ human Tregs as described previously.

Transduction efficiency was assessed by the percentage expression of GFP-positive cells, and CAR expression was monitored using Dextramer®. As shown in Figure 13, Tregs were 27%, 56%, and 34% transduced with CD28 or TNFR2 or TNFR2+4-1BB HLA*A2 CAR, respectively.

Three different HLA*A2 CAR-Tregs showed a robust Treg CD4 ⁺ CD45RA ⁺ FoxP3 ⁺ CTLA-4 ⁺ phenotype (Figure 14).

HLA*A2 CAR-Treg was injected into NSG mice in a 1:1 ratio (PBMC: CAR-Treg). All HLA*A2 CAR-Tregs containing TNFR2, TNFR2+4-1BB or CD28 co-signaling domains were able to control GVHD (Figure 15).

Table 13. Sequences

SID ¹ Type ² Description 1-2 aa anti-CD19 scFv 3-6 aa anti-CD20 scFv 7 aa anti-desmo 3 (domains 1-4) 8-11 aa linkers 12 nt linker 13 aa KIR ₂ DS ₂ hinged domain 14 aa CD8 hinge domain 15 nt CD8 hinge domain 16 aa IgG4 hinge domain 17 nt IgG4 hinge domain 18 aa IgD hinge domain 19 nt IgD hinge domain 20 aa CD28 hinge domain 21 nt CD28 hinge domain 22 aa TNFR2 transmembrane domain 23 nt TNFR2 transmembrane domain 24 aa CD8 transmembrane domain 25 nt CD8 transmembrane domain 26 aa CD28 transmembrane domain 27 nt CD28 transmembrane domain 28-31 aa CD3 zeta intracellular signaling domain 32-33 nt CD3 zeta intracellular signaling domain 34 aa TNFR2 intracellular domain 35 nt TNFR2 intracellular domain 36 aa 4-1BB intracellular domain 37 nt 4-1BB intracellular domain 38 aa CD27 intracellular domain 39 nt CD27 intracellular domain 40 aa CD28 intracellular domain 41 nt CD28 intracellular domain 42 aa CD8 leader sequence 43-44 aa TAG 45 aa P2A TAG 46 aa GFP TAG 47 aa Streptavidin tag 48 aa CD8 H-TNFR2 TM-TNFR2-3z 49 aa CD8 H-TNFR2 TM-TNFR2δ18-3z 50 aa CD8 H-TNFR2 TM-TNFR2δ59-3z 51 aa CD8 H-TNFR2 TM-TNFR2δ104-3z 52 aa CD8 H-TNFR2 TM-3z 53 aa CD8 H-3z-TNFR2TM 54 aa CD8 H-CD8 TM- TNFR2-3z 55 aa CD8 H-FUSED 1 TM-TNFR2-3z 56 aa CD8 H-FUSED 2 TM-TNFR2-3z 57 aa CD8 H-FUSED 3TM-TNFR2-3z 58 aa LAGLIDADG motive 59 aa Hybrid 1 - CD8 SEQ 60 aa Hybrid 2 - CD8 SEQ 61 aa Hybrid 3 - CD8 SEQ 62 aa Hybrid 1 - TNFR2 SEQ 63 aa Hybrid 2 - TNFR2 SEQ 64 aa Hybrid 3 - TNFR2 SEQ 65-67 aa anti-IL-23R scFv 68-107 aa anti-HLA-A2 scFv 108 nt CD20-CAR (TNFR1TM-TNFR1-CD3z)-P2A-GFP 109 aa CD20-CAR (TNFR1TM-TNFR1-CD3z)-P2A-GFP 110 aa CD8 H-TNFR2 TM-TNFR2δ151-3z 111-117 aa linkers

¹ - SID: SEQ ID NO: ² - aa: amino acid, nt: nucleotide

--->

SEQUENCE LISTING

<110> SANGAMO THERAPEUTICS FRANCE

<120> NEW CAR CONSTRUCTS COMPRISING TNFR2 DOMAINS

<130> 025297.WO003

<140>

<141>

<150> 62/717.234

<151> 2018-08-10

<160> 117

<170> Patent In version 3.5

<210> 1

<211> 242

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-CD19 ScFv"

<400> 1

Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile

35 40 45

Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln

65 70 75 80

Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Lys Leu Gln Glu

115 120 125

Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys

130 135 140

Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg

145 150 155 160

Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser

165 170 175

Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile

180 185 190

Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln

195 200 205

Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly

210 215 220

Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val

225 230 235 240

Ser Ser

<210> 2

<211> 245

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="FMC63"

<400> 2

Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile

35 40 45

Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln

65 70 75 80

Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val Lys

115 120 125

Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser

130 135 140

Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser

145 150 155 160

Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile

165 170 175

Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu

180 185 190

Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn

195 200 205

Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr

210 215 220

Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser

225 230 235 240

Val Thr Val Ser Ser

245

<210> 3

<211> 245

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="RITUXIMAB"

<400> 3

Ser Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro

1 5 10 15

Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Leu Ser Phe

20 25 30

Met His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile

35 40 45

Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala

65 70 75 80

Glu Asp Ala Ala Thr Tyr Phe Cys His Gln Trp Ser Ser Asn Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Ser Gly Gly Gly

100 105 110

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Gln Val

115 120 125

Gln Leu Arg Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala Ser Val

130 135 140

Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Asn Met

145 150 155 160

His Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp Ile Gly Ala

165 170 175

Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe Lys Gly

180 185 190

Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln

195 200 205

Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg

210 215 220

Ser His Tyr Gly Ser Asn Tyr Val Asp Tyr Trp Gly Gln Gly Thr Thr

225 230 235 240

Leu Thr Val Ser Ser

245

<210> 4

<211> 271

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-CD20 ScFv"

<400> 4

Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Leu Ser Phe Met

20 25 30

His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr

35 40 45

Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Thr Val Glu Ala Glu

65 70 75 80

Asp Ala Ala Ser Tyr Phe Cys His Gln Trp Ser Ser Asn Pro Leu Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Ile Ser Ser Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Asp Val Met Gly Val Asp Ser Gly Gly Gly

115 120 125

Leu Val Gln Pro Gly Gly Ser Arg Lys Leu Ser Cys Ala Ala Pro Gly

130 135 140

Phe Thr Phe Ser Ser Phe Gly Met His Trp Val Arg Gln Ala Pro Glu

145 150 155 160

Lys Gly Leu Glu Trp Val Ala Tyr Ile Ser Ser Pro Ser Ser Thr Leu

165 170 175

His Tyr Ala Asp Arg Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn

180 185 190

Pro Lys Asn Thr Leu Phe Leu Gln Met Lys Leu Pro Ser Leu Cys Tyr

195 200 205

Gly Leu Leu Gly Pro Arg Asp His Val His Arg Leu Leu Lys His His

210 215 220

His His His His Leu Glu Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Thr

225 230 235 240

Thr Asp Ala Ala His Pro Gly Arg Ser Val Val Pro Ala Leu Leu Pro

245 250 255

Leu Leu Ala Gly Thr Leu Leu Leu Leu Glu Thr Ala Thr Ala Pro

260 265 270

<210> 5

<211> 249

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-CD20 ScFv"

<400> 5

Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Leu Val Lys Pro Gly

1 5 10 15

Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser

20 25 30

Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp

35 40 45

Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys

50 55 60

Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala

65 70 75 80

Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr

85 90 95

Cys Ala Arg Ala Gln Leu Arg Pro Asn Tyr Trp Tyr Phe Asp Val Trp

100 105 110

Gly Ala Gly Thr Thr Val Thr Val Ser Lys Ile Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Ser Ser Asp

130 135 140

Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu

145 150 155 160

Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met His

165 170 175

Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala

180 185 190

Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly

195 200 205

Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp

210 215 220

Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ile Ser Asn Pro Pro Thr Phe

225 230 235 240

Gly Ala Gly Thr Lys Leu Glu Leu Lys

245

<210> 6

<211> 245

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-CD20 ScFv"

<400> 6

Ser Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro

1 5 10 15

Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Leu Ser Phe

20 25 30

Met His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile

35 40 45

Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala

65 70 75 80

Glu Asp Ala Ala Thr Tyr Phe Cys His Gln Trp Ser Ser Asn Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Ser Gly Gly Gly

100 105 110

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Gln Val

115 120 125

Gln Leu Arg Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala Ser Val

130 135 140

Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Asn Met

145 150 155 160

His Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp Ile Gly Ala

165 170 175

Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe Lys Gly

180 185 190

Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln

195 200 205

Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg

210 215 220

Ser His Tyr Gly Ser Asn Tyr Val Asp Tyr Trp Gly Gln Gly Thr Thr

225 230 235 240

Leu Thr Val Ser Ser

245

<210> 7

<211> 441

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-desmo 3 (domain 1-4)"

