RU2803202C9 - Panel and method of obtaining spatial information about nucleic acids - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following described: a group of inventions including a nucleic acid panel for obtaining spatial information about a nucleic acid in a sample, a kit for obtaining spatial information about a nucleic acid in a sample (versions), a method of manufacturing a nucleic acid panel for obtaining spatial information about a nucleic acid in a biological sample, and a method of obtaining spatial information about the nucleic acid in the sample (options). In one embodiment, a panel of nucleic acids includes a solid support with multiple types of carrier sequences attached to its surface, where each type of carrier sequence occupies a different position in the panel from another type, where multiple copies of the carrier sequence are the product of amplification formed by amplification using as a template a sequence complementary to the carrier sequence.

EFFECT: invention expands the arsenal of means for obtaining spatial information about the nucleic acid in the sample.

57 cl, 12 dwg, 12 tbl, 6 ex

Description

TECHNICAL FIELD

The invention relates to the field of spatial detection of biomolecules. In particular, the present invention provides a method for obtaining spatial information about nucleic acids in a sample, a panel of nucleic acids used in the method, and a method for obtaining a panel of nucleic acids.

BACKGROUND ART

The spatial arrangement of cells in tissue significantly affects their functions. To study such spatial heterogeneity, it is necessary to quantify and analyze the genome or transcriptome of a cell and knowledge of spatial coordinates. However, taking small pieces of tissue or even single cells for genomic or transcriptomic analysis is very labor-intensive, expensive and has low accuracy. Thus, there is a need to develop a method that allows high throughput spatial information about a biomolecule (eg, nucleic acid) at the single cell level or even at the subcellular level (eg, location, distribution and/or expression of the nucleic acid).

SUMMARY OF THE INVENTION

For spatial detection of nucleic acids, the prior art combines chip technology and high-throughput DNA sequencing technology by capturing and positionally tagging the nucleic acid in a tissue sample, sequencing and analyzing it. In the prior art, to obtain a chip that can solve the above problem, a probe capable of capturing a nucleic acid is fixed on the chip by spot deposition or a method based on the use of microparticles. However, the size of the active region of a chip obtained by the method of spot deposition of droplets on a plane using a microvolume spot deposition system is up to 200 micrometers, and the resolution reaches only the level of 20 cells; The size of the active region of a chip obtained by a microparticle-based method with microparticles labeled with positional markers distributed over the surface is up to 10 micrometers, and the resolution reaches only the level of single cells, and the subcellular level cannot be achieved. This invention proposes a new panel of nucleic acids for spatial detection of nucleic acids, a method for its preparation and a method for spatial detection of nucleic acids using the panel, which allows simultaneously determining subcellular localization with high accuracy and determining localization in tissue with high productivity, which has great practical value.

Preparation of a panel of nucleic acids

In a first aspect of the present invention, there is provided a method for producing a nucleic acid panel for obtaining spatial information about nucleic acids in a biological sample, comprising the following steps:

(1) providing multiple kinds of carrier sequences, each kind of carrier sequence contains multiple copies of the carrier sequence, and the carrier sequence in the 5' to 3' direction contains a positional sequence and a first immobilizing sequence,

positional sequence has a unique nucleotide sequence corresponding to the position of a given species

carrier sequences in the panel;

the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction;

(2) binding of multiple types of carrier sequences to the surface of a solid support (eg, a chip);

(3) providing a first primer and performing a primer elongation reaction using the carrier sequence as a template, so that the region of the first immobilization sequence and the position sequence in the carrier sequence forms a double strand, wherein the strand that hybridizes to the carrier sequence is a first nucleic acid molecule, the first nucleic acid molecule in the 5' to 3' direction contains a sequence complementary to the first immobilizing sequence and the positioning sequence; wherein the first primer contains at its 3' end a region complementary to the first immobilizing sequence, the region complementary to the first immobilizing sequence contains a sequence complementary to the first immobilizing sequence, or a fragment thereof, and has a free 3' end.

In some embodiments, the carrier sequence and the first nucleic acid molecule are single-stranded nucleic acid sequences. In some embodiments, the carrier sequence and the first nucleic acid molecule are single-stranded DNA sequences.

In some embodiments, in step (3), when performing the elongation reaction, the carrier sequence is sequenced to obtain sequence information about the positional sequence contained in the carrier sequence.

In some embodiments, multiple types

The carrier sequences in step (1) are provided through the following steps:

(i) providing numerous kinds of carrier sequence matrices, the carrier sequence matrix contains a sequence complementary to the carrier sequence;

(ii) using each kind of carrier sequence template as a template, performing a nucleic acid amplification reaction to obtain an amplification product of each kind of carrier sequence template, wherein the amplification product contains multiple copies of the carrier sequence.

In some embodiments, the amplification is selected from rolling circle amplification (RCA), bridging PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

In some embodiments, rolling circle amplification is performed to produce a DNB (DNA nanoball) formed by a concatemer of a carrier sequence. In such embodiments, in step (i) a circular template sequence is provided. The method for producing circular nucleic acid molecules is a standard method in the art and can be selected according to the needs of one skilled in the art. For example, a linear nucleic acid template may first be prepared, and then the linear nucleic acid template may be circularized using a ligase (eg, DNA ligase).

In some embodiments, bridging PCR amplification, emulsion PCR amplification, or multiple strand displacement amplification is performed to obtain a DNA cluster formed by a population of clones of a carrier sequence.

In some embodiments, the method further includes the following steps:

(4) providing a second nucleic acid molecule containing a capture sequence;

the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation;

(5) ligating a second nucleic acid molecule to a first nucleic acid molecule (eg, ligating a second nucleic acid molecule to a first nucleic acid molecule using a ligase).

In some embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In some embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In some embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

In some embodiments, the second nucleic acid molecule comprises, in a 5' to 3' direction, an immobilizing region and a capture sequence, and the immobilizing region comprises a double-stranded nucleic acid sequence, such as a double-stranded DNA sequence. In some embodiments, the capture sequence contained in the second nucleic acid molecule is a single-stranded nucleic acid sequence, such as a single-stranded DNA sequence or a single-stranded RNA sequence. It will be readily understood that in such embodiments, the second nucleic acid molecule has a partially double-stranded structure, which means that its immobilizing region has a double-stranded structure and its capture sequence has a single-stranded structure.

In some embodiments, the double-stranded nucleic acid sequence has a length of from 1 bp (nucleotide pairs) to 50 bp, for example, from 10 bp to 50 bp, from 10 bp to 40 bp, or from 10 bp to 30 bp.

In other embodiments, the method further includes the following steps:

(4) providing a second nucleic acid molecule, the second nucleic acid molecule comprising, in a 5' to 3' direction, the complement of a second immobilizing sequence and a capture sequence;

the complement of the second immobilizing sequence ensures hybridization with its complementary nucleotide sequence;

the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation;

(5) hybridizing the complement of the second immobilizing sequence with the second immobilizing sequence under annealing conditions, thereby ligating the second nucleic acid molecule to the carrier sequence;

(6) optionally ligating the first nucleic acid molecule and the second nucleic acid molecule that are hybridized to the carrier sequence, respectively (eg, ligating the second nucleic acid molecule and the first nucleic acid molecule using a ligase).

In such embodiments, each carrier sequence further comprises a second immobilizing sequence at its 5' end, and the second immobilizing sequence anneals to its complementary nucleotide sequence. In some embodiments, the second immobilizing sequence anneals its complementary nucleotide sequence and initiates an elongation reaction (eg, it can be used as a primer binding site for a bridging PCR).

In some embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In some embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In some embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

In some embodiments, the second immobilizing sequence is adjacent to the positioning sequence.

In some embodiments, the second immobilizing sequence has a length of from 1 to 50 bp, for example, from 10 pi to 50 pi, from 10 pi to 40 pi, from 10 pi to 30 bp, or from 10 bp to 20 bp.

In some embodiments, in step (3), the first primer further comprises a unique molecular identifier (UMI) sequence at the 5' end of a region contained therein complementary to the first immobilization sequence, such that the first nucleic acid molecule contains a UMI sequence at the 5' end of the contained her complement of the first immobilizing sequence; or in step (4), the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5' end of the capture sequence;

a UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5, e.g., 5 to 100, 5 to 50, 5 up to 20, for example 10) nucleotide N, where each N is independently any of A, C, G and T.

In some embodiments, when the first primer contains a unique molecular identifier (UMI) sequence at the 5' end of a region complementary to the first immobilization sequence contained therein, the first primer may further comprise an additional sequence at the 5' end of the UMI sequence.

In some embodiments, the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence contains at least 10 (eg, at least 20) deoxythymidine residues.

In some embodiments, the solid support is a chip. In some embodiments, a solid support can be used as a sequencing platform, such as a sequencing chip. In some embodiments, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI, or Thermo Fisher sequencing platforms.

In a second aspect of the present invention, there is provided a method for producing a nucleic acid panel for obtaining spatial information about a nucleic acid in a biological sample, comprising the following steps:

(1) providing multiple kinds of carrier sequences, each kind of carrier sequence contains multiple copies of the carrier sequence, the carrier sequence in the 5' to 3' direction contains: a capture sequence template, a positional sequence and a first immobilizing sequence,

the capture sequence template contains a sequence complementary to the capture sequence, and the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid;

the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel;

the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction; and the first immobilizing sequence also contains a cleavage site, and the cleavage may be selected from nickase enzyme cleavage, USER (uracil-specific excision reagent) enzyme cleavage, photocleavage, chemical cleavage, or CRISPR-based cleavage );

(2) binding of multiple types of carrier sequences to the surface of a solid support (eg, a chip);

(3) providing a first primer (referred to as primer-probe), the first primer contains, in a 5' to 3' direction, a binding region, a cleavage region, and a region complementary to the first immobilizing sequence, and a region complementary to the first immobilizing sequence contains a sequence complementary to the first an immobilizing sequence, or a fragment thereof, and has a free 3' end; the binding region contains a linker that can be ligated to the surface of a solid support; the cleavage region contains the cleavage site;

performing a primer elongation reaction using the first primer as a primer and a carrier sequence as a template, such that the first immobilization sequence region, the position sequence, and the capture sequence template of the carrier sequence form a double-stranded chain, wherein the strand hybridized to the carrier sequence is a first nucleic acid molecule, and the first nucleic acid molecule comprises, in a 5' to 3' direction, a complement of a first immobilizing sequence, a complement of a positional sequence, and a capture sequence; the first nucleic acid molecule may also be designated by a capture probe;

(4) binding the first primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order;

(5) it is possible to perform cleavage at a cleavage site contained in the first immobilizing sequence of the carrier sequence to cut the carrier sequence so that the elongation product in step (3) is separated from the template (i.e., the carrier sequence) to form an elongation product , such that the first nucleic acid molecule (capture probe) is ligated to the surface of a solid support (eg, a chip).

Since the capture probe (i.e., the first nucleic acid molecule) is prepared by using a carrier sequence as a template and performing primer elongation, the capture probe contains the complement of a unique positional sequence corresponding to the position of a given kind of capture probe (a given kind of carrier sequence) on the panel , and a capture sequence that can hybridize to all or part of the captured nucleic acid molecule. The position of a given type of capture probe on the panel can be determined by positional sequence complement analysis.

In this regard, the expression “each kind of carrier sequence” refers to carrier sequences containing the same positional sequence.

In some embodiments, multiple kinds of carrier sequences in step (1) are provided through the following steps:

(i) provision of numerous types of matrices

carrier sequences, the carrier sequence matrix contains a sequence complementary to the carrier sequence;

(ii) performing a nucleic acid amplification reaction using each kind of carrier sequence template as a template to obtain an amplification product of each kind of carrier sequence template, wherein the amplification product contains multiple copies of the carrier sequence.

In some embodiments, the amplification is selected from rolling circle amplification (RCA), bridging PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

In some embodiments, rolling circle amplification is performed to produce a DNB formed by a concatemer of the carrier sequence. In such embodiments, step (i) provides a circular template sequence. The method for producing circular nucleic acid molecules is a standard method in the art and can be selected according to the needs of one skilled in the art. For example, a linear nucleic acid template may first be prepared, and then circularization of the linear nucleic acid template may be performed using a ligase (eg, DNA ligase).

In some embodiments, each type of carrier sequence is a DNB formed by a concatemer of multiple copies of the carrier sequence.

In some embodiments, step (1) comprises the following steps:

(1a) providing a circular nucleic acid template, the circular nucleic acid template contains a carrier sequence template of one kind, the carrier sequence template contains a sequence complementary to the carrier sequence, which means that the carrier sequence template in the 5' to 3' direction contains the complement of the first immobilizing sequence, the complement of the positional sequence and the capturing sequence;

(1b) performing rolling circle amplification (RCA) using a circular nucleic acid template as a template to obtain a DNA nanoball (DNB) formed by a concatemer of a carrier sequence.

In some embodiments, bridging PCR amplification, emulsion PCR amplification, or multiple strand displacement amplification is performed to obtain a DNA cluster formed by a population of clones of a carrier sequence.

In some embodiments, the cleavage site contained in the first immobilizing sequence is a cleavage site for the nickase enzyme. In some embodiments, the nickase enzyme is selected from USER, BamHI and BmtI. In certain exemplary embodiments, the cleavage site is SEQ ID NO: 14.

In some embodiments, the first immobilization sequence further comprises a sequencing primer hybridization region and/or an amplification primer hybridization region; wherein the hybridization region of the sequencing primer ensures annealing of the sequencing primer and initiation of the sequencing reaction, and the hybridization region of the amplification primer ensures annealing of the amplification primer and initiation of the elongation reaction and the amplification reaction.

In some embodiments, the first immobilizing sequence is greater than 1 bp in length, such as greater than 10 bp or greater than 20 bp. In some embodiments, the first immobilizing sequence has a length of from 20 to 100 bp, for example, from 20 to 80 bp.

In some embodiments, the positional sequence is greater than 1 bp in length, such as greater than 10 bp. In some embodiments, the positional sequence is 10 to 100 bp in length, such as 10 to 50 bp, such as 10 to 30 bp, such as 20 bp.

In some embodiments, the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of fusion with the poly-A tail of the mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence contains at least 10 (eg, at least 20) deoxythymidine residues.

In some embodiments, the capture sequence is greater than 1 bp in length. In some embodiments, the capture sequence is 1 to 100 bp in length, such as 10 to 50 bp, such as 10 to 30 bp.

