RU2803148C2 - Antitumor agent and a method of its evaluation - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: antitumor agent is presented containing a peptide having 4 linked epitopes containing 4 CTL epitope peptides linked through linkers, and a PD-1 pathway antagonist as active ingredients. Options for using the said agent for the treatment of an oncological patient are also proposed. A method of evaluating the antitumor activity of a peptide having 4 linked epitopes and a PD-1 pathway antagonist using a cell into which a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 and a polynucleotide encodingα 1 andα 2 regions of human HLA-A24 are disclosed.

EFFECT: invention provides a new cancer treatment method that exhibits excellent antitumor activity and causes fewer adverse reactions.

40 cl, 9 dwg, 7 tbl, 7 ex

Description

Field of technology

The present invention relates to cancer chemotherapy using a peptide having 4 linked CTL epitopes, including 4 linked peptides capable of inducing HLA-A-restricted CTL responses, and an immune checkpoint modulator (immune checkpoint molecule modulator). The present invention also provides a cell co-expressing a human tumor antigen epitope peptide derived from SART2 and human HLA-A24, which can be suitably used to evaluate the effect of cancer chemotherapy of the present invention.

State of the art

Cancer peptide vaccine has long been considered a novel cancer therapy. However, treatment efficacy is very limited, although clinical studies of cancer peptide vaccines have been conducted worldwide since 1990, when human tumor epitope peptides were identified (non-patent literature 1).

The mechanism of cancer peptide vaccine treatment is that the epitope-specific cytotoxic T lymphocyte (CTL) T cell receptor (TCR) recognizes the major histocompatibility complex (MHC) presenting antigenic peptide on the surface of cancer cells, and the CTL kills the cancer cells. Human MHC is also called human leukocyte antigen (HLA), and HLA types are known to be highly polymorphic. Consequently, an attempt has been made to develop cancer peptide vaccines targeting only specific HLA alleles. However, cancer vaccines target limited HLA alleles, and unfortunately, patients with other HLA alleles may not benefit from cancer peptide vaccines. In addition, requiring HLA typing before treatment would add some burden to patients by delaying treatment initiation. Accordingly, research and development of cancer peptide vaccines that are applicable to all cancer patients without HLA typing have been desirable.

To solve this problem, a peptide having 4 linked CTL epitopes was described, obtained by linking different CTL epitope peptides capable of inducing any or more of the HLA-A2, HLA-A24, HLA-A26 or HLA-A3 supertype-restricted CTL response (Patent Document 1 ).

The molecular mechanisms involved in the suppression and activation of immune cells have been discovered in recent years. T cell immune responses are regulated by TCR signals and concomitant signals. Co-signals include the co-stimulation signal and the co-inhibition signal, which respectively positively and negatively regulate TCR-mediated signals and control T cell immune responses. Cancer cells exploit this mechanism and cause T cell exhaustion by suppressing antigen-specific T cell activation. In recent years, controlling tumor immune evasion by enhancing antitumor immune responses in vivo in cancer patients through enhancing costimulatory signals or blocking coinhibitory signals is considered effective for the treatment of cancer, and various cancer immunotherapies targeting costimulatory molecules or coinhibitory molecules have been proposed (not patented). document 2). For example, nivolumab is used as an immune checkpoint modulator that activates T cells through inhibition of PD-1 binding to its ligand (PD-L1 and PD-L2) in the treatment of malignant melanoma, etc. (non-patent documents 2 and 3 ).

However, improved antitumor activity by combining a peptide having 4 CTL-linked epitopes with an immune checkpoint modulator has not been shown.

Citation list

Patent documents

Patent Document 1: International Publication No. WO 2015/060235

Non-patent documents

Non-Patent Document 1: Nature Med., 10(9):909-15 (2004)

Non-patent document 2: Nat. Rev. Cancer., 12 (4): 252-64 (2012)

Non-patent document 3: N. Engl. J. Med., 366 (26): 2443-54 (2012)

The essence of the invention

Technical problem

An object of the present invention is to provide a new method for treating cancer that exhibits a markedly superior antitumor effect and causes fewer adverse reactions by administering a peptide having 4 linked CTL epitopes and an immune checkpoint modulator in combination. Another object of the present invention is to provide a cell co-expressing a human tumor antigen epitope peptide derived from SART2 and human HLA-A24, which can be suitably used to evaluate the effect of an antitumor agent in humans.

Solution

The present inventors studied the antitumor effect by administering a peptide having 4 CTL-linked epitopes and anti-PD-1 antibody or anti-PD-L1 antibody as an immune checkpoint modulator in combination, and then found that the antitumor effect was significantly improved without developing serious adverse reactions compared to the use of drugs separately. The present inventors further established a cell co-expressing a human tumor antigen epitope peptide derived from SART2 and human HLA-A24, and established a method that can evaluate the antitumor effect of the human tumor antigen epitope peptide on the cell.

More specifically, the present invention provides the following inventions.

[1] An antineoplastic agent for use in combination with an immune checkpoint modulator, comprising the active ingredient, a peptide having 4 linked epitopes, comprising 4 CTL epitope peptides linked through linkers, where

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[2] Antitumor agent according to [1], where the epitope peptides contained in a peptide having 4 linked epitopes consist of

PEP5

PEP6

PEP9, and

one epitope peptide selected from the group consisting of PEP2, PEP4 and PEP10, and

a peptide having 4 linked epitopes has PEP2, PEP4 or PEP10 at the C-terminus.

[3] The antitumor agent according to [1] or [2], wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences:

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP4;

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP2; And

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP10, where

"(L)" represents a linker.

[4] An antitumor agent according to any one of [1] to [3], wherein the linker is an amino acid linker.

[5] Antitumor agent according to [4], where the amino acid linker is an arginine dimer consisting of two arginine residues linked to each other, or an arginine trimer consisting of three arginine residues linked to each other.

[6] An antitumor agent according to any one of [1]-[5], wherein a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer , consisting of four arginine residues linked to each other.

[7] An antitumor agent according to any one of [1] to [6], wherein a peptide having 4 linked epitopes such as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26.

[8] An antitumor agent according to any one of [1]-[7], wherein the immune checkpoint modulator is at least one selected from the group consisting of a PD-1 pathway antagonist, an ICOS pathway agonist, a CTLA-4 pathway antagonist and a CD28 pathway agonist.

[9] An antitumor agent according to any one of [1]-[7], wherein the immune checkpoint modulator is at least one selected from the group consisting of a PD-1 pathway antagonist and a CTLA-4 pathway antagonist.

[10] An antitumor agent according to any one of [1]-[7], wherein the immune checkpoint modulator is a PD-1 pathway antagonist.

[11] An antitumor agent according to any one of [8]-[10], wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and anti-PD-L2 antibodies.

[12] An antitumor agent according to any one of [8]-[10], wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody.

[13] The antitumor agent according to [11] or [12], where the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab.

[14] The antitumor agent according to [8] or [9], wherein the CTLA-4 pathway antagonist is an anti-CTLA-4 antibody.

[15] Antineoplastic agent according to [14], where the anti-CTLA-4 antibody is ipilimumab or tremelimumab.

[16] An antineoplastic agent for the treatment of a cancer patient receiving an immune checkpoint modulator containing a peptide having 4 linked epitopes as an active ingredient, wherein

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[17] An antitumor agent for the treatment of a cancer patient receiving a peptide having 4 linked epitopes containing an immune checkpoint modulator, where

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus, and

wherein the immune checkpoint modulator is at least one selected from the group consisting of a PD-1 pathway antagonist, an ICOS pathway agonist, a CTLA-4 pathway antagonist, and a CD28 pathway agonist.

[18] A combined formulation comprising a peptide having 4 linked epitopes and an immune checkpoint modulator in combination, wherein

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[19] An antitumor enhancer for enhancing the antitumor effect of an immune checkpoint modulator, comprising a peptide having 4 linked epitopes as an active ingredient, wherein:

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[20] An antitumor agent comprising a peptide having 4 linked epitopes, containing 4 CTL epitope peptides linked via linkers, and an immune checkpoint modulator as active ingredients, wherein

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[21] A kit of formulation containing a peptide having 4 linked epitopes and instructions for use, wherein the instructions for use state that the peptide having 4 linked epitopes and an immune checkpoint modulator are administered in combination to a cancer patient, wherein

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[22] A cell into which a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 and a polynucleotide encoding the α1 and α2 regions of human HLA-A24 are introduced.

[23] A cell into which a polynucleotide selected from the following polynucleotides (a)-(e) is introduced:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 5;

(b) a polynucleotide encoding a polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 5;

(c) a polynucleotide encoding a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 5;

(d) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 29; And

(e) a polynucleotide containing a nucleotide sequence having 90% or more identity to the nucleotide sequence shown in SEQ ID NO: 29; And

a polynucleotide selected from the following polynucleotides (f)-(j):

(f) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 30;

(g) a polynucleotide encoding a polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 30;

(h) a polynucleotide encoding a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 30;

(i) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 31; And

(j) a polynucleotide containing a nucleotide sequence having 90% or more identity to the nucleotide sequence shown in SEQ ID NO: 31

[24] A cell into which a polynucleotide selected from the following polynucleotides (k)-(o) is introduced:

(k) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 32;

(l) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 32;

(m) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 32;

(n) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 33; And

(o) a polynucleotide consisting of a nucleotide sequence having 90% or more identity to the nucleotide sequence shown in SEQ ID NO: 33; And

a polynucleotide selected from the following polynucleotides (p)-(t):

(p) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34;

(q) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 34;

(r) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 34;

(s) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 35; And

(t) a polynucleotide consisting of a nucleotide sequence having 90% or more identity to the nucleotide sequence shown in SEQ ID NO: 35

[25] A cell according to any one of [22]-[24] for evaluating the antitumor effect of a human tumor antigen epitope peptide derived from SART2.

[26] A cell according to any one of [22]-[24] for assessing the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator, wherein

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[27] A method for assessing the antitumor effect of a human tumor antigen epitope peptide derived from SART2 using a cell according to any one of [22]-[24], comprising the following steps (I) and (II):

(I) administering a human tumor antigen epitope peptide derived from SART2 to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And

(II) cell transplantation into any of [22]-[24] a non-immunodeficient non-human animal with a knockin of the human HLA-A24 gene.

[28] A method for assessing the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator using a cell according to any one of [22]-[24], comprising the following steps (I) and (II):

(I) administering a peptide having 4 linked epitopes and/or an immune checkpoint modulator to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And

(II) cell transplantation into any of [22]-[24] a non-immunodeficient non-human animal with a knockin of the human HLA-A24 gene, where

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[29] A pharmaceutical composition for the prevention and/or treatment of a tumor containing a peptide having 4 linked epitopes, containing 4 CTL epitope peptides linked through linkers, an immune checkpoint modulator and a pharmaceutically acceptable carrier, wherein

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[30] A method of preventing and/or treating a tumor by combining a peptide having 4 linked epitopes containing 4 CTL epitope peptides linked via linkers with an immune checkpoint modulator, comprising the step of administering a prophylactically and/or therapeutically effective amount of the peptide having 4 linked epitopes , to the patient, where

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

[31] The method of [30], wherein the peptide having 4 linked epitopes is administered to the patient before administration of the immune checkpoint modulator, simultaneously with administration of the immune checkpoint modulator, or after administration of the immune checkpoint modulator.

[32] The method according to [30] for enhancing the antitumor effect of an immune checkpoint modulator.

[33] A peptide having 4 linked epitopes containing 4 CTL epitope peptides linked via linkers, for use in the prevention or treatment of a tumor in combination with an immune checkpoint modulator, where

in a peptide having 4 linked epitopes,

an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus, and

wherein the peptide having 4 linked epitopes is administered prior to administration of the immune checkpoint modulator, simultaneously with administration of the immune checkpoint modulator, or after administration of the immune checkpoint modulator.

[34] A peptide having 4 linked epitopes as in [33], wherein a peptide having 4 linked epitopes such as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26.

[35] A peptide having 4 linked epitopes, as in [33] or [34], where the immune checkpoint modulator is a PD-1 pathway antagonist.

[36] A peptide having 4 linked epitopes, according to any one of [33]-[35], wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-1 antibody. PD-L1 antibodies.

[37] A peptide having 4 linked epitopes, as in any one of [33]-[36], wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab.

[38] A peptide having 4 linked epitopes for use in enhancing the antitumor effects of an immune checkpoint modulator.

[39] A peptide having 4 linked epitopes and an immune checkpoint modulator for use in a method of preventing and/or treating a tumor in a patient, wherein the peptide having 4 linked epitopes and the immune checkpoint modulator are administered simultaneously or separately to a patient, wherein the peptide, having 4 linked epitopes, contains 4 CTL epitope peptides linked through linkers,

wherein an epitope peptide such as shown in SEQ ID NO: 5 (PEP5), and

3 epitope peptides selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 1 (PEP1), an epitope peptide such as shown in SEQ ID NO: 2 (PEP2), an epitope peptide such as shown in SEQ ID NO: 4 (PEP4), an epitope peptide such as shown in SEQ ID NO: 6 (PEP6), an epitope peptide such as shown in SEQ ID NO: 7 (PEP7), an epitope peptide such as shown in SEQ ID NO : 8 (PEP8), an epitope peptide such as shown in SEQ ID NO: 9 (PEP9), an epitope peptide such as shown in SEQ ID NO: 10 (PEP10), an epitope peptide such as shown in SEQ ID NO: 13 (PEP13), an epitope peptide such as shown in SEQ ID NO: 15 (PEP15), an epitope peptide such as shown in SEQ ID NO: 17 (PEP17) and an epitope peptide such as shown in SEQ ID NO: 18 (PEP18 ),

linked through linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

The present invention further relates to the following aspects.

Use of a peptide having 4 linked epitopes described above to enhance the antitumor effect of an immune checkpoint modulator.

Use of a peptide having the 4 linked epitopes described above to produce an antitumor enhancer for an immune checkpoint modulator.

A product containing a peptide having 4 linked epitopes described above and an immune checkpoint modulator in a combined formulation, wherein the peptide having 4 linked epitopes and the immune checkpoint modulator are used simultaneously, sequentially or separately at intervals for the prevention and/or treatment of a tumor .

This description includes part or all of the contents disclosed in Japanese Patent Application No. 2018-124894, based on which priority is claimed in this application.

Advantageous effects of the invention

The antitumor agent of the present invention makes it possible to treat cancer with a high antitumor effect (in particular, a tumor shrinking effect and/or a tumor growth inhibition effect (life extension effect)) while suppressing the development of adverse reactions. As a result, the antitumor agent of the present invention promotes long-term survival of cancer patients.

Brief description of drawings

[Figure 1] Figure 1 shows an HPLC chromatogram of the TPV07 peptide having 4 associated CTL epitopes.

[Figure 2] Figure 2 shows the HPLC chromatogram of the TPV08 peptide having 4 associated CTL epitopes.

[Figure 3] Figure 3 shows the mass spectrum of the TPV07 peptide having 4 associated CTL epitopes.

[Figure 4] Figure 4 shows the mass spectrum of the TPV08 peptide having 4 associated CTL epitopes.

[Figure 5] Figure 5a shows the change in tumor volume when a colony of EL4.A24/SART2 ^93-101 cells is transplanted into mice. Figure 5b shows the change in tumor volume when a colony of B16F10.A24/SART2 ^93-101 cells was transplanted into mice.

[Figure 6] Figure 6 shows the effect of TPV06 and anti-mouse PD-1 antibody, used in combination, on tumor growth in mouse models transplanted with a colony of B16F10.A24/SART2 ^93-101 cells.

[Figure 7] Figure 7 shows the effect of TPV06 and anti-mouse PD-L1 antibody, used in combination, on tumor growth in mouse models transplanted with B16F10.A24/SART2 ^93-101 cell colonies.

[Figure 8] Figure 8 shows the effect of TPV07 and anti-mouse PD-1 antibody, used in combination, on tumor growth in mouse models transplanted with a colony of B16F10.A24/SART2 ^93-101 cells.

[Figure 9] Figure 9 shows the effect of TPV08 and anti-mouse PD-1 antibody, used in combination, on tumor growth in mouse models transplanted with a colony of B16F10.A24/SART2 ^93-101 cells.

