RU2804300C2 - Demethylation for treatment of eye disease - Google Patents

Abstract

FIELD: medicine; ophthalmology.

SUBSTANCE: group of inventions is intended for the treatment, alleviation or prevention of age-related eye disease or pathology. A method of treating, alleviating, or preventing an age-related eye disease or pathology comprises administering to a subject in need of treatment an effective amount of at least one demethylating agent wherein the demethylating agent is decitabine. Also the methods of treating, alleviating or preventing age-related eye disease and pathology are provided, the said methods include increasing the level of the ELOVL2 enzyme in the eye and/or the level of 22:6 (n-3) docosahexaenoic acid (DHA) and 22:5 (n-6) docosapentaenoic acid (DPC) in the eye by introducing an effective amount of mRNA encoding ELOVL2 into the eye or gene therapy using an ELOVL2 expression vector. In another embodiment, a method is provided comprising selecting a patient in need of treatment for an age-related eye disease and administering to the patient's eye an effective amount of decitabine and/or an mRNA encoding ELOVL2 and/or an ELOVL2 expression vector, thereby curing the age-related disease. Also the following are disclosed: the methods involving the use of decitabine or an mRNA encoding ELOVL2 or an ELOVL2 expression vector in the treatment of age-related eye disease. Another embodiment is a method of the treatment of age-related eye diseases, including intravitreal administration of a preparation containing decitabine.

EFFECT: use of the group of inventions provides effective treatment, alleviation or prevention of age-related eye disease or pathology.

33 cl, 13 dwg, 2 tbl, 3 ex

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application No. 62/683292 and No. 62/716554, filed June 11, 2018 and August 9, 2018, respectively, which are incorporated herein by reference.

LIST OF SEQUENCES

This application contains a Sequence Listing that was filed electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy in question, created on May 20, 2019, is named 24978-0488_SL.txt and contains 17,271 bytes.

FIELD OF THE INVENTION

This invention relates to the field of ophthalmology and the field of cell biology. In particular, this invention relates to the treatment of age-related macular degeneration (AMD) and other eye diseases.

BACKGROUND OF THE ART

From a population perspective, chronological age is perhaps the most important biological feature in predicting age-related risks of disease, mental and physical performance, and mortality [1]. However, the use of chronological age in explaining significant biological variation among individuals of the same age is limited. Biological age is a concept that attempts to quantify the various states of aging influenced by lifestyle, genetics, disease, and environment. Environmental and lifestyle choices such as smoking and diet also have clear consequences for age-associated diseases [2]. While epidemiological studies have succeeded in providing quantitative estimates of their impact on human lifespan, advances in molecular biology now make it possible to move beyond demographic questions of mortality and clarify the specific effects of disease and other factors on the aging of individual organisms.

A quantitative model of aging was developed based on genome-wide DNA methylation patterns using measurements of 470,000 CpG markers from whole blood samples of a large population spanning a wide age range [3]. This method is highly accurate in predicting age and can also distinguish between relevant aging factors including gender, genetic variants and disease [3, 4]. The model works across multiple tissues, suggesting the possibility of a general molecular clock regulated in part by changes in the methylome. In addition, these methylation patterns are highly correlated with cellular decline and aging. Some genes have been observed to become increasingly methylated with increasing chronological age. How showed a model of aging,ELOVL2(Elongation Of Very Long Chain Fatty Acids-Like 2), in particular, very reliably shows an increase in methylation as a person ages [3].

ELOVL2 encodes a transmembrane protein involved in the synthesis of long (C22 and C24) ω3 and ω6 polyunsaturated fatty acids (VLC-PUFA) [5]. In particular, ELOVL2 is capable of converting docosapentaenoic acid (DPA) (22:5n-3) into 24:5n-3, which is the precursor of 22:6n-3, docosahexaenoic acid (DHA) [6]. DHA is the major polyunsaturated fatty acid (PUFA) in the retina and brain. Its presence in photoreceptors promotes healthy retinal function and protects against damage from bright light and oxidative stress. Low ELOVL2 expression has been associated with low DHA levels [7], which in turn, among many other retinal degenerative diseases, has been associated with age-related macular degeneration (AMD) [8]. In general, PUFAs are involved in key biological functions, including energy production, modulation of inflammation, and maintenance of cell membrane integrity. Therefore, it is possible that ELOVL2 methylation plays a role in the aging process through the regulation of various biological pathways.

AMD is a degenerative disease of the macula and a leading cause of blindness among older adults in developed countries. It is a multifactorial disease associated with genetic, environmental and metabolic factors, and there is currently no cure or effective prevention. A number of genes have been identified as risk factors, but many are still unknown. As AMD progresses, the center of vision becomes blurred and blind spots may form over time. AMD occurs in two forms: wet AMD and dry AMD. In dry AMD, which affects about 90% of AMD patients, focal deposition of acellular polymorphic debris called drusen is usually the first clinical sign of the disease observed. ELOVL4 , another fatty acid elongase involved in the synthesis of VLC-PUFA (very long chain polyunsaturated fatty acids), is involved in Stargardt macular degeneration, a juvenile form of macular degeneration causing vision loss [9, 10].

AMD has been associated with oxidative stress in the retina [11]. Oxidative stress can lead to inflammation and promote macrophage activation [12]. Oxidized phospholipids have been shown to be reliable markers of oxidative stress, and they initiate inflammation by binding to the retinal pigment epithelium (RPE) and macrophages, activating downstream inflammatory cascades [13]. Proteins and lipids modified by oxidation have also been found in drusen and Bruch's membrane [14]. Phosphatidylcholine, a highly enriched phospholipid in the retina, contains a head group phosphocholine. The oxidative epitope of phosphocholine can be recognized by the natural phosphocholine antibody, TEPC-15 [15], and has been shown to colocalize with drusen in human eyes with AMD [16]. HTRA1, one of the major AMD-associated proteins, has also been found to colocalize with drusen in eyes with AMD [17]. In addition, several components of the complement cascade, including complement fragments C3, C5 and the membrane attack complex C5b-9, have been found within drusen [18].

New treatments for age-related macular degeneration are needed.

SUMMARY OF THE INVENTION

This invention provides methods for treating age-related eye diseases and pathologies. In some embodiments, the methods include administering to a patient in need thereof an effective amount of one or more nucleic acid demethylating compounds. This invention provides methods for treating age-related eye diseases.

In embodiments, this invention contemplates that the age-related eye disease or pathology is age-related macular degeneration.

In embodiments, this invention contemplates that the selected demethylating compound is from the group consisting of 5-azacytidine, decitabine, zebularine, procainamide, procaine, hydralazine, valproic acid and EGCG.

In embodiments, this invention provides the preparation of a composition for ophthalmic administration.

In embodiments, this invention provides parenteral administration to the eye.

In embodiments, the present invention provides methods for treating an age-related ocular disease or pathology comprising increasing the expression of ELOVL2 in a patient in need thereof.

In embodiments, the present invention provides increased expression by demethylation of the ELOVL2 promoter.

In embodiments, the present invention provides an increase in expression by administering to a patient in need thereof an effective amount of ELOVL2 mRNA using adeno-associated virus delivery.

In embodiments, the present invention provides an ophthalmic pharmaceutical composition comprising a nucleic acid demethylating compound in an ophthalmologically acceptable preparation.

In embodiments, the present invention provides a selection of a demethylating compound from the group consisting of 5-azacytidine, decitabine, zebularine, procainamide, procaine and EGCG.

In other embodiments, the methods include administering an effective amount of ELOVL2 mRNA to a subject in need using adeno-associated virus delivery.

BRIEF DESCRIPTION OF GRAPHIC MATERIALS

Fig. 1A-1D show expression and methylation of ELOVL2 in WI-38 cells. Fig. Figure 1A shows ELOVL2 expression by qPCR in WI-38 cells at LP35, 45, 55. Higher % input shows higher DNA methylation. (**p <0.005 ANOVA, *p<0.05, t-test). Fig. 1B shows the level of methylation in the ELOVL2 promoter region in WI-38 cells by immunoprecipitation of methylated DNA followed by qPCR. The primers amplify the region containing the CpG markers cg16867657, cg24724428 and cg21572722. Fig. 1C shows the proliferation of WI-38 knockdown and luciferase knockdown control cells measured by surface area covered over time. Fig. 1D shows the percentage of senescence by beta-galactosidase staining in WI-38 knockdown cells. (n=3, *p <0.05, **p <0.005, t-test).

Fig. 2A-2C show manipulation of DNA methylation in UP52 WI-38 cells. Fig. 2A shows ELOVL2 promoter methylation measured by MeDIP followed by qPCR in untreated control and 5-azacytidine-treated WI-38 cells. Fig. 2B shows ELOVL2 expression by qPCR in untreated control and 5-azacytidine-treated WI-38 cells. Fig. 2C shows the percentage of senescence by beta-galactosidase staining in WI-38 cells treated with 2 μM 5-azacytidine. (n=3, *p <0.05, t-test).

Fig. 3A-3E show ELOVL2 and the retina. Fig. 3A shows ELOVL2 expression in mouse retina by qPCR in mice of different ages. Fig. 3B shows a Western blot of ELOVL2 in mouse retinas of different ages; asterisk - nonspecific stripe. Fig. Figure 3C shows methylation of the ELOVL2 promoter in the retina of mice of different ages. Fig. 3D shows autofluorescence imaging of wild-type mice at 2, 6, 12, and 24 months of age. Representative traces of rod ERG responses are shown below the images. Fig. 3E shows the rod response in mice of different ages as shown through ERG b-wave amplitude (n=4, **p<0.005, ANOVA).

Fig. 4A-4E show retinal phenotypes in ELOVL2 mutant mice. Fig. 4A shows a CRISPR-Cas9 mediated strategy to alter the substrate specificity of ELOVL2. Fig. 4A discloses SEQ ID NOS 17-20, respectively, in order of appearance. Fig. 4B shows autofluorescence imaging of the fundus of wild-type and homozygous mutant mice. Rod ERG responses are shown as graphs below the images. Fig. Figure 4C shows rod b-wave amplitude from the ERG in 6-month-old wild-type and frameshift mutant mice. Fig. 4D shows Htra1 and T-15 immunostaining in WT and C217W mouse retinas. Arrows indicate drusen-like aggregates. Fig. 4E shows quantification of drusen-like aggregates positive for HTRA1 and T-15. (n=4, *p<0.05, **p<0.005, t-test).

Fig. 5A-5D show injection of 5-azacytidine into mouse eyes. Fig. 5A shows methylation of ELOVL2 in mouse retinas following intraocular injection of PBS or 5-azacytidine using MeDIP. Fig. 5B shows ELOVL2 expression in retinas following intraocular injection of PBS or 5-azacytidine by qPCR. Fig. 5C shows the rod ERG response in mouse eyes following intraocular injection of PBS or 5-azacytidine. Fig. 5D shows the b-wave amplitude of the rods from the ERG. (n=4, *p<0.05, t-test).

Fig. 6A-6E show the aging characteristics of WI-38 cells. Fig. 6A shows proliferation of WI-38 cells measured by surface area covered at population doubling (PD) 35, 45, 55. FIG. 6B shows the percentage of senescence by beta-galactosidase staining in WI-38 cells. Fig. 6C shows representative images of cell morphology and beta-galactosidase staining of WI-38 cells. Fig. 6D shows illustrative images of cell morphology and beta-galactosidase staining of ELOVL2 knockdown WI38 cells compared to luciferase knockdown controls. Fig. 6E shows the efficiency of ELOVL2 knockdown in WI-38 cells by qPCR. (n=3, **p<0.005, t-test).

Fig. 7A-7E show the aging characteristics of IMR-90 cells. Fig. 7A shows IMR-90 cell proliferation as measured by surface area coverage at population doubling (PD) 35, 45, 55. FIG. 7B shows the percentage of senescence by beta-galactosidase staining in IMR-90 cells. Fig. 7C shows ELOVL2 expression by qPCR in IMR-90 cells. Fig. 7D shows the efficiency of ELOVL2 knockdown by qPCR in IMR-90 cells. Fig. 7E shows representative images of the morphology of ELOVL2 knockdown with luciferase knockdown control in IMR90 cells. (n=3, *p<0.05, **p<0.005, t-test).

Fig. 8A-8D show the characteristics of aging of WT mouse retinas. Fig. 8A shows autofluorescence images of WT mouse retinas at 2 months, 6 months, 1 year, and 2 years of age. Fig. 8B shows rod ERG responses in WT mice at 2 months, 6 months, 1 year, and 2 years of age. Fig. 8C shows ERG oscillatory potentials in 3-month-old and 2-year-old wild-type mice. Fig. 8D shows the 10 Hz flicker response from the ERG in 3-month and 2-year-old wild-type mice.

Fig. 9A-9B FIG. 9A shows MeDIP mouse retinas from Ames mice. A higher % of input indicates higher DNA methylation. Y=3 months WT mouse, O=2 years WT mouse, AY=3 months Ames mouse, AO=2 years Ames mouse. Fig. 9B shows ELOVL2 expression in Ames mice by qPCR. (n=3, *p <0.05, **p<0.005, t-test).