In some embodiments, the carrier sequence further comprises a complement of a UMI sequence (also referred to as a probe label region) located upstream of the capture sequence template and upstream of the first capture sequence, the complement of the UMI sequence is complementary to the UMI sequence, and the UMI sequence represents is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4 or at least 5; for example, from 5 to 100, from 5 to 50, from 5 to 20, for example, 10) nucleotide N, where each N is independently one of A, C, G, and T. In some embodiments, the complement of the UMI sequence is located between the positional sequence and the capture sequence template. In other embodiments, the complement of the UMI sequence is located between the first immobilizing sequence and the positioning sequence. In such embodiments, in step (3), when the primer elongation reaction is performed using the carrier sequence as a template, the first nucleic acid molecule/capture probe that hybridizes to the carrier sequence will suitably contain a UMI sequence (also referred to as a probe tag).

In some embodiments, to obtain the above-mentioned UMI sequence or a complementary sequence thereof, the carrier sequence template sequence (i.e., the carrier sequence template) comprises a UMI sequence template at an appropriate position, and the UMI sequence template is a sequence consisting of modified bases, modified bases are capable of forming complementary pairs through hydrogen bonds with various standard bases (for example, C, G, A, T, U); for example, the modified base may be inosine, which is capable of forming complementary pairs with the bases A, C, and U. Without being limited to any particular theory, it is believed that when the carrier sequence template contains a UMI sequence template, whenever amplification occurs in In the rolling circle amplification process, bases capable of forming complementary pairs with the UMI sequence template are added randomly, so that the amplification product has a unique UMI sequence generated randomly each time, making the amplification product different each time. For example, the copy number of different captured nucleic acid molecules can be determined. In some embodiments, the UMI sequence template contains multiple (eg, at least 10, eg, 10 to 100) inosines. In some embodiments, the UMI sequence matrix is greater than 1 pi in length. In some embodiments, the UMI sequence matrix is greater than 5 pi in length. In some embodiments, the UMI sequence template has a length of 5 to 100 bp, such as 5 to 50 bp, such as 5 to 20 bp, such as 5 to 15 bp, such as 10 bp.

In some embodiments, the solid support is a chip. In some embodiments, a solid support can be used as a sequencing platform. In some embodiments, the solid support is a sequencing chip (MGI), such as a sequencing chip on the BGISEQ-500 platform. In some embodiments, the solid substrate is a high-density matrix chip, which can be obtained, for example, by the method described in patent CN 103180496 B.

The carrier sequence (eg, DNB) can be ligated to the surface of a solid support by any suitable method known in the art. In some embodiments, non-exhaustive examples of the method include nucleic acid hybridization, biotin-streptavidin binding, binding to sulfhydryl groups, photoactivated binding, covalent binding, antibody-antigen binding, creation of physical restraints using hydrogel or other porous polymeric materials, etc. . or any combination thereof.

In some embodiments, the solid support is selected from the following materials: glass, silicone, polylysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymers (COCs), cyclic olefin polymers (COPs), polypropylene, polyethylene or polycarbonate, etc.

In some embodiments, in step (3), when performing the primer elongation reaction, the carrier sequence (eg, the positional sequence contained therein) is sequenced to obtain sequence information of the positional sequence contained in the carrier sequence.

In some embodiments, step (3) is further preceded by the step of sequencing the carrier sequence (eg, the positional sequence contained therein). In some embodiments, after sequencing is performed, a wash is performed to remove dNTPs (deoxynucleotide triphosphates) added to the synthetic strand during sequencing.

In some embodiments, the linker is a linker group capable of binding to an activating group (eg, NH ₂ ). In such embodiments, the surface of the solid support is modified with an activating group (eg, NH ₂ ). In some embodiments, the linker contains -SH, -DBCO (dibenzocyclooctine), -NHS, and the like. In some exemplary embodiments, the linker is DBCO and the azido-dPEG®8-NHS ester is attached to the surface of the solid support.

In some embodiments, the cleavage site contained in the cleavage region of the first primer is a site at which controlled cleavage can be accomplished by chemical, enzymatic, or photochemical means. In some embodiments, the cleavage site is an enzyme cleavage site. In some embodiments, the enzyme site is a USER (UUU) enzyme site.

In some embodiments, the cleavage region of the first primer is different from the cleavage site contained in the first immobilization sequence of the carrier sequence.

In some embodiments, the amplification includes PCR.

Nucleic Acid Panel and Kit

A third aspect of the present invention provides a nucleic acid panel for obtaining spatial information about a nucleic acid in a sample, including a solid support (eg, a chip) with multiple kinds of carrier sequences attached to its surface, where each kind of carrier sequence occupies a specific position. in the panel, each type of carrier sequence contains multiple copies

carrier sequence, and the carrier sequence in the 5' to 3' direction contains a positional sequence and a first immobilizing sequence,

the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel;

the first immobilizing sequence ensures the annealing of its complementary nucleotide sequence and initiation of the elongation reaction.

In some embodiments, each type of specified carrier sequence (i.e., carrier sequences containing the same positional sequence) occupies a region (i.e., active region) on the surface of the solid support having a diameter of less than 1 micrometer, for example, approximately 900 nanometers, about 800 nanometers, about 700 nanometers, about 600 nanometers, or about 500 nanometers.

In some embodiments, the panel of nucleic acids further comprises a first nucleic acid molecule, wherein the first nucleic acid molecule contains, in the 5' to 3' direction: the complement of the first immobilizing sequence and the complement of the positioning sequence, and forms a double-stranded structure due to hybridization with the first immobilizing sequence and the positioning sequence carrier sequences. It is easy to understand that in the first nucleic acid molecule, only the complement of the first immobilizing sequence and the complement of the positional sequence are complementary to the corresponding sequences of the carrier sequence and thus form a double strand, so that the double strand formed by the first immobilizing sequence and the carrier sequence is an incomplete double strand , that is, a partially double-stranded structure.

In some embodiments, each copy of each type of carrier sequence contains a first nucleic acid molecule hybridized thereto.

In some embodiments, the carrier sequence and the first nucleic acid molecule are single-stranded nucleic acid sequences. In some embodiments, the carrier sequence and the first nucleic acid molecule are single-stranded DNA sequences.

In some embodiments, the nucleic acid panel further comprises a second nucleic acid molecule, wherein the second nucleic acid molecule is ligated to the first nucleic acid molecule, thereby being immobilized on the nucleic acid panel, and the second nucleic acid molecule contains a capture sequence;

the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation.

In some embodiments, each first nucleic acid molecule is ligated to a second nucleic acid molecule.

In some embodiments, the 5' end of the second nucleic acid molecule is ligated to the 3' end of the first nucleic acid molecule.

In other embodiments, the nucleic acid panel further comprises a second nucleic acid molecule, wherein the second nucleic acid molecule is hybridized to a carrier sequence, thereby becoming immobilized on the nucleic acid panel.

In such embodiments, each carrier sequence further comprises a second immobilizing sequence at its 5' end, the second immobilizing sequence anneals to its complementary nucleotide sequence, and

the second nucleic acid molecule contains, in a 5' to 3' direction, the complement of a second immobilizing sequence and a capture sequence; the complement of the second immobilizing sequence hybridizes to the second immobilizing sequence of the carrier sequence to form a double strand;

the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation.

In some embodiments, each copy of each type of carrier sequence contains a second nucleic acid molecule hybridized thereto.

In some embodiments, the second immobilizing sequence anneals its complementary nucleotide sequence and initiates an elongation reaction (eg, it can be used as a primer binding site for a bridging PCR).

In some embodiments, the second immobilizing sequence is adjacent to the positioning sequence.

In some embodiments, the second nucleic acid molecule has a modification at the 5' end. In some embodiments, the modification is phosphorylation or modification with biotin.

In some embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In some embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In some embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

In some embodiments, multiple copies of the carrier sequence are an amplification product generated by amplification using a sequence complementary to the carrier sequence as a template, and the amplification is selected from rolling circle amplification (RCA), bridged PCR amplification, multiple displacement amplification chain (MDA) or emulsion PCR amplification.

In some embodiments, the multiple copies of the carrier sequence is a DNB formed by a concatemer of the carrier sequence. In some embodiments, the multiple copies of the carrier sequence is a DNB generated by rolling circle amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by a population of clones of the carrier sequence.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by bridging PCR amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by emulsion PCR amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by multiple strand displacement amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, the first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, and the UMI sequence is located at the 5' end of the complement of the first immobilizing sequence; or the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5' end of the capture sequence;

a UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5, e.g., 5 to 100, 5 to 50, 5 up to 20, for example 10) nucleotide N, where each N is independently any of A, C, G and T.

In some embodiments, the solid support is a chip. In some embodiments, a solid support can be used as a sequencing platform, such as a sequencing chip. In some embodiments, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI, or Thermo Fisher sequencing platforms.

In some embodiments, the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence contains at least 10 (eg, at least 20) deoxythymidine residues.

In some embodiments, the positional sequence is greater than 1 nt (nucleotide) in length, such as greater than 5 nt. In some embodiments, the positional sequence is 5 to 50 nt in length, such as 10 to 50 nt, 10 to 30 nt, or 20 to 30 nt. In some embodiments, the length of the positional sequence contained in different types of carrier sequence may be the same or different.

In some embodiments, the capture sequence is greater than 1 nt in length. In some embodiments, the capture sequence is 1 to 100 nt in length, such as 1 to 50 nt, such as 10 to 30 nt.

In some embodiments, the first immobilizing sequence is greater than 1 nt in length, such as greater than 10 nt. In some embodiments, the first immobilizing sequence has a length of from 10 to 200 nt. In some embodiments, the first immobilizing sequence has a length of from 20 to 100 nt, such as from 20 to 50 nt.

In some embodiments, the second immobilizing sequence is greater than 1 nt in length, such as greater than 10 nt. In some embodiments, the positional sequence is 10 to 200 nt in length, such as 10 to 100 nt, 10 to 50 nt, 10 to 30 nt, or 10 to 20 nt.

In a fourth aspect of the present invention, there is provided a kit for obtaining spatial information about a nucleic acid in a sample, comprising: (1) a panel of nucleic acids according to the third aspect, not containing a second nucleic acid molecule; and (2) a second nucleic acid molecule comprising, in a 5' to 3' direction, an immobilizing region and a capture sequence;

the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation.

In some embodiments, the kit comprises: (i) a panel of nucleic acids including a solid support (e.g., a chip) with multiple kinds of carrier sequences attached to its surface, wherein each kind of carrier sequence occupies a different position in the panel, wherein each specified type of carrier sequence contains multiple copies of the carrier sequence, and the carrier sequence in the 5' to 3' direction contains a positional sequence and a first immobilizing sequence,

the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel;

the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction;

the panel of nucleic acids also contains a first nucleic acid molecule, the first nucleic acid molecule contains in the 5' to 3' direction: the complement of the first immobilizing sequence and the complement of the positional sequence and hybridizes with the first immobilizing sequence and the positional sequence of the carrier sequence to form a double strand;

and (ii) a second nucleic acid molecule, the immobilizing region of which contains a double-stranded DNA sequence.

It will be readily understood that a ligase may be used to ligate the second nucleic acid molecule described in (ii) to the first nucleic acid molecule contained in the panel of nucleic acids described in (i). Thus, in some embodiments, the kit further comprises a ligase.

In other embodiments, the kit comprises: (i) a panel of nucleic acids including a solid support (e.g., a chip) with multiple kinds of carrier sequences attached to its surface, each kind of carrier sequence occupying a different position on the panel, each specified type of carrier sequence contains multiple copies of the carrier sequence, and the carrier sequence contains in the 5' to 3' direction: a second immobilizing sequence, a positional sequence and a first immobilizing sequence,

the second immobilizing sequence ensures annealing of its complementary nucleotide sequence;

the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel;

the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction;

the panel of nucleic acids also contains a first nucleic acid molecule, the first nucleic acid molecule contains in the 5' to 3' direction: the complement of the first immobilizing sequence and the complement of the positional sequence and hybridizes with the first immobilizing sequence and the positional sequence of the carrier sequence to form a double strand;

and (ii) a second nucleic acid molecule, the immobilizing region of which contains the complement of the second immobilizing sequence.

In some embodiments, the second immobilizing sequence is adjacent to the positioning sequence.

It will be readily understood that, under annealing conditions, the second nucleic acid molecule described in (ii) can hybridize to the complementary region of the carrier sequence contained in the panel of nucleic acids described in (i), so the second nucleic acid molecule can be ligated with the first nucleic acid molecule using a ligase. Thus, in some embodiments, the kit further comprises a ligase.

In another aspect, the present invention also relates to the use of a panel of nucleic acids according to the third aspect or a kit according to the fourth aspect for obtaining spatial information about a nucleic acid in a sample or for making a detection reagent for obtaining spatial information about a nucleic acid in a sample.

In some embodiments, spatial information about the nucleic acid includes the location, distribution and/or expression of the nucleic acid.

In some embodiments, the sample is a tissue sample, such as a tissue sample containing cells. In some embodiments, the sample is a tissue section. In some embodiments, the tissue section is prepared from fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

In a fifth aspect, the present invention also relates to a panel of nucleic acids for obtaining spatial information about a nucleic acid in a sample, including a solid support (eg, a chip) with multiple kinds of carrier sequences attached to its surface, where each kind of carrier sequence occupies a different position in the panel, wherein each said carrier sequence species comprises multiple copies of the carrier sequence, and the carrier sequence comprises, in a 5' to 3' direction: a capture sequence template, a positioning sequence, and a first immobilizing sequence, wherein

the capture sequence template contains a sequence complementary to the capture sequence, and the capture sequence is capable of hybridizing with all or part of the capture nucleic acid, including: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid;

the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel;

the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction; and the first immobilizing sequence also contains a cleavage site, and the cleavage may be selected from nickase enzyme cleavage, USER enzyme cleavage, photocleavage, chemical cleavage, or CRISPR-based cleavage;

the panel of nucleic acids also contains a first nucleic acid molecule (also referred to as a capture probe), and the first nucleic acid molecule contains, in the 5' to 3' direction: a binding region, a cleavage region, and a region complementary to the carrier sequence,

the binding region contains a linker capable of binding to the surface of a solid support;

the cleavage region contains the cleavage site;

the region complementary to the carrier sequence contains a sequence that may be complementary to the carrier sequence, and contains in the 5' to 3' direction: the complement of the first immobilizing sequence, the complement of the positional sequence and the capture sequence, and the capture sequence has a free 3' end , allowing the first nucleic acid molecule to serve as a primer for elongation;

and a region complementary to the carrier sequence of the first nucleic acid molecule hybridizes with the carrier sequence to form a double strand.