<400> 7

Glu Trp Val Lys Phe Ala Lys Pro Cys Arg Glu Gly Glu Asp Asn Ser

1 5 10 15

Lys Arg Asn Pro Ile Ala Lys Ile Thr Ser Asp Tyr Gln Ala Thr Gln

20 25 30

Lys Ile Thr Tyr Arg Ile Ser Gly Val Gly Ile Asp Gln Pro Pro Phe

35 40 45

Gly Ile Phe Val Val Asp Lys Asn Thr Gly Asp Ile Asn Ile Thr Ala

50 55 60

Ile Val Asp Arg Glu Glu Thr Pro Ser Phe Leu Ile Thr Cys Arg Ala

65 70 75 80

Leu Asn Ala Gln Gly Leu Asp Val Glu Lys Pro Leu Ile Leu Thr Val

85 90 95

Lys Ile Leu Asp Ile Asn Asp Asn Pro Pro Val Phe Ser Gln Gln Ile

100 105 110

Phe Met Gly Glu Ile Glu Glu Asn Ser Ala Ser Asn Ser Leu Val Met

115 120 125

Ile Leu Asn Ala Thr Asp Ala Asp Glu Pro Asn His Leu Asn Ser Lys

130 135 140

Ile Ala Phe Lys Ile Val Ser Gln Glu Pro Ala Gly Thr Pro Met Phe

145 150 155 160

Leu Leu Ser Arg Asn Thr Gly Glu Val Arg Thr Leu Thr Asn Ser Leu

165 170 175

Asp Arg Glu Gln Ala Ser Ser Tyr Arg Leu Val Val Ser Gly Ala Asp

180 185 190

Lys Asp Gly Glu Gly Leu Ser Thr Gln Cys Glu Cys Asn Ile Lys Val

195 200 205

Lys Asp Val Asn Asp Asn Phe Pro Met Phe Arg Asp Ser Gln Tyr Ser

210 215 220

Ala Arg Ile Glu Glu Asn Ile Leu Ser Ser Glu Leu Leu Arg Phe Gln

225 230 235 240

Val Thr Asp Leu Asp Glu Glu Tyr Thr Asp Asn Trp Leu Ala Val Tyr

245 250 255

Phe Phe Thr Ser Gly Asn Glu Gly Asn Trp Phe Glu Ile Gln Thr Asp

260 265 270

Pro Arg Thr Asn Glu Gly Ile Leu Lys Val Val Lys Ala Leu Asp Tyr

275 280 285

Glu Gln Leu Gln Ser Val Lys Leu Ser Ile Ala Val Lys Asn Lys Ala

290 295 300

Glu Phe His Gln Ser Val Ile Ser Arg Tyr Arg Val Gln Ser Thr Pro

305 310 315 320

Val Thr Ile Gln Val Ile Asn Val Arg Glu Gly Ile Ala Phe Arg Pro

325 330 335

Ala Ser Lys Thr Phe Thr Val Gln Lys Gly Ile Ser Ser Lys Lys Leu

340 345 350

Val Asp Tyr Ile Leu Gly Thr Tyr Gln Ala Ile Asp Glu Asp Thr Asn

355 360 365

Lys Ala Ala Ser Asn Val Lys Tyr Val Met Gly Arg Asn Asp Gly Gly

370 375 380

Tyr Leu Met Ile Asp Ser Lys Thr Ala Glu Ile Lys Phe Val Lys Asn

385 390 395 400

Met Asn Arg Asp Ser Thr Phe Ile Val Asn Lys Thr Ile Thr Ala Glu

405 410 415

Val Leu Ala Ile Asp Glu Tyr Thr Gly Lys Thr Ser Thr Gly Thr Val

420 425 430

Tyr Val Arg Val Pro Asp Phe Asn Asp

435 440

<210> 8

<211> 16

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Linker"

<400> 8

Ala Gly Ser Ser Ser Ser Gly Gly Ser Thr Thr Gly Gly Ser Thr Thr

1 5 10 15

<210> 9

<211> 16

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Linker"

<400> 9

Gly Thr Thr Ala Ala Ser Gly Ser Ser Gly Gly Ser Ser Ser Gly Ala

1 5 10 15

<210> 10

<211> 16

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Linker"

<400> 10

Ser Ser Ala Thr Ala Thr Ala Gly Thr Gly Ser Ser Thr Gly Ser Thr

1 5 10 15

<210> 11

<211> 16

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Linker"

<400> 11

Thr Ser Gly Ser Thr Gly Thr Ala Ala Ser Ser Thr Ser Thr Ser Thr

1 5 10 15

<210> 12

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

oligonucleotide"

<220>

<221> source

<223> /note="Linker"

<400> 12

ggtggcggag gttctggagg tggaggttcc 30

<210> 13

<211> 7

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="KIR2DS2 hinge domain"

<400> 13

Lys Ile Arg Arg Asp Ser Ser

15

<210> 14

<211> 45

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD8 hinge domain"

<400> 14

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

35 40 45

<210> 15

<211> 135

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD8 hinge domain"

<400> 15

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgat 135

<210> 16

<211> 230

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="IgG4 hinge domain"

<400> 16

Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe

1 5 10 15

Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr

20 25 30

Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val

35 40 45

Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val

50 55 60

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser

65 70 75 80

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu

85 90 95

Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser

100 105 110

Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro

115 120 125

Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln

130 135 140

Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala

145 150 155 160

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr

165 170 175

Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu

180 185 190

Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser

195 200 205

Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser

210 215 220

Leu Ser Leu Gly Lys Met

225 230

<210> 17

<211> 690

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="IgG4 hinge domain"

<400> 17

gagagcaagt acggccctcc ctgcccccct tgccctgccc ccgagttcct gggcggaccc 60

agcgtgttcc tgttcccccc caagcccaag gacaccctga tgatcagccg gacccccgag 120

gtgacctgtg tggtggtgga cgtgtcccag gaggaccccg aggtccagtt caactggtac 180

gtggacggcg tggaggtgca caacgccaag accaagcccc gggaggagca gttcaatagc 240

acctaccggg tggtgtccgt gctgaccgtg ctgcaccagg actggctgaa cggcaaggaa 300

tacaagtgta aggtgtccaa caagggcctg cccagcagca tcgagaaaac catcagcaag 360

gccaagggcc agcctcggga gccccaggtg tacaccctgc cccctagcca agaggagatg 420

accaagaacc aggtgtccct gacctgcctg gtgaagggct tctaccccag cgacatcgcc 480

gtggagtggg agagcaacgg ccagcccgag aacaactaca agaccacccc ccctgtgctg 540

gacagcgacg gcagcttctt cctgtacagc cggctgaccg tggacaagag ccggtggcag 600

gagggcaacg tctttagctg ctccgtgatg cacgaggccc tgcacaacca ctacacccag 660

aagagcctga gcctgtccct gggcaagatg 690

<210> 18

<211> 282

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="IgD hinge domain"

<400> 18

Arg Trp Pro Glu Ser Pro Lys Ala Gln Ala Ser Ser Val Pro Thr Ala

1 5 10 15

Gln Pro Gln Ala Glu Gly Ser Leu Ala Lys Ala Thr Thr Ala Pro Ala

20 25 30

Thr Thr Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Lys Glu Lys

35 40 45

Glu Lys Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro

50 55 60

Ser His Thr Gln Pro Leu Gly Val Tyr Leu Leu Thr Pro Ala Val Gln

65 70 75 80

Asp Leu Trp Leu Arg Asp Lys Ala Thr Phe Thr Cys Phe Val Val Gly

85 90 95

Ser Asp Leu Lys Asp Ala His Leu Thr Trp Glu Val Ala Gly Lys Val

100 105 110

Pro Thr Gly Gly Val Glu Glu Gly Leu Leu Glu Arg His Ser Asn Gly

115 120 125

Ser Gln Ser Gln His Ser Arg Leu Thr Leu Pro Arg Ser Leu Trp Asn

130 135 140

Ala Gly Thr Ser Val Thr Cys Thr Leu Asn His Pro Ser Leu Pro Pro

145 150 155 160

Gln Arg Leu Met Ala Leu Arg Glu Pro Ala Ala Gln Ala Pro Val Lys

165 170 175

Leu Ser Leu Asn Leu Leu Ala Ser Ser Asp Pro Pro Glu Ala Ala Ser

180 185 190

Trp Leu Leu Cys Glu Val Ser Gly Phe Ser Pro Pro Asn Ile Leu Leu

195 200 205

Met Trp Leu Glu Asp Gln Arg Glu Val Asn Thr Ser Gly Phe Ala Pro

210 215 220

Ala Arg Pro Pro Pro Gln Pro Gly Ser Thr Thr Phe Trp Ala Trp Ser

225 230 235 240

Val Leu Arg Val Pro Ala Pro Pro Ser Pro Gln Pro Ala Thr Tyr Thr

245 250 255

Cys Val Val Ser His Glu Asp Ser Arg Thr Leu Leu Asn Ala Ser Arg

260 265 270

Ser Leu Glu Val Ser Tyr Val Thr Asp His

275 280

<210> 19

<211> 847

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="IgD hinge domain"