Fig. 10A-10E show ELOVL2-ELOVL5 mutated mice. Fig. 10A shows the amino acid sequence similarity between ELOVL2 and ELOVL5 in human and mouse. Red arrows indicate the C217W targeted mutation. Fig. 10A discloses SEQ ID NOs: 21-24, respectively, in order of appearance. Fig. 10B shows the target cleavage site for CAS9. Fig. 10C shows the sequence of the ELOVL2 reducing oligonucleotide (SEQ ID NO: 25). Fig. 10D shows the sequence alignment of the WT and C217W proteins. Mutations are highlighted in blue. Fig. 10D discloses SEQ ID NOS 26-29, respectively, in order of appearance. Fig. 10E shows untargeted analysis of ELOVL2 mutant mice. Fig. 10E shows SEQ ID NOs: 30, 31, 30 and 32, respectively, in order of appearance.

Fig. 11A-11D show the characteristics of aging of C217W mouse retinas. Fig. 11A shows autofluorescence images of WT and C217W mouse retinas at 4 months, 6 months, 8 months and 1 year of age. Fig. 11B shows rod ERG responses in WT mice compared to C217W mice at 4, 6, and 8 months of age. Fig. 11C shows ERG oscillatory potentials in wild type and frameshift mutant mice. Fig. 11D shows the 10 Hz flicker response from the ERG in wild type and frameshift mutant mice.

Fig. 12A-12D show the characteristics of drusen-like aggregates. Fig. 12A shows immunostaining of Htra1, C3 and C5b-9 in WT and C217W mouse retinas. Arrows indicate drusen-like aggregates. Fig. 12B shows the scores of drusen-like aggregates positive for C3 and C5b-9. Fig. 12C shows C3 immunostaining and WT and C217W mouse retinas. Arrows indicate drusen-like aggregates. Fig. 12D shows the scores of drusen-like aggregates positive for C3. (n=4, **p<0.005, t-test).

Fig. 13 shows the rod ERG response in mouse eyes injected with PBS and 5-azacytidine.

DETAILED DESCRIPTION OF THE INVENTION

All publications, patents and patent applications referenced herein are incorporated herein by reference to the same extent as if each individual publication, patent or patent application had been specifically and separately identified for inclusion by reference.

In accordance with this invention, unless otherwise indicated, the practice will use conventional methods of molecular biology (including recombinant methods), microbiology, cell biology, biochemistry and immunology, which are within the competence of specialists in the art. Such methods are fully described in the literature, for example, Molecular Cloning: A Laboratory Manual, 2 ^nd ed. (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987, and periodic updates); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); Remington, The Science and Practice of Pharmacy, 20 ^th ed., (Lippincott, Williams & Wilkins 2003), and Remington, The Science and Practice of Pharmacy, 22 ^th ed., (Pharmaceutical Press and Philadelphia College of Pharmacy at the University of the Sciences 2012).

When presenting elements of the present invention or preferred embodiments thereof, singular nouns, plural nouns, and the adjective "specified" are used to indicate that there are one or more elements. The terms "comprising", "including" and "having" are used to include and mean that there may be additional elements other than those listed.

The term “and/or” when used in a list of two or more items means that any of the listed items may be used alone or in combination with any one or more of the listed items. For example, the expression "A and/or B" is used to refer to one or both of A and B, that is, A alone, B alone, or A and B in combination. The expression "A, B and/or C" is used to refer to one A, one B, one C, A and B in combination, A and C in combination, B and C in combination, or A, B, and C in combination.

It should be understood that the aspects and embodiments of the present invention described herein include “consisting of” and/or “consisting essentially of” aspects and embodiments.

It should be understood that the description in range format is provided merely for convenience and brevity and should not be construed as strictly limiting the scope of the present invention. Therefore, the description of a range should be considered to specifically disclose all possible subranges as well as the individual numerical values within that range. For example, a description of a range such as 1 to 6 should be considered as specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6 etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5 and 6. This applies regardless of the width of the range. Values or ranges may also be expressed herein as “about”, from “about” one particular value and/or to “about” another particular value. When such values or ranges are expressed, other disclosed embodiments include the specified specific value, from one specific value and/or to another specific value. Likewise, when values are expressed as approximations using the preceding “about,” it should be understood that the particular value constitutes another embodiment. Additionally, it should be understood that a number of meanings are disclosed therein, and that each meaning is also disclosed herein as being "about" that particular meaning in addition to the meaning itself. In embodiments, “about” may be used to mean, for example, within 10% of a specified value, within 5% of a specified value, or within 2% of a specified value.

As used herein, the term “patient” or “subject” refers to the human or animal subject to be treated.

As used herein, the term “pharmaceutical composition” refers to pharmaceutically acceptable compositions, wherein the composition contains demethylating compound(s) and, in some embodiments, further includes a pharmaceutically acceptable carrier. In embodiments, the pharmaceutical composition may be a combination.

As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the federal or state government or listed in the United States Pharmacopoeia, another generally accepted pharmacopoeia in addition to other drugs that are safe for use in animals, particularly humans and/or mammals, not related to humans.

As used herein, the term “pharmaceutically acceptable carrier” refers to an excipient, diluent, preservative, solubilizer, emulsifier, adjuvant and/or carrier with which the demethylating compound(s) is administered. Such carriers may be sterile liquids such as water and oils, including oils of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents . Antibacterial agents such as benzyl alcohol or methylparabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and tonicity adjusting agents such as sodium chloride or dextrose may also be carriers. Methods for preparing the compositions in combination with carriers are known to those skilled in the art. In some embodiments, the term “pharmaceutically acceptable carrier” is used to include any and all solvents, dispersion media, coatings, isotonic agents and absorption retarding agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. See, for example, Remington, The Science and Practice of Pharmacy, 20 ed. (Lippincott, Williams & Wilkins 2003). Such use in the compositions is intended unless any conventional vehicle or agent is incompatible with the active compound.

As used herein, "therapeutically effective" refers to an amount of demethylating compound(s) that is sufficient to treat or alleviate, or in any way reduce, symptoms associated with age-related eye diseases, such as, but not limited to, age-related macular disease degeneration (AMD). When used with reference to the method, the method is sufficiently effective for treating or alleviating or otherwise reducing symptoms associated with age-related eye diseases. For example, an effective amount for age-related eye diseases is one that is sufficient to block or prevent onset; or once pathological disease has begun, to mitigate, alleviate, stabilize, reverse or slow the progression of disease or to otherwise reduce the pathological effects of disease. In any case, an effective amount may be administered in single or divided doses.

As used herein, the term “treatment” encompasses at least an improvement in symptoms associated with age-related ocular diseases in a patient, where improvement is used broadly to mean at least a decrease in the magnitude of a parameter, such as a symptom, associated with the disease or pathology being treated . Thus, "treatment" also includes situations where the disease, disorder or condition, or at least the symptoms associated therewith, are completely suppressed (eg, prevented) or stopped (eg, stopped), such that the patient no longer suffers from the pathology, or at least from the symptoms that characterize the pathology.

The term “combination” refers to either a fixed combination in one unit dosage form or a set of parts for combined administration, where one or more demethylating compounds and a combination partner (for example, another drug, as explained below, also referred to as a “therapeutic agent " or "adjuvant agent") can be administered independently at the same time or separately within time intervals. In some cases, combination partners demonstrate a cooperative effect, such as a synergistic effect. As used herein, the terms “co-administration” or “combination administration” or the like are used to cover the administration of a selected combination partner to a single subject in need thereof (eg, a patient), and are intended to include treatment regimens in which the agents are not necessarily administered in the same route or at the same time. As used herein, the term "pharmaceutical combination" means a product that is obtained by mixing or combining more than one active ingredient, and includes both fixed and non-fixed combinations of active ingredients. The term "fixed combination" means that the active ingredients, eg, a compound and a combination partner, are administered to a patient at the same time in the form of a single unit or dose. The term “unfixed combination” means that the active ingredients, e.g., a compound and a combination partner, are administered to a patient as separate units, either simultaneously, concurrently, or sequentially without any specific time restrictions, such administration providing therapeutically effective levels of the two compounds in the patient's body. The latter also applies to cocktail therapy, for example the administration of three or more active ingredients.

Macular degeneration is a clinical term used to describe a family of diseases that are characterized by progressive loss of central vision associated with abnormalities of Bruch's membrane, choroid, neural retina, and/or retinal pigment epithelium. _{In the center of the retina there is a yellow spot measuring about 1/3 to 1/2 cm} ^{in diameter} . The spot provides detailed vision, especially in the center (fovea) because the cones have a higher density. Blood vessels, ganglion cells, inner nuclear layer and cells, and plexiform layers are shifted to one side (rather than sitting above them), thereby allowing light a more direct path to the cones. Beneath the retina is the choroid, a collection of blood vessels embedded in fibrous tissue, and the pigment epithelium (PE), which covers the choroid layer. Choroidal blood vessels provide nutrition to the retina (in particular its visual cells). The choroid and PE are located at the back of the eye.

Age-related macular degeneration (AMD), the most common macular degeneration, is associated with progressive loss of visual acuity in the central visual field, changes in color vision, and abnormal dark adaptation and sensitivity. Two main clinical manifestations of AMD have been described: the dry or atrophic form and the wet or exudative form. The dry form is associated with atrophic death of cells in the central retina or macula, which are essential for good vision used for activities such as reading, driving or recognizing faces. About 10-20% of these patients with dry AMD progress to a second form of AMD, known as wet AMD.

Wet (neovascular/exudative) AMD is caused by abnormal growth of blood vessels behind the retina under the macula and vascular leakage, leading to retinal displacement, hemorrhage, and scarring. This results in poor vision over a period of months to years. However, patients can quickly lose their vision. All cases of wet AMD arise from progressive dry AMD. The wet form accounts for 85% of blindness caused by AMD. In wet AMD, as blood vessels leak fluid and blood, scar tissue forms that destroys the central retina.

Glaucoma is a leading cause of blindness. Although the term glaucoma is applied to a wide variety of eye diseases, common to all types of glaucoma is a phenomenon in which the pressure inside the eye increases, causing destruction of the optic nerve. In most forms of glaucoma, the increase in pressure is not felt by the person, such as pain or decreased visual acuity, until significant vision loss occurs. In a healthy eye, fluid (aqueous humor) passes from the anterior chamber through a filter-like mass of tissue (trabecular meshwork) and from there into a connected series of veins in the sclera. In the most common form of glaucoma (open-angle glaucoma), increased pressure occurs as a result of blockage of the outflow pathway through the trabecular meshwork. There are two main forms of treatment for glaucoma: medication and surgery.

Diabetes is the fourth leading cause of death, affecting 16 million Americans, a third of whom are undiagnosed, and costs more than $100 billion annually, accounting for 15% of the U.S. health care budget. About 800,000 new cases of diabetes are diagnosed every year. By 2030, their number could reach 50 million in the United States and at least 300 million worldwide. Diabetes mellitus is the leading cause of new blindness among people aged 20 to 74 years in the United States. Soon after diagnosis of insulin-dependent diabetes mellitus (IDDM), retinopathy begins to develop, and after 15 years the prevalence is almost 100%. One million people in the United States have IDDM or type 1 diabetes. Today, with 15 million non-insulin-dependent diabetes mellitus (NIDDM) or type 2 diabetes, about 21% of patients have retinopathy at diagnosis and 60% after 20 years. The number of people with type 2 diabetes has tripled over the past 30 years, and includes half of Americans over 65 years of age. Proliferative retinopathy occurs in 10-20% of NIDDM cases. Brechner R J, et al, JAMA 1993;270:1714-1718.

Macular degeneration, or age-related macular degeneration (AMD), affects the central part of the retina and is the leading cause of blindness in people over 65 in the United States. AMD affects 13 million people and causes impairment in about 1.2 million. About 30% of patients over 75 years of age have AMD, and the remaining 23% will develop it within five years. The prevalence of AMD increases with age: from 16.8% in patients 55-64 years of age to 25.6% in patients 65-74 years of age and to 42% in patients over 75 years of age. There is currently no known cure for dry or atrophic AMD, a form characterized by hard or soft drusen (deposits of cellular debris), changes in the retinal pigment epithelium (RPE), or atrophy of the photoreceptors and RPE. This form accounts for approximately 90% of all cases. In other cases of AMD, a “wet” form is observed, characterized by neovascularization and exudation. Pratt S G, Review of Ophthalmology August 1998:42-50.

This invention relates to demethylating agents for the treatment of pathologies or diseases associated with the eye, such as age-related macular degeneration (AMD), diabetic retinopathy, ocular angiogenesis (for example, ocular neovascularization affecting choroidal, corneal or retinal tissue) and other ocular pathologies associated with methylation of genes such as ELOVL2 . Treatment for AMD includes both dry and wet forms of AMD.

This invention provides a method of treating, ameliorating, or preventing an age-related ocular disease or pathology, comprising administering to a subject in need of treatment an effective amount of at least one demethylating agent.

