RU2804092C1 - Wine polyploid yeast strain saccharomyces cerevisiae i-328-4 vkpm y-5031 - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: polyploid wine strain of the yeast Saccharomyces cerevisiae I-328-4 VKPM Y-5031 has been proposed, which has an auxotrophic phenotype due to the null allele of the CAR1 gene in the homozygote.

EFFECT: obtaining wine-making strains.

1 cl, 8 tbl, 5 ex

Description

The invention relates to the wine industry and can be used as a platform for creating new promising wine strains using genetic engineering methods.

The yeast Saccharomyces cerevisiae is a traditional microorganism used in winemaking. As a rule, in industrial conditions special strains are used that have higher productivity and reliability during fermentation compared to laboratory strains. Various techniques can be used to obtain modified versions of industrial strains. One of the promising approaches for effective genome engineering of yeast is the use of CRISPR/Cas9 techniques [Rainha J, Rodrigues JL, Rodrigues LR. CRISPR-Cas9: A Powerful Tool to Efficiently Engineer Saccharomyces cerevisiae . Life (Basel). 2020 Dec 26;11(1):13. doi: 10.3390/life11010013. PMID: 33375364; PMCID: PMC7823794, Cai G, Lin Z, Shi S. Development and expansion of the CRISPR/Cas9 toolboxes for powerful genome engineering in yeast. Enzyme Microb Technol. 2022 Sep;159:110056. doi: 10.1016/j.enzmictec.2022.110056. Epub 2022 May 7. PMID: 35561628]. The necessary modification of the genome can be achieved by targeted introduction of a double-strand break into a certain region of the chromosome and its repair in vivo using an artificially obtained donor DNA fragment with a given sequence.

An important feature of industrial yeast strains is that they are usually polyploid strains. The latter circumstance can significantly complicate the genetic engineering modification of such strains, since due to the presence of several chromosomal copies, it is more difficult to select variants that carry the required genetic change in all these copies. For example, single gene disruption has been reported with an efficiency of 15% to 60% in the polyploid industrial yeast strain ATCC 4124, compared with almost 100% efficiency in laboratory haploid counterparts [Zhang GC, Kong II, Kim H, Liu JJ, Cate JH, Jin YS. Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. PMID: 25281382; PMCID: PMC4249234.]. Therefore, in the case of polyploid strains, increasing the efficiency of selection of variants characterized by the presence of a given mutant allele in homozygous status is an urgent task. In particular, two interrelated approaches were proposed to solve this problem, one of which was to improve the CRISPR/Cas9 system by increasing the copy number of the plasmid expressing gRNA [Lian J, Jin R, Zhao H. Construction of plasmids with tunable copy numbers in Saccharomyces cerevisiae and their applications in pathway optimization and multiplex genome integration. Biotechnol Bioeng. 2016 Nov;113(11):2462-73. doi: 10.1002/bit.26004. Epub 2016 Jun 3. PMID: 27159405.]. Another approach involved obtaining various auxotrophic mutants from the polyploid yeast strain S. cerevisiae ATCC 4124. Such marked strains, carrying null alleles of the URA3, LEU2, TRP1, HIS3 and ADE2 genes in homozygote, are convenient to use for introducing additional genomic modifications using the CRISPR/Cas9 system , allowing the selection of transformants to restore prototrophy [Lian J, Bao Z, Hu S, Zhao H. Engineered CRISPR/Cas9 system for multiplex genome engineering of polyploid industrial yeast strains. Biotechnol Bioeng. 2018 Jun;115(6):1630-1635. doi: 10.1002/bit.26569. Epub 2018 Mar 8. PMID: 29460422].

The technical result of the claimed invention is to expand the range of polyploid strains of the yeast Saccharomices cerevisiae.

The purpose of this work is to obtain a polyploid wine strain of the yeast Saccharomyces cerevisiae, which has an auxotrophic phenotype due to the null allele of the CAR1 gene in the homozygote [Wu D, Li X, Shen C, Lu J, Chen J, Xie G. Decreased ethyl carbamate generation during Chinese rice wine fermentation by disruption of CAR1 in an industrial yeast strain. Int J Food Microbiol. 2014 Jun 16;180:19-23. doi: 10.1016/j.ijfoodmicro.2014.04.007. Epub 2014 Apr 13. PMID: 24769164; Guo XW, Li YZ, Guo J, Wang Q, Huang SY, Chen YF, Du LP, Xiao DG. Reduced production of ethyl carbamate for wine fermentation by deleting CAR1 in Saccharomyces cerevisiae. J Ind Microbiol Biotechnol. 2016 May;43(5):671-9. doi:10.1007/s10295-016-1737-7. Epub 2016 Jan 30. PMID: 26831650; Chin YW, Kang WK, Jang HW, Turner TL, Kim HJ. CAR1 deletion by CRISPR/Cas9 reduces formation of ethyl carbamate from ethanol fermentation by Saccharomyces cerevisiae. J Ind Microbiol Biotechnol. 2016 Nov;43(11):1517-1525. doi:10.1007/s10295-016-1831-x. Epub 2016 Aug 29. PMID: 27573438.]. This phenotype manifests itself as the inability of yeast to grow on a medium with arginine as the sole nitrogen source.