<400> 19

aggtggcccg aaagtcccaa ggcccaggca tctagtgttc ctactgcaca gccccaggca 60

gaaggcagcc tagccaaagc tactactgca cctgccacta cgcgcaatac tggccgtggc 120

ggggaggaga agaaaaagga gaaagagaaa gaagaacagg aagagaggga gaccaagacc 180

cctgaatgtc catcccatac ccagccgctg ggcgtctatc tcttgactcc cgcagtacag 240

gacttgtggc ttagagataa ggccaccttt acatgtttcg tcgtgggctc tgacctgaag 300

gatgcccatt tgacttggga ggttgccgga aaggtaccca cagggggggt tgaggaaggg 360

ttgctggagc gccattccaa tggctctcag agccagcact caagactcac ccttccgaga 420

tccctgtgga acgccgggac ctctgtcaca tgtactctaa atcatcctag cctgccccca 480

cagcgtctga tggcccttag agagccagcc gcccaggcac cagttaagct tagcctgaat 540

ctgctcgcca gtagtgatcc cccagaggcc gccagctggc tcttatgcga agtgtccggc 600

tttagcccgc ccaacatctt gctcatgtgg ctggaggacc agcgagaagt gaacaccagc 660

ggcttcgctc cagcccggcc cccaccccag ccgggttcta ccacattctg ggcctggagt 720

gtcttaaggg tcccagcacc acctagcccc cagccagcca catacacctg tgttgtgtcc 780

catgaagata gcaggaccct gctaaatgct tctaggagtc tggaggtttc ctacgtgact 840

gaccatt 847

<210> 20

<211> 39

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD28 hinge domain"

<400> 20

Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn

1 5 10 15

Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu

20 25 30

Phe Pro Gly Pro Ser Lys Pro

35

<210> 21

<211> 117

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD28 hinge domain"

<400> 21

attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 60

catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagccc 117

<210> 22

<211> 30

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="TNFR2 TM domain"

<400> 22

Phe Ala Leu Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu

1 5 10 15

Leu Ile Ile Gly Val Val Asn Cys Val Ile Met Thr Gln Val

20 25 30

<210> 23

<211> 90

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="TNFR2 TM domain"

<400> 23

ttcgctcttc cagttggact gattgtgggt gtgacagcct tgggtctact aataatagga 60

gtggtgaact gtgtcatcat gacccaggtg 90

<210> 24

<211> 24

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD8 TM"

<400> 24

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

1 5 10 15

Ser Leu Val Ile Thr Leu Tyr Cys

20

<210> 25

<211> 72

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD8 TM"

<400> 25

atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60

accctttact gc 72

<210> 26

<211> 27

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD28TM"

<400> 26

Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu

1 5 10 15

Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val

20 25

<210> 27

<211> 81

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD28TM"

<400> 27

ttttgggtgc tggtggtggt tggtggagtc ctggcttgct atagcttgct agtaacagtg 60

gcctttatta ttttctgggt g 81

<210> 28

<211> 112

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD3 zeta"

<400> 28

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly

1 5 10 15

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

20 25 30

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

35 40 45

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

50 55 60

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

65 70 75 80

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

85 90 95

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

100 105 110

<210> 29

<211> 112

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD3 zeta"

<400> 29

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

1 5 10 15

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

20 25 30

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

35 40 45

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

50 55 60

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

65 70 75 80

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

85 90 95

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

100 105 110

<210> 30

<211> 113

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD3 zeta"

<400> 30

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly

1 5 10 15

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

20 25 30

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

35 40 45

Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln

50 55 60

Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu

65 70 75 80

Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr

85 90 95

Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro

100 105 110

Arg

<210> 31

<211> 113

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD3 zeta"

<400> 31

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

1 5 10 15

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

20 25 30

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

35 40 45

Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln

50 55 60

Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu

65 70 75 80

Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr

85 90 95

Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro

100 105 110

Arg

<210> 32

<211> 336

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD3 zeta"

<400> 32

agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 60

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300

tacgacgccc ttcacatgca ggccctgccc cctcgc 336

<210> 33

<211> 336

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD3 zeta"

<400> 33

agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300

tacgacgccc ttcacatgca ggccctgccc cctcgc 336

<210> 34

<211> 174

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="TNFR2 intracellular"

<400> 34

Lys Lys Lys Pro Leu Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu

1 5 10 15

Pro Ala Asp Lys Ala Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu

20 25 30

Leu Ile Thr Ala Pro Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala

35 40 45

Ser Ala Leu Asp Arg Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro

50 55 60

Gly Val Glu Ala Ser Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser

65 70 75 80

Ser Asp Ser Ser Pro Gly Gly His Gly Thr Gln Val Asn Val Thr Cys

85 90 95

Ile Val Asn Val Cys Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser

100 105 110

Gln Ala Ser Ser Thr Met Gly Asp Thr Asp Ser Ser Pro Ser Glu Ser

115 120 125

Pro Lys Asp Glu Gln Val Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg

130 135 140

Ser Gln Leu Glu Thr Pro Glu Thr Leu Leu Gly Ser Thr Glu Glu Lys

145 150 155 160

Pro Leu Pro Leu Gly Val Pro Asp Ala Gly Met Lys Pro Ser

165 170

<210> 35

<211> 522

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="TNFR2 intracellular"

<400> 35

aaaaagaagc ccttgtgcct gcagagagaa gccaaggtgc ctcacttgcc tgcagataag 60

gccaggggta cacagggtcc cgagcagcag cacctcctga tcacagcgcc gagctccagc 120

agcagctccc tggagagctc ggccagtgcg ctagacagaa gggcccccac tcggaaccag 180

ccacaggcac caggcgtgga ggcgagtggg gctggggagg cgaggcaag caccgggagc 240

tcagattctt cccctggtgg tcatggcacc caggtcaatg tcacctgtat cgtgaacgtc 300

tgtagcagct ctgaccacag ctcacagtgc tcctcccaag cctcgtccac aatggggagac 360

acagattcca gcccctcgga gtccccgaag gacgagcaag tacccttctc caagggaggaa 420

tgtgcctttc ggtcacagct ggagacgcca gagaccctgc tggggagcac cgaagagaag 480

cccctgcccc ttggagtgcc tgatgctggg atgaagccca gt 522

<210> 36

<211> 42

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="4-1BB intracellular"

<400> 36

Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met

1 5 10 15

Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe

20 25 30

Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu

35 40

<210> 37

<211> 126

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="4-1BB intracellular"

<400> 37

aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa 60

actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt 120

gaactg 126

<210> 38

<211> 48

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD27 intracellular"

<400> 38

Gln Arg Arg Lys Tyr Arg Ser Asn Lys Gly Glu Ser Pro Val Glu Pro

1 5 10 15

Ala Glu Pro Cys Arg Tyr Ser Cys Pro Arg Glu Glu Glu Gly Ser Thr

20 25 30

Ile Pro Ile Gln Glu Asp Tyr Arg Lys Pro Glu Pro Ala Cys Ser Pro

35 40 45

<210> 39

<211> 144

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD27 intracellular"

<400> 39

caacgaagga aatatagatc aaacaaagga gaaagtcctg tggagcctgc agagccttgt 60

cgttacagct gccccaggga ggagaggagc agcaccatcc ccatccagga ggattaccga 120

aaaccggagc ctgcctgctc cccc 144

<210> 40

<211> 41

<212>PRT

<213> Homo sapiens

<220>

<221> source

<223> /note="CD28 intracellular"

<400> 40

Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr

1 5 10 15

Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro

20 25 30

Pro Arg Asp Phe Ala Ala Tyr Arg Ser

35 40

<210> 41

<211> 123

<212> DNA

<213> Homo sapiens

<220>

<221> source

<223> /note="CD28 intracellular"

<400> 41

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 42

<211> 21

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Leader sequence CD8"

<400> 42

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro

20

<210> 43

<211> 9

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="tag"

<400> 43

Asn Trp Ser His Pro Gln Phe Glu Lys

15

<210> 44

<211> 10

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="tag"

<400> 44

Ser Ala Trp Ser His Pro Gln Phe Glu Lys

1 5 10

<210> 45

<211> 22

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="P2A tag"

<400> 45

Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val

1 5 10 15

Glu Glu Asn Pro Gly Pro

20

<210> 46

<211> 239

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="GFP tag"

<400> 46

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 47

<211> 12

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Strepavidin tag"

<400> 47

Ser Ala Trp Ser His Pro Gln Phe Glu Lys Ser Gly

1 5 10

<210> 48

<211> 365

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-TNFR2TM-TNFR2-3z"