In embodiments, the present invention provides that the demethylating agent increases the expression of the very long chain fatty acid elongation type 2 gene ( ELOVL2 ) and/or increases the level of the ELOVL2 enzyme and/or increases the level of 22:6(n-3) docosahexaenoic acid ( DHA) and 22:5(n-6) docosapentaenoic acid (DPA) in the retina.

In embodiments, the present invention provides that the demethylating agent is selected from 5-azacytidine, decitabine, zebularine, procainamide, procaine, hydralazine, valproic acid and epigallocatechin gallate (EGCG).

In embodiments, the present invention provides that the demethylating agent is administered to the eye via the intravitreal, subretinal, subconjunctival, subtenon, or posterior juxtascleral route.

In embodiments, the present invention provides that the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision, or dry eye.

In embodiments, the present invention provides that the demethylating agent is administered as a slow release formulation.

In embodiments, the present invention provides a method of treating, ameliorating, or preventing age-related eye disease or pathology, comprising increasing the level of the ELOVL2 enzyme and/or the level of 22:6(n-3) docosahexaenoic acid (DHA) and 22:5(n-3) 6) docosapentaenoic acid (DPA) in the eye by introducing into the eye an effective amount of mRNA encoding ELOVL2; wherein the mRNA is delivered using a viral vector.

In embodiments, the present invention provides that the viral vector is selected from: an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a vaccinia virus vector, and a retroviral vector.

In embodiments, the present invention provides that the mRNA is delivered using a non-viral vector, such as a liposome or micro/nanoparticle.

In embodiments, the present invention provides that the agent is administered to the eye via the intravitreal, subretinal, subconjunctival, subtenon, or posterior juxtascleral route.

In embodiments, the present invention provides that the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision, or dry eye.

In embodiments, the present invention provides a method of treating, ameliorating, or preventing age-related eye disease and pathology, comprising increasing the level of the enzyme ELOVL2 in the eye and/or the level of 22:6(n-3) docosahexaenoic acid (DHA) and 22:5 (n-6) docosapentaenoic acid (DPA) in the eye, by gene therapy using the ELOVL2 expression vector.

In embodiments, the present invention provides that the vector is selected from: an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a vaccinia virus vector, and a retroviral vector.

In embodiments, the present invention provides that the ELOVL2 expression vector is administered via the intravitreal, subretinal, subconjunctival, subtenon, or posterior juxtascleral route.

In embodiments, the present invention provides that the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision, or dry eye; and wherein the age-related eye disease is dry AMD.

In embodiments, the present invention provides a method including selecting a patient in need of treatment for an age-related eye disease and administering to the patient's eye an effective amount of one or more demethylating agents and/or mRNA encoding ELOVL2 and/or an ELOVL2 expression vector. thereby curing this age-related disease.

In embodiments, the present invention provides that a patient is selected by determining ELOVL2 methylation and/or ELOVL2 expression in the patient's eye.

In embodiments, the present invention provides that the demethylating agent is decitabine.

In embodiments, the present invention provides that the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision, or dry eye; and wherein the age-related eye disease is dry AMD.

In embodiments, the present invention provides a method including the use of mRNA encoding ELOVL2 in the treatment of an age-related eye disease, optionally dry AMD.

In embodiments, the present invention provides a method comprising the use of an ELOVL2 expression vector in the treatment of an age-related eye disease, optionally dry AMD.

In embodiments, the present invention provides a formulation containing a specified concentration of a demethylating agent, wherein intravitreal administration of 1 μL to 100 μL constitutes an effective amount of 5 ng to 500 ng.

In embodiments, the present invention provides a formulation containing a specified concentration of a demethylating agent, wherein intravitreal administration of 1 μl to 100 μl constitutes an effective amount of 500 to 1500 ng.

In embodiments, the present invention provides a formulation containing a specified concentration of a demethylating agent, wherein intravitreal administration of 1 μl to 100 μl constitutes an effective amount of 1500 to 4500 ng.

In embodiments, the present invention provides that the formulation is substantially aqueous. In embodiments, the present invention provides that the formulation is substantially anhydrous. In embodiments, the present invention provides that the formulations are slow release and/or sustained release.

In embodiments, the present invention provides that the demethylating agent is decitabine.

In embodiments, the present invention provides a method for preparing a medicament for administration.

Unless otherwise specified, all technical and scientific terms and any abbreviations used herein have the same meanings as commonly understood by one skilled in the art of the invention. Although any methods and materials similar or equivalent to those described herein may be used in the practice of this invention, exemplary methods, devices and materials are described herein.

As used herein, unless otherwise indicated, the terms “prevent,” “prevention,” and “prevention” refer to preventing the occurrence, recurrence, or spread of a disease or disorder, or one or more symptoms thereof. In some embodiments, the terms refer to the treatment or administration of a compound or dosage form provided herein, with or without one or more other additional active agents, prior to the onset of symptoms, especially in subjects at risk of a disease or disorder provided herein. document. These terms cover the suppression or reduction of a symptom of a specific disease. In some embodiments, subjects with a family history of the disease are potential candidates for a prophylactic treatment regimen. In some embodiments, subjects who have a history of recurrent symptoms are also potential candidates for prophylaxis. In this regard, the term "prevention" can be used interchangeably with the term "preventative treatment".

As used herein, unless otherwise indicated, a “prophylactically effective amount” of a compound is an amount sufficient to prevent the disease or disorder, or prevent its recurrence. A prophylactically effective amount of a compound means an amount of a therapeutic agent, alone or in combination with one or more other agents, that exhibits a prophylactic effect in preventing disease. The term “prophylactically effective amount” may include an amount that improves overall prophylaxis or enhances the prophylactic effectiveness of another prophylactic agent. As used herein, unless otherwise noted, the term "subject" is defined herein to include animals such as mammals, including but not limited to: primates (e.g., humans), cows, sheep, goats, horses , dogs, cats, rabbits, rats, mice and the like. In specific embodiments, the subject is a human. The terms “subject” and “patient” are used interchangeably herein to refer, for example, to a mammalian subject such as a human. In certain embodiments, the subject suffering from AMD is a subject who has previously been diagnosed with age-related macular degeneration.

As used herein, and unless otherwise indicated, a compound described herein is used to cover all possible stereoisomers unless specific stereochemistry is indicated. Due to its low energy barrier, the compound can exist as a single tautomer or a mixture of tautomers. This may take the form of proton tautomerism; or so-called valence tautomerism in a compound, for example, which contains an aromatic moiety.

As used herein, and unless otherwise indicated, an analog such as cytidine referred to herein is used to cover the free base of a cytidine analog or a salt, solvate, hydrate, co-crystal, complex, predrug, precursor, metabolite and/or derivative thereof . In some embodiments, a cytidine analog referred to herein includes the free base of a cytidine analog or a salt, solvate, hydrate, co-crystal or complex thereof. In some embodiments, a cytidine analog referred to herein includes the free base of a cytidine analog or a pharmaceutically acceptable salt, solvate, or hydrate thereof.

Features of this invention are the use of agents to demethylate the ELOVL2 promoter, induce gene expression and improve visual function of a mammal using certain compounds such as 5-azacytidine, decitabine, zebularine, procainamide, procaine, procaine, epigallocatechin gallate, valproic acid, hydralazine and the like compounds and derivatives. Collectively they are described herein as a "demethylating agent".

In one embodiment, the demethylating agent is injected intraocularly, for example, by subconjunctival, intravitreal, subretinal or retrobulbar injection. For subconjunctival injection, concentrations ranging from about 1 ng/ml to about 500 μg/ml can be used. For intravitreal injection, concentrations ranging from about 1 μg/0.1 ml to about 1000 μg/0.1 ml can be used; one concentration that can be used is about 50 mcg/0.1 ml. For subretinal injection, concentrations ranging from about 1 μg/0.1 ml to about 100 μg/0.1 ml can be used. For retrobulbar injection, concentrations ranging from about 20 μg/ml to about 1000 μg/ml can be used. The demethylating agent can be introduced in an aqueous solution, for example associated with liposomes, or it can be dissolved in an organic solvent. In another alternative embodiment, the demethylating agent may also be provided in an inert physiologically acceptable carrier, such as a microsphere, liposome, capsule or polymer matrix, by injection or surgical implantation into or onto the eye. Aqueous solvents that may be used include, but are not limited to: 0.9% saline and 5% dextrose. Organic solvents that may be used include, but are not limited to: dimethyl sulfoxide (DMSO) or alcohol. The implant can provide a slow-release form of the demethylating agent to achieve a constant dose of medication. Also disclosed is a method of reducing the onset or progression of diabetic retinopathy, age-related macular degeneration and/or retinitis pigmentosa, by intraocular administration of a preparation containing a demethylating agent, alone or with other compounds that are related to the demethylating agent, as the active agent in a pharmaceutically acceptable preparation and in an effective amount without causing significant toxicity. The composition may contain a demethylating agent as the sole active agent, other agents being those that do not significantly affect the essential properties of the demethylating agent. Alternatively, in addition to the demethylating agent, the composition may contain other active agents. The composition may be injected by injection or implanted into the eye. The present invention provides a method of treating a patient by intraocular administration of a composition containing a demethylating agent as an active agent in a pharmaceutically acceptable preparation, and in an amount effective to treat macular degeneration, retinopathy, or retinitis pigmentosa without significant ocular toxicity. The composition is administered by injection or implantation into the eye and may be administered in a slow release form. A slow release formulation, such as a matrix, may carry an amount of demethylating agent that may be toxic if released at an uncontrolled rate, or in excess of therapeutic doses, but which is formulated to release a non-toxic therapeutic amount of demethylating agent over a period of time. For example, the matrix can contain from 1 microgram to more than 10 micrograms of detailing agent and can release a non-toxic maintenance dose of the demythylating agent over a long period of time. Such a matrix may be a reservoir with diffusion walls and may be a lipid, polyvinyl alcohol, polyvinyl acetate, polycaprolactone, poly(glycolic) acid and/or poly(lactic) acid.

The demethylating agent can be injected intraocularly using intravitreal (into the vitreous), subconjunctival (in the subconjunctival), subretinal (under the retina), or retrobulbar (behind the eyeball) injection. For subconjunctival injection, a concentration of the dermatizing agent ranging from about 1 ng/ml to about 500 μg/ml can be used. For intravitreal injection, a dose of the demethylating agent ranging from about 10.0 ng/0.1 ml to about 1000 μg/0.1 ml can be used. For retrobulbar injection, a dose of the demethylating agent ranging from about 20 μg/ml to about 1000 μg/ml can be used. For subretinal injection, a dose of the demethylating agent ranging from about 1 μg/0.1 ml to about 100 μg/0.1 ml can be used. However, these dosages are for immediate-release formulations, and longer-release formulations will require higher concentrations of the demethylating agent. The demethylating agent may be administered intraocularly in a composition in which it is the only active agent. Alternatively, the demethylating agent may be administered intraocularly in compositions with related compounds. Related compounds may include immunosuppressants, which include, but are not limited to: tacrolimus, cyclophosphamide, sirolimus, atoposide, thioepa, methotrexate, azathioprine (imuran), interferons, infliximab, etanercept, mycophenolate mofetil, 15-deoxyspergualine, thalidomide , glatiramer, leflunomide, vincristine, cytarabine, etc. In one embodiment, the composition containing the demethylating agent is administered in an amount or dosage that does not result in significant ocular toxicity. As used herein, absence of significant toxicity includes the absence of any toxicity as well as toxicity that would be considered insufficiently harmful by one skilled in the art to warrant reduction or discontinuation of treatment. The demethylating agent intravenous solution form can be diluted to achieve the indicated concentration using 0.9% NaCl or 5% dextrose or an organic solvent such as dimethyl sulfoxide (DMSO) or alcohol. Intraocular administration can be carried out by any of the previously described routes of administration and preparations. For injection, a solution, an emulsion, a suspension, a capsule composition of microspheres or liposomes, etc. can be used. The demelting agent can be surgically administered in the form of an ocular implant. As one example, a reservoir having a diffuse wall of polyvinyl alcohol or polyvinyl acetate and containing milligrams of a demethylating agent may be implanted in or onto the sclera. As another example, the milligram demethylating agent may be included in a polymer matrix having dimensions of about 2 mm by 4 mm and made from a polymer such as polycaprolactone, poly(glycolic) acid, poly(lactic) acid or a polyanhydride or lipid , such as sebacic acid, and can be implanted into the sclera or into the eye. This is usually achieved when the patient is given local or topical anesthesia and a small incision (3-4mm) is made behind the cornea. A matrix containing a demethylating agent is then inserted through the incision and sutured to the sclera using 9-0 nylon. The demethylating agent may be contained in an inert matrix for injection into the eye. As one example of an inert matrix, liposomes can be prepared from dipalmitoylphosphatidylcholine (DPPC), such as egg phosphatidylcholine (PC), a lipid having low heat transfer. Liposomes are prepared using standard procedures known to those skilled in the art. A demethylating agent, in nanogram to microgram to milligram quantities, is added to the egg PC solution and the lipophilic drug binds to the liposomes. A slow release drug delivery system can be implanted intraocularly to provide sustained release of the active agent over a period of time. The implantable structure can be in the form of a capsule of any of the previously described polymers (eg, polycaprolactone, poly(glycolic) acid, poly(lactic) acid, polyanhydride) or lipids, which can be prepared in the form of microspheres. As an illustrative example, the demethylating agent can be mixed with polyvinyl alcohol (PVA), the mixture then dried and coated with ethylene vinyl acetate, and then cooled again with PVA. In an intraocular injection formulation, the liposomal capsule is broken down due to cellular digestion and can be a slow-release drug delivery system, allowing the patient to be continuously exposed to the drug over an extended period. In a slow release formulation, the microsphere, capsule, liposome, etc. may contain a concentration of the demethylating agent that would be toxic if administered as a bolus dose. However, a slow-release administration is formulated so that the concentration released over any period of time does not exceed a toxic amount. This is achieved, for example, using various carrier preparations (coated or uncoated microspheres, coated or uncoated capsules, lipid or polymer components, single or multilayer structure and combinations of the above, etc.). Other variables may include patient pharmacokinetic-pharmacodynamic parameters (eg, body weight, gender, plasma clearance rate, liver function, etc.). Depending on the amount of demethylating agent that is offered in the drug, the patient may be dosed over several years with a single implant or injection. By way of illustrative and non-limiting examples, a capsule may be loaded with 1-2 mg of a demethylating agent; if the capsule is formulated to release a few micrograms of drug per day, a patient can be dosed for about 1,000 days, or nearly three years. As another example, if the capsule contained 5 mg of medication, the patient could be dosed for about fifteen years. Such a drug offers advantages that include precise dosing with increased patient convenience, since intervention in some cases is only required once or twice a decade or even less frequently. The preparation and loading of microspheres, microcapsules, liposomes, etc. and ocular implantation thereof are standard methods known to those skilled in the art, for example, the use of a ganciclovir slow release implant for the treatment of cytomegalovirus retinitis described in Vitreoretinal Surgical Techniques, Peyman et al. ,Eds. (Martin Dunitz. London 2001, chapter 45); Handbook of Pharmaceutical Controlled Release Technology, Wise, Ed. (Marcel Dekker, New York 2000), the relevant sections of which are incorporated herein by reference in their entirety. A demethylating agent, alone or in combination with other agents, can be administered intraocularly and without significant toxicity for the treatment of retinopathy, such as in patients with diabetes, macular degeneration and retinitis pigmentosa, using the methods and preparations described previously.

Provided herein are methods of treating an ocular disease, including AMD, using a cytidine analogue in the form of a salt, solvate, hydrate, precursor and/or derivative. Some of the methods proposed herein include treating an ocular disease using a combination of two or more active agents, including 5-azacytidine.

Nucleoside analogues have been tested in clinical trials for the treatment of some types of cancer, but not for the treatment of eye diseases. Nucleoside analogues 5-azacytidine (also known as 4-amino-1-β-D-ribofuranosyl-1,3,5-triazin-2(1H)-one; National Service Center designation NSC-102816; CAS registration number 320-67 -2; azacitidine; Aza and AZA; and currently marketed as VIDAZA®) and 2'-deoxy-5-azacytidine (also known as 5-aza-2'-deoxycytidine, decitabine, Dae and DAC, and currently marketed as DACOGEN®) are DNA methyltransferase (DNMT) inhibitors approved by the US Food and Drug Administration for the treatment of myelodysplastic syndromes (MDS). Azacitidine and decitabine are analogues of cytidine; the structural difference between these cytidine analogues and their related natural nucleosides is the presence of a nitrogen at position 5 of the cytosine ring instead of a carbon. Azacitidine can be defined as having the molecular formula C8Hi2N4O5, a molecular weight of 244.21 g per mole, and the structure shown below. Decitabine can be defined as having the molecular formula C8Hi2N4O4, and a molecular weight of 228.21 g per mole.

In one embodiment, the methods provided herein include the administration or simultaneous administration of one or more cytidine analogues. In some embodiments, the cytidine analog is 5-azacytidine (azacytidine). In some embodiments, the cytidine analog is 5-aza-2'-deoxycytidine (decitabine). In some embodiments, the cytidine analogue is 5-azacytidine (azacytidine) or 5-aza-2'-deoxycytidine (decitabine). In some embodiments, the cytidine analogue is, for example: 1-β-D-arabinofuranosylcytosine (cytarabine or ara-C); pseudoisocytidine (psi ICR); 5-fluoro-2'-deoxycytidine (FCdR); 2'-deoxy-2',2'-difluorocytidine (gemcitabine); 5-aza-2'-deoxy-2',2'-difluorocytidine; 5-aza-2'-deoxy-2'-fluorocytidine; 1-β-D-ribofuranosyl-2(1H)-pyrimidinone (zebularine); 2',3'-dideoxy-5-fluoro-3'-thiacytidine (Emtriva); 2'-cyclocytidine (ancetabine); 1-β-D-arabinofuranosyl-5-azacytosine (phasarabine or ara-AC); 6-azacytidine (6-aza-CR); 5,6-dihydro-5-azacytidine (dH-aza-CR); N4-pentyloxycarbonyl-5'-deoxy-5-fluorocytidine (capecitabine); N4-octadecylcytarabine; or cytarabine elaidic acid. In some embodiments, cytidine analogs provided herein include any compound that is structurally related to cytidine or deoxycytidine and functionally mimics and/or antagonizes the action of cytidine or deoxycytidine.

Some embodiments of this document provide salts, co-crystals, solvates (eg, hydrates), complexes, prodrugs, precursors, metabolites and/or other derivatives of the cytidine analogues provided herein. For example, certain embodiments provide salts, cocrystals, solvates (eg, hydrates), complexes, precursors, metabolites, and/or other derivatives of 5-azacytidine. Some embodiments of this document provide salts, co-crystals and/or solvates (eg, hydrates) of the cytidine analogues provided herein. Some embodiments of this document provide salts and/or solvates (eg, hydrates) of the cytidine analogues provided herein. In some embodiments, cytidine analogs are provided that are not salts, co-crystals, solvates (eg, hydrates), or complexes of the cytidine analogs provided herein. For example, in certain embodiments, 5-azacytidine is provided in a non-ionized, non-solvated (eg, anhydrous) non-complexed form. Some embodiments of this document provide a mixture of two or more cytidine analogs provided herein. The cytidine analogs provided herein can be prepared using synthetic methods and procedures mentioned herein or otherwise available in the literature. For example, certain methods for synthesizing 5-azacytidine are disclosed, for example, in US Pat. No. 7,038,038 and the references discussed therein, each of which is incorporated herein by reference. Other cytidine analogs provided herein may be prepared, for example, using procedures known in the art, or may be purchased from a commercial source. In one embodiment, the compound used in the methods provided herein is a free base or a pharmaceutically acceptable salt or solvate thereof. In one embodiment, the free base or pharmaceutically acceptable salt or solvate is a solid. In another embodiment, the free base or pharmaceutically acceptable salt or solvate is a solid in amorphous form. In yet another embodiment, the free base or pharmaceutically acceptable salt or solvate is a solid in crystalline form. For example, certain embodiments provide 5-azacytidine in solid forms, which can be prepared, for example, by methods described in US Patent Nos. 6,943,249, 6,887,855, and 7,078,518, and US Patent Application Publications No. 2005/027675 2006/247189, and WO2010/ 093435, each of which is incorporated herein by reference in its entirety. In other embodiments, 5-azacytidine in solid forms can be prepared using other methods known in the art.

In one embodiment, the compound used in the methods provided herein is a pharmaceutically acceptable salt of a cytidine analogue, which includes, but is not limited to: acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate (besylate), bisulfate, butyrate, citrate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecyl sulfate, 1,2-ethane disulfonate (edisylate), ethanesulfonate (esylate), formate, fumarate, glucoheptanoate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydrochloride odid, 2-hydroxyethanesulfonate, lactate, maleate, malonate, methanesulfonate (mesylate), 2-naphthalene sulfonate (napsylate), nicotinate, nitrate, oxalate, 3-phenylsulfate, palmoate, pepropylate phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, tartrate , thiocyanate, tosylate, or undecanoate salts.

Pharmaceutical Compositions: In one embodiment of this document, provided are pharmaceutical compositions that contain one or more cytidine analogues or a pharmaceutically acceptable salt or solvate thereof as an active ingredient in combination with one or more pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition includes at least one non-release controlled excipient or carrier. In one embodiment, the pharmaceutical composition contains at least one release-controlled excipient or carrier and at least one non-release-controlled excipient or carrier.

In some embodiments, the cytidine analogue used in the pharmaceutical compositions provided herein is in solid form. Suitable solid forms include, but are not limited to, solid forms containing the free base of the cytidine analog and solid forms containing salts of the cytidine analog. In some embodiments, solid forms provided herein include polymorphs, solvates (including hydrates), and cocrystals containing a cytidine analogue and/or salts thereof. In some embodiments, the solid form is a crystalline form of a cytidine analog or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the pharmaceutical compositions provided herein can be formulated in various dosage forms for optical, intravitreal, parenteral and topical administration. Pharmaceutical compositions may also be formulated in modified release dosage forms, including delayed, extended, sustained release, slow, pulsed, controlled, accelerated and rapid, targeted, programmed release and gastric retention. These dosage forms can be prepared in accordance with conventional methods and techniques known to those skilled in the art (see, for example, Remington, The Science and Practice of Pharmacy, 21st Edition; Lippincott Williams & Wilkins: Philadelphia, PA, 2005; Modified -Release Drug Delivery Technology, Rathbone et al, eds., Drugs and the Pharmaceutical Science, Marcel Dekker, Inc.: New York, NY, 2003; Vol. 126). In one embodiment, the pharmaceutical compositions are provided in dosage form for intravitreal administration. In another embodiment, the pharmaceutical compositions are provided in dosage form for parenteral administration. In yet another embodiment, the pharmaceutical compositions are provided in dosage form for topical use.

In one embodiment, the pharmaceutical compositions provided herein may be administered topically to the eye or intravitreously in the form of inserts, injections, implants, pastes, powders, dressings, creams, patches, ointments, solutions, emulsions, suspensions, gels, foam or sprays. These dosage forms can be manufactured using conventional processes, as described, for example, in Remington, The Science and Practice of Pharmacy, supra. The topical pharmaceutical compositions provided herein can be formulated as immediate release or modified release, including delayed, slow, pulsed, controlled, targeted and programmed release.

Decitabine is currently being developed as a treatment for chronic myeloid leukemia (CML), myelodysplastic syndrome (MDS), non-small cell lung cancer (NSCLC), sickle cell disease and acute myelocytic leukemia (AML).

Decitabine may include a preparation containing: (a) a compound of the formula shown in figure imgf000003_0001 of WO2013033176, or a pharmaceutically acceptable salt thereof; dissolved in (b) a substantially anhydrous solvent containing from about 45% to about 85% propylene glycol; from about 5% to about 45% glycerol; and 0% to about 30% ethanol. In some embodiments, said solvent contains from about 65% to about 70% propylene glycol; from about 25% to about 30% glycerol and from 0% to about 10% ethanol.

This invention provides a composition containing a demethylating agent and a pharmaceutically acceptable excipient or carrier. The term "pharmaceutically acceptable excipient or carrier" refers to the medium that is used to prepare the desired dosage form of the compound. The pharmaceutically acceptable excipient or carrier may include one or more solvents, diluents, or other liquid carriers; means for dispersing or suspending; surfactants; isotonic agents; thickeners or emulsifiers; preservatives; solid binders; lubricants; etc. Remington's Pharmaceutical Sciences, Fifteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1975) and Handbook of Pharmaceutical Excipients, Third Edition, A. H. Kibbe ed. (American Pharmaceutical Assoc. 2000), disclose various carriers used in the formulation of pharmaceutical compositions and known methods for their preparation. In one embodiment, the pharmaceutically acceptable excipient is not harmful to a mammal (eg, a human patient) when administered to the eye (eg, by intraocular injection). For intraocular administration, for example, but not limitation, the therapeutic agent can be administered in balanced salt solution (BSS) or balanced salt solution plus (BSS plus) (Alcon Laboratories, Fort Worth, Texas, USA). In a related aspect, the present invention provides a sterile container, eg a vial, containing a therapeutically acceptable demethylating agent, optionally a lyophilized preparation.

Another embodiment of the present invention relates to the administration of nucleic acid constructs that are capable of inhibiting methylation through gene therapy.

WO 2001/58494 is directed to the treatment or prevention of an ocular disease, such as age-related macular degeneration, by contacting an ocular cell with an expression vector containing a nucleic acid sequence encoding an angiogenesis inhibitor and a neurotrophic agent. In specific embodiments, the angiogenesis inhibitor and the neurotrophic agent are the same thing, for example, pigment epithelial factor (PEF). WO 2002/13812 relates to the use of an insulin-sensitizing agent, preferably peroxisome proliferator-activated receptor-γ (PPRγ) agonists, for the treatment of an inflammatory disease, such as an ophthalmic disease. WO 200/52479 concerns the diagnosis, treatment and prevention of drusen-like disorders (any disorder that involves the formation of drusen), including AMD. In specific embodiments, there are methods relating to providing an effective amount of an agent that inhibits the proliferation or differentiation of immune cells, such as TNF-alpha antagonists.

In one aspect, the present invention provides methods of treating an individual with AMD (eg, an individual who has a polymorphism or haplotype indicating an increased risk of developing symptomatic AMD) or other disease involving the ELOVL2 methylation variant gene. In one embodiment, the method includes administering to a patient an agent that reduces the amount of an ELOVL2 methylation variant or the expression of a gene responsible for ELOVL2 methylation in an amount effective to reduce a symptom of the disease in the patient. In a related embodiment, the individual is administered a therapeutic amount of an inhibitor (eg, inactivator) of an ELOVL2 methylation variant polypeptide.

In one embodiment, an inhibitory nucleic acid (eg, RNA complementary to at least a portion of the nucleotide sequence of an ELOVL2 methylation variant polypeptide) is administered to the individual. In one embodiment, purified antisense RNA complementary to the RNA encoding the ELOVL2 methylation variant polypeptide is administered.

In another embodiment, a therapeutic amount of an antibody against the ELOVL-2 methylation protein is administered sufficient to partially inactivate the ELOVL2 methylation polypeptide variant in an individual.

In one aspect, the present invention provides gene therapy vectors comprising a nucleic acid encoding an ELOVL2 methylation polypeptide. The vector may include a promoter that drives expression of the ELOVL2 methylation gene in multiple cell types. Alternatively, the vector may include a promoter that directs expression of the ELOVL2 methylation gene only in certain cell types, such as retinal cells. In one aspect, pharmaceutical compositions are provided comprising a gene therapy vector encoding the ELOVL2 methylation protein and a pharmaceutically acceptable excipient, wherein the composition is pathogen-free and suitable for administration to a human patient. In one embodiment, the encoded ELOVL2 methylation polypeptide is a protective variant.

In one aspect, the present invention provides a composition comprising a recombinant or purified ELOVL2 methylation polypeptide, wherein the polypeptide is a protective variant.

In a related aspect, the present invention provides a pharmaceutical composition comprising a recombinant or purified ELOVL2 methylation polypeptide and a pharmaceutically acceptable excipient, wherein the composition is pathogen-free and suitable for administration to a human patient. In one embodiment, the encoded ELOVL2 methylation polypeptide has a wild-type sequence. In one embodiment, the encoded ELOVL2 methylation polypeptide is a protective variant.

In one aspect, the present invention provides antibodies that specifically interact with a variant ELOVL2 methylation polypeptide, but not with a wild-type ELOVL2 methylation polypeptide. These antibodies can be polyclonal or monoclonal and can be produced by subtractive methods. These antibodies may be sufficient to inactivate the methylation polypeptide variant ELOVL2 . In a related aspect, the present invention provides pharmaceutical compositions comprising an anti -ELOVL2 methylation antibody and a pharmaceutically acceptable excipient, wherein the composition is pathogen-free and suitable for administration to a human patient.

In one aspect, the present invention provides methods for identifying ELOVL2 protein methylation variants associated with an increased or decreased risk of developing AMD. In one embodiment, the present invention provides a method for identifying an ELOVL2 protective methylation protein by (a) identifying an individual as having a protective haplotype and (b) determining the ELOVL2 methylation amino acid sequence(s) encoded in the genome of the individual, wherein the ELOVL2 protective methylation protein is encoded by an allele , having a protective haplotype. In one embodiment, the present invention provides a method for identifying a neutral ELOVL2 methylation protein by (a) identifying an individual as having a neutral haplotype and (b) determining the ELOVL2 methylation amino acid sequence(s) encoded in the genome of the individual, wherein the neutral ELOVL2 methylation protein is encoded by an allele having a neutral haplotype. In a related embodiment, the present invention provides a method for identifying a variant form of ELOVL2 methylation associated with a reduced risk of developing AMD, comprising (a) identifying an individual as having a haplotype or diplotype associated with a reduced risk of developing AMD; (b) obtaining genomic DNA or RNA from an individual; and (c) determining the amino acid sequence(s) of ELOVL2 methylation encoded in the genome of the individual, wherein the protective ELOVL2 methylation protein is encoded by an allele having a haplotype associated with a reduced risk of developing AMD. In one embodiment, the protective or neutral ELOVL2 methylation proteins do not have the amino acid sequence of the wild-type ELOVL2 methylation polypeptide.

As will be understood by those skilled in the art, gene therapy vectors contain the necessary elements for transcription and translation of the inserted coding sequence (and may include, for example, a promoter, enhancer, other regulatory elements). Promoters can be constitutive or inducible. Promoters can be selected to target preferential gene expression in a target tissue such as the RPE (for recent reviews, see Sutanto et al., 2005, “Development and evaluation of the specificity of a cathepsin D proximal promoter in the eye” Curr Eye Res. 30:53-61; Zhang et al., 2004, “Concurrent enhancement of transcriptional activity and specificity of a retinal pigment epithelial cell-preferential promoter” Mol Vis. 10:208-14; Esumi et al., 2004, “ Analysis of the VMD2 promoter and implication of E-box binding factors in its regulation” J Biol Chem 279:19064-73; Camacho-Hubner et al., 2000, “The Fugu rubripes tyrosinase gene promoter targets transgene expression to pigment cells in the mouse" Genesis. 28:99-105; and references therein).

Suitable viral vectors include DNA viral vectors (such as adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, and vaccinia virus vectors) and RNA viral vectors (such as retroviral vectors). In one embodiment, an adeno-associated virus (AAV) vector is used. For recent reviews, see Auricchio et al., 2005, “Adeno-associated viral vectors for retinal gene transfer and treatment of retinal diseases” Curr Gene Ther. 5:339-48; Martin et al., 2004, Gene therapy for optic nerve disease, Eye 18:1049-55; Ali, 2004, “Prospects for gene therapy” Novartis Found Symp. 255:165-72; Hennig et al., 2004, “AAV-mediated intravitreal gene therapy reduces lysosomal storage in the retinal pigmented epithelium and improves retinal function in adult MPS VII mice” Mol Ther. 10:106-16; Smith et al., 2003, “AAV-Mediated gene transfer slows photoreceptor loss in the RCS rat model of retinitis pigmentosa” Mol Ther. 8:188-95; Broderick et al., 2005, “Local administration of an adeno-associated viral vector expressing IL-10 reduces monocyte infiltration and subsequent photoreceptor damage during experimental autoimmune uveitis” Mol Ther. 12:369-73; Cheng et al., 2005, “Efficient gene transfer to retinal pigment epithelium cells with long-term expression. Retina 25:193–201; Rex et al., “Adenovirus-mediated delivery of catalase to retinal pigment epithelial cells protects neighboring photoreceptors from photo-oxidative stress. Hum Gene Ther. 15: 960-7; and references cited therein).

Gene therapy vectors must be produced in accordance with Good Manufacturing Practices (GMP) to make the product suitable for administration to patients. The present invention provides gene therapy vectors suitable for administration to patients, including gene therapy vectors that are produced and tested in accordance with GMP requirements. Gene therapy vectors to be approved by the FDA must be tested for potency and identity, must be sterile, free of foreign materials, and all ingredients in the product (i.e., preservatives, diluents, adjuvants, etc.) must meet standards purity and quality, and not be harmful to the patient. For example, the nucleic acid preparation has been shown to be free of mycoplasmas. See, for example, Islam et al., 1997, An academic center for gene therapy research and clinical grade manufacturing capability, Ann Med 29, 579-583.

Methods for administering gene therapy vectors are known. In one embodiment, ELOVL2 expression vectors are administered systemically (eg, intravenously or by infusion). In one embodiment, ELOVL2 expression vectors are administered locally (i.e., directly into a specific tissue or organ, e.g., the eye. In one preferred embodiment, ELOVL2 expression vectors are administered directly into the eye (e.g., by ocular injection). For recent reviews, see , for example, Dinculescu et al., 2005, “Adeno-associated virus-vectored gene therapy for retinal disease” Hum Gene Ther. 16:649-63; Rex et al., 2004, “Adenovirus-mediated delivery of catalase to retinal pigment epithelial cells protect neighboring photoreceptors from photo-oxidative stress" Hum Gene Ther. 15:960-7; Bennett, 2004, "Gene therapy for Leber congenital amaurosis" Novartis Found Symp. 255:195-202; Hauswirth et al., "Range of retinal diseases potentially treatable by AAV-vectored gene therapy” Novartis Found Symp. 255:179-188, and references cited therein).

Thus, in one aspect, the present invention provides a formulation comprising a gene therapy vector encoding an ELOVL2 protein or an ELOVL2 polypeptide, optionally a viral vector, wherein the gene therapy vector is suitable for administration to a human subject and in a vehicle suitable for administration to a human subject (e.g. , produced using GLP methods). Optionally, a gene therapy vector containing a promoter that is preferentially or specifically expressed in retinal pigmented epithelial cells.

Methods for preventing and treating orbital disorders associated with ocular aging in mammals may include applying a topical composition containing a penetration enhancing amount, one or more penetration enhancers, and one or more biologically active agents that penetrate underlying tissues. and into the orbital vasculature. The purpose of this method is to prevent and treat eye diseases such as macular degeneration, as well as cataract formation, glaucoma and diabetic retinopathy.

To increase the permeability of the skin to a pharmacologically active agent, drug delivery to the eye can be facilitated by a penetration enhancer or penetration enhancer, which increases the rate at which the drug diffuses through the skin and enters the tissues and bloodstream. A chemical skin penetration enhancer increases skin permeability by reversibly changing the physicochemical nature of the stratum corneum, reducing its diffusion resistance.

Many chemical compounds are known to enhance skin penetration. Most compounds are generally recognized as safe (GRAS) ingredients that are often considered inert by formulators. Osborne D W, Henke J J, Pharmaceutical Technology, Nov. 1997, pp. 58-86. Compounds cited in the article are incorporated by reference. Examples of penetration enhancers include: alcohols such as ethanol and isopropanol; polyols such as n-alkanols, limonene, terpenes, dioxolane, propylene glycol, ethylene glycol, other glycols and glycerin; sulfoxides such as dimethyl sulfoxide (DMSO), dimethylformamide, methyl dodecyl sulfoxide, dimethyl acetamide; esters such as isopropyl myristate/palmitate, ethyl acetate, butyl acetate, methyl propionate and capric/caprylic triglycerides; ketones; amides such as acetamides; oleates such as triolein; various surfactants such as sodium lauryl sulfate; various alkanoic acids such as caprylic acid; lactam compounds such as azone; alkanols such as oleyl alcohol; dialkylaminoacetates and mixtures.

A number of patents disclose the use of penetration enhancers for transdermal drug delivery. US Patent No. 5,837,289 discloses the use of at least two separate penetration enhancers in a cream to deliver an extensive list of drugs. US Patent No. 5,238,933 discloses a skin penetration enhancer composition containing a lower aliphatic ester of a lower aliphatic carboxylic acid in combination with a lower alkanol to introduce the active agent. US Patent No. 5,229,130 discloses a plant oil-based skin penetration enhancer for delivering active agents through the skin. US Patent No. 4,933,184 discloses a transdermal composition in which methanol is used to deliver drugs, either sequentially or simultaneously. US Pat. No. 4,342,784 discloses a method for topical administration of a DMSO gel and a carboxypolymethylene resin with a neutralizing agent to cause the skin salt to break down the gel to release DMSO. US Patent No. 5,482,965 discloses a transdermal composition containing dioxane. US Patents No. 5,620,980 and No. 5,807,957 disclose the use of dioxolane and urethane to treat hair loss.

In one aspect, transconjunctival penetration of Demethylating Agents and therapeutic, pharmaceutical, biochemical and biological agents or compounds can be facilitated by enhancers that can be used to further accelerate the penetration of these agents into the anterior chamber, trabecular meshwork, ciliary body, choroid and retina. Not only do permeation enhancers effectively permeate a membrane, but these enhancers also allow other biologically active agents to pass through a particular membrane more efficiently. Penetration enhancers exert their effects in a variety of ways, such as by disrupting the cellular layers of the conjunctival sac surface that interact with intracellular proteins and lipids, or by improving the distribution of bioactive agents upon contact with mucosal membranes.

With the help of these amplifiers, macromolecules up to 10 kDa can pass through the layers of the conjunctival sac of the eye, reaching the site of glaucoma, where the blood vessels and retina undergo pathological changes. These enhancers must be non-toxic, pharmacologically inert, non-allergic substances. In general, these enhancers may include anionic surfactants, urea, fatty acids, fatty alcohols, terpenes, cationic surfactants, nonionic surfactants, zwitterionic surfactants, polyols, amides, lactam, acetone , alcohols and sugars. In one aspect, penetration enhancer 10 includes dialkyl sulfoxides such as dimethyl sulfoxide (DMSO), decyl methyl sulfoxide, dodecyl dimethylphosphine oxide, octyl methyl sulfoxide, nonyl methyl sulfoxide, undecyl methyl sulfoxide, sodium dodecyl sulfate and phenylpiperazine, or any combination. In another aspect, the penetration enhancer may include lauryl alcohol, diisopropyl sebacate, oleyl alcohol, diethyl sebacate, dioctyl sebacate, dioctyl azelate, hexyl laurate, ethyl caprate, butyl stearate, dibutyl sebacate, dioctyl adipate, propylene glycol dipelargonate, ethyl laurate, butyl laurate, ethyl myristate, butyl amide ristate, isopropyl palmitate, isopropyl isostearate, 2 -ethylhexyl pelargonate, butyl benzoate, benzyl benzoate, benzyl salicylate, dibutyl phthalate or any combination. In one aspect, the skin permeation enhancer is at least greater than 1% weight per volume, weight per weight, or mole percent.

In another aspect, the mucosal permeation enhancer may be at least greater than 1.5%, 2.0%, 2.5%, 3.0%. 3.5%. 4.0%. 4.5% to 50% weight per volume, weight per weight, or mole percent. In one aspect, the mucosal permeation enhancer is dimethyl sulfoxide. In this aspect, the amount of dimethyl sulfoxide may be from 2% to 10%. From 2% to 9.5%. From 3% to 8%. 3% to 7% or 4% to 6% w/v, w/w, mole percent, or any effective therapeutic amount.

The therapeutic preparation may also contain non-toxic emulsifying, preservative, moisturizing agents, body agents such as, for example, polyethylene glycols 200, 300, 400 and 600, carbowax 1000, 1500, 4000, 6000 and 10000, antibacterial components such as quaternary ammonium compounds , phenylmercury salts which are known to have cold sterilization properties and which are not harmful when used, methyl and propylparaben, benzyl alcohol, phenylethanol, buffer ingredients such as sodium borate, sodium acetates, gluconate buffers and other common ingredients such such as sorbitan monolaurate, triethanolamine, oleate, polyoxyethylene sorbitan monopalmitate, sodium dioctyl sulfosuccinate, monothioglycerol, thiosorbitol, ethylenediamine tetracitate. In addition, suitable ophthalmic carriers can be used as carriers for the present purpose, including conventional phosphate buffered carrier systems, isotonic boric acid carriers, isotonic sodium chloride carriers, isotonic sodium borate carriers, and the like.

The demethylation agent therapeutic agent formulation may also contain surfactants such as polysorbate surfactants, polyoxyethylene surfactants (BASF Cremaphor), phosphonates, saponins and polyethoxylated castor oils and polyethoxylated castor oils, which are commercially available.

The pharmaceutical preparation may also contain wetting agents already used in ophthalmic solutions, such as arboxymethylcellulose, hydroxypropylmethylcellulose, glycerin, mannitol, polyvinyl alcohol, or hydroxyethylcellulose, and the diluting agent may be water, distilled water, sterile water, or artificial tears. The wetting agent is present in an amount of from about 0.001% to about 10%.

The ophthalmic preparation of the present invention may include acids and bases for pH adjustment; tonicizing agents such as sorbitol, glycerol and dextrose; other viscosity imparting agents such as sodium carboxymethylcellulose, polyvinylpyrrdidone, polyvinyl alcohol and other resins; suitable absorption enhancers such as surfactants, bile acids; stabilizing agents such as antioxidants such as bisulfites and ascorbates; metal chelating agents such as sodium EDTA; and drug solubility enhancers such as polyethylene glycols. These additional ingredients help create stable commercial solutions so they do not need to be mixed as needed.

Ophthalmic drug compositions will be formulated to be compatible with the eye and/or contact lenses. The eye drop preparation must be isotonic with blood. Because ophthalmic compositions are intended for direct application to the eye, they will be formulated to have a pH and tonicity compatible with the eye. This typically requires a buffer to maintain the pH of the composition at or near physiological pH (eg, 7.4) and may require a tonicity agent to bring the osmolality of the composition to or around 210-320 millimoles per kilogram (mOsm/kg).

EXAMPLES

The WI-38 and IMR-90 cell lines have previously been described as widely used models for studying cellular senescence. Both cell lines have been shown to exhibit significant changes in phenotype over time and population doublings (PD) [19, 20]. Their growth rate, measured as confluency using imaging software, decreases markedly from lower to higher UP (Figures 6A and 7A). The percentage of senescence-positive cells, measured by senescence-associated beta-galactosidase (AC-β-Gal) staining, increases as the SI increases ( Fig. 6B and Fig. 7B ), and their morphology changes from a more elongated shape to a more elongated shape. wide, flat shape (Fig. 6C).

Studies of methylation profiles during human aging have shown that promoter region methylationELOVL2, of course, most significantly correlates with age [3]. To study changes in promoter methylation levelsELOVL2 methylated DNA immunoprecipitation (MeDIP) was used in senescent WI38 and IMR90 cells. Primers were designed to contain the specific CpGs described in Table 1. Using this approach, promoter methylation was found to increase with increasing cell population doubling (Figure 1A). Since methylation of the promoter region was previously shown to inhibit transcription [21], it was investigated whether the level of expression correlatesELOVL2 back with promoter methylationELOVL2. Using qRT-PCR, gene expression levels were found to decrease with increasing number of UPs (Figure 1B and Figure 7C), leading to the conclusion that expressionELOVL2is suppressed in aging cells, which is accompanied by an increase in promoter methylationELOVL2 and the percentage of senescent cells in culture.

It was investigated whether modulation of ELOVL2 expression could influence cellular senescence. First, using lentiviral shRNA, ELOVL2 expression in WI-38 and IMR-90 cells was knocked down (Figure 6E and Figure 8D), and a significant decrease in proliferation rate was observed (Figure 1C), as well as an increase in the number of senescent cells in culture detected by AC-β-Gal staining (Fig. 1D) and morphological changes consistent with high UP cells (Fig. 6D). All observations together showed an increase in the measured age of fibroblasts.

The effect of ELOVL2 promoter methylation level on ELOVL2 expression was tested. WI-38 fibroblasts were treated with 5-aza-2'-deoxycytidine (5-azacytidine), a cytidine analogue that inhibits DNA methyltransferase [22]. Cells were treated with 2 μM 5-azacytidine for 2 days and then cultured for 5 days without compound. At the end of the experiment , ELOVL2 expression was measured by qRT-PCR. Following treatment with 5-azacytidine, ELOVL2 promoter methylation was found to be decreased (Figure 2A), whereas ELOVL2 expression was increased (Figure 2B). Moreover, a lower percentage of senescent cells was observed in culture after treatment with 5-azacytidine (Figure 2C). These data suggest that decreased ELOVL2 promoter methylation has a positive effect on ELOVL2 expression and measured fibroblast age.

Vision is one of the main predictors of aging. Visual contrast sensitivity was one of the top five individual predictors of age among 377 measures assessed [23]. ELOVL proteins are highly expressed in the eye, and some of them have been implicated in ocular diseases [9, 24]. However, in the methylation model, only ELOVL2 contains methylation marks that are highly correlated with age [3]. Therefore, it was investigated whether the expression level of ELOVL2 in wild-type (C57BL/6) mouse retinas changes with age. Using qPCR and Western blotting, it was found that, similar to data for aging human fibroblasts, the level of ELOVL2 expression was inversely correlated with the age of the animal (Fig. 3A and 3B). Most importantly, MeDIP analysis showed that methylation of the ELOVL2 promoter in the retina increases with animal age (Figure 3C).

In parallel, ELOVL2 promoter methylation levels and mRNA expression were examined in retinas excised from Ames dwarf mice ( Prop1 ^df ), which live significantly longer and exhibit many symptoms of delayed aging compared with wild-type mice [25, 26]. ELOVL2 promoter methylation and increased expression were shown to be lower in the retinas of aged Ames dwarf mice compared to aged wild-type mice (Figure 9). This suggests that ELOVL2 expression and methylation may indicate animal health.

It was determined whether visual abilities and eye structure change over the course of the animal's age. First, structural changes were determined using fundus autofluorescence imaging of wild-type C57BL/6 mice at 2 months, 6 months, 1 year, and 2 years of age. It was observed that autofluorescent punctate aggregates begin to appear in the fundus at the age of 1 year and become very prominent at the age of 2 years (Fig. 3D and Fig. 8A). Electroretinogram (ERG) analysis was then performed to determine the visual function of aging mice. As mice age, the number and sensitivity of rods decreases [27]. Indeed, older mice showed reduced rod ERG response amplitude (Figures 3D and 3E).

To investigate whether ELOVL2 plays a role in eye aging and visual performance, ELOVL2 mutant C57BL/6 mice were generated using CRISPR-Cas9 coupled with homologous recombination. Because ELOVL2 knockout mice exhibited reduced fertility [28], ELOVL2 mutant mice were produced instead, encoding a cysteine to tryptophan substitution (C217W), which was shown to change the substrate specificity of ELOVL2 to that of ELOVL5 , effectively disrupting the unique ability of ELOVL2 convert C22 omega-3 PUFA docosapentaenoic acid (DPA) (22:5n-3) to 24:5n-3 [6]. Two gRNAs were designed to target ELOVL2 near codon 217 and a reducing donor olinucleotide with a base pair mutation to generate the C217W mutant, along with silent mutations to disrupt the guide sequence and the protospacer-adjacent motif sequence to prevent re-cleavage after editing . nRNA, reducing oligonucleotide, and Cas9 mRNA were injected into zygotes of C57BL/6N mice (Figure 4A and Figures 10A-10D). One homozygous founder with a correctly introduced mutation in one of the nRNAs was identified. No off-target mutations were detected (Fig. 10E). Homozygous C217W mice developed normally without exhibiting obvious phenotypes.

It was then examined whether eye structure and visual characteristics were altered in the C217W mutant. Interestingly, in ELOVL2 mutant mice, autofluorescent aggregates appear in the fundus at just 6 months of age, much earlier than in wild-type mice (Figure 4B and Figure 3D), indicating that normal ELOVL2 activity is critical for maintaining retinal health . This phenotype was consistently observed in mutant animals at 4, 6, 8, and 12 months of age (Fig. 11A).

The photoreceptor function of these mutant mice was then tested using ERG. Compared with wild-type littermates, there was a decrease in rod response amplitude in C217W mutant mice (Figures 4B and 4C). This reduced response was consistently reproduced at other ages (Fig. 11B). Although the most affected signal was the rod response, other types of ERG measurements were also affected in ELOVL2 mutants, including oscillatory potential and flicker response (Figures 11C and 11D).

To determine whether the aggregates observed as dots on fundus autofluorescence images were similar to drusen, which are a risk factor for AMD in humans, the retinas of C217W and WT mice were immunostained [14]. Indeed, immunostaining revealed HTRA1, T-15, C3, and C5b-9 positive aggregates only in C217W retinas (Fig. 4D, 4E and Fig. 12). Given the prominence and early development of drusen-like aggregates in mutant mice, they have the potential to be models of AMD.

Finally, it was investigated whether the characteristics of aging in mouse eyes could be reversed by demethylation of DNA, including the ELOVL2 promoter. To do this, each mouse was injected with 1 μl of 2 μM 5-azacytidine in one eye and 1 μl of PBS in the other eye every two weeks for 2 months, starting at 10 months of age. Using the MeDIP method, it was found that ELOVL2 promoter methylation was reduced after treatment (Figure 5A). ELOVL2 expression was also found to be increased in treated eyes (Figure 5B). Finally, photoreceptor function was tested using ERG and rod response was found to be improved in the injected eyes (Figure 5C and Figure 13). These data further support the methylation status of ELOVL2 as a target of aging and the use of DNA methyltransferase inhibitors to influence characteristics of ocular aging.

Example of clinical use in humans: Biweekly administration (20 µM) for three months to a patient with dry AMD

A 75-year-old woman with bilateral dry age-related macular degeneration (AMD) is seen in the ophthalmology clinic. Otherwise she is healthy. She agrees to a pilot study comparing demethylation therapy with control. At baseline, both eyes exhibit similar levels of AMD, as evidenced by clinical assessments of visual acuity, extent of geographic atrophy measured by autofluorescence, optical coherence tomography, and scotopic response on electroretinography. The patient receives 100 μl of decitabine (20 μM) prepared as a sterile, isotonic, pH-buffered solution administered by intravitreal injection into her left eye (active treatment). She is given 100 μl of the same sterile isotonic pH-buffered solution, but without decitabine, by intravitreal injection into the right eye (control treatment). Immediately after administration of active and control treatments, an intravitreal fluid sample was collected from each eye to measure baseline ELOVL2 expression and methylation levels. ELOVL2 is observed to be hypermethylated to a similar extent in both eyes. Expression levels of ELOVL2 are also similar, and low levels of expression are observed in both eyes. Both active and control treatments were continued in the left and right eyes, respectively, with injections every two weeks for 3 months. Both active and control treatments were equally well tolerated during the administration period. Immediately after the last administration, intravitreal fluid samples are collected from both eyes to measure ELOVL2 gene expression and methylation. The same clinical assessments of geographic atrophy that were performed at baseline are repeated for each eye. Significant differences were observed between eyes treated with decitabine compared with controls. In eyes treated with decitabine, ELOVL2 methylation was reduced by almost 30%, and ELOVL2 gene expression was also increased by about 30% compared to baseline. In addition, the rod response is increased by about 30% compared to baseline. In addition, there was no progression of geographic atrophy as measured by fundus autofluorescence compared with baseline. In contrast, the control eye showed no noticeable changes in any other parameters. Indicators of gene methylation and gene expression and rod response remain the same as at baseline values. The patient returns to the clinic for a follow-up visit after 6 months. Clinical evaluation shows that the improvement in rod response in the decitabine-treated eye is maintained, showing an improvement of about 20-30% over baseline. The rod response in the control eye remains similar to baseline.

Example of clinical use in humans: Administration (15 µM) once a month for 12 months to a patient with geographic atrophy

A 65-year-old man with dry age-related macular degeneration (AMD) with geographic atrophy is seen in the ophthalmology clinic. His vision, assessed by rod response, is deteriorating. His area of geographic atrophy, measured by fundus autofluorescence over the past 2 years, shows steady progression. Otherwise he is healthy. The patient is administered 100 μl of decitabine (15 μM) prepared as a sterile isotonic solution with buffered pH, administered by intravitreal injection. An intravitreal sample taken immediately after decitabine administration showed hypermethylation of the ELOVL2 promoter and low levels of ELOVL2 expression. Treatment with decitabine is continued at the same dose administered every 5 weeks for 12 months. The administration of the drug was well tolerated, no side effects were observed. After the last administration of decitabine, a vitreous sample is obtained and examined for ELOVL2 gene methylation and ELOVL2 gene expression. Research shows that ELOVL2 methylation decreased by almost 60% (from baseline) and ELOVL2 gene expression increased by about 50% (from baseline). The patient's rod response has improved markedly and is about 30% above baseline. According to fundus autofluorescence, there is no increase in geographic atrophy.

Human Clinical Case Study: ELOVL2 Gene Therapy

A 70-year-old man with dry age-related macular degeneration (AMD) with geographic atrophy is seen in the ophthalmology clinic. His vision, assessed by rod response, consistently deteriorated. His area of geographic atrophy, as measured by fundus autofluorescence, is invariably progressive. He is otherwise healthy and consenting to treatment using ELOVL2 gene therapy. One week before the gene therapy procedure, he was prescribed oral prednisolone (0.5 mg/kg). The recombinant adeno-associated viral vector with the ELOVL2 coding sequence is generated and packaged in accordance with Good Medical Practice guidelines. It is suspended in buffered saline with a titer of 1.5 x 10 ¹¹ genomes in 0.3 ml aliquots. One week after oral prednisone, a standard vitrectomy is performed to remove the cortical vitreous using standard vitreoretinal techniques under general anesthesia. The patient is then injected with 0.3 ml of buffered saline containing a total titer of 1.5 x 10 ¹¹ genomes injected into the subretinal space using a special subretinal cannula just outside the macula. Air exchange and standard wound suturing are carried out. The patient continues to take oral prednisone (0.5 mg/kg) with a slow taper until 4 weeks after surgery. Analysis of cells obtained from a vitreous sample shows low levels of ELOVL2 expression. Follow-up at 6 months and one year after the gene therapy procedure shows that there is no significant progression in the area of geographic atrophy as measured by fundus autofluorescence, and vision, as assessed by rod response, has improved by about 20-30%.

DISCUSSION

Previous studies have found a highly significant correlation between ELOVL2 promoter methylation and age in humans [3, 29, 30]. The current study examined whether ELOVL2 methylation and expression plays a role in the aging phenotypes of human fibroblasts and mouse retinal models.

WI-38 fibroblasts were isolated by Hayflick and Moorhead in the 1960s, and they were observed to gradually show signs of aging as they divided, first slowing down and then stopping at 50+/-10 population doublings, a phenomenon that later became known as the Hayflick limit [31]. Additionally, cells have been found to senesce in vivo with age [32], and primary cells of different species have been found to have a maximum lifespan in vitro that correlates with the maximum lifespan of the species [33]. In addition to these changes, ELOVL2 expression was found to decrease with increasing passage number in human fibroblasts. Because promoter methylation generally inversely correlates with expression, it was expected that promoter methylation would increase with cellular aging, and this was found to be true. Due to decreased expression in cells and increased promoter methylation with age in both cells and humans, it has been proposed that silencing of ELOVL2 will lead to advanced aging phenotypes. Indeed, cells treated with shRNA directed against ELOVL2 showed decreased ELOVL2 expression, decreased proliferative capacity, increased senescence, and age-related changes in morphology compared to control cells.

To further study aging phenotypes , ELOVL2 mutant mice were generated. Using CRISPR-Cas9, the C217W mutation was created, which was previously shown to switch the substrate specificity of the ELOVL2 catalytic site to the ELOVL5 equivalent, effectively disrupting the unique ability of ELOVL2 to convert the C22 omega-3 PUFA docosapentaenoic acid (DPA) (22:5n-3) until 24:5n-36. Both ELOVL2 and ELOVL5 have been found to extend eicosapentaenoic acid (EPA; 20:5n-3) to docosapentaenoic acid (DPA; 22:5n-3), but only ELOVL2 is known to further extend DPA to 24:5n- 3, i.e. penultimate precursor of DHA [6]. Therefore, the ocular health of ELOVL2 mutant mice was examined.

Autofluorescence imaging revealed the presence of protein aggregates in the retina at 6 months of age, compared with 1 year in wild-type mice. Retinal sections were stained for oxidized phosphocholine (using T-15 antibody), HTRA1, C3, and C5b-9, all proteins found in drusen that are commonly found in patients with age-related macular degeneration (AMD).

Photoreceptor function was assessed using ERG. ERG measures the electrical signals produced by the retina in response to a light stimulus and can thus detect functional abnormalities of the photoreceptors. Because the mouse retina contains primarily rod photoreceptors, functional differences in their electrical signals (rod response) are most important for assessing visual performance. In addition to the rod response, the cone response and 10 Hz flicker were also examined. All of these signals, but primarily the rod response, decreased in amplitude with age in both wild-type and mutant mice compared with age-matched littermates. These indicators of decreased photoreceptor function, together with the presence of drusen-like aggregates, are signs of AMD. Thus, it was concluded that ELOVL2 function is critical for preventing the early appearance of drusen-like aggregates and maintaining healthy photoreceptor function in mice. Combined with the accelerated appearance of drusen-like aggregates, the loss of photoreceptor function in ELOVL2 mutant mice indicates that ELOVL2 is an important part of maintaining retinal health in older mice. Additionally, ELOVL2 has been found to play an important role in influencing the aging phenotype in human cells and has the potential to influence the aging process at a broader level.

ELOVL2 C217W mice were found to present drusen-like aggregates and reduced photoreceptor sensitivity at a significantly earlier stage than any of the control littermates. It was concluded that the ELOVL2 C217W mutation is responsible for the accelerated ocular aging phenotype. Overall, this study provides evidence that ELOVL2 plays a role in the characteristics of aging and, in particular, ocular function. In addition, the level of methylation in the promoter region of ELOVL2 correlates with its expression and can be altered to potentially influence aging characteristics.

WAYS

Cell culture and processing.

Human fibroblasts WI-38 and IMR-90 were cultured in EMEM (ATCC) supplemented with 10% fetal bovine serum (Omega) and 1% penicillin/streptomycin (Gibco) and stored in a humidified incubator at 5% CO2 and 37°C. Confluency was calculated using ImageJ image processing software, including 3 fields of view per sample (10x). After confluence, the cells were separated and plated at a ratio of 1:3. Population doubling (PD) was calculated from the number of cells. Knockdown lentivirus was generated using MISSION shRNA (Sigma) according to the manufacturer's instructions. 5-Aza-2′-deoxycytidine was purchased from TSZ Chem (cat. no. 2353-33-5) and dissolved in cell culture medium at a concentration of 2 μM. Cells were treated for 48 hours. The medium was then replaced with normal cell culture medium, and the cells were cultured for an additional 5 days.

Aging-associated β-galactosidase (AS-β-gal) activity.

AC-β-gal activity in cultured cells was determined using Senescence β-Galactosidase Staining Kit (Cell Signaling Technology) according to the manufacturer's instructions. Cells were then stained with DAPI, and the percentage of cells with positive staining was calculated using imaging software (Keyence), including 3 fields of view (10x).

Nucleic acid analysis.

DNA and RNA were isolated from human fibroblasts and murine tissues using TRIzol (Ambion) according to the manufacturer's instructions. RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad).

Methylated DNA immunoprecipitation (MeDIP) was performed by fragmenting 1 μg of DNA using Bioruptor (Diagenode) for 8 cycles with high intensity settings, each cycle consisting of 30 seconds on and 30 seconds off. The fragmented DNA was denatured by further incubation with 1 μg of 5mC antibody MABE146 (Millipore) for 2 hours, then with SureBeads protein G beads (Bio-Rad) for 1 hour. After washing, the DNA was purified using the QIAquick PCR Purification Kit (Qiagen). qPCR was then performed as above.

Western blotting.

10 μg of total protein isolated using TRIzol (Ambion) from WT mouse retinas at various developmental stages was subjected to SDS-PAGE. Western blotting was performed using a conventional protocol (see Table 2 for antibodies used in the study). The protein expression level of ELOVL2 was normalized to H3.

CRISPR-Cas9 design.

CRISPR-Cas9 reagents were prepared as previously described [34]. The T7 promoter was added to the cloned Cas9 coding sequence by PCR amplification. The T7-Cas9 product was then gel purified and used as an in vitro transcription (IVT) template using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies). The T7 promoter and shRNA sequence were synthesized as a long oligonucleotide (Ultramer, IDT) and amplified by PCR. The T7-shRNA PCR product was gel purified and used as template for IVT using the MEGAshortscript T7 kit (Life Technologies). The repair template encoding the C217W variant was synthesized as a single-stranded oligonucleotide (Ultramer, IDT) and used without purification. Potential off-target changes were identified using Cas-OFFinder35, selecting targets with the fewest mismatches ( http://www.rgenome.net/cas-offinder/ ). The founder mouse and all F1 mice were sequenced for off-target changes.

Animal injections and analysis.

All animal procedures were performed with the approval of the Institutional Animal Care Committee of the University of California, San Diego. C57BL/6N mouse zygotes were injected with CRISPR-Cas9 constructs. Oligonucleotides were injected into the cytoplasm of zygotes at the pronucleus stage. Mice were housed in static racks in a regular animal house and fed ad libitum with the Teklad Global 2020X diet. For the 5-azacytidine injection study, mice were anesthetized with an intraperitoneal injection of ketamine/xylazine (100 mg/kg and 10 mg/kg, respectively) and received analgesic proparacaine eye drops (0.5%, Bausch & Lomb). Animals were intraocularly injected with 1 μl of PBS in one eye and 1 μl of 2 μM 5-azacytidine dissolved in PBS in the contralateral eye every two weeks for 2 months.

Electroretinograms (ERG) were performed according to a previously described protocol [36]. In a few words, mice were dark-adapted for 12 hours, anesthetized with a weight-based intraperitoneal injection of ketamine/xylazine, and received a dilating drop of tropicamide (1.5%, Alcon) as well as a drop of proparacaine (0.5%, Bausch & Lomb) as a painkiller. Mice were examined using a Ganzfeld visual field camera apparatus (Diagnosys LLC), with electrodes placed on each cornea, a subcutaneous ground needle electrode placed in the tail, and a reference electrode in the mouth (Grass Telefactor, F-E2). A lubricant (Goniovisc 2.5%, HUB Pharmaceuticals) was used to ensure contact of the electrodes with the eyes. Gain (with a 1–1000 Hz bandpass, no notch filtering), stimulus presentation, and data acquisition were programmed and performed using a UTAS-E 3000 system (LKC Technologies). For rod ERG, the retina was stimulated with a xenon lamp at -2 and -0.5 log cd s/m ² . For cone ERGs, mice were adapted to a background illumination of 1 log cd s/m ² and light stimulation was set at 1.5 log cd s/m ² . Records were collected and averaged in the manufacturer's software (Veris, EDI) and processed in Excel.

Analysis of the mouse retina.

Retinas were collected immediately after killing the mice, fixed in 4% paraformaldehyde for 1 hour, and stored in PBS at 4°C. For immunostaining, retinas were sectioned, mounted on glass slides, and then incubated with 5% BSA, 0.1% Triton-X PBS blocking solution for 1 hour. Primary antibodies (see Table 2 for antibodies used in the study) were added 1:50 in 5% BSA PBS and incubated at 4°C for 16 hours. After washing three times with PBS, secondary antibodies were added at a ratio of 1:1000 in 5% BSA PBS for 30 minutes at room temperature. Samples were then washed 3 times with PBS, stained with DAPI for 5 minutes at room temperature, mounted, and imaged (Keyence BZ-X700).

Table 1. List of primers used in the study.

