RU2805859C1 - Method of genotyping tlr1 gene using rs5743551 polymorphism and a set of oligonucleotide primers and probes for its implementation - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following has been proposed: a method of genotyping A and G alleles of TLR1 gene using rs5743551 polymorphism, including DNA extraction from biological material, real-time PCR using a reaction mixture containing a set of nucleotide primers and probes of the following SEQ ID NO: 1–4, amplification, analysis and interpretation of the results, where the presence of the A allele of TLR1 gene for rs5743551 polymorphism is determined by assessing the accumulation curves of fluorescent signals through the channel for the FAM fluorophore, and the presence in the biological material of the G allele of TLR1 gene for rs5743551 polymorphism is determined by assessing the curves accumulation of fluorescent signals through the channel for the R6G fluorophore. A set of oligonucleotide primers and probes for use in the genotyping method is proposed.

EFFECT: invention makes it possible to detect rs5743551-A and rs5743551-G alleles of TLR1 gene in samples of biological material using real-time PCR.

5 cl, 1 tbl, 6 ex

Description

The invention relates to the field of biotechnology, in particular to the determination of alleles of the human TLR1 gene by single nucleotide polymorphism rs5743551 in samples of biological material using the polymerase chain reaction (PCR) method in real time and can be used in studies studying the influence of single nucleotide polymorphisms (SNPs) in innate immunity genes on the occurrence and course of multifactorial diseases, as well as in practical activities when diagnosing genetic diseases caused by such influence.

Toll-like receptors (TLRs) are innate immune receptors located both on the surface and inside the cell and recognize pathogens entering the body. TLRs recognize not only exogenous pathogen-associated molecular patterns (PAMPs) but also endogenous damage-associated molecules (DAMPs) that are released from damaged or dying cells. Activated TLRs by PAMPs or DAMPs initiate signaling cascades such as nuclear factor-kappa B (NFkB), mitogen-associated protein kinase (MAPK) and interferon (IFN) pathways, and promote the secretion of cytokines and chemokines that regulate immune and inflammatory responses. aimed at eliminating pathogens.

The association of SNPs in TLR genes with a predisposition to the occurrence and severe course of multifactorial diseases has been shown. Determination of SNP alleles in TLR genes can be used to prevent severe infectious diseases.

TLR1 plays an important role in mucosal Th17 immunity and IgA responses during Yersinia enterocolitica infection. Studies have repeatedly shown the association of polymorphisms in the TLR1 gene with the likelihood of developing tuberculosis, asthma, pulmonary fibrosis and other multifactorial diseases.

Risk alleles in combination with other factors can lead to severe infectious diseases. Allele A in the rs5743551 polymorphism of the TLR1 gene (rs5743551-A) is a protective allele against the development of severe (sepsis, adverse outcomes) pneumonia, the rs5743551-G allele, on the contrary, is a risk marker for severe pneumonia, including a high probability of developing sepsis [ Wurfel MM, Gordon AC, Holden TD, Radella F, Strout J, Kajikawa O, Ruzinski JT, Rona G, Black RA, Stratton S, Jarvik GP, Hajjar AM, Nickerson DA, Rieder M, Sevransky J, Maloney JP, Moss M , Martin G, Shanholtz C, Garcia JG, Gao L, Brower R, Barnes KS, Walley KR, Russell JA, Martin TR. Toll-like receptor 1 polymorphisms affect innate immune responses and outcomes in sepsis. Am J Respir Crit Care Med. 2008 Oct 1;178(7):710-20. doi: 10.1164/rccm.200803-4620C. Epub 2008 Jul 17. PMID: 18635889; PMCID: PMC2556453. Karnaushkina MA, Guryev AS, Mironov KO, Dunaeva EA, Korchagin VI, Bobkova OY, Vasilyeva IS, Kassina DV, Litvinova MM. Associations of Toll-like Receptor Gene Polymorphisms with NETosis Activity as Prognostic Criteria for the Severity of Pneumonia. Sovrem Tekhnologii Med. 2021;13(3):47-53. doi: 10.17691/stm2021.13.3.06. Epub 2021 Jun 28. PMID: 34603755; PMCID: PMC8482823.].