<400> 48

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Ala Leu

35 40 45

Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu Leu Ile Ile

50 55 60

Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu

65 70 75 80

Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala

85 90 95

Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro

100 105 110

Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg

115 120 125

Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser

130 135 140

Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro

145 150 155 160

Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys

165 170 175

Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr

180 185 190

Met Gly Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln

195 200 205

Val Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr

210 215 220

Pro Glu Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly

225 230 235 240

Val Pro Asp Ala Gly Met Lys Pro Ser Gly Ser Arg Val Lys Phe Ser

245 250 255

Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr

260 265 270

Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys

275 280 285

Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn

290 295 300

Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu

305 310 315 320

Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly

325 330 335

His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr

340 345 350

Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Ala Ser

355 360 365

<210> 49

<211> 347

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-TNFR2 TM-TNFR2del18-3z"

<400> 49

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Ala Leu

35 40 45

Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu Leu Ile Ile

50 55 60

Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu

65 70 75 80

Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala

85 90 95

Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro

100 105 110

Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg

115 120 125

Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser

130 135 140

Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro

145 150 155 160

Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys

165 170 175

Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr

180 185 190

Met Gly Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln

195 200 205

Val Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr

210 215 220

Pro Glu Thr Leu Leu Gly Ser Gly Ser Arg Val Lys Phe Ser Arg Ser

225 230 235 240

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

245 250 255

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

260 265 270

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

275 280 285

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

290 295 300

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

305 310 315 320

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

325 330 335

Leu His Met Gln Ala Leu Pro Pro Arg Ala Ser

340 345

<210> 50

<211> 306

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-TNFR2 TM-TNFR2del59-3z"

<400> 50

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Ala Leu

35 40 45

Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu Leu Ile Ile

50 55 60

Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu

65 70 75 80

Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala

85 90 95

Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro

100 105 110

Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg

115 120 125

Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser

130 135 140

Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro

145 150 155 160

Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys

165 170 175

Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Gly Ser

180 185 190

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

195 200 205

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

210 215 220

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

225 230 235 240

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

245 250 255

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

260 265 270

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

275 280 285

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

290 295 300

Ala Ser

305

<210> 51

<211> 261

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-TNFR2 TM-TNFR2del104-3z"

<400> 51

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Ala Leu

35 40 45

Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu Leu Ile Ile

50 55 60

Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu

65 70 75 80

Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala

85 90 95

Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro

100 105 110

Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg

115 120 125

Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser

130 135 140

Gly Gly Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

145 150 155 160

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

165 170 175

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

180 185 190

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

195 200 205

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

210 215 220

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

225 230 235 240

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

245 250 255

Pro Pro Arg Ala Ser

260

<210> 52

<211> 189

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-TNFR2 TM-3z"

<400> 52

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Ala Leu

35 40 45

Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu Leu Ile Ile

50 55 60

Gly Val Val Asn Cys Val Ile Met Thr Gln Val Arg Val Lys Phe Ser

65 70 75 80

Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr

85 90 95

Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys

100 105 110

Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn

115 120 125

Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu

130 135 140

Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly

145 150 155 160

His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr

165 170 175

Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Ala Ser

180 185

<210> 53

<211> 361

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-3z-TNFR2 TM"

<400> 53

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile

35 40 45

Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val

50 55 60

Ile Thr Leu Tyr Cys Thr Arg Arg Val Lys Phe Ser Arg Ser Ala Asp

65 70 75 80

Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn

85 90 95

Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg

100 105 110

Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly

115 120 125

Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu

130 135 140

Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu

145 150 155 160

Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His

165 170 175

Met Gln Ala Leu Pro Pro Arg Ala Ser Lys Lys Lys Pro Leu Cys Leu

180 185 190

Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala Arg Gly

195 200 205

Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro Ser Ser

210 215 220

Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg Arg Ala

225 230 235 240

Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser Gly Ala

245 250 255

Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro Gly Gly

260 265 270

His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys Ser Ser

275 280 285

Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr Met Gly

290 295 300

Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln Val Pro

305 310 315 320

Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr Pro Glu

325 330 335

Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly Val Pro

340 345 350

Asp Ala Gly Met Lys Pro Ser Ala Ser

355 360

<210> 54

<211> 359

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-CD8 TM-TNFR2-3z"

<400> 54

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile

35 40 45

Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val

50 55 60

Ile Thr Leu Tyr Cys Lys Lys Lys Pro Leu Cys Leu Gln Arg Glu Ala

65 70 75 80

Lys Val Pro His Leu Pro Ala Asp Lys Ala Arg Gly Thr Gln Gly Pro

85 90 95

Glu Gln Gln His Leu Leu Ile Thr Ala Pro Ser Ser Ser Ser Ser Ser

100 105 110

Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg Arg Ala Pro Thr Arg Asn

115 120 125

Gln Pro Gln Ala Pro Gly Val Glu Ala Ser Gly Ala Gly Glu Ala Arg

130 135 140

Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro Gly Gly His Gly Thr Gln

145 150 155 160

Val Asn Val Thr Cys Ile Val Asn Val Cys Ser Ser Ser Asp His Ser

165 170 175

Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr Met Gly Asp Thr Asp Ser

180 185 190

Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln Val Pro Phe Ser Lys Glu

195 200 205

Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr Pro Glu Thr Leu Leu Gly

210 215 220

Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly Val Pro Asp Ala Gly Met

225 230 235 240

Lys Pro Ser Gly Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro

245 250 255

Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly

260 265 270

Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro

275 280 285

Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr

290 295 300

Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly

305 310 315 320

Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln

325 330 335

Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln

340 345 350

Ala Leu Pro Pro Arg Ala Ser

355

<210> 55

<211> 363

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-FUSED 1 TM-TNFR2-3z"

<400> 55

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile

35 40 45

Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val

50 55 60

Ile Thr Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu Cys Leu

65 70 75 80

Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala Arg Gly

85 90 95

Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro Ser Ser

100 105 110

Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg Arg Ala

115 120 125

Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser Gly Ala

130 135 140

Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro Gly Gly

145 150 155 160

His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys Ser Ser

165 170 175

Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr Met Gly

180 185 190

Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln Val Pro

195 200 205

Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr Pro Glu

210 215 220

Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly Val Pro

225 230 235 240

Asp Ala Gly Met Lys Pro Ser Gly Ser Arg Val Lys Phe Ser Arg Ser

245 250 255

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

260 265 270

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

275 280 285

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

290 295 300

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

305 310 315 320

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

325 330 335

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

340 345 350

Leu His Met Gln Ala Leu Pro Pro Arg Ala Ser

355 360

<210> 56

<211> 365

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-FUSED 2TM-TNFR2-3z"

<400> 56

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile

35 40 45

Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val

50 55 60

Ile Thr Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu

65 70 75 80

Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala

85 90 95

Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro

100 105 110

Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg

115 120 125

Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser

130 135 140

Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro

145 150 155 160

Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys

165 170 175

Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr

180 185 190

Met Gly Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln

195 200 205

Val Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr

210 215 220

Pro Glu Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly

225 230 235 240

Val Pro Asp Ala Gly Met Lys Pro Ser Gly Ser Arg Val Lys Phe Ser

245 250 255

Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr

260 265 270

Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys

275 280 285

Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn

290 295 300

Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu

305 310 315 320

Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly

325 330 335

His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr

340 345 350

Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Ala Ser

355 360 365

<210> 57

<211> 363

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD8 H-FUSED 3 TM-TNFR2-3z"

<400> 57

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile

35 40 45

Trp Ala Pro Leu Ala Gly Thr Ala Leu Gly Leu Leu Ile Ile Gly Val

50 55 60

Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu Cys Leu

65 70 75 80

Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala Arg Gly

85 90 95

Thr Gln Gly Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro Ser Ser

100 105 110

Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg Arg Ala

115 120 125

Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly Val Glu Ala Ser Gly Ala

130 135 140

Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser Asp Ser Ser Pro Gly Gly

145 150 155 160

His Gly Thr Gln Val Asn Val Thr Cys Ile Val Asn Val Cys Ser Ser

165 170 175

Ser Asp His Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr Met Gly

180 185 190

Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln Val Pro

195 200 205

Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser Gln Leu Glu Thr Pro Glu

210 215 220

Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro Leu Pro Leu Gly Val Pro

225 230 235 240

Asp Ala Gly Met Lys Pro Ser Gly Ser Arg Val Lys Phe Ser Arg Ser

245 250 255

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

260 265 270

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

275 280 285

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

290 295 300

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

305 310 315 320

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

325 330 335

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

340 345 350

Leu His Met Gln Ala Leu Pro Pro Arg Ala Ser

355 360

<210> 58

<211> 9

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="LAGLIDADG motif"

<400> 58

Leu Ala Gly Leu Ile Asp Ala Asp Gly

15

<210> 59

<211> 21

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Fusion 1 - CD8 SEQ"

<400> 59

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

1 5 10 15

Ser Leu Val Ile Thr

20

<210> 60

<211> 21

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Fusion 2 - CD8 SEQ"

<400> 60

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

1 5 10 15

Ser Leu Val Ile Thr

20

<210> 61

<211> 9

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Fusion 3 - CD8 SEQ"

