RU2803178C1 - Recombinant cell line tmdk562-15 showing the ability to activate and proliferate human nk cells - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: present invention relates to a recombinant human myelogenous leukaemia cell line TMDK562-15, which has a surface expression of a membrane-bound form of a chimeric protein consisting of interleukin 15, a combination of CD215 sushi domain signalling molecules and TNFRSF9L (mbIL15sCD215TNFRSF9L).

EFFECT: invention is effective for activation and proliferation of natural killer cells (NK cells) during their co-culturing.

1 cl, 6 dwg, 3 ex

Description

The invention relates to the field of biotechnology, immunology and cell biology. The proposed cell line can be used for the activation and expansion of human natural killer cells (NK cells) when they are co-cultured. Human NK cells will be useful in the development of new approaches to the immunotherapy of malignant neoplasms.

Currently, active research is underway on the use of immune cells, such as activated NK cells, NK and T cells with chimeric antigen receptors (CAR-EK, CAR-T) and others, for adoptive immunotherapy of various viral and oncological diseases [1 ,2]. The main difficulty in studying immune cells, as well as in their use for adoptive immunotherapy, is the difficulty of obtaining them in sufficient quantities ex vivo. At the moment, the main method of expansion of immune cells remains their cultivation in a medium with the addition of various cytokines and growth factors [3,4], however, this does not lead to a significant increase in the number of immune cells and sustainable activation of lymphocytes. In particular, it is known that interleukin 15 (IL-15), a common gamma chain cytokine, plays an important role in the activation and proliferation of immune cells [1,5,6]. It is also known that the protein TNFRSF9L, from the superfamily of tumor necrosis factors, interacting with its own receptor CD 137 is able to enhance the proliferation, survival and cytolytic activity of immune cells, thereby stimulating the immune response against tumor cells [7]. The CD215 receptor (IL-15R alpha) is a widely expressed 60 kDa transmembrane glycoprotein. The high-affinity receptor for IL-15 can be used to enhance the signal exerted by IL-15 on the activation and expansion of immune cells [8].

Thus, the development of new immunotherapeutic approaches for the treatment of cancer patients through the elimination of tumor cells through NK cells is an extremely urgent task [9]. For some types of immune cells, such as NK cells, one approach to efficient generation and expansion may be to provide direct contact with certain sensitive types of tumor cells that carry ligands for activating NK cell receptors on their surface [10]. Such cell lines can serve as the basis for the production of new recombinant cell lines capable of expressing the molecules described above to increase the efficiency of expansion and activation of immune cells. An additional way to enhance the proliferative activity of NK cells while maintaining the activated phenotype and the absence of depletion in the resulting population is the co-cultivation of NK cells with recombinant cell lines in which stimulating cytokines introduced through genetic modification (GM) are expressed as their own membranes -related forms (mbIL15, etc.). Using this approach does not require the addition of similar cytokines to the culture medium, which simplifies the cultivation process and makes it more efficient [1,7,11-14].

Known [15] is an artificial antigen presenting cell line (iAPC), in which CD137L, CD86, CD64, membrane-bound IL-15 and CD 19 are expressed on the surface of the cell membrane, designed for activation and expansion of CAR-T cells with a chimeric antigen receptor . The described cell line is obtained by sequential lentiviral transduction of K562 line cells with genetic constructs (GC) containing CD137L, CD86, CD64, CD 19 and mbIL15. However, the use of lentiviral transduction does not allow for stable long-term expression of the introduced recombinant proteins on the cell membrane, since the expression level decreases after each cell division, and the presence of five additional GCs negatively affects the functional activity of cells and their viability.