Detection of a target such as the G allele of the rs5743551 polymorphism of the TLR1 gene (rs5743551-G) will make it possible to determine the likelihood of complications at an early stage and provide more effective medical care to patients in intensive care units.

It is known from the prior art to determine mononucleotide polymorphic sites for assessing the risk of traumatic sepsis [patent CN 20171905554, application filing date 09/29/2017, publication date 03/27/2018], where the single nucleotide polymorphism site contains rs5743551, carrying allele A, rs4755453, carrying allele C, rs10654 89 , carrying the T allele, rs2071746, carrying the T allele, rs1799983, carrying the T allele, rs2297518, carrying the G allele, rs740598, carrying the G allele, and rs7851696, carrying the T allele. Although such a reference site contains the rs5743551-A allele, it does not allow the identification of the rs5743551-G risk allele.

There is also a known genotyping method based on the creation of a panel of DNA chips for predicting severe viral infection [patent CN 111455105, application date 04/10/2020, publication date 07/28/2020], which includes ACE, ANGPT2, ASRD, CD55, ILIA, GLDC , IFITM3 and LRRRRRRRRRRRC16A, MBL-2, VEGF, IL6, IL10, IL17, IRAK3, BCLCLCL2L1, LGALS1, TERT, PI3, POPDC3, PPFIA1, ZNFNFNF311, ZNFNFNF311 and ZNF676. The invention further discloses a panel of DNA chips for predicting severe viral infection, ST3GAL1, which contains the following genes: ACE XKR3, ACYP2A and CTC1, CXCR4, NFY1, OBFC1 GLDC and RTEL1 TLR1, TLR3, TMPRSS2. TNFA, VEGF ZNF208 and. SP.

According to US patent 20110020803 (application date 09/29/2008, publication date 01/27/2011), markers are known for predicting lung function and colonization with an infectious agent, which allow determining the presence or absence of one or more nucleic acid variants in a gene or combination of genes.

The mentioned solutions do not allow differentiating the rs5743551 polymorphism by alleles A or G of the TLR1 gene, which does not allow for timely implementation of diagnostic and preventive measures.

There are known sets of reagents for determining SNP alleles using real-time PCR. Reagent kits include oligonucleotides for the detection of several specific alleles in test samples and are user-friendly. For the selected detection targets, the connection with the disease is not always confirmed and therefore such kits cannot always be used in clinical practice, but are used for research purposes. A set of reagents “ThermoFisher Scientific C_30687121_20” for determining the rs5743565 alleles of the TLR1 gene is also known from the prior art [https://www.thermoflsher.com/order/genome-database/details/genotyping/C_30687121_20?CID=&ICID=&subtype≠more-information -section]. However, this solution is not intended to detect rs5743551 alleles of the TLR1 gene.

Also, genotyping of the rs5743551 loci was performed using reagents for DNA isolation (“RIBO-prep”), amplification and sample preparation (“PIRO-prep”) produced by the Central Research Institute of Epidemiology of Rospotrebnadzor (“AmpliSens”, Russia) using the pyrosequencing method using PyroMark Q96 reagents and the system genetic analysis PyroMark Q24 (Qiagen, Germany) [M.A. Karnaushkina, A.S. Guryev, K.O. Mironov, E.A. Dunaeva, V.I. Korchagin, O.Yu. Bobkova, I.S. Vasilyeva, D.V. Kassina, M.M. Litvinova. Associations of toll-like receptor gene polymorphisms and NETosis activity as prognostic criteria for the severity of pneumonia. http://www.stm-journal.ru/ru/numbers/2021/3/1723/html]. According to the described method, rs5743551-A and rs5743551-G of the TLR1 gene were determined by pyrosequencing, which makes it more expensive and labor-intensive.

Thus, there is a need to expand accurate diagnostic tools that allow genotyping TLR1 gene alleles based on the rs5743551 polymorphism in a short time and at the lowest cost for timely and adequate prescription of diagnostic, therapeutic and preventive measures, as well as for further study of innate immunity and the mechanism of its occurrence and course. multifactorial diseases.