Description of Embodiments

This invention relates to an antitumor agent, an antitumor enhancer and a composite composition, and the use of these agents, a method of treatment and a method for enhancing an antitumor effect, wherein a peptide having 4 linked epitopes and an immune checkpoint modulator (for example, an anti-PD-1 antibody and anti-PD-L1 antibody) are administered in combination.

In the present invention, a peptide having 4 CTL-linked epitopes (hereinafter referred to as a peptide having 4 linked epitopes) means a single molecule in which 4 peptides selected from CTL epitope peptides derived from the same and/or different tumor antigen molecules are linear connected through linkers.

The following CTL epitope peptides derived from tumor antigen molecules are known:

KLVERLGAA (SEQ ID NO: 1; herein designated "PEP1"; eg, International Publication No. WO 2001/011044);

ASLDSDPWV (SEQ ID NO: 2; herein designated "PEP2"; eg, International Publication No. WO 2002/010369);

ALVEFEDVL (SEQ ID NO: 3; herein designated "PEP3"; eg, International Publication No. WO 2002/010369);

LLQAEAPRL (SEQ ID NO: 4; herein designated "PEP4"; e.g., International Publication No. WO 2000/12701);

DYSARWNEI (SEQ ID NO: 5; herein designated "PEP5"; e.g., JP Patent Publication (Kokai) No. 11-318455 A (1999));

VYDYNCHVDL (SEQ ID NO: 6; herein designated "PEP6"; eg, International Publication No. WO 2000/12701);

LYAWEPSFL (SEQ ID NO: 7; herein designated "PEP7"; e.g., JP Patent Publication (Kokai) No. 2003-000270 A);

DYLRSVLEDF (SEQ ID NO: 8; herein designated "PEP8"; e.g., International Publication No. WO 2001/011044);

QIRPIFSNR (SEQ ID NO: 9; herein designated "PEP9"; e.g., International Publication No. WO 2008/007711);

ILEQSGEWWK (SEQ ID NO: 10; herein designated "PEP10"; e.g., International Publication No. WO 2009/022652);

VIQNLERGYR (SEQ ID NO: 11; herein designated "PEP11"; e.g., International Publication No. WO 2009/022652);

KLKHYGPGWV (SEQ ID NO: 12; herein designated "PEP12"; eg, International Publication No. WO 1999/067288);

RLQEWCSVI (SEQ ID NO: 13; herein designated "PEP13"; eg, International Publication No. WO 2002/010369);

ILGELREKV (SEQ ID NO: 14; herein designated "PEP14"; eg, International Publication No. WO 2002/010369);

DYVREHKDNI (SEQ ID NO: 15; herein designated "PEP15"; eg, International Publication No. WO 2005/071075);

HYTNASDGL (SEQ ID NO: 16; herein designated "PEP16"; eg, International Publication No. WO 2001/011044);

NYSVRYRPGL (SEQ ID NO: 17; herein designated "PEP17"; e.g., JP Patent Publication (Kokai) No. 2003-000270 A);

RYLTQETNKV (SEQ ID NO: 18; herein designated "PEP18"; e.g., International Publication No. WO 2005/116056).

Table 1 below shows information related to the proteins from which the CTL epitope peptides PEP1-PEP18 are derived. These proteins have been described to be highly expressed in tumor tissues.

[Table 1]

Peptide Origin Amino acid sequence SEQ ID NO. REP1 Lck-246 KLVERLGAA SEQ ID NO: 1 REP2 WHSC2-103 ASLDSDPWV SEQ ID NO: 2 REP3 HNRPL-140 ALVEFEDVL SEQ ID NO: 3 REP4 SART3-302 LLQAEAPRL SEQ ID NO: 4 REP5 SART2-93 DYSARWNEI SEQ ID NO: 5 REP6 SART3-109 VYDYNCHVDL SEQ ID NO: 6 REP7 MRP3-503 LYAWEPSFL SEQ ID NO: 7 REP8 Lck-488 DYLRSVLEDF SEQ ID NO: 8 REP9 SART3-734 QIRPIFSNR SEQ ID NO: 9 REP10 Lck-90 ILEQSGEWWK SEQ ID NO: 10 REP11 Lck-449 VIQNLERGYR SEQ ID NO: 11 REP12 SurV-129 KLKHYGPGWV SEQ ID NO: 12 REP13 UBE2V-43 RLQEWCSVI SEQ ID NO: 13 REP14 WHSC2-141 ILGELREKV SEQ ID NO: 14 REP15 EGFR-800 DYVREHKDNI SEQ ID NO: 15 REP16 Lck-208 HYTNASDGL SEQ ID NO: 16 REP17 MRP3-1293 NYSVRYRPGL SEQ ID NO: 17 REP18 PTHrP-102 RYLTQETNKV SEQ ID NO: 18

A peptide having 4 associated CTL epitopes in accordance with the present invention is a peptide in which 4 types of CTL epitope peptides selected from the specific 13 types of CTL epitope peptides (the peptide shown in SEQ ID NO: 1 (PEP1), the peptide shown in SEQ ID NO: 2 (PEP2), the peptide shown in SEQ ID NO: 4 (PEP4), the peptide shown in SEQ ID NO: 5 (PEP5), the peptide shown in SEQ ID NO: 6 (PEP6), the peptide, shown in SEQ ID NO: 7 (PEP7), peptide shown in SEQ ID NO: 8 (PEP8), peptide shown in SEQ ID NO: 9 (PEP9), peptide shown in SEQ ID NO: 10 (PEP10), the peptide shown in SEQ ID NO: 13 (PEP13), the peptide shown in SEQ ID NO: 15 (PEP15), the peptide shown in SEQ ID NO: 17 (PEP17) and the peptide shown in SEQ ID NO: 18 (PEP18 )) are linearly linked by linkers, and which can induce and/or activate three or more CTLs specific for each CTL epitope peptide. Even if CTL epitope peptide-specific induction is not directly assessed, the existence of CTL epitope peptide-specific induction can be determined in an immunoproteasome digestion experiment (International Publication No. WO 2015/060235, etc.).

A peptide having 4 linked epitopes according to the present invention is a peptide in which

the peptide shown in SEQ ID NO: 5 (PEP5), and

3 peptides selected from the group consisting of the peptide shown in SEQ ID NO: 1 (PEP1), the peptide shown in SEQ ID NO: 2 (PEP2), the peptide shown in SEQ ID NO: 4 (PEP4), the peptide, shown in SEQ ID NO: 6 (PEP6), peptide shown in SEQ ID NO: 7 (PEP7), peptide shown in SEQ ID NO: 8 (PEP8), peptide shown in SEQ ID NO: 9 (PEP9), the peptide shown in SEQ ID NO: 10 (PEP10), the peptide shown in SEQ ID NO: 13 (PEP13), the peptide shown in SEQ ID NO: 15 (PEP15), the peptide shown in SEQ ID NO: 17 (PEP17 ) and the peptide shown in SEQ ID NO: 18 (PEP18),

connected by linkers.

In the present invention, a peptide having an amino acid sequence having a substitution, insertion, deletion and/or addition of one or more amino acids in each amino acid sequence PEP1, PEP2, PEP4, PEP5, PEP6, PEP7, PEP8, PEP9, PEP10, PEP13, PEP15, PEP17 or PEP18, and having the ability to induce CTL and/or the ability to induce immunoglobulin production equivalent to or greater than that of the original peptide, can be used as a "CTL epitope peptide". The term "several" as used herein refers to 2 or 3, and preferably 2. An example of such a peptide is a peptide obtained by substituting amino acids with amino acids having properties similar to those of the original amino acids (i.e., a peptide obtained by conservative amino acid substitution) .

Whether the peptide has "the ability to induce CTL and/or the ability to induce immunoglobulin production equivalent to or greater than that of the original peptide" or not can be assessed in accordance with the method described in, for example, International Publication No. WO 2015/060235. In the case of assessing the ability to induce CTL using this method, the number of cells producing IFN-γ in wells supplemented with cells obtained from mice that have previously produced a test peptide having an amino acid sequence having a substitution, insertion, deletion and/or addition of one or several amino acids, antigen presenting cells obtained from syngeneic mice and the test peptide are used as an indicator, and the peptide can be confirmed to have the ability to induce CTL equivalent to or greater than that of the original peptide if the results of the resulting Δ value (positive (10 ≤Δ < 100), moderately positive (100≤Δ < 200), strongly positive (200≤Δ)) are equivalent or higher. In this case, the equivalent ability is determined if the original peptide is "positive" and the peptide having an amino acid sequence having a substitution, insertion, deletion and/or addition of one or more amino acids is also "positive". Regarding the ability to induce immunoglobulin production, the titer of CTL epitope-specific IgG antibody in the serum of mice treated with the test peptide is used as an indicator, and the peptide can be confirmed to have the ability to induce immunoglobulin production equivalent to or greater than that of the original peptide if the results measured increase (fold) in the resulting IgG antibody titer (2 < times < 10, 10≤ times < 100, 100≤ times) equivalent or higher. In this case, equivalent capacity is determined if the measurement results for the original peptide fall within the range of "2 < times < 10", and the measurement results for the peptide having an amino acid sequence having a substitution, insertion, deletion and/or addition of multiple amino acids also fall within in the range "2 < times < 10".

In the present invention, any linker can be used as long as it is cleaved when a peptide having 4 linked CTL epitopes is introduced into the body, and the linked CTL epitope peptides can be separated from each other. Examples thereof include an ester linker, an ether linker, a sugar chain linker, a polyethylene glycol linker and an amino acid linker. Examples of amino acid sequences used as amino acid linkers include arginine dimer (RR), arginine trimer (RRR), arginine tetramer (RRRR), lysine dimer (KK), lysine trimer (KKK), lysine tetramer (KKKK), glycine dimer ( GG), glycine trimer (GGG), glycine tetramer (GGGG), glycine pentamer (GGGGG), glycine hexamer (GGGGGG), alanine-alanine-tyrosine (AAY), isoleucine-leucine-alanine (ILA) and arginine-valine-lysine -arginine (RVKR), where arginine dimer (RR) or arginine trimer (RRR) are preferred, and arginine dimer (RR) is most preferred. Linkers for use in peptides having linked epitopes are known in the art and can be suitably selected for use by those skilled in the art.

In a peptide having 4 linked epitopes in accordance with the present invention, the selectable CTL epitope peptides and their locations can be determined by administering the peptide having 4 linked epitopes, obtained by synthesizing it in given combinations and in a given order of epitopes, to transgenic mice expressing human HLA- A, and assessing the presence of CTL-specific induction of a CTL epitope peptide in vivo . The presence of CTL-specific induction of a CTL epitope peptide in vivo can be assessed in accordance with the method described in, for example, international publication No. WO 2015/060235. Selectable CTL epitope peptides and their locations can be determined using a method such as CTL-specific induction of a CTL epitope peptide found for at least 3 or more preferably 4 CTL epitope peptides.

The peptide having 4 linked epitopes according to the present invention preferably has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

Thus, preferably, in a peptide having 4 linked epitopes in accordance with the present invention,

the peptide shown in SEQ ID NO: 5 (PEP5), and

3 peptides selected from the group consisting of the peptide shown in SEQ ID NO: 1 (PEP1), the peptide shown in SEQ ID NO: 2 (PEP2), the peptide shown in SEQ ID NO: 4 (PEP4), the peptide, shown in SEQ ID NO: 6 (PEP6), peptide shown in SEQ ID NO: 7 (PEP7), peptide shown in SEQ ID NO: 8 (PEP8), peptide shown in SEQ ID NO: 9 (PEP9), the peptide shown in SEQ ID NO: 10 (PEP10), the peptide shown in SEQ ID NO: 13 (PEP13), the peptide shown in SEQ ID NO: 15 (PEP15), the peptide shown in SEQ ID NO: 17 (PEP17 ) and the peptide shown in SEQ ID NO: 18 (PEP18),

linked by linkers, and the peptide having 4 linked epitopes has one of the characteristics selected from the following characteristics (1)-(3):

(1) the peptide contains PEP2 at the C-terminus (except for peptides containing PEP7 and PEP8 at the N-terminus, sequentially arranged in that order from the N-terminus through the linker);

(2) the peptide contains PEP4 at the C-terminus; And

(3) the peptide contains PEP10 at the C-terminus.

More preferably, the peptide having 4 linked epitopes in accordance with the present invention contains

the peptide shown in SEQ ID NO: 5 (PEP5), the peptide shown in SEQ ID NO: 6 (PEP6) and the peptide shown in SEQ ID NO: 9 (PEP9), and

one peptide selected from the group consisting of the peptide shown in SEQ ID NO: 2 (PEP2), the peptide shown in SEQ ID NO: 4 (PEP4) and the peptide shown in SEQ ID NO: 10 (PEP10),

linked by linkers, and contains PEP2, PEP4 or PEP10 at the C-terminus.

More preferably, the peptide having 4 linked epitopes in accordance with the present invention is a peptide consisting of a sequence selected from the following sequences:

PEP5-(L)-PEP6-(L)-PEP9-(L)-PEP4;

PEP9-(L)-PEP5-(L)-PEP6-(L)-PEP4;

PEP6-(L)-PEP5-(L)-PEP9-(L)-PEP4;

PEP6-(L)-PEP9-(L)-PEP5-(L)-PEP4;

PEP9-(L)-PEP6-(L)-PEP5-(L)-PEP4;

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP4;

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP2; And

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP10,

where "(L)" represents the linker.

More preferably, the peptide having 4 linked epitopes in accordance with the present invention is a peptide consisting of a sequence selected from the following sequences:

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP4;

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP2; And

PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP10,

where "(L)" represents the linker.

More preferably, the peptide having 4 linked epitopes in accordance with the present invention is a peptide having an arginine dimer as a linker and a sequence selected from the following sequences:

PEP5-RR-PEP9-RR-PEP6-RR-PEP4 (SEQ ID NO: 24; herein designated TPV06);

PEP5-RR-PEP9-RR-PEP6-RR-PEP2 (SEQ ID NO: 25; herein designated TPV07); And

PEP5-RR-PEP9-RR-PEP6-RR-PEP10 (SEQ ID NO: 26; here referred to as TPV08).

More preferably, the peptide having 4 linked epitopes in accordance with the present invention is the TPV06 peptide shown in SEQ ID NO: 24.

In one embodiment of the present invention, the peptide having 4 linked epitopes is preferably a peptide having a sequence selected from SEQ ID Nos: 19-28 shown in Table 2 below.

[Table 2]

Peptide Amino acid sequence SEQ ID NO. TPV01 PEP5-RR-PEP6-RR-PEP9-RR-PEP4 SEQ ID NO: 19 TPV02 PEP9-RR-PEP5-RR-PEP6-RR-PEP4 SEQ ID NO: 20 TPV03 PEP6-RR-PEP5-RR-PEP9-RR-PEP4 SEQ ID NO: 21 TPV04 PEP6-RR-PEP9-RR-PEP5-RR-PEP4 SEQ ID NO: 22 TPV05 PEP9-RR-PEP6-RR-PEP5-RR-PEP4 SEQ ID NO: 23 TPV06 PEP5-RR-PEP9-RR-PEP6-RR-PEP4 SEQ ID NO: 24 TPV07 PEP5-RR-PEP9-RR-PEP6-RR-PEP2 SEQ ID NO: 25 TPV08 PEP5-RR-PEP9-RR-PEP6-RR-PEP1О SEQ ID NO: 26 TPV09 RRR-PEP5-RR-PEP9-RR-PEP6-RR-PEP4 SEQ ID NO: 27 TPV10 RRRR-PEP5-RR-PEP9-RR-PEP6-RR-PEP4 SEQ ID NO: 28

More preferably, the peptide having 4 linked epitopes is any of the following peptides:

TPV01 (SEQ ID NO: 19);

TPV02 (SEQ ID NO: 20);

TPV03 (SEQ ID NO: 21);

TPV04 (SEQ ID NO: 22);

TPV05 (SEQ ID NO: 23); And

TPV06 (SEQ ID NO: 24),

selected from Table 2 described above.