In some embodiments, the carrier sequence and the first nucleic acid molecule are single-stranded nucleic acid sequences. In some embodiments, the carrier sequence and the first nucleic acid molecule are single-stranded DNA sequences.

In some embodiments, each copy of each type of carrier sequence contains the above-mentioned first nucleic acid molecule hybridized therewith.

In some embodiments, the linker of the first nucleic acid molecule is a linker group capable of connecting to an activating group (eg, NH ₂ ), and the surface of the solid support is modified with an activating group (eg, NH ₂ ). In some embodiments, the linker comprises -SH, -DBCO, or -NHS. In some embodiments, the linker is (DBCO)a (azido-dPEG®8-NHS ester) is attached to the surface of the solid support.

In some embodiments, the cleavage site contained in the first immobilizing sequence is a cleavage site for the nickase enzyme. In some embodiments, the nickase enzyme is selected from USER, BamHI, BmtI, and the like. In certain exemplary embodiments, the cleavage site is set forth in SEQ ID NO: 14.

In some embodiments, the cleavage site contained in the cleavage region of the first nucleic acid molecule is a site at which controlled cleavage can be accomplished by chemical, enzymatic, or photochemical means. In some embodiments, the cleavage site is an enzyme cleavage site. In some embodiments, the cleavage site is a USER enzyme cleavage site (UUU).

In some embodiments, the cleavage region of the first nucleic acid molecule is different from the cleavage site contained in the first immobilizing sequence of the carrier sequence.

In some embodiments, a panel of nucleic acids is prepared by the method described in the second aspect.

In some embodiments, multiple copies of the carrier sequence are an amplification product generated by amplification using a sequence complementary to the carrier sequence as a template, and the amplification is selected from rolling circle amplification (RCA), bridged PCR amplification, multiple displacement amplification chain (MDA) or emulsion PCR amplification.

In some embodiments, the multiple copies of the carrier sequence is a DNB formed by a concatemer of the carrier sequence. In some embodiments, the multiple copies of the carrier sequence is a DNB generated by rolling circle amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by a population of clones of the carrier sequence.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by bridging PCR amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by emulsion PCR amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, multiple copies of the carrier sequence are a DNA cluster formed by multiple strand displacement amplification using a sequence complementary to the carrier sequence as a template.

In some embodiments, the carrier sequence further comprises a complement of a UMI sequence located upstream of the template capture sequence and upstream of the first capture sequence, the complement of the UMI sequence is complementary to the UMI sequence, and the UMI sequence is a nucleotide sequence consisting of at least of 1 (e.g. at least 2, at least 3. at least 4 or at least 5, e.g. 5 to 100, 5 to 50, 5 to 20, e.g. 10) nucleotide N, where each N is independently one of A, C, G and T;

and a region of the first nucleic acid molecule complementary to the carrier sequence further comprises a UMI sequence. located upstream of the capture sequence and downstream of the complement of the first immobilizing sequence.

In some embodiments, the complement of the UMI sequence is located between the positioning sequence and the capture sequence template or between the first capture sequence and the positioning sequence.

In some embodiments, each copy of each type of carrier sequence (ie, carrier sequences containing the same positional sequence) contains a unique complement of the UMI sequence. Accordingly, the first nucleic acid molecule (capture probe) hybridized to each of the copies of the carrier sequence also has a unique UMI sequence.

In some embodiments, the carrier sequence is removed from the panel of nucleic acids due to a cleavage site contained in the first immobilizing sequence of the carrier sequence. In such embodiments, the nucleic acid panel includes a solid support (e.g., a chip) with multiple kinds of capture probes (first nucleic acid molecules) attached to its surface, and each kind of capture probe (first nucleic acid molecule) occupies a specific position in the panel and oriented so as to have a free 3' end to allow the capture probe (first nucleic acid molecule) to serve as a primer for elongation, with each type of capture probe (first nucleic acid molecule) containing in the 5' to 3' direction: a binding region , the cleavage region, the complement of the positional sequence, and the capture sequence, where

the binding region contains a linker capable of binding to the surface of a solid support;

the cleavage region contains the cleavage site;

the positional sequence corresponds to the position of a given type of gripping probe on the panel;

the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (1a) an oligonucleotide sequence capable of capturing mRNA; and/or (1b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid.

In some embodiments, each capture probe of each capture probe species (i.e., capture probes containing the same positional sequence/positional sequence complement) has a unique UMI sequence, and the UMI sequence is located upstream of the capture sequence and downstream of the capture sequence from the area of splitting. In some embodiments, the UMI sequence is located at the 5' end of the capture sequence, for example, between the capture sequence and the complement of the positioning sequence. In other embodiments, the UMI sequence is located at the 5' end of the positional sequence complement, for example, between the cleavage region and the positional complement.

In some embodiments, each type of the above carrier sequence (i.e., carrier sequences containing the same positional sequence) or each type of capture probe occupies a region (i.e., an active region) on the surface of the solid support having a diameter of less than 1 micrometer, for example , about 900 nanometers, about 800 nanometers, about 700 nanometers, about 600 nanometers, or about 500 nanometers. In some embodiments, each type of the above carrier sequence or each type of capture probe occupies an active region with a diameter of approximately 500 nanometers.

In some embodiments, the solid support is a chip. In some embodiments, a solid support can be used as a sequencing platform. In some embodiments, the solid support is a sequencing chip (MGI), such as for the BGISEQ-500 platform. In some embodiments, the solid substrate is a high-density matrix chip, which can be obtained, for example, by the method described in patent CN 103180496 B.

In some embodiments, the first immobilizing sequence is greater than 1 bp in length, such as greater than 10 bp or greater than 20 bp. In some embodiments, the first immobilizing sequence has a length of from 20 to 100 bp, such as from 20 to 80 bp.

In some embodiments, the positional sequence is greater than 1 bp in length, such as greater than 10 bp. In some embodiments, the positional sequence is 10 to 100 bp in length, such as 10 to 50 bp, such as 10 to 30 bp, such as 20 bp.

In some embodiments, the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence contains at least 10 (eg, at least 20) deoxythymidine residues.

In some embodiments, the capture sequence is greater than 1 bp in length. In some embodiments, the capture sequence is 1 to 100 bp in length, such as 10 to 50 bp, such as 10 to 30 bp.

Detection method

In a sixth aspect of the present invention, there is provided a method for obtaining spatial information about a nucleic acid in a sample, comprising the following steps:

(1) providing a panel of nucleic acids according to the third aspect or obtaining a panel of nucleic acids by a method according to the first aspect; and

the nucleic acid panel contains multiple kinds of carrier sequences attached to the surface of a solid support (eg, a chip), each kind of carrier sequence occupies a specific position in the panel, and each kind of carrier sequence contains multiple copies of the carrier sequence;

each copy of the carrier sequence contains a first nucleic acid molecule and a second nucleic acid molecule hybridized thereto, and the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other;

the first nucleic acid molecule contains the complement of a positional sequence corresponding to the position of a given type of carrier sequence on the panel,

the second nucleic acid molecule contains a capture sequence capable of capturing a nucleic acid in a sample;

(2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that a nucleic acid in the test sample anneals to the capture sequence of a second nucleic acid molecule and the position of the nucleic acid can be matched to the position of a carrier sequence on the panel of nucleic acids;

(3) (i) ligating a first nucleic acid molecule and a second nucleic acid molecule that are hybridized to each copy of the carrier sequence (eg, using a ligase);

performing a primer elongation reaction using ligated first and second nucleic acid molecules as a primer and using the captured nucleic acid molecule as a template under conditions allowing for primer elongation, so as to obtain an elongation product in which a strand that hybridizes with the captured nucleic acid molecule, has a positional sequence complement contained in the first nucleic acid molecule as a spatial information tag; and/or

carrying out a primer elongation reaction using a captured nucleic acid molecule as a primer, and using ligated first and second nucleic acid molecules as a template under conditions that ensure primer elongation, so as to obtain an elongated captured nucleic acid molecule, wherein the elongated captured nucleic acid molecule has a positional sequence as a spatial information label;

alternatively, (ii) performing a primer elongation reaction using a second nucleic acid molecule as a primer and using the captured nucleic acid molecule as a template under conditions allowing primer elongation so as to produce an extended second nucleic acid molecule, wherein the extended second nucleic acid molecule comprises a sequence complementary to the captured nucleic acid; ligating a first nucleic acid molecule and an extended second nucleic acid molecule hybridized to each copy of a carrier sequence (e.g., using a ligase) such that the extended second nucleic acid molecule ligated to the first nucleic acid molecule has a positional sequence complement contained in the molecule the first nucleic acid, as a spatial information label;

(4) releasing from the surface of the panel at least a portion of the nucleic acid molecules bearing the spatial information tags, the portion comprising a positional sequence or a strand complementary thereto and an entrapped nucleic acid molecule or a strand complementary thereto; And

(5) directly or indirectly analyzing the sequence information of the nucleic acid molecule released in step (4).

In such embodiments, prior to capture of the target nucleic acid in step (2), the first nucleic acid molecule is not ligated to a second nucleic acid molecule in the panel of nucleic acids.

A seventh aspect of the present invention provides a method for obtaining spatial information about a nucleic acid in a sample, comprising the following steps:

(1) providing a panel of nucleic acids according to the first aspect or obtaining a panel of nucleic acids by a method according to the third aspect; Where

the nucleic acid panel contains multiple kinds of carrier sequences attached to the surface of a solid support (eg, a chip), each kind of carrier sequence occupies a specific position in the panel, and each kind of carrier sequence contains multiple copies of the carrier sequence;

each copy of the carrier sequence contains a first nucleic acid molecule hybridized thereto, and the first nucleic acid molecule is ligated to a second nucleic acid molecule;

the first nucleic acid molecule contains the complement of a positional sequence corresponding to the position of a given type of carrier sequence on the panel,

the second nucleic acid molecule contains a capture sequence capable of capturing a nucleic acid in a sample;

(2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that a nucleic acid in the test sample anneals to the capture sequence of a second nucleic acid molecule and the position of the nucleic acid can be matched to the position of a carrier sequence on the panel of nucleic acids;

(3) (iii) performing a primer elongation reaction using ligated first and second nucleic acid molecules as a primer and using the captured nucleic acid molecule as a template under primer elongation conditions, so as to obtain an elongation product in which a strand hybridized with captured by the nucleic acid molecule, has a positional sequence complement contained in the first nucleic acid molecule as a spatial information tag; and/or

performing a primer elongation reaction using a captured nucleic acid molecule as a primer, and using ligated first and second nucleic acid molecules as a template under conditions that ensure primer elongation, so as to obtain an elongated captured nucleic acid molecule, wherein the elongated captured nucleic acid sequence has a positional sequence as a spatial information label;

(4) releasing from the surface of the panel at least a portion of the nucleic acid molecules bearing the spatial information tags, the portion comprising a positional sequence or a strand complementary thereto and an entrapped nucleic acid molecule or a strand complementary thereto; And

(5) directly or indirectly analyzing the sequence information of the nucleic acid molecule released in step (4).

In such embodiments, prior to capturing the target nucleic acid in step (2), the first nucleic acid molecule is ligated to a second nucleic acid molecule in a panel of nucleic acids.

In some embodiments of the method of the sixth or seventh aspect, the multiple copies of the carrier sequence are a DNB formed by a concatemer of the carrier sequence, or the multiple copies of the carrier sequence are a DNA cluster formed by a population of clones of the carrier sequence.

In some embodiments of the method of the sixth or seventh aspect, the carrier sequence and the first nucleic acid molecule are single-stranded DNA. In some embodiments, the second nucleic acid molecule is single-stranded DNA or single-stranded RNA.

An eighth aspect of the present invention provides a method for obtaining spatial information about a nucleic acid in a sample, comprising the following steps:

(1) providing a panel of nucleic acids according to the fifth aspect or obtaining a panel of nucleic acids by a method according to the second aspect; wherein the panel of nucleic acids comprises multiple kinds of carrier sequences attached to the surface of a solid support (eg, a chip), each kind of carrier sequence occupies a specific position in the panel, and each type of carrier sequence contains multiple copies of the carrier sequence;

each copy of the carrier sequence contains a first nucleic acid molecule hybridized thereto, and the first nucleic acid molecule contains a positional sequence complement corresponding to the position of a given type of carrier sequence in the panel, and a capture sequence capable of capturing the nucleic acid in the sample;

(2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that a nucleic acid in the test sample anneals to the capture sequence of the first nucleic acid molecule, and thus the position of the nucleic acid can be compared with the position of the first nucleic acid molecule in the panel nucleic acids;

(3) performing a primer elongation reaction using a first nucleic acid molecule as a primer and using the captured nucleic acid molecule as a template under conditions allowing for primer elongation to produce an elongation product in which the strand hybridized with the captured nucleic acid molecule has complement a positional sequence contained in the first nucleic acid molecule as a spatial information tag;

(4) releasing from the surface of the panel at least a portion of the nucleic acid molecules bearing the spatial information tags, the portion comprising a positional sequence or a strand complementary thereto and an entrapped nucleic acid molecule or a strand complementary thereto; And

(5) directly or indirectly analyzing the sequence information of the nucleic acid molecule released in step (4).

In some embodiments, before step (2), the method further includes cleavage at a cleavage site contained in the first immobilizing sequence of the carrier sequence to cut the carrier sequence and, at the same time, ligating the first nucleic acid molecule (capture probe) to the surface of a solid support (eg , chip); In such embodiments, the nucleic acid panel contains multiple types of capture probes attached to the surface of a solid support (e.g., a chip), each type of capture probe occupies a specific position in the panel, and the capture probe contains the complement of a positional sequence corresponding to the position of the type of capture probe in the panel, and a capture sequence capable of capturing a nucleic acid in a sample;

(2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that the nucleic acid in the test sample anneals to the capture sequence of the capture probe and the position of the nucleic acid can be matched to the position of the capture probe on the panel;

(3) performing a primer elongation reaction using a capture probe as a primer and using a captured nucleic acid molecule as a template under conditions allowing primer elongation, wherein the resulting elongation product contains the complement of the positional sequence as a spatial information tag and a sequence complementary to the molecule captured nucleic acid, forming a DNA molecule carrying a spatial information label; optionally creating a strand complementary to a DNA molecule carrying a spatial information tag, and/or optionally amplifying a DNA molecule carrying a spatial information tag;

(4) releasing from the surface of the panel at least a portion of the DNA molecules carrying the spatial information tags and/or their complements or amplicons, wherein a portion contains the spatial information tag or a strand complementary thereto; And

(5) directly or indirectly analyzing the sequence information of the nucleic acid molecule released in step (4).