The technical result of the claimed invention is aimed at genotyping alleles A and G of the TLR1 gene using the rs5743551 polymorphism, namely the determination of rs5743551-A and rs5743551-G of the TLR1 gene, in samples of DNA biological material using widely used methods and available equipment.

The declared technical result is achieved by carrying out a polymerase chain reaction (hereinafter referred to as PCR) with hybridization-fluorescence detection of amplification products in real time using a reaction mixture containing a set of unique synthesized nucleotide primers and conformation-blocked probes, and genotyping is carried out by assessing accumulation curves fluorescent signals through the corresponding channels for fluorophores, namely: for rs5743551-A through the FAM channel, for rs5743551-G through the R6G channel.

The mentioned set of synthesized nucleotide primers and probes makes it possible to effectively detect the polymorphic nucleotide rs5743551 in a DNA sequence and has the following oligonucleotide composition:

direct primer 3551-F - SEQ ID NO: 1,

reverse primer 3551-R - SEQ ID NO: 2,

fluorescent probe 3551-A - SEQ ID NO: 3,

fluorescent probe 3551-G - SEQ ID NO: 4.

Primers are oligonucleotide sequences for fragment amplification, including the rs5743551 polymorphism; fluorescent probes are oligonucleotides containing a fluorophore, a fluorescence quencher, allowing the detection of alleles in the amplified fragment.

The claimed set of oligonucleotide primers and probes was developed based on the analysis of the sequences: TLR1 toll like receptor 1 gene (Homo sapiens (human)), Gene ID: 7096 NC 000004.12 GRCh38.p14 (GCF_000001405.40), presented in the National Center for Biotechnology database Information (NCBI) [NCBI https://www.ncbi.nlm.nih.gov/gene/70961. and having no homology with other DNA sequences. As a result, a fragment was selected for detection of a region containing rs5743551 of the TLR1 gene to which forward and reverse primers were selected to amplify a fragment 116 base pairs long, as well as fluorescent probes for detection of alleles A and G of the selected SNP: forward primer 3551-F - SEQ ID NO: 1; reverse primer 3551-R - SEQ ID NO: 2; fluorescent probe 3551-A - SEQ ID NO: 3; fluorescent probe 3551-G - SEQ ID NO: 4.

In this case, the probes contain conformationally blocked nucleotides, which make it possible to increase the stability of the duplex with the target DNA. The 3551-A fluorescent probe contains 5 blockers, which are located at positions 3, 5, 7, 10, 12. The 3551-G fluorescent probe contains 4 blockers, which are located at positions 5, 7, 10, 12.

To select targets - sites for landing oligonucleotides, fragments of the reference genome taken from the NCBI dbSNP database are used [NCBI dbSNP https://www.ncbi.nlm.nih.gov/snp/accessed 12/12/2022]. To search for homologous regions, modern algorithms for in silico analysis of nucleotide sequences and publicly available programs are used: Primer BLAST, Unipro UGENE. The composition of the set of oligonucleotide primers and probes is shown in Table 1.

Analysis of the results demonstrated that forward primer 3551-F (SEQ ID NO: 1) and reverse primer 3551-R (SEQ ID NO: 2) amplified a region of the human TLR1 gene containing the rs5743551 polymorphism with 100% specificity. Also, the specificity of forward and reverse primers was confirmed using the direct method of pyrosequencing of nucleotide sequences.

where FAM is a fluorophore for SEQ ID NO: 3, R6G is a fluorophore for SEQ ID NO: 4, BHQ1 is a fluorescence quencher, corresponding to the dye of the FAM and R6G fluorophore channels, the “+” sign is before the conformationally blocked nucleotide.

The claimed invention is the result of research work of the laboratory of molecular methods for studying genetic polymorphisms “Study of genetic predisposition to multifactorial diseases”, conducted by the Federal Budgetary Institution Central Research Institute of Epidemiology of Rospotrebnadzor (Moscow, Russia).

It is preferable to use venous blood as a biological material.