In the present invention, 2 or more peptides having 4 linked epitopes can be used. For example, 2, 3, 4 or more peptides having 4 linked epitopes can be used alone or in a mixture, and 3 or more peptides having 4 linked epitopes are preferably used in a mixture. In the case of using 2 or more peptides having 4 linked epitopes, one or more peptides may be a peptide having 4 linked epitopes according to the present invention, or may be a peptide having 4 linked epitopes described in, for example, International Publication No. WO 2015/060235, while at least one peptide having 4 linked epitopes according to the present invention is included. It is preferable to use the peptide shown in SEQ ID NO: 24 and one or more peptides having 4 associated CTL epitopes described in international publication No. WO 2015/060235. It is more preferable to use the peptide shown in SEQ ID NO: 24 and 2 peptides having 4 related epitopes described in international publication No. WO 2015/060235. Even more preferably, 3 peptides are used, i.e. the peptide shown in SEQ ID NO: 24, the peptide shown in SEQ ID NO: 44 (TPV011: PEP15-RR-PEP18-RR-PEP1-RR-PEP10) and the peptide shown in SEQ ID NO: 45 (TPV012: RRRR -PEP7-RR-PEP13-RR-PEP8-RR-PEP2) in the form of a mixture.

The peptide having 4 linked CTL epitopes in accordance with the present invention may additionally be a peptide sequence consisting of hydrophilic amino acids. Such a peptide sequence can be added at the N-terminus and/or C-terminus of a peptide having 4 CTL-linked epitopes, and is preferably added at the N-terminus. Such a peptide sequence consists of 1-15, preferably 2-10, and most preferably 3-5 hydrophilic amino acids selected from the group consisting of arginine, histidine, lysine, threonine, tyrosine, serine, asparagine, glutamine, aspartic acid and glutamic acid. For example, an arginine trimer (RRR) or an arginine tetramer (RRRR) can be used as such a peptide sequence. Examples of peptides having 4 CTL-linked epitopes containing such peptide sequences added therein include RRR-TPV06, RRRR-TPV06, TPV06-RRR, TPV06-RRRR, RRR-TPV07, RRRR-TPV07, TPV07-RRR, TPV07-RRRR, RRR-TPV08, RRRR-TPV08, TPV08-RRR, TPV08-RRRR, KKK-TPV06, KKKK-TPV06, TPV06-KKK, TPV06-KKKK, KKK-TPV07, KKKK-TPV07, TPV07-KKK, TPV07-KKKK, KKK- TPV08, KKKK-TPV08, TPV08-KKK, TPV08-KKKK, HHH-TPV06, HHHH-TPV06, TPV06-HHH, TPV06-HHHH, HHH-TPV07, HHHH-TPV07, TPV07-HHH, TPV07-HHHH, HHH-TPV08, HHHH-TPV08, TPV08-HHH, TPV08-HHHH, RRKK-TPV06, RKRK-TPV06, RHRH-TPV06, RRHH-TPV06, KKHH-TPV06 and KHKH-TPV06, where RRR-TPV06, RRRR-TPV06, RRR-TPV07, RRRR -TPV07, RRR-TPV08, RRRR-TPV08, KKK-TPV06, KKKK-TPV06, KKK-TPV07, KKKK-TPV07, KKK-TPV08, KKKK-TPV08, HHH-TPV06, HHHH-TPV06, HHH-TPV07, HHHH-TPV07 , HHH-TPV08, HHHH-TPV08, RRKK-TPV06, RKRK-TPV06, RHRH-TPV06, RRHH-TPV06, KKHH-TPV06, and preferably KHKH-TPV06, RRR-TPV06 (TPV09), RRRR-TPV06 (TPV10) , RRR-TPV07, RRRR-TPV07, RRR-TPV08, and more preferably RRRR-TPV08, and most preferably RRR-TPV06 (TPV09) and RRRR-TPV06 (TPV10).

[0038]

It is known that a peptide containing such a peptide sequence consisting of hydrophilic amino acids has improved solubility in an aqueous solvent (Peptides: 38, 302-311 (2012); JP Patent Publication (Kokai) No. 2006-188507 A). By adding such a peptide sequence to a peptide having 4 CTL-linked epitopes in accordance with the present invention, the solubility of the peptide having 4 CTL-linked epitopes in an aqueous solvent can be improved.

"A peptide having 4 linked epitopes, optionally further containing a peptide sequence consisting of hydrophilic amino acids" according to the present invention is preferably a peptide having 4 linked CTL epitopes, optionally containing a peptide sequence consisting of hydrophilic amino acids at the N-terminus, more preferably, a peptide having 4 CTL linked epitopes, optionally containing a peptide sequence consisting of 3-5 hydrophilic amino acids selected from the group consisting of arginine, histidine and lysine, at the N-terminus, more preferably, a peptide having 4 CTL linked an epitope, optionally containing an arginine trimer (RRR) or an arginine tetramer (RRRR) at the N-terminus, and even more preferably, a peptide having 4 CTL-linked epitopes, not containing a peptide sequence consisting of hydrophilic amino acids.

The peptide having 4 linked CTL epitopes in accordance with the present invention can be synthesized in accordance with the method described in, for example, international publication No. WO 2015/060235.

The immune checkpoint modulator of the present invention targets an immune checkpoint molecule and induces in vivo antitumor immune responses in cancer patients and prevents tumor immune escape.

Thus, a substance that targets an immune checkpoint molecule can be used as an immune checkpoint modulator. Examples of immune checkpoint molecules include molecules of the B7 family (B7-1, B7-2, PD-L1, PD-L2, etc.), CD28 family (CTLA-4, PD-1, etc.), superfamily TNF (4-1BBL, OX40L, etc.) and the TNF receptor superfamily (4-1BB, OX40, etc.), which are broadly classified into co-stimulatory molecules, which have a stimulatory effect, and co-inhibitory molecules, which have an inhibitory effect.

Examples of an immune checkpoint modulator that can be suitably used in the present invention include substances that promote the functions of co-stimulatory molecules and substances that inhibit the functions of coinhibitory molecules. More specifically, examples of the immune checkpoint modulator include a PD-1 pathway antagonist, an ICOS pathway agonist, a CTLA-4 pathway antagonist, a CD28 pathway agonist, a BTLA pathway antagonist and a 4-1BB pathway agonist, etc.

In the present invention, the immune checkpoint modulator is preferably at least one selected from the group consisting of a PD-1 pathway antagonist, an ICOS pathway agonist, a CTLA-4 pathway antagonist and a CD28 pathway agonist, more preferably at least one selected from the group consisting of a PD-1 pathway antagonist, a CTLA-4 pathway antagonist and a CD28 pathway agonist, more preferably at least one selected from the group consisting of a PD-1 pathway antagonist and a CTLA-4 pathway antagonist , and even more preferably, a PD-1 pathway antagonist from the point of view of suppression of adverse reactions.

A PD-1 pathway antagonist inhibits the immunosuppressive signals induced by PD-1 expressed on T cells or its ligands PD-L1 or PD-L2. Examples thereof include anti-PD-1 antibody, anti-PD-L1 antibody, anti-PD-L2 antibody, PD-1 extracellular domain, PD-L1 extracellular domain, PD-L2 extracellular domain, PD-1-Ig (fusion protein PD-1 extracellular domain and FC region of immunoglobulin (Ig)), PD-L1-Ig, PD-L2-Ig, PD-1 siRNA, PD-L1 siRNA and PD-L2 siRNA. The PD-1 pathway antagonist is preferably an anti-PD-1 antibody, an anti-PD-L1 antibody or an anti-PD-L2 antibody, more preferably an anti-PD-1 antibody or an anti-PD-L1 antibody. Among them, an anti-PD-1 antibody is particularly preferred.

A CTLA-4 pathway antagonist inhibits immunosuppressive signals induced by CTLA-4 expressed on T cells or its ligands B7-1 (CD80) or B7-2 (CD86). Examples thereof include anti-CTLA-4 antibody, CTLA-4 extracellular domain, CTLA-4-Ig, anti-B7-1 (CD80) antibody, anti-B7-2 (CD86) antibody, and CTLA-4 siRNA. The CTLA-4 pathway antagonist is preferably an anti-CTLA-4 antibody, CTLA-4 extracellular domain, CTLA-4-Ig, anti-B7-1 (CD80) antibody or anti-B7-2 (CD86) antibody, more preferably anti -CTLA-4 antibody or CTLA-4-Ig. Among them, anti-CTLA-4 antibody is particularly preferred.

Examples of these antibodies include immunoglobulins (IgA, IgD, IgE, IgG, IgM, IgY, etc.), Fab fragments, F(ab') ₂ fragments, single chain variable fragments (scFv), single domain antibodies and diabody (Nat. Rev. Immunol., 6: 343-357, 2006). Examples thereof include monoclonal or polyclonal antibodies, including human antibodies, humanized antibodies, chimeric antibodies, mouse antibodies, llama antibodies and chicken antibodies.

A humanized IgG monoclonal antibody or a human IgG monoclonal antibody is preferred.

Examples of anti-PD-1 antibodies according to the present invention include nivolumab, pembrolizumab, cemiplimab and spartalizumab, where nivolumab or pembrolizumab are preferred.

Examples of the anti-PD-L1 antibody according to the present invention include atezolizumab, durvalumab, avelumab and the like, where atezolizumab, durvalumab or avelumab are preferred.

Examples of the anti-CTLA-4 antibody according to the present invention include ipilimumab, tremelimumab and the like, where ipilimumab is preferred.

Examples of CTLA-4-Ig in accordance with the present invention include abatacept and the like, where abatacept is preferred.

These antibodies can be produced by commonly known antibody production methods.

The anti-PD-1 antibody is or will be marketed as nivolumab or pembrolizumab; the anti-PD-L1 antibody is or will be marketed as atezolizumab, durvalumab or avelumab; the anti-CTLA-4 antibody is or will be marketed as ipilimumab or tremelimumab; and CTLA-4-Ig is or will be marketed as abatacept, either of which could also be used.

In the present invention, in the case of using 2 or more immune checkpoint modulators, for example, an anti-PD-1 antibody and/or an anti-CTLA-4 antibody may be used in combination, or a bispecific antibody capable of binding to both PD-1 may be used. and CTLA-4. Examples of bispecific antibodies include XmAb20717 (PD-1 x CTLA-4).

The recommended dose of the 4-linked epitope peptide used in the present invention for humans is in the range of 3 to 9 mg/body/day for each 4-linked epitope peptide for monotherapy. In the present invention, the amount of the peptide having 4 linked epitopes administered per day, on the day of administration, is preferably 80-120%, preferably 100% of the recommended dose of the peptide having 4 linked epitopes for monotherapy, in terms of enhancing effect antitumor effect of an immune checkpoint modulator with a peptide having 4 linked epitopes.

Thus, if the recommended human dose is 3 mg/body/day, the amount of peptide having 4 linked epitopes administered is preferably 1.5 to 6 mg/body/day, more preferably 2.4 to 3.6 mg/body/day, and especially preferably 3 mg/body/day, per peptide having 4 linked epitopes. If the recommended human dose is 9 mg/body/day, the amount of peptide having 4 linked epitopes administered is preferably 4.5 to 18 mg/body/day, more preferably 7.2 to 10.8 mg/body /day, and especially preferably 9 mg/body/day, per peptide having 4 linked epitopes.

In the present invention, the amount of the immune checkpoint modulator administered per day, on the day of administration, is preferably 50-100%, and more preferably 100% of the recommended dose of the immune checkpoint modulator administered alone, from the viewpoint of the effect of enhancing the antitumor effect of the modulator immune checkpoint peptide having 4 linked epitopes.

More specifically, the recommended dose of nivolumab when administered alone is 2 mg/kg (body weight) per dose or 3 mg/kg (body weight) per dose, which is approved in Japan. Therefore, the amount of nivolumab administered per day, on the day of administration, in accordance with the present invention, is preferably 1 to 3 mg/kg (body weight) per dose, and more preferably, 2 mg/kg (body weight) per dose or 3 mg/kg (body weight) per dose.

The recommended dose of pembrolizumab when administered alone is 2 mg/kg (body weight) per dose or 200 mg per dose, which is approved in Japan. Therefore, the amount of pembrolizumab administered per day, on the day of administration, in accordance with the present invention, is preferably 1 to 2 mg/kg (body weight) per dose, or 100 to 200 mg per dose, and more preferably 2 mg/kg (body weight) per dose or 200 mg per dose.

The recommended dose of atezolizumab when administered alone is 1200 mg per dose, which is approved in Japan. Therefore, the amount of atezolizumab administered per day on the day of administration in accordance with the present invention is preferably 600 to 1200 mg per dose, and more preferably 1200 mg per dose.

The recommended dose of avelumab or durvalumab when administered alone is 10 mg/kg (body weight) per dose, which is approved in the United States. Therefore, the amount of avelumab or durvalumab administered per day on the day of administration in accordance with the present invention is preferably 5 to 10 mg/kg (body weight) per dose, and more preferably 10 mg/kg (body weight) per dose .

The recommended dose of ipilimumab when administered alone is 3 mg/kg (body weight) per dose, which is approved in Japan. Therefore, the amount of ipilimumab administered per day on the day of administration in accordance with the present invention is preferably 1.5 to 3 mg/kg (body weight) per dose, and more preferably 3 mg/kg (body weight) per dose .

In the present invention, the "recommended dose" is the range that has been determined in clinical studies, etc. and can be safely used without severe side effects, which can provide maximum therapeutic effect. More specifically, examples thereof include a recommended dose approved and/or recommended by a public organization or institution such as the Pharmaceuticals and Medical Devices Agency (PMDA), Food and Drug Administration (FDA), or European Medicines Agency (EMA), and described in the package inserts given during consultations, in doctor’s prescriptions and the like. The recommended dose approved by any of the public organizations PMDA, FDA and EMA is preferred.

The antitumor agent of the present invention can be administered according to a schedule suitably selected depending on the cancer type, stage, etc.

The peptide having 4 linked epitopes is preferably administered according to a regimen where one course is a total of 21 days, including 3 repeated stages of administration once a week (once daily on days 1, 8 and 15). In course 3 or later, it is preferably administered according to a schedule where one course is a total of 21 days, including administration on day 1 and drug withdrawal for 20 days (administration every 3 weeks).

Nivolumab is preferably administered according to an dosing schedule at 2-week or 3-week intervals.

Pembrolizumab, atezolizumab or ipilimumab are preferably administered according to an dosing schedule at 3-week intervals.

Avelumab or durvalumab is preferably administered according to a dosing schedule at 2-week intervals.

The number of administrations of the antitumor agent of the present invention per day can be suitably selected according to the cancer type, stage, etc.

A peptide having 4 linked epitopes, nivolumab, pembrolizumab, atezolizumab, avelumab or ipilimumab is preferably administered once daily.

The peptide having 4 linked epitopes according to the present invention and the immune checkpoint modulator can be administered in an order suitably selected according to the cancer type, stage, etc., either of them can be administered first or both can be administered simultaneously. If these agents are not administered simultaneously, the agents may be administered at appropriately selected intervals while the antitumor enhancing effect is in effect. The interval is preferably 1 to 21 days, more preferably 1 to 14 days, and particularly preferably 1 to 7 days. The peptide having 4 linked epitopes according to the present invention and the immune checkpoint modulator are preferably administered in the order in which the peptide having 4 linked epitopes is administered first.

The tumor affected in the present invention is not particularly limited as long as the effect of enhancing the antitumor effect is exhibited. The tumor is preferably a tumor on which the peptide having the 4 linked epitope has an antitumor effect, more preferably a cancer positive for Lck, WHSC2, SART2, SART3, MRP3, UBE2V, EGFR or PTHrP, and more preferably a SART2 positive cancer tumor.

Specific examples of cancer affected by the present invention include brain tumor, head and neck cancer, gastrointestinal cancer (esophageal cancer, stomach cancer, duodenal cancer, liver cancer, biliary tract cancer (gallbladder cancer, bile duct cancer) etc.), pancreatic cancer, small intestinal cancer, colon cancer (colorectal cancer, colon cancer, rectal cancer, etc.), gastrointestinal stromal tumor, etc.), cancer lung (non-small cell lung cancer and small cell lung cancer), breast cancer, ovarian cancer, uterine cancer (cervical cancer, endometrial cancer, etc.), kidney cancer, urothelial cancer (bladder cancer, renal pelvis cancer and ureteral cancer) , prostate cancer, skin cancer and cancer of unknown primary origin. In this context, cancer includes not only the primary tumor, but also cancer that has metastasized to other organs (liver, etc.). Among them, head and neck cancer, gastrointestinal cancer, lung cancer, kidney cancer, urothelial cancer and skin cancer are preferred, digestive system cancer, lung cancer, urothelial cancer and skin cancer are more preferred, and lung cancer and urothelial cancer are particularly preferred from the point of view of antitumor action. The antitumor agent of the present invention may be an agent for use in postoperative adjuvant chemotherapy that is administered to prevent recurrence after surgical removal of a tumor, or may be an agent for use in preoperative adjuvant chemotherapy that is administered before surgical removal of a tumor.