In some embodiments of the method of the eighth aspect, the first nucleic acid molecule and the capture probe are DNA molecules, such as single-stranded DNA.

In some embodiments of the method of any of the sixth to eighth aspects, the spatial information about the nucleic acid includes the location, distribution and/or expression of the nucleic acid.

In some embodiments of the method of any of the sixth to eighth aspects, the sample is a tissue sample, such as a tissue section. In some embodiments, the tissue section is prepared from fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

In some embodiments of the method of any of the sixth through eighth aspects, the method is used for non-diagnostic purposes.

In some embodiments of the method described in any of the sixth to eighth aspects, any nucleic acid analysis method may be used in step (5). In some embodiments, this step may include sequencing. In some embodiments, sequence-specific analysis methods can be used. For example, a sequence-specific amplification reaction can be performed, for example, using primers specific for a positional domain and/or a specific target sequence (eg, the particular DNA being detected). An example of an analysis method is a sequence-specific PCR reaction. Thus, in some embodiments, this step may include a sequence-specific PCR reaction.

In some embodiments of the method described in any of the sixth to eighth aspects, the information obtained from the sequence analysis in step (5) can be used to obtain spatial information about the nucleic acid in the sample (ie, position information). In some embodiments, spatial information may be inferred from the nature of the information obtained during sequence analysis, e.g., the presence of a particular nucleic acid may be detected, which may itself be informative about the tissue sample used, and/or spatial information (e.g., spatial localization) can be inferred from the position of the tissue sample in the panel, coupled with information obtained from sequencing. Thus, the method may include simply matching information obtained from the sequence analysis to a position in a tissue sample, for example, through a positional tag and matching to a position in the tissue sample. In some embodiments, spatial information can be conveniently obtained by correlating sequence analysis data with an image of a tissue sample. Therefore, in such embodiments, the method according to any of the sixth to eighth aspects further includes step (6): matching the information obtained from the sequence analysis in step (5) with a sample image, where the sample image is obtained before or after step (3). In some embodiments, the sample is imaged using light, bright-field, dark-field, phase contrast, fluorescence, reflectance, interference, confocal microscopy, or a combination thereof.

In some embodiments of the method of the sixth aspect, the method is used to determine the transcriptome in a sample. In such embodiments, step (3)(i) generates a cDNA molecule from the captured RNA molecule using ligated first and second nucleic acid molecules as a primer for reverse transcription, said cDNA molecule having a positional sequence complement contained in the molecule as a spatial information tag the first nucleic acid, and optionally the cDNA molecule is amplified; or in step (3)(ii), generating a cDNA molecule from the captured RNA molecule using a second nucleic acid molecule as a primer for reverse transcription, and the first nucleic acid molecule and the cDNA molecule hybridized to each carrier sequence are ligated (for example, to using a ligase) to create a cDNA molecule having as a spatial information tag the complement of a positional sequence contained in the first nucleic acid molecule, and optionally the cDNA molecule is amplified; and in step (4) at least a portion of the cDNA molecules and/or amplicons thereof are released from the surface of the panel, wherein the released nucleic acid molecule may be a first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the portion comprises a sequence carrying spatial information , or its complementary chain. In some embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

In some embodiments of the method of the seventh aspect, the method is used to determine the transcriptome in a sample. In such embodiments, step (3)(iii) generates a cDNA molecule from the captured RNA molecule using ligated first and second nucleic acid molecules as a primer for reverse transcription, the cDNA molecule having a positional sequence complement contained in the first nucleic acid molecule as spatial information tags, and possibly the cDNA molecule is amplified; and in step (4) at least a portion of the cDNA molecules and/or amplicons thereof are released from the surface of the panel, wherein the released nucleic acid molecule may be a first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the portion comprises a sequence carrying spatial information , or its complementary chain. In some embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

In some embodiments of the method of the eighth aspect, the method is used to determine the transcriptome in a sample. In such embodiments, step (3) generates a cDNA molecule from the captured RNA molecule using a capture probe as a primer for reverse transcription, the cDNA molecule is tagged with spatial information, and optionally the cDNA molecule is amplified; in step (4), at least a portion of the cDNA molecules and/or amplicons thereof are released from the surface of the panel, wherein the released nucleic acid molecule may be the first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the portion comprises a spatial information tag or complementary sequence her chain. In some embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

In some embodiments of the method of any of the sixth to eighth aspects, before or after the release of a nucleic acid molecule (e.g., a DNA molecule) bearing a spatial information tag or a cDNA molecule carrying a spatial information tag from the surface of the panel, a complementary strand or a second strand of cDNA is formed .

The step of forming the second strand of DNA (eg, cDNA) can be performed on the panel in situ, either as a separate step of second strand synthesis or as an initial step in the amplification reaction. Alternatively, the first strand of DNA, for example a cDNA (i.e., a strand synthesized using a captured nucleic acid molecule as a template) can be released from the panel and the second strand can then be synthesized, for example in a solution reaction, or as a separate step or in an amplification reaction.

When second strand synthesis is performed on a panel (i.e., in situ), the method may include the optional step of removing an entrapped nucleic acid molecule (e.g., RNA) prior to second strand synthesis, for example, using an RNA degrading enzyme (RNase), e.g. RNase H. Methods for this are well known and described in the art. However, this step is usually unnecessary, and in most cases the RNA is degraded naturally. The step of removing the sample from the panel typically also removes RNA from the panel.

In some embodiments, the second strand of DNA (eg, cDNA) is formed in a single reaction, and the synthesis of the second strand can be accomplished by any suitable method known in the art. For example, the first strand of cDNA released from the panel substrate can be incubated with random primers, eg, hexamer primers, and a DNA polymerase, eg, strand extrusion polymerase, to perform a DNA synthesis reaction using the first strand as a template. Thus, in some embodiments, a random primer and a strand extrusion polymerase are used in the synthesis of the complementary strand or second strand.

In some embodiments of the method of any of the sixth to eighth aspects, the step of amplifying nucleic acid molecules (eg, DNA molecules) or cDNA molecules bearing a spatial information tag is further included before sequence analysis. In some embodiments, the amplification step is performed after nucleic acid molecules (e.g., DNA molecules) or cDNA molecules bearing spatial information tags are released from the panel, or the amplification step is performed on the panel in situ (i.e., when the first nucleic acid molecules and/or sequences -carriers and/or capture probes are still ligated to the surface of the solid support). In some embodiments, the amplification step includes PCR.

In some embodiments of the method described in any of the sixth to eighth aspects of step (4), the molecule is released from the surface of the panel by the following method: (1) cleavage of the nucleic acid; (2) denaturation and/or (3) physical means. In some embodiments, the molecule is released upon exposure of the solid support to heated water or buffer.

In some embodiments, the step of purifying the released molecule is further included before sequencing.

In some embodiments, after contacting the sample with the panel and before step (3), a sample rehydration step is additionally included.

In some embodiments, before step (4), the method further includes the step of washing the panel to remove sample debris (eg, tissue).

In some embodiments, the panel includes at least one orientation marker for orienting the pattern on the panel.

In some embodiments, in step (5), sequence analysis includes a sequencing step. In some embodiments, the sequencing step includes a sequencing reaction based on reversible dye-labeled terminators.

The method for obtaining spatial information about a nucleic acid according to any of the sixth to eighth aspects of the present invention can be used for RNA detection, transcriptomic analysis, DNA detection, genomic analysis and the like. Spatial information is of great importance for studies related to transcriptomics and genomics, especially useful in the study of transcriptomic or genomic variations in different cells or tissue regions, such as the comparative study of normal and pathological cells or tissues, or the study of transcriptomic or genomic changes during the course of disease and etc.

For example, pathophysiological analysis in Alzheimer's disease shows that its pathological process affects the interaction of neurons and glial cells, and related transcriptomic and epigenetic studies have also found severe impairment of neuronal function in the brains of patients with Alzheimer's disease and abnormalities of the innate immune response. However, population-level studies have failed to detect complex changes in cells and cell populations, particularly in these rare cell types. However, conventional studies at the single-cell level do not reveal differences in the characteristics of specific cell types in different tissue regions and changes in cellular composition during neurodegeneration. Therefore, to further study the pathogenetic mechanism and disease development process, it is necessary to obtain information about the transcriptome of single cells along with spatial characteristics.

The method for obtaining spatial information about a nucleic acid according to any one of the sixth to eighth aspects of the present invention allows nucleic acid molecules to be immobilized in various regions of a brain tissue sample on a chip due to a position-tag capture sequence ligated to the chip, and sequencing is performed, so that the resulting transcriptomic results analyzes that include precise positional information can detect changes in specific cell types in different areas during the progression of Alzheimer's disease. In particular, since the dimensions of the DNB active region or DNA cluster on the chip of the present invention are in the nanometer range and the cell diameter is approximately 12 μm, the chip of the present invention allows spatial location information to be obtained with subcellular resolution.

The present invention also includes the following exemplary embodiments.

Embodiment 1. A method for producing a panel of nucleic acids used to obtain spatial information about a biomolecule (for example, a nucleic acid) in a biological sample, comprising the following steps:

(1) providing a circular nucleic acid template containing a template sequence of a capture probe, and the template sequence comprises in a 5' to 3' direction a linker region, a spatial label region, and a capture region; wherein

the linker region contains a cleavage site, and the cleavage may be selected from nickase enzymatic cleavage, USER enzymatic cleavage, photocleavage, chemical cleavage, or CRISPR-based cleavage;

the spatial cue region contains a spatial cue sequence, and the spatial cue sequence corresponds to a position of a given capture probe in the panel;

the capture region comprises a capture sequence capable of capturing a biomolecule (eg, a nucleic acid) in a sample; wherein the capture sequence contains: (1a) an oligonucleotide sequence capable of capturing mRNA; and/or (16) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target molecule (eg, target nucleic acid);

(2) performing rolling circle amplification (RCA) using a circular nucleic acid template as a template to produce a DNA nanobead (DNB) that is formed by a concatemer of a sequence complementary to the template sequence (ie, a sequence complementary to the template);

(3) ligation of DNB to the surface of a solid support (eg, a chip);

(4) providing a primer-probe and, using a template-complementary sequence contained in the DNB as a template, performing a primer elongation reaction to produce an elongation product, wherein the strand hybridized to the template-complementary sequence constitutes a capture probe; possibly amplification of the elongation product; wherein the primer-probe contains in the direction from 5' to 3' a binding region, a cleavage region and a linker region of the primer; and

the binding region contains a linker that can be bonded to the surface of a solid support;

the cleavage region contains the cleavage site;

the primer linker region is complementary to all or part of the sequence of the linker region complementary to the template sequence contained in the DNB (ie, the sequence complementary to the linker region of the template sequence) and has a free 3' end allowing the primer-probe to serve as a primer and initiate an elongation reaction; preferably, the primer linker region comprises a template sequence linker region sequence or a fragment thereof;

(5) binding of the primer-probe to the surface of the solid support; wherein steps (4) and (5) are performed in any order;

(6) performing a cleavage at the cleavage site contained in the linker region to cut the DNB so that the elongation product in step (4) is separated from the DNB matrix forming the elongation product, thereby ligating the capture probe to the surface of the solid support (e.g., chip );

preferably, the circular nucleic acid template, DNB and capture probe are DNA;

Preferably, to obtain a solid support (eg, a chip) with multiple kinds of capture probes attached to its surface, multiple kinds of circular nucleic acid templates are provided in step (1), and each kind of circular nucleic acid template contains a unique capture probe template sequence.

Embodiment 2. The method of Embodiment 1, wherein the cleavage site contained in the linker region is a cleavage site for the nickase enzyme;

preferably, the nickase enzyme is selected from USER, BamHI and BmtI.

Embodiment 3. The method according to embodiment 1 or 2, wherein the linker region further comprises a sequencing primer hybridization region and/or an amplification primer hybridization region; wherein the hybridization region of the sequencing primer provides annealing of the sequencing primer and initiation of the sequencing reaction, and the hybridization region of the amplification primer provides annealing of the amplification primer and initiation of the elongation reaction and the amplification reaction.

Embodiment 4. The method according to any of embodiments 1-3, wherein the oligonucleotide sequence capable of capturing mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA;

preferably, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence;

preferably, the poly-T oligonucleotide sequence contains at least 10 (eg at least 20) deoxythymidine residues.

Embodiment 5. The method according to any one of embodiments 1-4, wherein the template sequence further comprises a probe label region located upstream of the capture region and downstream of the linker region, and the probe label region contains a sequence complementary to the probe label , consisting of modified bases, and modified bases are capable of forming complementary pairs with various types of standard bases (for example, C, G, A, T, U) using hydrogen bonds;

preferably, the probe mark region is located between the spatial mark region and the capture region, or between the linker region and the spatial mark region;

preferably, the sequence complementary to the probe tag contains multiple (eg, at least 10) inosines.

Embodiment 6. The method according to any of embodiments 1-5, having one or more of the following features:

(1) the linker region is more than 1 bp in length, such as more than 10 bp or more than 20 bp; preferably, the linker region has a length of from 20 to 100 bp;

(2) the spatial label region is more than 1 bp in length, such as more than 10 bp; preferably, the spatial label region has a length of from 10 to 100 bp;

(3) the capture region is longer than 1 bp; preferably, the capture region has a length of from 1 to 100 bp;

(4) the probe label region is more than 1 bp in length, such as more than 5 bp; preferably, the probe label region is between 5 and 100 bp in length.

Embodiment 7. The method according to any of embodiments 1-6, where the solid substrate is a chip;

preferably, the solid support can be used as a sequencing platform, such as a sequencing chip.

Embodiment 8. The method according to any one of embodiments 1 to 7, wherein in step (4), when performing the primer elongation reaction, a sequence complementary to the spatial tag sequence is sequenced to obtain information about the sequence of the spatial tag contained in the corresponding capture probe.