An industrial polyploid yeast strain was chosen as the starting one.Saccharomices cerevisiae , deposited in the collection of winemaking microorganisms "Magarach" (KMV "Magarach") under No. I-328 [Collection of winemaking microorganisms. Catalog of crops / Tanashchuk T.N., Kishkovskaya S.A., Ivanova E.V., Skorikova T.K. // Yalta: All-Russian National Research Institute of Viticulture and Winemaking "Magarach" RAS" - 2016. - 252 pp.] For mutagenesis, we used components of the CRISPR/Cas9 system for yeast, described in the protocol https://www.benchling.com /blog/quick-and-easy-crispr-engineering-in-saccharomyces-cerevisiae, in particular, plasmids pWS82 and pWS173. Based on pWS82, plasmids were constructed carrying a so-called spacer indicating the location of gene cuttingCAR1 Cas9 nuclease. To do this, a pair of primers Cr-Car1nD and Cr-Car1nR (see Table 1) were annealed to each other, and the resulting DNA fragment was cloned into the Esp3I site of plasmid pWS82, resulting in plasmid pWS82-CAR1-3. A similar procedure was carried out for another pair of primers: Cr-Car1mD and Cr-Car1mR, and the plasmid pWS82-CAR1-4 was obtained.

Table 1. Sequences of oligonucleotides used in the work.

Cr-Car1nD
Cr-Car1nR gactACTACTATCAAGATGGAAAC
aaacGTTTCCATCTTGATAGTAGT Cr-Car1mD
Cr-Car1mR gactGGGTTGAGAGATGTTGATGC
aaacGCATCAACATCTCTCAACCC Car_1F AACCGTGTAGGCAAAACTGGAC Car_2R1 atgatgatAGACAGTATGCGTAGCTTTACCA Car_3F1 tactgtctATCATCATCCCTTTTATCAAAATAAGCA Car_4R AGATGGCCGATTTGAGAGCCT

The donor DNA fragment for double-strand break repair in vivo was obtained using PCR with overlapping primers. To do this, we first amplified PCR fragments PCR4 and PCR5 using the genomic DNA of strain I-328 as a template. Amplification was carried out using Phusion polymerase (Finnzymes Inc., MA 01801, USA) using appropriate primer pairs (see Table 2).

Table 2. Primer pairs used to amplify PCR fragments PCR4, PCR5 and PCR6.

PCR fragment Primer pair Fragment length PCR4 Car_1F / Car_2R1 220 n.p. PCR5 Car_3F1 / Car_4R 392 n.p. PCR6 Car_1F / Car_4R 612 n.p.

For PCR amplification of DNA fragments, a Mastercycler Eppendorf AG 22331 device was used. After electrophoresis in an agarose gel, PCR fragments were purified using the Wizard SV Gel and PCR Clean-up system kit (Promega Corporation, WI 53711, USA). A mixture of PCR4 and PCR5 fragments was used as a template to obtain fragment PCR 6. The resulting PCR fragment PCR 6 was isolated from an agarose gel and used as donor DNA to replace the CAR1 gene with the car1Δ allele in the genome of yeast strain I-328. Below is the sequence of the PCR fragment PCR 6:

AACCGTGTAGGCAAAACTGGACCGCCCGTTAAGTTCTGCTATTAACAAATTAAATAAAATTGGCCAAACTGATGATTGACAGTTCTGAATATCCAAGATTACTGACTTCAATTTTCTCACTTCTCATCATAATTTCCGCTGATTTTTACATACCGTATATCCAATTTACGGCCCTTCACATATAGCGGCGAAATGATGGTAAAGCTACGCATACTGTCTATCATCATCCCTTTTATCAAAATAAGCATTCTCTT TTTATTTTAGTTAAGCACATGCATACATAAATTTACGAACAAAAAAAGAAAATAAATTAAAAATAAAAGTAGTGTATCTTCGTTACTTTTCATTCTTTTTGGTTAACCCACGTCTAATTGCCAATACACTATCGACGATCACGGCATCTACACCTGCTTCAATTTGTATACTGGCATTTTCGGGATCATTGTTGTCCACACCGTAAGTGACACATACCAGCCCATTAGACTTAACCACTTGCACCAACCGTG GGGCCTTTAAAATGGGTGCTGCAGCAGATACAATCCCCAATAAATTCCACTTCTTAGCAAATCTTATACCGTTTTGTAACGATGAGGCTCTCAAATCGGCCATCT