The genetically modified cell line K562-OX40L-mbIL 18-mbIL21 is known [16] and is intended for activation and amplification of NK cells. The described cell line is capable of expressing membrane-bound IL-18 (mbIL-18), membrane-bound IL-21 (mbIL-21) and OX40 receptor ligand. The mbIL-18 gene and the mbIL-21 gene were cloned into the lentiviral vector pCDH-CMV-RFP to create a vector to obtain a recombinant lentivirus. The resulting plasmid (pCDH-CMV-RFP-mbIL-1821) was then transfected into 293FT cells along with a packaging plasmid to assemble viral particles. The OX40L gene, in turn, was cloned into the lentiviral vector pLVX-IRES-ZsGreen. The resulting plasmid (OX40L-pLVX-IRES-ZsGreen) was processed and sequential lentiviral transduction of K562 cells was carried out. Using fluorescent cell sorting, cells carrying both red (RFP) and green (ZsGreen) labels were selected. The disadvantage of this cell line is the use of lentiviral transduction, which does not allow maintaining the expression of the introduced HA for a long time during repeated cell division. In addition, the use of fluorescent proteins (RFP and ZsGreen) reduces the transduction efficiency and increases the size of the construct used. Cell sorting, in turn, leads to disruption of the sterility of the cell culture and makes it unsuitable for clinical use.

A recombinant stimulatory cell line designed for activation and expansion of NK cells ex vivo is known [17]. To obtain the described cell line, K562-mb15-41BBL cells, obtained similarly to iAPC from the patent US7435596B2, are subjected to sequential retroviral transduction using the MSCV pseudotype RD144 retrovirus containing cDNA of membrane-bound interleukin IL-12 and/or IL-18. The disadvantage of the described cell line is the lack of the possibility of adequate selection of cells that have undergone transduction, as well as a large number of final GM, which significantly reduces the viability of the cell line, as well as its ability to proliferate and resistance to the cryopreservation procedure.

The closest analogue, prototype, is the well-known [18] recombinant iAPC cell line, obtained by sequential retroviral transduction of cells of the K562 GC line, carrying a membrane-bound form of IL-15 with green fluorescent protein (GFP) and the ligand protein 4-1BBL. To obtain pseudoretroviral particles, HEK293T cells were transfected with the pMSCV-IRES-GFP plasmid with cloned target constructs, as well as the auxiliary plasmids pEQ-PAM3(-E) and pRDF. The disadvantages of this cell line are the use of GFP, which leads to an increase in the size of the construct used and significantly reduces the transduction efficiency. Also in this case, the cell sorting method is used to select transduced cells, in which the cells lose their sterility, which makes them unsuitable for clinical use.

The objective of the invention is to obtain a new stable recombinant cell line of chronic myelogenous leukemia TMDK562-15, which has high surface expression of a membrane-bound form of a chimeric protein consisting of interleukin 15, the sushi domain of CD215 and TNFRSF9L, exhibiting the ability to activate and proliferate NK cells when their joint cultivation. This will allow us to expand the collection of recombinant cell lines for the purposes of long-term cultivation, stimulation of activation and proliferation of human NK cells with high viability. The new recombinant cell line TMDK562-15, over several months of cultivation, stably expresses CD137 receptor ligand protein (TNFRSF9L) in high concentrations in more than 95% of cells and a membrane-bound chimeric protein consisting of IL-15 and part of CD215 in more than 75% of cells. The use of the sCD215 fragment as part of the chimeric protein mbIL15/sCD215 allows one to avoid a critical increase in the size of the GC, while maintaining the influence on the ability of the resulting cell line to activate and proliferate NK cells.

The technical result of the claimed invention: expansion of the collection of recombinant cell lines due to the stable expression of the membrane-bound form of the chimeric protein IL15/sCD215 (mbIL15/sCD215) and the ligand protein TNFRSF9L, which can be used for activation and proliferation of NK cells when they are co-cultured.