<400> 61

Ile Tyr Ile Trp Ala Pro Leu Ala Gly

15

<210> 62

<211> 7

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Fusion 1 - TNFR2 SEQ"

<400> 62

Cys Val Ile Met Thr Gln Val

15

<210> 63

<211> 9

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Fusion 2 - TNFR2 SEQ"

<400> 63

Val Asn Cys Val Ile Met Thr Gln Val

15

<210> 64

<211> 19

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="Fusion 3 - TNFR2 SEQ"

<400> 64

Thr Ala Leu Gly Leu Leu Ile Ile Gly Val Val Asn Cys Val Ile Met

1 5 10 15

Thr Gln Val

<210> 65

<211> 249

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="scFv anti-IL-23R"

<400> 65

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Glu Asn Ile Tyr Ser Phe

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Lys Leu Ala Ala Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Asn Arg Tyr Ser Asn

85 90 95

Pro Asp Ile Tyr Asn Val Phe Gly Gln Gly Thr Lys Leu Thr Val Leu

100 105 110

Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

130 135 140

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ile Asp Phe Asn Ser Asn

145 150 155 160

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

165 170 175

Ile Gly Cys Ile Tyr Val Gly Ser His Val Asn Thr Tyr Tyr Ala Asn

180 185 190

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

195 200 205

Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

210 215 220

Tyr Cys Ala Thr Ser Gly Ser Ser Val Leu Tyr Phe Lys Phe Trp Gly

225 230 235 240

Gln Gly Thr Leu Val Thr Val Ser Ser

245

<210> 66

<211> 249

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="scFv anti-IL-23R"

<400> 66

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Glu Asn Ile Tyr Ser Phe

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Lys Leu Ala Ala Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Asn Arg Tyr Ser Asn

85 90 95

Pro Asp Ile Tyr Asn Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

130 135 140

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ile Asp Phe Asn Ser Asn

145 150 155 160

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

165 170 175

Ile Gly Cys Ile Tyr Val Gly Ser His Val Asn Thr Tyr Tyr Ala Asn

180 185 190

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

195 200 205

Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

210 215 220

Tyr Cys Ala Thr Ser Gly Ser Ser Val Leu Tyr Phe Lys Phe Trp Gly

225 230 235 240

Gln Gly Thr Leu Val Thr Val Ser Ser

245

<210> 67

<211> 249

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="scFv anti IL-23R"

<400> 67

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Glu Asn Ile Tyr Ser Phe

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Lys Leu Ala Ala Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Asn Arg Tyr Ser Asn

85 90 95

Pro Asp Ile Tyr Asn Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu

100 105 110

Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

130 135 140

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ile Asp Phe Asn Ser Asn

145 150 155 160

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

165 170 175

Ile Gly Cys Ile Tyr Val Gly Ser His Val Asn Thr Tyr Tyr Ala Asn

180 185 190

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

195 200 205

Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

210 215 220

Tyr Cys Ala Thr Ser Gly Ser Ser Val Leu Tyr Phe Lys Phe Trp Gly

225 230 235 240

Gln Gly Thr Leu Val Thr Val Ser Ser

245

<210> 68

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 68

Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Lys Thr Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Leu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Ile Tyr Phe Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Val Leu Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gln Val Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

245 250

<210> 69

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 69

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Val Val Met Thr

130 135 140

Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Phe Gln Gln Arg Pro Gly Gln Ser Pro Arg Arg Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 70

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 70

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 71

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 71

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 72

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 72

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Val Val Met Thr

130 135 140

Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Ser Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 73

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 73

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Phe Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 74

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 74

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Leu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Val Val Met Thr

130 135 140

Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Phe Gln Gln Arg Pro Gly Gln Ser Pro Arg Arg Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 75

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 75

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Leu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 76

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 76

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 77

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 77

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 78

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 78

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Val Val Met Thr

130 135 140

Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Ser Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 79

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 79

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Phe Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 80

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 80

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 81

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 81

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 82

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 82

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 83

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 83

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Phe Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 84

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 84

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 85

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 85

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 86

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 86

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Val Val Met Thr

130 135 140

Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Ser Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 87

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 87

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Phe Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Arg Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 88

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 88

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Lys Tyr Ser Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Val Asp Ser Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Ser Asp Ile Val Met Thr

130 135 140

Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly Gln Pro Ala Ser Ile

145 150 155 160

Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr

165 170 175

Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile

180 185 190

Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly

195 200 205

Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala

210 215 220

Glu Asp Val Gly Val Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg

225 230 235 240

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

245 250

<210> 89

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 89

Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Tyr Asp Ser Arg Gly Ser Tyr Tyr Tyr Met Asp Val

100 105 110

Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser Gly Ser Ala Ser Ala

115 120 125

Pro Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Ser Val

130 135 140

Leu Thr Gln Pro Pro Ser Thr Ser Gly Thr Pro Gly Gln Arg Val Thr

145 150 155 160

Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Gly Asn Ala Val Asn

165 170 175

Trp Tyr Gln His Phe Pro Gly Thr Ala Pro Thr Leu Leu Ile Tyr Ser

180 185 190

Asn Asn Gln Arg Pro Ser Gly Val Pro Glu Arg Phe Ser Gly Ser Lys

195 200 205

Ser Gly Thr Ser Ala Ser Leu Thr Val Ser Gly Leu Gln Ala Glu Asp

210 215 220

Glu Ala Asp Tyr Tyr Cys Thr Ala Trp Asp Asp Ser Leu Arg Gly Tyr

225 230 235 240

Leu Phe Gly Thr Gly Thr Lys Val Thr Val Leu

245 250

<210> 90

<211> 249

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 90

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Arg Glu Glu Leu Leu Ala Leu Phe Gly Gly Met Asp Val

100 105 110

Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Ser Ala Ser Ala

115 120 125

Pro Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Pro Val

130 135 140

Leu Thr Gln Pro Ser Ser Val Ser Val Ala Pro Gly Gln Thr Ala Arg

145 150 155 160

Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val His Trp Tyr

165 170 175

Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr Asp Asp Ser

180 185 190

Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly

195 200 205

Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Arg Asp Glu Ala

210 215 220

Asp Tyr Tyr Cys His Val Trp Asp Ala Lys Thr Asn His Gln Val Phe

225 230 235 240

Gly Gly Gly Thr Arg Leu Thr Val Gln

245

<210> 91

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 91

Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Pro Gln Ser Arg Trp Leu Gln Ser Gly Asp Ala Phe Asp Ile

100 105 110

Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Ser Ala Ser Ala

115 120 125

Pro Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Pro Val

130 135 140

Leu Thr Gln Pro Arg Ser Val Ser Gly Ser Pro Gly Gln Ser Val Thr

145 150 155 160

Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr Asn Arg Val

165 170 175

Ser Trp Tyr Gln Gln Thr Pro Gly Thr Ala Pro Lys Leu Met Ile Tyr

180 185 190

Glu Val Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser

195 200 205

Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu

210 215 220

Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Ser Ser Ser Thr Val

225 230 235 240

Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

245 250

<210> 92

<211> 246

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 92

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Arg Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Leu Thr Gly Thr Leu Leu Phe Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ser Gly Ser Ala Ser Ala Pro Lys Leu Glu

115 120 125

Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Ser Val Leu Thr Gln Pro

130 135 140

Pro Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys Ser

145 150 155 160

Gly Ser Ser Ser Asn Ile Gly Ser Asn Gly Val Lys Trp Tyr Gln Gln

165 170 175

Leu Pro Gly Thr Ala Pro Lys Leu Val Ile Tyr Arg Asp Tyr Gln Arg

180 185 190

Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser

195 200 205

Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Lys Tyr

210 215 220

Tyr Cys Ala Ala Trp Asp Asp Ser Leu Asn Val Val Phe Gly Gly Gly

225 230 235 240

Thr Gln Leu Thr Val Leu

245

<210> 93

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 93

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Ala Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Arg Ala Glu Arg Trp Leu His Leu Ser Gly Ala Phe Asp Ile

100 105 110

Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Ser Ala Ser Ala

115 120 125

Pro Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Pro Val

130 135 140

Leu Thr Gln Ser Ser Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Ala

145 150 155 160

Ile Ser Cys Ser Gly Ser Ser Ser Asn Val Gly Ser Asn Thr Val Asn

165 170 175

Trp Tyr Gln Gln Ser Pro Gly Thr Ala Pro Lys Leu Leu Ile Ser Ser

180 185 190

Asn His Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys

195 200 205

Phe Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp

210 215 220

Glu Ala Asp Tyr Tyr Cys Gly Ala Trp Asp Asp Ser Leu Asn Gly Tyr

225 230 235 240

Val Phe Gly Ser Gly Thr Lys Val Thr Val Leu

245 250

<210> 94

<211> 244

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 94

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Met Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Val Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Thr Gly His Tyr Gly Asp Tyr Val Trp Gly Gln Gly Ala Leu Val