Embodiment 9. The method according to any of embodiments 1 to 7, wherein before step (4) there is further included the step of sequencing a sequence complementary to the spatial label sequence contained in the DNB;

preferably, after sequencing, dNTPs added to the synthetic strand due to sequencing are removed by washing.

Embodiment 10. The method according to any one of embodiments 1-9, wherein the linker is a linker group capable of connecting to an activating group (eg, NH ₂ ), and the surface of the solid support is modified with an activating group (eg, NH ₂ );

preferably the linker contains -SH, -DBCO or -NHS;

preferably the linker is (DBCO), and (azido-dPEG®8-NHS ester) is attached to the surface of the solid support.

Embodiment 11. The method according to any one of embodiments 1 to 10, wherein the cleavage site contained in the cleavage region is a site in which controlled cleavage can be carried out by a chemical, enzymatic or photochemical method;

preferably, the cleavage site is an enzyme cleavage site;

preferably, the cleavage sites contained in the cleavage region and the linker region are different.

Embodiment 12. The method according to any of embodiments 1-11, where the amplification includes PCR.

Embodiment 13. A panel of nucleic acids prepared by the method of any one of embodiments 1-12.

Embodiment 14. A nucleic acid panel for obtaining spatial information about a biomolecule (e.g., a nucleic acid) in a sample, including a solid support (e.g., a chip) with multiple types of capture probes attached to its surface, where each type of capture probe occupies a specific position in the panel and is oriented such that it has a free 3' end to allow the capture probe to serve as a primer for elongation, with each capture probe species containing in the 5' to 3' direction: a binding region, a cleavage region, a spatial tag sequence, and a capture region sequence where

the binding region contains a linker that can be bonded to the surface of the solid support;

the cleavage region contains the cleavage site;

the spatial mark sequence corresponds to the position of a given type of capture probe on the panel;

the capture sequence is capable of hybridizing with all or part of the captured biomolecule (eg, nucleic acid) and contains: (1a) an oligonucleotide sequence capable of capturing mRNA; and/or (1b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target molecule (eg, target nucleic acid).

Embodiment 15. The panel of nucleic acids of Embodiment 14, wherein each capture probe of each capture probe species (i.e., capture probes containing the same spatial tag sequence) has a unique probe tag sequence, and the probe tag sequence is located upstream of the capture probe. sequence and in the direction downstream of the cleavage region;

preferably, the probe label sequence is located between the capture sequence and the spatial label sequence or between the cleavage region and the spatial label sequence.

Embodiment 16. The nucleic acid panel of embodiment 14 or 15, wherein each kind of capture probe (ie, capture probes containing the same space label sequence) occupies a region (ie, active region) less than 1 micron in diameter on the surface of a solid support;

Preferably, each type of capture probe occupies an active region of approximately 500 nanometers in diameter.

Embodiment 17. The nucleic acid panel according to any one of embodiments 14-16, wherein the solid support is a chip;

preferably, the solid support can be used as a sequencing platform, such as a sequencing chip.

Embodiment 18. A panel of nucleic acids according to any one of embodiments 14-17, obtained by the method according to any one of embodiments 1-12.

Embodiment 19. A method for obtaining spatial information about a biomolecule in a sample, including the following stages:

(1) providing a panel of nucleic acids according to any of embodiments 13-18 or obtaining a panel of nucleic acids by a method according to any of embodiments 1-12; a nucleic acid panel contains multiple kinds of capture probes attached to the surface of a solid support (e.g., a chip), each kind of capture probe occupies a specific position in the panel, and the capture probe contains a spatial label sequence corresponding to the position of that kind of capture probe in the panel, and a capture sequence , capable of capturing a biomolecule in a sample;

(2) bringing the panel of nucleic acids into contact with the sample of interest, such that the capture sequence of the capture probe binds to a biomolecule in the sample of interest, and thus the position of the biomolecule can be matched to the position of the capture probe in the panel of nucleic acids, and a spatially labeled biomolecule is generated ;

(3) release of a spatially labeled biomolecule from the surface of the panel; And

(4) direct or indirect sequence analysis of the biomolecule released in step (3).

Embodiment 20. A method for obtaining spatial information about a nucleic acid in a sample, comprising the following steps:

(1) providing a panel of nucleic acids according to any of embodiments 13-18 or obtaining a panel of nucleic acids by a method according to any of embodiments 1-12; a nucleic acid panel contains multiple kinds of capture probes attached to the surface of a solid support (eg, a chip), each kind of capture probe occupies a specific position in the panel, and the capture probe contains a spatial label sequence corresponding to the position of a given kind of capture probe in the panel, and a capture sequence , capable of capturing nucleic acid in a sample;

(2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that the nucleic acid in the test sample anneals to the capture sequence of the capture probe, and thus the position of the nucleic acid can be matched to the position of the capture probe in the panel;

(3) performing a primer elongation reaction under conditions allowing primer elongation, using a capture probe as a primer and using a captured nucleic acid molecule as a template, the resulting elongation product contains a spatial tag sequence and a sequence complementary to the captured nucleic acid molecule, thereby producing a molecule Spatial labeled DNA; optionally creating a strand complementary to the spatially labeled DNA molecule, and/or optionally amplifying the spatially labeled DNA molecule;

(4) releasing from the surface of the panel at least a portion of DNA molecules carrying spatial information tags and/or complementary chains or amplicons, wherein a portion contains a spatial tag sequence or a chain complementary thereto; And

(5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4);

preferably, the spatial information about the nucleic acid includes the location, distribution and/or expression of the nucleic acid; preferably, the capture probe is a DNA molecule; preferably the sample is a tissue sample, such as a section

fabrics;

preferably, the tissue section is prepared from fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

Embodiment 21. The method according to embodiment 20, wherein in step (5) the sequence analysis includes sequencing or a site-specific PCR reaction.

Embodiment 22. The method of embodiment 20 or 21, further comprising step (6): comparing the information obtained from sequence analysis in step (5) with a sample image, where the sample image is obtained before or after step (3).

Embodiment 23. The method according to any of embodiments 20-22, which is used to determine the transcriptome in a sample, where:

in step (3), synthesizing a cDNA molecule from the captured RNA molecule using a capture probe as a primer for RT, wherein the cDNA molecule is spatially labeled, and optionally amplifying the cDNA molecule;

at step (4) at least a portion of the cDNA molecules and/or amplicons thereof are released from the surface of the panel, wherein the released nucleic acid molecule may be the first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the portion contains a spatial tag sequence or complementary thereto chain;

preferably, in step (1) the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

Embodiment 24. The method according to any one of embodiments 20-23, in which, before or after the release of a spatially labeled DNA molecule or a spatially labeled cDNA molecule from the surface of the panel, a complementary strand or a second cDNA strand is formed;

Preferably, a random primer and a strand displacement polymerase are used in the synthesis of the complementary strand or second strand.

Embodiment 25. The method according to any of embodiments 20-24, further comprising the step of amplifying a DNA molecule or cDNA molecule labeled with a spatial tag before sequence analysis;

Preferably, the amplification step is carried out after the spatially labeled DNA molecule or cDNA molecule is released from the surface of the panel, or the amplification step is carried out on the panel in situ:

preferably, the amplification step includes PCR.

Embodiment 26. The method of any one of embodiments 20-25, wherein the sequence analysis further includes the step of purifying the released molecule.

Embodiment 27. The method according to any of embodiments 20-26, further comprising, before step (4), the step of washing the panel to remove sample residues (eg, tissue).

Embodiment 28. The method according to any one of embodiments 20-27, wherein in step (4) the molecule is released from the surface of the panel by the following method: (1) cleavage of the nucleic acid; (2) denaturation and/or (3) physical means;

preferably, the molecule is released by enzymatic cleavage of the capture probe in the region of cleavage.

Embodiment 29. The method according to any one of embodiments 20-28, wherein in step (6) an image of the sample is obtained using light, bright-field, dark-field, phase contrast, fluorescence, reflectance, interference, confocal microscopy, or a combination thereof.

Beneficial effect

This invention provides a new panel for obtaining spatial information about a nucleic acid and a method for obtaining it. When a nucleic acid panel is used to obtain spatial information about a nucleic acid, high-precision positioning at the subcellular level and high-throughput positioning at the tissue level can be realized at the same time. The panel of the present invention and the detection method based on the panel are of great practical importance for cellular level positioning, subcellular level positioning, organelle level positioning, cellular interaction, organelle interaction, molecular pathway research, disease diagnosis and the like.

BRIEF DESCRIPTION OF GRAPHIC MATERIALS

In FIG. Figure 1 shows a diagram of cDNA synthesis after mRNA capture in Example 2.

In FIG. 2 shows a schematic representation of the molecule released from the chip in Example 2.

In FIG. Figure 3 shows the results of assessing the degree of cDNA fragmentation using the 2100 analyzer in Example 2.

In FIG. 4 shows the results of a sequence alignment of the 25 bp of the first strand obtained from cDNA sequencing in Example 3 and the fq file of the positional sequence on the capture chip.

In FIG. Figure 5 shows a graph of mRNA expression in the tissue section of Example 3.

In FIG. 6 shows a schematic representation of the primer probe and carrier sequence contained in the DNB from the embodiment illustrated in Example 4.

In FIG. 7 shows a schematic representation of the probe ligated to the chip in Example 4.

In FIG. 8 shows a diagram of the cDNA synthesis of the captured nucleic acid molecule in Example 5.

In FIG. 9 shows a schematic representation of the molecule released from the chip in Example 5.

In FIG. Figure 10 shows the results of assessing the degree of cDNA fragmentation using the 2100 analyzer in Example 5.

In FIG. 11 shows the results of a sequence alignment of the 20 bp of the first strand obtained from cDNA sequencing in Example 6 and the fq file of the positional sequence on the capture chip.

In FIG. 12 shows mRNA expression in the tissue section of Example 6.

DESCRIPTION OF EXAMPLES OF IMPLEMENTATION OF THE INVENTION

The present invention will be described in more detail below with reference to the following examples, which are given to illustrate the invention without limiting its scope.

Unless otherwise indicated, the experiments and methods described in the Examples were carried out according to standard methods well known in the art and described in various sources. In addition, in cases where special conditions are not specified in the Examples, they were carried out in accordance with standard conditions or conditions recommended by the manufacturer. All reagents or instruments used that did not have manufacturer's recommendations were standard commercially purchased products. Those skilled in the art will understand that the Examples are provided by way of illustration to describe the invention and are not intended to limit the scope of the claimed invention. All publications and other sources mentioned in this document are incorporated by reference in their entirety.

Example 1: Obtaining a Capturing Chip (1)

1. Designed and synthesized the following DNA library. The sequence was synthesized at Beijing Liuhe BGI.

5'-phosphoryl-AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (Linker A, SEQ ID NO: 1) NNNNNNNNNNNNNNNNNNNNNNNNNNNNN (positional sequence complement, N represents any base such as C, G, A or T) CTGATAAGGTCGCCA (second immobilizing sequence complement. SEQ ID NO: 2) CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT (Linker B, SEQ ID NO: 3)-3'. Where Linker A contained part of the complement of the first immobilization sequence and a circularization site, and Linker B contained another part of the complement of the first immobilization sequence, a cleavage site and a circularization site.

2. In situ library amplification

Preparation of DNA nanoball (DNB): 40 μL of the following reaction mixture was prepared and 80 fmol of the above DNA library was added, and the DNB primer had the sequence GGCCTCCGACTTAAGTCGGATCGT (SEQ ID NO: 4), and it was synthesized in Beijing Liuhe BGI.

The above reaction mixture was placed into a PCR machine to carry out the reaction. The reaction conditions were as follows: 95°C for 3 min, 40°C for 3 min; After completion of the reaction, the mixture was placed on ice, 40 μl of enzyme I mixture and 2 μl of enzyme II mixture from the DNBSEQ sequencing kit were added, which were necessary to obtain DNB, as well as 1 μl of ATP (100 mM matrix solution, Thermo Fisher) and 0. 1 µl T4 ligase (manufactured by BGI). After thorough mixing, the above reaction mixture was transferred to a PCR machine at 30°C and reacted for 20 min to form DNB. DNB was loaded according to the procedure described in the BGISEQ500 SE50 kit onto the BGISEQ500 sequencing chip.

3. Sequencing and positional sequencing: Positional sequencing and sequencing were carried out in accordance with the instructions for the BGISEQ500 SE50 sequencing kit, the read length was 25 bp. The fq file generated by sequencing was stored for future use.

4. Immobilization of the capture sequence: The following DNA sequence was synthesized in Beijing Liuhe BGI: 5'-phosphoryl-CTGATAAGGTCGCCA (complement of the second immobilization sequence, SEQ ID NO: 5) NNNNNNNNNN (UMI) TTTTTTTTTTTTTTTTTTTVN (capture sequence, SEQ ID NO: 6)-3 ', where N represents any base (eg C, G, A or T). The sequencing chip was removed from the sequencer and the Hole 7 digestion reagent from the BGISEQ500 SE50 kit was injected into the chip (ensuring that the chip was completely coated with the reagent and no bubbles had formed). The chip was left at 60°C and the reaction was carried out for 10 minutes. After completion of the reaction, an appropriate amount of 5×SSC (standard saline solution, purchased from Shanghai Shenggong) was injected into the sequencer chip to replace the previous reagent in the chip. The capture sequence was diluted with 5×SSC to 1 μM and the appropriate amount of diluted capture sequence was added to the chip so that the chip was filled with the capture sequence. The chip was left at room temperature for approximately 30 min to allow the capture sequence to fully hybridize to the DNB.

5. Cutting the chip: The resulting chip was cut into several smaller pieces, selecting the size of each piece in accordance with the objectives of the experiment, and the chip was immersed in 50 mM Tris buffer with pH 8.0 and stored at 4°C for further use.

Example 2. Capture of tissue mRNA and synthesis to DNA

1. Preparation of frozen tissue sections. Mouse cerebellar tissue sections were prepared according to standard procedures for cryostat sections.

2. Capture of mRNA. A suitable size chip obtained in Example 1 corresponding to the size of the tissue section was taken and left at room temperature. After the liquid evaporated from the chip, the tissue section was attached to the chip due to the temperature difference between the chip and the tissue section in the cryotome. The attached tissue section was left at room temperature, a 5×SSC reaction solution was added to the chip (and completely covering the area with the attached tissue), and the reaction was carried out at 30°C for 30 minutes to allow the mRNA in the tissue to fully hybridize to the capture region on the chip.