In the present invention, the peptide having 4 linked epitopes and the immune checkpoint modulator can be provided in multiple active ingredient formulations or in the form of a single-component formulation (eg, combination drug formulations) based on the dosage form of each active ingredient or administration schedule. These formulations may be prepared and distributed in a single package suitable for use in combination, or may be prepared and distributed in separate packages.

The dosage form of the antitumor agent of the present invention is not particularly limited, and can be suitably selected according to the therapeutic purpose. Specific examples thereof may include oral formulations (tablets, coated tablets, powders, granules, capsules, liquid formulations, etc.), injections, suppositories, patches and ointments.

Examples of dosage forms of a peptide having 4 linked epitopes, anti-PD-1 antibody, anti-PD-L1 antibody and anti-CTLA-4 antibody include the dosage forms described above, with injection being preferred.

The antitumor agent of the present invention can be prepared by a generally known method using a pharmaceutically acceptable carrier in accordance with the dosage form of both the peptide having 4 linked epitopes and the immune checkpoint modulator. Examples of such carriers may include various carriers commonly used in conventional medicinal products, for example, excipients, coupling agents, disintegrating agents, lubricants, diluents, solubilizers, suspending agents, isotonicizing agents, pH adjusters, buffers, stabilizers, colorants, flavoring agents, and odor correctors. .

This invention also relates to an antitumor enhancer for enhancing the antitumor effect of an immune checkpoint modulator in a cancer patient, comprising a peptide having 4 linked epitopes as an active ingredient. The antitumor action enhancer has a dosage form of the antitumor agent described above.

This invention also relates to an antitumor agent for the treatment of a cancer patient receiving an immune checkpoint modulator containing a peptide having 4 linked epitopes. The antitumor agent has the dosage form described above.

This invention also relates to an antitumor agent for the treatment of a cancer patient receiving a peptide having 4 linked epitopes comprising an immune checkpoint modulator. The antitumor agent has the dosage form described above.

“Treatment” includes postoperative adjuvant chemotherapy, which is given to prevent recurrence after surgical removal of the tumor, and preoperative adjuvant chemotherapy, which is given in advance of surgical removal of the tumor.

This invention also relates to an antitumor agent comprising a peptide having 4 linked epitopes, wherein the peptide having 4 linked epitopes is used in combination with an immune checkpoint modulator for a cancer patient. The antitumor agent has the dosage form described above.

This invention also relates to an antitumor agent containing an immune checkpoint modulator, wherein the immune checkpoint modulator is used in combination with a peptide having 4 related epitopes for a cancer patient. The antitumor agent has the dosage form described above.

The present invention also relates to a kit composition containing an antitumor agent containing a peptide having 4 linked epitopes, and instructions for use, which indicate that the peptide having 4 linked epitopes and an immune checkpoint modulator are administered together to a cancer patient.

In this context, the “instructions for use” describe the amounts to be administered and the preferred recommended doses as described above, with or without legal binding. Specific examples of these include package inserts and brochures. In a kit containing instructions for use, the instructions for use may be printed and/or affixed to the kit composition package, or the instructions for use may be included with the antineoplastic agent in the kit composition package.

Meanwhile, the group of authors of this invention, et al. established a technique for expressing an artificial chimeric gene of human or non-human β2 microglobulin, α1 and α2 HLA class I regions, and human or non-human α3 MHC class region linked to each other in non-human animals, and subsequently producing a non-human animal expressing HLA class I (International Publication No. WO 2015/056774).

The use of a non-human animal as described above makes it possible to restore human immune responses in non-human animals. More specifically, antigen presenting cells in a non-human animal express the α1 and α2 regions of HLA class I and therefore can present an epitope peptide of a human tumor antigen capable of binding thereto.

The present inventors have further discovered that the effect of a peptide having 4 linked epitopes on CTL induction can be assessed through co-expression of human HLA-A24 and a human tumor antigen epitope peptide derived from SART2. For example, a tumor representing a human tumor antigen epitope peptide derived from SART2 is grown by coexpressing human HLA-A24 and a human tumor antigen epitope peptide derived from SART2 on cultured cells derived from a murine tumor, and transplanting the cultured cells into a non-human animal. described above.

More specifically, the present invention provides a cell into which a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 and a polynucleotide encoding, in particular, the α1 and α2 regions of human HLA-A24 are introduced. In this context, the human tumor antigen epitope peptide derived from SART2 preferably contains PEP5. Thus, a polynucleotide encoding PEP5 is preferably introduced into a cell.

The inventors of the present invention successfully engrafted tumors co-expressing HLA-A24 and PEP5 into the non-human animal described above and demonstrated that this system allows the evaluation of the antitumor agent of the present invention, etc.

Therefore, the present invention relates to a cell into which a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 and a polynucleotide encoding the α1 and α2 regions of human HLA-A24 are introduced (hereinafter referred to as “the cell of the present invention”).

SART2 is one of the proteins described as highly expressed in tumor tissues, as described above. Examples of a human tumor antigen epitope peptide derived from SART2 that can be presented through binding to an HLA molecule like HLA-A24 in antigen presenting cells such as dendritic cells include PEP5, described above. The amino acid sequence of the PEP5 peptide is shown in SEQ ID NO: 5, and the polynucleotide sequence encoding the PEP5 peptide is shown in SEQ ID NO: 29.

"A polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2" as used herein is preferably a polynucleotide selected from the following polynucleotides (a) to (e):

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 5;

(b) a polynucleotide encoding a polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 5;

(c) a polynucleotide encoding a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 5;

(d) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 29; And

(e) a polynucleotide containing a nucleotide sequence having 90% or more identity to the nucleotide sequence shown in SEQ ID NO: 29;

more preferably, the polynucleotide is selected from the following polynucleotides (a)-(e):

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 5;

(b) a polynucleotide encoding a polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 5 (where the addition of amino acids is limited to addition from the N-terminus);

(c) a polynucleotide encoding a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 5;

(d) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 29; And

(e) a polynucleotide containing a nucleotide sequence having 90% or more identity to the nucleotide sequence shown in SEQ ID NO: 29;

and more preferably, a polynucleotide selected from polynucleotides (a) and (d).

"A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 5" herein may further comprise an added signal sequence. Preferably, the "polypeptide comprising the amino acid sequence shown in SEQ ID NO: 5" is a polypeptide having a signal sequence of 10-30 amino acids, more preferably a signal sequence of 15-25 amino acids is added at the N-terminus of the amino acid sequence shown in SEQ ID NO: 5, and more preferably, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 32.

Also, "a polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 5" herein may further comprise an added signal sequence. Preferably, the polypeptide is a polypeptide having a signal sequence of 10-30 amino acids, more preferably, a signal sequence of 15-25 amino acids is added at the N-terminus of the amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence, shown in SEQ ID NO: 5, and more preferably, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 32.

Also, "a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 5" herein may further comprise an added signal sequence. Preferably, the polypeptide is a polypeptide having a signal sequence of 10-30 amino acids, more preferably a signal sequence of 15-25 amino acids, added at the N-terminus of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 5, and more preferably, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 32.

Also, a “polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 29” herein may further comprise an added nucleotide sequence encoding a signal sequence. Preferably, the polynucleotide is a polynucleotide having 30-90 nucleotides encoding a signal sequence, more preferably 45-75 nucleotides encoding a signal sequence added at the 5' end of the nucleotide sequence shown in SEQ ID NO: 29, and more preferably, a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 33.

Also, a “polynucleotide comprising a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 29” herein may further comprise an added nucleotide sequence encoding a signal sequence. Preferably, the polynucleotide is a polynucleotide having 30-90 nucleotides encoding a signal sequence, more preferably 45-75 nucleotides encoding a signal sequence added at the 5' end of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 29, and more preferably, a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 33.

In one aspect of the present invention, the "polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2" may preferably be a polynucleotide selected from the following polynucleotides (k)-(o):

(k) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 32;

(l) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 32;

(m) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 32;

(n) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 33; And

(o) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 33

more preferably, the polynucleotide is selected from the following polynucleotides (k)-(o):

(k) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 32;

(l) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 32 (where the addition of amino acids is limited to addition from the N-terminus);

(m) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 32;

(n) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 33; And

(o) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 33

and more preferably, the polynucleotide is selected from polynucleotides (k) and (n).

Preferably, the "human tumor antigen epitope peptide derived from SART2" can be recognized by CTLs specific to the amino acid sequence shown in SEQ ID NO: 5.

In this context, whether or not an epitope peptide "can be recognized by a CTL specific for the amino acid sequence shown in SEQ ID NO: 5" can be confirmed, for example, by a ⁵¹ Cr release assay, ELISA (eg, measuring IFN-γ) or ELISPOT assay (e.g., measuring IFN-γ) using a cell of the present invention and CTLs specific for the amino acid sequence shown in SEQ ID NO: 5.

The “polynucleotide encoding the α1 and α2 regions of human HLA-A24” herein may preferably be a polynucleotide selected from the following polynucleotides (f) to (j):

(f) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 30;

(g) a polynucleotide encoding a polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 30;

(h) a polynucleotide encoding a polypeptide having an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 30;

(i) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 31; And

(j) a polynucleotide containing a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 31

and more preferably, a polynucleotide selected from polynucleotides (f) and (i).

"The polypeptide comprising the amino acid sequence shown in SEQ ID NO: 30" herein may preferably be a polypeptide comprising a β2 microglobulin added at the N-terminus and an α3 MHC class I region added at the C-terminus of the amino acid sequence, shown in SEQ ID NO: 30, and more preferably, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34.

"A polypeptide having an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 30" here, preferably, may be a polypeptide containing β2 microglobulin added at the N-terminus, and α3 an MHC class I region added at the C-terminus of an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 30, and more preferably, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34.

"A polypeptide containing an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 30" here, preferably, may be a polypeptide containing a β2 microglobulin added at the N-terminus, and an α3 region of MHC class I , added at the C-terminus of an amino acid sequence having 90% or more identity to the amino acid sequence shown in SEQ ID NO: 30, and more preferably, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34.

The "polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 31" herein may preferably be a polynucleotide comprising a β2 microglobulin encoding nucleotide sequence added at the 5' end and an α3 MHC class I region encoding nucleotide sequence added at the 3 end '-end of the nucleotide sequence shown in SEQ ID NO: 31, and more preferably, a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 35.

"A polynucleotide comprising a nucleotide sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 31" herein may preferably be a polynucleotide containing a β2 microglobulin encoding nucleotide sequence added at the 5' end and an α3 encoding region MHC class I nucleotide sequence added at the 3' end of a nucleotide sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 31, and more preferably, a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO : 35.

"β2 microglobulin" here refers to the protein constituting the β chain of the MHC class I molecule. "β2 microglobulin" herein can be obtained from a human or any non-human animal (mouse, rat, hamster, guinea pig, rabbit, pig, cow, sheep etc.) and is preferably human β2 microglobulin (herein also called "hβ2M").

"Human β2 microglobulin" herein may be a polynucleotide selected from the following polynucleotides (i) to (iii):

(i) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 36;

(ii) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 36, and has antigen presenting ability specific for MHC class I through complexation with α chain of MHC class I; And

(iii) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has 90% or more identity with the amino acid sequence shown in SEQ ID NO: 36 and has antigen presenting ability specific for MHC class I through formation of a complex with the α chain of MHC class I ;

and is preferably a polynucleotide (i).

“MHC class I α3 region” here refers to the α3 region involved in binding to the CD8 coreceptor molecule expressed on the surface of the CTL and the transmembrane region and intracellular region located at the C-terminus. "MHC class I α3 region" herein may be obtained from a human or any non-human animal (mouse, rat, hamster, guinea pig, rabbit, pig, cow, sheep, etc.) and is preferably a murine α3 region MHC class I (here also called "mα3").

"Mouse α3 MHC class I region" herein may be a polynucleotide selected from the following polynucleotides (iv)-(vi):

(iv) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 37;

(v) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 37, and has the ability to bind to the CD8 molecule; And

(vi) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has 90% or more identity with the amino acid sequence shown in SEQ ID NO: 37 and has the ability to bind to the CD8 molecule;

and preferably the polynucleotide is (iv).

In one aspect of the present invention, the “polynucleotide encoding the α1 and α2 regions of human HLA-A24” herein may preferably be a polynucleotide selected from the following polynucleotides (p)-(t):

(p) a polynucleotide encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 34;

(q) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having a substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 34;

(r) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 34;

(s) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 35; And

(t) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 35;

and more preferably, a polynucleotide selected from polynucleotides (p) and (s).

Preferably, the α1 and α2 regions encoded by the “polynucleotide encoding the α1 and α2 regions of human HLA-A24” may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 as an antigen. Preferably, these regions may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 as an antigen, and have the ability to bind the CD8 molecule. Preferably, these regions may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 as an antigen and have the ability to bind the CD8 molecule, and β2 microglobulin, preferably has antigen presenting ability specific to MHC class I through formation of a complex with α chain of MHC class I.

The presence of these functions in a cell can be confirmed, for example, by a ⁵¹ Cr release assay, ELISA (eg, measuring IFN-γ), or an ELISPOT assay (eg, measuring IFN-γ) using a cell of the present invention and an amino acid sequence-specific CTL, shown in SEQ ID NO: 5.

Host cells for use in generating the cell of the present invention are preferably colonies of cells obtained from an animal and are capable of forming a tumor when transplanted into the animal. More preferably, the host cells are colonies of cells derived from mice that are capable of forming a tumor when transplanted into a mouse. The tumor formed by host cells is not limited and is preferably, for example, a solid tumor such as melanoma or lymphoma, since growth and regression, etc. tumors are easy to evaluate. The host cells are preferably B16F10 cells.

A vector for introducing a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 and a polynucleotide encoding the α1 and α2 regions of human HLA-A24 into a host cell for use in generating a cell of the present invention is not particularly limited as long as the vector is replicable in host cells. The vector can be suitably selected according to the type of host cell to be administered, the method of administration, etc. Examples thereof include plasmid DNA vectors and viral vectors. Examples of plasmid DNA vectors include pCMV6 (OriGene Technologies, Inc.), piggyBac Transposon Vector (System Biosciences, LLC.), pCAG (FUJIFILM Wako Pure Chemical Corp.), and pcDNA3.1 (Thermo Fisher Scientific Inc.). Examples of viral vectors include pMX (Cell Biolabs, Inc.), pLVSIN (Takara Bio Inc.), pAAV (Takara Bio Inc.), and pAdenoX (Clontech Laboratories, Inc.).

The host cell can be transformed with the vector using lipofection, electroporation, or the like. The resulting transformant can be cultured under appropriate conditions using a medium containing a source of assimilable carbon, a source of nitrogen, a metal salt, a vitamin, etc.

Whether the cell is a cell into which a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 and a polynucleotide encoding the α1 and α2 regions of human HLA-A24 has been introduced can be confirmed, for example, by using methods for determining the expression of the polynucleotide encoding an epitope peptide of a human tumor antigen or encoded polypeptide, and a polynucleotide encoding the α1 and α2 regions of the human HLA-A24 or encoded polypeptide, and using expression as an index.

In the method for determining the expression of a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2, for example, a polypeptide that specifically hybridizes to the polynucleotide shown in SEQ ID NO: 29 or SEQ ID NO: 33, including a polynucleotide, may be used as a primer. encoding PEP5, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide shown in SEQ ID NO: 29 or SEQ ID NO: 33, and a well-known detection method such as Northern blotting, Southern blotting, RT-PCR can be used , real-time PCR, digital PCR, DNA chip technique, in situ hybridization or sequencing.

The method for determining the expression of a polynucleotide encoding the α1 and α2 regions of human HLA-A24 may use, as a primer, for example, a polypeptide that specifically hybridizes to the polynucleotide shown in SEQ ID NO: 31 or SEQ ID NO: 35, including the polynucleotide encoding amino acid sequences of the α1 and α2 regions of human HLA-A24, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide shown in SEQ ID NO: 31 or SEQ ID NO: 35, and a well-known detection method such as described above can be used.