The following DNA fragments were prepared for CRISPR/Cas9 transformation:

fr.1: EcoRV- EcoRV fragment pWS82-CAR1-3 (2046 bp),

fr.2: EcoRV- EcoRV fragment pWS82-CAR1-4 (2046 bp),

fr.3: Esp3I- Esp3I fragment pWS173 (10387 bp),

fr.4: PCR fragment of donor DNA Car1Δ.(612 bp).

Transformation of strain I-328 was carried out as described in [Gietz RD & Woods RA (2002) Transformation of yeast by lithium acetate/single stranded carrier DNA/polyethylene glycol method. Methods Enzymol 350, 87–96]. The above-described DNA fragments were used in the following ratios: fr.1/fr.2 – 0.1 μg; fr.3 – 0.2 µg and fr.4 – 1 µg.

Transformants were selected on plates with standard complete YPD medium (peptone - 2%, yeast extract - 1%, glucose - 2%, agar - 2.5%) with the addition of antibiotic G-418 (200 μg/ml medium). Selected clones were then tested for growth ability on SC+arg agar medium (YNB (without ammonium sulfate) - 0.17%, glucose - 2%, arginine - 0.3%, agar - 2.5%), in which ammonium sulfate replaced by arginine as the sole nitrogen source. 7 transformants were selected that were not able to grow on SC+arg medium, 3 clones in the case of the pWS82-CAR1-3 plasmid and 4 clones in the case of pWS82-CAR1-4. The resulting transformants were checked by PCR for the absence of the wild-type CAR1 allele. All 7 selected clones completely lacked the wild-type CAR1 allele, while clones capable of growing on SC+arg medium contained both the null car1Δ allele and the wild-type CAR1 allele. The correctness of the replacement of the CAR1 allele with the car1Δ allele in 4 clones out of 7 selected was verified by whole-genome sequencing. The resulting auxotrophic car1Δ mutants restored prototrophy when transformed with a multicopy plasmid carrying an intact CAR1 gene.

One of the selected car1Δ clones, called I-328-4, was analyzed using approaches and techniques generally accepted in the microbiology of winemaking and enochemistry [Methods of technochemical control in winemaking / ed. Gerzhikova V.G. / Simferopol: “Tavrida”. – 2002. – 260 p.; Buryan N.I. Practical microbiology of winemaking // Simferopol: Tavrida. – 2003. – 560 s], as well as using gas and liquid chromatography. The original strain I-328 was used as a control. The strains were characterized according to a standard set of taxonomic characters [Kudryavtsev V.I. Systematics of yeast // M.: Publishing House of the USSR Academy of Sciences - 1954 - 427 pp.; Kvasnikov E.I., Nesterenko O.A. Lactic acid bacteria and ways of their use // M.: Science. – 1975. – 389 pp.], as well as on technological characteristics [Ribero-Gayon J., Peynot E., Ribero-Gayon P., Sudro P. Theory and practice of winemaking. Characteristics of wines. Ripening of grapes. Yeast and bacteria // trans. from French. – M.: “Food industry”. – 1980. – T. 2. – p. 111-243.; Buryan N.I., Tyurina L.V. Microbiology of winemaking. // M.: Food industry. – 1979. – 272 p.; Jiranek V., Langridge P., Henschke PA Validation of bismuth-containing indicator media for predicting H ₂ S-production potential of Saccharomyces cerevisiae wine yeasts under enological conditions // Am. J. Enol. Vitic. – 1995. – V. 46. – No. 2. – P. 269-273; Lemaresquier H. Gainvors A. Lequart C. Charlemagne B. Frezier V. Belarbi A. Sélection de levures œnologiques à activité clarifiante: Les différentes techniques utilisées pour caractériser des levures, intérêt de la sélection d' une levure productrice d' enzymes pectolytique s // Rev. française d'oenologie. – 1995]. When cultivating the strains, we used selective synthetic media and grape must from the Aligote grape variety of one batch with a mass concentration of sugars of 235 g/l, titratable acids - 7.0 g/l, pH 3.4. The results of the experiments performed are given below in the form of relevant examples.