3. cDNA synthesis. The chip was washed twice with 5xSSC at room temperature, 200 μl of the following reaction mixture was prepared for the reverse transcription reaction, the reaction solution was added to the chip to completely cover it, and the reaction was carried out at 42°C for 90-180 min. PolyT was used as a primer for the synthesis of cDNA from mRNA; the 3' end of the mRNA had a TSO tag (AAGTCGGAGGCCAAGCGGTC/rG//rG//iXNA_G/) (SEQ ID NO: 7) for the synthesis of the complementary cDNA strand. A diagram of the above process is shown in Fig. 1.

4. Ligation of the region providing spatial positioning with the capturing region. After cDNA synthesis, the chip was washed twice with 5×SSC. 1 ml of the following reaction mixture was prepared, the corresponding volume was injected into the chip to fill it with the next ligation reaction solution, and the gap shown in FIG. 1, ligated. The reaction was carried out for 30 minutes at room temperature. After the reaction, the chip was washed with 5×SSC at 55°C three times, each time for 5 min.

5. Release of cDNA. After the first cDNA strand was synthesized on the chip, an appropriate amount of formamide solution was added to the chip and reacted at 55°C for 10 minutes to release the cDNA strand from the chip. The released molecule had the structure shown in FIG. 2. The reaction solution released from the chip was collected, 2× XP magnetic beads were used to purify the cDNA strand, and finally 45 μl of TE (Tris-EDTA) buffer (Thermo Fisher) was used to isolate the product. The Qubit ssDNA kit was used to quantify single-stranded cDNA.

6. cDNA amplification. Prepare 100 μl of the following reaction mixture:

The above reaction mixture was placed in a PCR machine and the reaction was set to the following program: 95°C for 3 min, 11 cycles (98°C for 20 sec, 58°C for 20 sec, 72°C for 3 min ), 72°C for 5 minutes, maintaining temperature at 4°C. After completion of the reaction, the XP particles were again used for purification and isolation. The Qubit kit was used to determine the concentration of dsDNA, and the 2100 analyzer was used to assess the degree of cDNA fragmentation. The results obtained from the 2100 analyzer are shown in FIG. 3. The cDNA length was normal.

Example 3 Construction and Sequencing of a cDNA Library

1. Termination using Tn5 (transposase). Based on the cDNA concentration, 0.5 μM Tn5 enzyme and the corresponding buffer were added to 20 ig cDNA (barcoding using the Tn5 enzyme was carried out according to the method described in the stLFR library construction kit (reading long fragments in one tube)), and mixed thoroughly with obtaining 20 μl of the reaction mixture. The reaction was carried out at 55°C for 10 min, 5 μl of 0.1% SDS was added and thoroughly mixed at room temperature for 5 min to complete the Tn5 termination step.

2. PCR amplification. Prepare 100 μl of the following reaction mixture:

After mixing, it was placed in a PCR machine and the following program was set: 95°C for 3 min, 11 cycles (98°C for 20 sec, 58°C for 20 sec, 72°C for 3 min), 72 °C for 5 minutes, maintaining temperature at 4°C. After completion of the reaction, the XP particles were again used for purification and isolation. The Qubit kit was used to determine the dsDNA concentration.

3. Sequencing. After the above interruption, 80 fmol of the amplified product was taken to obtain DNB. Prepare 40 µl of the following reaction mixture:

The above reaction mixture was placed into a PCR machine for reaction, and the reaction conditions were as follows: 95°C for 3 min, 40°C for 3 min. After completion of the reaction, the mixture was placed on ice, 40 μl of enzyme I mixture and 2 μl of enzyme II mixture from the DNBSEQ sequencing kit required to obtain DNB were added, as well as 1 μl of ATP (100 mM matrix solution, Thermo Fisher) and 0.1 μl T4 ligase (manufactured by BGI). After thorough mixing, the above reaction mixture was transferred to a PCR machine at 30°C and reacted for 20 min to generate DNB. Load DNB into the MGISEQ2000 sequencing chip according to the method described in the MGISEQ2000 PE50 kit and, following the appropriate instructions, perform sequencing using the PE50 settings, with first-strand sequencing divided into two steps, i.e. 25 bp were sequenced and then 15 reaction cycles were carried out without recording the optical signal, after which 10 bp of the UMI sequence were sequenced and 50 bp of the second strand were sequenced.

Data analysis

1. The 25 bp sequences obtained from first-strand cDNA sequencing were compared by alignment with the sequences corresponding to the position on the capture chip recorded in the fq file (sequencing results were obtained at step 3 in Example 1). The comparison results are shown in Fig. 4, where the illuminated area represented the region where the 25 bp cDNA sequencing results exactly matched the capture chip, and this region represented the tissue capture region of the capture chip. This indicated that the use of a spatial positioning region in the capture chip allows precise localization of the tissue capture region.

2. Further analysis was performed on DNBs for which the cDNA sequencing results matched the capture chip, and the second-strand cDNA sequences (mRNA expression in the tissue of interest) in these DNB reads were analyzed by aligning them with the mouse genome. For DNB reads aligned to the mouse genome, mouse mRNA information was mapped to the 25 bp sequencing results corresponding to the position on the capture chip. As shown in FIG. 5, the left side shows the overall picture of mRNA expression in the analyzed tissue section, the overall picture demonstrates that this capture chip allows the analysis of differences in mRNA expression in tissues; The right side shows the tissue expression level of randomly selected genes expressed in the mouse cerebellum, indicating that this chip can analyze differences in the expression of a specific gene across an entire tissue.

Example 4: Obtaining a Capturing Chip (2)

1. Designed and synthesized the following DNA library. The sequence was synthesized at Beijing Liuhe BGI.

5'-phosphoryl-GAACGACATGGCTTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG(immobilizing sequence 1, SEQ ID NO: 12)NNNNNNNNNNNNNNNNNNNNNNNNNN (positional sequence template, N is any base, e.g. C, G, A or T)IIIIIIIIII(UMI template, I is inosine)TTTTTTTTTTTTTTTTTTTTTTTT TTTT (capture sequence, SEQ ID NO: 13)CCTCAGC(cleavage site, SEQ ID NO: 14)CCTTGGCTCACA(capture sequence 2, SEQ ID NO: 15). In this case, immobilizing sequence 1 contained a partial complement sequence of the first immobilizing sequence and a circularization site, and immobilizing sequence 2 contained a partial complement sequence of the first immobilizing sequence and a circularization site.

2. In situ library amplification

Preparation of DNA nanoball (DNB): 40 μL of the following reaction mixture was prepared and 80 fmol of the above DNA library was added, the DNB primer had the sequence GACATGGCTACGTGTGAGCCAAGG (SEQ ID NO: 16) and was synthesized by Beijing Liuhe BGI.

The above reaction mixture was placed into a PCR machine for reaction, and the reaction conditions were as follows: 95°C for 3 min, 40°C for 3 min; after the reaction, the mixture was placed on ice, 40 μl of the enzyme I mixture and 2 μl of the enzyme II mixture from the DNBSEQ sequencing kit were added, necessary to obtain DNB, as well as 1 μl of ATP (100 mM matrix solution, Thermo Fisher) and 0.1 μl T4 ligase (manufactured by BGI). After thorough mixing, the above reaction mixture was transferred to a PCR machine at 30°C and reacted for 20 min to form DNB. DNB was loaded onto the BGISEQ500 sequencing chip according to the procedure described in the BGISEQ500 SE50 kit. 3. Decoding spatial information

(1) Chip surface modification:

The surface of the above chip for the BGISEQ-500 platform was brought into contact with the ester Azido-dPEG®8-NHS, which had the following structure:

Modification of the chip surface was carried out according to the following method: 100 ml of NHS-PEG8-azido (564.58 g/mol) at a concentration of 45 μmol was prepared as follows:

Stored at -20°C, avoiding repeated freezing and thawing.

The DBCO primer had a concentration of 1 μM, and dilutions were prepared using PBS.

(2) Primer-probe attachment:

The following primer-probe sequences were synthesized at Beijing Liuhe BGI:

DBCO(linker group)-UUU(USER cleavage site)TTTTTCCCGTAGCCATGTCGTTCT GCGCCTTCCCGATG(SEQ ID NO: 17, this sequence contained the complement of the first immobilization sequence, the sequence of the PCR amplification site, the intermediate sequence. 1 μmol of the above primer probe was diluted with PBS and added to azido-modified chip and reacted at room temperature for 1 hour or overnight.

(3) Deciphering spatial information. The positional sequence was deciphered and sequenced according to the instructions of the BGISEQ500 SE50 sequencing kit, the sequencing length was 30 bp (the first 20 bp was related to the sequence storing spatial information, and the last 10 bp was related to the probe tag sequence). The fq file generated by sequencing was stored for future use.

(4) Capturing region synthesis:

To elongate the oligo-dT sequence, a mixed solution of dTTP and Hifi polymerase was prepared, DNB was used as the template, the probe sequence containing the spatial positioning region was used as the primer, and dTTP was used as the substrate.

4. Release of the probe containing spatial information

1 µM primer Spatial_RNA_BbvCI (diluted 5×SSC) was prepared, primer sequence CCTCAGCCAACTCCT (SEQ ID NO: 18) was synthesized at Beijing Liuhe BGI. Hybridization was carried out at room temperature for 30 minutes. A system was prepared for cutting using BbvCI (1.5 ml): 15 µl RE + 150 µl 10× CS buffer + 1335 µl ddH ₂ O and introduced into the chip after deciphering the spatial positioning region, the reaction was carried out at 37°C for 1 hour or overnight. Washing was done twice by adding WB2 from the sequencing kit (MGI), then reacting with formamide at 55°C for 15 min, followed by washing twice with WB2. The schematic structure of the resulting probe is shown in Fig. 7, the probe sequence was as follows:

UUU(cleavage region)TTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG(complement of the first immobilizing sequence, SEQ ID NO: 19)NNNNNNNNNNNNNNNNNNNN (positional sequence complement, same as the positional sequence template in the DNA library sequence in step 1)NNNNNNNNNN(UMI sequence, which was the sequence complementary random base sequence obtained from the UMI template, which was used as a template in step 1) TTTTTTTTTTTTTTTTTTTTTTTTTT (capture sequence, SEQ ID NO: 20).

5. Chip cutting

The resulting chip was cut into several smaller parts, the size of the parts was adjusted depending on the objectives of the experiment, and the chip was immersed in 50 mM Tris buffer with pH 8.0 and stored at 4°C for further use.

Example 5. Tissue mRNA capture and synthesis to DNA

1. Preparation of frozen tissue sections. Mouse cerebellar tissue sections were prepared according to standard procedures for cryostat sections.

2. Capture of mRNA. Depending on the size of the tissue section, a suitable size chip obtained in Example 4 was taken and left at room temperature. After the liquid on the chip evaporated, the tissue section was attached to the capture chip due to the temperature difference between the chip and the tissue section in the cryotome. The attached tissue section was left at room temperature, the 5×SSC reaction solution was added to the chip (completely covering the area with the attached tissue), and the reaction was carried out at 30°C for 30 minutes to allow the mRNA in the tissue to fully hybridize to the capture region on the chip.

3. cDNA synthesis. The chip was washed twice with 5xSSC at room temperature, 200 μl of the following reverse transcription reaction mixture was prepared, the reaction solution was added to the chip until it was completely coated, and the reaction was carried out at 42°C for 90-180 min. To synthesize cDNA from mRNA, polyT was used as a primer, and the 3' end of the mRNA was labeled TSO (CGTAGCCATGTCGTTCTGCG/rG//rG//iXNA_G/) (SEQ ID NO: 21) to synthesize the complementary cDNA strand. A diagram of the above process is shown in Fig. 8.

4. Release of cDNA. After the first strand cDNA was synthesized on the chip, a reaction system for the USER enzyme was prepared and the reaction was carried out according to the instructions for using the USER enzyme. The released molecule had the structure shown in FIG. 9. The reaction solution released from the chip was collected, 2xXP magnetic beads were used to purify the first strand of cDNA, and finally 45 μl of TE buffer (Thermo Fisher) was used to isolate the product.

5. cDNA amplification. Prepare 100 μl of the following reaction mixture:

The above reaction mixture was placed in a PCR machine and the reaction was set to the following program: 95°C for 3 min, 11 cycles (98°C for 20 sec, 58°C for 20 sec, 72°C for 3 min ), 72°C for 5 minutes. maintaining a temperature of 4°C. After completion of the reaction, the XP particles were again used for purification and isolation. The Qubit kit was used to determine the concentration of dsDNA, and the 2100 analyzer was used to assess the degree of cDNA fragmentation. The results obtained from the 2100 analyzer are shown in FIG. 10, indicating that the cDNA was of normal length.

Example 6 Construction and Sequencing of a cDNA Library

1. Interrupt using Tn5. Based on the cDNA concentration, 20 ng of cDNA was taken and 0.5 μM Tn5 enzyme and appropriate buffer were added (Tn5 enzyme barcoding was performed according to the method described in the stLFR Library Construction Kit) and mixed thoroughly to obtain a 20 μl reaction mixture. The reaction was carried out at 55°C for 10 min, 5 μl of 0.1% SDS was added and thoroughly mixed at room temperature for 5 min to complete the Tn5 termination step.

2. PCR amplification. Prepare 100 μl of the following reaction mixture:

After mixing, it was placed in a PCR machine and the following program was set: 95°C for 3 min, 11 cycles (98°C for 20 sec, 58°C for 20 sec, 72°C for 3 min), 72 °C for 5 minutes, maintaining temperature at 4°C. After completion of the reaction, the XP particles were again used for purification and isolation. The dsDNA concentration was determined using a Qubit kit.

3. Sequencing. To obtain DNB, 80 fmol of the amplification product was taken after the above interruption. Prepare 40 µl of the following reaction mixture:

The above reaction mixture was placed into a PCR machine for reaction, and the reaction conditions were as follows: 95°C for 3 min, 40°C for 3 min. After completion of the reaction, the mixture was placed on ice, 40 μl of enzyme I mixture and 2 μl of enzyme II mixture from the DNBSEQ sequencing kit required to obtain DNB were added, as well as 1 μl of ATP (100 mM matrix solution, Thermo Fisher) and 0.1 μl T4 ligase (manufactured by BGI). After thorough mixing, the above reaction mixture was transferred to a PCR machine at 30°C and reacted for 20 min to form DNB. DNB was loaded into the MGISEQ2000 sequencing chip according to the method described in the MGISEQ2000 PE50 kit and, following the appropriate instructions, sequencing was carried out with custom settings, with the first strand sequencing divided into two stages, i.e. 20 bp were sequenced, and then 10 bp of the probe tag sequence was sequenced and 50 bp of the second strand was sequenced.