PCR research is carried out in accordance with MU 1.3.2569-09 “Organization of work in laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV.” For DNA extraction, the “RIBO-prep” reagent kit (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) or any similar kit/reagent kit for DNA extraction can be used, in accordance with the manufacturer’s instructions. The optimal DNA concentration is 10 ³ -10 ⁵ copies in 10 µl. Real-time PCR is carried out using the proposed set of oligonucleotide primers and probes for detection of alleles of the rs5743551 polymorphism of the human TLR1 gene, presented in Table 1.

PCR is carried out under the following conditions:

The total volume of the reaction mixture is 25 µl.

PCR components are mixed as follows:

(a) 10 µl of a mixture containing:

-oligonucleotide primers SEQ ID NO NO: 1, 2 - 0.2 mM each;

-fluorescent probes SEQ ID NO NO: 3, 4 - 0.03 mM each

-dNTPs - 0.44 mM.

(b) a reagent containing recombinant enzyme Taq DNA polymerase, for example, 0.5 μl of “TaqF Polymerase” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Moscow, Russia) or any similar commercial kit in accordance with the manufacturer’s instructions.

(c) PCR buffer containing MgCl ₂ , for example, 5.0 μl of PCR buffer “RT-PCR-mix-2 FEP/FRT” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Moscow, Russia) or any similar commercial kit in accordance with manufacturer's instructions.

(d) DNA extracted from human whole blood - 10 µl. Amplification is carried out on a cycler with the ability to detect a fluorescent signal through at least 2 fluorescence channels, for example, “Rotor-Gene Q” (Qiagen, Germany) in accordance with the manufacturer’s instructions.

Amplification is carried out according to the following program: 1 cycle at 95°C for 15 minutes, 45 cycles at a temperature of 95°C - 10 seconds / 60°C - 20 seconds. Fluorescence detection is carried out at the 60°C stage through the channel for the FAM fluorophore - for rs5743551-A, through the channel for the R6G fluorophore for rs5743551-G.

Data analysis is carried out based on detection of the fluorescent signal level by the amplifier. The results are interpreted based on the presence (or absence) of the intersection of the S-shaped (sigma-shaped) fluorescence curve with the threshold line set at the appropriate level. This determines whether the analyzed sample has a threshold cycle value or not. During DNA amplification, probes compete for binding to a DNA template containing two primers SEQ ID NO: 1 and SEQ ID NO: 2. In this case, the probe corresponding to the allele represented in the sample receives preference. If two alleles of a polymorphism are present, both probes hybridize.

For each channel, a threshold line is set corresponding to the value of 10% of the maximum fluorescence signal of the sample among samples with a certain allele. Samples for which the fluorescence curves cross the threshold line along the channel for detecting the FAM fluorophore and the kinetics of fluorescent signal accumulation is exponential contain allele A of the rs5743551 polymorphism of the TLR1 gene. Samples for which the fluorescence curves cross the threshold line along the channel for detecting the R6G fluorophore and the kinetics of fluorescent signal accumulation is exponential contain the G allele of the rs5743551 polymorphism of the TLR1 gene.

Samples for which the fluorescence curves crossed the threshold lines along the channels for detecting the FAM and R6G fluorophores and the kinetics of accumulation of the fluorescent signal is exponential contain rs5743551-A and rs5743551-G.

The implementation of the claimed invention is illustrated by the following examples:

Example 1. Preparation of a set of oligonucleotide primers and probes for genotyping TLR1 gene alleles using the rs5743551 polymorphism

To select target sequences - oligonucleotide landing sites, we used fragments of the TLR1 toll like receptor 1 (Homo sapiens (human)) gene, Gene ID: 7096 N_000004.12 GRCh38.p14 (GCF_000001405.40), presented in the National Center for Biotechnology Information database (NCBI) [NCBI https://www.ncbi.nlm.nih.gov/gene/7096], and have no homology with other DNA sequences. To search for homologous regions, modern algorithms for in silico analysis of nucleotide sequences and the Primer BLAST, Unipro UGENE, and MEGA programs were used.