Such a primer is prepared in a generally known manner, in the form of a polynucleotide that specifically hybridizes with the polynucleotide shown in SEQ ID NO: 29 or SEQ ID NO: 33, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide shown in SEQ ID NO: 29 or SEQ ID NO: 33. Also, such a primer is prepared in a generally known manner in the form of a polynucleotide that more specifically hybridizes with the polynucleotide shown in SEQ ID NO: 31 or SEQ ID NO: 35, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide shown in SEQ ID NO: 31 or SEQ ID NO: 35. The number of nucleotides in such a primer is 10-50 nucleotides, preferably 10-40 nucleotides, and more preferably 10-30 nucleotides.

The primer need not be completely complementary as long as the primer specifically hybridizes to a polynucleotide shown in SEQ ID NO: 29 or SEQ ID NO: 33, or a polynucleotide consisting of a nucleotide sequence complementary to a polynucleotide shown in SEQ ID NO: 29 or SEQ ID NO: 33, or a polynucleotide shown in SEQ ID NO: 31 or SEQ ID NO: 35, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide shown in SEQ ID NO: 31 or SEQ ID NO: 35. Such a primer is a polynucleotide having 70% or more, preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 98% or more identity with the corresponding nucleotide sequence, and most preferably fully complementary polynucleotide.

A primer for use in the method for determining the expression of a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 is preferably the primer shown in SEQ ID NO: 42 and SEQ ID NO: 43.

A commonly used detection method such as ELISA, Western blotting, flow cytometry or immunohistochemical staining, for example using an antibody that specifically binds to the polypeptide shown in SEQ ID NO: 5, can be used as a method for determining the expression of a polypeptide encoding an epitope human tumor antigen peptide derived from SART2. Flow cytometry is preferred. An antibody that specifically binds to the polypeptide shown in SEQ ID NO: 5 may be commercially available or may be prepared by a generally known method.

A method of detection commonly used, such as ELISA, Western blotting, flow cytometry or immunohistochemical staining, for example, using an antibody that specifically binds to the polypeptide shown in SEQ ID NO: 30 or SEQ ID NO: 34, including the α1 and α2 regions HLA-A24 can be used as a method for determining the expression of a polypeptide encoding the α1 and α2 regions of human HLA-A24. Flow cytometry is preferred. An antibody that specifically binds to the polypeptide shown in SEQ ID NO: 30 or SEQ ID NO: 34 may be commercially available or may be prepared by a generally known method. Examples of commercially available antibody include anti-human HLA-A,B,C antibody (Clone: W6/32, BioLegend, Inc.), anti-HLA-A24 (human) mAb (Clone: 22E1, MBL) and anti-HLA A antibody (Clone: EP1395Y, Abcam plc), where anti-human HLA-A, B, C antibody (Clone: W6/32, BioLegend, Inc.) is preferred. If such an antibody is, for example, an anti-human HLA-A, B, C antibody (Clone: W6/32, BioLegend, Inc.), its labeled form, such as a PE-labeled form, PE anti-human HLA-A, B,C antibody (Clone: W6/32, BioLegend, Inc.) or FITC-labeled form, FITC anti-human HLA-A, B,C antibody (Clone: W6/32, BioLegend, Inc.) are also included in the anti -human HLA-A, B, C antibody (Clone: W6/32, BioLegend, Inc.).

For in vivo evaluation, it is preferable that the cell of the present invention can form a tumor in a non-immunodeficient non-human animal when transplanted into a non-immunodeficient non-human animal, and should not regress spontaneously. It can be confirmed that the cell is not capable of spontaneous regression by subcutaneously transplanting the cell of the present invention, for example, into a mouse with a knockout of the human HLA-A24 gene (International Publication No. WO 2015/056774) and measuring the size of the tumor. Preferably, tumor size does not decrease (tumor size increases) for at least 20 days or longer after transplantation of a cell of the present invention into a non-immunodeficient non-human animal. If the absence of regression of the transplanted cells (increase in tumor size) is confirmed in the non-drug group (control group) during the in vivo testing period, the cells can be included in the cell of the present invention even if the period without spontaneous regression is shorter than 20 days.

In the present invention, the term "non-immunodeficient" in reference to a non-immunodeficient non-human animal refers to an animal having an innate immune system or a modified immune system. Thus, such non-immunodeficient animals exclude immunodeficient animals such as hairless mice. "Non-human animal" is not particularly limited as long as the animal has β2 microglobulin loci and a foreign gene can be introduced therein. A rodent is preferred, and a mouse is more preferred. The mouse is particularly preferred from the point of view of breeding and experimental use.

The present invention also provides a cell of the present invention for evaluating the antitumor effect of a human tumor antigen epitope peptide derived from SART2.

The present invention also provides a cell of the present invention for evaluating the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator.

The present invention also provides a method for assessing the antitumor effect of a human tumor antigen epitope peptide derived from SART2 using a cell of the present invention. The method is preferably carried out using a non-immunodeficient non-human animal with a knockin of the human HLA-A24 gene into which a cell of the present invention is transplanted. In this context, a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene may be a non-immuno-deficient non-human animal having the α1 and α2 regions of human HLA-A24 and, preferably, a mouse with a knock-in of the human HLA-A24 gene (B2m ^{tm2 (HLA-A24/H-2Db/B2M) Tai} mouse), described in International Publication No. WO 2015/056774.

In this method, the number of transplanted cells of the present invention can be suitably selected, and preferably it is 1 × 10 ⁵ -1 × 10 ⁷ cells/body, more preferably 1 × 10 ⁵ -5 × 10 ⁵ cells/body, or more preferably 5 × 10 ⁵ cells/body, per human HLA-A24 gene knockin mouse (B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mouse). In the method, the amount of human tumor antigen epitope peptide derived from SART2 administered per dose can be suitably selected and is preferably 10-1000 μg/body, more preferably 100-1000 μg/body, and more preferably 300 μg/body. body, into a mouse with a knockin of the human HLA-A24 gene (B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mouse).

Evaluation of the antitumor effect of human tumor antigen epitope peptides derived from SART2 using a cell of the present invention can be carried out by a method comprising the following steps.

More specifically, the method may be carried out in a manner comprising the steps of:

(I) administering a human tumor antigen epitope peptide derived from SART2 to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And

(ii) transplanting a cell of the present invention into a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene.

Preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a human tumor antigen epitope peptide derived from SART2 into a human HLA-A24 gene knockin mouse; And

(II) the step of transplanting a cell according to the present invention into a mouse with a knockin of the human HLA-A24 gene.

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing, twice or more, an epitope peptide of a human tumor antigen derived from SART2 to a human HLA-A24 gene knockin mouse; And

(II) the step of transplanting the cell of the present invention into a mouse with the human HLA-A24 gene knockin after step (I).

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing, three times or more, an epitope peptide of a human tumor antigen derived from SART2, a human HLA-A24 gene knockin mouse; And

(II) the step of transplanting the cell of the present invention into a mouse with the human HLA-A24 gene knockin after step (I).

The present invention also relates to a method for assessing the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator using a cell of the present invention. The method is preferably carried out using a non-immunodeficient non-human animal with a knockin of the human HLA-A24 gene into which a cell of the present invention is transplanted. In this context, the non-immunodeficient non-human animal having the human HLA-A24 gene knockin may be a non-immunodeficient non-human animal having the α1 and α2 regions of human HLA-A24, and is preferably a human HLA-A24 gene knock-in mouse (B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mouse), described in International Publication No. WO 2015/056774.

In this method, the transplantable number of cells of the present invention can be suitably selected, and is preferably 1 x 10 ⁵ -1 x 10 ⁷ cells/body, more preferably 1 x 10 ⁵ -5 x 10 ⁵ cells/body, and more preferably , 5 × 10 ⁵ cells/body, for a mouse with a knockin of the human HLA-A24 gene (B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mouse). In the method, the amount of peptide having 4 linked epitopes administered per dose can be suitably selected, and is preferably 10-1000 μg/body, more preferably 100-1000 μg/body, and more preferably 300 μg/body, for mice with knockin of the human HLA-A24 gene (B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mice). In the method, the amount of immune checkpoint modulator administered per dose can be suitably selected, and is preferably 10-1000 μg/body, more preferably 30-500 μg/body, and more preferably 50-200 μg/body, per mouse with knockin of the human HLA-A24 gene (B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mouse).

A method for assessing the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator using a cell of the present invention may comprise the following steps.

More specifically, the method may be carried out in a manner comprising the steps of:

(I) administering a peptide having 4 linked epitopes and/or an immune checkpoint modulator to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And

(ii) transplanting a cell of the present invention into a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene.

Preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a peptide having 4 linked epitopes and/or a mouse immune checkpoint modulator with a human HLA-A24 gene knockin; And

(II) the step of transplanting a cell according to the present invention into a mouse with a knockin of the human HLA-A24 gene.

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing twice or more times a peptide having 4 mouse epitopes linked to the human HLA-A24 gene knockin; And

(II) the step of transplanting the cell of the present invention into a mouse with the human HLA-A24 gene knockin after step (I).

More preferably, the method is a method comprising the following steps (I) and (III):

(I) the step of introducing three times or more times a peptide having 4 mouse epitopes linked to the human HLA-A24 gene knockin;

(II) a step of transplanting a cell of the present invention into a mouse with a knockin of the human HLA-A24 gene after step (I); And

(III) the step of introducing a human HLA-A24 gene knockin mouse immune checkpoint modulator after step (I).

In the method of the present invention, the evaluation of the antitumor effect of a peptide having 4 linked epitopes can be carried out by a method including the following steps.

More specifically, the method may be carried out in a manner comprising the steps of:

(I) administering a peptide having 4 linked epitopes to a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene; And

(ii) transplanting a cell of the present invention into a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene.

Preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a peptide having 4 linked epitopes into a human HLA-A24 gene knockin mouse; And

(II) the step of transplanting a cell according to the present invention into a mouse with a knockin of the human HLA-A24 gene.

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a peptide having 4 linked epitopes into a human HLA-A24 gene knockin mouse twice or more times; And

(II) the step of transplanting the cell of the present invention into a mouse with the human HLA-A24 gene knockin after step (I).

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a peptide having 4 linked epitopes into a human HLA-A24 gene knockin mouse three times or more; And

(II) the step of transplanting the cell of the present invention into a mouse with the human HLA-A24 gene knockin after step (I).

In the present invention, the evaluation of the antitumor effect of the immune checkpoint modulator can be carried out by a method comprising the following steps.

More specifically, the method may be carried out in a manner comprising the steps of:

(I) administering an immune checkpoint modulator to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And

(ii) transplanting a cell of the present invention into a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene.

Preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a human HLA-A24 gene knockin mouse immune checkpoint modulator; And

(II) the step of transplanting a cell according to the present invention into a mouse with a knockin of the human HLA-A24 gene.

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a human HLA-A24 gene knockin mouse immune checkpoint modulator; And

(II) the stage of transplanting a cell according to the present invention into a mouse with a knockin of the human HLA-A24 gene on the day of stage (I).

In the present invention, evaluation of the antitumor effect of a peptide having 4 linked epitopes and an immune checkpoint modulator can be carried out by a method comprising the following steps.

More specifically, the method may be carried out in a manner comprising the steps of:

(I) administering a peptide having 4 linked epitopes and an immune checkpoint modulator to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And

(ii) transplanting a cell of the present invention into a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene.

Preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a peptide having 4 associated epitopes of a mouse immune checkpoint modulator with a knockin of the human HLA-A24 gene; And

(II) the step of transplanting a cell according to the present invention into a mouse with a knockin of the human HLA-A24 gene.

More preferably, the method is a method comprising the following steps (I) and (II):

(I) the step of introducing a peptide having 4 linked epitopes into a human HLA-A24 gene knockin mouse twice or more times; And

(II) the step of transplanting the cell of the present invention into a mouse with the human HLA-A24 gene knockin after step (I).

More preferably, the method is a method comprising the following steps (I) and (III):

(I) the step of introducing a peptide having 4 linked epitopes into a human HLA-A24 gene knockin mouse three times or more;

(II) a step of transplanting a cell of the present invention into a mouse with a knockin of the human HLA-A24 gene after step (I); and

(III) the step of introducing a human HLA-A24 gene knockin mouse immune checkpoint modulator after step (I).

The method of the present invention described above may comprise the step of evaluating the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator after the steps described above. The antitumor effect can be assessed using, for example, tumor growth inhibition of transplanted cells in the animal, tumor regression and disappearance, or increase in survival rate as an indicator.

“Antitumor effect of a human tumor antigen epitope peptide derived from SART2” and “antitumor effect of a peptide having 4 linked epitopes” can be assessed, for example, using a human HLA-A24 gene knockin mouse subcutaneously injected three times with a human tumor antigen epitope peptide , derived from SART2, or a peptide having 4 linked epitopes, in a mouse, followed by subcutaneous transplantation of a cell of the present invention into a mouse, and measurement of tumor size to confirm whether antitumor effect is demonstrated or not.

The “antitumor effect of an immune checkpoint modulator” can be assessed, for example, by using a human HLA-A24 gene knockin mouse, intravenously or intraperitoneally administering the immune checkpoint modulator to the mouse on the day of cell transplantation of the present invention, and measuring the size of the tumor to confirm that whether antitumor effect is demonstrated or not.

Examples

Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is in no way limited to these examples. Various changes or modifications can be made by those skilled in the art without deviating from the technical concept of the present invention.

For ease of understanding of the present invention, SEQ ID Nos: 29-43 described herein are explained in Table 3 below.

[Table 3]

Nucleotide sequence of SART2-93 SEQ ID NO: 29 Amino acid sequence of HLA-A24 α1 and α2 regions SEQ ID NO: 30 Nucleotide sequence of HLA-A24 α1 and α2 regions SEQ ID NO: 31 Amino acid sequence of signal sequence+SART2-93 SEQ ID NO: 32 Nucleotide sequence of signal sequence+SART2-93 SEQ ID NO: 33 Amino acid sequence of hβ2M - HLA-A24 α1 and α2 regions - mα3 SEQ ID NO: 34 Nucleotide sequence of hβ2M - HLA-A24 α1 and α2 regions - mα3 SEQ ID NO: 35 Amino acid sequence of human β2 microglobulin (excluding signal sequence) SEQ ID NO: 36 Amino acid sequence of the α3 region of mouse MHC class I SEQ ID NO: 37 Sense primer for hβ2M amplification - HLA-A24 α1+α2 - mα3 SEQ ID NO: 38 Antisense primer for amplification of hβ2M - HLA-A24 α1+α2 - mα3 SEQ ID NO: 39 Antisense primer for signal sequence insertion+SART2-93 SEQ ID NO: 40 Sense primer for signal sequence insertion+SART2-93 SEQ ID NO: 41 Sense primer for signal sequence deletion+SART2-93 SEQ ID NO: 42 Antisense primer for signal sequence deletion+SART2-93 SEQ ID NO: 43

[Example 1: Peptide synthesis and purification]

Peptides TPV07 and TPV08, having 4 linked epitopes, were synthesized using a Prelude automated peptide synthesizer (Protein Technologies, Inc.) using a solid-phase synthesis method based on the 9-fluorenylmethyloxycarbonyl (Fmoc) method. More specifically, an amino acid in which the α-amino group is protected by an Fmoc group and the side chain functional group is protected by a general protecting group is condensed in a Wang-ChemMatrix resin under 1-(mesitylene-2-sulfonyl)-3-nitro-1,2,4 conditions -triazole/N-methylmimidazole/dichloromethane to complete the fixation of the C-terminal amino acid to the resin. A deblocking solution (20% piperidine/N,N-dimethylformamide (DMF)) is injected there to remove the Fmoc group. Then the amino acid, in which the α-amino group is protected by the Fmoc group and the side chain functional group is protected by a general protecting group, is condensed there under the conditions of 1-[bis(dimethylamino)methylene]-5-chloro-1H-benzotriazolium hexafluorophosphate 3-oxide (HCTU)/ N-methylmorpholine (NMM)/DMF for dipeptide synthesis. By repeating the procedure of deprotecting the Fmoc group with a deblocking solution and condensing the amino acid under HCTU/NMM/DMF conditions, peptides containing the sequences of interest are synthesized. After completion of the synthesis of the protected peptide resin, deprotection of the peptide side chains and exclusion of free peptides from the resin is carried out by reaction for 4 hours in a deprotection solution (2.5% triisopropylsilane, 2.5% water, 2.5% 1. 2-ethanedithiol, 92.5% trifluoroacetic acid) added to the protected peptide resin. The resin is filtered, and the peptides are reduced to precipitates by adding the resulting filtrate to cold ether. The obtained different synthetic peptides were purified using a Proteonavi column (Shiseido Japan Co., Ltd.) and a solvent system of an aqueous solution of 0.1% TFA and acetonitrile. After the final purification step, the purity of the peptides was confirmed using a CAPCELL PAK UG120 column (Shiseido Japan Co., Ltd.) and an HPLC system (Hitachi, Ltd.). The molecular weight was also confirmed on an ESI-MS system (Synapt HDMS, Waters Corp.). The peptides are lyophilized, stored at a cool temperature in the dark and then subjected to the examples described below.

