RU2807306C1 - Method of detecting dnajb1-prkaca chimeric transcript in clinical tissue samples from patients with fibrolamellar liver carcinoma using real-time polymerase chain reaction - Google Patents

Abstract

FIELD: biotechnology and medicine.

SUBSTANCE: method of detecting the chimeric DNAJB1-PRKACA transcript in clinical tissue samples from patients with fibrolamellar liver carcinoma using real-time polymerase chain reaction is described, the said method is characterized by the use of specific oligonucleotide sequences, primers, with the following SEQ ID NO: 1, NO. 2, the following SEQ ID NO: 4, NO. 5, supplemented with specially adapted fluorescent probes of the following SEQ ID NO: 3, ID NO: 6.

EFFECT: invention makes it possible to differentiate fibrolamellar carcinomas from other types of liver tumors in order to select the optimal treatment tactics for a specific disease, and also improves diagnostic accuracy through the use of original oligonucleotide sequences and optimized reaction conditions.

1 cl, 2 dwg, 7 ex

Description

The invention relates to the fields of biotechnology and medicine, namely to molecular oncology, and concerns a method for identifying a specific chimeric DNAJB1-PRKACA transcript in samples of a separate subtype of hepatocellular carcinoma (HCC) - fibrolamellar carcinoma (FlC) (Shavochkina D.A., Kustova I.F. ., Lazarevich N.L. Fibrolamellar carcinoma as a separate subtype of hepatocellular cancer: molecular genetic features, diagnosis, treatment prospects // Malignant tumors. - 2017. - N 3 (7). - P. 71-80), which usually occurs in young patients and is characterized by a special morphological structure. The proposed method can be used in clinical practice for reliable differential diagnosis of fibrolamellar carcinoma from other forms of liver tumors to select the optimal treatment tactics for a specific disease (O'Neill A.F., Church A.J., Perez-Atayde A.R., Shaikh R., Marcus K.J., Vakili K. Fibrolamellar carcinoma: An entity all its own // Current Problems in Cancer. - 2021. - Vol. 45, No. 4. - P. 100770).

In 2014, during a full transcriptomic analysis of FlK samples, a chimeric DNAJB1-PRKACA transcript was discovered, which is formed as a result of the deletion of a 400 thousand nucleotide pairs (kb) region of chromosome 19, leading to the fusion of two genes (Honeyman J.N., Simon E R. Robine N., Chiaroni-Clarke R., Darcy D.G., Lim LLP., Gleason C.G., Murphy J., Rosenberg B.R., Teegan L., Takacs C.N., Botero S., Belote R., Germer S., Emde A-K., Vacic V., Bhanot U., Michael P. LaQuaglia M.P., Simon S.F. Detection of a Recurrent DNAJB1-PRKACA Chimeric Transcript in Fibrolamellar Hepatocellular Carcinoma // Science. - 2014. - Vol. 343, No. 6174. - P . 1010-1022). This rearrangement changes the biological properties of the genes that form the chimeric transcript and, as a consequence, the proteins encoded by these genes. The formation of the DNAJB1-PRKACA chimeric transcript is specific for FlK, is a key genetic disorder in the formation of this form of tumors, and is considered as a promising target for the development of targeted drugs for the treatment of this form of tumors. Currently, in clinical practice, differential diagnosis of FLC from other forms of liver tumors is carried out on the basis of histological examination of postoperative sections, however, this method is time-consuming, requires significant qualifications of the performer and does not always allow obtaining an unambiguous answer.

In the international application “Method for detecting DNAJB1-PRKACA gene”, which describes options for methods for detecting a chimeric transcript or the protein sequences encoded by it, a specific set of primers was presented for detecting the DNAJB1-PRKACA transcript using various molecular biological methods (WO 2015/129655 A1) .

The disadvantage of this method is the inability to verify the proprietary primer set. The application does not contain data on the use of the reference gene.

In 2015, in a scientific article by Graham and co-authors, 3 methods were proposed to detect the DNAJB1-PRKACA chromosomal rearrangement or the resulting chimeric transcript (Graham R.P., Jin L., Knutson D.L., Kloft-Nelson S.M., Greipp P.T., Waldburger N., Roessler S., Longerich T., Roberts L.R., Oliveira A.M., Kevin S. Hailing K.C., Schirmacher P., Torbenson M.S. DNAJB1-PRKACA is specific for fibrolamellar carcinoma // Modern Pathology. - 2015. - Vol. 28, No. 6. - P. 822-829).

1. Fluorescent in situ hybridization (FISH) method used to diagnose chromosomal abnormalities. The method is based on the use of DNA probes, complementary to the DNA region under study, with a specific fluorescent label.

R.P. Graham et al used FISH to detect the DNAJB1-PRKACA fusion gene resulting from chromosomal rearrangement on paraffin sections of human liver tumor samples.

The disadvantages of this method are labor intensity, the need for specialized reagents and equipment, high cost and time-consuming.

2. The RNA in situ hybridization (RNA ISH) method, which allows semi-quantitative assessment of RNA expression on paraffin sections of the tissue samples under study. Graham et al used this method to assess the expression levels of the chimeric DNAJB1-PRKACA transcript and the intact PRKACA transcript using specific oligonucleotide probes.

The disadvantages of this method include high labor intensity, subjectivity in assessing the analysis results, and the high cost of the specialized reagents used.

3. Polymerase chain reaction (PCR) method with reverse transcription with endpoint detection with specific primers for the DNAJB1-PRKACA chimeric transcript, proposed in 2015 by R.P. Graham et al., is a prototype of the proposed method. The object of study in this method is cDNA preparations obtained by reverse transcription of total RNA samples isolated from paraffin sections fixed in formalin of tumor tissues after microdissection, in an amount equivalent to 50-100 ng of RNA per reaction.

The design of the primers used for PCR was carried out in such a way that the left primer corresponds to the sequence of exon 1 of the DNAJB1 gene, and the right one corresponds to exon 2 of the PRKACA gene. As a result of PCR, only chimeric transcripts containing sequences complementary to the sequences of both genes are amplified, which ensures the specificity of the reaction. To check the presence and quality of the taken cDNA, an independent reaction with primers to the reference gene phosphoglycerol kinase 1 (PGK1) is used. The method is not quantitative; at the end of the reaction, its result for each of the two transcripts is analyzed by electrophoresis of PCR products in a 3% agarose gel, stained with ethidium bromide, according to the presence/absence of a product of the expected size.

The disadvantages of the method are that it is labor-intensive, time-consuming, the need to use significant quantities of RNA samples, the low sensitivity of detecting a chimeric transcript and, as a consequence, the possibility of obtaining false-negative results, and the inability to quantify the results of independent amplification of two different transcripts in different reactions.

The objective of the invention is to develop a new, most sensitive and unified method for detecting the DNAJB1-PRKACA chimeric transcript and assessing its relative amount in clinical samples of human fibrolamellar liver carcinoma.

The technical result of the invention lies in the fact that the claimed method. has high specificity and sensitivity, allowing for high reliability detection of the DNAJB1-PRKACA chimeric transcript in the studied samples. The invention is available for use in clinical practice.

The technical result is achieved by carrying out real-time PCR with specific oligonucleotide sequences - primers (SEQ ID NO 1, NO 2; SEQ ID NO 4, NO 5) and two specially adapted fluorescent probes (SEQ ID NO 3, ID NO 6 ) to increase the sensitivity of the method.

To implement the technical result, cDNA preparations are used, obtained as a result of a reverse transcription reaction with random hexamer primers of samples of total RNA treated with DNase I, isolated from various types (fresh, frozen in liquid nitrogen or in a preservative solution (RNALater or analogues) of tumor samples and (optional , as a negative control) non-tumor liver tissue obtained during tumor resection, or similarly preserved biopsy material. If necessary, RNA samples isolated from paraffin sections fixed in formalin of tumor tissue can also be used, but in this case the amount of RNA and its integrity will be significantly reduced.

The resulting cDNA preparations are used as a template in multiplex real-time PCR with specific primers and TaqMan fluorescent probes (linear degradable probes), labeled at the 5' end with a fluorophore and at the 3' end with a fluorescence quencher. Detection of the reaction results is carried out at each amplification cycle due to the fluorescence of the TaqMan probe, which increases linearly due to its destruction by the polymerase upon binding to a specific sequence within the analyzed amplicon.

A distinctive feature of the claimed invention is a system of four primers and two fluorescent probes, which makes it possible to specifically detect in one reaction the chimeric transcript DNAJB1-PRKACA, a marker for FlK, and the transcript of the reference gene C-terminal binding protein 1 (CTBP1), which is uniformly expressed in normal liver tissues and in HCC of various etiologies and is used to control the quantity and integrity of RNA preparations used for analysis.

Oligonucleotide sequences are given in the Sequence List.

A copy of the List of Oligonucleotide Sequences presented on a machine-readable medium is identical to the List of Oligonucleotide Sequences in printed form.

The following oligonucleotide sequences are used:

1) Primers:

A. DNAJB1-PRKACA

i. Left TTCAAGGAGATCGCTGAGGC (SEQ ID NO 1)

ii. Right TGTGTTCTGAGCGGGACTTT (SEQ ID NO 2)

b. CTBP1

iii. Left AAGGATGCACCCAACCTCAT (SEQ ID NO 4)

iv. Right GATGGTCCTTGTTGACACAGT (SEQ ID NO 5)

2) Fluorescently labeled TaqMan probes:

A. DNAJB1-PRKACA HEX-CGCTACGGGGAGGAAGTGAA-BHQ1 (SEQ. ID NO 3)

b. CTBP1 FAM-CGAGAGGAGGCGGCACGGGA-BHQ1 (SEQ ID NO 6)

The selection of primer and probe sequences includes the design of oligonucleotides that are strictly complementary to the target sequences of the detected transcripts. The length of the amplified region is 147 nucleotide pairs (bp) for the DNAJB1-PRKACA fusion transcript and 154 bp. for STVR1. The design of the primers used for PCR of the chimeric transcript is carried out in such a way that the left primer corresponds to the sequence of exon 1 of the DNAJB1 gene, and the right one lies at the junction of exons 2 and 3 of the PRKACA gene, which ensures specific amplification only of chimeric transcripts containing sequences complementary to the sequences of both genes . An additional increase in the specificity of the reaction is achieved by using a fluorescent probe complementary to the sequences located at the junction of two genes.

Amplification is carried out in real time on devices that provide the ability to detect fluorescence in two channels: FAM and HEX, for example, CFX Connect, CFX 96 or CFX Opus Real-Time PCR Detection System (Bio-Rad).

The composition of the PCR mixture for one reaction (25 µl) includes:

- 0.2 pmol/μl of each of 4 primers,

- 0.1 pmol/μl of each of two fluorescent probes,

- cDNA of the test sample (hereinafter: conditional ng - the amount of cDNA obtained by reverse transcription of 1 ng of total RNA, a.ng) - 15 (permissible concentration range - 0.5-32) a.ng;

as well as components of a real-time PCR kit (for example, Syntol, catalog number R-412):

- dNTP with a final concentration in the reaction of 0.25 mM,

- PCR buffer without MgCl ₂ with a final concentration in the reaction of 1x,

- MgCl ₂ with a final concentration in the reaction of 2.5 mM,

- SynTaq DNA polymerase with a final amount of activity in the reaction of 1.5 units.

PCR mode:

Stage 1: denaturation at t=95°C for 5 minutes

Stage 2: 40 PCR cycles:

- denaturation at t=95°C for 30 seconds

- annealing of oligonucleotides at t=62°C for 30 seconds

- elongation at t=72°С for 50 sec

- detection of fluorescent signal

Stage 3: elongation at t=72° for 5 minutes.

Detection of the fluorescent signal is carried out at each cycle of the second stage immediately after completion of elongation.

The reaction is carried out with the following set of samples:

• Water (sample into which, instead of the test sample, water is added, in which the entire reaction is prepared)

• Control RNA sample without reversion (a sample in which FlK tumor RNA is used as a template, subjected to a reversion reaction without the addition of the reverse transcriptase enzyme)

• Test samples are samples of tumor and (optionally) non-tumor liver tissue from the same patient.

• If it is necessary to carry out quantitative testing (see below), a calibration curve from three consecutive fourfold dilutions of a cDNA sample positive for the presence of the DNAJB1-PRKACA chimeric transcript (from a FlK tumor), for example, 32, 8 and 2 u.ng of cDNA. The ng of cDNA is equal to the mass of RNA introduced into the reversion reaction, expressed in ng of the SI system.

Each reaction is carried out in three technical repetitions: for each repetition a separate master mix is mixed, the cDNA sample under study is diluted to the required concentration once for all three repetitions.

Interpretation of PCR results.

Interpretation of multiplex real-time PCR results is carried out using the built-in software for the cycler used (for example, Bio-Rad CFX Maestro) according to the manufacturer's recommendations.

The reaction is considered positive if the signal is registered in at least 2 out of three technical replicas, and:

• Ct (average threshold cycle between technical replicates) of the reference transcript CTBP1 should be less than or equal to 36.v. otherwise, it is necessary to rearrange the PCR with a larger amount of sample or repeat the study with a fresh RNA sample.

• A chimeric transcript is considered to be expressed if the Ct signal of the corresponding probe is less than or equal to 36 in the reaction.

• In control reactions with water and control without reversal, the signal is not detected until the 38th cycle.

The invention is illustrated by figures 1 and 2.

Figure 1. Results of a multiplex reaction with primers and probes for DNAJB1-PRKACA (HEX channel) and CTBP1 (FAM channel) in cDNA samples from tumor (O) and non-tumor (N) liver tissue. A) NTC - sample - water. B) NRT - sample - 20 ng RNA FlK HCC 144-0 without reversion, C) Matrix - 15 u.ng cDNA FlK HCC 087-P, D) matrix - 15 u.ng cDNA FlK HCC 087-O, E) matrix - 15 u.ng cDNA of non-fibrolamellar HCC 83-P, E) matrix - 15 u.ng cDNA of non-fibrolamellar HCC 83 O. Circles indicate the FAM signal, triangles - HEX.

Figure 2. Relative level of expression of the chimeric transcript DNAJB1-PRKACA, normalized by the expression of the reference gene STBP1, for 7 pairs of samples of non-tumor (N) and tumor (T) liver tissue of 5 cases of FlC (HCS 087, 103, 108, 144, 148) and 2 cases of non-fibrolamellar (NSS 83, 88) form of HCC. Analysis of PCR results was carried out using the Bio-Rad CFX Maestro program in normalized expression mode (ΔΔCq).

An example of the results obtained is presented in Figure 1. It shows the results of a multiplex reaction with primers and probes for DNAJB1-PRKACA (HEX channel) and CTBP1 (FAM channel) in cDNA samples from tumor (O) and non-tumor (N) liver tissue. A) NTC - sample - water. B) NRT - sample - 20 ng RNA FlK HCC 144-0 without reversion, C) Matrix - 15 u.ng cDNA FlK HCC 087-P, D) matrix - 15 u.ng cDNA FlK HCC 087-O, E) matrix - 15 u.ng cDNA of non-fibrolamellar HCC 83-P, E) matrix - 15 u.ng cDNA of non-fibrolamellar HCC 83 O. Green circles indicate the FAM signal, red triangles - HEX.

If a calibration curve is available, quantitative analysis of the results obtained can be performed using a positive control sample. In this case, upon completion of the reaction, in the appropriate program (for example, Bio-Rad CFX Maestro), based on the calibration curve for each channel, the value of the threshold cycle Ct and the conditional amount of product for the DNAJB1-PRKACA and CTBP1 amplicons are determined, and the relative amount of the chimeric transcript is determined relative to the reference in each of the samples. An example of quantitative analysis results for 7 pairs of samples of various forms of HCC and non-tumor liver tissue is presented in Figure 2.

The invention is illustrated by examples 1-7, representing a study of paired samples of tumor and non-tumor liver tissue in various forms of HCC.

Example 1.

Identifier: ГЦК 83

Age: 74 years

Diagnosis: non-fibrolamellar form of HCC.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was not detected either in the tumor tissue or in the adjacent healthy liver tissue.

Example 2.

Identifier: ГЦК 88

Age: 53 years

Diagnosis: non-fibrolamellar form of HCC.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was not detected either in the tumor tissue or in the adjacent healthy liver tissue.

Example 3.

Identifier: ГЦК 087

Age: 21 years old. Diagnosis: FlK.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was detected in the tumor tissue and was not detected in the adjacent healthy liver tissue.

Example 4.

Identifier: ГЦК 103

Age: 17 years old.

Diagnosis: FlK.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was detected in the tumor tissue and was not detected in the adjacent healthy liver tissue.

Example 5.

Identifier: ГЦК 108

Age 19 years.

Diagnosis: FlK.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was detected in the tumor tissue, but was not detected in the adjacent healthy liver tissue.

Example 6.

Identifier: G TsK 144

Age: 30 years old.

Diagnosis: FlK.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was detected in the tumor tissue and was not detected in the adjacent healthy liver tissue.

Example 7.

Identifier: ГЦК 148

Age: 20 years old.

Diagnosis: FlK.

The presence of DNAJB1-PRKACA expression was analyzed using the stated method.

Result: When examining excised tissue material from the patient, DNAJB1-PRKACA expression was detected in the tumor tissue and was not detected in the adjacent healthy liver tissue.

--->

List of oligonucleotide sequences

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="Method for

detecting the DNAJB1-PRKACA chimeric transcript in tissue samples

from patients with fibrolamellar liver carcinoma by real-time

polymerase chain reaction.xml" softwareName="WIPO Sequence"

softwareVersion="2.2.0" productionDate="2023-03-09">

<ApplicationIdentification>

<IPOfficeCode> N.N. Blokhin National Medical Research Center of

Oncology оf the Ministry of Health of the Russian

Federation</IPOfficeCode>

<ApplicationNumberText> IPC:C12N15/00</ApplicationNumberText>

<ApplicantFileReference>IPC: C12N15/00</ApplicantFileReference>

<ApplicantName languageCode="ru">Natalia Lazarevich </ApplicantName>

<ApplicantNameLatin>Natalia Lazarevich</ApplicantNameLatin>

<InventorName languageCode="ru">Artem Gorev</InventorName>

<InventorNameLatin>Artem Gorev</InventorNameLatin>

<InventionTitle languageCode="en">Method for detecting chimeric

DNAJB1-PRKACA transcript in tissue samples from patients with

fibrolamellar liver carcinoma using the polymerase chain method

real-time reactions</InventionTitle>

<SequenceTotalQuantity>6</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ttcaaggagatcgctgaggc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q4">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tgtgttctgagcgggacttt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q6">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cgctacggggaggaagtgaa</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aaggatgcacccaacctcat</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q10">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gatggtccttgttgacacagt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q12">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cgagaggaggcggcacggga</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (1)

A method for detecting the chimeric DNAJB1-PRKACA transcript in clinical tissue samples from patients with fibrolamellar liver carcinoma using real-time polymerase chain reaction, characterized by the use of specific oligonucleotide sequences - primers - SEQ ID NO: 1, NO: 2; SEQ ID NO: 4, NO: 5, supplemented with specially adapted fluorescent probes SEQ ID NO: 3, ID NO: 6.