100 105 110

Thr Val Ser Ser Gly Ser Ala Ser Ala Pro Lys Leu Glu Glu Gly Glu

115 120 125

Phe Ser Glu Ala Arg Val Gln Ala Gly Leu Thr Gln Pro Pro Ser Ala

130 135 140

Ser Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser

145 150 155 160

Ser Asn Ile Gly Ser Asn Thr Val Asn Trp Tyr Gln Gln Leu Pro Gly

165 170 175

Thr Ala Pro Lys Leu Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly

180 185 190

Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu

195 200 205

Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala

210 215 220

Ala Trp Asp Asp Ser Leu Asn Gly Pro Val Phe Gly Gly Gly Thr Lys

225 230 235 240

Leu Thr Val Leu

<210> 95

<211> 246

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 95

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Ser Ser Gly Gly Ala Phe Asp Ile Trp Gly Gln Gly Thr

100 105 110

Val Val Thr Val Ser Ser Gly Ser Ala Ser Ala Pro Lys Leu Glu Glu

115 120 125

Gly Glu Phe Ser Glu Ala Arg Val Gln Ser Ala Leu Thr Gln Pro Ala

130 135 140

Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly

145 150 155 160

Thr Gly Ser Asp Val Gly Gly Tyr Lys Tyr Val Ser Trp Tyr Gln His

165 170 175

His Pro Gly Lys Ala Pro Arg Leu Ile Ile Tyr Asp Val Asn Tyr Trp

180 185 190

Pro Ser Gly Val Ser His Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr

195 200 205

Ala Ser Leu Thr Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr

210 215 220

Tyr Cys Ser Ser Tyr Arg Thr Gly Asp Thr Trp Val Phe Gly Gly Gly

225 230 235 240

Thr Lys Leu Thr Val Leu

245

<210> 96

<211> 248

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 96

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Gly Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Glu Ile Ile Pro Met Phe Gly Thr Ala Asn Tyr Ala Gln Lys Leu

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Glu Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Thr Tyr Tyr Cys

85 90 95

Ala Arg Val Pro Arg Ser Ser Ser Gly Tyr Asn Tyr Gly Met Asp Val

100 105 110

Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Ser Ala Ser Ala

115 120 125

Pro Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Asp Ile Gln

130 135 140

Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val

145 150 155 160

Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Asn Tyr Leu Ala Trp

165 170 175

Tyr Gln Gln Lys Pro Gly Lys Val Pro Lys Leu Leu Ile Tyr Ala Ala

180 185 190

Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser

195 200 205

Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Val

210 215 220

Ala Thr Tyr Tyr Cys Gln Lys Tyr Asn Ser Ala Pro Arg Thr Phe Gly

225 230 235 240

Gln Gly Thr Lys Val Glu Ile Lys

245

<210> 97

<211> 250

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 97

Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Leu Lys Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Asp Ser Val Ser Thr Asn

20 25 30

Ser Gly Ala Trp Ser Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu

35 40 45

Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Ser Thr Asp Tyr Ala

50 55 60

Leu Ser Leu Gln Ser Arg Val Thr Ile Lys Ser Asp Arg Ser Lys Asn

65 70 75 80

Gln Phe Ser Leu Gln Leu Asp Ser Val Thr Pro Glu Asp Thr Ala Ile

85 90 95

Tyr Tyr Cys Ala Arg Glu Asn Trp Asn Ser Gly Gly Phe Asp Tyr Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Pro Ser Gly Ser Ala Ser Ala Pro

115 120 125

Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Pro Val Leu

130 135 140

Thr Gln Ser Ser Ser Ala Ser Gly Ser Pro Gly Gln Ser Val Thr Ile

145 150 155 160

Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser

165 170 175

Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu

180 185 190

Val Ser Lys Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys

195 200 205

Ser Gly Ser Thr Ala Ser Leu Thr Val Ser Gly Leu Gln Ala Glu Asp

210 215 220

Glu Ala Glu Tyr Tyr Cys Ser Ser Tyr Ala Gly Ser Asn Asn Tyr Val

225 230 235 240

Phe Gly Thr Gly Thr Lys Val Thr Val Leu

245 250

<210> 98

<211> 249

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 98

Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Ala Ala Ser Arg Trp Glu Pro Gly Asp Ala Phe Asp Ile Trp

100 105 110

Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Ser Ala Ser Ala Pro

115 120 125

Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Pro Val Leu

130 135 140

Thr Gln Ser Ser Ser Val Ser Val Ala Pro Gly Lys Thr Ala Arg Val

145 150 155 160

Thr Cys Gly Gly Asp Asn Ile Gly Gly Lys Ser Val His Trp Tyr Gln

165 170 175

Gln Arg Ala Gly Gln Ala Pro Val Leu Val Ile Ser His Asp Thr Asp

180 185 190

Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Lys Ser Gly Thr

195 200 205

Ser Ala Ser Leu Ala Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp

210 215 220

Tyr Tyr Cys Ala Val Trp Asp Ala Ser Leu Gly Gly Ser Trp Leu Phe

225 230 235 240

Gly Gly Gly Thr Lys Leu Thr Val Leu

245

<210> 99

<211> 252

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 99

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Asp Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu

50 55 60

Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Arg Trp Leu Arg Ser Ala Ser Ser Phe Asp Tyr Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Ser Ala Ser Ala Pro

115 120 125

Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Gln Ala Gly Leu

130 135 140

Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln Arg Val Thr Ile

145 150 155 160

Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Ala Tyr Asp Val His

165 170 175

Trp Tyr Gln Gln Leu Pro Gly Ala Ala Pro Lys Leu Leu Ile Phe Gly

180 185 190

Asp Ser Asn Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys

195 200 205

Ser Asp Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln Ala Glu Asp

210 215 220

Glu Ala Asp Tyr Tyr Cys Gln Ser Phe Asp Ser Ser Leu Ser Gly Ser

225 230 235 240

Arg Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

245 250

<210> 100

<211> 251

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 100

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Tyr Ile Thr Ser Gly Gly Ser Ser Ile Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Leu Asp Ser Ser Ala Tyr Gln Gly Arg Ala Phe Asp Ile

100 105 110

Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Ser Ala Ser Ala

115 120 125

Pro Lys Leu Glu Glu Gly Glu Phe Ser Glu Ala Arg Val Leu Pro Val

130 135 140

Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Thr

145 150 155 160

Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn Pro Val His

165 170 175

Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Val Tyr Arg

180 185 190

Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys

195 200 205

Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Arg Ser Glu Asp

210 215 220

Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Val Ser Leu Ser Gly Val

225 230 235 240

Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

245 250

<210> 101

<211> 246

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 101

Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu

130 135 140

Pro Val Thr Leu Gly Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln

145 150 155 160

Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln

165 170 175

Lys Pro Gly Gln Ser Pro Arg Leu Leu Ile Tyr Lys Val Ser Asn Arg

180 185 190

Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp

195 200 205

Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr

210 215 220

Tyr Cys Phe Gln Gly Ser His Val Pro Arg Thr Phe Gly Gly Gly Thr

225 230 235 240

Lys Leu Glu Ile Lys Arg

245

<210> 102

<211> 246

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 102

Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu

130 135 140

Ser Val Thr Leu Gly Asp Arg Val Ser Ile Ser Cys Arg Ser Ser Gln

145 150 155 160

Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Gln Gln

165 170 175

Lys Pro Gly Gln Ser Pro Arg Leu Leu Ile Tyr Lys Val Ser Asn Arg

180 185 190

Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp

195 200 205

Phe Thr Leu Thr Ile Ser Arg Val Glu Pro Glu Asp Leu Gly Val Tyr

210 215 220

Tyr Cys Phe Gln Gly Ser His Val Pro Arg Thr Phe Gly Gly Gly Thr

225 230 235 240

Lys Leu Glu Ile Lys Arg

245

<210> 103

<211> 246

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 103

Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ala Thr Leu

130 135 140

Ser Val Ser Pro Gly Glu Arg Ala Thr Ile Ser Cys Arg Ser Ser Gln

145 150 155 160

Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Gln Gln

165 170 175

Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Lys Val Ser Asn Arg

180 185 190

Phe Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp

195 200 205

Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr

210 215 220

Tyr Cys Phe Gln Gly Ser His Val Pro Arg Thr Phe Gly Gly Gly Thr

225 230 235 240

Lys Leu Glu Ile Lys Arg

245

<210> 104

<211> 247

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 104

Ser Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly

1 5 10 15

Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser

20 25 30

Tyr His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp

35 40 45

Ile Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala

65 70 75 80

Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr

85 90 95

Cys Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Ser Ser

130 135 140

Leu Ser Val Thr Leu Gly Asp Arg Val Ser Ile Ser Cys Arg Ser Ser

145 150 155 160

Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Gln

165 170 175

Gln Lys Pro Gly Gln Ser Pro Arg Leu Leu Ile Tyr Lys Val Ser Asn

180 185 190

Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro Glu Asp Leu Gly Val

210 215 220

Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg Thr Phe Gly Gly Gly

225 230 235 240

Thr Lys Leu Glu Ile Lys Arg

245

<210> 105

<211> 247

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 105

Ser Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly

1 5 10 15

Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser

20 25 30

Tyr His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp

35 40 45

Ile Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala

65 70 75 80

Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr

85 90 95

Cys Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Ser Ser

130 135 140

Leu Ser Val Thr Leu Gly Asp Arg Val Ser Ile Ser Cys Arg Ser Ser

145 150 155 160

Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Gln

165 170 175

Gln Lys Pro Gly Gln Ser Pro Arg Leu Leu Ile Tyr Lys Val Ser Asn

180 185 190

Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro Glu Asp Leu Gly Val

210 215 220

Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg Thr Phe Gly Gly Gly

225 230 235 240

Thr Lys Leu Glu Ile Lys Arg

245

<210> 106

<211> 247

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 106

Ser Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly

1 5 10 15

Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser

20 25 30

Tyr His Ile Gln Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp

35 40 45

Ile Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala

65 70 75 80

Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr

85 90 95

Cys Ala Arg Glu Gly Thr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ala Thr