Checking for off-target changes Sequence (5' -> 3') SUBSEQUENCE non-target chr8 F GTAATTCCGTGATCACCGTC SEQ ID NO:1 non-target chr8 R CCAATAAATAACAGCAGAAG SEQ ID NO:2 non-target chr10 F CAATATGCTCATCATTGTCT SEQ ID NO:3 non-target chr10 R CCACACATGTCTACCTTTCCT SEQ ID NO:4 MeDIP primers hELOVL2 promoter. F CGATTTGCAGGTCCAGCCG SEQ ID NO:5 hELOVL2 promoter. R CAGCGGGTGGGTATTCCTG SEQ ID NO:6 hACTB F promoter CTAGGTGTGGACATCTCTTG SEQ ID NO:7 hACTB R promoter TGCAGGAGCGTACAGAA SEQ ID NO:8 mELOVL2 F promoter AGCTCCTCCGCTACTC SEQ ID NO:9 mELOVL2 R promoter CCAGCCTTGGTCATC SEQ ID NO:10 mACTB F promoter TAGGCCCAGATGTACAGGAA SEQ ID NO:11 mACTB R promoter CCAGAATGCAGGCCTAGTAA SEQ ID NO:12 qPCR primers hELOVL2 F GCGGATCATGGAACATCTAA SEQ ID NO:13 hELOVL2 R CCAGCCATATTGAGAGCAGA SEQ ID NO:14 hACTB F CACCATTGGCAATGAGCGGTTC SEQ ID NO:15 hACTB R AGGTCTTTGCGGATGTCCACGT SEQ ID NO:16

Table 2. List of antibodies used in the study.

Immunostaining Company, cat. No. RRID TEPC 15 Sigma M1421 AB_1163630 HtrA Santa Cruz sc-377050 C3 Santa Cruz sc-58926 AB_1119819 C5-b9 Santa Cruz sc-66190 AB_1119840 MeDIP 5-methylcytosine Millipore MABE146 AB_10863148 Western blotting ELOVL2 Santa Cruz sc-54874 AB_2262364 Histone H3 Cell Signaling 9715 AB_331563

BIBLIOGRAPHY

1. Glei, D. A. et al. Predicting Survival from Telomere Length versus Conventional Predictors: A Multinational Population-Based Cohort Study. PloS One 11, e0152486 (2016).

2. Health, C. O. on S. and. Smoking and Tobacco Use; Surgeon General's Reports; 2004. Smoking and Tobacco Use Available at: http://www.cdc.gov/tobacco/data_statistics/sgr/2004/. (Accessed: 14th November 2014)

3. Hannum, G. et al. Genome-wide Methylation Profiles Reveal Quantitative Views of Human Aging Rates. Mol. Cell 49, 359-367 (2013).

4. Gross, A. M. et al. Methylome-wide Analysis of Chronic HIV Infection Reveals Five-Year Increase in Biological Age and Epigenetic Targeting of HLA. Mol. Cell 62, 157-168 (2016).

5. Leonard, A. E. et al. Identification and expression of mammalian long-chain PUFA elongation enzymes. Lipids 37, 733-740 (2002).

6. Gregory, M. K., Cleland, L. G. & James, M. J. Molecular basis for differential elongation of omega-3 docosapentaenoic acid by the rat ELOVL5 and ELOVL2. J. Lipid Res. 54, 2851-2857 (2013).

7. Tikhonenko, M. et al. Remodeling of Retinal Fatty Acids in an Animal Model of Diabetes: A Decrease in Long-Chain Polyunsaturated Fatty Acids Is Associated With a Decrease in Fatty Acid Elongases ELOVL2 and ELOVL4. Diabetes 59, 219-227 (2010).

8. Bazan, N. G., Molina, M. F. & Gordon, W. C. Docosahexaenoic Acid Signalolipidomics in Nutrition: Significance in Aging, Neuroinflammation, Macular Degeneration, Alzheimer’s, and Other Neurodegenerative Diseases. Annu. Rev. Nutr. 31, 321-351 (2011).

9. Agbaga, M.-P. et al. Role of Stargardt-3 macular dystrophy protein (ELOVLL4) in the biosynthesis of very long chain fatty acids. Proc. Natl. Acad. Sci. 105, 12843-12848 (2008).

10. Harkewicz, R. et al. Essential Role of ELOVLL4 Protein in Very Long Chain Fatty Acid Synthesis and Retinal Function. J Biol. Chem. 287, 11469-11480 (2012).

11. Beatty, S., Koh, H., Phil, M., Henson, D. & Boulton, M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Surv. Ophthalmol. 45, 115-134 (2000).

12. Hollyfield, J. G. et al. Oxidative damage-induced inflammation initiates age-related macular degeneration. Nat. Med. 14, 194-198 (2008).

13. Curcio, C. A., Johnson, M., Huang, J.-D. & Rudolf, M. Apolipoprotein B-containing lipoproteins in retinal aging and age-related macular degeneration. J. Lipid Res. 51, 451-467 (2010).

14. Crabb, J. W. et al. Drusen proteome analysis: An approach to the etiology of age-related macular degeneration. Proc. Natl. Acad. Sci. 99, 14682-14687 (2002).

15. Shaw, P. X. et al. Natural antibodies with the T15 idiotype may act in atherosclerosis, apoptotic clearance, and protective immunity. J. Clin. Invest. 105, 1731-1740 (2000).

16. Shaw, P. X. et al. Complement factor H genotypes impact risk of age-related macular degeneration by interaction with oxidized phospholipids. Proc. Natl. Acad. Sci. U.S.A. 109, 13757-13762 (2012).

17. Cameron, D. J. et al. HTRA1 variant confers similar risks to geographic atrophy and neovascular age-related macular degeneration. Cell Cycle Georget. Tex 6, 1122-1125 (2007).

18. Sivaprasad, S. & Chong, N. V. The complement system and age-related macular degeneration. Eye 20, 867 (2006).

19. Pignolo, R. J., Rotenberg, M. O. & Cristofalo, V. J. Alterations in contact and density-dependent arrest state in senescent WI-38 cells. In Vitro Cell. Dev. Biol. Anim. 30A, 471-476 (1994).

20. Schäuble, S. et al. Quantitative Model of Cell Cycle Arrest and Cellular Senescence in Primary Human Fibroblasts. PLoS ONE 7, e42150 (2012).

21. Jones, P. L. et al. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat. Genet. 19, 187-191 (1998).

22. Momparler, R. L. Pharmacology of 5-Aza-2’-deoxycytidine (decitabine). Semin. Hematol. 42, S9-16 (2005).

23. Swindell, W. R. et al. Indicators of ‘Healthy Aging’ in older women (65-69 years of age). A data-mining approach based on prediction of long-term survival. BMC Geriatr. 10, 55 (2010).

24. Xue, X. et al. Characterization of the fatty acyl elongase (ELOVL) gene family, and hepatic ELOVL and delta-6 fatty acyl desaturase transcript expression and fatty acid responses to diets containing camelina oil in Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 175, 9-22 (2014).

25. Bartke, A. & Brown-Borg, H. Life extension in the dwarf mouse. Curr. Top. Dev. Biol. 63, 189-225 (2004).

26. Wang, T. et al. Epigenetic aging signatures in mice livers are slowed by dwarfism, calorie restriction and rapamycin treatment. Genome Biol. 18, 57 (2017).

27. Kolesnikov, A. V., Fan, J., Crouch, R. K. & Kefalov, V. J. Age-Related Deterioration of Rod Vision in Mice. J. Neurosci. Off. J. Soc. Neurosci. 30, 11222-11231 (2010).

28. Zadravec, D. et al. ELOVL2 controls the level of n-6 28:5 and 30:5 fatty acids in testis, a prerequisite for male fertility and sperm maturation in mice. J. Lipid Res. 52, 245-255 (2011).

29. Garagnani, P. et al. Methylation of ELOVL2 gene as a new epigenetic marker of age. Aging Cell 11, 1132-1134 (2012).

30. Bacalini, M. G. et al. A meta-analysis on age-associated changes in blood DNA methylation: results from an original analysis pipeline for Infinium 450k data. Aging 7, 97-109 (2015).

31. Hayflick, L. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 37, 614-636 (1965).

32. Herbig, U., Ferreira, M., Condel, L., Carey, D. & Sedivy, J. M. Cellular senescence in aging primates. Science 311, 1257 (2006).

33. Röhme, D. Evidence for a relationship between longevity of mammalian species and life spans of normal fibroblasts in vitro and erythrocytes in vivo. Proc. Natl. Acad. Sci. U.S.A. 78, 5009-5013 (1981).

34. Wang, H. et al. One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Cell 153, 910-918 (2013).

35. Bae, S., Park, J. & Kim, J.-S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473-1475 (2014).

36. Luo, J. et al. Human retinal progenitor cell transplantation preserves vision. J Biol. Chem. 289, 6362-6371 (2014).

Claims (33)

1. A method of treating, ameliorating, or preventing an age-related ocular disease or pathology, comprising administering to a subject in need of treatment an effective amount of at least one demethylating agent, wherein the demethylating agent is decitabine. 2. The method according to claim 1, characterized in that the demethylating agent increases the expression of the very long chain fatty acid elongation type 2 gene (ELOVL2) and/or increases the level of the ELOVL2 enzyme and/or increases the level of 22:6(n-3) docosahexaenoic acid acid (DHA) and 22:5(n-6) docosapentaenoic acid (DPA) in the retina. 3. Method according to paragraphs. 1, 2, characterized in that the demethylating agent is injected into the eye. 4. Method according to paragraphs. 1-3, characterized in that the demethylating agent is administered into the eye via the intravitreal, subretinal, subconjunctival, subtenon or posterior juxtascleral route. 5. Method according to paragraphs. 1-4, wherein the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision or dry eye. 6. The method according to claim 5, characterized in that the AMD is dry or wet AMD. 7. The method according to claim 6, characterized in that the AMD is a dry AMD. 8. Method according to paragraphs. 1-7, characterized in that the demethylating agent is administered in the form of a slow-release preparation. 9. A method of treating, alleviating or preventing an age-related eye disease or pathology, including increasing the level of the ELOVL2 enzyme and/or the level of 22:6(n-3) docosahexaenoic acid (DHA) and 22:5(n-6) docosapentaenoic acid (DPA) in eye by introducing into the eye an effective amount of mRNA encoding ELOVL2. 10. The method according to claim 9, characterized in that the mRNA is delivered using a viral vector. 11. The method according to claim 10, characterized in that the viral vector is selected from: an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a vaccinia virus vector and a retroviral vector. 12. The method of claim 9, wherein the mRNA is delivered using a non-viral vector such as a liposome or micro/nanoparticle. 13. Method according to paragraphs. 9-12, characterized in that the agent is administered into the eye via the intravitreal, subretinal, subconjunctival, subtenon or posterior juxtascleral route. 14. Method according to paragraphs. 9-13, wherein the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision or dry eye. 15. The method according to claim 14, characterized in that the age-related eye disease is dry AMD. 16. A method of treating, alleviating or preventing age-related eye disease and pathology, including increasing the level of the ELOVL2 enzyme in the eye and/or the level of 22:6(n-3) docosahexaenoic acid (DHA) and 22:5(n-6) docosapentaenoic acid ( duodenum) in the eye by gene therapy using the ELOVL2 expression vector. 17. The method according to claim 16, characterized in that the vector is selected from: an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a vaccinia virus vector and a retroviral vector. 18. Method according to paragraphs. 16, 17, characterized in that the ELOVL2 expression vector is administered intravitreal, subretinal, subconjunctival, subtenon or posterior juxtascleral. 19. Method according to paragraphs. 16-18, wherein the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision or dry eye. 20. The method according to claim 19, characterized in that the age-related eye disease is dry AMD. 21. A method comprising selecting a patient in need of treatment for an age-related eye disease and administering an effective amount of decitabine and/or mRNA encoding ELOVL2 and/or an ELOVL2 expression vector to the patient's eye, thereby treating the age-related disease. 22. The method of claim 21, wherein the patient is selected by determining ELOVL2 methylation and/or ELOVL2 expression in the patient's eye. 23. Method according to paragraphs. 21, 22, wherein the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision or dry eye. 24. The method according to claim 23, characterized in that the age-related eye disease is dry AMD. 25. A method comprising using decitabine in the treatment of an age-related eye disease. 26. The method according to claim 25, characterized in that the age-related eye disease is dry AMD. 27. A method comprising using mRNA encoding ELOVL2 in the treatment of an age-related eye disease. 28. A method comprising using an ELOVL2 expression vector in the treatment of age-related eye disease. 29. A method for treating age-related eye diseases, including intravitreal administration of a drug containing decitabine. 30. The method of claim 29, wherein the age-related eye disease is age-related macular degeneration (AMD), diabetic eye disease, glaucoma, low vision or dry eye. 31. Method according to paragraphs. 29, 30, characterized in that the age-related eye disease is dry AMD. 32. The method according to claim 27, characterized in that the age-related eye disease is dry AMD. 33. The method according to claim 28, characterized in that the age-related eye disease is dry AMD.