Data analysis:

1. The 20 bp sequences obtained from sequencing the first strand of cDNA were compared by alignment with the sequences carrying information about the spatial location on the chip, recorded in the fq file (sequencing results were obtained at stage 3 in Example 4). The comparison results are shown in Fig. 11, where the illuminated area represented the region where the 20 bp cDNA sequencing results exactly matched the capture chip, and this region represented the tissue capture region of the capture chip. This indicated that the use of a spatial positioning region in the capture chip allows precise localization of the tissue capture region.

2. Further analysis was performed on DNBs for which the cDNA sequencing results matched the capture chip, and the second-strand cDNA sequences (mRNA expression in the tissue of interest) in these DNB reads were analyzed by aligning them with the mouse genome. For DNB reads aligned to the mouse genome, the mouse mRNA information was mapped to the 20 bp sequencing results corresponding to the position on the capture chip. As shown in FIG. 12, the left side shows the overall picture of mRNA expression in the analyzed tissue section, the overall picture demonstrates that this capture chip can analyze the differences in mRNA expression in tissues; The right panel shows the tissue expression level of randomly selected genes expressed in the mouse cerebellum, indicating that this chip allows one to analyze differences in the expression of a specific gene across an entire tissue.

Although particular embodiments of this invention have been described in detail, one skilled in the art will understand that, based on all published knowledge, various modifications and changes in detail are possible, and the scope of protection of this invention will extend to all such changes. This invention and all its equivalents are set forth in their entirety in the accompanying claims.

Claims (171)