130 135 140

Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Ile Ser Cys Arg Ser Ser

145 150 155 160

Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Gln

165 170 175

Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Lys Val Ser Asn

180 185 190

Arg Phe Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val

210 215 220

Tyr Tyr Cys Phe Gln Gly Ser His Val Pro Arg Thr Phe Gly Gly Gly

225 230 235 240

Thr Lys Leu Glu Ile Lys Arg

245

<210> 107

<211> 245

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="anti-HLA-A2 scFv"

<400> 107

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Val Ser Cys Ala Ala Ser Gly Val Thr Leu Ser Asp Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Met

35 40 45

Ala Phe Ile Arg Asn Asp Gly Ser Asp Lys Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Lys Thr Val Ser

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Lys Asn Gly Glu Ser Gly Pro Leu Asp Tyr Trp Tyr Phe Asp Leu

100 105 110

Trp Gly Arg Gly Thr Leu Val Thr Val Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser

130 135 140

Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys

145 150 155 160

Gln Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn Trp Tyr Gln Gln Lys

165 170 175

Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn Leu Glu

180 185 190

Thr Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe

195 200 205

Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr

210 215 220

Cys Gln Gln Tyr Ser Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr Lys

225 230 235 240

Val Asp Ile Lys Arg

245

<210> 108

<211> 2853

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polynucleotide"

<220>

<221> source

<223> /note="CD20-CAR (TNFR1TM-TNFR1-CD3z)-P2A-GFP"

<400> 108

atggctctgc ctgtgacagc tctgctgctg cctctggctc tgcttctgca tgccgccaga 60

ccttctcagg tgcagctggt tcagtctggc gccgagcttg tgaaacctgg cgcctctgtg 120

aagatgagct gcaaggccag cggctacacc ttcaccagct acaacatgca ctgggtcaag 180

cagacccctg gacagggact cgagtggatc ggagccatct atcccggcaa tggcgacacc 240

tcctacaacc agaagttcaa gggcaaagcc acactgaccg ccgacaagag cagcagcaca 300

gcctacatgc agctgagcag cctgaccagc gaagatagcg ccgtgtacta ctgcgctaga 360

gcccagctga ggcccaacta ctggtacttc gatgtgtggg gagccggcac caccgtgacc 420

gtgtcaaaaa tttctggcgg cggaggatct ggcggaggtg gaagcggagg cggaggaagc 480

ggtggatctt ctgacatcgt gctgtctcag agccccgcca tcctttcagc tagccctggc 540

gagaaagtga ccatgacctg tagagccagc agcagcgtgt cctatatgca ctggtatcag 600

cagaagcccg gcagcagccc taagccttgg atctacgcca caagcaatct ggccagcgga 660

gtgcctgcca gattttctgg ctctggcagc ggcacaagct actccctgac aatcagcaga 720

gtggaagccg aggatgccgc cacctactac tgtcagcagt ggatcagcaa ccctcctacc 780

tttggcgctg gcaccaagct ggaactgaag tctgcatggt cccatcctca gttcgagaag 840

tctggaatgc atacaacaac ccctgctcct cggcctccta caccagctcc tacaattgcc 900

agccagccac tgtctctgag gcccgaagct tgtagacctg ctgctggcgg agccgtgcat 960

acaagaggac tggatttcgc ctgcgacgtg ctgttgcccc tggtcatttt ctttggtctt 1020

tgccttttat ccctcctctt cattggttta atgtatcgct accaacggtg gaagtccaag 1080

ctctactcca ttgtttgtgg gaaatcgaca cctgaaaaag agggggagct tgaaggaact 1140

actactaagc ccctggcccc aaacccaagc ttcagtccca ctccaggctt cacccccacc 1200

ctgggcttca gtcccgtgcc cagttccacc ttcacctcca gctccaccta tacccccggt 1260

gactgtccca actttgcggc tccccgcaga gaggtggcac caccctatca gggggctgac 1320

cccatccttg cgacagccct cgcctccgac cccatcccca acccccttca gaagtgggag 1380

gacagcgccc acaagccaca gagcctagac actgatgacc ccgcgacgct gtacgccgtg 1440

gtggagaacg tgcccccgtt gcgctggaag gaattcgtgc ggcgccttgg gctgagcgac 1500

cacgagatag atcggctgga gctacagaac gggcgctgcc tgcgcgaggc gcaatacagt 1560

atgctggcga cctggaggcg gcgcacgcca cggcgcgagg ccacgctgga gctgctgggt 1620

cgcgtgctcc gcgacatgga cctgctgggc tgcctggagg acatcgagga ggcgctttgc 1680

ggccccgccg ccctcccgcc cgcgcccagt cttctcagaa cgcgtagagt gaagttcagc 1740

agatccgccg acgctcctgc ctatcagcag ggccaaaacc agctgtacaa cgagctgaac 1800

ctggggagaa gagaagagta cgacgtgctg gacaagcgga gaggcagaga tcctgaaatg 1860

ggcggcaagc cgacggaa gaatcctcaa gagggcctgt ataatgagct gcagaaagac 1920

aagatggccg aggcctacag cgagatcgga atgaagggcg agcgcagaag aggcaaggga 1980

cacgatggac tgtaccaggg cctgagcacc gccaccaagg atacctatga tgccctgcac 2040

atgcaggccc tgcctccaag agctagcgga agcggagcta ctaacttcag cctgctgaag 2100

caggctggag acgtggagga gaaccctgga cctatggtga gcaagggcga ggagctgttc 2160

accggggtgg tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagttcagc 2220

gtgtccggcg agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc 2280

accaccggca agctgcccgt gccctggccc accctcgtga ccaccctgac ctacggcgtg 2340

cagtgcttca gccgctaccc cgaccacatg aagcagcacg acttcttcaa gtccgccatg 2400

cccgaaggct acgtccagga gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc 2460

cgcgccgagg tgaagttcga gggcgacacc ctggtgaacc gcatcgagct gaagggcatc 2520

gacttcaagg aggacggcaa catcctgggg cacaagctgg agtacaacta caacagccac 2580

aacgtctata tcatggccga caagcagaag aacggcatca aggtgaactt caagatccgc 2640

cacaacatcg aggacggcag cgtgcagctc gccgaccact accagcagaa cacccccatc 2700

ggcgacggcc ccgtgctgct gcccgacaac cactacctga gcacccagtc cgccctgagc 2760

aaagacccca acgagaagcg cgatcacatg gtcctgctgg agttcgtgac cgccgccggg 2820

atcactctcg gcatggacga gctgtacaag taa 2853

<210> 109

<211> 950

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<220>

<221> source

<223> /note="CD20-CAR (TNFR1TM-TNFR1-CD3z)-P2A-GFP"

<400> 109

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu

20 25 30

Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly

35 40 45

Tyr Thr Phe Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly

50 55 60

Gln Gly Leu Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr

65 70 75 80

Ser Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys

85 90 95

Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp

100 105 110

Ser Ala Val Tyr Tyr Cys Ala Arg Ala Gln Leu Arg Pro Asn Tyr Trp

115 120 125

Tyr Phe Asp Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Lys Ile

130 135 140

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

145 150 155 160

Gly Gly Ser Ser Asp Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser

165 170 175

Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser

180 185 190

Val Ser Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys

195 200 205

Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg

210 215 220

Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg

225 230 235 240

Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ile Ser

245 250 255

Asn Pro Pro Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Ser Ala

260 265 270

Trp Ser His Pro Gln Phe Glu Lys Ser Gly Met His Thr Thr Thr Pro

275 280 285

Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu

290 295 300

Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His

305 310 315 320

Thr Arg Gly Leu Asp Phe Ala Cys Asp Val Leu Leu Pro Leu Val Ile

325 330 335

Phe Phe Gly Leu Cys Leu Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr

340 345 350

Arg Tyr Gln Arg Trp Lys Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys

355 360 365

Ser Thr Pro Glu Lys Glu Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro

370 375 380

Leu Ala Pro Asn Pro Ser Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr

385 390 395 400

Leu Gly Phe Ser Pro Val Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr

405 410 415

Tyr Thr Pro Gly Asp Cys Pro Asn Phe Ala Ala Pro Arg Arg Glu Val

420 425 430

Ala Pro Pro Tyr Gln Gly Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala

435 440 445

Ser Asp Pro Ile Pro Asn Pro Leu Gln Lys Trp Glu Asp Ser Ala His

450 455 460

Lys Pro Gln Ser Leu Asp Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val

465 470 475 480

Val Glu Asn Val Pro Pro Leu Arg Trp Lys Glu Phe Val Arg Arg Leu

485 490 495

Gly Leu Ser Asp His Glu Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg

500 505 510

Cys Leu Arg Glu Ala Gln Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg

515 520 525

Thr Pro Arg Arg Glu Ala Thr Leu Glu Leu Leu Gly Arg Val Leu Arg

530 535 540

Asp Met Asp Leu Leu Gly Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys

545 550 555 560

Gly Pro Ala Ala Leu Pro Pro Ala Pro Ser Leu Leu Arg Thr Arg Arg

565 570 575

Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln

580 585 590

Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp

595 600 605

Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro

610 615 620

Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp

625 630 635 640

Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg

645 650 655

Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr

660 665 670

Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Ala

675 680 685

Ser Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp

690 695 700

Val Glu Glu Asn Pro Gly Pro Met Val Ser Lys Gly Glu Glu Leu Phe

705 710 715 720

Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly

725 730 735

His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly

740 745 750

Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro

755 760 765

Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr Gly Val Gln Cys Phe Ser

770 775 780

Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met

785 790 795 800

Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly

805 810 815

Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val

820 825 830

Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile

835 840 845

Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile

850 855 860

Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg

865 870 875 880

His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln

885 890 895

Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr

900 905 910

Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp

915 920 925

His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly

930 935 940

Met Asp Glu Leu Tyr Lys

945 950

<210> 110

<211> 214

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> /note="CD8 H-TNFR2 TM-TNFR2del151-3z"

<400> 110

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Ala Leu

35 40 45

Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly Leu Leu Ile Ile

50 55 60

Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys Lys Lys Pro Leu

65 70 75 80

Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala

85 90 95

Arg Gly Gly Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala

100 105 110

Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg

115 120 125

Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu

130 135 140

Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn

145 150 155 160

Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met

165 170 175

Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly

180 185 190

Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala

195 200 205

Leu Pro Pro Arg Ala Ser

210

<210> 111

<211> 15

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 111

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 112

<211> 4

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 112

Gly Gly Gly Ser

1

<210> 113

<211> 16

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 113

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser

1 5 10 15

<210> 114

<211> 5

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 114

Gly Gly Gly Gly Ser

15

<210> 115

<211> 10

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 115

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10

<210> 116

<211> 15

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 116

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 117

<211> 20

<212>PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

peptide"

<220>

<221> source

<223> ./note="Linker"

<400> 117

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser

20

<---

Claims (28)

1. A chimeric antigen receptor (CAR) with lower tonic signaling when expressed in immune cells compared to immune cells expressing a CAR without the TNFR2 intracellular co-stimulatory signaling domain, wherein said CAR contains a single polypeptide chain comprising an extracellular binding domain, a transmembrane domain, and intracellular domain, where the intracellular domain includes a human tumor necrosis factor receptor 2 TNFR2 costimulatory intracellular signaling domain or a functional fragment thereof, wherein said functional fragment comprises at least 80 contiguous amino acid residues from the human TNFR2 costimulatory intracellular signaling domain. 2. The CAR of claim 1, wherein the transmembrane domain comprises a human TNFR2 transmembrane domain or a functional fragment thereof, wherein said functional fragment comprises at least 6 contiguous amino acids from the human TNFR2 transmembrane domain. 3. The CAR of claim 1 or 2, comprising an extracellular hinge domain, preferably wherein the hinge domain comprises a human CD8 or CD28 hinge region, and more preferably wherein the hinge domain comprises the sequence SEQ ID NO: 14 or a sequence having at least about 70% identity with SEQ ID NO: 14. 4. The CAR according to any one of claims 1 to 3, wherein the intracellular domain comprises a primary intracellular signaling domain of an immune cell, preferably a primary intracellular signaling domain of a human CD3-zeta T cell, preferably comprising the sequence SEQ ID NO: 28, 29, 30 or 31 or a sequence having at least about 70% identity to SEQ ID NO: 28, 29, 30 or 31. 5. CAR according to any one of claims 1-4, containing: - extracellular binding domain, and - an extracellular hinge domain comprising the hinge region of human CD8 or CD28, and (i) a transmembrane domain, and an intracellular domain comprising a human TNFR2 costimulatory intracellular signaling domain or a functional fragment thereof, wherein said functional fragment comprises at least 80 contiguous amino acid residues from the human TNFR2 costimulatory intracellular signaling domain, and a primary CD3-zeta intracellular signaling domain person, or (ii) a transmembrane domain comprising a human TNFR2 transmembrane domain or a functional fragment thereof, where said functional fragment comprises at least 6 contiguous amino acid residues from a human TNFR2 transmembrane domain, and an intracellular domain comprising a human TNFR2 costimulatory intracellular signaling domain or a functional fragment thereof, wherein said functional fragment comprises at least 80 contiguous amino acid residues from the costimulatory intracellular signaling domain of human TNFR2, and the primary intracellular signaling domain of human CD3-zeta. 6. The CAR of any one of claims 2 to 5, wherein the transmembrane domain contains at least six contiguous amino acids from SEQ ID NO: 22 or a sequence having at least about 70% identity to SEQ ID NO: 22, optionally in combination with amino acid residues of the transmembrane domain of a protein that is not TNFR2. 7. CAR according to any one of claims 2 to 6, wherein the transmembrane domain contains the amino acid sequence VNCVIMTQV (SEQ ID NO: 63). 8. The CAR according to any one of claims 1 to 7, wherein the intracellular domain contains at least 30 contiguous amino acid residues from SEQ ID NO: 34 or a sequence having at least about 70% identity to SEQ ID NO: 34, optionally in combination with amino acid residues of the costimulatory intracellular signaling domain of a protein that is not TNFR2. 9. The CAR according to any one of claims 1 to 8, wherein said intracellular domain contains residues 1-115 or 1-156 of SEQ ID NO: 34. 10. CAR according to any one of claims 1-9, containing: - extracellular binding domain, - extracellular hinge domain containing the CD8 hinge region SEQ ID NO: 14, - a transmembrane domain containing the TNFR2 transmembrane domain of SEQ ID NO: 22, and - intracellular domain containing: (a) the TNFR2 costimulatory intracellular signaling domain of SEQ ID NO: 34, and (b) the primary intracellular signaling domain of human CD3-zeta from SEQ ID NO: 28, 29, 30 or 31. 11. The CAR according to any one of claims 1 to 10, wherein the extracellular binding domain is an antibody or an antigen binding fragment thereof, preferably a single chain variable fragment (scFv). 12. A nucleic acid encoding a CAR according to any one of claims 1 to 11, comprising a nucleic acid encoding a CAR which contains a single polypeptide chain containing an extracellular binding domain, a transmembrane domain and an intracellular domain, wherein the intracellular domain includes a costimulatory intracellular necrosis factor receptor signaling domain human TNFR2 tumors or a functional fragment thereof, wherein said functional fragment comprises at least 80 contiguous amino acid residues from the costimulatory intracellular signaling domain of human TNFR2. 13. An immune cell expressing a CAR according to any one of claims 1 to 11. 14. The immune cell of claim 13, wherein the immune cell is selected from the group consisting of a T cell, a natural killer (NK) cell, an αβ T cell, a γδ T cell, a double negative (DN) cell, a regulatory immune cell, a regulatory T (Treg) cells, an effector immune cell, an effector T cell, a B cell and a cell of myeloid origin, and any combination thereof, where the immune cell is optionally a human cell, preferably where the cell is a Treg cell, wherein the Treg cell not necessarily a human cell. 15. An immune cell population comprising an immune cell according to claim 13 or 14, for treating a disease or disorder in a human subject in need thereof, preferably wherein the disease or disorder is selected from the group consisting of an inflammatory disease, an autoimmune disease, an allergic disease, a condition after organ transplantation, cancer and infectious disease. 16. Use of a population of immune cells according to claim 15 as a medicament for treating a disease or disorder in a human subject in need thereof, wherein the immune cells are regulatory immune cells and wherein the disease or disorder is selected from the group consisting of an inflammatory disease, autoimmune disease, allergic disease, organ transplant condition, cancer and infectious disease. 17. Use according to claim 16, wherein the immune cell population is a Treg cell population and wherein the human subject is in need of immunosuppression.

Images