Table 4 shows the molecular weight of TPV07 and TPV08 measured by mass spectrometry (MS). Figures 1-4 show the HPLC chromatograms and mass spectra of TPV07 and TPV08.

[Table 4]

Peptide Molecular weight (calculated) Molecular weight (after deconvolution) TPV07 5396.03 5395.20 TPV08 5682.41 5682.00

TPV01 - TPV06, TPV09 and TPV10 can be synthesized according to the method described in, for example, international publication No. WO 2015/060235, or can be synthesized using a method similar to the method of TPV07 and TPV08, as described above. All peptides are obtained with a purity of 90% or greater.

[Example 2. Introduction of a colony of B16F10.A24/SART2 ^93-101 cells and a colony of EL4.A24/SART2 ^93-101 cells]

B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mice are obtained by the method described in example 8 of international publication No. WO 2015/056774. This mouse can express an artificial chemical protein containing human β2 microglobulin, α1 and α2 regions of HLA-A24 and α3 region of mouse MHC class I linked to each other.

The spleen was collected from the resulting mouse, tightly sealed on a glass slide, and then hemolyzed using BD Pharm Lyse (BD Bioscience) to obtain a single cell suspension. RNA was extracted from the resulting single cell suspension using the RNeasy kit (Qiagen NV). More specifically, after adding 350 μl of buffer RLT to 1×10 ⁶ cells, the mixture is added to a QIAshredder spin column (Qiagen NV) and centrifuged (15,000 rpm, 2 min), and the flow-through fraction is recovered. After adding 350 μl of an aqueous solution of 70% ethanol to the reconstituted RNA solution, the mixture is added to an RNeasy Mini column and centrifuged (10,000 rpm, 15 sec). The column is then washed with 350 μl of RW1 buffer and then treated with DNase using the RNase-Free DNase kit (Qiagen NV). The column is washed with 350 μl of RW1 buffer, then the RNA is purified using the RNeasy Mini Kit protocol. 30 μl of RNase-free H ₂ O is added to the purified RNA to restore total RNA.

cDNA was synthesized from the resulting total RNA using the Superscript III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific Inc.). More specifically, 2 μg of total RNA was suspended in 8 μl of purified water. 1 μl of oligo (dT) ₂₀ and 1 μl of 10 mM dNTP are added to the suspension and the mixture is incubated at 65°C for 5 minutes. After cooling for 2 minutes on ice, add 2 μl of 10 × RT buffer, 1 μl of 25 mM MgCl ₂ , 2 μl of 0.1 M DTT, 1 μl of RNaseOUT (40 U/μl) and 1 μl of SuperScript III RT and mix . The mixture is incubated at 50°C for 50 minutes and then treated at 85°C for 5 minutes to complete the reaction.

The polynucleotide encoding the artificial chimeric protein described above, having the sequence shown in SEQ ID NO: 35, is obtained by performing PCR (94°C for 2 min → 30 cycles, each including 94°C for 30 sec, 55°C for for 30 sec and 68°C for 2 min → 68°C for 2 min → 4°C) using the synthesized cDNA as template, primer 1 (TCAAGCTTAACTAGCATGGCCGTCATGGC: SEQ ID NO: 38) as sense primer, primer 2 (TTAAACCTCGAGTGCTCACGCTTTACAATCTCGGAGAGA: SEQ ID NO: 39) as an antisense primer and KOD-Plus-ver. 2 (Toyobo Co., Ltd.). The amplified polynucleotide is inserted into a PiggyBac Transposon Vector (System Biosciences, LLC.) using the InFusion HD Cloning Kit (Clontech Laboratories, Inc.) to obtain plasmid vector A having the sequence SEQ ID NO: 35.

Then, to obtain the polynucleotide encoding PEP5, PCR is performed (25 cycles, each including 98°C for 10 sec, 55°C for 15 sec and 68°C for 6 min → 68°C for 3 min → 4 °C) using plasmid vector A having the sequence SEQ ID NO: 35 to obtain the template, primer 3 (CTCAAATTTCATTCCAGCGGGCACTGTAGTCTGCCCAGGTCTGGGT: SEQ ID NO: 40) as the antisense primer, primer 4 (GCAGACTACAGTGCCCGCTGGAATGAAATTTGAGCACTCGAGGTTTAA: SEQ ID NO: 41) as sense primer and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.). The result is a plasmid vector B having the nucleotide sequence shown in SEQ ID NO: 33, including the nucleotide sequence encoding the signal sequence and PEP5 in the PiggyBac Transposon Vector.

The thus obtained plasmid vectors A and B, together with the PiggyBac Transposase Expression Vector (System Biosciences, LLC.), are introduced into a colony of B16F10 murine melanoma cells (American Type Culture Collection, ATCC) using Lipofectamine LTX Reagent with PLUS Reagent ( Thermo Fisher Scientific Inc.). Single clone cells are prepared from cells thus transfected using a limiting dilution technique.

Plasmid vectors A and B prepared as described above and the Super PiggyBac Transposase Expression Vector (System Biosciences, LLC.) were also introduced into a murine EL4 lymphoma cell colony (ATCC) using the Cell line Nucleofector Kit L (Lonza Group AG). and Nucleofector Device (Lonza Group AG). Single clone cells are prepared from cells transfected in this manner using a limiting dilution technique.

The resulting single clone cells were recovered and RNA was extracted from them using the RNeasy kit (Qiagen NV). More specifically, after adding 350 μl of buffer RLT to 5x10 ⁵ cells, the mixtures are added to a QIAshredder spin column (Qiagen NV) and centrifuged (15,000 rpm, 2 min), and the flow-through fraction is recovered. After adding 350 μl of an aqueous solution of 70% ethanol to the reconstituted ONC solution, the mixture was added to an RNeasy Mini column and centrifuged (10,000 rpm, 15 sec). The column is washed with an additional 350 μl of RW1 buffer and then treated with the RNase-Free DNase kit (Qiagen NV). The column is washed with 350 μl of RW1 buffer, then RNA purification is carried out according to the RNeasy Mini Kit protocol. 30 μl of RNase-free H ₂ O is added to the thus purified RNA to restore the total RNA.

cDNA was synthesized from the resulting RNA using the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific Inc.). More specifically, 2 μg of total RNA was suspended in 14 μl of DPEC-treated water and mixed with 4 μl of 5× VILO Reaction Mix and 2 μl of 10× SuperScript Enzyme Mix. The mixture is incubated at 25°C for 10 minutes and at 42°C for 60 minutes and then treated at 85°C for 5 minutes to complete the reaction.

To confirm the expression of the polynucleotide encoding PEP5 in the resulting cells with one clone, PCR is performed (94°C for 2 min → 30 cycles, including 98°C for 10 sec, 55°C for 30 sec and 68°C for 30 sec → 68°C for 1 min → 4°C) using the synthesized cDNA as a template, primer 5 (ATGGCCGTCATGGC: SEQ ID NO: 42) as a sense primer, primer 6 (TCAAATTTCATTCCAGCG: SEQ ID NO: 43) as an antisense primer and KOD-Plus-ver. 2 (Toyobo Co., Ltd.), and the amplification of the polynucleotide sequence shown in SEQ ID NO: 33 was confirmed by agarose gel electrophoresis. Amplification of a polynucleotide having the sequence shown in SEQ ID NO: 33 cannot be confirmed in B16F10 and EL4 cells without gene insertion, and amplification of a polynucleotide having the sequence shown in SEQ ID NO: 33 cannot be confirmed in the resulting individual clones . Thus, it was confirmed that PEP5-expressing cells were generated by insertion of plasmid vector B.

To analyze the expression of the HLA molecule in the resulting single clone cells, fledglings are stained with PE Anti-Human HLA-A, B, C Antibody (Clone: W6/32, BioLegend, Inc.). Stained cells were analyzed using BD FACSVerse (BD Biosciences). As a result, the increase in fluorescence intensity caused by antibody staining cannot be confirmed in B16F10 and EL4 cells without gene insertion, but the increase in fluorescence intensity caused by antibody staining can be confirmed in the resulting individual clones. It was thus confirmed that HLA-A24-expressing cells were obtained by inserting the plasmid vector A.

More specifically, the resulting cells were confirmed to be HLA-A24 expressing cells and also expressing PEP5 (B16F10.A24/SART2 ^93-101 cells and EL4.A24/SART2 ^93-101 cells).

[Example 3. Confirmation of engraftment of B16F10.A24/SART2 ^93-101 cell colony and cell colony]

The B16F10.A24/SART2 ^93-101 cell colony and the EL4.A24/SART2 ^93-101 cell colony obtained in Example 2 were cultured using Dulbecco's modified Eagle's medium (Sigma-Aldrich Co. LLC.) containing 10% FBS. For passages, cells are subcultured at a ratio of 1:25-1:40 twice a week at 37°C in a 5% CO ₂ incubator.

A colony of B16F10.A24/SART2 ^93-101 cells and a colony of EL4.A24/SART2 ^93-101 cells were transplanted subcutaneously in an amount of 1×10 ⁵ cells/0.1 ml into the right lateral region of each of 9-11 week old B2m ^{tm2 mice ( HLA-A24/H-2Db/B2M)Tai} .

Tumor long axes and short axes are measured using Digimatic calipers starting 7 days after transplantation, and tumor volume (TV) is calculated using the following formula.

OO (mm ³ ) = Long axles (mm) × Short axles (mm) × Short axles (mm) / 2

The results are shown in Figure 5.

As shown in Figure 5a, upon colony transplantation of EL4.A24/SART2 ^93-101 cells, although transient engraftment (growth) was found in some mice, spontaneous regression was confirmed on day 13 in all mice (five). On the other hand, as shown in Figure 5b, when transplanting a colony of B16F10.A24/SART2 ^93-101 cells, tumor engraftment without spontaneous regression was confirmed in all ten mice even 20 days after conversion. More specifically, only the B16F10.A24/SART2 ^93-101 cell colony was confirmed to be applicable in in vivo tests.

[Example 4. Effect of TPV06 and anti-mouse PD-1 antibody used in combination in a subcutaneously transplanted B16F10.A24/SART2 ^93-101 cell colony model]

8-week-old B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai mice} were randomly divided into groups of 15 animals each. The day of division into groups is defined as day 0.

A 6 mg/ml peptide solution is prepared by dissolving the 4-epitope-linked peptide TPV06 in distilled water (Otsuka Pharmaceutical Factory Inc.) and filled into a Braun Injekt syringe B (B. Braun Melsungen AG). After filling an equivalent amount of Montanide ISA 51 VG (SEPPIC) into another syringe, these syringes are connected to each other through a connector and the peptide solution is thoroughly mixed with Montanide ISA 51 VG to form an emulsion. Also, an emulsion of distilled water mixed with an equivalent amount of Montanide ISA 51 VG is prepared as a vehicle control. Each of these emulsions is administered subcutaneously weekly in quantities of 100 μl each near the base of the tail of each B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai} mouse, for a total of three administrations (days 0, 7 and 14).

GoInVivo purified anti-mouse CD279 (PD-1) (Clone: RMP-1-14, BioLegend, Inc.) is prepared as an anti-mouse PD-1 antibody (anti-mPD-1 Ab) at 1 mg/ml with using D-PBS (FUJIFILM Wako Pure Chemical Corp.) immediately after administration. One week after the final administration of the emulsions (day 21), anti-mouse PD-1 antibody was administered intraperitoneally at a dose of 100 μg/body.

A colony of B16F10.A24/SART2 ^93-101 cells was cultured using Dulbecco's modified Eagle's medium (Sigma-Aldrich Co. LLC.) containing 10% FBS. B16F10.A24/SART2 ^93-101 is subcultured at a ratio of 1:25-1:40 twice a week at 37°C in a 5% CO ₂ incubator.

On the same day (day 21) after administration of anti-mouse PD-1 antibody, a cell suspension prepared using D-PBS (FUJIFILM Wako Pure Chemical Corp.) was transplanted subcutaneously at a dose of 5 x 10 ⁵ cells/0.1 ml to the right side area of the mouse.

Tumor long axes and short axes are measured using Digimatic calipers starting 7 days after transplantation, and tumor volume (TV) is calculated using the following formula.

OO (mm ³ ) = Long axles (mm) × Short axles (mm) × Short axles (mm) / 2

As shown in Figure 6 (change in tumor volume after cell transplantation), both TPV06 and anti-mouse PD-1 antibody have tumor growth inhibitory effects when used alone compared with the control group, and when used in combination is even more significant. inhibits tumor growth.

Table 5 shows a summary of the results obtained 18 days after cell transplantation. In the table, the RR value represents the mean for each group. The rate of relative change in tumor volume (T/C) is calculated from the RR according to the following formula.

T/C (%) = (Average RR of each treatment group) / (Average RR of the control group) × 100

Body weight is measured using an electronic animal scale, and the rate of change of body weight (BMI) is calculated from body weight on day 0 (division day, BW0) and body weight 18 days after cell transplantation (BMT) using the following formula.

Rate of change in body weight BMI (%) = (MT - MT0) / MT0 × 100

The proportion of tumor-free mice (Tumor Free) 57 days after cell transplantation is calculated using the following formula.

Tumor free (%) = (Number of tumor free mice in each group) / (Number of mice per study in each group) × 100

[Table 5]

18 days after transplant 57 days after transplant OO (average±SD) T/C BMI(%) No tumor(%) Control 1183.14±205.04 - 28.3 0.0 TPV06 247.45±89.16 20.9 27.0 13.3 Anti-mPD-1 Ab 703.36±141.55 59.5 26.9 0.0 TPV06+Anti-mPD-1 Ab 71.45±46.72 6.0 23.8 53.3

At 18 days after cell transplantation, the TPV06 or anti-mouse PD-1 antibody alone group and the combined TPV06+anti-mouse PD-1 antibody group had a lower OR value than the control group, indicating an antitumor effect. In addition, the combined TPV06+anti-mouse PD-1 antibody group had a lower RR value than the TPV06 or anti-mouse PD-1 antibody groups alone, indicating a stronger antitumor effect. At 57 days after cell transplantation, 53.3% of mice in the TPV06+anti-mouse PD-1 antibody combined treatment group were tumor-free. In addition, the combined TPV06+anti-mouse PD-1 antibody group demonstrated improved survival 57 years after cell transplantation compared with the single drug group.

The rate of change in mean body weight in the combined administration group showed that no increase in toxicity was observed compared with the TPV06 or anti-mouse PD-1 antibody administration groups alone.

[Example 5. Effect of TPV06 and anti-mouse PD-L1 antibody used in combination in the B16F10.A24/SART2 ^93-101 SC cell colony transplant model]

9-week-old B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai mice} were randomly divided into groups of 15 animals each. The day of division into groups is defined as day 0.

This study was carried out as described in Example 4 except that anti-mouse PD-L1 antibody was used instead of anti-mouse PD-1 antibody. GoInVivo purified anti-mouse CD274 (B7-H1, PD-L1) (Clone: 10F.9G2, BioLegend, Inc.) is prepared as anti-mouse PD-L1 antibody (anti-mPD-L1 Ab) at 1 mg/ml using D-PBS (FUJIFILM Wako Pure Chemical Corp.) immediately before administration. One week after the final administration of the emulsions (day 21), anti-mouse PD-L1 antibody was administered intraperitoneally at a dose of 200 μg/body.