This technical result is achieved by obtaining a new recombinant cell line TMDK562-15, which is obtained on the basis of a culture of chronic myelogenous leukemia cells K562 [stored in the Russian Collection of Vertebrate Cell Cultures (RVCC P) of the Institute of the Russian Academy of Sciences] by retroviral transduction. To do this, when integrating the cDNA cassette encoding mbIL15/sCD215-TNFRSF9L, K562 cells were treated with pseudo-retroviral particles. They were assembled using a standard calcium phosphate transfection protocol using pseudotyped HEK293T cells using the surface G protein of vesicular stomatitis virus (VSV). The recombinant retroviral plasmid pBABE-mbIL15-sCD215-P2A-TNFRSF9L-puro, encoding the membrane-bound form of the chimeric protein IL15/sCD215 and the ligand protein TNFRSF9L, was used as a vector plasmid, using auxiliary plasmids pUMVC and PCMV-VSV-G. The mbIL15/sCD215 protein was produced by combining the sequences of human IL-15, the sushi domain of CD215 with the transmembrane domain of CD8a.

The constructed recombinant retroviral plasmid rBAVE-mbIL15-sCD215-P2A-TNFRSF9L-puro has the following characteristics:

- encodes the membrane-bound form of the chimeric protein IL15/sCD215 (mbIL15/sCD215)

- encodes the human transmembrane protein TNFRSF9L;

- consists of the following elements:

a) a sequence encoding the main functional and structural elements of the costimulatory domain of the transmembrane chimeric protein IL15/sCD215/TNFRSF9L;

b) a DNA fragment encoding a domain containing the transmembrane region of CD8 alpha;

c) self-cleaving sequence P2A;

d) genetic markers:

AmpR - ampicillin resistance gene (bla), which determines resistance to ampicillin during transformation of Escherichia coli;

PuroR - selective puromycin resistance gene (gene for Streptomyces alboniger races);

e) modified genetic elements (MMLV psi, gag), necessary for correct processing of viral RNA and assembly of pseudoretroviral particles;

f) the polyomavirus sv40 promoter, which ensures the initiation of translation of the PuroR marker.

The invention is illustrated by the following figures:

In fig. Figure 1 shows a map of the genetic design of the recombinant plasmid pBABE-mbIL15-sCD215-P2A-TNFRSF9L-puro, where IL15/sCD215, TNFRSF9L, CD8a are DNA sequences encoding the main functional and structural elements of the costimulatory domain of the chimeric protein mbIL15/sCD215/TNFRSF9L, P2A is self-cleaving sequence, SV40 promoter - polyomavirus sv40 promoter, SV40 ori - origin of replication for the PuroR gene, PuroR - puromycin resistance gene, ori - sequence of the origin of general replication, AmpR - ampicillin resistance gene, AmpR promoter - penicillin resistance gene promoter, MMLV Psi is a signal for retrovirus packaging, which is part of the murine leukemia virus, gag (truncated) is a shortened sequence of the HIV-1 gag gene.

In fig. Figure 2 shows the morphology of cell lines obtained using an inverted light microscope, where:

A. Cells of the original K562 line;

B. Cells of the recombinant line TMDK562-15

In fig. 3 using cytometric analysis shows a comparison of the expression of surface markers of the original K562 cell line and the recombinant cell line TMDK562-15, where:

A. The proportion of cells expressing sCD215 in the original K562 culture;

B. The proportion of cells expressing sCD215 in the culture of recombinant TMDK562-15 cells;

C. Proportion of cells expressing TNFRS9FL in the original K562 culture;

D. The proportion of cells expressing TNFRS9FL in the culture of recombinant TMDK562-15 cells;

In fig. 4, using cytometric analysis with staining with the vital dye 7AAD, shows the viability of the TMDK562-15 cell line, where:

A. Number of viable cells before irradiation;

B. Number of viable cells after irradiation;

In fig. Figure 5, using cytometric analysis of the surface expression of CD3 and CD56 markers, shows the average level of NK cell proliferation during co-cultivation of donor peripheral blood mononuclear cells with the TMDK562-15 line;

In fig. 6, using cytometric analysis, shows the proportion of activated NK cells expressing CD38 and HLA-DR, where:

A. Proportion of NK cells expressing the surface marker CD38 before co-culture with the TMDK562-15 cell line;

B. Proportion of NK cells expressing the surface marker HLA-DR before coculture with the TMDK562-15 cell line;

C. Proportion of NK cells expressing the surface marker CD38 on day 10 of co-culture with the TMDK562-15 cell line;

D. Proportion of NK cells expressing the surface marker HLA-DR on day 10 of co-culture with the TMDK562-15 cell line.

Transduction was carried out by spinoculation with different MOIs (multiplicity of infection) in the presence of 8 μg/ml polybrene (Sigma, USA). 48 hours after transduction, cells were selected on medium supplemented with puromycin (3 μg/ml) for 5 days. TMDK562-15 cells were stained with antibodies to TNFRSF9L (clone REA254, Miltenyi Biotec, Germany) conjugated to phycoerythrin (PE). Next, to obtain a homogeneous mbIL15/sCD215-TNFRSF9L-expressing line, the cells were cloned on a Sony SH800 sorter (Sony, Japan).

It was shown that the resulting human myelogenous leukemia cell line TMDK562-15 has stable morphological characteristics when cultivated. It is represented by round-shaped cells, with the morphology of large granular cells with a large nucleus, differing in size by up to 30%, growing singly or forming clusters (Fig. 2).

The marker characteristics of the TMDK562-15 cell line are as follows:

- surface expression of IL-15 fused with the sushi domain of the CD215 protein is observed in more than 75% of cells;

- surface expression of the TNFRSF9L protein is observed in more than 95% of cells.

The TMDK562-15 cell line is cultured in RPMI1640 nutrient medium (PanEko, Russia), in the presence of 10% fetal bovine serum (FBS) (GIBCO, USA), 100 U/ml penicillin and 100 μg/ml streptomycin (Capricorn-Scientific, Germany) , in an atmosphere of 5% CO ₂ at 37°C. The culture has a suspension type of growth. When subcultivating, cells are transplanted every 2-3 days to a concentration of 0.3-0.5 × 10 ⁶ cells/ml.

The cryopreservation conditions are as follows.

Environment CryoMed-M (PanEco, Russia). Standard freezing mode: 3 × 10 ⁷ cells/ampoule at a temperature decrease of one degree Celsius per minute in a Biofreeze BV-65 program freezer (Biofreeze, France). Storage in liquid nitrogen at -196°C. Defrosts quickly at 37°C. To do this, 1.5 ml of cell suspension is diluted in 10 ml of RPMI1640 medium or in phosphate-buffered saline and pelleted by centrifugation at 800 rpm, the cells are resuspended in RPMI1640 growth medium and seeded into culture flasks. Cell viability after cryopreservation ≥75% (trypan blue staining).

Contamination analysis.

During long-term cultivation, bacteria and fungi were not found in the culture. Analysis of ureaplasma and mycoplasma was performed by real-time RT-PCR using a pair of primers: 5'GGCGAATGGGTAAGTAACACG3' and 5'CGATAACGCTTGCGACCTAT3' allowing to detect Mycoplasma hyorhinis, fermentans, arginini, orale, genitalium, hominis, pirum, pneumoniae, salivarium, Acholeplasma laidlawii and Ureaplasma urealyticum. The test for mycoplasma and ureaplasma is negative.

Example 1. Production of recombinant cell line TMDK562-15

The TMDK562-15 cell line was obtained on the basis of the K562 cell line (transferred from the Russian Collection of Vertebrate Cell Cultures (RKKK P) of the Institute of the Russian Academy of Sciences) by transduction (infection) with pseudoretroviral particles. To obtain pseudoretroviral particles, the DNA of the recombinant retroviral plasmid pBABE-mbIL15-sCD215-P2A-TNFRSF9L-puro was mixed with the DNA of the auxiliary plasmids pUMVC and PCMV-VSV-G, necessary for packaging pseudoretroviral particles, in a ratio of 4:1:3 and HEK293T cells were transformed using the calcium phosphate transfection method, after which they were cultured for 6 hours in IMDM medium supplemented with 10% FBS, 100 µg/ml streptomycin and 100 units/ml penicillin in an atmosphere of 5% CO ₂ at 37°C. Next, the medium in the dishes was replaced with a new one and the cells were incubated for 48 hours. Then, the supernatants of the conditioned medium were filtered through 0.45 μm PES filters and used to infect the K562 cell line by spinoculation in the presence of 8 μg/ml polybrene. After infection, transductants were selected on a medium supplemented with 3 μg/ml puromycin for 5 days. Finally, TMDK562-15 cells were stained with antibodies to TNFRSF9L (Miltenyi Biotec, Germany) conjugated to phycoerythrin (PE) and to obtain a homogeneous mbIL15/sCD215-TNFRSF9L-expressing line, cells were cloned on a Sony SH800 sorter (Sony, Japan). Surface expression of IL15 fused to the sushi domain of the CD215 protein, analyzed using flow cytometry (staining with antibodies to CD215, clone JM7A4, BioLegend, USA), is observed in 84.9% of cells, and surface expression of the TNFRSF9L protein is observed in 98.1 %) cells (Fig. 3).

Example 2. Limitation of proliferation of the recombinant cell line TMDK562-15

TMDK562-15 cells were cultured to reach a total number of 100 million. The cell viability in the suspension was more than 90%. The resulting suspension was transferred into 25 ml tubes (Eppendorf, Germany) and subjected to gamma irradiation using a cobalt-60 source at a dose of 90-100 Gy. After irradiation, the number of viable cells remained more than 86%. To assess the level of proliferation after irradiation, irradiated cells were cultured for 3 days; there was no proliferative activity, viability remained at the same level (Fig. 4).

Example 3. Use of genetically modified cells for expansion of NK cells

To assess the effect of TMDK562-15 on the expansion and functional activity of immune cells, the resulting cell culture was co-cultivated with peripheral blood mononuclear cells (PBMCs). For this purpose, PBMCs were isolated from heparinized blood of a healthy donor using a density gradient Hystopague-1077 (Sigma Aldrich, USA) using a standard method. Cultivation was carried out in RPMI1640 nutrient medium containing 10% FBS with the addition of IL-2 at a concentration of 200 IU/ml in a CO ₂ incubator in a humid atmosphere at 37°C. Gamma-irradiated TMDK562-15 cells were added to cultured PBMCs at day 0 and day 7. The proportion of NK cells with the CD3-CD56+ phenotype in the mixture of cultured PBMCs by day 10 averaged 32.4% and in most donors increased on average by more than 55.2 times (Fig. 5). As a result of cultivation, the proportion of activated NK cells expressing CD38 and HLA-DR markers increased to 99.2% and 97.6%, respectively (Fig. 6). These cells can be used for adoptive immunotherapy of cancer patients, as well as for studying the cytotoxic activity of NK cells.

Information sources:

1. Denman CJ, Senyukov VV, Somanchi SS, et al. Membrane-bound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PLoS One. 2012; 7(1): e30264.

2. Abakushina EV, Popova LI, Zamyatnin AA Jr, et al. The Advantages and Challenges of Anticancer Dendritic Cell Vaccines and NK Cells in Adoptive Cell Immunotherapy. Vaccines. 2021; 9(11): 1363.

3. Moseman JE, Foltz JA, Sorathia K, et al. Evaluation of serum-free media formulations in feeder cell-stimulated expansion of natural killer cells. Cytotherapy. 2020;22(6):322-328.

4. Gelm Yu.V., Kuzmina E.G., Abakushina E.B. Functional activity of lymphocytes from healthy donors and cancer patients when cultured in the presence of IL-2 and IL-15. Bulletin of Experimental Biology and Medicine. 2019; T.167(4):471-477

5. Fang F, Xie S, Chen M, et al. Advances in NK cell production. Cell Mol Immunol. 2022; 19(4):460-481.

6. Kweon S, Phan MT, Chun S, et al. Expansion of Human NK Cells Using K562 Cells Expressing OX40 Ligand and Short Exposure to IL-21. Front Immunol. 2019; 10:879.