As a result of the analysis, a region of the homologous sequence was selected, to which primers and probes were selected to amplify a fragment of 116 base pairs in length, as well as fluorescent probes to detect alleles A and G of the selected SNP: forward primer 3551-F - SEQ ID NO: 1; reverse primer 3551-R - SEQ ID NO: 2; fluorescent probe 3551-A - SEQ ID NO: 3; fluorescent probe 3551-G - SEQ ID NO: 4. Moreover, each probe contains conformationally blocked nucleotides, namely: fluorescent probe 3551-A contains 5 blockers, which are located in positions 3, 5, 7, 10, 12, and the fluorescent probe 3551-G - 4 blockers, which are located in positions 5, 7, 10, 12.

Analysis of the mentioned sequences using the Primer BLAST resource [https://www.ncbi.nlm.nih.gov/tools/primer-blast/] showed that the forward 3551-F and reverse 3551-R primers amplify the region containing the rs5743551 polymorphism in TLR1 gene with 100% specificity.

Example 2. Detection of alleles A and G of the TLR1 gene using the rs5743551 polymorphism using real-time PCR.

Real-time PCR was performed under the following conditions.

The total volume of the reaction mixture is 25 µl.

PCR components are mixed as follows:

(a) 10 µl of a mixture containing:

- oligonucleotide primers: SEQ ID NO: 1, SEQ ID NO: 2, 0.2 mM;

- fluorescent probes SEQ ID NO: 3, SEQ ID NO: 4 - 0.03 mM each;

- dNTPs - 0.44 mM.

(b) 0.5 μl of the “TaqF Polymerase” reagent (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia), containing the recombinant enzyme Taq DNA polymerase.

(c) 5.0 μl of PCR buffer “RT-PCR-mix-2 FEP/FRT” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) containing MgCl ₂ ;

(d) DNA extracted from human venous whole blood - 10 µl.

Real-time PCR was carried out with fluorescent detection of the result on a Rotor-Gene Q device with 5 detection channels (Qiagen, Germany).

The material prepared in the described manner, containing unique oligonucleotide sequences SEQ ID NO: 1-4, was used to determine the rs5743551 alleles of the TLR1 gene in samples of biological material.

Example 3. Genotyping of alleles A and G of the TLR1 gene using the rs5743551 polymorphism in samples of biological material.

To determine the rs5743551 alleles of the human TLR1 gene in samples of biological material, 54 samples were selected; the biological material used for the study was venous blood. DNA extraction was carried out in accordance with MU 1.3.2569-09 “Organization of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV.” For DNA extraction, a set of reagents “RIBO-prep” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) was used in accordance with the manufacturer’s instructions.

PCR-PCR was carried out under the conditions described in Example 2, using unique synthesized oligonucleotide primers and probes SEQ ID NO: 1-4.

Amplification was carried out on a Rotor-Gene Q device (Qiagen, Germany) according to the following program: 1 cycle at 95°C for 15 minutes, 45 cycles at 95°C for 10 seconds / 60°C for 20 seconds. Detection of the fluorescent signal was carried out at the 60°C stage through the channel for the FAM fluorophore for the A allele, and through the channel for the R6G fluorophore for the G allele.

When analyzing the results, a threshold line was set for each channel corresponding to a value of 10% of the maximum fluorescence signal of the sample among samples with a certain allele.

For 38/54 samples, the fluorescence curve crossed the threshold line along the channel for the FAM fluorophore; for 16/54 samples, the fluorescence curve crossed the threshold line through the channel for the R6G fluorophore, while the kinetics of accumulation of fluorescent signals was exponential.

The presence of the rs5743551-A allele was determined using the channel for the FAM fluorophore; the presence of the rs5743551-G polymorphism allele was determined using the channel for the R6G fluorophore.

The results of the study were confirmed using the method of pyrosequencing of nucleotide sequences, which was performed using the PyroMark Q24 genetic analysis system (Qiagen, Germany) in accordance with the manufacturer’s instructions.

Example 4 Genotyping of alleles A and G of the TLR1 gene using the rs5743551 polymorphism in samples of biological material.

To determine the rs5743551 alleles of the human TLR1 gene in samples of biological material, 9 samples were selected; biological material was used for the study - whole blood. DNA extraction was carried out in accordance with MU 1.3.2569-09 “Organization of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV.” For DNA extraction, a set of reagents “RIBO-prep” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) was used in accordance with the manufacturer’s instructions.

PCR-PCR was carried out under the conditions described in Example 2, using unique synthesized oligonucleotide primers and probes SEQ ID NO: 1-4.

Amplification was carried out on a Rotor-Gene Q device (Qiagen, Germany) according to the following program: 1 cycle at 95°C for 15 minutes, 45 cycles at 95°C for 10 seconds / 60°C for 20 seconds. Detection of the fluorescent signal was carried out at the 60°C stage through the channel for the FAM fluorophore - for rs5743551-A, and through the channel for the R6G fluorophore - for rs5743551-G.

When analyzing the results, a threshold line was set for each channel corresponding to a value of 10% of the maximum fluorescence signal of the sample among samples with a certain allele.

For 9/9 samples, the fluorescence curve crossed the threshold line along the channel for the FAM fluorophore, which made it possible to determine the presence of allele A of the rs5743551 polymorphism of the TLR1 gene in 9 samples from the sample.

The results of the study were confirmed using the method of pyrosequencing of nucleotide sequences, which was performed using the PyroMark Q24 genetic analysis system (Qiagen, Germany) in accordance with the manufacturer’s instructions.

Example 5. Genotyping of alleles A and G of the TLR1 gene using the rs5743551 polymorphism in samples of biological material.

To determine the rs5743551 alleles of the human TLR1 gene in samples of biological material, 12 samples were selected; biological material - venous blood - was used for the study. DNA extraction was carried out in accordance with MU 1.3.2569-09 “Organization of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV.” For DNA extraction, a set of reagents “RIBO-prep” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) was used in accordance with the manufacturer’s instructions.

PCR-PCR was carried out under the conditions described in Example 2, using unique synthesized oligonucleotide primers and probes SEQ ID NO: 1-4.

Amplification was carried out on a Rotor-Gene Q device (Qiagen, Germany) according to the following program: 1 cycle at 95°C for 15 minutes, 45 cycles at 95°C for 10 seconds / 60°C for 20 seconds. Detection of the fluorescent signal was carried out at the 60°C stage through the channel for the FAM fluorophore for rs5743551-A, and through the channel for the R6G fluorophore for rs5743551-G.

When analyzing the results, a threshold line was set for each channel corresponding to a value of 10% of the maximum fluorescence signal of the sample among samples with a certain allele.

For 12/12 samples, the fluorescence curve crossed the threshold line along the channel for the R6G fluorophore, which made it possible to determine the presence of the G allele of the rs5743551 polymorphism of the TLR1 gene in 12 samples from the sample.

The results of the study were confirmed using the method of pyrosequencing of nucleotide sequences, which was performed using the PyroMark Q24 genetic analysis system (Qiagen, Germany) in accordance with the manufacturer’s instructions.

Example 6. Genotyping of alleles A and G of the TLR1 gene using the rs5743551 polymorphism in samples of biological material.

To determine the rs5743551 alleles of the human TLR1 gene in samples of biological material, 37 samples were selected; the biological material used for the study was whole blood. DNA extraction was carried out in accordance with MU 1.3.2569-09 “Organization of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV.” For DNA extraction, a set of reagents “RIBO-prep” (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) was used in accordance with the manufacturer’s instructions.

Real-time PCR was carried out under the conditions described in Example 2, using unique synthesized oligonucleotide primers and probes SEQ ID NO: 1-4.

Amplification was carried out on a Rotor-Gene Q device (Qiagen, Germany) according to the following program: 1 cycle at 95°C for 15 minutes, 45 cycles at 95°C for 10 seconds / 60°C for 20 seconds. Detection of the fluorescent signal was carried out at the 60°C stage through the channel for the FAM fluorophore - for the A allele, and through the channel for the R6G fluorophore - for the G allele.

When analyzing the results, a threshold line was set for each channel corresponding to a value of 10% of the maximum fluorescence signal of the sample among samples with a certain allele.

For 16/37 samples, the fluorescence curve crossed the threshold line along the channel for the FAM fluorophore, for 12/37 samples, the fluorescence curves crossed the threshold line through the channel for the R6G fluorophore, for 9/37 samples, the fluorescence curve crossed the threshold lines through the channels for the FAM and R6G fluorophore, in this case, the kinetics of accumulation of fluorescent signals was exponential.

The presence of rs5743551-A DNA was determined using the channel for the FAM fluorophore; the presence of rs5743551-G DNA was determined using the channel for the R6G fluorophore; the presence of signals through two channels for the FAM and R6G fluorophores simultaneously confirmed the presence of DNA of two alleles - rs5743551-A and rs5743551-G.

The results of the study were confirmed using the method of pyrosequencing of nucleotide sequences, which was performed using the PyroMark Q24 genetic analysis system (Qiagen, Germany) in accordance with the manufacturer’s instructions.

Thus, the claimed invention makes it possible to detect the rs5743551-A and rs5743551-G alleles of the TLR1 gene in samples of biological material. A set of unique synthesized oligonucleotide primers and probes SEQ ID NO: 1-4 does not cross-react with other genome sequences, amplifies the sequence including rs5743551 with 100% specificity and allows unambiguous interpretation of the results.

This XML file does not appear to have any style information associated with it. The document tree is shown below.

--->

<ST26SequenceListing originalFreeTextLanguageCode="en"

dtdVersion="V1_3" fileName="Genotyping of the TLR1 gene by polymorphism

rs5743551.xml" softwareName="WIPO Sequence" softwareVersion="2.2.0"

productionDate="2023-04-11">

<ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>1</ApplicationNumberText>

<FilingDate>2023-04-11</FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>no</ApplicantFileReference>

<ApplicantName languageCode="ru">FBUN Central Research Institute of Epidemiology

Rospotrebnadzor</ApplicantName>

<ApplicantNameLatin>FBUN CRIE</ApplicantNameLatin>

<InventionTitle languageCode="en">Method for genotyping the TLR1 gene by

polymorphism rs5743551 and a set of oligonucleotide primers and probes

for its implementation</InventionTitle>

<SequenceTotalQuantity>4</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>rs5743551</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatccaggctgagggagcaa</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>19</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q4">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>rs5743551</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>actgggagtggggatgagt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>13</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..13</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q6">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>rs5743551</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gctgagaagcttc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>13</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..13</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>rs5743551</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gctgaggagcttc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (10)

1. A method for genotyping alleles A and G of the TLR1 gene using the rs5743551 polymorphism, including: DNA extraction from biological material, real-time PCR using a reaction mixture containing a set of nucleotide primers and probes SEQ ID NO: 1-4, amplification, analysis and interpretation of the results, where the presence of allele A of the TLR1 gene according to the rs5743551 polymorphism is determined by assessing the accumulation curves of fluorescent signals through the channel for the FAM fluorophore, and the presence in the sample of biological material of the allele G of the TLR1 gene according to the rs5743551 polymorphism is determined by assessing the accumulation curves of fluorescent signals through the fluorophore channel R6G. 2. The genotyping method according to claim 1, where the presence in the sample of biological material of allele A of the TLR1 gene according to the rs5743551 polymorphism and allele G of the TLR1 gene according to the rs5743551 polymorphism is determined by assessing the accumulation curves of fluorescent signals through the FAM and R6G channels simultaneously. 3. Method of genotyping according to claims. 1 and 2, where to analyze the results, a threshold line is set corresponding to a value of 10% of the maximum fluorescence signal of the sample among samples with a certain allele. 4. A set of oligonucleotide primers and probes for use in the genotyping method according to claims. 1 and 2, having the following nucleotide composition: forward primer 3551-F - SEQ ID NO: 1; reverse primer 3551-R - SEQ ID NO: 2; fluorescent probe 3551-A - SEQ ID NO: 3; fluorescent probe 3551-G - SEQ ID NO: 4, in this case, the fluorescent probe 3551-A contains conformationally blocked nucleotides located at positions 3, 5, 7, 10, 12. and the fluorescent probe 3551-G contains conformationally blocked nucleotides located at positions 5, 7, 10, 12. 5. A set of oligonucleotide primers and probes according to claim 4, where a fragment of the Homo sapiens TLR1 gene is used to create forward and reverse primers and fluorescent probes.