As shown in Figure 7 (change in tumor volume after cell transplantation), TPV06 has an inhibitory effect on tumor growth when administered alone compared with the control group, while the anti-mouse PD-L1 antibody is not effective. However, the use of TPV06 and anti-mouse PD-L1 antibody in combination inhibited tumor growth more significantly.

Table 6 below shows tumor volume, the rate of relative change in tumor volume and change in body weight (BMI) 18 days after cell transplantation, and the proportion of tumor-free mice 57 days after cell transplantation.

[Table 6]

18 days after transplant 57 days after transplant OO(average±SD) T/C BMI (%) No tumor(%) Control 627.2±82.7 - 19 0.0 TPV06
Anti-mPD-L1 Ab 205.8±73.9
987.4±168.9 32.8
157.4 21.9
21.2 0.0
0.0 TPV06 + Anti-mPD-L1 Ab 17.7±14.9 2.8 20.4 66.7

At 18 days after cell transplantation, the TPV06 alone group and the combined TPV06+anti-mouse PD-L1 antibody group had a lower OR value than the control group, indicating an antitumor effect. In addition, the combined TPV06+anti-mouse PD-L1 antibody group had a lower RR value than the TPV06 or anti-mouse PD-L1 antibody groups alone, indicating a stronger antitumor effect. At 57 days after cell transplantation, 66.7% of mice in the combined TPV06+anti-mouse PD-L1 antibody group were tumor-free. In addition, the TPV06+anti-mouse PD-L1 antibody combination group showed improved survival 57 years after cell transplantation compared with the single drug group.

The rate of change in mean body weight in the combined administration group showed that no increase in toxicity was observed compared with the TPV06 or anti-mouse PD-L1 antibody administration groups alone.

[Example 6. Effect of TPV07 or TPV08 and anti-mouse PD-1 antibody used in combination in the B16F10.A24/SART2 ^93-101 SC cell colony transplant model]

9-week-old B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai mice} were randomly divided into groups of 15 animals each. The day of division into groups is defined as day 0.

This study was carried out as in Example 4 except that TPV07 or TPV08 was used instead of TPV06 as the peptide having 4 linked epitopes. TPV07 and TPV08, like TPV06, are each prepared at 6 mg/ml using distilled water (Otsuka Pharmaceutical Factory Inc.) and then mixed with an equivalent amount of Montanide ISA 51 VG (SEPPIC) to form an emulsion, which is administered. This example does not include the anti-mouse PD-1 antibody only administration group.

Figures 8 and 9 show the change in tumor volume after cell transplantation. Table 7 shows tumor volume, the rate of relative change in tumor volume and change in body weight (BMI) 18 days after cell transplantation, and the proportion of tumor-free mice 56 days after cell transplantation.

[Table 7]

18 days after transplant 57 days after transplant OO(average±SD) T/C BMI (%) No tumor(%) Control 850.8±176.6 - 23.1 0.0 TPV07 58.2±24.4 6.8 18.9 13.3 TPV07+anti-mPD-1 Ab 8.6±6.8 1.0 18.6 80.0 TPV08 129.7±67.0 15.2 21.7 6.7 TPV08+anti-mPD-1 Ab 21.6±12.7 2.5 16.1 40.0

Figures 8 and 9 show that both TPV07 and TPV08 have a high tumor growth inhibitory effect when used alone compared to the control group, while when used in combination with anti-mouse PD-1 antibody, they inhibit growth more significantly tumors.

Table 7 shows that 18 days after cell transplantation, the TPV07 or TPV08 alone group and the combined TPV07+anti-mouse PD-1 antibody or TPV08+anti-mouse PD-1 antibody group had lower RR values than control group, which shows an antitumor effect. In addition, the TPV07+anti-mouse PD-1 antibody combined administration group showed a lower RR value than the TPV07 alone administration group, indicating a stronger antitumor effect. Also, the TPV08+anti-mouse PD-1 antibody combined administration group showed a lower RR value than the TPV08 alone administration group, indicating a stronger antitumor effect. At 56 days after cell transplantation, 80.0% of mice in the TPV07+anti-mouse PD-1 antibody pooled group were tumor-free, and 40.0% of mice in the TPV08+anti-mouse PD-1 antibody pooled group were tumor-free. tumors. In addition, the TPV07+anti-mouse PD-1 antibody combined administration group or the TPV08+anti-mouse PD-1 antibody combined administration group was confirmed to have an improved survival rate 56 years after cell transplantation compared with the single drug administration group.

The rate of change in mean body weight in the combined administration group showed that no increase in toxicity was observed compared with the TPV076 or TPV08 administration groups alone.

[Example 7: Effect of 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012) and anti-mouse PD-1 antibody used in combination in the B16F10.A24/SART293-101 SC cell colony transplant model]

9-week-old B2m ^{tm2(HLA-A24/H-2Db/B2M)Tai mice} were randomly divided into groups of 15 animals each. The day of division into groups is defined as day 0.

This study is carried out as in Example 4 except that a total of 3 mixed peptides having 4 linked epitopes, consisting of TPV06 and the other two peptides having 4 linked epitopes (TPV011 and TPV012) are used instead of TPV06.

More specifically, the study is conducted with a control group, a group of 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012), an anti-mouse PD-1 antibody group and a combined administration group of 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012) + anti-mouse PD-1 antibody.

3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012) were prepared at 6 mg/ml each of TPV06, TPV011 and TPV012 (i.e. total peptides: 18 mg/ml), using distilled water (Otsuka Pharmaceutical Factory Inc.) and then mixed with an equivalent amount of Montanide ISA 51 VG (SEPPIC) to form an emulsion, which is administered.

As a result, it was confirmed that the combined administration group of 3 mixed peptides having 4 related epitopes (TPV06, TPV011 and TPV012) + anti-mouse PD-1 antibody had an improved survival rate at 56 days after cell transplantation, compared with administration group 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012) or anti-mouse PD-1 antibodies alone.

The rate of change in mean body weight in the combined administration group showed that no increase in toxicity was observed compared with the individual drug administration groups.

All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

--->

LIST OF SEQUENCES

<110> TAIHO PHARMACEUTICAL CO., LTD.

<120> Antitumor agent and method for evaluating the agent

<130>PH-7968-PCT

<150> JP 2018-124894

<151> 2018-06-29

<160> 45

<170> Patent In version 3.5

<210> 1

<211> 9

<212>PRT

<213> Homo sapiens

<400> 1

Lys Leu Val Glu Arg Leu Gly Ala Ala

15

<210> 2

<211> 9

<212>PRT

<213> Homo sapiens

<400> 2

Ala Ser Leu Asp Ser Asp Pro Trp Val

15

<210> 3

<211> 9

<212>PRT

<213> Homo sapiens

<400> 3

Ala Leu Val Glu Phe Glu Asp Val Leu

15

<210> 4

<211> 9

<212>PRT

<213> Homo sapiens

<400> 4

Leu Leu Gln Ala Glu Ala Pro Arg Leu

15

<210> 5

<211> 9

<212>PRT

<213> Homo sapiens

<400> 5

Asp Tyr Ser Ala Arg Trp Asn Glu Ile

15

<210> 6

<211> 10

<212>PRT

<213> Homo sapiens

<400> 6

Val Tyr Asp Tyr Asn Cys His Val Asp Leu

1.5 10

<210> 7

<211> 9

<212>PRT

<213> Homo sapiens

<400> 7

Leu Tyr Ala Trp Glu Pro Ser Phe Leu

15

<210> 8

<211> 10

<212>PRT

<213> Homo sapiens

<400> 8

Asp Tyr Leu Arg Ser Val Leu Glu Asp Phe

1.5 10

<210> 9

<211> 9

<212>PRT

<213> Homo sapiens

<400> 9

Gln Ile Arg Pro Ile Phe Ser Asn Arg

15

<210> 10

<211> 10

<212>PRT

<213> Homo sapiens

<400> 10

Ile Leu Glu Gln Ser Gly Glu Trp Trp Lys

1.5 10

<210> 11

<211> 10

<212>PRT

<213> Homo sapiens

<400> 11

Val Ile Gln Asn Leu Glu Arg Gly Tyr Arg

1.5 10

<210> 12

<211> 10

<212>PRT

<213> Homo sapiens

<400> 12

Lys Leu Lys His Tyr Gly Pro Gly Trp Val

1.5 10

<210> 13

<211> 9

<212>PRT

<213> Homo sapiens

<400> 13

Arg Leu Gln Glu Trp Cys Ser Val Ile

15

<210> 14

<211> 9

<212>PRT

<213> Homo sapiens

<400> 14

Ile Leu Gly Glu Leu Arg Glu Lys Val

15

<210> 15

<211> 10

<212>PRT

<213> Homo sapiens

<400> 15

Asp Tyr Val Arg Glu His Lys Asp Asn Ile

1.5 10

<210> 16

<211> 9

<212>PRT

<213> Homo sapiens

<400> 16

His Tyr Thr Asn Ala Ser Asp Gly Leu

15

<210> 17

<211> 10

<212>PRT

<213> Homo sapiens

<400> 17

Asn Tyr Ser Val Arg Tyr Arg Pro Gly Leu

1.5 10

<210> 18

<211> 10

<212>PRT

<213> Homo sapiens

<400> 18

Arg Tyr Leu Thr Gln Glu Thr Asn Lys Val

1.5 10

<210> 19

<211> 43

<212>PRT

<213> Artificial

<220>

<223> synthetic peptide

<400> 19

Asp Tyr Ser Ala Arg Trp Asn Glu Ile Arg Arg Val Tyr Asp Tyr Asn

1. 5 10 15

Cys His Val Asp Leu Arg Arg Gln Ile Arg Pro Ile Phe Ser Asn Arg

20 25 30

Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40

<210> 20

<211> 43

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 20

Gln Ile Arg Pro Ile Phe Ser Asn Arg Arg Arg Asp Tyr Ser Ala Arg

1. 5 10 15

Trp Asn Glu Ile Arg Arg Val Tyr Asp Tyr Asn Cys His Val Asp Leu

20 25 30

Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40

<210> 21

<211> 43

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 21

Val Tyr Asp Tyr Asn Cys His Val Asp Leu Arg Arg Asp Tyr Ser Ala

1. 5 10 15

Arg Trp Asn Glu Ile Arg Arg Gln Ile Arg Pro Ile Phe Ser Asn Arg

20 25 30

Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40

<210> 22

<211> 43

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 22

Val Tyr Asp Tyr Asn Cys His Val Asp Leu Arg Arg Gln Ile Arg Pro

1. 5 10 15

Ile Phe Ser Asn Arg Arg Arg Asp Tyr Ser Ala Arg Trp Asn Glu Ile

20 25 30

Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40

<210> 23

<211> 43

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 23

Gln Ile Arg Pro Ile Phe Ser Asn Arg Arg Arg Val Tyr Asp Tyr Asn

1. 5 10 15

Cys His Val Asp Leu Arg Arg Asp Tyr Ser Ala Arg Trp Asn Glu Ile

20 25 30

Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40

<210> 24

<211> 43

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 24

Asp Tyr Ser Ala Arg Trp Asn Glu Ile Arg Arg Gln Ile Arg Pro Ile

1. 5 10 15

Phe Ser Asn Arg Arg Arg Val Tyr Asp Tyr Asn Cys His Val Asp Leu

20 25 30

Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40

<210> 25

<211> 43

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 25

Asp Tyr Ser Ala Arg Trp Asn Glu Ile Arg Arg Gln Ile Arg Pro Ile

1. 5 10 15

Phe Ser Asn Arg Arg Arg Val Tyr Asp Tyr Asn Cys His Val Asp Leu

20 25 30

Arg Arg Ala Ser Leu Asp Ser Asp Pro Trp Val

35 40

<210> 26

<211> 44

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 26

Asp Tyr Ser Ala Arg Trp Asn Glu Ile Arg Arg Gln Ile Arg Pro Ile

1. 5 10 15

Phe Ser Asn Arg Arg Arg Val Tyr Asp Tyr Asn Cys His Val Asp Leu

20 25 30

Arg Arg Ile Leu Glu Gln Ser Gly Glu Trp Trp Lys

35 40

<210> 27

<211> 46

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 27

Arg Arg Arg Asp Tyr Ser Ala Arg Trp Asn Glu Ile Arg Arg Gln Ile

1. 5 10 15

Arg Pro Ile Phe Ser Asn Arg Arg Arg Val Tyr Asp Tyr Asn Cys His

20 25 30

Val Asp Leu Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40 45

<210> 28

<211> 47

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 28

Arg Arg Arg Arg Asp Tyr Ser Ala Arg Trp Asn Glu Ile Arg Arg Gln

1. 5 10 15

Ile Arg Pro Ile Phe Ser Asn Arg Arg Arg Val Tyr Asp Tyr Asn Cys

20 25 30

His Val Asp Leu Arg Arg Leu Leu Gln Ala Glu Ala Pro Arg Leu

35 40 45

<210> 29

<211> 27

<212> DNA

<213> Homo sapiens

<400> 29

gactacagtg cccgctggaa tgaaatt 27

<210> 30

<211> 182

<212>PRT

<213> Homo sapiens

<400> 30

Gly Ser His Ser Met Arg Tyr Phe Ser Thr Ser Val Ser Arg Pro Gly

1. 5 10 15

Arg Gly Glu Pro Arg Phe Ile Ala Val Gly Tyr Val Asp Asp Thr Gln

20 25 30

Phe Val Arg Phe Asp Ser Asp Ala Ala Ser Gln Arg Met Glu Pro Arg

35 40 45

Ala Pro Trp Ile Glu Gln Glu Gly Pro Glu Tyr Trp Asp Glu Glu Thr

50 55 60

Gly Lys Val Lys Ala His Ser Gln Thr Asp Arg Glu Asn Leu Arg Ile

65 70 75 80

Ala Leu Arg Tyr Tyr Asn Gln Ser Glu Ala Gly Ser His Thr Leu Gln

85 90 95

Met Met Phe Gly Cys Asp Val Gly Ser Asp Gly Arg Phe Leu Arg Gly

100 105 110

Tyr His Gln Tyr Ala Tyr Asp Gly Lys Asp Tyr Ile Ala Leu Lys Glu

115 120 125

Asp Leu Arg Ser Trp Thr Ala Ala Asp Met Ala Ala Gln Ile Thr Lys

130 135 140

Arg Lys Trp Glu Ala Ala His Val Ala Glu Gln Gln Arg Ala Tyr Leu

145 150 155 160

Glu Gly Thr Cys Val Asp Gly Leu Arg Arg Tyr Leu Glu Asn Gly Lys

165 170 175

Glu Thr Leu Gln Arg Thr

180

<210> 31

<211> 546

<212> DNA

<213> Homo sapiens

<400> 31

ggatctcact ccatgaggta tttctccaca tccgtgtccc ggcccggccg cggggagccc 60

cgcttcatcg ccgtgggcta cgtggacgac acgcagttcg tgcggttcga cagcgacgcc 120

gcgagccaga ggatggagcc gcgggcgccg tggatagagc aggaggggcc ggagtattgg 180

gacgaggaga cagggaaagt gaaggcccac tcacagactg accgagagaa cctgcggatc 240

gcgctccgct actacaacca gagcgaggcc ggttctcaca ccctccagat gatgtttggc 300

tgcgacgtgg ggtcggacgg gcgcttcctc cgcgggtacc accagtacgc ctacgacggc 360

aaggattaca tcgccctgaa agaggacctg cgctcttgga ccgcggcgga catggcggct 420

cagatcacca agcgcaagtg ggaggcggcc catgtggcgg agcagcagag agcctacctg 480

gagggcacgt gcgtggacgg gctccgcaga tacctggaga acgggaagga gacgctgcag 540

cgcacg 546

<210> 32

<211> 33

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 32

Met Ala Val Met Ala Pro Arg Thr Leu Val Leu Leu Leu Ser Gly Ala

1. 5 10 15

Leu Ala Leu Thr Gln Thr Trp Ala Asp Tyr Ser Ala Arg Trp Asn Glu

20 25 30

Ile

<210> 33

<211> 102

<212> DNA

<213> artificial

<220>

<223> synthetic peptide

<400> 33

atggccgtca tggcgccccg aaccctcgtc ctgctactct cggggggccct ggccctgacc 60

cagacctggg cagactacag tgcccgctgg aatgaaattt ga 102

<210> 34

<211> 476

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 34

Met Ala Val Met Ala Pro Arg Thr Leu Val Leu Leu Leu Ser Gly Ala

1. 5 10 15

Leu Ala Leu Thr Gln Thr Trp Ala Ile Gln Arg Thr Pro Lys Ile Gln

20 25 30

Val Tyr Ser Arg His Pro Ala Glu Asn Gly Lys Ser Asn Phe Leu Asn

35 40 45

Cys Tyr Val Ser Gly Phe His Pro Ser Asp Ile Glu Val Asp Leu Leu

50 55 60

Lys Asn Gly Glu Arg Ile Glu Lys Val Glu His Ser Asp Leu Ser Phe

65 70 75 80

Ser Lys Asp Trp Ser Phe Tyr Leu Leu Tyr Tyr Thr Glu Phe Thr Pro

85 90 95

Thr Glu Lys Asp Glu Tyr Ala Cys Arg Val Asn His Val Thr Leu Ser

100 105 110

Gln Pro Lys Ile Val Lys Trp Asp Arg Asp Met Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser His Ser Met Arg