7. Min B, Yang B, Kim YS, et al. Harnessing novel engineered feeder cells expressing activating molecules for optimal expansion of NK cells with potent antitumor activity. Cell Mol Immunol. 2022; 19(2):296-298.

8. Van den Bergh J, Willemen Y, Lion E, et al. Transpresentation of interleukin-15 by IL-15/IL-15Rα mRNA-engineered human dendritic cells boosts antitumoral natural killer cell activity. Oncotarget. 2015;6(42):44123-44133.

9. Rybachuk B.A., Popova L.I., Borisov M.A., et al. Functional activity of NK cells in the development of a method of adoptive immunotherapy for cancer patients. Oncology issues. 2022. T. 68. No. S3. P.151

10. Becker PS, Suck G, Nowakowska P, et al. Selection and expansion of natural killer cells for NK cell-based immunotherapy. Cancer Immunol Immunother. 2016;65(4):477-484.

11. Cho D, Campana D. Expansion and activation of natural killer cells for cancer immunotherapy. Korean J Lab Med. 2009 Apr;29(2):89-96.

12. Klöß S, Oberschmidt O, Morgan M, et al. Optimization of Human NK Cell Manufacturing: Fully Automated Separation, Improved Ex Vivo Expansion Using IL-21 with Autologous Feeder Cells, and Generation of Anti-CD123-CAR-Ex-pressing Effector Cells. Hum Gene Ther. 2017; 28(10):897-913.

13. Kim EK, Ahn YO, Kim S, et al. Ex vivo activation and expansion of natural killer cells from patients with advanced cancer with feeder cells from healthy volunteers. Cytotherapy. 2013; 15(2):231-241.el.

14. Gelm Yu.V., Pasova I.A., Grivtsova L.Yu., et al. Experience in cultivating human NK cells with feeder cells in vitro. Medical immunology. 2022;24(3):481-490.

15. Wenju W, Zongliu N, Benshan X, et al. Artificial antigen presenting cell, construction method thereof and application thereof in chimeric antigen receptor T cell amplification. CN108251376B.

16. Genetically-modified cell line for NK cell activation and amplification, and use thereof. WO2021251707A1.

17. Campana D, Imai C. Modified cell line and method for expansion of NK cells. US7435596B2.

18. Campana D, Takahiro K. Stimulatory cell lines for ex vivo expansion and activation of natural killer cells. WO2018182511A1.

Claims (6)

Recombinant human myelogenous leukemia cell line TMDK562-15, which has the surface expression of a membrane-bound form of a chimeric protein consisting of interleukin 15, a combination of signaling molecules sushi domain CD215 and TNFRSF9L, exhibiting the ability to activate and proliferate NK cells when they are co-cultured, obtained by transducing the K562 cell line with pseudoretroviral particles based on the recombinant plasmid pBABE-mbIL15-sCD215-P2A-TNFRSF9L-puro, characterized in accordance with the graphic map presented in Fig. 1, with the following features: encodes the membrane-bound form of the chimeric protein IL15/sCD215 (mbIL15/sCD215) and the human transmembrane protein TNFRSF9L, which consists of the following elements: sequence encoding the main functional and structural elements of the costimulatory domain of the transmembrane chimeric protein IL15/sCD215/TNFRSF9L; a DNA fragment encoding a domain containing the transmembrane region of CD8 alpha; self-cleaving sequence P2A for post-translational separation of transmembrane protein fragments; genetic markers AmpR - ampicillin resistance gene (bla) and PuroR - selective puromycin resistance gene (rac); modified genetic elements MMLV psi, gag; the sv40 promoter to ensure a high level of expression of the used sequences and correct processing of viral RNA.