As a result, a wine polyploid yeast strain was obtainedSaccharomyces cerevisiae I-328-4 VKPM Y-5031, having an auxotrophic phenotype due to a null allele of the geneCAR1 in homozygote and intended for the biosynthesis of new promising wine-making strains.

Example 1 . Comparison of strains I-328-4 and I-328 according to morphological-cultural and physiological-biochemical characteristics.

Morphological and cultural characteristics . The strains were cultivated in test tubes with grape must at a temperature of (26±0.5)°C. The shape and size of cells were assessed by microscopy of the culture in the exponential growth phase. Cell sizes were estimated from digital images, for processing and analysis of which the “Image Scope M” computer program was used. The presence of surface growth and the structure of the sediment were determined visually in a 30-day culture. The nature of the formed sediments, the presence of a ring and a film on the surface of the cultivation medium were visually assessed (see Table 3).

Physiological and biochemical signs. The ability of yeast to form spores was assessed based on the results of growth on Gorodkova’s medium [Buryan N.I. Practical microbiology of winemaking // Simferopol: Tavrida. – 2003. – 560 s]. The crops were incubated at a temperature of (26±0.5)°C, and every three days for 5-6 weeks the culture was microscopically examined for the appearance of spores. To determine the phenotype of the yeast under study, colonies were selected from agarized grape must and test cultures of yeast with a sensitive phenotype were transferred to the lawn by injection. Suspensions of the same colonies were also placed on agarized grape must in the form of a small lawn with a diameter of about 1.5 cm, into the center of which the biomass of a test culture of a killer yeast strain was injected. The crops were incubated at a temperature of (26±0.5)°C for 3 days. When a zone of no growth formed around the test strain in the lawn of a sensitive strain, it was identified as a killer (K). The strain on the lawn of which the killer strain forms zones was identified as sensitive. The remaining strains are classified as neutral (see Table 3). Strains 47-K (killer) and Kakhuri 7 (sensitive), deposited in the Magarach Medical Center, were used as test cultures.

Table 3. Morphological-cultural and physiological-biochemical properties of strains I-328-4 and I-328.

No. Strain Cell morphology Average cell size, µm Sediment Ring Film Phenotype Sporulation ability 1. I-328 round-ovoid, sometimes elongated and oval 8.3 × 5.9 dusty No No Sensitive forms asci with 1-4 spores 2. I-328-4 round-ovoid, sometimes elongated and oval 8.5 × 6.0 dusty No No Sensitive forms asci with 1-4 spores

Example 2. Comparison of the fermentation ability of strains I-328-4 and I-328.

Fermentation ability (the speed and completeness of fermentation of sugars) was assessed in laboratory conditions by cultivating strains in grape must in flasks sealed with stoppers with “fermentation” closures. A two-day enoculum of yeast was added to the wort to a concentration of 2·10 ⁶ cells/ml, and the fermentation experiment was carried out in triplicate at a temperature of (26±1)°C. Every day, the flasks with fermenting wort were weighed to determine the amount of carbon dioxide released during fermentation. At the end of fermentation (which is characterized by the absence of a change in the mass of the flasks), graphs of carbon dioxide release were plotted in terms of 100 ml of culture and the mass concentration of sugars, titratable and volatile acids and the volume fraction of ethyl alcohol in the fermented wort were determined (see Tables 4 and 5).

Table 4. Fermentation ability of strains I-328-4 and I-328.

No. Strain Time, days CO ₂ release, g pH Volume fraction of ethyl alcohol,% Mass concentration, g/l sugars titratable acids volatile acids 1 I-328 23 12.5 3.44 14.38 1.52 6.38 0.53 2 I-328-4 23 11.1 3.46 12.85 14.92 6.45 0.69

Table 5. Biochemical properties of strains I-328-4 and I-328 (Aquilla Biolabs, 48 h, active growth phase).

No. Strain pH Volume fraction of ethyl alcohol,% Mass concentration, g/l titratable acids volatile acids 1 I-328 3.15 7.3 6.08 0.30 2 I-328-4 3.20 5.7 6.53 0.20

Example 3. Comparison of technological properties of strains I-328-4 and I-328.