130 135 140

Tyr Phe Ser Thr Ser Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe

145 150 155 160

Ile Ala Val Gly Tyr Val Asp Asp Thr Gln Phe Val Arg Phe Asp Ser

165 170 175

Asp Ala Ala Ser Gln Arg Met Glu Pro Arg Ala Pro Trp Ile Glu Gln

180 185 190

Glu Gly Pro Glu Tyr Trp Asp Glu Glu Thr Gly Lys Val Lys Ala His

195 200 205

Ser Gln Thr Asp Arg Glu Asn Leu Arg Ile Ala Leu Arg Tyr Tyr Asn

210 215 220

Gln Ser Glu Ala Gly Ser His Thr Leu Gln Met Met Phe Gly Cys Asp

225 230 235 240

Val Gly Ser Asp Gly Arg Phe Leu Arg Gly Tyr His Gln Tyr Ala Tyr

245 250 255

Asp Gly Lys Asp Tyr Ile Ala Leu Lys Glu Asp Leu Arg Ser Trp Thr

260 265 270

Ala Ala Asp Met Ala Ala Gln Ile Thr Lys Arg Lys Trp Glu Ala Ala

275 280 285

His Val Ala Glu Gln Gln Arg Ala Tyr Leu Glu Gly Thr Cys Val Asp

290 295 300

Gly Leu Arg Arg Tyr Leu Glu Asn Gly Lys Glu Thr Leu Gln Arg Thr

305 310 315 320

Asp Ser Pro Lys Ala His Val Thr His His Pro Arg Ser Lys Gly Glu

325 330 335

Val Thr Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Asp Ile Thr

340 345 350

Leu Thr Trp Gln Leu Asn Gly Glu Glu Leu Thr Gln Asp Met Glu Leu

355 360 365

Val Glu Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala Ser

370 375 380

Val Val Val Pro Leu Gly Lys Glu Gln Asn Tyr Thr Cys Arg Val Tyr

385 390 395 400

His Glu Gly Leu Pro Glu Pro Leu Thr Leu Arg Trp Glu Pro Pro Pro

405 410 415

Ser Thr Asp Ser Tyr Met Val Ile Val Ala Val Leu Gly Val Leu Gly

420 425 430

Ala Met Ala Ile Ile Gly Ala Val Val Ala Phe Val Met Lys Arg Arg

435 440 445

Arg Asn Thr Gly Gly Lys Gly Gly Asp Tyr Ala Leu Ala Pro Gly Ser

450 455 460

Gln Ser Ser Glu Met Ser Leu Arg Asp Cys Lys Ala

465 470 475

<210> 35

<211> 1431

<212> DNA

<213> artificial

<220>

<223> synthetic peptide

<400> 35

atggccgtca tggcgccccg aaccctcgtc ctgctactct cggggggccct ggccctgacc 60

cagacctggg cgatccagcg tactccaaag attcaggttt actcacgtca tccagcagag 120

aatggaaagt caaatttcct gaattgctat gtgtctgggt ttcatccatc cgacattgaa 180

gttgacttac tgaagaatgg agagagaatt gaaaaagtgg agcattcaga cttgtctttc 240

agcaaggact ggtctttcta tctcttgtac tacactgaat tcacccccac tgaaaaagat 300

gagtatgcct gccgtgtgaa ccatgtgact ttgtcacagc ccaagatagt taagtgggat 360

cgagacatgg gaggtggcgg atccggcgga ggcggctcgg gtggcggcgg ctctggatct 420

cactccatga ggtatttctc cacatccgtg tcccggcccg gccgcgggga gccccgcttc 480

atcgccgtgg gctacgtgga cgacacgcag ttcgtgcggt tcgacagcga cgccgcgagc 540

cagaggatgg agccgcgggc gccgtggata gagcaggagg ggccggagta ttgggacgag 600

gagacaggga aagtgaaggc ccactcacag actgaccgag agaacctgcg gatcgcgctc 660

cgctactaca accagagcga ggccggttct cacaccctcc agatgatgtt tggctgcgac 720

gtggggtcgg acgggcgctt cctccgcggg taccaccagt acgcctacga cggcaaggat 780

tacatcgccc tgaaagagga cctgcgctct tggaccgcgg cggacatggc ggctcagatc 840

accaagcgca agtgggaggc ggcccatgtg gcggagcagc agagagccta cctggagggc 900

acgtgcgtgg acgggctccg cagatacctg gagaacggga aggagacgct gcagcgcacg 960

gattccccaa aggcacatgt gacccatcac cccagatcta aaggtgaagt caccctgagg 1020

tgctgggccc tgggcttcta ccctgctgac atcaccctga cctggcagtt gaatggggag 1080

gagctgaccc aggacatgga gcttgtggag accaggcctg caggggatgg aaccttccag 1140

aagtgggcat ctgtggtggt gcctcttggg aaggagcaga attacacatg ccgtgtgtac 1200

catgaggggc tgcctgagcc cctcaccctg agatgggagc ctcctccgtc cactgactct 1260

tacatggtga tcgttgctgt tctgggtgtc cttggagcta tggccatcat tggagctgtg 1320

gtggcttttg tgatgaagag aaggagaaac acaggtggaa aaggagggga ctatgctctg 1380

gctccaggct cccagagctc tgaaatgtct ctccgagatt gtaaagcgtg a 1431

<210> 36

<211> 99

<212>PRT

<213> Homo sapiens

<400> 36

Ile Gln Arg Thr Pro Lys Ile Gln Val Tyr Ser Arg His Pro Ala Glu

1. 5 10 15

Asn Gly Lys Ser Asn Phe Leu Asn Cys Tyr Val Ser Gly Phe His Pro

20 25 30

Ser Asp Ile Glu Val Asp Leu Leu Lys Asn Gly Glu Arg Ile Glu Lys

35 40 45

Val Glu His Ser Asp Leu Ser Phe Ser Lys Asp Trp Ser Phe Tyr Leu

50 55 60

Leu Tyr Tyr Thr Glu Phe Thr Pro Thr Glu Lys Asp Glu Tyr Ala Cys

65 70 75 80

Arg Val Asn His Val Thr Leu Ser Gln Pro Lys Ile Val Lys Trp Asp

85 90 95

Arg Asp Met

<210> 37

<211> 156

<212>PRT

<213> Mus musculus

<400> 37

Asp Ser Pro Lys Ala His Val Thr His His Pro Arg Ser Lys Gly Glu

1. 5 10 15

Val Thr Leu Arg Cys Trp Ala Leu Gly Phe Tyr Pro Ala Asp Ile Thr

20 25 30

Leu Thr Trp Gln Leu Asn Gly Glu Glu Leu Thr Gln Asp Met Glu Leu

35 40 45

Val Glu Thr Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala Ser

50 55 60

Val Val Val Pro Leu Gly Lys Glu Gln Asn Tyr Thr Cys Arg Val Tyr

65 70 75 80

His Glu Gly Leu Pro Glu Pro Leu Thr Leu Arg Trp Glu Pro Pro Pro

85 90 95

Ser Thr Asp Ser Tyr Met Val Ile Val Ala Val Leu Gly Val Leu Gly

100 105 110

Ala Met Ala Ile Ile Gly Ala Val Val Ala Phe Val Met Lys Arg Arg

115 120 125

Arg Asn Thr Gly Gly Lys Gly Gly Asp Tyr Ala Leu Ala Pro Gly Ser

130 135 140

Gln Ser Ser Glu Met Ser Leu Arg Asp Cys Lys Ala

145 150 155

<210> 38

<211> 29

<212> DNA

<213> artificial

<220>

<223> primer 1

<400> 38

tcaagcttaa ctagcatggc cgtcatggc 29

<210> 39

<211> 39

<212> DNA

<213> artificial

<220>

<223> primer 2

<400> 39

ttaaacctcg agtgctcacg ctttacaatc tcggagaga 39

<210> 40

<211> 46

<212> DNA

<213> artificial

<220>

<223> primer 3

<400> 40

ctcaaatttc attccagcgg gcactgtagt ctgcccaggt ctgggt 46

<210> 41

<211> 48

<212> DNA

<213> artificial

<220>

<223> primer 4

<400> 41

gcagactaca gtgcccgctg gaatgaaatt tgagcactcg aggtttaa 48

<210> 42

<211> 14

<212> DNA

<213> artificial

<220>

<223> primer 5

<400> 42

atggccgtca tggc 14

<210> 43

<211> 18

<212> DNA

<213> artificial

<220>

<223> primer 6

<400> 43

tcaaatttca ttccagcg 18

<210> 44

<211> 45

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 44

Asp Tyr Val Arg Glu His Lys Asp Asn Ile Arg Arg Arg Tyr Leu Thr

1. 5 10 15

Gln Glu Thr Asn Lys Val Arg Arg Lys Leu Val Glu Arg Leu Gly Ala

20 25 30

Ala Arg Arg Ile Leu Glu Gln Ser Gly Glu Trp Trp Lys

35 40 45

<210> 45

<211> 47

<212>PRT

<213> artificial

<220>

<223> synthetic peptide

<400> 45

Arg Arg Arg Arg Leu Tyr Ala Trp Glu Pro Ser Phe Leu Arg Arg Arg

1. 5 10 15

Leu Gln Glu Trp Cys Ser Val Ile Arg Arg Asp Tyr Leu Arg Ser Val

20 25 30

Leu Glu Asp Phe Arg Arg Ala Ser Leu Asp Ser Asp Pro Trp Val

35 40 45

<---

Claims (124)

1. The use of a peptide having 4 linked epitopes as an active ingredient for the treatment of a cancer patient in combination with a PD-1 pathway antagonist, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, Where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide such as shown in SEQ ID NO: 10, at the C-terminus, which are linked via linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, wherein the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 2. Use according to claim 1, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 3. Use according to claim 1, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 4. Use according to claim 1, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 5. Use according to claim 1, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 6. Use of a PD-1 pathway antagonist as an active ingredient for the treatment of a cancer patient in combination with a peptide having 4 linked epitopes, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, and an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide, such as shown in SEQ ID NO: 4, an epitope peptide, such as shown in SEQ ID NO: 10, at the C-terminus, which are linked through linkers, wherein the peptide having 4 linked epitopes optionally further contains a peptide sequence consisting of hydrophilic amino acids, where the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 7. Use according to claim 6, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 8. Use according to claim 6, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 9. Use according to claim 6, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 10. Use according to claim 6, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 11. A combined composition for treating a cancer patient, comprising a peptide having 4 linked epitopes and a PD-1 pathway antagonist, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, anti-PD-L1 antibodies and anti-PD-L2 antibodies, where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide such as shown in SEQ ID NO: 10, at the C-terminus, which are linked through linkers, wherein the peptide having 4 linked epitopes optionally further contains a peptide sequence consisting of hydrophilic amino acids, where the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 12. The combined composition of claim 11, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 13. The combined composition of claim 11, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 14. The combined composition of claim 11, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 15. The combined composition of claim 11, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 16. An antitumor enhancer for enhancing the antitumor effect of a PD-1 pathway antagonist, comprising a peptide having 4 linked epitopes as an active ingredient, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of anti-PD -1 antibodies, anti-PD-L1 antibodies and anti-PD-L2 antibodies, where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, and an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide such as shown in SEQ ID NO: 10, at the C-terminus, which are linked through linkers, wherein the peptide having 4 linked epitopes optionally further contains a peptide sequence consisting of hydrophilic amino acids, where the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 17. The antitumor enhancer of claim 16, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 18. The antitumor enhancer of claim 16, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 19. The antitumor effect enhancer according to claim 16, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 20. The antitumor effect enhancer according to claim 16, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 21. An antitumor agent comprising a peptide having 4 linked epitopes, containing 4 CTL epitope peptides linked through linkers, and a PD-1 pathway antagonist as active ingredients, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide such as shown in SEQ ID NO: 10, at the C-terminus, which are linked through linkers, wherein the peptide having 4 linked epitopes optionally further contains a peptide sequence consisting of hydrophilic amino acids, where the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 22. The antitumor agent according to claim 21, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 23. The antitumor agent of claim 21, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 24. The antitumor agent according to claim 21, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 25. The antitumor agent according to claim 21, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 26. A set of formulation for the treatment of a cancer patient, containing a peptide having 4 linked epitopes, in combination with a PD-1 pathway antagonist, and instructions for use, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide, such as shown in SEQ ID NO: 10 (PEP10), at the C-terminus, which are linked through linkers, wherein the peptide having 4 linked epitopes optionally further contains a peptide sequence consisting of hydrophilic amino acids, where the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 27. The composition kit of claim 26, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 28. The composition kit of claim 26, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 29. The composition kit of claim 26, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 30. The composition kit of claim 26, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 31. A method for assessing the antitumor effect of a peptide having 4 linked epitopes and a PD-1 pathway antagonist using a cell into which a polynucleotide encoding a human tumor antigen epitope peptide derived from SART2 and a polynucleotide encoding the α1 and α2 regions of human HLA- A24, comprising the following steps (I) and (II): (I) administering a peptide having 4 linked epitopes and a PD-1 pathway antagonist to a non-immunodeficient non-human animal with a human HLA-A24 gene knockin; And (ii) transplantation of the cell into a non-immunodeficient non-human animal with a knock-in of the human HLA-A24 gene, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, where a peptide having 4 linked epitopes contains an epitope peptide such as shown in SEQ ID NO: 5, an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide, such as shown in SEQ ID NO: 10, at the C-terminus, which are linked through linkers, wherein the peptide having 4 linked epitopes optionally further contains a peptide sequence consisting of hydrophilic amino acids, where the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 32. The method of claim 31, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents a linker. 33. The method of claim 31, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 34. The method of claim 31, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 35. The method of claim 31, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab. 36. A method of treating a tumor, comprising administering a peptide having 4 linked epitopes and a PD-1 pathway antagonist simultaneously, sequentially or separately, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, where a peptide having 4 linked epitopes contains: an epitope peptide such as shown in SEQ ID NO: 5, an epitope peptide such as shown in SEQ ID NO: 6, an epitope peptide such as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of an epitope peptide such as shown in SEQ ID NO: 2, an epitope peptide such as shown in SEQ ID NO: 4, and an epitope peptide such as shown in SEQ ID NO: 10, at the C-terminus, which are linked via linkers, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, wherein the linker is an arginine dimer consisting of two arginine residues linked to each other, where a peptide sequence consisting of hydrophilic amino acids is linked to the N-terminus and consists of an arginine trimer consisting of three arginine residues linked to each other, or an arginine tetramer consisting of four arginine residues linked to each other. 37. The method of claim 36, wherein the peptide having 4 linked epitopes optionally further comprises a peptide sequence consisting of hydrophilic amino acids, and wherein the peptide having 4 linked epitopes consists of a sequence selected from the following sequences: SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 4; SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 2; And SEQ ID NO: 5-(L)-SEQ ID NO: 9-(L)-SEQ ID NO: 6-(L)-SEQ ID NO: 10, where "(L)" represents the linker. 38. The method of claim 36, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26. 39. The use of claim 36, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody. 40. The use of claim 36, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab.