RU2806252C1 - Method for diagnostics of classic swine fever using fluorescent in situ hybridization (fish) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention is related to a method for diagnosing classical swine fever using fluorescent in situ hybridization (FISH). The method involves the use of a nucleotide sequence in which pig organs are examined for the presence of a virus genome using a hybridization probe in the form of a nucleotide sequence CTGTGGCTAATAGTGACCTACATAGTTCTAACAGAACAACCCGCCGCTGGTTTACAGCTGGGCCAGGGTGAGGTAGTGTTAATAGGGAACTTAATTACCCACACAGACATTGAGGTTGTAGTATATTTCTTACTGCTCTATTTGGTCATGAGAGATGAGCCTATAAAGAAATG with fluorescein-12-dUTP dye detected under ultraviolet light as an emerald green glow inside susceptible cells.

EFFECT: invention is effective for detecting the genetic sequence of the classical swine fever virus in virus-susceptible cells of organs (tonsil, spleen and mesenteric lymph node) and expanding the arsenal of methods for diagnosing classical swine fever.

1 cl, 6 dwg

Description

The invention relates to the field of veterinary virology and can be used in research institutions and veterinary laboratories for the diagnosis of classical swine fever in histological sections of target organs by identifying the genetic material of the virus in infected cells using the in-situ hybridization method based on the use of fluorescein-labeled nucleotide probe.

State of the art

To diagnose CSF, a variety of laboratory methods are used, aimed at isolating the virus and detecting its antigen or nucleotide sequence. Among the studies aimed at achieving this goal, virus isolation in cell cultures, polymerase chain reaction (PCR), enzyme-linked immunosorbent assay (ELISA), fluorescent in-situ hybridization and immunohistochemical study (IGHI) are used [Stafford V.V., Alekseev K. P., Yuzhakov A.G., Gulyukin A.M., Aliper T.I.. Application of the immunohistochemical method for the diagnosis of classical swine fever. Veterinary medicine and feeding. - 2022. - N3. - pp. 61-65. DOI: 10.30917/ATT-VK-1814-9588-2022-3-16].

Foreign specialists, for in-situ hybridization in organs and tissues from pigs infected with CSF, use the protocol published in the collection of the World Organization of Animal Health (OIE) “Manual of Diagnostic Tests and Vaccines for Terrestrial Animals” (Chapter 3.9.3) [Electronic resource ]. - Access mode: https://www.oie.int/en/what-we-do/standards/codes-and-manuals/terrestrial-manual-online-access/. The technique is as follows. A nucleotide sequence consisting of 61 bp is used as a hybridization probe. (TATGATTTATTGCAAGCCCAGAGGTACGGTATAGAAGATGGGATAAATATCACCAAATCCT) tagged with cyanine (Cy3) corresponding to the region 6728-6788 of strain cF114 (AF333000) [Zhang Q, Xu L, Zhang Y, et al. A novel ViewRNA in-situ hybridization method for the detection of the dynamic distribution of Classical Swine Fever Virus RNA in PK15 cells. Virol J. 2017; 14(1):81]. To perform in-situ hybridization, foreign colleagues use paraffin histological sections from parenchymal organs of pigs, which they incubate at 60°C for 30 minutes, followed by deparaffinization in xylene (2 × 10 min) and dehydration in a series of ethanol (100%, 95%, 70 % and 50% for 5 minutes each). Sections are then washed in diethyl pyrocarbonate water (DEPC) (2×5 min), followed by DEPC with phosphate buffered saline (PBS) (pH 7.4) (2×5 min), and then washed in DEPC PBS solution containing 100 mM glycine (2×5 min), then rinse DEPC with PBS with 0.3% Triton X-100 solution (1×15 min), washed in PBS, and in DEPC (2×5 min). To increase target accessibility and probe penetration, tissue sections are treated with 200 microliters of proteinase-K solution (40 μg/ml) for 45 min at 37°C in a hybridization chamber (HYBAID, USA). The sections are then fixed in 4% buffered paraformaldehyde (pH 7.4) for 15 minutes at 4°C and washed in PBS and then in DEPC (2 x 5 min).

Pre-hybridization, hybridization and post-hybridization washing. Hybridization is carried out in a plastic container with a tight-fitting lid. Blotting paper moistened with 6x sodium chloride and sodium citrate (SSC) solution is placed at the bottom of the cup. Avoid contact of the slides with the wet bottom by using a glass rod backing. Slides held on glass rods must be level. Sections were preincubated in 200 μl of prehybridization buffer (4X SSC containing 50% deionized formamide) under siliconized coverslips at 42°C for 1 hour. The liquid is then discarded and the slides are washed in 2X SSC for 1 min. Finally, the sections are coated with 70 μl of hybridization buffer (40% deionized formamide containing 4X SSC, 1X Denhardt's reagent, 10% dextran sulfate, 10 mM DTT, 2 mg/ml denatured salmon sperm DNA and a thermodenatured biotin-labeled probe, 100 ng/μl ). Sections are covered with siliconized coverslips and sealed with rubber cement. Denaturation is carried out at 70°C on a heated platform for 5 minutes, followed by cooling on an ice platform for 3 minutes. The slides are transferred to the hybridization chamber and incubated overnight at 42°C. Post-hybridization washing steps include rinsing 2 times SSC (1×10 min), 2 times SSC (2×15 min, 37°C), 1 time SSC (2×15 min, 37°C) and ODC SSC (2 ×30 min, 42°C). Tag detection. Tissue sections are washed twice in TNT buffer (100 mM Tris-HCl, 150 mM NaCl, 0.05% Tween-20) pH 7.5 at RT and incubated with 200 μl blocking buffer (TBS containing 3% BSA and 0.1 % TritonX-100) for 1 hour at 37°C. Then the blocking buffer is decanted and the sections are incubated with fluorescently labeled streptavidin conjugate (Bangalore Genei, India) at a dilution of 1:250 for 30 minutes at 37°C. Afterwards, the sections are washed in TNT buffer (3×10 min). Slides are prepared for viewing under a fluorescence microscope by dehydration in a series of increasing concentrations of ethanol and mounted in 50% buffered glycerol gelatin. Positive signals are identified by the presence of fluorescence. [Kumaresan Nagarajan, Guttula Saikumar. Fluorescent in-situ hybridization technique for the detection and localization of classical swine fever virus in infected tissues. Veterinarski Archiv. 82(5). 2012. P. 495-504]. We took this development as a prototype.

On the territory of the Russian Federation, for the diagnosis of classical swine fever, a bioassay, polymerase chain reaction, immunofluorescence reaction, neutralization reaction and enzyme immunoassay are used [Stafford V.V., Alekseev K.P., Yuzhakov A.G., Gulyukin A.M., Aliper T.I. .. Application of the immunohistochemical method for the diagnosis of classical swine fever. Veterinary medicine and feeding. - 2022. - N3. - pp. 61-65. DOI: 10.30917/ATT-VK-1814-9588-2022-3-16., Stafford V.V., Streltsova Ya.B. Immunohistochemistry and in situ hybridization in the diagnosis of classical swine fever. Veterinary medicine and feeding. No. 6. - 2018. - pp. 14-16., Guidelines for laboratory diagnosis of classical swine fever // Approved. Ministry of Agriculture and Food of Russia 12/30/1996 N 13-4-2/809].

The technical problem is the need to develop a labeled hybridization probe complementary to a region of the genome of the classical swine fever virus to create an effective and affordable method for diagnosing classical swine fever, to detect the genetic material of the virus in the tissues and organs of pigs, feasible in histological laboratories without the use of expensive consumables, and for expansion of the arsenal of methods for diagnosing classical swine fever.

Disclosure of the invention

The technical result is the identification of the genetic sequence of the classical swine fever virus in organ cells susceptible to the virus (tonsil, spleen and mesenteric lymph node) and expanding the arsenal of methods for diagnosing classical swine fever.

This method of in-situ hybridization allows you to determine the localization of the virus genome in the cells of organs in the body, as well as study the pathogenesis of the disease, compare data in complex diagnostics with pathohistological changes, thereby confirm the pathological effect of the virus on infected tissues and organs and make a final diagnosis in case of latent course of the disease. The use of this method is important for pathomorphological studies and contributes to accurate differential diagnosis, study of pathogenesis and immune response in a sick animal.

The proposed method is as follows.

To perform in-situ hybridization on native histological sections of pig organs, an oligonucleotide DNA probe is used. The hybridization DNA probe is obtained according to the following method: first, RNA is isolated from the lyophilized vaccine strain KS of the classical swine fever virus using a commercial kit "RIBO-prep" (InterLabService, Russia) according to the manufacturer's method.

Next, to obtain a specific fragment of 173 bp in size. Nested PCR is performed for the corresponding region of the E2 glycoprotein gene. In the first round of reverse transcription PCR (RT-PCR), forward primer F1 5'-ATATATGCTCAAGGGCGAGT-3' and reverse primer R1 5'-ACAGCAGTAGTATCCATTTCTTTA-3' are used. A 25 μl reaction mixture contains 5 μl of sample, 5 μl of 5x RT-PCR buffer (Diam, Russia), 0.5 μl dNTP mixture (Diam, Russia), 12.1 μl of nuclease-free water, 0.25 μl of Taq- polymerase (Diam, Russia), 0.125 MMLV-revertase and 10 pM each of forward and reverse primers. Thermal cycle: 50°C - 30 min, 94°C - 5 min, then 25 cycles: 95°C - 30s, 60.5°C - 30s and 72°C - 90s; at the end 72°C - 5 min. In the second round, PCR is carried out with primers: forward F2 5'-CTGTGGCTAATAGTGACCTAC-3' and reverse R2 5'-CATTTCTTTATGGGCTCATC-3'. A 25 µl reaction mixture contains 5 µl of sample, 2.5 µl 10x PCR buffer (Diam, Russia), 0.5 µl dNTP mixture (Diam, Russia), 14.6 µl nuclease-free water, 0.25 µl Taq- polymerase (Diam, Russia) and 10 pM each of forward and reverse primers. Thermal cycle: 94°C - 5 min, then 25 cycles: 94°C - 30s, 55°C - 30s and 72°C - 90s; at the end 72°C - 5 min. After amplification, electrophoresis is carried out in a 1% agarose gel prepared in Tris-acetate buffer solution (pH 8.0) with the addition of 40 μl of ethidium bromide per liter of buffer. A PCR fragment corresponding in electrophoretic mobility to a size of 173 bp is cut out and isolated from the gel using the LumiPure kit (Lumiprobe, Russia) according to the manufacturer’s method.

To label a DNA sample using PCR, fluorescein-12-dUTP (Silex, Russia) is used. The reaction mixture contains the following components: 4.0 μl of fluorescein-12-dUTP 1/3 mixture, 2.5 μl of Taq buffer (x10), 1 μl of primers F2 and R2 to a final concentration of each primer of 0.1-1 μM, 0, 25 µl Taq polymerase, 5 µl template DNA (0.02-0.15 µg/25 µl mixture), deionized water up to 25 µl. Amplification program: 40 cycles: 94°C - 10s; 55°C - 10s; 72°C - 30 s, after the last cycle incubate at 72°C - 3 min.

Additionally, the nucleotide sequence of the probe is determined by the Sanger method using the BigDye 3.1 kit (Applied Biosystems, USA). As a result, a nucleotide sequence is obtained, which is used as a fluorescein-labeled probe for the in-situ hybridization reaction:

After this, the second stage begins - the in-situ hybridization reaction. The technique is as follows:

The tonsil, spleen and mesenteric lymph node are taken as pathological material to determine the localization of the genetic material of the classical swine fever virus from dead or forcedly killed animals. Native pathological material is cooled for 6 hours in a refrigerator at a temperature of 4°C. Samples are transported in a cooler bag with cold packs that maintain a temperature of 4°C throughout the entire transportation phase. Then, for long-term storage, the material is placed in a low-temperature chamber and stored at a temperature of -70°C. Immediately before testing, samples are thawed. Next, the necessary samples measuring 0.5 cm in length and width and 2 cm in thickness are excised from the selected organs. The excised areas of organs are fixed on cryotomy tables, filling the area between the table and the tissue with a special cryogel. Tables with objects are placed in a cryotome chamber at a temperature of -34°C for 60 minutes. Sections 10 microns thick are cut from the finished block and glued onto polarized glass. After this, the sections are treated with a mixture of isopropyl alcohol 70 ml and physiological solution 30 ml, 1 hour at 4°C. After this, they are washed in 0.01 M PBS 3 times for 5 minutes in each portion at room temperature.

Preparation of 0.01 M PBS for washing sections:

pH=7.0

Then the sections are rinsed in a 4% paraformaldehyde solution for 15 minutes at a temperature of +4°C. Solution recipe:

40% paraformaldehyde - 4 g dissolved in 100 ml 0.1 M PBS at

help of boiling.

Cool the solution in ice before use.

After this, they are washed in 0.1 M PBS 3 times for 5 minutes. Prepare a solution of proteinase K in PBS at the rate of 20 mg per 1 ml of 0.1 M PBS. The total volume of the solution is calculated based on 0.3 ml per 1 glass. Incubate in proteinase K solution for 15 minutes at room temperature. Then they are washed in 0.1 M PBS 3 times for 5 minutes. Prepare hybridization buffer (GB) pH=7.2:

Formamide 5 ml

50% solution of sodium dextran sulfate in distilled water

water - 1 ml

0.1 MFSB 1 ml

20xCitrate buffer (CSB) - 1 ml (87.5 g NaCl + 44 g

Na ₃ citrate *2H ₂ O + 400 ml double-distilled water) - 1 ml

Adjust acidity with 37% HCl (12M=>1 ml HCl/11 ml H ₂ O

=>1M)

Then a hybridization mixture (HS) is prepared at the rate of:

Hybridization buffer 500 µl

Hybridization probe 5 µl

The hybridization mixture is applied to slides in an amount of 200 μl per section, covered with a coverslip and sealed with rubber glue. Place in petri dishes on stands on a heating table at 96°C for 15 minutes. After incubation in the HS, the temperature is reduced to 37°C and the dishes are left for 16 hours at the given temperature.

After a 16-hour incubation, carefully disassemble the sections from the coverslip in 4x CSB 4 times for 5 minutes:

20x CSB - 60 ml

H ₂ O double-distilled - 240 ml

And then immediately placed in the formamide-salt mixture and rinsed at room temperature 3 times for 10 minutes in each portion:

Formamide - 150 ml

20xCSB - 60 ml

H ₂ O double-distilled - 90 ml

After this, the sections are again rinsed in 4x CSB 4 times for 5 minutes at room temperature. The sections are then incubated in Tris-HCl buffer for 30 minutes at room temperature and coverslipped with fluorescent mounting medium. Prescription of Tris-HCl buffer:

50 μM Tris HCl - 5 ml

100 μM NaCl - 0.58 g

H ₂ O double-distilled up to 100 ml

This method is applicable for in-situ hybridization on native cryosections of the tonsil, spleen, mesenteric lymph node and other organs using a hybridization probe to the nucleotide sequence of the classical swine fever virus genome. Detection of the nucleotide sequence of the virus occurs in the cytoplasm of susceptible cells of infected organs by visualizing the fluorescent label of the hybridization probe in the form of a bright green glow in an ultraviolet beam with a wavelength of 480 nm. When using the proposed method, with a positive reaction, a fluorescent label is visualized in the form of an emerald green glow in the cytoplasm of susceptible cells (Fig. 1-2).

The proposed method has high specificity and sensitivity, allows you to accurately detect the localization of the virus, as well as carry out differential diagnosis of CSF from other pathogens of pig infections with a similar clinical picture.

The Pathomorphology Sector of the Federal State Budgetary Scientific Institution FSC VIEV RAS has successfully tested the above method for diagnosing classical swine fever in scientific and practical activities. According to the test results, this research method can be recommended for use in research institutes and veterinary laboratories.

The implementation of the invention is illustrated by the following examples:

Example No. 1

Fresh material was collected from 30 dead pigs for research (tonsil, spleen and mesenteric lymph node), and within 8 hours the material was delivered to the laboratory in a refrigerator bag, in a tightly closed container at 3°C. In the laboratory, in compliance with the rules of asepsis and antisepsis, samples measuring 0.5 cm by 0.5 cm were excised from each organ, frozen on cryotomy tables in a cryostat chamber, and 2 sections were cut onto glass from each organ. Sections 10 microns thick were placed on polarized glass and dried. After this, the sections were treated with a mixture of 70 ml isopropyl alcohol and 30 ml physiological solution for 1 hour at 4°C. Then they were washed in 0.01 M PBS 3 times for 5 minutes in each portion at room temperature. Then rinsed in a 4% paraformaldehyde solution for 15 minutes at a temperature of +4°C. And washed in 0.1 M PBS 3 times for 5 minutes. Next, a solution of proteinase K was prepared in PBS at the rate of 20 mg per 1 ml of 0.1 M PBS. The total volume of the solution was calculated based on 0.3 ml per 1 glass. The mixture was kept in the proteinase K solution for 15 minutes at room temperature. Then they were washed in 0.1 M PBS 3 times for 5 minutes. During rinsing in PBS, a hybridization buffer (GB) pH = 7.2 and a hybridization mixture were prepared. GS was applied to slides in an amount of 200 μl per section, covered with a coverslip and sealed with rubber glue. The mounted glasses were placed in Petri dishes on stands on a heating table at 96°C for 15 minutes. After the incubation period in the HS, the table temperature was reduced to 37°C and the dishes were left for 16 hours at the given temperature. After a 16-hour incubation, the sections from the coverslip were carefully disassembled by dipping them into different portions in 4x CSB 4 times for 5 minutes. After the last portion, the glasses with sections were immediately placed in a formamide-salt mixture and rinsed at room temperature 3 times for 10 minutes in each portion. After this, the sections were again rinsed in 4x CSB 4 times for 5 minutes at room temperature. Then they were incubated in Tris-HCl buffer for 30 minutes at room temperature and mounted with a coverslip on fluorescent mounting medium.

As a result of the study of the material, it was revealed that 24 pigs were infected with the classical swine fever virus.

A positive reaction result for the presence of the classical swine fever virus genome is demonstrated in Figures 1, 2 and 3, where an emerald green glow is clearly visualized in the cytoplasm of susceptible cells. When a negative test result is obtained for the presence of the virus genome, areas of emerald green fluorescence are absent, which is clearly shown in figures 4, 5, 6.

Example No. 2 Obtaining a hybridization mixture

To perform a study of native histological samples from 30 dead pigs (tonsil, spleen and mesenteric lymph node), 18 ml of hybridization mixture was required. To do this, we first prepared a hybridization buffer with pH = 7.2, consisting of 15 ml of formamide, 3 ml of a 50% solution of sodium dextran sulfate in distilled water, 3 ml of 0.1 M PBS, 3 ml of 20xCSB. Then, 18 ml of the resulting volume was taken into a separate container and 180 μl of the hybridization probe was added to obtain a hybridization mixture.

Example No. 3 Obtaining a hybridization probe

To prepare an 18 ml volume of the hybridization mixture, it was necessary to prepare 180 μl of the hybridization probe. To do this, the required volume was produced based on a strict scheme of the amount of substances and production stages described below. Thus, we took the lyophilized vaccine strain KS of the CSF virus to isolate RNA using a commercial kit “RIBO-prep” (InterLabService, Russia) according to the manufacturer’s method. To obtain a specific fragment of 173 bp. Nested PCR was performed for the corresponding region of the E2 glycoprotein gene. In the first round of reverse transcription PCR (RT-PCR), forward primer F1 5'-ATATATGCTCAAGGGCGAGT-3' and reverse primer R1 5'-ACAGCAGTAGTATCCATTTCTTTA-3' were used. A 25 μl reaction mixture contains 5 μl of sample, 5 μl of 5x RT-PCR buffer (Diam, Russia), 0.5 μl dNTP mixture (Diam, Russia), 12.1 μl of nuclease-free water, 0.25 μl of Taq- polymerase (Diam, Russia), 0.125 MMLV-revertase and 10 pM each of forward and reverse primers. Thermal cycle: 50°C - 30 min, 94°C - 5 min, then 25 cycles: 95°C - 30s, 60.5°C - 30s and 72°C - 90s; at the end 72°C - 5 min. In the second round, PCR was performed with primers: forward F2 5'-CTGTGGCTAATAGTGACCTAC-3' and reverse R2 5'-CATTTCTTTATGGGCTCATC-3'. A 25 µl reaction mixture contains 5 µl of sample, 2.5 µl 10x PCR buffer (Diam, Russia), 0.5 µl dNTP mixture (Diam, Russia), 14.6 µl nuclease-free water, 0.25 µl Taq- polymerase (Diam, Russia) and 10 pM each of forward and reverse primers. Thermal cycle: 94°C - 5 min, then 25 cycles: 94°C - 30s, 55°C - 30s and 72°C - 90s; at the end 72°C - 5 min. After amplification, electrophoresis was performed in a 1% agarose gel prepared in a Tris-acetate buffer solution (pH 8.0) with the addition of 40 μl of ethidium bromide per liter of buffer. A PCR fragment corresponding in electrophoretic mobility to a size of 173 bp was cut out and isolated from the gel using the LumiPure kit (Lumiprobe, Russia) according to the manufacturer’s method.

Fluorescein-12-dUTP (Silex, Russia) was used to label the DNA sample using PCR. The reaction mixture contained the following components: 4.0 μl of fluorescein-12-dUTP 1/3 mixture, 2.5 μl of Taq buffer (x10), 1 μl of primers F2 and R2 to a final concentration of each primer of 0.1-1 μM, 0. 25 µl Taq polymerase, 5 µl template DNA (0.02-0.15 µg/25 µl mixture), deionized water up to 25 µl. Amplification program: 40 cycles: 94°C - 10s; 55°C - 10s; 72°C - 30 s, after the last cycle incubate at 72°C - 3 min.

Additionally, the nucleotide sequence of the probe was determined by the Sanger method using the BigDye 3.1 kit (Applied Biosystems, USA). As a result, we obtained a nucleotide sequence that was used as a fluorescein-labeled probe for the in-situ hybridization reaction:

Brief description of drawings

Fig. 1 - Amygdala. A positive FISH result with a bright fluorescent label upon hybridization of the probe with the CSF virus genome in the cytoplasm of susceptible cells. Uv. 630x.

Fig. 2 - Spleen. A positive FISH result with a bright fluorescent label upon hybridization of the probe with the CSF virus genome in the cytoplasm of susceptible cells. Uv. 630x.

Fig. 3 - Mesenteric lymph node. A positive FISH result with a bright fluorescent label upon hybridization of the probe with the CSF virus genome in the cytoplasm of susceptible cells. Uv. 630x.

Fig. 4 - Amygdala. Negative result of probe hybridization with the CSF virus genome in the cytoplasm of susceptible cells. Uv. 630x.

Fig. 5 - Spleen. Negative result of probe hybridization with the CSF virus genome in the cytoplasm of susceptible cells. Uv. 630x.

Fig. 6 - Mesenteric lymph node. Negative result of probe hybridization with the CSF virus genome in the cytoplasm of susceptible cells. Uv. 630x.

Claims (1)

A method for diagnosing classical swine fever using fluorescence in situ hybridization (FISH), based on the use of a hybridization probe specific to a region of the E2 glycoprotein gene of the virus, characterized in that the object of study is native cryotomic sections from the tonsil, spleen and mesenteric lymph node, and in The nucleotide sequence CTGTGGCTAATAGTGACCTACATAGTTCTAACAGAACAACCCGCCGCTGGTTTACAGCTGGGCCAGGGTGAGGTAGTGTTAATAGGGAACTTAATTACCCACACAGACATTGAGGTTGTAGTATATTTCTTACTGCTCTATTTGGTCATGAGAGATGAGCCTATAAAGAAATG with fluorescein-12-dUTP dye is used as a hybridization probe, we detect visible under the ultraviolet light of a microscope as an emerald green glow inside susceptible cells.