Acid and alcohol tolerance, cold and heat resistance, and sulfite resistance were assessed by the growth response of yeast cells to low pH values, low and high temperatures, high values of sulfur dioxide and high concentrations of ethyl alcohol. Cells were cultured in standard complete YPD medium. To assess cold resistance, incubation was carried out at a temperature of (10±1)°C, heat resistance - at (35±1)°C; to assess acid tolerance - at a temperature of (26±1)°C, the pH of the medium was adjusted to 2.8. To assess sulfite resistance, incubation was carried out at a temperature of (26±1)°C and a mass concentration of total sulfur dioxide in the medium of 100 mg/l. To assess alcohol tolerance, incubation was carried out at a temperature of (26±0.5)°C; ethyl alcohol was added to the medium until its volume fraction reached 10 or 12%. To more clearly identify the reaction of yeast to new conditions, strains were seeded into test tubes at a rate of 0.8-3·10 ⁴ cells/ml. The state of the cultures in test tubes was analyzed daily for 5 days. The growth response to given cultivation conditions (presence of growth, absence of growth) was assessed visually (see Table 6).

Table 6. Assessment of the resistance of strains I-328-4 and I-328 under stress conditions.

Strain Beginning of growth, days. Temperature 10°C Temperature 37°C pH 2.6 Mass concentration of total sulfurous acid,
100 mg/l Volume fraction of ethyl alcohol, 10% Volume fraction of ethyl alcohol, 12% I-328 5 1 1 1 4 lack of growth I-328-4 5 1 1 2 4 lack of growth

Example 4. Comparison of the biochemical properties of strains I-328-4 and I-328.

Tables 7a and 7b show the results of chromatographic analysis of samples of strains I-328-4 and I-328 after 48 hours of complete fermentation.

Table 7a. Liquid chromatography (g/l)

Component Strains I-328 I-328-4 lemon juice 1.87 / 0.81 2.35 / 0.62 wine shop 2.24/ 3.21 1.95 / 3.07 apple juice 3.07 / 1.37 3.97 / 1.57 amber color 1.13 / 0.43 1.27 / 0.42 dairy 1.05 / 1.51 1.05 / 1.88 vinegar 0.25 / 0.31 0.18 / 0.54 bioses 1.7 / 0.5 0.55 / 0.33 glucose 24.29 / 2.65 39.88/ 2.97 fructose 64.4 / 0.73 79.01 / 14.32 glycerol 5.34 / 6.16 5.42 / 6.88 ethanol,% 7.94 / 14.56 6.08 / 13.58

Table 7b. Gas chromatography (mg/l)

Component Strain I-328 I-328-4 acetaldehyde 74.7 / 106.4 27.6 / 57.4 ethyl acetate 3.5 / 15.1 2.3/8.0 methyl alcohol 7.1 / 19.8 4.9 / 9.7 propyl alcohol 6.7 / 17.3 5.1 / 6.9 isobutyl alcohol 48.0 / 53.0 45.8 / 31.5 isoamyl alcohol 39.9 / 79.5 33.5 / 36.5 ethyl caproate 15.3 / 29.4 11.9 / 13.0 ethyl lactate – / 3.9 – / 2.2 hexyl alcohol – / 0.4 – / 0.4 acetic acid 644.4 / 483.0 811.9/702.7 BG1 racemate 817.0 / 877.4 497.9/955.9 isobutyric acid 17.7 / 1.1 35.4 / 2.0 BG2 meso 50.2 / 76.6 34.7 / 88.8 propylene glycol 106.0 / 161.5 88.5 / 236.3 ethyl caprate 9.1/7.0 10.3 / 6.8 phenylethyl alcohol 45.0 / 30.4 61.0 / 25.4 caprylic acid 0.8/1.0 1.9/1.0 capric acid 682.1 / 13.1 1048.3/121.6 glycerol 6,325.2 / 5663.0 5284.5/7232.1

Example 5 . Comparison of growth dynamics of strains I-328-4 and I-328.

The results of comparison of the growth dynamics of strains I-328-4 and I-328 are given in table. 8.

Table 8. Growth dynamics of strains I-328-4 and I-328 (Aquilla Biolabs)

Strain Lag phase
h Expo. phase, h Optical density (D) at the end of the exp. phase Optical density (D) - 48 h Active growth phase µ, 1/h g, h D Period, h I-328 4.0 27.0 14.4 24.1 0.27 2.6 4.1 14.5 I-328-4 3.5 30.5 10.4 14.1 0.26 3.1 4.5 18.5

Claims (1)

Wine polyploid yeast strain Saccharomyces cerevisiae I-328-4 VKPM Y-5031, which has an auxotrophic phenotype due to the null allele of the CAR1 gene in the homozygote and is intended for producing wine-making strains.