RU2806699C2 - C. novyi for the treatment of human solid tumors - Google Patents

Abstract

FIELD: medicine; oncology; therapy.

SUBSTANCE: cytoreduction or destruction of a solid tumor present in humans. A method for cytoreduction or destruction of a solid tumor involves administering to a human tumor one to four cycles of dose units of C. novyi NT spores comprising approximately 1×10³-1×10⁵ spores per cycle. Each dose unit of C. novyi NT is suspended in a pharmaceutically acceptable carrier or solution. Moreover, C. novyi NT is effective for cytoreduction or destruction of solid tumors without the introduction of additional anticancer agents.

EFFECT: cytoreduction or destruction of a solid tumor in a patient.

28 cl, 16 dwg, 18 tbl, 9 ex

Description

Field of technology to which the invention relates

The present invention provides, in particular, methods for treating or mitigating a solid tumor present in a person, cytoreducing a solid tumor present in a person, microscopically precise excision of tumor cells in a person, and eradicating a solid tumor present in a person. C. novyi CFU dose units and kits are also provided.

Cross reference to related applications

The present invention claims benefit from US Provisional Application No. 61/806497, filed March 29, 2013, the entire contents of which are incorporated by reference.

State of the art

Strategies that have successfully targeted human malignancies exploit the differences between normal and malignant tissues (Dang et al., 2001). Such differences may be found at the molecular level, as observed in the case of genetic aberrations, or more globally in the case of physiological aberrations in the tumor.

It is known that malignant solid tumors usually consist of a necrotic central mass and a viable peripheral mass. Therapeutic interventions to date have focused on the well-vascularized outer tumor mass, but few have targeted the inner hypoxic mass (Jain et al., 2001). The internal mass of a tumor has unique characteristics that distinguish it from normal tissue. The central mass has a poor blood supply and is therefore deficient in nutrients and oxygen. At the site of active cell necrosis, the lack of a functioning blood supply limits the clearance of toxic destroyed cells and results in low pH. This medium is not suitable for the growth of most human cells, but is a rich medium for the growth of certain anaerobic bacteria. More than sixty years ago, this concept led researchers to inject Clostridium histolyticus spores into tumor-bearing animals (Parker et al., 1947). Remarkably, the bacteria only grew in the necrotic central mass of the tumor and liquefied the tumors. In the 1950s and 1960s, Clostridium butyricum spores were administered to patients with a variety of very advanced solid malignant tumors (Mose, 1967; Mose, 1972). Many patients experienced significant growth and destruction of a significant proportion of their tumors, but the very poor health of these patients and the advanced stage of the disease made their clinical management difficult, and the lack of complete clinical responses weakened further pursuit of this goal.

Successful treatment of solid tumors remains an unmet goal in medicine. Thus, there is a need to find treatments for solid tumors. The present invention addresses this and other needs.

Summary of the invention

One embodiment of the present invention is a method of treating or mitigating a solid tumor present in a human. This method involves administering to a human tumor a unit dose of colony forming units (CFU) of C. novyi comprising approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

Another embodiment of the present invention is a method for cytoreduction of a solid tumor present in a human. This method involves administering to a human tumor a unit dose of C. novyi CFU comprising approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

A further embodiment of the present invention is a method for cytoreducing a solid tumor present in a human. This method involves administering to a human tumor, over one to four cycles, a dose unit of C. novyi NT spores comprising approximately 1×10 ⁴ spores per cycle, with each dose unit of C. novyi NT suspended in a pharmaceutically acceptable carrier or solution.

A further embodiment of the present invention is a method of treating or ameliorating a solid tumor present in a human. This method involves administering to a human tumor, over one to four cycles, a dose unit of C. novyi NT spores comprising approximately 1×10 ⁴ spores per cycle, with each dose unit of C. novyi NT suspended in a pharmaceutically acceptable carrier or solution.

Another embodiment of the present invention is a method for destroying a solid tumor present in a human. This method involves administering to a human tumor a unit dose of C. novyi CFU comprising approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable vehicle or solution, where the tumor is killed leaving a margin of normal tissue.

In another embodiment, the present invention provides a CFU dosage unit of C. novyi. This dosage unit includes approximately 1×10 ³ -1×10 ⁷ CFU in a pharmaceutically acceptable carrier or solution that is effective for treating or ameliorating a solid tumor present in a human.

In a further embodiment, the present invention provides a kit for treating or mitigating a solid tumor present in a human. This kit includes a C. novyi CFU dosage unit comprising approximately 1×10 ³ -1×10 ⁷ CFU in a pharmaceutically acceptable carrier or solution, and instructions for use of the kit.

In another embodiment, the present invention provides a method for microscopically precise removal of tumor cells in humans. This method involves administering to a human tumor a unit dose of C. novyi NT colony forming units (CFU) comprising approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

In another embodiment, the present invention provides a method of treating or mitigating a solid tumor that has metastasized to one or more sites in the human body. This method involves administering to a human tumor a unit dose of C. novyi NT colony forming units (CFU) comprising at least about 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

Brief description of the figures

Figures 1A-B show various images of canine osteosarcomas on the right distal radius/ulna of test subjects "Sasha" (Figure 1A) and "Sampson" (Figure 1B) following radiation therapy and intravenous (IV) administration of C. novyi N.T.

Figure 2A shows Kaplan-Meier curves demonstrating the survival of Fisher F433 rats after orthotopic implantation of a syngeneic glioma cell line (F98). External line - C. novyi-NT spores were injected into the tumor 12-15 days after tumor implantation. Internal line - control. Figure 2B shows bioluminescence (Xenogen imaging system) in three illustrative Fisher F433 rats following orthotopic implantation of the F98 glioma cell line. Images obtained on day 0 (pre-treatment - day of injection of C. novyi-NT spores), on day 1 after IT injection of C. novyi-NT spores, and on day 2 after IT injection of C. novyi-NT spores. Figure 2C shows luciferase activity (amount in millions) on day 0 (pre-treatment), day 1 post-IT administration of C. novyi-NT spores, and day 2 post-IT administration of C. novyi-NT spores.

Figures 3A-B and 4A-B show germinated C. novyi-NT bacteria within microscopic lesions of a brain tumor. In these figures, Gram staining revealed vegetative C. novyi-NT bacteria (white or black arrowheads) localized in tumor tissue (T) and stellate microinvasion (S) but not in normal brain tissue (Br). Figure 3A is a 100x magnification showing the interface between tumor and normal brain. Figure 3B is a 400x magnification showing the interface between tumor and normal brain. Figure 4A is a 100× magnification showing the interface between normal brain, tumor, and stellate microinvasion of tumor tissue. Figure 4B is a 400× magnification showing the growth of C. novyi-NT into a star-shaped microinvasive lesion.

Figure 5 is a summary table of sequenced samples.

Figure 6 is a table of copy number changes in canine sarcomas.

On the figure 7A-F are photographic CT images from dog 11-R01 showing a partial response to C. novyi-NT treatment. Images cover the time from pretreatment to day 70 after the first IT dose of C. novyi-NT spores. Figure 7A shows an image of a peripheral nerve sheath tumor after pretreatment. Figure 7B shows the formation of an abscess on day 3 of the study in an area limited by the tumor. Figure 7C shows medical debridement of a wound after spontaneous rupture of the abscess and release of necrotic and purulent material, allowing healing by secondary intention. Figure 7D shows that the wound was completely healed on study day 70 and there was a 77.6% reduction in the longest tumor diameter. Figure 7E is a post-pretreatment CT image taken 4 days before the first treatment, which shows the extent of the tumor (circles) at the intersection of the auricle and the skull. Figure 7F shows a post-treatment CT image on study day 10 demonstrating almost complete tumor cytoreduction.

Figures 8A-D are photographic and CT images of dog 04-R03 demonstrating complete response to C. novyi-NT treatment. Images span the time from pretreatment to day 60 after the first IT dose of C. novyi-NT spores. Figure 8A shows an image of a soft tissue sarcoma after pretreatment. Figure 8B shows a tumor-localized abscess formed on study day 15, 1 day after the third dose of C. novyi-NT spores. Figure 8C shows that tumor cytoreduction was complete on study day 27 and healthy granulation tissue was formed. Figure 8D shows that the wound was completely healed on study day 60 and no residual tumor was seen (complete response). Figure 8E is a pre-treatment CT image taken 5 days before the first treatment showing the extent of the tumor (circles) on the forearm. Figure 8F shows a post-treatment CT image on study day 62 demonstrating complete loss of tumor mass.

Figure 9 shows the tumor size of dog 11-R01 from initial IT dosing with C. novyi NT spores to completion of the clinical course.

On the figure 10A shows photographic (top panels) and CT images (bottom panels) of a canine soft tissue sarcoma in test subject "Drake" (04-R01) following IT dosing of C. novyi NT spores. The areas enclosed by circles in CT images indicate the location of the tumor. Figure 10B shows the size of the Drake tumor from the initial IT dosing of C. novyi NT, through three subsequent doses until completion of the clinical course.

Figure 11 shows the tumor size of dog 04-R03 from initial IT dosing of C. novyi NT spores, over two subsequent cycles until completion of the clinical course.

On the figure 12A shows tumor size in eight test subjects (11-R02, 04-R02, 26-R01, 16-R02, 04-R05, 16-R03, 11-R04 and 04-R06) during the clinical course in which the four cycles of IT introduction of C. novyi NT spores. Figure 12B shows tumor size in three study subjects (04-R08, 01-R02 and 10-R02) for which full clinical course data were unavailable due to required amputation or cessation of data collection.

Figure 13 shows the tumor administration schedule for the IT treatment study disclosed in Examples 6 and 7.

Figures 14A-D show CT and MRI images of a sick person. Figure 14A shows a contrast-enhanced CT image on day 3 showing evidence of air collection within and outside the medullary region. Figure 14B shows a post-pretreatment (T1 gadolinium-enhanced) MRI image of the right upper humerus demonstrating an enhanced contrast mass including soft tissue and possibly adjacent bone. Figure 14C shows an MRI image at day 4 post-treatment demonstrating a decrease in the enhancement in the tumor mass compared to baseline. Figure 14D shows an MRI image on day 29 after treatment, demonstrating a homogeneous mass without increased contrast with necrosis that had occurred. The tumor is highlighted with arrowheads.

Figures 15A-D show extensive tumor necrosis in a human patient treated with C. novyi-NT spores. Figures 15A and 15B show a pre-treatment tumor biopsy demonstrating tumor cell viability (leiomyosarcoma) at 40x (A) and 100x (B) magnification, respectively. Figures 15C and 15D show a post-treatment tumor biopsy 4 days after IT administration of C. novyi-NT spores, demonstrating extensive tumor cell necrosis, magnification 40x (A) and 100x (B), respectively.

On the figures 16A-D illustrate various aspects of an IT insertion procedure using a tridental needle. Figure 16A shows a photograph of a trident needle. Figures 16B and 16C show computed tomography (CT) images of the targeted injection area before and after needle insertion. Figure 16D shows an enlarged view of a tridental needle. Figure 16E shows a CT image with measurements overlaid to determine needle insertion points.

Detailed Description of the Invention

One embodiment of the present invention relates to a method of treating or mitigating a solid tumor present in a human. This method involves administering to a human tumor a unit dose of colony forming units (CFU) of C. novyi comprising approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

As used herein, the terms “treat,” “treatment,” “therapy,” and grammatical variations thereof, refer to exposing an individual subject (e.g., a diseased individual) to a protocol, regimen, process, or means in which a physiological response or outcome is desired. in this individual, for example, in a patient. In particular, the methods and compositions of the present invention can be used to slow the progression of symptoms of a disease or delay the onset of a disease or condition, or stop the progression of a disease. However, since each individual treated may not respond to a particular treatment protocol, regimen, process, or treatment, treatment does not require that the desired physiological response or outcome be achieved in every individual or subject, e.g., a patient in the population. Accordingly, a given individual or subject, eg a patient, a population, may not respond or respond inadequately to treatment.

As used herein, the terms “improve,” “enhancement,” and grammatical variations thereof refer to a reduction in the severity of symptoms of a disease in an individual.

As used herein, “solid tumor” refers to an abnormal mass of growing cells. Solid tumors can occur in any part of the body. Solid tumors can be cancerous (malignant) or non-cancerous (benign). Examples of solid tumors of the present invention include adrenocortical carcinoma, anal tumor/cancer, bladder tumor/cancer, bone tumors/cancer (eg, osteosarcoma), brain tumor, breast tumor/cancer, carcinoid tumor, carcinoma, cervical tumor/cancer , colon tumor/cancer, endometrial tumor/cancer, esophageal tumor/cancer, extrahepatic bile duct tumor/cancer, Ewing tumor family, extracranial germ cell tumor, eyeball tumor/cancer, gallbladder tumor/cancer, stomach tumor/cancer, germ cell tumor, gestational trophoblastic tumor, head and neck tumor/cancer, hypopharyngeal tumor/cancer, islet cell carcinoma, kidney tumor/cancer, laryngeal tumor/cancer, leiomyosarcoma, leukemia, lip and oral cavity tumor/cancer, liver tumor/cancer (eg, hepatocellular carcinoma), lung tumor/cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative diseases, nasopharyngeal tumor/cancer, neuroblastoma, oral tumor/cancer, oropharyngeal tumor/cancer, osteosarcoma, ovarian epithelial tumor/cancer, ovarian germ cell tumor, pancreatic tumor/cancer, sinus and nasal cavity tumor/cancer, parathyroid tumor/cancer, penile tumor/cancer, pituitary tumor/cancer, plasma cell neoplasm, tumor/cancer prostate, rhabdomyosarcoma, rectal tumor/cancer, renal cell tumor/cancer, transitional cell tumor/cancer of the renal pelvis and ureter, salivary gland tumor/cancer, Sézary syndrome, skin tumors (eg, cutaneous T-cell lymphoma, Kaposi's sarcoma, tumor mast cell, and melanoma), tumor/cancer of the small intestine, soft tissue sarcoma, tumor/cancer of the stomach, tumor/testicular cancer, thymoma, tumor/cancer of the thyroid gland, tumor/cancer of the urethra, tumor/cancer of the uterus, tumor/cancer of the vagina, vulvar tumor/cancer and Wilms tumor. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.

As used herein, the term "dose unit" refers to the amount of drug administered to an individual, such as a human, in a single dose.

When used herein, “C. novyi" refers to bacteria belonging to the Clostridium novyi strain or bacteria derived from it. Clostridium novyi, which can be obtained commercially, for example from ATCC (#19402), is a Gram-positive anaerobic bacterium. Bacteria derived from Clostridium novyi can be obtained, for example, by screening native Clostridium novyi for clones that have specific characteristics. Preferred C. novyi bacteria are bacteria that are non-toxic or minimally toxic to an individual, such as a mammal, such as a human. For example, preferred C. novyi, C. novyi NT are bacteria derived from native Clostridium novyi that have lost their single systemic toxin gene (α-toxin), for example, through genetic engineering or selection procedures. C. novyi NT can be obtained, for example, using the procedure disclosed in Dang et al., 2001 and US patent No. 7344710. Thus, the present invention includes the bacteria C. novyi as well as C. novyi NT.

Pharmacokinetic studies have shown that C. novyi NT spores, when administered intravenously, are rapidly cleared from the bloodstream (more than 99% of spores are cleared within 1 hour) and pass into the reticuloendothelial system. Long-term distribution studies indicate that these spores are eventually cleared from all tissues within one year. Delivered as spores (dormant stage), C. novyi NT germinate (progress from spore to vegetative stage) when exposed to hypoxic areas of tumors. Thus, the toxicity of C. novyi NT is expected to be higher in tumor carriers than in healthy individuals.

Healthy mice and rabbits showed no obvious clinical signs (morbidity, mortality or clinical presentation) of toxicity regardless of treatment dose when administered intravenously with C. novyi NT. However, examination of tissues at autopsies showed both macroscopic and microscopic inflammatory changes, which are believed to be dose-dependent. These changes, mainly in the liver, spleen and adrenal glands, were detected at doses of 5x10 ⁸ spores/kg or more. Healthy animals receiving lower doses did not show macroscopic or microscopic abnormalities at necropsy. In animals that received high doses, resolution of inflammation was evident as early as day 28, and all signs of inflammation were absent in all animals one year after administration. To determine whether C. novyi NT spores would germinate in non-tumor hypoxic tissue, studies of aged mice with atherosclerotic plaques and experimental myocardial infarctions were treated with C. novyi NT. There was no evidence of localization or germination of spores in these vascular lesions. At the conclusion of the study, no clinical or pathological abnormalities (other than pre-existing cardiovascular lesions) were noted in these mice. These studies have shown that C. novyi NT does not cause overt clinical toxicity and causes minimal pathological toxicity in healthy animals.

Intravenous (i.v.) administration of spores to immunocompetent tumor-bearing mice leads to tumor lysis and an intense inflammatory response. Mice typically experience one of three outcomes: one subset of mice (25–35%) are cured (no tumor recurrence after one year of follow-up) and develop long-term resistance to the original tumor (Agrawal et al., 2004). Another subgroup (65-75%) experience a complete clinical response but relapse with regrowth of the primary tumor. Finally, the remaining subgroup (0 to 20% depending on the experiment) undergoes tumor destruction but develops significant clinical toxicity 2 to 5 days after initiation of therapy. Relatively simple measures such as hydration are adequate to reduce this toxicity, often completely eliminating its signs. Studies conducted in larger animals (rabbits) demonstrate similar rates of cure and relapse with C. novyi NT treatment but do not show the life-threatening clinical toxicity observed in a subset of mice. Treatment-related death was observed in tumor-bearing mice, but not in rabbits, treated with C. novyi NT spores (Diaz et al., 2005). In these studies, toxicity was related to both spore dose and tumor size. In the deceased mice, no specific clinical laboratory or pathological damage to target organs was noted and the only significant sign was hepatosplenomegaly. The cured mice had rare residual inflammatory changes in the liver and spleen, but were otherwise indistinguishable from untreated animals. These studies indicate that toxicity in tumor-bearing animals may be severe (death) in mice with large tumors, but was minimal in larger animals (rabbits), and manageable in mice with hydration or antibiotics.

Previous work using C. novyi NT spores administered intravenously (1 x 10 ⁹ spores/m ² ) as the sole agent in tumor-bearing dogs did not show life-threatening toxicity. Dogs were maintained on fluid resuscitation (2-4 ml/kg/hour) for several days after treatment, which may reduce toxicity. Unfortunately, there were no measurable tumor responses to treatment.

As used herein, “colony-forming units” (“CFU”) refers to the viable forms of bacteria that create aggregates of cells (or colonies). Such viable forms include vegetative and spore forms, and the present invention includes both forms, used alone or in combination. Colony-forming unit assays are known in the art. See, for example, Breed et al., 1916. Media to support growth of C. novyi are commercially available, such as enhanced clostridial medium (RCM) from Difco (BD, Franklin Lakes, NJ). As stated above, a dose unit includes approximately 1×10 ³ -1×10 ⁷ , for example, approximately 1×10 ³ -1×10 ⁴ , approximately 1×10 ⁴ -1×10 ⁵ , approximately 1×10 ⁵ -1× 10 ⁶ or approximately 1×10 ⁶ -1×10 ⁷ CFU C. novyi.

In one aspect of this embodiment, a dose unit includes approximately 1×10 ⁶ -1×10 ⁷ CFU of C. novyi. In another aspect of this embodiment, a dose unit includes approximately 1×10 ⁴ CFU of C. novyi. Surprisingly, the doses described herein for human treatment were unexpectedly lower than would be expected by simple extrapolation of the inventors' non-rodent models using 1/6 of the highest doses without severe non-rodent toxicity (HNSTD). , as is typical for the initial therapeutic dose for oncological indications. See, for example, Senderowicz, AM, "Information needed to conduct first-in human oncology trials in the United States: a view from a former FDA medical reviewer." Clin. Cane. Res., 2010, 16:1719-25.

Preferably, in the present invention, C. novyi is C. novyi NT.

In another aspect of this embodiment, a dose unit includes approximately 1×10 ⁶ -1×10 ⁷ C. novyi NT spores. In yet another aspect of this embodiment, a dose unit includes approximately 1×10 ⁴ C. novyi NT spores.

In a further aspect of this embodiment, the administration step includes injecting the dose unit into a single site in the tumor. In another aspect of this embodiment, the administration step includes injecting a dose unit into multiple individual sites, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 unique sites in the tumor. Preferably, the administration step includes injecting the dose unit into 1-5 individual sites in the tumor, for example, in the arrangement shown in Figure 13. In another preferred embodiment, the administration step includes injecting the dose unit into 5 or more individual sites in the tumor. Injections into multiple sites can be performed as described herein, preferably using a multi-pronged needle such as Quadra-Fuse® (Rex-Medical, Conshohocken, PA). In the present invention, the administration step, as noted above, involves injection directly into the tumor, but other methods of introducing an active agent, such as C. novyi or C. novyi NT, into the tumor are also contemplated. Such methods include implantation, transdermal delivery and mucosal delivery.

In another aspect of this embodiment, the method further includes administering to a person with multiple treatment cycles, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 , 25, 30, or more than 30 cycles, with each treatment cycle comprising the injection of one dose unit of C. novyi CFU, such as one dose unit of C. novyi NT spores, into a solid tumor. Preferably, administration is carried out over 1-10 treatment cycles. More preferably, administration is carried out over 2-4 treatment cycles. The interval between each treatment cycle may vary. In one preferred embodiment, the interval between each treatment cycle is approximately 5-100 days. In another preferred embodiment, the interval between each treatment cycle is approximately 7 days.

In an additional aspect of this embodiment, the method further includes intravenous (IV) administration of fluid to a human before, during, and/or after each administration of C. novyi CFU, such as C. novyi NT spores. V./V. fluids for hydrating patients are disclosed herein and are well known in the art. Such fluids may be fluids that are isotonic with blood, such as, for example, 0.9% sodium chloride solution or lactated Ringer's solution.

In another aspect of this embodiment, the method further includes administering to the individual a first course of antibiotics for a period of time and at a dosage that is effective to treat or alleviate an adverse side effect caused by C. novyi CFU, such as C. novyi NT spores. In the present invention, an adverse side effect (or an adverse event used interchangeably with an adverse side effect) may include, but is not limited to, infections (such as those caused by open wounds), vomiting, bloody stools, and fever.

In one preferred embodiment, antibiotics are administered within two weeks of C. novyi administration. Non-limiting examples of such antibiotics include amoxicillin, clavulanate, metronidazole, and combinations thereof.

In another preferred embodiment, the method further comprises administering to the individual a second course of antibiotics for a period of time and at a dosage that is effective in treating or alleviating the adverse side effect caused by C. novyi. A second course of antibiotics can be started after completion of the first course of antibiotics and carried out for 1-6 months, for example, within 3 months. Preferably, the antibiotic used in the second course is doxycycline, but any antibiotic approved by a medical professional can be used.

In yet another aspect of this embodiment, the method further includes using a concomitant treatment protocol by, for example, providing the individual with a therapeutic agent selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof.

C. novyi, such as C. novyi NT spores, and the anticancer agent(s) used in concomitant therapy can be administered to a person either simultaneously or at different times as deemed most appropriate by the physician. If C. novyi, e.g., C. novyi NT spores, and other anticancer agent(s) are administered at different times, for example, by sequential administration, then C. novyi, e.g., C. novyi NT spores, can be administered to a person before the other anticancer agent. Alternatively, other anti-cancer agent(s) may be administered to humans prior to C. novyi, such as C. novyi NT spores.

As used herein, “chemotherapy” means any therapeutic regimen that is compatible with C. novyi, e.g., C. novyi NT, with the treatment of the present invention and which uses cytotoxic and/or cytostatic agents against cancer cells or cells that associated with or support cancer cells. In a preferred embodiment, the chemotherapy comprises administering to a human an agent selected from the group consisting of an antimetabolite, a microtubule inhibitor, a DNA damaging agent, an antibiotic, an anti-angiogenesis agent, a vascular disrupting agent, a molecular targeting agent, and combinations thereof.

As used herein, an “antimetabolite” is a substance that reduces or inhibits the cells' use of a chemical that is part of normal metabolism. Non-limiting examples of antimetabolite agents or analogs thereof according to the present invention include antifolates, purine inhibitors, pyrimidine inhibitors, and combinations thereof.

As used herein, an “antifolate” is a substance that modifies, reduces, or inhibits the use of folic acid (vitamin B9) by cells. Non-limiting examples of antifolates include methotrexate (Duramed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), pralatrexate (Srectrum Pharmaceuticals), aminopterin (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

As used herein, the term “purine” is a compound that contains fused six-membered and five-membered nitrogen-containing rings. Non-limiting examples of purines that are important for cellular metabolism include adenine, guanine, hypoxanthine and xanthine. A "purine inhibitor" is a substance that alters, reduces or inhibits the production of purine or the use of purine by a cell. Non-limiting examples of purine inhibitors include methotrexate (Duramed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), clofarabine (Genzyme Corp.), nelarabine (GlaxoSmithKline), pralatrexate (Srectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), forodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), aminopterin (Sigma Aldrich), azathioprine (GlaxoSmithKline), pharmaceutically acceptable salts thereof and combinations thereof.

As used herein, "pyrimidine" is a compound that contains a six-membered nitrogen-containing ring. Non-limiting examples of pyrimidines that are important for cellular metabolism include uracil, thymine, cytosine and orotic acid. A "pyrimidine inhibitor" is a substance that alters, reduces, or inhibits pyrimidine production or pyrimidine utilization by a cell. Non-limiting examples of pyrimidine inhibitors include 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), gemcitabine (Eli Lilly), cytarabine (Bedford Laboratories), decitabine (Eisai Inc. ) floxuridine (Bedford Laboratories), 5-azacytidine (Pharmion Pharmaceuticals), doxyfluridine (Cayman Chemicals), tiarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), carmofur (Santa Cruz Biotechnology, Inc.), 6- azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof and combinations thereof.

In a preferred aspect of the present invention, the antimetabolite agent is selected from the group consisting of 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), methotrexate (Duramed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), gemcitabine (Eli Lilly), clofarabine (Genzyme Corp. ), cytarabine (Bedford Laboratories), decitabine (Eisai Inc.), floxuridine (Bedford Laboratories), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), 5-azacytidine (Pharmion Pharmaceuticals), doxyfluridine ( Cayman chemicals), forodesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), tiarabine (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), aminopterin (Sigma Aldrich), carmofur ( Santa Cruz Biotechnology, Inc.), azathioprine (GlaxoSmithKline), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.

As used herein, the term “microtubule inhibitor” is a substance that interferes with microtubule function, such as the polymerization or depolymerization of individual microtubule units. In one aspect of the present invention, a microtubule inhibitor may be selected from the group consisting of a microtubule destabilizing agent, a microtubule stabilizing agent, and combinations thereof. The microtubule inhibitor of the present invention may also be selected from the group consisting of a taxane, vinca alkaloid, epothilone, and combinations thereof. Non-limiting examples of microtubule inhibitors in accordance with the present invention include BT-062 (Biotest), HMN-214 (D. Western Therapeutics), eribulin mesylate (Eisai), vindesine (Eli Lilly), EC-1069 (Endocyte), EC-1456 ( Endocyte), EC-531 (Endocyte), vintafolide (Endocyte), 2-methoxyestradiol (EntreMed), GTx-230 (GTx), trastuzumab-emtansine (Hoffman-La Roche), crolibulin (Immune Pharmaceuticals), D1302A-maytansinoid conjugates ( ImmunoGen), IMGN-529 (ImmunoGen), lorvotuzumab-mertansine (ImmunoGen), SAR-3419 (ImmunoGen), SAR-566658 (ImmunoGen), IMP-03138 (Impact Therapeutics), topotecan/vincristine combinations (LipoCure), BPH-8 (Molecular Discovery Systems), fosbretabuline tromethamine (OXiGENE), estramustine sodium phosphate (Pfizer), vincristine (Pierre Fabre), vinflunine (Pierre Fabre), vinorelbine (Pierre Fabre), RX-21101 (Rexahn), cabazitaxel (Sanofi), STA -9584 (Synta Pharmaceuticals), Vinblastine, Epothilone A, Patupilone (Novartis), Ixabepilone (Bristol-Myers Squibb), Epothilone D (Kosan Biosciences), Paclitaxel (Bristol-Myers Squibb), Docetaxel (Sanofi-Aventis), HAI Abraxane, DJ-927 (Daiichi Sankyo), discodermolide (CAS No.: 127943-53-7), eleutherobine (CAS No.: 174545-76-7), pharmaceutically acceptable salts thereof, and combinations thereof.

The DNA damaging agents of the present invention include, but are not limited to, alkylating agents, platinum-based agents, intercalating agents, and DNA replication inhibitors.

As _used herein, the term "alkylating agent" is a substance that adds one or more alkyl groups ( _CnHm , where n and m are integers) to a nucleic acid. In the present invention, the alkylating agent is selected from the group consisting of nitrogen mustards, nitrosourea derivatives, alkyl sulfonates, triazines, ethylene imines and combinations thereof. Non-limiting examples of nitrogen mustards include mechlorethamine (Lundbeck), chlorambucil (GlaxoSnnithKline), cyclophosphamide (Mead Johnson Co.), bendamustine (Astellas), ifosfamide (Baxter International), melphalan (Ligand), melphalan flufenamide (Oncopeptides) and pharmaceutically acceptable salts thereof. Non-limiting examples of nitrosourea derivatives include streptozocin (Teva), carmustine (Eisai), lomustine (Sanofi) and pharmaceutically acceptable salts thereof. Non-limiting examples of alkyl sulfonates include busulfan (Jazz Pharmaceuticals) and pharmaceutically acceptable salts thereof. Non-limiting examples of triazines include dacarbazine (Bayer), temozolomide (Cancer Research Technology) and pharmaceutically acceptable salts thereof. Non-limiting examples of ethylenimines include thiotepa (Bedford Laboratories), altretamine (MGI Pharma) and pharmaceutically acceptable salts thereof. Other alkylating agents include ProLindac (Access), AC-225 BC-8 (Actinium Pharmaceuticals), ALF-2111 (Alfact Innovation), trofosfamide (Baxter International), MDX-1203 (Bristol-Myers Squibb), thioureidobutyronitrile (CellCeutix), mitobronitol (Chinoin), mitolactol (Chinoin), nimustine (Daiichi Sankyo), glufosfamide (Eleison Pharmaceuticals), HuMax-TAC and PBD ADC combinations (Genmab), BP-C1 (Meabco), treosulfan (Medac), nifurtimox (Metronomx), improsulfan tosylate (Mitsubishi Tanabe Pharma), ranimustine (Mitsubishi Tanabe Pharma), ND-01 (NanoCarrier), HH-1 (Nordic Nanovector), combinations of 22P1G cells and ifosfamide (Nuvilex), estramustine phosphate (Pfizer), prednimustine (Pfizer), lurbinectedin (PharmaMar), trabectedin (PharmaMar), altritamine (Sanofi), SGN-CD33A (Seattle Genetics), fotemustine (Servier), nedaplatin (Shionogi), heptaplatin (Sk Holdings), apasiquine (Spectrum Pharmaceuticals), CG-2000 (Spirogen) , TLK-58747 (Telik), laromustine (Vion Pharmaceuticals), procarbazine (Alkem Laboratories Ltd.) and pharmaceutically acceptable salts thereof.

As used herein, the term “platinum-based agent” is an anticancer agent that contains platinum metal, and analogues of such substances. Platinum can be in any oxidation state. The platinum-based agents of the present invention include, but are not limited to, 1,2-diaminocyclohexane (DACH) derivatives, phenanthroimidazole Pt(II) complexes, platinum IV compounds, bi- and tri-nuclear platinum compounds, demethylcantharidin-integrated platinum complexes, platinum-conjugated compounds, nanoparticles and polymeric micelles of cisplatin, sterically hindered platinum complexes, oxaliplatin (Debiopharm), satraplatin (Johnson Matthey), BBR3464 (Novuspharma SpA.), ZD0473 (Astra Zeneca), cisplatin (Nippon Kayaku), JM-11 (Johnson Matthey), PAD (cis-dichlorobiscyclopentylamine platinum (II)), MBA ((trans-1,2-diaminocyclohexane)bisbromoacetate platinum (II)), PHM ((1,2-cyclohexanediamine)malonato platinum (II)), SHP ((1,2-cyclohexanediamine)platinum(II)sulfato), neo-PHM ((trans-R,R-1,2-cyclohexanediamine)platinum(II)malonato), neo-SHP ((trans-R,R -1,2-cyclohexanediamine)sulfatoplatinum (II)), JM-82 (Johnson Matthey), PYP ((1,2-cyclohexanediamine)bispirovato platinum (II)), PHIC ((1,2)-cyclohexanediamine)isocitrate platinum (II)), TRK-710 ((trans-R,R-1,2-cyclohexanediamine)[3-acetyl-5-methyl-2,4(3H,5H)-furandionato]platinum (II)), BOP ( (1,2-cyclooctanediamine) platinum(II) bibromoacetate), JM-40 (Johnson Matthey), enloplatin (UnionPharma), zeniplatin (LGM Pharma), CI-973 (Parke-Davis), lobaplatin (Zentaris AG/Hainan Tianwang International Pharmaceutical), cycloplatam (LGM Pharma), WA2114R (miboplatin/lobaplatin) (Chembest Research Laboratories, Ltd.), heptaplatin (SKI2053R) (SK Chemicals), TNO-6 (spiroplatin) (Haihang Industry Co., Ltd.), ormaplatin ( tetraplatin) (LGM Pharma), JM-9 (iproplatin) (Johnson Matthey), BBR3610 (Novuspharma SpA.), BBR3005 (Novuspharma SpA), BBR3571 (Novuspharma SpA), BBR3537 (Novuspharma SpA), aroplatin (L-NDDP) ( BOC Sciences), Pt-ACRAMTU ({[Pt(en) CI(ACRAMTU-S)](NO ₃ ) ₂ (en = ethane-1, 2-diamine, ACRAMTU = 1-[2-(-acridine-9- yl)ethyl]-1,3-dimethylthiourea}), cisplatin-loaded liposomes (LiPlasomes), SPI-077 (Alza), lipoplatin (Regulon), lipoxal (Regulon), carboplatin (Johnson Matthey), nedaplatin (Shionogi Seiyaku), miriplatin hydrate (Dainippon Sumitomo Pharma), ormaplatin (LGM Pharma), enloplatin (Lederle Laboratories), CI973 (Parke-Davis), PEGylated cisplatin, PEGylated carboplatin, PEGylated oxaliplatin, transplatin (trans-diaminodichloroplatinum (II); mixed Z:trans-[PtCl ₂ {Z-HN=C(OMe)Me}(NH ₃ )]), CD-37 (estradiol-platinum (II) hybrid molecule), picoplatin (Poniard Pharmaceuticals),

AH44 (Komeda et al., 2006; Harris et al., 2005; Qu et al., 2004), triplatin NC (Harris et al., 2005; Qu et al., 2004), ProLindac (Access) their pharmaceutically acceptable salts and their combinations.

As used herein, the term “intercalating agent” includes, but is not limited to, doxorubicin (Adriamycin), daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts, prodrugs, and combinations thereof.

Non-limiting examples of DNA replication inhibitors include, but are not limited to, topoisomerase inhibitors. As used herein, the term “topoisomerase inhibitor” is a substance that reduces the expression or activity of topoisomerase. The topoisomerase inhibitors of the present invention can inhibit topoisomerase I, topoisomerase II, or both topoisomerase I and topoisomerase II. Non-limiting examples of topoisomerase I inhibitors of the present invention include irinotecan (Alchemia), APH-0804 (Aphios), camptothecin (Aphios), cositecan (BioNumerik), topotecan (GlaxoSmithKline), belotecan hydrochloride (Chon Kun Dang), firtecan pegol (Enzon), HN-30181A (Hanmi), hRS7-SN-38 (Immunonnedics), labetuzumab-SN-38 (Immunonnedics), ethirinotecan pegol (Nektar Therapeutics), NK-012 (Nippon Kayaku), SER-203 (Serina Therapeutics), simmitecan prodrug hydrochloride (Shanghai HaiHe Pharmaceuticals), hymatecan (Sigma-Tau), namitecan (Sigma-Tau), SN-38 (Supratek Pharnna), TSX-388 hydrochloride (Taiwan Liposome Company), lamellarin D (PharmaMar), their pharmaceutically acceptable salts and their combinations. Non-limiting examples of type II topoisomerase inhibitors of the present invention include ADVA-27a (Advanomics), zoptarelin doxorubicin (Aeterna Zentaris), valrubicin (Anthra Pharmaceuticals), razoxane (AstraZeneca), doxorubicin (Avena Therapeutics), amsacrine (Bristol-Myers Squibb) , etoposide phosphate (Bristol-Myers Squibb), etoposide (Novartis), dexrazoxane (Cancer Research Technology), cytarabine/daunorubicin combination (Celator Pharmaceuticals), CAP7.1 (CellAct Pharma), aldoxorubicin (CytRx), amrubicin hydrochloride (Dainippon Sumitomo Pharma ), vosaroxin (Dainippon Sumitomo Pharma), daunorubicin (Gilead Sciences), milatuzumab/doxorubicin combination (Immunomedics), aclarubicin (Kyowa Hakko Kirin), mitoxantrone (Meda), pyrarubicin (Meji), epirubicin (Pfizer), teniposide (Novartis), F-14512 (Pierre Fabre), elliptinium acetate (Sanofi), zorubicin (Sanofi), dexrazoxane (TopoTarget), sobuzoxane (Zenyaku Kogyo), idarubicin (Pfizer), HU-331 (Cayman Chemical), aurine tricarboxylic acid (Sigma Aldrich), their pharmaceutically acceptable salts and combinations thereof.

Chemotherapeutic antibiotics according to the present invention include, but are not limited to, actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, their pharmaceutically acceptable salts, prodrugs, and combinations thereof.

As used herein, the term “anti-angiogenesis agent” refers to any compound that prevents or delays the formation of new blood vessels from existing vessels. In the present invention, examples of anti-angiogenesis agents include, but are not limited to, pegaptanib, ranibizumab, bevacizumab (Avastin), carboxyamidotriazole, TNP-470, CM101, IFN-α, IL-12, platelet factor 4, suramin, SU5416, thrombospondin, antagonists VEGFR, angiostatic steroids and heparin, cartilage-derived angiogenesis inhibitory factor, matrix metalloproteinase inhibitors, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, prolactin, α _v β ₃ inhibitors, linomide, VEGF trap, aminosterols, cortisone, tyrosine kinase inhibitors, antiangiogenic siRNAs, complement inhibitors, vascular disrupting agents, and combinations thereof. Preferably, the anti-angiogenesis agent is bevacizumab.

The VEGFR antagonists of the present invention include, but are not limited to, pazopanib, regorafenib, lenvatinib, sorafenib, sunitinib, axitinib, vandetanib, cabozantinib, vatalanib, semaxanib, ZD6474, SU6668, AG-013736, AZD2171, AEE788, MF1 /MC-18F1, DC101/IMC-1C11, ramucirumab and motesanib. VEGFR antagonists may also include VEGF inhibitors such as bevacizumab, aflibercept, 2C3, r84, VEGF trap and ranibizumab.

The angiostatic steroids of the present invention include any steroid that inhibits, attenuates, prevents angiogenesis or neovascularization, or causes regression of pathological vascularization. The angiostatic steroids of the present invention include those disclosed in European Patent Application Serial No. EP1236471 A2, as well as those 20-substituted steroids disclosed in US Patent Serial No. 4,599,331, those 21-hydroxy steroids disclosed in US Patent Serial No. 4771042, those C ₁₁ -functionalized steroids described in international application WO 1987/02672, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione 21-acetate , 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11) -diene-3,20-dione-21-phosphonoxy and their pharmaceutically acceptable salts, hydrocortisone, tetrahydrocortisol, 17α-hydroxyprogesterone, 11α-epihydrocortisone, cortexolone, corticosterone, deoxycorticosterone, dexamethasone, cortisone 21-acetate, hydrocortisone 21-phosphate, 17α- hydroxy-6α-methylpregn-4-ene-3,20-dione 17-acetate, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione and Δ9( 11)-ethane esters, all of which are disclosed in the international application with serial no. WO 1990/015816 A1.

Cartilage-derived angiogenesis inhibitory factors include, but are not limited to, troponin peptide and chondromodulin I.

Matrix metalloproteinase inhibitors of the present invention include, but are not limited to, succinyl hydroxamates such as marimastat and SC903, sulfonamide hydroxamates such as CGS27023A, phosphinamide hydroxamates, carboxylate inhibitors such as BAY12-9566, thiol inhibitors such as Compound B, aminomethylbenzimidazole analogues, peptide s , such as regasepin and tetracyclines such as minocycline.

α _v β ₃ inhibitors include, but are not limited to, IS20I, P11 peptide, EMD 85189 and 66203, RGD peptide, RGD mimetics such as S 36578-2, echistatin, antibodies or antibody fragments against α _v β ₃ integrin such as Vitaxin, which target the extracellular domain of the dimer, cilengitide and peptidomimetics such as S247.

Anti-angiogenic siRNAs include, but are not limited to, siRNAs targeting mRNAs that are up-regulated during angiogenesis, optionally PEGylated siRNAs targeting VEGF or VEGFR mRNA, and siRNAs targeting UPR (unfolded protein responsive element)-IRE1α, XBP- 1 and ATF6 mRNA. In addition, siRNAs that are at least 21 nucleotides in length, regardless of sequence direction, have been shown to suppress neovascularization (Kleinman et al., 2008) and can be included in the antiangiogenic siRNAs of the present invention.

Complement inhibitors include, but are not limited to, modified natural complement components such as soluble complement receptor type 1, soluble complement receptor type 1 lacking long homologous repeat-A, soluble complement receptor type 1-sialyl Lewis ^x , complement receptor type 2 complement, soluble decay accelerating factor, soluble membrane protein cofactor, soluble CD59, hybrid of soluble decay accelerating factor and CD59, hybrid of membrane protein cofactor and soluble decay accelerating factor, C1 inhibitor and C1q receptor, complement inhibitory antibodies such such as anti-C5 monoclonal antibody and anti-C5 single chain Fv, synthetic inhibitors of complement activation such as antagonistic peptides and analogs targeting the C5a receptor, and natural compounds that block complement activation such as heparin and related glycosaminoglycan compounds. Additional complement inhibitors are disclosed by Makrides (Makrides, 1998).

As used herein, the term “vascular disrupting agent” means any compound that targets existing vasculature, eg, tumor vasculature, damages or disrupts said vasculature, and/or causes necrosis of the central tumor mass. In the present invention, examples of vascular disrupting agents include, but are not limited to, ABT-751 (Abbott), AVE8062 (Aventis), BCN105 (Bionomics), BMXAA (Antisoma), CA-4-P (Oxigene), CA-1 -P (Oxigene), CYT997 (Cytopia), MPC-6827 (Myriad Pharmaceuticals), MN-029 (MediciNova), NPI-2358 (Nereus), Oxi4503 (Oxigene), TZT-1027 (Daichi Pharmaceuticals), ZD6126 (AstraZeneca and Angiogene), their pharmaceutically acceptable salts and combinations thereof.

As used herein, the term “molecularly targeted agent” is a substance that interferes with the function of a single molecule or group of molecules, preferably those involved in tumor growth and progression, when administered to an individual. Non-limiting examples of molecularly targeted agents of the present invention include signal transduction inhibitors, modulators of gene expression and other cellular functions, immune system modulators, antibody-drug conjugates (ADCs), and combinations thereof.

As used herein, the term “signal transduction inhibitor” is a substance that interferes with the transmission of information between cells, for example, when an extracellular signaling molecule activates a cell surface receptor. Non-limiting examples of signal transduction inhibitors of the present invention include anaplastic lymphoma kinase (ALK) inhibitors, B-Raf inhibitors, epidermal growth factor inhibitors (EGFRi), ERK inhibitors, Janus kinase inhibitors, MEK inhibitors, mammalian target of rapamycin (mTor) inhibitors, phosphoinositide inhibitors -3-kinase (PI3Ki) and Ras inhibitors.

As used herein, an “anaplastic lymphoma kinase (ALK) inhibitor” is a substance that (i) directly interacts with ALK, for example, by binding to ALK and (ii) reduces the expression or activity of ALK. Non-limiting examples of anaplastic lymphoma kinase (ALK) inhibitors of the present invention include crizotinib (Pfizer, New York, NY), CH5424802 (Chugai Pharmaceutical Co., Tokyo, Japan), GSK1838705 (GlaxoSmithKline, United Kingdom), Chugai 13d (Chugai Pharmaceutical Co. , Tokyo, Japan), CEP28122 (Teva Pharmaceutical Industries, Ltd., Israel), AP26113 (Ariad Pharmaceuticals, Cambridge, MA), Cephalon 30 (Teva Pharmaceutical Industries, Ltd., Israel), X-396 (Xcovery, Inc. West Palm Beach, FL), Amgen 36 (Amgen Pharmaceuticals, Thousand Oaks, CA), ASP3026 (Astellas Pharma US, Inc., Northbrook, Illinois) and Amgen 49 (Amgen Pharmaceuticals, Thousand Oaks, CA), pharmaceutically acceptable salts thereof, and their combinations.

As used herein, a “B-Raf inhibitor” of the present invention is a substance that (i) directly interacts with B-Raf, for example, by binding to B-Raf and (ii) reduces the expression or activity of B-Raf. B-Raf inhibitors can be divided into two types based on their corresponding binding mode. As used herein, “type 1” B-Raf inhibitors are those inhibitors that target the ATP binding sites of the kinase in its active conformation. “Type 2” B-Raf inhibitors are those inhibitors that preferentially bind to the kinase in an inactive conformation. Non-limiting examples of B-Raf type 1 inhibitors of the present invention include:

Compound 14 (Id.), dabrafenib (GlaxoSmithKline), GDC-0879 (Genentech), L-779450 B-Raf (Merck), PLX3202 (Plexxikon), PLX4720 (Plexxikon), CO-590885 (GlaxoSmithKline), CO-699393 ( GlaxoSmithKline), vemurafenib (Plexxikon), pharmaceutically acceptable salts thereof and combinations thereof. Preferably, the RAF type 1 inhibitor is dabrafenib or a pharmaceutically acceptable salt thereof.

Non-limiting examples of B-Raf type 2 inhibitors of the present invention include:

sorafenib (Onyx Pharmaceuticals), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof and combinations thereof.

Other B-Raf inhibitors include, but are not limited to, AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), inhibitor b RAF (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 253 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), DP-4978 (Deciphera Pharmaceuticals) , HM-95573 (Hanmi), GW 5074 (Sigma Aldrich), ISIS 5132 (Novartis), LErafAON (NeoPharm, Inc.) LBT613 (Novartis), LGX 818 (Novartis), pazopanib (GlaxoSmithKline), PLX5568 (Plexxikon), RAF -265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Pharmaceuticals Healthcare, Inc.) RO 5126766 (Hoffmann-La Roche), TAK 632 (Takeda), TL-241 (Teligene), XL-281 (Exelixis) , their pharmaceutically acceptable salts and combinations thereof.

As used herein, an “EGFR inhibitor” is a substance that (i) directly interacts with EGFR, for example, by binding to EGFR, and (ii) reduces the expression or activity of EGFR. Non-limiting examples of EGFR inhibitors according to the present invention include (+)-aeroplizinin-1 (CAS # 28656-91-9), 3-(4-isoparopylbenzylidennyl)-indolin-2-one, ABT-806 (Life Science Pharmaceuticals), AC-480 (Bristol-Myers Squibb), afatinib (Boehringer Ingelheim), AG 1478 (CAS # 153436-53-4), AG 494 (CAS # 133550-35-3), AG 555 (CAS # 133550-34-2 ), AG 556 (CAS # 133550-41-1), AG 825 (CAS # 149092-50-2), AG-490 (CAS # 134036-52-5), anthroquinonol (Golden Biotechnology), AP-26113 (Ariad ), ARRY334543 (CAS #845272-21-1), AST 1306 (CAS #897383-62-9), AVL-301 (Celgene), AZD8931 (CAS #848942-61-0), BIBU 1361 (CAS #793726- 84-8), BIBX 1382 (CAS # 196612-93-8), BMS-690514 (Bristol-Myers Squibb), BPIQ-I (CAS # 174709-30-9), canertinib (Pfizer), cetuximab (Actavis), cipatinib (Jiangsu Hengrui Medicine), CL-387785 (Santa Cruz Biotech), compound 56 (CAS # 171745-13-4), CTX-023 (CytomX Therapeutics), CUDC-101 (Curis), dacomitinib (Pfizer), DAPH ( CAS # 145915-58-8), dafnetin (Santa Cruz Biotech), dovitinib lactate (Novartis), EGFR inhibitor (CAS # 879127-07-8), epitinib (Hutchison China MediTech), erbstatin analogue (CAS # 63177-57- 1), erlotinib (Astellas), gefitinib (AstraZeneca), GT-MAB 5.2 GEX (Glycotope), GW 583340 (CAS # 388082-81-3), GW2974 (CAS # 202272-68-2), HDS 029 ( CAS # 881001-19-0), hypericin (Santa Cruz Biotech), icotinib hydrochloride (Betapharma), JNJ-26483327 (Johnson & Johnson), JNJ-28871063 (Johnson & Johnson), KD-020 (Kadmon Pharmaceuticals), lapatinib ditosylate (GlaxoSmithKline), lavendustin A (Sigma), lavendustin C (Sigma), LY-3016859 (Eli Lilly), MEHD-7945A (Hoffman-La Roche), MM-151 (Merrimack), MT-062 (Medisyn Technologies), necitumumab (Eli Lilly), neratinib (Pfizer), nimotuzumab (Center of Molcular Immunology), NT-004 (NewGen Therapeutics), pantiumumab (Amgen), PD 153035 (CAS # 153436-54-5), PD 161570 (CAS # 192705- 80-9), PD 168393, PD 174265 (CAS # 216163-53-0), pyrotinib (Sihuan Pharmaceuticals), poziotinib (Hanmi), PP 3 (CAS # 5334-30-5), PR-610 (Proacta), pyrotinib (Jiangsu Hengrui Medicine), RG-13022 (CAS # 136831 -48-6), rindopeptimut (Celldex Therapeutics), RPI-1 (CAS # 269730-03-2), S-222611 (Shionogi), TAK 285 (CAS #871026-44-7), TAS-2913 (Taiho), Teliatinib (Hutchison China MediTech), Tyrphostin 47 (RG-50864, AG-213) (CAS #1 18409-60-2), Tyrphostin 51 (CAS #122520 -90-5), Tyrphostin AG 1478 (CAS # 175178-82-2), Tyrphostin AG 183 (CAS # 126433-07-6), Tyrphostin AG 528 (CAS # 133550-49-9), Tyrphostin AG 99 (CAS # 18409-59-9 1), tyrphostin B42 (Santa Cruz Biotech), tyrphostin B44 (Santa Cruz Biotech), tyrphostin RG 14620 (CAS # 136831-49-7), vandetanib (AstraZeneca), varlitinib (Array BioPharma), vatalanib (Novartis), WZ 3146 (CAS # 1214265-56-1), WZ 4002 (CAS # 1213269-23-8), WZ8040 (CAS # 1214265-57-2), XL-647 (Exelixis), Z-650 ( HEC Pharm), ZM 323881 (CAS # 324077-30-7), pharmaceutically acceptable salts thereof and combinations thereof. Preferably, the EGFR inhibitor is selected from the group consisting of panitumumab, erlotinib, pharmaceutically acceptable salts thereof, and combinations thereof.

As used herein, an “ERK inhibitor” is a substance that (i) directly interacts with ERK, including ERK1 and ERK2, for example, by binding to ERK, and (ii) reduces the expression or activity of ERK protein kinase. Thus, inhibitors that act upstream of ERK, such as MEK inhibitors and RAF inhibitors, are not ERK inhibitors according to the present invention. Non-limiting examples of ERK inhibitors of the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), SCH-722984 (Merck & Co.) SCH-772984 (Merck & Co.) SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof and combinations thereof.

As used herein, the term “Janus kinase inhibitor” is a substance that (i) directly interacts with Janus kinase, for example, by binding to Janus kinase and (ii) reduces the expression or activity of Janus kinase. The Janus kinases of the present invention include Tyk2, Jak1, Jak2 and Jak3. Non-limiting examples of Janus kinase inhibitors of the present invention include ruxolitinib (Incyte Corporation, Wilmington, DE), baricitinib (Incyte Corporation, Wilmington, DE), tofacitinib (Pfizer, New York, NY), VX-509 (Vertex Pharmaceuticals, Inc., Boston , MA), GLPG0634 (Galapagos NV, Belgium), CEP-33779 (Teva Pharmaceuticals, Israel), pharmaceutically acceptable salts thereof and combinations thereof.

As used herein, the term “MEK inhibitor” is a substance that (i) directly interacts with MEK, for example by binding to MEK, and (ii) reduces the expression or activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEK inhibitors according to the present invention. MEK inhibitors can be classified into two types depending on whether the inhibitor competes with ATP. As used herein, a “type 1” MEK inhibitor is an inhibitor that competes with ATP for binding to MEK. A “type 2” MEK inhibitor is an inhibitor that does not compete with ATP for binding to MEK. Non-limiting examples of MEK type 1 inhibitors of the present invention include bentamapimod (Merck KGaA), L783277 (Merck), RO092210 (Roche), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the MEK type 1 inhibitor is RO092210 (Roche) or a pharmaceutically acceptable salt thereof. Non-limiting examples of MEK type 2 inhibitors in accordance with the present invention include anthrax toxin, part of the lethal factor of anthrax toxin, Arry-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H -benzoimidazole-5-carboxylic acid (2-hydroxyethoxy)amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), MEK162 (Array BioPharma), PD 098059 (2-(2'-amino -3'-methoxyphenyl)-oxanaphthalen-4-one), PD 184352 (CI-1040), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), refametinib (AstraZeneca), celumetinib (AZD6244) (AstraZeneca), TAK- 733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), RDEA119 (Ardea Biosciences/Bayer), their pharmaceutically acceptable salts and combinations thereof. Preferably, the MEK type 2 inhibitor is trametinib or a pharmaceutically acceptable salt thereof. Other MEK inhibitors include, but are not limited to, anthroquinonol (Golden Biotechnology), AS-1940477 (Astellas), AS-703988 (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche ), GDC-0973, RG422, RO4987655, RO5126766, SL327, WX-554 (Wilex), YopJ polypeptide, pharmaceutically acceptable salts thereof and combinations thereof.

As used herein, an “mTOR inhibitor” is a substance that (i) directly interacts with mTOR, for example, by binding to mTOR, and (ii) reduces the expression or activity of mTOR. Non-limiting examples of mTOR inhibitors according to the present invention include zotarolimus (Abbvie), umirolimus (Biosensors), temsirolimus (Pfizer), sirolimus (Pfizer), NanoCrystal sirolimus (Elan Pharmaceutical Technogies), TransDerm sirolimus (TransDerm), sirolimus-PNP (Samyang) , everolimus (Novartis), biolimus A9 (Biosensors), ridaforolimus (Ariad), rapamycin, TCD-10023 (Terumo), DE-109 (MacuSight), MS-R001 (MacuSight), MS-R002 (MacuSight), MS-R003 (MacuSight), Persave (MacuSight), XL-765 (Exelixis), Quinacrine (Cleveland BioLabs), PKI-587 (Pfizer), PF-04691502 (Pfizer), GDC-0980 (Genentech and Piramed), Dactolisib (Novartis), CC-223 (Celgene), PWT-33597 (Pathway Therapeutics), P-7170 (Piramal Life Sciences), LY-3023414 (Eli Lilly), INK-128 (Takeda), GDC-0084 (Genentech), DS-7423 ( Daiichi Sankyo), DS-3078 (Daiichi Sankyo), CC-115 (Celgene), CBLC-137 (Cleveland BioLabs), AZD-2014 (AstraZeneca), X-480 (Xcovery), X-414 (Xcovery), EU- 0371 (Endocyte), VS-5584 (Verastem), PQR-401 (Piqur), PQR-316 (Piqur), PQR-311 (Piqur), PQR-309 (Piqur), PF-06465603 (Pfizer), NV-128 (Novogen), nPT-MTOR (Biotica Technology), BC-210 ((Biotica Technology), WAY-600 (Biotica Technology), WYE-354 (Biotica Technology), WYE-687 (Biotica Technology), LOR-220 (Lorus Therapeutics), HMPL-518 (Hutchison China MediTech), GNE-317 (Genentech), EC-0565 (Endocyte), CC-214 (Celgene) and ABTL-0812 (Ability Pharmaceuticals).

As used herein, the term “PI3K inhibitor” is a substance that reduces the expression or activity of phosphatidylinositol 3-kinases (PI3Ks) or downstream cascade proteins such as Akt. PI3Ks, when activated, phosphorylate the 3′-OH group of the inositol ring in inositol phospholipids to produce the second messenger phosphatidylinositol 3,4,5-trisphosphate (PI-3,4,5-P(3)). Akt interacts with a phospholipid, causing its translocation to the inner membrane, where it is phosphorylated and activated. Activated Akt modulates the function of numerous substrates involved in the regulation of cell survival, cell cycle progression, and cell growth.

Non-limiting examples of PI3K inhibitors according to the present invention include A-674563 (CAS # 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3] dioxol-5-ylmethylene-thiazolidin-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)thiazolidin-2,4-dione), AS -605240 (5-quinoxylin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS # 857531-00-1), benzimidazoles series, Genentech (Roche Holdings Inc., South San Francisco, CA ), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences ), CAL-263 (Gilead Sciences), CAS # 612847-09-3, CAS # 681281-88-9, CAS # 75747-14-7, CAS # 925681-41-0, CAS # 98510-80-6, CCT128930 (CAS # 885499-61-6), CH5132799 (CAS # 1007207-67-1), CHR-4432 (Chroma therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS # 902779-59-3), GS -1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS # 937174-76-0), H-89 (CAS # 127243-85-0), honokiol, IC87114 (Gilead Science) IPI-145 (Intellikine Inc .), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS # 108068-98-0), miltefosine, MK-2206 dihydrochloride ( CAS # 1032350-13-2), ML-9 (CAS # 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, RNT-427 (CAS # 1 1191951-57 -1), PI3-kinase inhibitor delta, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3-kinase inhibitors delta, Genentech (Roche Holdings Inc.), PI3-kinase inhibitors delta, Incozen (Incozen Therapeutics, Pvt . Ltd., Hydrabad, India), PI3-kinase inhibitors-2 delta, Incozen (Incozen Therepeutics), PI3-kinase inhibitor, Roche-4 (Poche Holdings Inc.), PI3-kinase inhibitors, Roche (Roche Holdings Inc.), PI3-kinase inhibitors, Roche-5 (Roche Holdings Inc.), PI3-kinase inhibitors alpha/delta, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-kinase inhibitors delta, Cellzome (Cellzome AG, Heidelberg , Gemany), PI3-kinase delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-kinase delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-kinase delta inhibitors, Pathway Therapeutics-2 ( Pathway Therapeutics Ltd.), PI3-kinase delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-kinase delta/gamma inhibitors, Cellzome (Cellzome AG), PI3-kinase delta/gamma inhibitors, Intellikine (Intellikine Inc.), inhibitors PI3-kinase delta/gamma, Intellikine (Intellikine Inc.), PI3-kinase delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-kinase delta/gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3 inhibitor -kinase gamma, Evotec (Evotec), PI3-kinase gamma inhibitor, Cellzome (Cellzome AG), PI3-kinase gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta/gamma inhibitors, lntellikine-1 (Intellikine Inc.) , PI3K delta/gamma inhibitors, lntellikine-1 (Intellikine Inc.) pictilisib (GDC-0941) (Roche Holdings Inc.), PIK-90 (CAS # 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianopolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach , FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof and combinations thereof. Preferably, the PI3K/Akt pathway inhibitor is pictilisib (GDC-0941) or a pharmaceutically acceptable salt thereof.

As used herein, the term “RAS inhibitor” is a substance that (i) directly interacts with RAS, for example by binding to RAS, and (ii) reduces the expression or activity of RAS. Non-limiting examples of RAS inhibitors in accordance with the present invention include farnesyltransferase inhibitors (such as, for example, tipifarnib and lonafarnib), small molecules containing farnesyl groups (such as, for example, salirasib and TLN-4601), DCAI, as described by Maurer et al. al., 2012), Kobe0065 and Kobe2602 as described by Shima (Shima, et al., 2013), and HBS 3 (Patgiri, et al., 2011) and AIK-4 (Allinky), pharmaceutically acceptable salts thereof, and combinations thereof .

As used herein, the term “gene expression” is the process by which information from DNA is used to form a polypeptide. A “modulator of gene expression and other cellular functions” is a substance that affects gene expression and other cellular activities. Non-limiting examples of such modulators include hormones, histone deacetylase inhibitors (HDACi) and cyclin-dependent kinase inhibitors (CDKi), and poly(ADP-ribose) polymerase inhibitors (PARP).

In the present invention, the term "hormone" is a substance secreted by cells in one part of the body that affects cells in another part of the body. Non-limiting examples of hormones in accordance with the present invention include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptide, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone , melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone , estriol, cortisol, progesterone, calcitriol and calcidiol.

Some compounds affect the activity of certain hormones or stop the production of certain hormones. Non-limiting examples of hormone-altering compounds of the present invention include tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also included within the designation hormone of the present invention.

As used herein, an “HDAC inhibitor” is a substance that (i) directly interacts with HDAC, for example, by binding to HDAC, and (ii) reduces HDAC expression or activity. Non-limiting examples of HDAC inhibitors according to the present invention include 4SC-201 (4SC AG), 4SC-202 (Takeda), abexinostat (Celera), AN-1 (Titan Pharmaceuticals, Inc.), apicidin (Merck & Co., Inc. ) AR-42 (Arno Therapeutics), ARQ-700RP (ArQule), Avugan (TopoTarget AC), Azelaic Acid-1-hydroxamate-9-anilide (AAHA), Belinostat (TopoTarget), Butyrate (Enzo Life Sciences, Inc.) , CG-1255 (Errant Gene Therapeutics, LLC), CG-1521 (Errant Gene Therapeutics, LLC), CG-200745 (CrystalGenomics, Inc.), chidamide (Shanzhen Chipscreen Biosciences), CHR-3996 (Chroma Therapeutics), CRA- 024781 (Pharmacyclics), CS-3158 (Shanzhen Chipscreen Biosciences), CU-903 (Curis), DAC-60 (Genextra), Entinostat (Bayer), Hyaluronic Acid Butyric Ester (HA-But), IKH-02 ( IkerChem), IKH-35 (IkerChem), ITF-2357 (Italfarmaco), ITF-A (Italfarmaco), JNJ-16241199 (Johnson & Johnson), KA-001 (Karus Therapeutics), KAR-3000 (Karus Therapeutics), KD -5150 (Kalypsys), KD-5170 (Kalypsys), KLYP-278 (Kalypsys), KLYP-298 (Kalypsys), KLYP-319 (Kalypsys), KLYP-722 (Kalypsys), m-carboxycinnamic acid bis-hydroxamide (CBHA) ), MG-2856 (MethylGene), MG-3290 (MethylGene), MG-4230 (MethylGene), MG-4915 (MethylGene), MG-5026 (MethylGene), MGCD-0103 (MethylGene Inc.) mosetinostat (MethylGene), MS-27-275 (Schering AG), NBM-HD-1 (NatureWise), NVP-LAQ824 (Novartis), OCID-4681-S-01 (Orchid Pharmaceuticals), oxamflatin ((2E)-5-[3-[ (phenylsulfonyl)aminophenyl]pent-2-en-4-inohydroxamic acid), panobinostat (Novartis), PCI-34051 (Pharmacyclics), phenylbutyrate (Enzo Life Sciences, Inc.), pivaloyloxymethylbutyrate (AH-9, Titan Pharmaceuticals, Inc. ), pivanex (Titan Pharmaceuticals, Inc.), pracinostat (SBIO), PX-117794 (TopoTarget AS), PXD-118490 (LEO-80140) (TopoTarget AS), pyroxamide (hydroxamic acid suberoyl-3-aminopyridinamide), resminostat ( Takeda), RG-2833 (Repligen), ricolinostat (Acetylon), romidepsin (Astellas), CO-1304 (S ^* BIO), SB-1354 (S ^* BIO), SB-623 (Merrion Research I Limited), SB- 624 (Merrion Research I Limited), SB-639 (Merrion Research I Limited), SB-939 (S ^* BIO), scriptaid (N-hydroxy-1,3-dioxo-1H-benz[de]isoquinoline-2(3H )-hexanamide), SK-7041 (In2Gen/SK Chemical Co.), SK-7068 (In2Gen/SK Chemical Co.), hydroxamic acid suberoylanilide (SAHA), hydroxamic acid sulfonamide, tributyrin (Sigma Aldrich), trichostatin A (TSA ) (Sigma Aldrich), valproic acid (VPA) (Sigma Aldrich), vorinostat (Zolinza), WF-27082B (Fujisawa Pharmaceutical Company, Ltd.), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the HDAC inhibitor is romidepsin, pharmaceutically acceptable salts thereof, and combinations thereof.

As used herein, "CDK" is a family of protein kinases that regulate the cell cycle. Known CDKs include cdkl, cdk2, cdk3, cdk4, cdk5, cdk6, cdk7, cdk8, cdk9, cdk10 and cdk11. A “CDK inhibitor” is a substance that (i) directly interacts with a CDK, for example by binding to a CDK, and (ii) reduces the expression or activity of a CDK. Non-limiting examples of CDK inhibitors according to the present invention include 2-hydroxybohemin, 3-ATA, 5-iodo-indirubin-3'-monoxime, 9-cyanopaulone, aloysin A, alsterpoulone 2-cyanoethyl, alvocidib (Sanofi), AM-5992 ( Amgen), aminopurvalanol A, arciriaflavin A, AT-7519 (Astex Pharmaceuticals), AZD 5438 (CAS # 602306-29-6), BMS-265246 (CAS # 582315-72-8), BS-181 (CAS # 1092443- 52-1), butyrolactone I (CAS # 87414-49-1), Cdk/Crk inhibitor (CAS # 784211-09-2), Cdk1/5 inhibitor (CAS # 40254-90-8), Cdk2 inhibitor II (CAS #222035-13-4), Cdk2 Inhibitor IV, NU6140 (CAS #444723-13-1), Cdk4 Inhibitor (CAS #546102-60-7), Cdk4 Inhibitor III (CAS #265312-55-8), IV Inhibitor Cdk4/6 (CAS #359886-84-3), Cdk9 inhibitor II (CAS #140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinacislib (Ligand), (R)-DRF053 dihydrochloride ( CAS # 1056016-06-8), fascaplysine, flavopiridol, hygrolidine, indirubin, Lee-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano Medical Sciences), MM-D37K (Maxwell Biotech), N9 - isopropylolomoucine, NSC 625987 (CAS # 141992-47-4), NU2058 (CAS # 161058-83-9), NU6102 (CAS # 444722-95-6), olomoucine, ON-108600 (Onconova), ON-123300 ( Onconova), oxindole I, P-1446-05 (Piramal), P-276-00 (Piramal), palbociclib (Pfizer), PHA-767491 (CAS # 845714-00-3), PHA-793887 (CAS # 718630- 59-2), PHA-848125 (CAS # 802539-81-7), purvalanol A, purvalanol B, R547 (CAS # 741713-40-6), RO-3306 (CAS # 872573-93-8), roscovitine, SB-1317 (SBIO), SCH 900776 (CAS # 891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS # 345627-80-7), SU9516 (CAS # 377090- 84-1), WHI-P180 (CAS # 211555-08-7), pharmaceutically acceptable salts thereof and combinations thereof. Preferably, the CDK inhibitor is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.

As used herein, the term “poly(ADP-ribose) polymerase (PARP) inhibitor” is a substance that reduces the expression or activity of poly(ADP-ribose) polymerases (PARPs) or downstream proteins. Non-limiting examples of poly(ADP-ribose) polymerase (PARP) inhibitors of the present invention include PF01367338 (Pfizer, New York, NY), olaparib (AstraZeneca, United Kingdom), iniparib (Sanofi-Aventis, Paris, France), veliparib (Abbott Laboratories , Abbot Park, IL), MK 4827 (Merck, White House Station, NJ), CEP 9722 (Teva Pharmaceuticals, Israel), LT-673 (Biomarin, San Rafael, CA) and BSI 401 (Sanofi-Aventis, Paris, France ), their pharmaceutically acceptable salts and combinations thereof.

In a preferred embodiment, chemotherapy comprises administering to a human an agent selected from the group consisting of gemcitabine, Taxol, Adriamycin, ifosfamide, trabectedin, pazopanib, Abraxane, Avastin, everolimus, and combinations thereof.

As used herein, “radiation therapy” means any therapeutic regimen that is compatible with C. novyi, eg, C. novyi NT, with the treatment of the present invention and in which an individual, eg, a human, is irradiated to treat cancer. Radiation therapy can be carried out, for example, in humans using, for example, a machine external to the body (external beam radiotherapy) or radioactive material introduced into the body (brachytherapy, systemic radiotherapy).

External beam radiation therapy includes, but is not limited to, 3-dimensional conformal radiation therapy, intensity modulated radiation therapy, image-guided radiation therapy, tomotherapy, stereotactic radiosurgery, stereotactic body radiation therapy, proton therapy and other charged particle beam therapy, such as electron beam therapy. External beam radiation therapy is widely used in the treatment of cancer and is well known to those skilled in the art.

Brachytherapy refers to radiation therapy delivered by implantation into the body or placement on the body of an individual. Brachytherapy includes, but is not limited to, interstitial brachytherapy, intracavitary brachytherapy, and episcleral brachytherapy. Brachytherapy techniques are also widely used in the treatment of cancer and are well known to those skilled in the art.

Systemic radiation therapy refers to radiation therapy delivered by injection or by administration to the individual. One example of systemic radiation therapy is radioactive iodine therapy. Radioactive iodine is a radioactive isotope molecule of iodine that is safe and effective for use in an individual, such as a human. Non-limiting examples of radioiodine in accordance with the present invention may be selected from the group consisting of ¹²³ I, ¹²⁴ I, ¹²⁵ I, ¹³¹ I, and combinations thereof. Preferably, the radioactive iodine is ¹³¹ I.

As used herein, the term "immunotherapy" means any anticancer therapeutic regimen that is compatible with C. novyi, e.g., C. novyi NT, with the treatment of the present invention and which uses a substance that modifies the immune response by increasing or decreasing immune capacity systems to produce antibodies or sensitized cells that recognize and interact with the antigen that initiates their production. Immunotherapy can be provided by recombinant, synthetic or natural drugs, including cytokines, corticosteroids, cytotoxic agents, thymosin and immunoglobulins. Some immunotherapy agents are naturally present in the body, and some are available in pharmaceutical preparations. Examples of immunotherapy agents include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferons, imiquimod and cell membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7 and synthetic cytosine Guanosine phosphate (CpG).

In one preferred embodiment, immunotherapy comprises administering an immune checkpoint inhibitor to a human. As used herein, “immune checkpoint inhibitor” refers to a substance that blocks the activity of molecules involved in dampening the immune response. Such molecules include, for example, cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed cell death protein 1 (PD-1). Immune checkpoint inhibitors of the present invention include, but are not limited to, ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer), MDX-1106 (Medarex, Inc.), MK3475 (Merck), CT-011 (CureTech, Ltd.) , AMP-224 (Amplmmune), MDX-1105 (Medarex, Inc.), IMP321 (Immutep S.A.), and MGA271 (MacroGenics).

In a further aspect of this embodiment, therapy of the present invention with C. novyi, for example, C. novyi HT, is effective against, for example, solid tumors that are resistant to therapy selected from the group consisting of chemotherapy, radiation therapy, immunotherapy and their combinations.

In another aspect of this embodiment, the solid tumor is refractory to standard therapy or the solid tumor is not accessible to standard therapy, but the C. novyi therapy, such as C. novyi HT, of the present invention is effective against such tumor.

As used herein, the terms “resistant” and “non-resistant” are used interchangeably. Being “refractory” to therapy means that previous therapy or therapy options were/were of low effectiveness, for example in treating cancer or killing cancer cells, compared to the same individual before therapy resistance occurred.

As used herein, the term “standard therapy” refers to those treatments that are generally accepted by those skilled in the art of medicine as appropriate for treating a particular type of cancer, preferably a particular solid tumor. Standard treatments may be the same or different for different tumor types. Standard treatments are typically approved by various regulatory agencies, such as the US Food and Drug Administration.

In another aspect of this embodiment, the method induces a strong localized inflammatory response and adaptive immune response in a person.

As used herein, an "inflammatory response" is a local response to cellular damage, pathogens, or irritants, which may include, but is not limited to, capillary dilation, leukocyte infiltration, swelling, redness, heat, itching, pain, loss of function, and their combinations.

As used herein, an “adaptive immune response” involves the B and T cells of an individual's immune system. When exposed to a pathogenic substance, such as a cancer cell, B cells can produce antibodies against pathogenic antigens in the pathogenic substance, and T cells can acquire the ability to target pathogens for eventual destruction. Certain populations of B and T cells specific for a given antigen are retained by the immune system and are recruited upon subsequent exposure to a pathogenic antigen. The adaptive immune response is thus persistent and provides the host individual's immune system with a constant ability to recognize and destroy a given pathogenic antigen-presenting pathogen.

Another embodiment of the present invention is a method for cytoreducing a solid tumor present in a human. This method involves administering intratumorally to a human a unit dose of C. novyi CFU, preferably C. novyi NT, containing approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

As used herein, “cytoreduction” of a solid tumor means a reduction in the size or number of cancer cells in a solid tumor. This procedure is palliative and can be used to enhance the effectiveness of therapy, including radiation therapy, chemotherapy or amputation. In this embodiment, the solid tumors are as set forth above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.

A further embodiment of the present invention is a method for cytoreducing a solid tumor present in a human. This method involves administering to a human tumor over one to four cycles a dosage unit of C. novyi NT spores comprising approximately 1×10 ⁴ spores per cycle, with each dosage unit of C. novyi NT suspended in a pharmaceutically acceptable carrier or solution. In this embodiment, the types of solid tumors are as set forth above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma.

Another embodiment of the present invention is a method of treating or mitigating a solid tumor present in a human. This method involves administering to a human subject, over one to four cycles, a dosage unit of C. novyi NT spores comprising approximately 1×10 ⁴ spores per cycle, with each dosage unit of C. novyi NT spores suspended in a pharmaceutically acceptable carrier or solution. The different types of solid tumors are as outlined above. Preferably, the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma.

Another embodiment of the present invention is a method of destroying a solid tumor present in a human. This method involves administering intratumorally to a human a unit dose of CFU of C. novyi, preferably C. novyi NT, containing approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable vehicle or solution, where the tumor is killed leaving a margin of normal tissue.

As used herein, “killing” a solid tumor means that the method removes the entire solid tumor. In this method, after treatment, a margin of normal tissue remains around the area where the tumor was. In this embodiment, the types of solid tumors are as set forth above. Preferably, the solid tumor is a sarcoma. More preferably, the solid tumor is a leiomyosarcoma, such as a retroperitoneal leiomyosarcoma.

In yet another embodiment, the present invention provides a CFU dosage unit of C. novyi. This dosage unit includes approximately 1×10 ³ -1×10 ⁷ CFU in a pharmaceutically acceptable carrier or solution that is effective for treating or ameliorating a solid tumor present in a human. As stated above, CFU of C. novyi can be in vegetative and spore forms.

In one aspect of this embodiment, the C. novyi is C. novyi NT. Preferably, a dose unit comprises approximately 1×10 ⁴ -1×10 ⁷ C. novyi NT spores, for example approximately 1×10 ⁶ -1×10 ⁷ C. novyi NT spores in a pharmaceutically acceptable carrier or solution. Preferably, a dosage unit comprises approximately 1 x 10 ⁴ C. novyi NT spores in a pharmaceutically acceptable carrier or solution.

In a further embodiment, the present invention provides a kit for treating or mitigating a solid tumor present in a human. This kit includes a C. novyi CFU dosage unit comprising approximately 1×10 ³ -1×10 ⁷ CFU in a pharmaceutically acceptable carrier or solution and instructions for use of the kit. The kit may be divided into one or more compartments, and may have one or more containers containing different reagents. The kit can be further adapted to provide storage and transport for each component.

In one aspect of this embodiment, the kit further includes one or more antibiotics that are effective for treating or alleviating an adverse side effect caused by CFU C. novyi. CFU can be in vegetative and spore form. Suitable antibiotics are those outlined above. Preferably, the kit further includes 1-4 dose units of C. novyi for 1-4 treatment cycles.

In another aspect of this embodiment, the C. novyi is C. novyi NT. Preferably, a unit dose comprises about 1×10 ⁴ -1×10 ⁷ C. novyi NT spores, for example, about 1×10 ⁶ -1×10 ⁷ C. novyi NT spores or about 1×10 ⁴ C. novyi NT spores in pharmaceutical acceptable carrier or solution. It is also preferred that the kit additionally includes 1-4 dose units of C. novyi NT spores for 1-4 treatment cycles.

Another embodiment of the present invention is a method for microscopically precise removal of tumor cells in humans. This method involves administering to a human tumor a unit dose of C. novyi NT colony forming units (CFU) comprising approximately 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution.

As used herein, "microscopically precise ablation" means the removal of target tissue from an individual, such as pathogenic tissue, wherein said ablation is particularly specific at the cellular level for the pathogenic tissue while causing no or minimal harm to nearby "healthy" tissue. » fabrics. Removal of target tissue may include, but is not limited to, apoptosis, necrosis, and cell lysis. This embodiment can be achieved by accurately delivering, for example, the C. novyi NT spores of the invention via CT-guided injection into a tumor using, for example, a multi-pronged delivery device such as a multi-pronged needle.

In the present invention, C. novyi spores, such as C. novyi NT spores, are delivered to an individual, such as a diseased individual, within a tumor using any therapeutically appropriate method. For example, C. novyi NT spores can be delivered using a single needle used at one or more tumor sites. Alternatively, a multi-pronged delivery vehicle, such as a multi-pronged needle, can be used to deliver, for example, C. novyi NT spores to a tumor. Delivery of, for example, spores can be to the same or different depths at one or more tumor sites. The selected delivery means can be used manually or controlled electronically. Delivery vehicles can be positioned and/or moved on the surface or within the tumor manually or via a remotely controlled device, and the injection site can be imaged using various imaging techniques known in the art, such as CT. Multi-prong delivery devices that can be used in the present invention include those disclosed, for example, in McGuckin, Jr. et al., US Pat. Nos. 6905480 and 7331947, which are incorporated herein by reference.

Another embodiment of the present invention is a method of treating or mitigating a solid tumor that has metastasized to one or more sites in a person. This method involves administering to a human tumor a unit dose of colony forming units (CFU) of C. novyi NT comprising at least about 1×10 ³ -1×10 ⁷ CFU suspended in a pharmaceutically acceptable carrier or solution. Preferably, at least one site of metastasis is distant from the original solid tumor.

As used herein, "metastasis" and its grammatical variants denote the spread of pathogenic cells, i.e. tumor cells, from the original, primary region of the body, to the secondary region of the body. Metastases may be local or distant depending on the distance from the original primary tumor site. Whether metastases are local or distant can be determined by the attending physician. For example, breast cancer cells that have spread to the brain are distant metastases, while breast cancer cells that have spread to the axillary lymph nodes are local metastases.

As used herein, an “effective amount” or “therapeutically effective amount” of a compound or composition disclosed herein is an amount of such compound or composition that is sufficient to produce therapeutic or desired results when administered to an individual as described herein. Effective dosage unit units, routes of administration, and dosage amounts are as described herein or as modified by a healthcare professional. It will be apparent to those skilled in the art that the dosage amount will vary depending on the route of administration, the rate of elimination, the duration of treatment, the identity of any other drugs administered, the age and size of the patient, and the like factors well known in the medical field. In general, a suitable dose of a composition in accordance with the invention will be that amount of the composition that is the lowest dose effective to produce the desired effect. The effective dose of the composition of the present invention is described above. In addition, the composition of the present invention can be administered in combination with other treatment options.

The compositions of the invention include one or more active ingredients in admixture with one or more pharmaceutically acceptable carriers and optionally with one or more other compounds, drugs, ingredients and/or substances. Regardless of the route of administration chosen, the agents/compounds of the present invention are formulated into pharmaceutically acceptable unit dosage forms by conventional methods known to those skilled in the art. See, for example, Remington, The Science and Practice of Pharmacy ( ^21st Edition, Loppincott Williams and Wilkins, Philadelphia, PA.).

Pharmaceutically acceptable carriers or solutions are well known in the art (see, for example, Remington, The Science and Practice of Pharmacy ( ^21st Edition, Loppincott Williams and Wilkins, Philadelphia, PA.) and the National Formulary (American Pharmaceutical Association)) and include sugars (for example, lactose, sucrose, mannitol and sorbitol), starches, cellulose preparations, calcium phosphates (for example, dicalcium phosphate, tricalcium phosphate and dicalcium phosphate), sodium citrate, water, aqueous solutions (for example, saline, sodium chloride injection , Ringer's solution for injection, dextrose solution for injection, dextrose sodium chloride injection, lactated Ringer's solution for injection, alcohols (such as ethyl alcohol, propyl alcohol, and benzyl alcohol), polyhydric alcohols (such as glycerin, propylene glycol, and polyethylene glycol), organic esters (e.g. ethyl oleate and triglycerides), biodegradable polymers (e.g. polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g. corn oil, germ oil wheat, olive, castor, sesame, cottonseed and peanut oil), cocoa butter, wax (for example, suppository wax), paraffins, silicones, talc, silicylate, etc. Each pharmaceutically acceptable carrier or solution used in a dosage unit in accordance with the present invention must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the individual. Carriers or solutions suitable for the selected dosage unit and route of administration, eg IT, are well known in the art, and suitable carriers or solutions for the selected dosage unit and route of administration can be determined by one skilled in the art.

The dosage units of the invention may optionally contain additional ingredients and/or substances commonly used in pharmaceutical compositions. These ingredients and substances are well known in the art and include (1) fillers or diluents such as starches, lactose, sucrose, glucose, mannitol and silicic acid; (2) binders such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose and gum arabic; (3) humectants such as glycerin; (4) disintegrants such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethylcellulose and sodium carbonate; (5) dissolution retarding agents such as paraffin; (6) absorption accelerators such as quaternary ammonium compounds; (7) wetting agents such as cetyl alcohol and glycerol monostearate; (8) absorbents such as kaolin and bentonite clay; (9) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols and sodium lauryl sulfate; (10) suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitol esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth; (11) buffering agents; (12) fillers such as lactose, milk sugars, polyethylene glycols, animal and vegetable fats, oils, waxes, paraffins, cocoa butter, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonites, silicic acid, talc, salicylate, zinc oxide , aluminum hydroxide, calcium silicates and polyamide powder; (13) inert diluents such as water or other solvents; (14) preservatives; (15) surfactants; (16) dispersing agents; (17) release controlling agents or absorption retarding agents such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin and waxes; (18) opacifiers; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents; (22), solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (particularly cottonseed, peanut, corn, wheat germ, olive, castor and sesame oils), glycerin, tetrahydrofuryl alcohol, polyethylene glycols and sorbitan fatty acid esters; (23) propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons such as butane and propane; (24) antioxidants; (25) agents that render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickeners; (27) coating agents such as lecithin; and (28) sweeteners, flavors, colors, flavorings and preservatives. Each such ingredient or substance must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the individual. Ingredients and substances suitable for the selected dosage unit and intended route of administration are well known in the art, and suitable ingredients and substances for the selected dosage unit and route of administration can be determined by one skilled in the art.

Liquid unit dosage forms include pharmaceutically acceptable emulsions, microemulsions, solutions and suspensions. Liquid unit dosage forms may contain suitable inert diluents commonly used in the art. In addition to inert diluents, oral compositions may also include adjuvants such as wetting agents, emulsifiers and suspending agents, coloring agents and preservatives. Suspensions may contain suspending agents.

Unit dosage forms for intratumoral administration include solutions, dispersions, suspensions or emulsions, or sterile powders. The active agent(s)/compound(s) may be mixed under sterile conditions with a suitable pharmaceutically acceptable carrier.

Dosage units in accordance with the present invention may alternatively include one or more active agents, for example, CFU of C. novyi or C. novyi NT spores in combination with sterile powders, which can be reconstituted into sterile injectable solutions or dispersions immediately before use, which can contain suitable antioxidants, buffers, solutes rendering the composition isotonic with the blood of the intended recipient, or suspending agents or thickening agents. Suitable fluidity can be maintained, for example, by the use of coating materials, by maintaining the required particle size in the case of dispersions and by the use of surfactants. These compositions may also contain suitable adjuvants such as wetting agents, emulsifiers and dispersing agents. It may also be desirable to include isotonic agents. In addition, prolonged absorption of an injectable pharmaceutical form may be caused by the inclusion of agents that delay absorption.

Depot forms introduced into the tumor can be obtained by forming microencapsulated matrices of the active ingredient in biodegradable polymers. The rate of release of the active ingredient can be controlled depending on the ratio of the active ingredient to the polymer and the nature of the particular polymer used. Injectable depot forms are also prepared by enclosing the active agent in liposomes or microemulsions that are compatible with body tissues.

As noted above, the compositions may be presented in single dose or multiple doses in sealed containers, such as ampoules and vials, and may be stored in a lyophilized state, requiring only the addition of a sterile liquid carrier, such as water for injection, immediately prior to use. Immediate injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the type described above.

The following examples are intended to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.

Examples

Example 1

Combination of intravenous (IV) dosing of C. novyi NT with irradiation

A study was conducted on the effect of a single i.v. doses of C. novyi NT spores to dogs with spontaneous tumors after treatment with external beam radiotherapy.

The preparation and final compilation of C. novyi NT spores was carried out at the Johns Hopkins Development laboratory in accordance with the following method. C. novyi NT spores generated according to Dang et al., 2001 were inoculated into enriched sporulation medium and incubated in an anaerobic chamber for 17–19 days at 37°C. Spores were purified by sequential continuous Percoll gradient centrifugation followed by extensive washing with phosphate-buffered saline. The spores were stored at 2-8°C. Spores were obtained prior to transport, suspended in sterile phosphate buffered saline, and diluted in 50 ml of 0.9% sodium chloride.

Controversy C. novyi NT was reconstituted in a bag containing 50 ml saline and transported overnight to the testing site. The radiation dose was approximately 54 Gy and was delivered in over 20 fractions: 11 to i.v. administration of C. novyi NT and 9 after administration. C. novyi NT spores were administered as a single injection at a dose of 1×10⁹ dispute/m² based on body surface area. Transfer of spores into a syringe was carried out on an absorbent pad with an impermeable backing. A 22-gauge needle with an attached 3-way stopcock was inserted into the bag. The male end of a closed-loop chemotherapy system (OnGuard™, TEVA Medical Ltd.) was connected to the port on the tap. The contents of the bag were completely emptied into a 60 cubic centimeter (cm) syringe³), to which the screwed end of the closed system was attached. The spores were administered to each individual over 15 minutes via i.v. a catheter to which the pin end of a closed-loop chemotherapy system was attached. The infusion was followed by a 10 cm pass.³ physiological solution. The subject was closely monitored for 6 hours after infusion as follows: vital signs, blood pressure, and oxygen saturation were monitored by monitoring every 15 minutes for the first 60 minutes, then by monitoring every 30 minutes for the next 60 minutes, then every 60 minutes for the next 120 minutes. Subsequent checks were performed every 60 minutes for a total of 6 hours.

Subjects were hospitalized for the first 3 weeks of treatment: 2 weeks for radiotherapy and 1 week after i.v. treatment of C. novyi NT. Follow-up visits occurred up to 6 months after treatment at months 1, 2, 3, and 6. See Tables 1 and 2 for sample treatment regimens.

Table 1
Schedule of inspections when introducing a dispute Screening (before starting radiation therapy) 1 day Day 2 Day 3 4 day 5 day 8 day ±2 days 15 day ±2 days 1 month ±3 days 2 months ±3 days 3 months ±14 days 6 months ±14 days Monitoring the patient for 6 hours after infusion Informed consent × Disease history × Physical examination × × × × × × × × × × × × Vital Signs × × × × × × × × × × × × Chest X-ray × × ¹ × ¹ × ¹ × ¹ × ¹ × ¹ Fine needle aspiration (FNA) biopsy for culture × × × × × Abdominal ultrasound × × ¹ × ¹ × ¹ × ¹ × ¹ × ¹ X-ray irradiation of the limb (if indicated) × × ¹ × ¹ × ¹ × ¹ × ¹ × ¹ Complete blood cell count (CBC), prothrombin time/partial thromboplastin time (PT/PTT), blood chemistry, urinalysis × × × × × × × × × × Research blood test ² × × × × × × × × × × × × Measurements and photographs of the tumor × × × × × × × × × Infusion of C. novyi NT spores × Answer × × × × × × Adverse Events (AEs) × × × × × × × × × Concomitant drug treatment × × × × × × × × × × ¹ Chest X-ray and additional imaging as clinically indicated
² Exploratory blood test includes collection of plasma, serum, blood clot and peripheral blood mononuclear cells (cells from plasma collection)

table 2
Calendar of combined treatment with irradiation and C. novyi NT (days) Monday Tuesday Wednesday Thursday Friday Saturday Sunday Irradiation, 1 day Irradiation, day 2 Irradiation, day 3 Irradiation, 4 days Irradiation, 5 day Irradiation, day 6 Irradiation, 7 day Irradiation, 8 day Irradiation, day 9 Irradiation, 10 day Spores, 1 dayX infusionX Irradiation, 11 day
Disputes, day 2 AY Irradiation, 12 day
Disputes, day 3 X Irradiation, day 13
Disputes, 4th day Y Irradiation, 14 day
Disputes, day 5 X Disputes, day 6 Disputes, day 7 Irradiation, 15 day
spores, day 8 X, Y Irradiation, 16 day
Disputes, day 9 Irradiation, 18 day B
Disputes, day 10 Irradiation, 19 day B
Disputes, day 11 Irradiation, 20 day B
Disputes, day 12 Disputes, day 13 Disputes, day 14 Disputes, day 15 X, Y Disputes, 30 day X, Y Re-evaluation of the tumor using CT 60 days after irradiation. Controversy, 90 day X, Y Disputes, 180 day X, Z A Radiation may be interrupted for more than one day, but irradiation will be resumed on day 11 B Irradiation must be completed on one of these days. X = CBC, chem. profile, AST, PT/PT, exploratory blood samples, adverse events (AEs), concomitant treatments, tumor measurements, photographs Y= samples for research blood analysis Z=check for chest metastases and additional imaging as indicated, including abdominal ultrasound

As of September 10, 2012, five dogs were treated in this manner. Of the five, 2 developed an abscess, 1 maintained stable disease, and 2 died or were killed. The two subjects who developed an abscess were photographed during treatment, as shown in Figures 1A and 1B.

Figure 1A shows a canine osteosarcoma located on the right distal radius/ulna during the course of treatment. Test subject "Sasha" presented with fever and swelling on day 3 and a ruptured abscess on day 6. Antibiotics were started on day 8 due to the open wound, and necrotic tissue and bone were then removed. Sasha completed 12 of 19 cycles of radiation therapy and was healing with stable disease as of September 10, 2012.

Figure 1B also depicts a canine osteosarcoma located on the right distal radius/ulna during the course of treatment. Test subject Sampson presented with fever and swelling on day 5. On day 6, the abscess ruptured and antibiotics were started. Sampson had completed 14 of 20 cycles of radiation therapy and was healing with stable disease as of September 10, 2012.

Other individuals - Chipper, Bailey and Ruskin - obtained different results. Chipper had squamous cell carcinoma of the left mandible. During the course of treatment, Chipper experienced swelling at the site of the tumor and received 20 of 20 rounds of radiation therapy. As of September 10, 2012, Chipper was in stable disease.

Another individual, Bailey, had a soft tissue sarcoma of the left axillary region. During treatment, Bailey died after experiencing sepsis, acute renal failure, occult disseminated intravascular coagulation, and cardiac arrest. However, an autopsy revealed that all tissue inside the tumor was dead with no tumor cells present.

The remaining individual, Ruskin, presented with osteosarcoma of the proximal right humerus. During treatment, Raskin experienced swelling at the site of the tumor and completed the full 20/20 courses of radiation therapy. However, on the 30th day, the tumor site produced large quantities of purulent material and Raskin experienced renal failure. The owner decided to euthanize him when his renal status did not improve. As of September 10, 2012, the autopsy results are still pending.

Example 2

Administration of C. novyi-NT IT spores specifically targeting tumor tissue and survival time in rats - Methods

Cell lines and tissue culture

Rat glioma cell line F98 was transfected with a lentivirus-mediated luciferase construct and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin.

Experiments on rats

6-week-old female F344 Fisher rats (100–150 g) were purchased from the National Cancer Institute. For the implantation procedure, female F344 Fisher rats were anesthetized with intraperitoneal (i.p.) administration of ketamine hydrochloride (75 mg/kg; 100 mg/ml ketamine HCl; Abbot Laboratories), xylazine (7.5 mg/kg; 100 mg/mL). ml Xyla-ject; Phoenix Pharmaceutical, Burlingame, CA), and ethanol (14.25%) in sterile NaCl solution (0.9%). F98 glioma cells ( ^2x104 ) were stereotactically implanted through a burr hole in the right frontal lobe, located 3 mm lateral to bregma and 2 mm anterior to it, as previously described (Bai, et al., 2011). Tumor size was assessed using the Xenogen instrument using i.p. administration of 8 mg/rat potassium salt of D-luciferin on the 12th day after implantation of tumor cells. Then, 3 million C. novyi-NT spores, prepared as described previously (Dang, et al., 2001, Bettegowda, et al., 2006), were stereotactically injected into the intracranial tumor using the same coordinates as described above and rats received i.p. 10 mg/kg/day dexamethasone for the first 2 days. Animals were monitored daily for any signs of deterioration, lethargy, neurotoxicity, or pain in accordance with the Johns Hopkins Guide for the Care and Use of Animals. If symptoms of distress were present, maintenance therapy with hydration and doxycycline (loading dose 15 mg/kg i.p., then 10 mg/kg every 12 hours as a maintenance dose) was initiated and continued for a 7-day period. If symptoms persisted and/or resulted in malnutrition, dying animals were euthanized. The effectiveness of IT administration of C. novyi-NT spores was assessed using Kaplan-Meier survival curves as well as the remaining tumor burden on brain sections. For the latter, brains were collected after autopsy, placed in formaldehyde, and embedded in paraffin for additional pathological studies. Gram-stained sections were counterstained with safranin, and H&E-stained sections were prepared according to standard guidelines methods.

Statistical analysis

Kaplan-Meier survival curves were generated and analyzed by the Mantel-Cox test using GraphPad Prism v.5.00 (GraphPad Software, San Diego, CA).

Example 3

Administration of C. novyi-NT IT spores specifically targeting tumor tissue and survival time in rats - Results

Complete surgical removal of advanced gliomas is almost always impossible, and these tumors inevitably recur. Although this type of tumor does not usually metastasize, there are no highly effective medical treatments available to cure it. Therefore, gliomas are proposed to be a type of tumor for which local administration of C. novyi-NT spores may be therapeutically beneficial. To evaluate this possibility, rat F98 glioma cells were orthotopically implanted into 6-week-old Fisher F433 rats, resulting in locally invasive tumors that quickly became fatal (Figure 2A). Injection of C. novyi-NT IT spores into the tumors of these rats resulted in tumor germination within 24 hours and a rapid decline in luciferase activity as an indicator of tumor burden within 24-48 hours (Figures 2B and 2C). The germination of C. novyi-NT was confirmed by the appearance of vegetative forms of bacteria. Strikingly, C. novyi-NT localized precisely to the tumor, and moderately to adjacent normal cells only a few microns away (Figures 3A and 3B). In addition, these vegetative bacteria could be seen to grow within islands of microinvasive tumor cells and simultaneously destroy these cells located within the normal brain parenchyma (Figures 4A and 4B). This bacterial biosurgery resulted in a significant survival advantage in this highly aggressive mouse model (Figure 2A, P value <0.0001).

Example 4

Canine soft tissue sarcomas similar to human tumors - Methods

Isolation of genomic DNA for sequencing

Genomic DNA from dogs participating in a comparative IT study of C. novyi-NT spore administration was extracted from peripheral blood lymphocytes (PBLs) and formalin-fixed, paraffin-embedded tumor tissue using the QIAamp DNA Mini Kit (QIAGEN, Valencia, CA) according to protocol manufacturer.

Sequencing and analysis using bioinformatics

Genomic DNA purification, library construction, exome capture, next generation sequencing, and bioinformatics analysis of tumor and normal samples were performed at Personal Genome Diagnostics (PGDx, Baltimore, MD). Briefly, genomic DNA from tumor and normal samples was fragmented and used to construct the lllumina TruSeq library (lllumina, San Diego, CA). Exon regions were captured in solution using the Agilent Canine All Exon kit according to the manufacturer's instructions (Agilent, Santa Clara, CA). Paired-end sequencing resulting in 100 bases from each end of the fragments was performed using the HiSeq 2000 Genome Analyzer (lllumina, San Diego, CA). Tags were aligned to the canine reference sequence (CanFam2.0) using the Eland algorithm of CASAVA 1.7 software (lllumina, San Diego, CA). The BaseCall Illumina software purity filter was used to read selected sequences for subsequent analysis. The Eland algorithm of CASAVA 1.7 software (lllumina, San Diego, CA) was then used to identify point mutations and small insertions and deletions. Known polymorphisms recorded in dbSNP131 (CanFam2.0) were excluded from the analysis. Potential somatic mutations were filtered and visually inspected as previously described (Jones, et al., 2010).

Example 5

Canine Soft Tissue Sarcomas Similar to Human Tumors - Results

Preclinical animal studies of anticancer agents often fail to reproduce observed effects in humans. In dogs, however, clinical use of therapeutic agents produces toxicity and effects similar to those observed in humans (Paoloni, et al., 2008). The development of investigational treatments in dogs may represent a key transition between preclinical animal studies and human clinical studies. In particular, canine soft tissue sarcomas provide an excellent model because they are common in many dog breeds and have clinical and histopathological features very similar to human soft tissue sarcomas (Paoloni, et al., 2008, Vail, et al., 2000). However, while recent advances in genomics have greatly expanded our knowledge of the genetics of cancer in humans, relatively little is known about the genetic makeup of canine cancer types. Therefore, to determine whether canine tumors are genetically similar to human tumors, the tumor exome and corresponding normal DNA from 11 dogs participating in the comparative study were sequenced (Figure 5). This analysis included querying 30,194 nominal genes comprising 32.9 megabases (Mb) of DNA. Ten dogs had soft tissue sarcomas (six peripheral nerve sheath tumors) and one had chondroblastic osteosarcoma. An average of 15.7 gigabases (Gb) (range: 8.1–23.3 Gb) of generated sequence was mapped to the genome, and 92.1% of bases in target regions were covered by at least 10 unique reads in tumor DNA . Similarly, an average of 16.3 Gb (range: 14.6–19.7 Gb) of sequence was mapped to the genome in normal DNA, and 93.6% of the target bases were covered by at least ten unique reads. The average coverage of each target base in the tumor was 153-fold (range: 73-227-fold), and it was 152-fold in the corresponding normal samples (range: 130-178-fold).

Using stringent analysis criteria, 156 somatic mutations and 28 somatic copy number changes were identified among the 10 soft tissue sarcomas (Table 3 and Figure 6). The range of somatic mutations is from 0 to 95, with an average of 14 per tumor. The prevalence of mutations in soft tissue sarcomas was low, with a mean of 0.47 per Mb (range: 0.00–2.89 per Mb). Except for the outlier of one sample with 95 somatic changes, where a mean prevalence of 0.21 mutations per Mb (range: 0.00-0.61 per Mb) was observed (Figure 5), similar to the determination of mutation rates in human pediatric rhabdoid tumors (Lee , et al., 2012) and other soft tissue sarcomas (Joseph, et al., 2013). The most common type of somatic change was a missense mutation with a predominance of C to T transition (45.5%) and G to A transition (34.0%; Tables 4a and 4b).

Table 4a
Types of physical changes observed in canine soft tissue sarcomas Type Subtype Number of changes Percentage of change (%) Substitutions Antisense eleven 6 Meaningless (Non-synonymous) 135 73 Splice site acceptor 1 1 Splice site donor 4 2 Intermediate 151 82 INDELs Deletion 4 2 Insert 1 1 Intermediate 5 3 CNAs Deletion 0 0 Amplification 28 15 Intermediate 28 15 Total 184 100 INDELs - insertions and deletions; CNAs – copy number changes

Table 4b
Types of somatic mutations in canine soft tissue sarcomas Type of somatic change Quantity Percent Deletion 1 bp 3 1.9 3 bp deletion 1 0.6 Deletion 1 bp 1 0.6 3 1.9 4 2.6 3 1.9 4 2.6 2 1.3 71 45.5 53 34.0 3 1.9 4 2.6 1 0.6 1 0.6 2 1.3 Total 156 100

Amplifications and deletions were less common, with an average of three per tumor (range: 0-17) (Figure 5). Seven of 10 soft tissue sarcomas did not harbor amplifications or deletions. The exome of chondroblastic osteosarcoma was similar to that of soft tissue sarcomas with 14 somatic mutations and four amplifications (Table 3 and Figure 6).

Single base substitutions have been identified in four tumor suppressor genes that are frequently mutated in human tumors {NF1, MLL3, TP53, and PTCH1). Additionally, MDM4, an oncogene that has been shown to undergo amplification but not point mutations in human cancers, was found to be amplified (but not subject to point mutations) in one canine tumor (Lee, et al., 2012, Barretina, et al., 2010, Chmielecki, et al., 2013, Vogelstein, et al., 2013). The only genes mutated in more than one tumor were ATP7B (missense mutations in two tumors) and AIG1 (amplification in two tumors). Interestingly, mutations in ATP7B are also found in human liposarcomas (Joseph et al., 2013). Twenty-two of the 184 somatic mutations in canine tumors arose in genes previously shown to be mutated in human soft tissue sarcomas (Table 5).

Larger studies of soft tissue sarcomas in both species are required to determine whether these reported driver mutations are indicative of important, conserved oncogenic pathways. Regardless, the genetic landscapes of canine tumors are similar to those of humans in terms of the number of genetic changes and the spectrum of mutations. In particular, they rule out the possibility that dog tumors have a very high number of mutations that could make them more likely to generate an immune response than similar types of tumors in humans.

Example 6

Intratumoral (IT) administration of C. novyi NT - Study 1. Methods

To investigate the safety and effectiveness of the method of the present invention, a comparative study was conducted on 16 dogs with spontaneously occurring solid tumors (Table 6).

Dogs were enrolled in the study at multiple institutions participating in the Animal Oncology Clinical Trials Network (ACI, Washington, DC), and written informed consent was obtained from the owner(s) prior to enrollment. Study treatment, content, and outcome measures were monitored to meet the requirements of board-certified veterinary oncologists. Inclusion was offered to client-owned dogs with spontaneous solid tumors with a preference for soft tissue sarcoma in which standard therapy had failed or whose owner(s) had declined such therapy. Participation was limited to tumor-bearing dogs with a target node having the largest diameter between 1 and 7 centimeters. Dogs with tumors located in areas where development of an abscess would be catastrophic (eg, nasal tumors that spread to the brain or advanced metastatic pulmonary disease) were excluded from the study.

Dogs with evidence of an active bacterial infection requiring systemic antibiotic therapy for seven days or cancer therapy (chemotherapy, radiation therapy, immunotherapy) for 21 days were not eligible for treatment with C. novyi-NT spores. Dogs were required to have an activity score of 0 or 1 (Table 7) and be available for enrollment throughout the study period. Concomitant use of anticancer agents and participation in other clinical trials was prohibited. Dogs that were pregnant or at risk of becoming pregnant were not included in the study. In addition, dogs that may not be available for the duration of the study or dogs that were considered unsuitable for inclusion in the study by the investigator or primary care physician were not included in the study.

Table 7
Activity level assessment Point Description 0 Normal activity 1 Reduced activity: activity reduced relative to pre-disease activity 2 Impaired: only in outpatient settings, capable of consistent defecation and urination in acceptable places 3 Disabled: Requires force feeding and/or inability to limit urination and defecation to acceptable areas 4 Death

At the time of the screening visit, each dog was assigned a unique study identification number consisting of a 5-digit numeric code (which may not be the same as the dog's sequential screening number). The first 2 digits indicated the study site (01 to 99), the middle digit indicated study “R,” and the last 2 digits described the study number of the dog at the study site (01 to 99). For example, the 11th dog enrolled in the study at location 9 was assigned study dog number 09-R11. Study numbers were assigned to dogs in the chronological order in which dogs were enrolled at a given study site. A dog was considered for inclusion in the study when it met the inclusion and exclusion criteria.

Gross pathology and histology studies were performed in accordance with Food and Drug Administration Industry Guideline CVM 185. At autopsy, the following tissues (Table 8) were evaluated for gross pathology and histopathology and described in the autopsy report. For microbiology, samples were collected from brain, heart, lung, liver, spleen, kidney, muscle, bone, small intestine, colon, and any tissue with extensive abnormality.

Table 8
List of tissues obtained for examination of gross pathology and histopathology Pituitary Brain Bone and bone marrow Thyroid Spinal cord Spinal cord smear Epithelial body Eyes Spleen Adrenal Lung Stomach Pancreas Muscle Duodenum Ovaries Breast Jejunum Uterus Liver Ileum Testes Gallbladder Colon Prostate Kidneys Cecum Epididymis Bladder Thymus Heart The lymph nodes Injection site Ventricles Leather Any abnormal tissue

All dogs were hospitalized from day 0 (D0) to day 4 (D4) and then optionally (at the investigator's discretion) for 24 to 48 hours after each subsequent treatment cycle for clinical observation. Fluids were administered to all dogs included in the study during hospitalization following treatment with C. novyi NT. On dosing days, all dogs were administered intravenous (IV) crystalloid 4 mL/kg/hour over 2 hours. Dogs were closely monitored for six hours after each IT injection of C. novyi-NT spores. At the next visit (4 days later), all dogs were administered subcutaneous crystalloid (SQ) 20 ml/kg. If the dog was hospitalized and received i.v. crystalloids on the day that SQ crystalloids were to be given, there was no need to give a dose of SQ.

Study visits and events are summarized in Table 9, with a 4-dose treatment regimen given as an example. The dosing interval was assumed to be a weekly interval unless the dog was considered to be treated with repeated doses. Treatment delays in repeat dosing occurred during the study due to adverse events or investigator decision.

Table 9
Summary of Study Evaluations Screening before treatment ^a 0 day ^b 4 day Day 7 ^b Day 11 Day 14 ^b Day 18 21 day ^b Day 25 60 day 90 day Informed consent X Medical history & personal information X Physical examination X X X X X X X X X X X Weight & vital signs X X X X X X X X X X X Activity rating X Inclusion & exclusion criteria X Laboratory indicators ^With X X X X (X) (X) (X) (X) (X) (X) (X) Visualization ^D X (X) (X) (X) (X) (X) (X) (X) (X) (X) (X) Biopsy X Study X Blood test Tumor measurements & photos X X X X X X X Number assigned to the dog in the study X Inclusion X IT C. novyi-NT X X X X X Therapy i.v. liquid ^e X X X X X SQ Liquid Therapy ^f X X X X End of the study ^g X ^a Screening assessments were performed 1–14 days before study entry. ^b The patient was monitored for 6 hours after treatment. Assessments were made every 15 minutes for 1 hour after treatment, every 30 minutes for 2 hours after treatment, and every 60 minutes for 3 to 6 hours after treatment. ^c Laboratory values include: complete blood count, serum chemistry panel, prothrombin time, thromboplastin time and urinalysis. (X) - at the discretion of the investigator. ^d Diagnostic imaging including: radiographs, ultrasound, or computed tomography. ^e Crystalloid at a dose of 4 ml/kg/hour for two hours. ^f Crystalloid at a dose of 20 ml/kg. ^g Following completion of the study, and if systemic antibiotics were required to treat adverse events, it was recommended that dogs be treated with doxycycline 5–10 mg/kg orally twice daily (PO BID) for 3 months.

Sixteen dogs, 9 neutered males, 1 healthy (intact) male and 6 neutered females were included in the study. (Table 6). Their personal and tumor characteristics are shown in Table 6. The individuals included in the study were of different breeds, weights and ages. The individuals were previously diagnosed with spontaneously occurring types of cancer of various histological origins: 13 dogs were diagnosed with soft tissue sarcoma (81%), 1 osteosarcoma (6.3%), 1 melanoma (6.3%) and 1st mast cell tumor (6.3%). Of the 13 soft tissue sarcomas, histological subtype was available in 11 and included: 4 hemangiopericytomas (30.8%), 3 peripheral nerve sheath tumors (23.1%), 1 synovial cell sarcoma (7.7%), 1 myxosarcoma (7.7%), 1 rhabdosarcoma (7.7%) and 1 fibrosarcoma (7.7%). The mean weight of the dogs included in the study was 29.4 kg (range: 8.1–44.3 kg) and their mean age was 10.9 years (range: 7.2–14.3 years). Thirteen dogs were diagnosed with soft tissue sarcoma and one each was diagnosed with osteosarcoma, malignant melanoma and mast cell tumor. Of the 13 soft tissue sarcomas, six were available for immunohistochemistry (IHC). All six were positive for S100 and negative for smooth muscle actin, suggesting a diagnosis of sarcoma of a subtype called peripheral nerve sheath tumor. Seven tumors were stage I, five were stage II, and four were stage III. Eight dogs had previously undergone surgical treatment for cancer.

Production of C. novyi-NT spores and IT injection into spontaneous tumors of dogs

C. novyi-NT spores for use in the canine comparative study were obtained as previously described ( Dang et al., 2001 , Bettegowda et al., 2006 ). Briefly, bacteria were cultured in sporulation medium for at least two weeks to ensure maximum yield of mature spores. Mature spores were purified using two sequential, continuous gradients and resuspension in PBS. Testing the sterility of the final product was carried out by culturing the product in

soy-casein medium and thioglycollate medium according to FDA guideline 21CFR610.12 (Nelson Laboratories, Salt Lake City, UT). Germination efficiency assays were performed under anaerobic conditions on Brucella culture agar with 5% horse blood to ensure that the spores met the specified viability criteria. Spores were packaged in sterile 1.8 ml cryovials with sealed O-ring screw caps (Simport, Beloeil, Canada) in a volume of 1000 µl and a concentration of 1×10 ⁹ spores/ml. Cryovials with C. novyi-NT were stored at a temperature of 2-8°C. For dosing, a 0.4 ml aliquot of the spore stock solution was packed into 0.5 ml cryovials. Following dosing, cryovials and unused C. novyi-NT spores were disposed of in accordance with current biosafety level 2 material disposal guidelines. Before IT administration, spores were resuspended by vortexing at maximum speed for 10 seconds for a total of three times, before being aspirated into a 1 ml syringe. The injection site was prepared under aseptic conditions. When possible, ultrasound or computed tomography (CT) was used to identify the necrotic area of the tumor. If no necrotic areas were detected, the injection was directed to the center of the tumor. The needle was inserted once at a predetermined location, and 100 μl of spore suspension (1×10 ⁸ C. novyi-NT spores) was dispensed with uniform pressure. The injection needle was removed slowly and the injection site was sterilized. All dogs received at least 1 cycle of IT dose of ^1x108 spores in 100 µl saline (biosurgery grade): 3 dogs received one cycle of treatment, 13 dogs received more than 1 cycle, up to 4 cycles of treatment. Dogs could receive up to 4 cycles of biosurgery with a one week interval between cycles. Following treatment, dogs were observed for at least 90 days after the first IT injection. Longer follow-up of disease progression and survival was warranted when available. Early withdrawal from the study was possible due to toxicity or disease progression.

Study assessments were performed as described in Table 9. Pre-observation assessments were performed from days 1 to 14 before the first biosurgery cycle. Dogs in the study were examined periodically on both an inpatient and outpatient basis. Laboratory samples were collected as presented in Table 9 and included complete blood count, serum chemistry, prothrombin time, partial thromboplastin time, and urinalysis. Imaging was performed at screening and included local CT, chest x-ray, and abdominal ultrasound. Additional imaging may have been performed during the study at the discretion of the investigator.

Adverse events were assessed, whenever possible, using the Veterinary Cooperative Oncology Group Common Terminology Criteria for Adverse Events (VCOG-CTCAE) v1.0 (Veterinary Co-operative Oncology Group, 2004) with terminology from the veterinary dictionary for information on issues related to drugs (VeDDRA) Rev.4 (European Medcines Agency, 2012). Terminology for adverse events associated with C. novyi-NT germination (target node reactions) is defined in Table 10. Clinical observations without appropriate VeDDRA or target node reaction terminology were classified separately as uncoded features (Table 11). Attitudes toward treatment of C. novyi-NT were determined by the reporting investigator.

Table 10
Coded terms to describe tumor adverse events associated with C. novyi-NT activity Term for classification of damage to organs and organ systems (SOC) High Level Term (HLT) Preferred Term (PT) Low Level Term (LLT) Target tumor node response Tumor inflammation Tumor abscess Tumor abscess Target tumor node response Tumor inflammation Tumor abscess Closed tumor wound Target tumor node response Tumor inflammation Tumor abscess Tumor unpleasant odor Target tumor node response Tumor inflammation Tumor abscess Tumor necrosis Target tumor node response Tumor inflammation Tumor abscess Open tumor wound Target tumor node response Tumor inflammation Tumor abscess Loss of tumor tissue Target tumor node response Tumor inflammation Tumor abscess Rejected tumor tissue Target tumor node response Tumor inflammation Tumor abscess Tumor ulceration Target tumor node response Tumor inflammation Change in tumor consistency Change in tumor consistency Target tumor node response Tumor inflammation Change in tumor consistency Tumor density Target tumor node response Tumor inflammation Change in tumor consistency Softness of the tumor Target tumor node response Tumor inflammation Isolation from tumor Tumor bleeding Target tumor node response Tumor inflammation Isolation from tumor Bloody discharge from the tumor Target tumor node response Tumor inflammation Isolation from tumor Isolation from tumor Target tumor node response Tumor inflammation Isolation from tumor Purulent discharge from the tumor Target tumor node response Tumor inflammation Isolation from tumor Serous discharge from the tumor Target tumor node response Tumor inflammation Tumor inflammation Increased tumor temperature Reaction of the target tumor node Reaction of the target tumor node Tumor inflammation Tumor inflammation Increased tumor warmth Target tumor node response Tumor inflammation Tumor inflammation Tumor swelling Target tumor node response Tumor inflammation Tumor inflammation Tumor inflammation Target tumor node response Tumor inflammation Tumor inflammation Tumor inflammatory response Target tumor node response Tumor inflammation Tumor inflammation Itching tumor Target tumor node response Tumor inflammation Tumor inflammation Tumor swelling Target tumor node response Tumor inflammation Tumor pain Tumor pain Target tumor node response Tumor inflammation Skin tumor disorder Tumor hematoma Target tumor node response Tumor inflammation Skin tumor disorder Change in tumor color Target tumor node response Tumor inflammation Skin tumor disorder Tumor erythema Target tumor node response Tumor inflammation Skin tumor disorder Petechial hemorrhage in the tumor Target tumor node response Tumor inflammation Other neoplastic disorder Other neoplastic disorder Target tumor node response Tumor inflammation Tumor pain Tumor discomfort

Table 11
Non-VeDDRA features underlying disease entity or target site response associated with C. novyi-NT Adverse event (preferred term) G-I G-II G-III G-IV # dogs (with at least one AE) Total Uncoded attribute 15 2 1 ^A 5 18 ^a Stage IV, investigator-reported decrease in blood eosinophils.

Measurements of the longest tumor diameter of the target tumor node (intended for injection) were taken on day 0, day 7, day 14, day 21, day 60 and day 90 after treatment (Table 9). Non-target and new nodes were recorded but not measured. Best overall target response was assessed at or after day 21 of the study visit: complete response (CR) was defined as complete resolution of the target nodule; partial response (PR) was defined as at least a 30% reduction in the largest diameter of the target node; and target disease progression (PD) was defined as at least a 20% increase in the largest diameter of the target node or the appearance of new non-target nodes. Stable disease (SD) was defined as insufficient decrease or increase in the largest diameter of the target node to classify it as CR, PR, or PD. For abscesses associated with C. novyi-NT, medical or surgical debridement of necrotic tissue was left to the discretion of the investigator.

Surgical specimens and necropsies were evaluated by a department of board certified veterinary pathologists. Tissue samples were fixed in 10% neutral buffered formalin and embedded in paraffin. H&E-stained and/or Gram-stained sections were obtained for evaluation according to the principles of standard guidelines. For immunohistochemistry (IHC), 5-μm sections of formalin-fixed, paraffin-embedded tumor tissue were obtained, deparaffinized in xylene, and rehydrated by running through a battery of alcohols. Antigen unmasking was performed using unmasking solution (Vector Laboratories, Burlingame, CA). Primary antibodies against S100 (DAKO, Carpinteria, CA) and anti-smooth muscle actin antibodies (DAKO, Carpinteria, CA) were used at a dilution of 1:100. DAB-labeled secondary antibodies (Vector Laboratories, Burlingame, CA) were used at a 1:500 dilution. Sections were incubated with ABC reagent (Vector Laboratories, Burlingame, CA) and stained with hematoxylin. Tumor grade was assessed for each tumor based on published criteria (Dennis, et al., 2011, Patnaik, et al., 1984, Smedley, et al., 2011, Sabattini, et al., 2014).

Example 7

Intratumoral (IT) administration of C. novyi-NT - Study 1. Results

All dogs received at least one cycle of biosurgery, with 53 cycles obtained from the maximum of 64 planned. The majority of dogs, 10 of 16, received the intended four cycles. The biosurgery cycles were one week at a time. No placebo or masking controls were used.

Dogs demonstrating early tumor responses, toxicity, or disease progression after the first cycle had subsequent cycles discontinued. The most common adverse events indicated local infection at the injection site of C. novyi-NT spores included: fever (17 incidents), tumor inflammation (12 incidents), tumor abscess (10 incidents), anorexia (nine incidents), and lethargy (six incidents). ) (Table 12). Clinical signs of an inflammatory reaction at the injection site into the target tumor site were observed in 14 of 16 dogs (87.5%), including: tumor inflammation (12/14), tumor abscess (7/14), tumor pain (5/14) and tumor discharge (4/14) (Table 13).

Table 12
Summary of adverse events observed during the study Adverse event (preferred term) G-I G-II G-III G-IV # dogs (with at least one AE) Total Hyperthermia 14 3 10 17 Tumor inflammation 7 4 1 12 12 Tumor abscess 6 3 1 8 10 Anorexia 7 2 8 9 Lethargy 3 2 1 6 6 Lameness 5 1 6 6 Edema 5 1 5 6 Hypertension 6 4 6 Neutrophilia 6 6 6 Discharge from the tumor 6 4 6 Anemia 4 1 5 5 Diarrhea 3 1 2 4 Tumor pain 3 1 4 4 Leukocytosis 4 3 4 Lymphadenitis 4 4 4 Change in tumor consistency 3 3 3 Leukopenia 1 1 1 2 Thrombocytopenia 1 1 2 2 Localized pain 1 1 2 2 Lymphopenia 1 1 2 2 Changes in blood proteins 1 1 2 2 Vomit 1 1 2 2 Fluid in the abdominal cavity 1 1 1 2 Generalized pain 1 1 2 2 Electrolyte imbalance 2 2 2 Disturbed consciousness 2 2 2 Skin tumor disorder 2 2 2 Neutropenia 1 1 1 Anxiety 1 1 1 Muscle weakness 1 1 1 Recumbent state 1 1 1 Panniculitis 1 1 1 Hemorrhage of the digestive tract 1 1 1 Skin and tissue infection 1 1 1 Arrhythmia 1 1 1 Bone and joint disorders 1 1 1 Cardiac hypertrophy 1 1 1 Digestive tract disorder 1 1 1 Eosinophilia 1 1 1 Erythema 1 1 1 Hepatomegaly 1 1 1 Hepatopathy 1 1 1 Itching at the injection site 1 1 1 Lymphocytosis 1 1 1 Noise 1 1 1 Nausea 1 1 1 Palpable mass 1 1 1 Pulmonary disorder 1 1 1 Skin hemorrhage 1 1 1 Urine abnormalities 1 1 1 Total 153

Table 13
Summary of clinical evidence for germination and response to therapy of C. novyi-NT Case ID Clinical proof of germination ^A Clinical response ^b Tumor inflammation, skin disorder and discharge Tumor inflammation and pain Tumor inflammation and abscess Inflammation of the tumor, change in consistency, discharge and pain in the tumor Tumor inflammation and pain Inflammation of the tumor, change in consistency, skin breakdown and pain Tumor inflammation, abscess and discharge Tumor abscess and discharge - Tumor inflammation, abscess and pain Tumor inflammation and abscess Tumor inflammation Tumor abscess and change in consistency Tumor inflammation Tumor inflammation and abscess ^a Clinical evidence of C. novyi-NT germination on or after day 0 of the study and includes target tumor node responses (Figure 5). ^b Best response of the target tumor node, as defined by the study protocol, after 21 days of the study: CR - complete response; PR - partial response; SD - stable disease; PD - progressive disease; NE—not evaluable for response at or after 21 days of study.

Adverse events with early onset

Early-onset adverse events refer to events occurring within the first 7 days after the first treatment cycle (13 dogs) or single treatment cycle (3 dogs). A variety of adverse events (AEs) have been reported in many cases. Early-onset adverse events that occurred within 7 days of either the first treatment cycle (13 dogs receiving multiple cycles) or a single treatment cycle (3 dogs receiving only one cycle) are listed in Table 14.

Table 14
Summary of early-onset adverse events ^of any grade during the first treatment cycle Adverse event Type Number of dogs ^b (N=16) Incidence (%) Tumor inflammation Target tumor node response 9 56.3% Anorexia General signs or symptoms 4 25.0% Edema General signs or symptoms 4 25.0% Fever General signs or symptoms 4 25.0% Elevated white blood cells Blood and lymphatic system 2 12.5% Hypertension Circulatory disorders 2 12.5% Lethargy General signs or symptoms 2 12.5% Pain General signs or symptoms 2 12.5% Tumor abscess Target tumor node response 2 12.5% Reduced Hb Blood and lymphatic system 1 6.3% Reduced MCV Blood and lymphatic system 1 6.3% Elevated neutrophils Blood and lymphatic system 1 6.3% Decreased red blood cells Blood and lymphatic system 1 6.3% Decreased white blood cells Blood and lymphatic system 1 6.3% Blood in stool Digestive tract disorders 1 6.3% Diarrhea Digestive tract disorders 1 6.3% Nausea Digestive tract disorders 1 6.3% Regurgitation Digestive tract disorders 1 6.3% Vomit Digestive tract disorders 1 6.3% Itching at the injection site Reactions at the injection site 1 6.3% Tumor bleeding Target tumor node response 1 6.3% Tumorous erythema Target tumor node response 1 6.3% ^a Up to 7 days and less than 7 days after the first cycle of treatment. ^b Number of dogs with at least one adverse event of any grade

Common findings of early-onset adverse events included: target tumor site reactions, changes in general signs and symptoms, and blood and lymphatic system abnormalities. Most early-onset adverse events were mild to moderate (grades I-II), with tumor inflammation, anorexia, tumor edema, and fever being the most commonly observed events. Grade III tumor abscess and grade III tumor inflammation were observed in two cases (10-R02 and R03-16). The data on early-onset adverse events appear to be consistent with the expected tumor inflammatory responses resulting from the mechanism of action of therapeutic C. novyi-NTs.

Adverse events with late onset

A subgroup of 3 dogs received only one cycle of treatment (as of December 2, 2012). Adverse events with late onset refer to events occurring after 7 days following a single treatment cycle and are summarized in Table 15 for 3 dogs (04-R04, 10-R02 and 11-R01). The majority of late-onset adverse events were mild to moderate (Grade I-II), and 11 of the 12 late-onset adverse event data occurred in a single individual, 04-R04. This dog presented with chondroblastic osteosarcoma of the right forepaw with a baseline LD measurement of 94.5 mm (CT measurement was not available). Amputation was considered 20 days after administration of C. novyi-NT spores due to disease progression. Two other individuals tolerated a single cycle of treatment well. Their late-onset AE was limited exclusively to mild fever (Grade I).

Table 15
Summary of late-onset adverse events ^of any grade after the first cycle of treatment Adverse event Type Number of dogs ^b (N=3) Morbidity (%) Days before the study ^With Fever General signs or symptoms 1 33.3% 9 Pain General signs or symptoms 1 33.3% 20 Disturbance at the surgical site Systemic NOS violation 1 33.3% 24 Elevated neutrophils Blood and lymphatic system 1 33.3% 34 Decreased red blood cells Blood and lymphatic system 1 33.3% 34 Elevated eosinophils Blood and lymphatic system 1 33.3% 61 Elevated white blood cells Blood and lymphatic system 1 33.3% 61 New tumor mass Neoplasia 1 33.3% 82 Lymphadenopathy Lymph node disorders 1 33.3% 82 Low platelets Blood and lymphatic system 1 33.3% 93 ^a After 7 days following the first treatment cycle. ^b Number of dogs with at least one adverse event of any grade. ^from the date of first treatment.

Thus, the safety profile observed after one cycle of IT treatment with 1 x 10 ⁸ C. novyi-NT spores suggested adequate tolerability. Early-onset and late-onset adverse events were consistent with the expected tumor inflammatory responses resulting from the mechanism of action of C. novyi-NT. Adverse events were monitored and effectively managed as described herein.

Adverse events observed in dogs receiving multiple cycles of IT treatment with C. novyi-NT are listed in Table 9 for adverse events (AEs) of any grade and in Table 10 for AEs grade III and higher.

The variety and number of adverse events reported after multiple treatment cycles was very similar to that observed after a single treatment cycle. In addition, the occurrence of events appeared to be largely consistent with that observed after a single cycle of treatment: of the 169 data for all cases, only 30 occurred more than seven days after the previous dose. Likewise, tumor inflammation, anorexia, and fever were the most commonly observed events. Adverse events that occurred on more than one occasion included: target tumor site reactions, changes in general signs and symptoms, blood and lymphatic system abnormalities, claudication, hypertension, lymphadenopathy, diarrhea, and new masses. The majority (approximately 95%) of the data indicated mild to moderate intensity (grades I to II).

Severe Adverse Events

Severe adverse events (grade III or more) were noted in 5 cases (Table 16). Individual 04-R05 experienced a grade III increase in neutrophils. Individual 10-R01 experienced anemia, lethargy, muscle weakness, myositis, grade III pain, and was in a supine position. Extensive metastatic disease in the absence of detection at baseline was diagnosed after autopsy of individual 10-R01 on day 60; disease progression may have influenced the adverse event data in this case. Individual 10-R02 experienced a grade III tumor abscess. Individual 11-R01 experienced a grade IV platelet count decline 93 days after the first cycle of treatment, which resolved spontaneously. Symptoms resolved 21 days after the 93-day visit without any medical treatment. Notably, this individual also had symptoms of grade I and grade II thrombocytopenia at screening and baseline, respectively. Individual 16-R03 experienced grade III diarrhea, lameness, and swelling that resolved within one week.

Table 16
Summary of adverse events greater than or equal to grade III for all treatment cycles Adverse event Type Number of dogs ^A (N=16) Incidence (%) Lameness Musculoskeletal disorders 3 18.8% Pain General signs or symptoms 2 12.5% Anemia Blood and lymphatic system 1 6.3% Decreased neutrophils Blood and lymphatic system 1 6.3% Low platelets Blood and lymphatic system 1 6.3% Diarrhea Digestive tract disorders 1 6.3% Lethargy General signs or symptoms 1 6.3% Panniculitis General signs or symptoms 1 6.3% Myositis Musculoskeletal disorders 1 6.3% Tumor abscess Target tumor node response 1 6.3% Tumor inflammation Target tumor node response 1 6.3% ^a Number of dogs with at least one adverse event of any grade.

Two dogs, new masses were documented during the study. A rectal mass was identified in individual 04-R04 on day 82 and a stage T1 lytic spinal lesion in individual 10-R01 on day 9. These findings may reflect the presence of metastasis or a second separate pathology. In both cases, the relationship to C. novyi-NT therapy was unclear.

Response to treatment C. novyi-NT

In summary, treatment of companion dogs with C. novyi-NT at a dose of 1x10 ⁸ spores per treatment cycle for up to 4 cycles is well tolerated. Most adverse events possibly or probably related to the drug that were greater than grade III resolved within one week. Expected adverse events were largely related to local inflammatory changes after intratumoral therapy and usually resolved within one week. Adverse events and severe adverse events were monitored and effectively managed as described herein.

Given that C. novyi-NT administration was accompanied by broad evidence of biological activity, a preliminary assessment of primary tumor response using RECIST 1.1 was performed and is summarized in Table 17 below.

Table 17
Summary of clinical signs of C. novyi-NT germination and response to C. novyi-NT therapy Case ID Clinical sign of germination ^A Clinical response ^b Tumor inflammation, skin disorder and disorder Tumor inflammation and pain Tumor inflammation and abscess Inflammation of the tumor, change in consistency, discharge and pain in the tumor Tumor inflammation and pain Inflammation of the tumor, change in consistency, skin breakdown and pain Tumor inflammation, abscess and discharge Tumor abscess and discharge - Tumor inflammation, abscess and pain Tumor inflammation and abscess Tumor inflammation Tumor abscess and change in consistency Tumor inflammation Tumor inflammation and abscess -

The dogs were assessed for best response on day 21 or after 21 days of the study. Three had a complete response (CR) to therapy, three had partial responses (PR), five had stable disease (SD), three had progressive disease (PD), and two dogs (04-R04 and 04-R08 ) response was not assessed due to the fact that the tumor injected was surgically removed before 21 days. The objective response rate to biosurgery was 37.5% (6 of 16 dogs, 95% confidence interval: 15.2–64.6%). Tumor abscesses and responses occurred after one to four cycles of biosurgery. Dog 11-R01 experienced PRs after a single cycle, 04-R03 had CRs after three cycles, dogs 04-R02 and 04-R05 had PRs after four cycles, while 04-R01 and 04-R06 had CRs after four cycles. Figures 7A-F and Figures 8A-F show representative changes in dogs with partial (11-R01) and complete (04-R03) responses, respectively. Resolution of abscesses occurred with debridement, and wound healing was complete in 2 to 4 weeks. However, obvious abscess formation before objective response was not always observed. Dogs 04-R01 and 04-R06 received 4 cycles of biosurgery with tumor inflammation but no abscess formation when observed until day 21 of the study visit. However, complete responses were observed in these two dogs at day 42 (unscheduled visit) and day 60 study visits, respectively.

More details about individual dogs are discussed below:

Andy (11-R01, Figures 7A-F), a 10-year-old neutered male Maltese, had a grade II soft tissue sarcoma on his left ear. His medical history included surgery prior to inclusion. He received a single dose of C. novyi-NT spores on June 18, 2012. Andy experienced grade I swelling for 1 day (June 19, 2012). The formation of an abscess led to ulceration of the tumor and the release of purulent, necrotic material. As a result, the wound healed without complications. During the extended follow-up period, grade IV thrombocytopenia was observed on day 93 (September 19, 2012), which resolved by the routine follow-up visit several weeks later. A thickened area of skin of approximately 8 mm remained after the wound healed (see Figure 9, demonstrating the time course of tumor measurements during the study cycle). This may have represented scar tissue or residual tumor.

Molly (11-R02), a 12-year-old spayed female Labrador retriever, had a grade II soft tissue sarcoma on her left hind knee. She had no medical history prior to inclusion. She received 3 IT cycles of C. novyi-NT spores followed by 1 i.v. dose of 1×10 ⁸ spores of C. novyi-NT 7 days after the 3rd IT dose. She received the 1st, 2nd, and 3rd IT doses on July 11, 2012, July 18, 2012, and July 25, 2012, respectively. Single i.v. the dose of C. novyi-NT spores was given on August 1, 2012 due to the lack of detection of biological activity of previous IT doses. The only adverse event noted was grade 1 hypertension after the 3rd IT dose. Hypertension was transient and self-limiting, resolving within 1 hour. Molly's tumor was surgically removed on day 30 (August 10, 2012) for histological analysis. The tumor was confirmed to be a soft tissue sarcoma with areas of necrosis and inflammation. Bacteria were not present on Gram stain, confirming the lack of biological activity in this case.

Ricky (10-R01), a 13-year-old neutered male Golden Retriever, had oral melanoma. His medical history included surgery prior to inclusion. He received 2 IT courses of C. novyi-NT spores. IT administration of C. novyi-NT was carried out during treatment on August 2, 2012 and August 9, 2012. On day 9 (August 11, 2012), Ricky suddenly began to develop pain in the cervical spine 2 days after the 2nd treatment cycle and neurological deficits of the hind leg. Grade III anemia was also noted. An MRI was performed and revealed probable cervical panniculitis and cervical spinal cord compression. Corticosteroids and gastrointestinal protective agents were administered and Ricky recovered within 3 days. There were no changes in oral melanoma and no additional treatment was given for C. novyi-NT. On day 21 (August 23, 2012), an MRI was performed and showed improvement in the previously described panniculitis; however, chest CT showed metastatic pulmonary nodules. Surgical removal of oral melanoma was performed. Treatment with the human melanoma tyrosinase vaccine was initiated on August 30, 2012. On day 42 (September 13, 2012), Ricky began experiencing recurrent cervical and forelimb pain (2 weeks after stopping corticosteroids) and 2 weeks after receiving melanoma vaccines. Medical intervention with pain relief failed to improve after 4 days, so corticosteroids were restarted. On day 46, grade III anemia and increased BUN were noted. Suspected gastrointestinal bleeding was treated with gastrointestinal protective agents. On day 60, Ricky developed collapse and hematemesis. Humane euthanasia was carried out. Autopsy revealed disseminated metastatic melanoma, including the submandibular lymph node, mediastinal lymph node, mesenteric lymph node, kidney, and perispinal adipose tissue in the cervical spine. No evidence of stomach or intestinal ulcers was found. The suspected cause of two episodes of spinal pain is metastatic melanoma. The relationship to C. novyi-NT remains uncertain.

Finnegan (04-R02), an 11-year-old intact male golden retriever, had a soft tissue sarcoma (hemangiopericytoma) on his right lateral metacarpus. His medical history included surgery prior to inclusion. He received 4 IT cycles of C. novyi-NT spores. Adverse events were moderate and well tolerated. Complete destruction of the tumor occurred after 4 cycles of treatment, leaving a margin of normal tissue around the circumference of the tumor site. Finnegan received cycles 1, 2, 3, and 4 of treatment on August 3, 2012, August 10, 2012, August 17, 2012, and August 24, 2012, respectively. Administration of C. novyi-NT was associated with only grade 1 adverse events after cycles 1, 2, and 3. Grade I and II adverse events were observed 48 hours after the 4th dose. Tumor infection was noted and consisted of fever, leukocytosis, neutrophilia, and tumor-associated pain and abscess formation. The infection progressed to abscess formation and destruction of the entire tumor with minimal debridement, occurring 96 hours after the 4th dose. Tumor measurements at this visit were recorded in the morning before complete removal of the entire tumor mass later that day. Limb amputation was performed instead of open wound treatment on day 25 (August 28, 2012) and antibiotics were given. Finnegan recovered from surgery without side effects and remained tumor-free for 94 days (November 05, 2012) after his first cycle of treatment.

Drake (04-R01, Figure 10A), a 7-year-old spayed male Golden Retriever, had a soft tissue sarcoma (fibrosarcoma) in the mid-maxillary area on the right side. He had no medical history prior to inclusion. He received 4 IT cycles of dispute with novyi-NT. Adverse events were moderate and well tolerated. Complete tumor destruction occurred after 4 cycles, leaving a margin of normal tissue around the tumor site. Drake received cycles 1, 2, 3, and 4 of treatment on August 13, 2012, August 20, 2012, August 27, 2012, and September 4, 2012, respectively. The intervals between the 1st, 2nd and 3rd doses were 7 days; while the interval between the 3rd and 4th doses was 8 days to observe the national holiday. Administration of C. novyi-NT was associated with moderate adverse events, including grade I lethargy and anorexia, and grade II vomiting and bloody stools noted 24 to 48 hours after cycle 1. These AEs were successfully treated with an antiemetic and antibiotic. AEs were observed within 24 hours after the 4th dose, including tumor pain and swelling grade I. There was no further evidence of tumor infection and abscess formation. Killing of tumor mass was evident at day 60 (October 12, 2012), and tumor was not measurable (see Figure 10B for tumor measurements over time throughout the study). The area was firm and remained slightly swollen, and a CT scan was performed. Drake remained tumor-free at day 86 (November 7, 2012) after the 1st dose.

Baxter (04-R03, Figure 8A-F), a 9-year-old, neutered male Boxer, had a grade II soft tissue sarcoma on his left medial forearm. He had no medical history prior to inclusion. He obtained three IT cycles of C. novyi-NT spores. Adverse events were moderate and well tolerated. Complete destruction of the tumor occurred after three injections, leaving a margin of normal tissue around the tumor site. Baxter received his 1st, 2nd, and 3rd doses of C. novyi-NT spores on August 17, 2012, August 24, 2012, and August 31, 2012, respectively. Administration of C. novyi-NT was well tolerated, with no study agent-related toxicity reported after the 1st or 2nd dose. Study-related adverse events occurred 24 hours after the 3rd dose. These adverse events were related to tumor infection and consisted of fever, anorexia, lethargy, and tumor-related pain, swelling, and bleeding. Adverse events were moderate (grade II or lower) and were managed with supportive care and analgesics. Tumor infection associated with C. novyi-NT progressed to involve the entire tumor and abscess formation. Surgical debridement of the tumor on September 2, 2012 resulted in rapid resolution of AEs. Wound healing was uneventful and completed by October 16, 2012. Baxter remains tumor-free at day 94 (November 19, 2012) after his first treatment cycle (see Figure 11 for tumor measurements over time throughout the study) .

Harley (26-R01), a 7-year-old neutered male Labrador Retriever, had a grade II soft tissue sarcoma (hemangiopericytoma) on his right paw. He had no medical history prior to inclusion. He received 4 IT cycles of C. novyi-NT spores. The 1st, 2nd, 3rd, and 4th doses were administered on August 20, 2012, August 27, 2012, September 4, 2012, and September 10, 2012. The interval between doses was 6–8 days. An increase in temperature relative to basal was noted during the 1st and 2nd doses. IT treatment with C. novyi-NT spores was well tolerated with no adverse events reported. There was no response to treatment.

Ursula (04-R-04), an 11-year-old, spayed female St. Bernard mix, had chondroblastic osteosarcoma of the right forelimb. Her medical history included surgery prior to inclusion. She received one IT dose of C. novyi-NT spores. No metastatic disease was observed at the time of inclusion. After the first treatment cycle on August 31, 2012, tumor abscess formation and inflammation around the tumor were observed within the first 24 hours and was treated therapeutically with analgesia, warm compresses, and intravenous crystalloids. After no improvement, the tumor/abscess was opened on day 2 (September 2, 2012). Serosanguineous fluid was moderately present. C. novyi was isolated in anaerobic culture. Antibiotics were administered starting on day 4 (September 4, 2012). The excision site was treated as an open wound until day 20 (September 20, 2012), at which time amputation was performed due to disease progression. Histopathology showed severe necrosis and hemorrhage along with persistent chondroblastic osteosarcoma. After amputation, infection at the excision site was noted. Cultivation did not reveal C. novyi. No adjuvant therapy was given after amputation. At day 81 (November 21, 2012), Ursula had rectal prolapse and was determined to have rectal polyps. Chest X-rays performed during this evaluation showed the presence of pulmonary metastases.

Gabriel (16-R02), a 9-year-old neutered male Labrador Retriever, had a grade I soft tissue sarcoma on his left lateral thigh. His medical history included surgery prior to inclusion. He received 4 IT cycles of C. novyi-NT spores. IT administration of C. novyi-NT spores was generally well tolerated, with a 1 week delay between the 1st and 2nd doses due to grade II diarrhea in response to medical intervention. Gabriel received his 1st, 2nd, 3rd, and 4th doses on September 12, 2012, September 26, 2012, October 3, 2012, and October 10, 2012, respectively. Toxicity was moderate and consisted primarily of diarrhea and constitutional symptoms. Grade II diarrhea occurred after each dose and responded well to medical intervention. After the 1st dose, there was a 1-week dosing delay, resulting in a 14-day interval between the 1st and 2nd doses. Dose delays due to grade II diarrhea were not implemented with subsequent doses. In addition, grade II tumor swelling was observed on day 4 (September 16, 2012). Tumor size remained stable from D0 (September 12, 2012) to D63 (November 14, 2012), the date of the most recent study visit.

Buddy (04-R05), a 13-year-old neutered male Sheltie, had a soft tissue sarcoma (rhabdomyosarcoma) on his right forearm. His medical history included surgery, chemotherapy, and a previous clinical trial of C. novyi-NT before enrollment. No metastatic disease was observed at the time of study entry. He received 4 IT cycles of C. novyi-NT spores. Clinically significant adverse events coinciding with the administration of C. novyi-NT were grade III neutropenia and fever after the 3rd cycle of therapy. This event resolved within 48 hours of medical intervention with intravenous antibiotics and fluid resuscitation. Buddy received courses 1, 2, 3, and 4 on September 20, 2012, September 27, 2012, October 5, 2012, and October 12, 2012. Mild tumor inflammation (erythema, heat, swelling) was noted to be associated with 2 of the 4 cycles. A temporary decrease in tumor size was noted on day 4 (September 24, 2012). A new nontarget node was noted adjacent to the primary tumor site on day 21 (October 12, 2012). The primary tumor was stable at 61 days.

Ambra (16-R03), a 10-year-old spayed female shepherd dog, had a grade I soft tissue sarcoma on the palmar and dorsal surfaces of her left paw. Her medical history included surgery prior to inclusion. She received 4 IT cycles of C. novyi-NT spores. The 1st, 2nd, 3rd, and 4th doses were administered on September 26, 2012, October 3, 2012, October 15, 2012, and October 24, 2012. The interval between doses was 7–12 days. Ambra experienced grade II tumor swelling and pain after the 1st and 2nd doses. I degree loss of appetite was noted on the 2nd day (September 28, 2012). On day 8 (October 4, 2012, 1 day after the 2nd dose), grade I fever, grade II fever, and grade III lameness were noted. Her tumor was opened and she was given analgesics. Grade III diarrhea occurred on Day 11 (October 7, 2012) and was treated with medical intervention. Due to tumor-related adverse events and diarrhea, the 3rd dose was delayed until day 19 (October 15, 2012). Grade II tumor swelling was observed again on day 19, after the 3rd dose of C. novyi-NT, and was treated with analgesics. No adverse events were noted after the 4th dose.

Sextus (11-R04), a 9-year-old neutered male husky, had a grade I soft tissue sarcoma on his right paw. He had no medical history prior to enrollment. He received 4 IT cycles of C. novyi-NT spores. Sextus received the 1st, 2nd, 3rd, and 4th doses on October 1, 2012, October 8, 2012, October 15, 2012, and October 22, 2012, respectively. Administration of C. novyi-NT spores was well tolerated with only moderate adverse events observed. After the 1st dose, grade I hypertension and fever were noted. Fever and hypertension were self-limiting and resolved within 1 and 2 hours after dosing, respectively. On day 4 (October 5, 2012), the tumor was subjectively softer and there was a small area of ulceration (grade I) at the previous biopsy site. Ulceration continued until day 31 (November 1, 2012), the most recent current study visit. This ulceration may be due to either the study agent or a complication of the biopsy required for study inclusion.

Bella (04-R06), an 11-year-old, spayed female Labrador Retriever, had a mast cell tumor (initially identified on aspiration as a soft tissue sarcoma) on the 3rd toe of her right hind leg with metastases to the popliteal lymph node. She had no medical history prior to inclusion. She received 4 IT cycles of C. novyi-NT spores. Adverse events were moderate and limited to grade I fever and grade I tumor inflammation. Bella received treatment cycles 1, 2, 3, and 4 on October 19, 2012, October 26, 2012, November 2, 2012, and November 9, 2012. Grade 1 fever coincided with treatment C. novyi-NT and tumor inflammation. Fever and inflammation resolved spontaneously without the need for medical intervention other than the protocol requiring subcutaneous fluids during study visits. Tumor ulceration was noted on day 21 (November 9, 2012). Photographs of the tumor sent to the researcher by the dog's owner showed resolution of the ulcers and significant regression of the tumor mass. An unscheduled visit was performed on day 46 (December 4, 2012) to capture and evaluate tumor response. Complete regression of the tumor was noted.

Frida (11-R01), a 7-year-old spayed female German Shepherd mix, had a soft tissue sarcoma (hemangiopericytoma) on her right hind leg with possible lymph node metastases (CT scan). Her medical history included surgery prior to inclusion. Her owner traveled with her from Mexico to participate in this clinical trial. She received 3 IT cycles of S. novyi-NT spores. Adverse events were limited to the waxing and waning of fever over 48 hours, which resolved with intravenous fluids and NSAIDs. Frida received cycles 1, 2, and 3 of treatment on November 6, 2012, November 14, 2012, and November 21, 2012. The only significant adverse events included grade 1 fever requiring hospitalization and fluids starting at 4 days (November 10, 2012), and fever progressing to grade II on day 5 (November 11, 2012). Fever resolved after 48 hours. Grade I fever was also observed after the 3rd cycle of treatment on day 18 (November 24, 2012). Tumor progression made amputation necessary on day 21 (November 27, 2012).

Miya (01-R02), a 7-year-old neutered male border collie, had a soft tissue sarcoma (peripheral nerve sheath tumor) on the left side of his chest. He had no medical history prior to enrollment. He received 3 IT cycles of C. novyi-NT spores. Adverse events were moderate and well tolerated. Tumor inflammation, fever, and serous-hemorrhagic to mucopurulent discharge are likely due to C. novyi-NT activity. The 4th spore cycle of C. novyi-NT is planned. Miya received the 1st, 2nd and 3rd doses on November 12, 2012, November 20, 2012, and November 27, 2012, respectively. The interval between the 1st and 2nd doses was 8 days; while the interval between the 2nd and 3rd doses was 7 days. Administration of C. novyi-NT was associated with moderate grade I–II toxicity. Nausea and belching of the 1st degree were noted after the 1st dose, loss of appetite and lethargy of the 1st degree were noted after the 3rd dose. Toxicity soon resolved with medical intervention. The greatest grade 1 or grade 2 toxicity was localized to the tumor site (heat, inflammation, pruritus, serosanguineous to mucopurulent discharge, and erythema) and occurred within 2 days of C. novyi-NT administration. In addition, grade I - II ventral edema was observed 2 days after the 1st and 3rd doses.

Tank (10-R02), a 10-year-old, neutered mixed breed male, had a soft tissue sarcoma (hemangiopericytoma) on his right flank. His medical history included surgery prior to inclusion. He received 1 IT cycle of C. novyi-NT spores on November 12, 2012. Grade I fever, decreased appetite, grade II swelling around the tumor, and grade III tumor abscess were noted on day 4 (November 16, 2012) after treatment. Medical intervention including pain medications, i.v. fluids and broad-spectrum antibiotics have been used to manage the abscess. Tumor inflammation and surrounding swelling resolved on day 11 (November 23, 2012). Tank received his 2nd cycle of treatment on December 3, 2012. The interval between cycles was 21 days. The 2nd dose was delayed due to the antibiotic washout period.

Tumor measurements in eight dogs over time are shown in Figure 12A. Figure 12B shows three time curves that were shortened due to amputation or missing data.

Overall, C. novyi-NT administered by IT injection at a dose of 1 x 10 ⁸ spores per cycle for up to 4 treatment cycles exhibited significant biological and antitumor activity and was considered to be well tolerated in companion dogs with spontaneously occurring solid tumors. Tumor responses are rapid with significant tumor necrosis and marked disease regression occurring within a few days of C. novyi-NT administration. Most adverse events are limited to grade 1 and grade 2 and are consistent with the mechanism of tumor inflammatory responses expected with C. novyi-NT treatment. Several cases are currently under long-term follow-up to assess progression and survival.

Example 8

Intratumoral (IT) administration of C. novyi-NT. - Study 2 - methods

A study was conducted to characterize the dose and volume of C. novyi-NT administered by IT injection for the treatment of dogs with solid tumors (excluding osteosarcoma or mast cell tumor).

Dogs with solid tumors (excluding osteosarcoma or mast cell tumor) of any weight, breed, sex, or age were screened for inclusion. Inclusion criteria were similar to those presented in Example 6 except that each dog had a cytological or histological diagnosis of any type of cancer other than osteosarcoma or mast cell tumor and that each dog had at least 1 measurable tumor nodule with the largest diameter ≥1 cm.

At the initial screening visit, each dog was assigned a unique Dog Study Identification Number, consisting of a 5-digit numeric code (which may not be the same as the dog screening number sequence). The first 2 digits indicated the study site (01 to 99), the middle digit indicated study "5", and the last 2 digits described the study number of the dog at the study site (01 to 99). For example, the 11th dog admitted to Study Site 9 was assigned study dog number 09-511. Dog study numbers were assigned in the chronological order in which dogs were included at a given study site. A dog was considered for inclusion in the study when it met the inclusion and exclusion criteria.

Gross pathological, histopathological examination and autopsy were performed as described in example 6.

C. novyi-NT spores were prepared as above before delivery at a concentration of 1×10 ⁸ spores/ml and suspended in sterile saline in 2 ml cryovials. Each treatment cycle for C. novyi consisted of up to 5 injections of 1 mL spore suspension (1 x 10 ⁸ spores) for each injection at one site of the target node. A spore suspension containing 1×10 ⁸ spores was packaged in separate cryovials for each 1 ml injection, and the vial, syringe and needle were discarded after each injection.

The injection pattern is shown in Figure 13. Five 1 ml injection sites (represented by squares) were distributed throughout the tumor: the center and four (4) evenly spaced injection sites within the tumor. The site for each 1 ml injection additionally included 5 redirection sites (as represented by circles in Figure 13). Each redirection site received 200 μl of spore suspension. The needle was first directed to the center of the injection site and then evenly redirected to the four corners of the injection site without removing the needle. After completion of the first 1 ml injection, the needle was removed and the syringe was discarded. The depth of each injection must be properly determined so that the best distribution is achieved. The recommended syringe size was 1 ml for each injection, the recommended needle was between 22 gauge and 25 gauge. An adequate needle length should be selected based on the depth of the tumor node.

All dogs were hospitalized from D0 to D2 and then at the investigator's discretion for 24 to 48 hours after each subsequent treatment for clinical observation. Fluids were administered to all dogs included in the study during hospitalization following C. novyi-NT treatment. On the days of dosing, all dogs received i.v. administered crystalloids 4 ml/Hg/hour for 2 hours after C. novyi-NT treatment.

Study visits and events are summarized in Table 18 using an 8-cycle treatment regimen as an example. The dosing interval was assumed to be once per week if the goal was to treat the dog with multiple cycles of therapy.

Table 18
Summary of research visits and events Observation Cycle 1* Cycle
D70±7 days D90±7 days From D-14 to D0 D0 D__ Informed consent X Personal Information X Mass and Vitality X X X X X Physical examination X X X X X Laboratory samples X X (X) (X) X Research blood samples X X X X X Research tumor sample X Diagnostic Imaging X X*** Activity indicator X Inclusion/exclusion X Inclusion X Tumor measurement X X X X X C. novyi-NT* X* X Crystalloids** X** X** Completion of the study X *Owners will bring their dog to the clinic D0 to D2 and crystalloids will be administered IV. to all dogs in the clinic. In subsequent cycles, investigators will complete D according to the number of days in the study compared to D0.
**Dogs will be administered i.v. crystalloids.
***Chest X-ray only.
Dogs may not receive 8 cycles. In this study, the decision to proceed with the next dosing cycle must be made on an individual basis through consultation between the medical director, the investigator, and the sponsor.
After completion of the study, and if systemic antibiotics were required to manage adverse events, it is recommended that dogs be administered doxycycline 5-10 mg/kg postoperatively twice daily for 3 months.

Example 9

Intratumoral (IT) administration of C. novyi-NT. - Study 2 - interim results

As of December 2, 2012, two companion dogs were being treated in the study. Both animals received a dose level of 5 x 10 ⁸ spores injected into 5 unique IT injection sites per treatment cycle.

The first dog, Buddy (04-503), a 9-year-old, neutered male Belgian Malinois, had a soft tissue sarcoma in the left carpus with an initially measured LD of 69 mm (4.4 x 3.3 x 0.7 cm as determined by CT). His medical history included surgery prior to inclusion. He received 2 IT cycles of C. novyi-NT spores. Adverse events were moderate and limited to grade I fever and grade I tumor inflammation. Buddy received cycles 1 and 2 of treatment on November 21, 2012 and November 28, 2012. Grade 1 fever and tumor redness, swelling, and increased pain were noted within 6 hours of the first injection. Fever resolved within 6 hours after treatment with the NSAID carprofen. Moderate ulceration of the tumor was observed on day 2 (November 23, 2012) after treatment. On day 7 (November 28, 2012), there was a slight decrease in the size of the tumor mass (-12.0%). Each treatment cycle was well tolerated with no adverse events above grade 1.

The second dog, Guinness (04-502), a 9-year-old, neutered male Wheaton Terrier, had squamous cell carcinoma on the left shoulder with an initially measured LD of 122 mm (9.1 x 9.3 x 14.5 cm on CT) , low-grade hemangiosarcoma on the hind leg and proven pulmonary metastases (based on CT). His medical history included surgery prior to inclusion. Pre-existing mitral valve disease was demonstrated based on echocardiography performed prior to inclusion. He received one IT dose of C. novyi-NT spores on November 28, 2012. Grade III fever occurred within 6 hours of treatment and was treated with IV. liquids. On day 1 (November 29, 2012), tumor mass abscess, purulent discharge, and neutrophilia were assessed. Continued administration of i.v. fluids and started on pain medications (including NSAIDs). On day 2 (November 30, 2012), progressive swelling of the tumor and signs of sepsis (fever, neutropenia, hypoglycemia, hypoalbuminemia) prompted opening and irrigation of the tumor. Broad-spectrum antibiotics, hydroxyethyl starch and human albumin were administered. On day 3 (December 1, 2012), there was a progressive decline in status as a result of respiratory failure. The euthanasing solution was administered. An autopsy was performed. Macroscopic clinically significant findings included autonomic endocarditis, pulmonary suppurative nodules and subcutaneous hemorrhages, and whole body edema. Post-mortem aerobic cultures of various tissues and organs (lungs, liver, heart, kidneys, spleen, gastrointestinal tract, stomach) revealed polymicrobial growth of bacteria (Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Streptococcus strains); Anaerobic cultures of all organs and tissues were negative for the growth of C. novyi-NT with the exception of tumor tissue and the bladder. The histopathology of the affected tissues is reviewed. Septic toxic shock is considered the most likely cause of death, and the relationship to treatment for C. novyi-NT is unclear at this time.

Example 10

Intratumoral (IT) administration of C. novyi-NT to humans – methods

Phase I clinical trial of IT administration of C. novyi-NT spores to humans

A Phase I, open-label, non-randomized, multicenter safety study of a single IT administration of C. novyi-NT spores is currently ongoing in patients with treatment-resistant solid tumors. The clinical study protocol was reviewed and approved by the institutional review board (IRB) at each participating institution, and all regulatory steps were performed in accordance with Food and Drug Administration (FDA) guidelines (number NCT01924689). All patients were required to sign a written informed consent form (ICF) before inclusion in the study.

The primary objectives of this phase I study were to determine the safety profile of dose-limiting toxicity (DLT) and maximum tolerated dose (MTD) administered by IT C. novyi-NT. In addition, the antitumor activity of the therapeutic agent was studied.

Production and IT administration of C. novyi-NT spores in phase I trial

Clinically supplied C. novyi-NT spores were packaged in single-use 2 mL sterile and pyrogen-free borosilicate glass rubber stopper and aluminum lined rubber stopper vials with a physically secured cap at a concentration of 8.52 x 10 ⁸ spores/mL suspended in sterile phosphate buffered saline. saline solution (PBS) in full 1.0 ml. The vials were stored at 2-8°C in a controlled ambient temperature with constant temperature monitoring. The GMP product was obtained and formulated by Omnia biologics, Inc. (Rockville, MD).

After the patient was enrolled in the trial, one vial was delivered to the study site. Further acquisition of C. novyi-NT was necessary and occurred on the same day as IT administration. Dilution of the concentrated spore suspension was performed in a designated biosafety room using sterile saline (0.9%) infusion bags of a size appropriate to achieve the required dose based on the allocated cohort. The injection volume (3 ml) was then aspirated from the saline bag and injected using radiographic guidance. C. novyi-NT spores were injected with an 18-gauge multi-pronged Quadra-Fuse® needle, Rex-Medical, Conshohocken, PA).

Design and conduct of a human clinical trial

The study was conducted using a standard 3+3 dose escalation design. Patients should be diagnosed with an advanced malignant solid tumor with a target tumor node that is measurable, palpable, or clearly identifiable by ultrasound or radiography and amenable to percutaneous injection of C. novyi-NT spores. The target node must have a greatest diameter of ≥1 cm and be measurable as defined by RECIST 1.1 criteria. Key inclusion criteria included history of refractory malignancy; age at least 18 years; performance status ≤2 according to Eastern Cooperative Oncology Group (ECOG) parameters; ability to tolerate 45 minutes of ambulance travel and presence of a caregiver for 28 days after IT injection. The main exclusion criteria were pregnancy; primary malignant brain tumor or brain metastases; clinically significant ascites or clinically proven portosystemic hypertension or cirrhosis, or a history of their presence; Glasgow Coma Scale (GCS) <15; serum creatinine level > 1.5 times the upper limit of normal (ULN), chronic renal failure requiring hemodialysis or peritoneal dialysis; oxygen saturation (SPCO ₂ ) <95% (at room air); mean arterial blood pressure (BP) <70 mm Hg. Art.; platelet count ≤100,000/mm ³ ; hemoglobin <9.0 g/dl; absolute neutrophil count (ANC) <1000/mm ³ ; clinically significant exudative pleurisy, pericardial effusion, circular pericardial effusion, or any effusion greater than 1.0 cm anywhere around the heart; the need for treatment with an immunosuppressive agent; history of solid organ transplantation; systemic or local infection.

Eligible patients were accepted and included in the dosing cohorts. According to the protocol, patients remained hospitalized after spore administration and were observed for 8 days, and patients returned to the clinical trial site for scheduled follow-up visits over a 12-month period during which time-dependent safety and efficacy assessments were performed.

Clinical response and progression were assessed using RECIST version 1.1. Objective responses were measured using serial CT or MRI scans of the injected tumor as well as distant metastases (up to 5 target nodes). Safety monitoring for infectious complications or other treatment-related adverse events was performed continuously for 12 months.

Example 11

Intratumoral (IT) administration of C. novyi-NT to humans - Results

C. novyi-NT causes rapid local tumor destruction in the first sick person

Promising results and favorable risk/benefit profiles of biosurgery in a comparative study in dogs, combined with results obtained in rats, provided the basis for attempting biosurgery in humans. Accordingly, a phase I investigational trial was initiated in human patients with solid tumors that were either refractory to standard therapy or not available to standard therapy (NCT01924689). The first patient enrolled in this trial is described herein: a 53-year-old woman diagnosed with retroperitoneal leiomyosarcoma in August 2006. The patient underwent multiple surgical resections and received multiple courses of chemotherapy and radiation therapy, including right radical nephrectomy and radiation therapy in March 2007, chemotherapy with gemcitabine, taxol, adriamycin and ifosfamide, resection of liver metastases in November 2008, multiple wedge resections of right-sided pulmonary metastases in December 2009, treatment with trabectedin from March 2010 to April 2011, multiple wedge resections of left-sided pulmonary metastases in December 2010, treatment with pazopanib in April 2011, left lower lobectomy in October 2011, Abraxane HAI, gemcitabine and Avastin from February 2012 to January 2013, everolimus and pazopanib with February 2013 to July 2013 and mild arterial hepatic embolization in August 2013 and September 2013. However, the patient experienced progression with metastatic disease present in her liver, lungs, peritoneum and soft tissue of the right shoulder and adjacent right humerus.

Biosurgery was performed with a planned initial dose of 1 x 10 ⁴ C. novyi-NT spores injected into her metastatic right shoulder tumor with an 18-gauge multi-pronged needle (Day 0, November 19, 2013).

Intratumoral injection using a tridental needle under CT guidance

The patient was moderately sedated with fentanyl and studied for 35 minutes. An 18 gauge Quadra-Fuse device (Rex-Medical) (Figure 16A) was used for CT-guided injection by inserting a 3-prong needle (27g) into the injection target area (Figures 16B and 16C). Three prongs (each with 2 through holes for 4 fluid outlets) (Figure 16D) were deployed at 4, 3 and 2 cm at each location (Figure 16E), a 1 ml aliquot of C. novyi-NT spore solution was injected over a stepwise retraction process. The device was removed after complete retraction of the deployed teeth into the needle cannula, and manual compression was used to achieve hemostasis.

On day 1, the patient experienced moderate pain in the right shoulder extending to the scapula, which responded to tramadol and acetaminophen. On day 2 her pain required IV. After administering the controlled analgesic hydromorphone to the patient, her white blood cell count increased to 18,300 per microliter and she developed a fever with a maximum temperature of 39.2°C. On day 3, the pain in the patient's right shoulder and scapula was difficult to control. Her maximum temperature was 37.8°C. A CT scan of the right upper extremity showed significant destruction of the tumor with gas in the soft tissue and with a bone component of the tumor (Figure 14A). Necrosis of her humerus was discussed. CT-guided aspiration of her tumor showed growth of C. novyi-NT under anaerobic culture conditions. The patient was then started on antibiotics and the fever subsided shortly thereafter. On day 4, MRI of the right upper extremity demonstrated a marked decrease in the elevation limited by the tumor mass compared to baseline (Figures 14B and 14C). A tumor biopsy showed many gram-positive bacteria and no viable tumor cells. During the biopsy, a percutaneous drain was placed into the tumor abscess to drain fluid and destroyed cells. The patient remained without fever, and her white blood cell count gradually returned to normal. She continued to be given antibiotics and remained in the hospital for IV. administration of analgesics until day 20, when she switched to oral analgesics. She was discharged with oral metronidazole and doxycycline as per protocol. On day 29, follow-up MRI demonstrated continued reduction in tumor elevation (Figure 14D). On day 55, the patient had localized pain as a result of the patient's effort causing a pathological fracture of the right proximal humerus. Subsequent partial humeral resection, debridement, and internal fixation with an osteosynthesis pin and cement spacer resulted in significant improvement in pain and range of motion. Intraoperative cultures showed growth of C. novyi-NT under anaerobic culture conditions. Histopathology demonstrated intense tumor necrosis with small foci of residual tumor cells (Figures 15A-D). The patient remains under observation and has an Eastern Cooperative Oncology Group (ECOG) activity status of 1 with no clinical signs of infection.

Documentation

All documents cited in this application are incorporated herein by reference as if set forth herein in their entirety.

Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to what is described and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the invention.

Claims (28)

1. A method of cytoreduction or destruction of a solid tumor present in a human, comprising administering to the human tumor one to four cycles of dose units of C. novyi NT spores comprising approximately 1×10 ³ -1×10 ⁵ spores per cycle, each dose unit C. novyi NT is suspended in a pharmaceutically acceptable carrier or solution, and C. novyi NT is effective in cytoreducing or killing a solid tumor without the administration of additional anticancer agents. 2. The method of claim 1, wherein the solid tumor is selected from the group consisting of soft tissue sarcoma, hepatocellular carcinoma, breast cancer, pancreatic cancer and melanoma. 3. The method according to claim 1, wherein the solid tumor is a leiomyosarcoma. 4. The method according to claim 3, where the solid tumor is a retroperitoneal leiomyosarcoma. 5. The method of claim 1, wherein the dose unit comprises approximately 1×10 ⁵ C. novyi spores. 6. The method of claim 1, wherein the dose unit comprises approximately 1×10 ⁴ C. novyi spores. 7. The method according to claim 1, where the spores of C. novyi are selected from the group consisting of a vegetative form and a spore form. 8. The method according to claim 1, where the administration step includes injection of a dose unit into one localization site in the tumor. 9. The method of claim 1, wherein the step of administration comprises injecting a dose unit into multiple unique tumor sites. 10. The method of claim 1, wherein the administration step comprises injecting a dose unit into 1-5 unique locations within the tumor. 11. The method of claim 1, wherein the administration step comprises injecting a dose unit into 5 or more unique tumor sites. 12. The method of claim 1, wherein the interval between each treatment cycle is approximately 5-100 days. 13. The method of claim 1, wherein the interval between each treatment cycle is approximately 7 days. 14. The method according to claim 1, further comprising intravenous administration of fluids to a person before, during and/or after each administration of C. novyi NT spores. 15. The method of claim 1, further comprising providing the person with a first course of antibiotics for a period of time and at a dosage that is effective to treat or alleviate the adverse side effect caused by C. novyi. 16. The method according to claim 15, where antibiotics are administered within two weeks after the introduction of C. novyi. 17. The method according to claim 15, where the antibiotics are selected from the group consisting of amoxicillin, clavulanate, metronidazole and combinations thereof. 18. The method of claim 15, further comprising providing the person with a second course of antibiotics for a period of time and at a dosage that is effective to treat or alleviate the adverse side effect caused by C. novyi. 19. The method according to claim 18, where the second course of antibiotics begins after completion of the first course of antibiotics and is carried out for 1-6 months. 20. The method according to claim 18, where the second course of antibiotics begins after completion of the first course of antibiotics and is carried out for 3 months. 21. The method according to claim 18, where the antibiotic used in the second course is doxycycline. 22. The method of claim 1, further comprising receiving the person a therapy selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof. 23. The method of claim 22, wherein the immunotherapy comprises administering an immune checkpoint inhibitor to a human. 24. The method according to claim 1, wherein the solid tumor is resistant to therapy selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, and combinations thereof. 25. The method of claim 22, wherein the chemotherapy comprises administering to a human an agent selected from the group consisting of an antimetabolite, a microtubule inhibitor, a DNA damaging agent, an antibiotic, an anti-angiogenesis agent, a molecular targeting agent, and combinations thereof. 26. The method of claim 22, wherein the chemotherapy comprises administering to a person an agent selected from the group consisting of gemcitabine, Taxol, Adriamycin, ifosfamide, trabectedin, pazopanib, Abraxane, Avastin, everolimus, and combinations thereof. 27. The method according to claim 1, where the solid tumor is not amenable to standard therapy or the solid tumor is not available for standard therapy. 28. The method according to claim 1, where a powerful local inflammatory response and adaptive immune response are induced in humans.