1. A nucleic acid panel for obtaining spatial information about a nucleic acid in a sample, wherein the spatial information includes the location and/or distribution of the nucleic acid, and said nucleic acid panel includes a solid support with multiple kinds of carrier sequences attached to its surface, wherein each type of carrier sequence occupies a different position in the panel from the other type, wherein each specified type of carrier sequence contains multiple copies of the carrier sequence, and the carrier sequence contains in the 5' to 3' direction a positional sequence and a first immobilizing sequence, wherein the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel; the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction; wherein multiple copies of the carrier sequence are an amplification product formed by amplification using a sequence complementary to the carrier sequence as a template; and wherein each said carrier sequence species containing the same positional sequence occupies a region having a diameter of less than 1 micrometer. 2. The nucleic acid panel of claim 1, wherein the spatial information further includes gene or mRNA expression. 3. The nucleic acid panel of claim 1 or 2, further comprising a first nucleic acid molecule comprising, in the 5' to 3' direction: a complement of a first immobilizing sequence and a complement of a positional sequence, and wherein the first nucleic acid molecule hybridizes to the first immobilizing sequence and positional sequence of the carrier sequence to form a double strand; preferably, each copy of each type of carrier sequence contains a first nucleic acid molecule hybridized thereto. 4. The nucleic acid panel of claim 3, further comprising a second nucleic acid molecule ligated to the first nucleic acid molecule, and the second nucleic acid molecule comprising a capture sequence; wherein the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation; preferably, each first nucleic acid molecule is ligated to a second nucleic acid molecule. 5. The nucleic acid panel of claim 3, wherein each carrier sequence further comprises a second immobilizing sequence at its 5' end, and the second immobilizing sequence anneals its complementary nucleotide sequence; the second immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction. 6. The panel of nucleic acids according to claim 5, further comprising a second nucleic acid molecule containing in the 5' to 3' direction: a complement of the second immobilizing sequence and a capture sequence; wherein the complement of the second immobilizing sequence hybridizes with the second immobilizing sequence of the carrier sequence to form a double strand; the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation; preferably, each copy of each type of carrier sequence contains a second nucleic acid molecule hybridized thereto. 7. Panel of nucleic acids according to any one of paragraphs. 1-6, where the amplification is selected from rolling circle amplification (RCA), bridging PCR amplification, multiple strand displacement amplification (MDA) or emulsion PCR amplification. 8. The nucleic acid panel according to claim 1, wherein the multiple copies of the carrier sequence are a DNB (DNA nanoball) formed by a concatemer of the carrier sequence; preferably, the multiple copies of the carrier sequence are a DNB formed by rolling circle amplification using a sequence complementary to the carrier sequence as a template. 9. The panel of nucleic acids according to claim 1, where multiple copies of the carrier sequence represent a DNA cluster formed by a population of clones of the carrier sequence; for example, multiple copies of a carrier sequence are a DNA cluster formed by bridging PCR amplification using a sequence complementary to the carrier sequence as a template; for example, multiple copies of a carrier sequence are a DNA cluster formed by emulsion PCR amplification using a sequence complementary to the carrier sequence as a template; for example, multiple copies of a carrier sequence is a DNA cluster formed by multiple strand displacement amplification using a sequence complementary to the carrier sequence as a template. 10. Panel of nucleic acids according to any one of paragraphs. 1-9, wherein the first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, and the UMI sequence is located at the 5' end of the complement of the first immobilizing sequence; or the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5' end of the capture sequence; a UMI sequence is a nucleotide sequence consisting of at least 1, at least 2, at least 3, at least 4 or at least 5 nucleotides N, where each N is independently one of A, C, G and T; preferably, the UMI sequences contained in each of the first nucleic acid molecules are different from each other. 11. Panel of nucleic acids according to any one of paragraphs. 1-10, where the solid support is a chip; preferably, the solid support can be used as a sequencing platform, such as a sequencing chip; preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platforms. 12. Panel of nucleic acids according to any one of paragraphs. 1-11, wherein the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA; preferably, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence; preferably, the poly-T oligonucleotide sequence contains at least 10 deoxythymidine residues. 13. The nucleic acid panel of claim 1 or 2, wherein the carrier sequence further comprises a capture sequence template located upstream of the positional sequence, the capture sequence template contains a sequence complementary to the capture sequence, and the capture sequence is capable of hybridizing with the entire capture sequence. a nucleic acid or part thereof and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the first immobilizing sequence of the carrier sequence also contains a cleavage site, and the cleavage may be selected from nickase enzyme cleavage, USER (uracil-specific excision reagent) enzyme cleavage, photocleavage, chemical cleavage, or CRISPR-based cleavage. regularly spaced in groups); and the panel of nucleic acids further comprises a first nucleic acid molecule comprising, in a 5' to 3' direction: a binding region, a cleavage region, and a region complementary to the carrier sequence, the binding region contains a linker capable of binding to the surface of a solid support; the cleavage region contains the cleavage site; a region complementary to a carrier sequence contains a sequence that may be complementary to a carrier sequence, and contains, in a 5' to 3' direction: a complement of a first immobilizing sequence, a complement of a positional sequence, and a capture sequence, and the capture sequence has a free 3' end allowing the first nucleic acid molecule to serve as a primer for elongation; and a region of the first nucleic acid molecule complementary to the carrier sequence hybridizes with the carrier sequence to form a double strand; preferably, each copy of each type of carrier sequence contains a first nucleic acid molecule hybridized thereto. 14. The nucleic acid panel of claim 13, wherein the carrier sequence further comprises a complement of a UMI sequence located upstream of the template capture sequence and upstream of the first immobilizing sequence, the complement of the UMI sequence is complementary to the UMI sequence, the UMI sequence is a nucleotide sequence consisting of at least 1, at least 2, at least 3, at least 4 or at least 5 nucleotides N, and each N is independently one of A, C, G and T; and a region of the first nucleic acid molecule complementary to the carrier sequence further comprises a UMI sequence located upstream of the capture sequence and downstream of the complement of the first immobilizing sequence; preferably, the complement of the UMI sequence is located between the positioning sequence and the capture sequence template or between the first capture sequence and the positioning sequence; preferably, each copy of each type of carrier sequence containing the same positional sequence contains a UMI sequence complement that is different from the others. 15. The nucleic acid panel according to claim 13 or 14, wherein the linker of the first nucleic acid molecule is a linker group capable of connecting to an activating group, and the surface of the solid support is modified with an activating group; preferably the linker contains -SH, or -NHS; preferably the linker is , A (azido-dPEG®8-NHS ester) is attached to the surface of the solid support. 16. Panel of nucleic acids according to any one of paragraphs. 13-15, wherein the cleavage site contained in the cleavage region of the first nucleic acid molecule is a site at which controlled cleavage can be carried out by a chemical, enzymatic or photochemical method; preferably, the cleavage site contained in the cleavage region of the first nucleic acid molecule is an enzyme cleavage site; preferably, the cleavage region of the first nucleic acid molecule is different from the cleavage site contained in the first immobilizing sequence of the carrier sequence. 17. Panel of nucleic acids according to any one of paragraphs. 13-16, where the solid support is a chip; preferably, the solid support can be used as a sequencing platform, such as a sequencing chip; preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platforms. 18. Panel of nucleic acids according to any one of paragraphs. 13-17, wherein the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA; preferably, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence; preferably, the poly-T oligonucleotide sequence contains at least 10 deoxythymidine residues. 19. A kit for obtaining spatial information about a nucleic acid in a sample, where the spatial information includes the location and/or distribution of the nucleic acid, containing: (1) a panel of nucleic acids according to claim 3; and (2) a second nucleic acid molecule comprising, in a 5' to 3' direction, an immobilizing region and a capture sequence; wherein the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation. 20. The set of claim 19, wherein the spatial information further includes gene or mRNA expression. 21. The kit according to claim 19 or 20, where the immobilizing region of the second nucleic acid molecule contains a double-stranded nucleic acid sequence; preferably the double-stranded nucleic acid sequence is a double-stranded DNA sequence. 22. A kit for obtaining spatial information about a nucleic acid in a sample, where the spatial information includes the location and/or distribution of the nucleic acid, containing: (1) a panel of nucleic acids according to claim 5; and (2) a second nucleic acid molecule comprising, in a 5' to 3' direction, an immobilizing region and a capture sequence, and wherein the immobilizing region of the second nucleic acid molecule comprises a complement of the second capture sequence; and the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation. 23. The set of claim 22, wherein the spatial information further includes gene or mRNA expression. 24. Set according to any one of paragraphs. 19-23, where when the first nucleic acid molecule contained in the panel of nucleic acids does not contain a UMI sequence, then the second nucleic acid molecule further contains a UMI sequence, and said UMI sequence is located at the 5' end of the capture sequence; a UMI sequence is a nucleotide sequence consisting of at least 1, at least 2, at least 3, at least 4 or at least 5 nucleotides N, where each N independently represents any of A, C, G and T. 25. A method of producing a panel of nucleic acids for obtaining spatial information about a nucleic acid in a biological sample, where the spatial information includes the location and/or distribution of the nucleic acid, and the method includes the following steps: (1) providing multiple kinds of carrier sequences, where each kind of carrier sequence contains multiple copies of the carrier sequence, and the carrier sequence contains in the 5' to 3' direction a positional sequence and a first immobilizing sequence, the positional sequence has a unique nucleotide sequence corresponding to the position of a given type of carrier sequence on the panel; the first immobilizing sequence ensures annealing of its complementary nucleotide sequence and initiation of the elongation reaction; (2) binding of multiple types of carrier sequences to the surface of a solid support; (3) providing a first primer and performing a primer elongation reaction using a carrier sequence as a template, so that the region of the first immobilization sequence and the positional sequence of the carrier sequence form a double strand, wherein the strand that hybridizes to the carrier sequence is a molecule of the first nucleic acid, the first nucleic acid molecule contains, in the 5' to 3' direction, a first immobilizing sequence and a sequence complementary to the positional sequence; where the first primer contains a region complementary to the first immobilizing sequence at its 3' end; the region complementary to the first immobilizing sequence contains the sequence complementary to the first immobilizing sequence, or a fragment thereof, and has a free 3' end; wherein in step (1), multiple kinds of carrier sequences are provided through the following steps: (1) providing many kinds of carrier sequence matrices, wherein the carrier sequence matrix contains a sequence complementary to the carrier sequence; (2) performing a nucleic acid amplification reaction using each kind of carrier sequence template as a template to obtain an amplification product of each kind of carrier sequence template, wherein the amplification product contains multiple copies of the carrier sequence; and wherein each said carrier sequence species containing the same positional sequence occupies a region having a diameter of less than 1 micrometer. 26. The method of claim 25, wherein the spatial information further includes gene or mRNA expression. 27. The method according to claim 25 or 26, wherein rolling circle amplification is performed to obtain a DNB formed by a concatemer of the carrier sequence; or bridging PCR amplification, emulsion PCR amplification or multiple strand displacement amplification is performed to obtain a DNA cluster formed by a population of clones of the carrier sequence. 28. Method according to any one of paragraphs. 25-27, further including the following steps: (4) providing a second nucleic acid molecule containing a capture sequence; wherein the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation, (5) ligating a second nucleic acid molecule to a first nucleic acid molecule; preferably using a ligase. 29. The method of claim 28, wherein the second nucleic acid molecule comprises, in a 5' to 3' direction, an immobilizing region and a capture sequence, and the immobilizing region comprises a double-stranded DNA sequence. 30. The method of claim 28, wherein each carrier sequence further comprises a second immobilizing sequence at its 5' end, and the second immobilizing sequence anneals its complementary nucleotide sequence; where the method further includes the following steps: (4) providing a second nucleic acid molecule comprising, in a 5' to 3' direction, the complement of a second immobilizing sequence and a capture sequence; wherein the complement of the second immobilizing sequence provides hybridization with its complementary nucleotide sequence; the capture sequence is capable of hybridizing with all or part of the captured nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a free 3' end allowing the second nucleic acid molecule to serve as a primer for elongation; (5) hybridizing the complement of the second immobilizing sequence to the second immobilizing sequence under annealing conditions, thereby ligating the second nucleic acid molecule to the carrier sequence; (6) optionally ligating a first nucleic acid molecule and a second nucleic acid molecule hybridized to the carrier sequence, respectively; preferably using a ligase. 31. Method according to any one of paragraphs. 28-30, wherein in step (3), the first primer further contains a unique molecular identifier (UMI) at the 5' end of its region complementary to the first immobilization sequence, such that the first nucleic acid molecule contains a UMI sequence at the 5' end of its complement of the first immobilizing sequence; or in step (4), the second nucleic acid molecule further comprises a UMI sequence located at the 5' end of the capture sequence; a UMI sequence is a nucleotide sequence consisting of at least 1, at least 2, at least 3, at least 4 or at least 5 nucleotides N, where each N independently represents any of A, C, G and T. 32. The method according to claim 25 or 26, in which: in step (1), the carrier sequence further comprises a capture sequence template located upstream of the positional sequence, the capture sequence template contains a sequence complementary to the capture sequence, and the capture sequence is capable of hybridizing with all or part of the capture nucleic acid and contains: (a) an oligonucleotide sequence capable of capturing mRNA; and/or (b) a random or degenerate oligonucleotide sequence; or (c) a specific sequence for a specific target nucleic acid; and the first immobilizing sequence of the carrier sequence also contains a cleavage site, and the cleavage may be selected from nickase enzyme cleavage, USER enzyme cleavage, photocleavage, chemical cleavage, or CRISPR-based cleavage; in step (3), the first immobilization sequence region, the positional sequence and the capture sequence template of the carrier sequence form a double strand so that the first nucleic acid molecule contains, in a 5' to 3' direction, the complement of the first immobilization sequence, the complement of the positional sequence and the capture sequence; and the first primer contains in a 5' to 3' direction a binding region, a cleavage region and a region complementary to the first immobilizing sequence, the binding region contains a linker capable of binding to the surface of a solid support, and the cleavage region contains a cleavage site; and the method further includes the following steps: (4) binding the first primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order; (5) it is possible to carry out cleavage at a cleavage site contained in the first immobilizing sequence of the carrier sequence to cut the carrier sequence, so that the elongation product in step (3) is separated from the matrix on which such elongation product was formed, and thus the first nucleic acid molecule binds to the surface of the solid support. 33. The method of claim 32, wherein each type of carrier sequence is a DNB formed by a concatemer of multiple copies of the carrier sequence. 34. The method according to claim 32 or 33, wherein in step (1) the cleavage site contained in the first immobilizing sequence is a cleavage site for the nickase enzyme; preferably, the nickase enzyme is selected from USER, BamHI and BmtI. 35. Method according to any one of paragraphs. 32-34, wherein in step (1), the carrier sequence further comprises a complement of a UMI sequence located upstream of the template capture sequence and upstream of the first capture sequence, wherein the complement of the UMI sequence is complementary to the UMI sequence, and the UMI sequence represents is a nucleotide sequence consisting of at least 1, at least 2, at least 3, at least 4 or at least 5 nucleotides N, where each N independently represents any of A, C, G and T; and in step (3), the first immobilizing sequence region, the positional sequence, the capture sequence template, and the complement of the UMI sequence of the carrier sequence form a double strand such that the first nucleic acid molecule contains, in a 5' to 3' direction, the complement of the first immobilizing sequence, the complement of the positional sequence and a capture sequence, as well as a UMI sequence located upstream of the capture sequence and downstream of the complement of the first immobilizing sequence; wherein, preferably, the complement of the UMI sequence is located between the positioning sequence and the capture sequence template or between the first immobilizing sequence and the positioning sequence. 36. Method according to any one of paragraphs. 32-35, wherein the linker of the first primer is a linker group capable of attaching to an activating group, and the surface of the solid support is modified with an activating group; preferably the linker contains -SH, or -NHS; preferably the linker is , A (azido-dPEG®8-NHS ester) is attached to the surface of the solid support. 37. Method according to any one of paragraphs. 32-36, wherein the cleavage site contained in the cleavage region of the first primer is a site at which controlled cleavage can be carried out by a chemical, enzymatic or photochemical method; preferably, the cleavage site contained in the cleavage region of the first primer is an enzyme cleavage site; preferably, the cleavage region of the first primer is different from the cleavage site contained in the first immobilizing sequence of the carrier sequence. 38. Method according to any one of paragraphs. 25-37, wherein the oligonucleotide sequence capable of capturing the mRNA contains a sequence capable of hybridizing to the poly-A tail of the mRNA; preferably, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence; preferably, the poly-T oligonucleotide sequence contains at least 10 deoxythymidine residues. 39. Method according to any one of paragraphs. 25-38, wherein in step (3), when performing the elongation reaction, the carrier sequence is sequenced to obtain sequence information of the positional sequence contained in the carrier sequence. 40. Method according to any one of paragraphs. 25-39, in which the step of sequencing the carrier sequence is included before step (3); Preferably, after sequencing, a wash is performed to remove dNTPs (deoxynucleotide triphosphates) added to the synthetic chain during sequencing. 41. A method for obtaining spatial information about a nucleic acid in a sample, where the spatial information includes the location and/or distribution of the nucleic acid, and said method includes the following steps: (1) providing a panel of nucleic acids according to claim 4 or 6 or obtaining a panel of nucleic acids by a method according to any one of claims. 28-31; Where the nucleic acid panel contains multiple kinds of carrier sequences attached to the surface of the solid support, each kind of carrier sequence occupies a different position in the panel, and each kind of carrier sequence contains multiple copies of the carrier sequence; each carrier sequence contains a first nucleic acid molecule hybridized thereto, and the first nucleic acid molecule is ligated to a second nucleic acid molecule, or each carrier sequence contains a first nucleic acid molecule and a second nucleic acid molecule that are hybridized thereto; the first nucleic acid molecule contains a positional sequence complement corresponding to the position of a given type of carrier sequence on the panel; the second nucleic acid molecule contains a capture sequence capable of capturing a nucleic acid in a sample; wherein each specified carrier sequence species containing the same positional sequence occupies a region having a diameter of less than 1 micrometer; (2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that a nucleic acid in the test sample anneals to the capture sequence of a second nucleic acid molecule, and thus the position of the nucleic acid can be matched to the position of the carrier sequence on the panel nucleic acids; (3) (i) when the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other, ligating the first nucleic acid molecule and the second nucleic acid molecule hybridized to each carrier sequence; carrying out a primer elongation reaction, using ligated molecules of the first and second nucleic acids as a primer and using a captured nucleic acid molecule as a template, under conditions that ensure primer elongation, to obtain an elongation product in which a chain that hybridizes with the captured nucleic acid molecule acid, as a spatial information label has the complement of the positional sequence contained in the first nucleic acid molecule; and/or performing a primer elongation reaction using a captured nucleic acid molecule as a primer and using ligated molecules of the first and second nucleic acids as a template under conditions ensuring primer elongation to produce an elongated captured nucleic acid molecule, wherein the elongated captured nucleic acid serves as a spatial tag information has a positional sequence; alternatively, (ii) when the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other, performing a primer elongation reaction using the second nucleic acid molecule as a primer and using the captured nucleic acid molecule as a template under conditions allowing primer elongation , producing an extended second nucleic acid molecule, wherein the extended second nucleic acid molecule contains a sequence complementary to the captured nucleic acid; ligating a first nucleic acid molecule and an extended second nucleic acid molecule hybridized to each carrier sequence, wherein the extended second nucleic acid molecule ligated to the first nucleic acid molecule has a positional sequence complement contained in the first nucleic acid molecule as a spatial information tag; alternatively, (iii) when the first nucleic acid molecule and the second nucleic acid molecule are ligated to each other, performing a primer elongation reaction using the ligated first and second nucleic acid molecules as a primer and using the captured nucleic acid molecule as a template under conditions allowing elongating the primer to produce an elongation product in which the strand that hybridizes to the captured nucleic acid molecule has as a spatial information tag the positional sequence complement contained in the first nucleic acid molecule; and/or performing a primer elongation reaction using a captured nucleic acid molecule as a primer and using ligated first and second nucleic acid molecules joined together as a template, under conditions allowing for primer elongation, to produce an elongated captured nucleic acid molecule, wherein the elongated captured nucleic acid molecule has a positional sequence as a spatial information label; (4) releasing from the surface of the panel at least a portion of the nucleic acid molecules bearing the spatial information tags, the portion comprising a positional sequence or a strand complementary thereto and a captured nucleic acid molecule or a strand complementary thereto; And (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4). 42. The method of claim 41, wherein the spatial information further includes gene or mRNA expression. 43. The method according to claim 41 or 42, wherein the ligation specified in step (3)(i) or step (3)(ii) is carried out using a ligase. 44. Method according to any one of paragraphs. 41-43, used to determine the transcriptome in a sample where: (a) in step (3) (i) a cDNA molecule is synthesized from the captured RNA molecule using the ligated molecules of the first and second nucleic acids as a primer for reverse transcription, where the cDNA molecule as a spatial information tag has the complement of the positional sequence contained in the molecule the first nucleic acid, and optionally amplifying a cDNA molecule; or in step (3)(ii), a cDNA molecule is synthesized from the captured RNA molecule using the second nucleic acid molecule as a primer for reverse transcription, the first nucleic acid molecule and the cDNA molecule hybridized to each carrier sequence are ligated, preferably using a ligase, with obtaining a cDNA molecule that has a positional sequence complement contained in the first nucleic acid molecule as a spatial information tag, and optionally amplifying the cDNA molecule; or in step (3)(iii), a cDNA molecule is synthesized from the captured RNA molecule using the ligated first and second nucleic acid molecules as a primer for reverse transcription, where the cDNA molecule as a spatial information tag has the complement of the positional sequence contained in the first nucleic acid molecule acids, and possibly amplify the cDNA molecule; And (b) in step (4) releasing from the surface of the panel at least a portion of the cDNA molecules and/or amplicons thereof, wherein the released nucleic acid molecule may be a first and/or second strand of a cDNA molecule or an amplicon thereof, and wherein said portion contains a positional sequence or its complementary chain; preferably, in step (1) the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA. 45. A method for obtaining spatial information about a nucleic acid in a sample, where the spatial information includes the location and/or distribution of the nucleic acid, and the method includes the following steps: (1) providing a panel of nucleic acids according to any one of claims. 13-18 or obtaining a panel of nucleic acids by the method according to any one of paragraphs. 32-37; wherein the nucleic acid panel comprises a solid support with multiple kinds of carrier sequences attached to its surface, each kind of carrier sequence occupies a different position in the panel, and each kind of carrier sequence contains multiple copies of the carrier sequence; each carrier sequence contains a first nucleic acid molecule hybridized thereto, and the first nucleic acid molecule contains a positional sequence complement corresponding to the position of a given type of carrier sequence on the panel, and a capture sequence capable of capturing the nucleic acid in the sample; wherein each specified carrier sequence species containing the same positional sequence occupies a region having a diameter of less than 1 micrometer; (2) bringing the panel of nucleic acids into contact with the test sample under annealing conditions such that a nucleic acid in the test sample anneals to the capture sequence of the first nucleic acid molecule, and thus the position of the nucleic acid can be compared with the position of the first nucleic acid molecule on nucleic acid panels; (3) performing a primer elongation reaction using the first nucleic acid molecule as a primer and using the captured nucleic acid molecule as a template, under conditions allowing for primer elongation, to produce an elongation product in which a strand that hybridizes to the captured nucleic acid molecule , as a spatial information label, has the complement of the positional sequence contained in the first nucleic acid molecule; (4) releasing from the surface of the panel at least a portion of the nucleic acid molecules bearing the spatial information tags, the portion comprising a positional sequence or a strand complementary thereto and a captured nucleic acid molecule or a strand complementary thereto; And (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4). 46. The method of claim 45, wherein the spatial information further includes gene or mRNA expression. 47. The method according to claim 45 or 46, used to determine the transcriptome in a sample in which: in step (3), a cDNA molecule is synthesized from the captured RNA molecule using the first nucleic acid molecule as a primer for reverse transcription, the cDNA molecule having a positional sequence complement contained in the first nucleic acid molecule as a spatial information tag, and optionally amplifying a cDNA molecule; at step (4) releasing from the surface of the panel at least a portion of the cDNA molecules and/or amplicons thereof, wherein the released nucleic acid molecule may be the first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein said portion comprises a positional sequence or complementary her chain; preferably, in step (1) the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA. 48. Method according to any one of paragraphs. 41-47, wherein the multiple copies of the carrier sequence are a DNB formed by a concatemer of the carrier sequence, or the multiple copies of the carrier sequence are a DNA cluster formed by a population of clones of the carrier sequence. 49. Method according to any one of paragraphs. 41-48, wherein step (5) sequence analysis involves sequencing or a sequence-specific PCR reaction. 50. Method according to any one of paragraphs. 41-49, further comprising step (6): comparing the information obtained by analyzing the sequence in step (5) with a sample image, where the sample image is obtained before or after step (3); preferably, the sample is imaged using light, bright-field, dark-field, phase contrast, fluorescence, reflectance, interference, confocal microscopy, or a combination thereof. 51. Method according to any one of paragraphs. 41-50, in which, before or after the release of a nucleic acid molecule carrying a spatial information tag or a cDNA molecule carrying a spatial information tag from the surface of the panel, a complementary strand or a second strand of cDNA is synthesized; Preferably, a random primer and a strand displacement polymerase are used in the synthesis of the complementary strand or second strand. 52. Method according to any one of paragraphs. 41-51, which, prior to sequence analysis, further includes the step of amplifying a nucleic acid molecule or cDNA molecule carrying a spatial information tag; wherein, preferably, the amplification step is carried out after the nucleic acid molecule or cDNA molecule carrying the spatial information tag is released from the panel, or the amplification step is carried out on the panel in situ; preferably, the amplification step includes PCR. 53. Method according to any one of paragraphs. 41-52, which, prior to sequence analysis, further includes the step of purifying the released nucleic acid molecule. 54. Method according to any one of paragraphs. 41-53, which, before step (4), further includes the step of washing the panel to remove sample residues. 55. Method according to any one of paragraphs. 41-54, in which in step (4) the nucleic acid molecule is released from the surface of the panel by the following method: (1) cleavage of the nucleic acid; (2) denaturation and/or (3) physical means. 56. The method according to any one of claims 41-55, where the sample is a tissue sample, such as a tissue section; preferably, the tissue section is prepared from fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue. 57. Method according to any one of paragraphs. 25-56, where the solid support is a chip; preferably, the solid support can be used as a sequencing platform, such as a sequencing chip; preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platforms.