RU2802421C1 - SET OF REAGENTS FOR SIMULTANEOUS DETECTION OF FIVE MAJOR SOMATIC MUTATIONS IN pH-NEGATIVE MYELOPROLIFERATIVE NEOPLASMS AND DIAGNOSTIC METHOD BASED ON IT - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention is related to technology of molecular diagnostics of myeloproliferative neoplasms. A set of reagents for the simultaneous detection of five major somatic mutations of Ph-negative myeloproliferative neoplasms in the JAK2, CALR and MPL genes and a diagnostic method based on it are proposed. A distinctive feature of the kit is the use of original combinations of specific primers and fluorescently labelled DNA probes in two reaction mixtures. The first mixture includes the following primers: JAK2-WF, JAK2-R, CALR-D, CALR-R, 515K, 515-R5 and TaqMan probes: JAK2-P, CALR-P, 515-P6. The second mixture contains the following primers: JAK2-WF, JAK2-R, CALR-R, JAK2-RM, CALR-I, 515L, 515-R9 and TaqMan probes: JAK2-P, CALR-P, 515-P10.

EFFECT: invention allows simultaneous study of five mutations in one analytical series, using only two test tubes with reaction mixtures, which leads to savings in the volume of biological sample used for analysis, reagents and analysis time.

2 cl, 3 dwg, 4 tbl

Description

The group of inventions relates to the field of medicine, including the diagnosis of oncohematological diseases, and is intended for use in molecular genetic studies in clinical diagnostic laboratories in order to identify genetic markers of chronic Ph-negative myeloproliferative neoplasms.

In accordance with clinical guidelines [Barbui T., Thiele J., Gisslinger N., Finazzi G., Vannucchi A.M, Tefferi A. The 2016 revision of WHO classification of myeloproliferative neoplasms: Clinical and molecular advances. Blood Reviews, 2016. 30: 453-459] the main diagnostic criterion for diagnosing Ph-negative myeloproliferative neoplasms, namely polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF), is the identification of one of the five most common pathogenetic somatic mutations in the genes of Janus kinase-2 (JAK2 V617F), calreticulin (CALR type 1 - p. 1092_1143del and type 2 - p. 1154_1155insTTGTC) and thrombopoietin receptor (MPL W515L and W515K).

The most common methods and reagent kits for detecting mutations in the practice of clinical diagnostic laboratories provide for the ability to study only mutations in individual genes; complete laboratory testing of all the main mutations associated with myeloproliferation takes a fairly long period of time.

It is known to simultaneously study various mutations in different genes using DNA sequencing methods [Langabeer SE, Andrikovics H, Asp J, et al. Molecular diagnostics of myeloproliferative neoplasms. Eur J Haematol. 2015, 95:270-279] and microarrays (https://tools.mermofisher.com/content/sfs/brochures/genomewide_snp6_datasheet.pdf).

However, the requirements for equipment and personnel qualifications, as well as the high labor intensity and cost of testing, complicate the widespread use of these methods in real practice in clinical diagnostic laboratories.

There is a known method that involves the use of allele-specific primers with registration of PCR results in real time using fluorescently labeled samples. The reaction mixture includes primers that are different for each allele, and a primer and probe common to two alleles, as well as a common fluorescent probe [RU, Pat. 2445373, IPC C12Q 1/68, publ. 03/20/2012, bulletin. No. 8].

The disadvantages of this method are the impossibility of carrying out a multiplex reaction due to the use of one fluorescent probe common to the two analyzed alleles.

The closest to the claimed set of reagents and diagnostic method based on it in terms of the set of characteristics is a set of reagents for identifying Ph-negative myeloproliferative neoplasms, which involved the use of four reaction mixtures, including specific primers and TaqMan probes, when performing a multiplex polymerase chain reaction [RU Pat. 2679653, IPC G01N 33/533, publ. 02/12/2019, Bulletin. No. 5 (prototype)]. Patent 2679653 proposes a kit containing specific primers and fluorescently labeled DNA probes. The primers have the following nucleotide composition (5'-3'-): JAK2-W-F, JAK2-W-R, JAK2-W-P, JAK2-M-F, JAK2-M-R, JAK2-M-P, CALR-1-F, CALR-1-R, MPL-K-F, MPL-K-R, CALR-1-P, MPL-K-P, CALR-2-F, CALR-2-R, MPL-L-F, MPL-L-R, CALR-2-P, MPL-L-P. TaqMan probes use fluorescein (FAM) and chlorinated fluorescein (HEX) dyes at the 5' end. To quench fluorescence, Black Hole Quencher-1 (BHQ1) is used at the 3' end. This technical solution allows for simultaneous study of several mutations in one analytical series, which leads to results in a shorter time. It also provides accurate diagnosis of chronic Ph-negative myeloproliferative tumors and allows us to identify a group of patients with the presence of combined pathogenetic mutations.

However, when using the above kit, it is necessary to use four reaction mixtures for each analyzed sample, requiring at least 4 separate tubes, which limits the production resources of the laboratory, especially with large volumes of testing.

The objective of the invention is to develop a set of reagents for the simultaneous detection of five main somatic mutations in the JAK2, CALR and MPL genes, as well as an accelerated and economical method for diagnosing Ph-negative myeloproliferative neoplasms based on it.

The technical result achieved by the claimed group of inventions is the production of a set of reagents for the detection of five somatic mutations in the genes of Janus kinase-2 (JAK2 V617F), calreticulin (CALR type 1 - p. 1092_1143de1 and type 2 - p. 1154_1155insTTGTC) and thrombopoietin receptor (MPL W515L and W515K) by multiplex polymerase chain reaction, reducing working time for performing laboratory tests and saving consumables.

The specified unified technical result when implementing a group of inventions on the subject of a set of reagents is achieved by the fact that in a set of reagents for the simultaneous detection of five main somatic mutations of Ph-negative myeloproliferative neoplasms, containing specific primers and fluorescently labeled DNA probes, as a source of fluorescence in TaqMan probes dyes are used at the 5' end: fluorescein (FAM), and chlorinated fluorescein (HEX), and for fluorescence quenching, Black Hole Quencher-1 (BHQ1) is used at the 3' end, what is new is that two reactions are used to analyze one biological sample mixtures, the first mixture includes primers: JAK2-W-F, JAK2-R, CALR-D, CALR-R, 515K, 515-R5 and TaqMan probes: JAK2-P, CALR-P, 515-P6, and the second mixture includes primers: JAK2-W-F, JAK2-R, CALR-R, JAK2-RM, CALR-I, 515L, 515-R9 and TaqMan probes: JAK2-P, CALR-P, 515-P10 and have the following nucleotide composition (5' -3'-):

JAK2-W-F: AGCAGCAAGTATGATGAGC,

JAK2-R: GATGCTCTGAGAAAGGCAT,

JAK2-P: FAM-CACAGACACATACTC-BHQ1,

JAK2-RM: GATGCTCTGAGAAAGGCAT,

CALR-D: GAGGAGTTTGGCAACGAGAC,

CALR-R: SSTSTSTSTSTSTSTSSA,

CALR-P: HEX-AGGAGCAGAGGACAAGGAGGATGA-BHQ2,

CALR-I: GCAACGAGACGTGGGGCGTA

515-R9: TAGCCTGGATCTCCTTGGTG,

515L: ACAGAGCGAACCAAGAATGC,

515-P6: HEX-TGCTGCTGAGGAAGCAGTTTCC-BHQ2,

515K: TAGCCTGGATCTCCTTGGTG,

515-R5: ACAGAGCGAACCAAGAATGC,

515-P10: HEX-CTGCTGAGGTTGCAGTTTC-BHQ2,

Additionally, the dye carboxy-X-rhodamine (ROX) is used as a source of fluorescence in TaqMan probes at the 5' end, and Black Hole Quencher-2 (BHQ2) is used at the 3' end to quench fluorescence.

The specified unified technical result when implementing a group of inventions according to the subject method is also achieved by the fact that in the method for diagnosing Ph-negative myeloproliferative neoplasms, including carrying out a multiplex version of the polymerase chain reaction in real time by mixing buffer, dNTPs, specific primers, TaqMan probes, Taq -polymerase, MgCI ₂ ; and water in optimal volumes, followed by amplification which is carried out in the following mode: preliminary activation at 95°C - 5 minutes and subsequent cycles, including denaturation at 95°C - 15 seconds, annealing and elongation at 60°C - 60 seconds, cycle repeat 50 times, the new thing is that the multiplex polymerase chain reaction is carried out simultaneously in two reaction mixtures, the first mixture includes primers: JAK2-WF, JAK2-R, CALR-D, CALR-R, 515K, 515-R5 and TaqMan probes: JAK2-P, CALR-P, 515-P6, the second mixture includes primers: JAK2-WF, JAK2-R, CALR-R, JAK2-RM, CALR-I, 515L, 515-R9 and TaqMan probes: JAK2-P, CALR-P, 515-P10, having the following nucleotide composition (5'-3'-):

JAK2-W-F: AGCAGCAAGTATGATGAGC,

JAK2-R: GATGCTCTGAGAAAGGCAT,

JAK2-P: FAM-CACAGACACATACTC-BHQ1,

JAK2-RM: GATGCTCTGAGAAAGGCAT,

CALR-D: GAGGAGTTTGGCAACGAGAC,

CALR-R: CCTCATCCTCCTCATCCCTCA,

CALR-P: HEX-AGGAGCAGAGGACAAGGAGGATGA-BHQ2,

CALR-I: GCAACGAGACGTGGGGCGTA

515-R9: TAGCCTGGATCTCCTTGGTG,

515L: ACAGAGCGAACCAAGAATGC,

515-P6: HEX-TGCTGCTGAGGAAGCAGTTTCC-BHQ2,

515K: TAGCCTGGATCTCCTTGGTG,

515-R5: ACAGAGCGAACCAAGAATGC,

515-P10: HEX-CTGCTGAGGTTGCAGTTTC-BHQ2,

Additionally, the dye carboxy-X-rhodamine (ROX) is used as a source of fluorescence in TaqMan probes at the 5' end, and Black Hole Quencher-2 (BHQ2) is used at the 3' end to quench fluorescence, and the result is considered positive if the threshold cycle value (Ct) for the sample is no more than 35.

The claimed group of inventions meets the requirement of unity of invention, since a group of diverse inventions forms a single inventive concept, and one of the claimed objects - a set of reagents for identifying Ph-negative myeloproliferative neoplasms, is intended for use in another - a method for diagnosing Ph-negative myeloproliferative neoplasms, while both object of a group of inventions are aimed at solving the same problem with obtaining a single technical result.

A comparative analysis with the prototype made it possible to identify a set of distinctive features that are significant in relation to the technical result for each of the claimed objects of the group, set out in the formulas. Consequently, each of the objects of the group of inventions meets the “novelty” criterion.

From the literature and practice of PCR studies, it is not known about the method of multiplex PCR analysis and (or) a set of reagents for the simultaneous detection of individual pathogenetic somatic mutations V617F, p. 1092_1143del, p. 1154_1155insTTGTC, W515L, W515K in the JAK2, CALR and MPL genes using only two reaction mixtures for one biological sample, which allows us to conclude that the proposed solution meets the “inventive step” criterion.

The essence of the invention is illustrated with the help of graphic materials.

In fig. Figure 1 shows the accumulation curves of the fluorescent signal after RT-PCR for a sample without somatic mutations: 1 - “wild type” JAK2 allele.

In fig. Figure 2 shows fluorescent signal accumulation curves after RT-PCR for a sample with one of five somatic mutations: 1 - JAK2 wild-type allele, 2 - JAK2 V617F mutation.

In fig. Figure 3 shows the accumulation curves of the fluorescent signal after RT-PCR for a sample simultaneously with two somatic mutations: 1 - wild-type JAK2 allele, 2 - JAK2 V617F mutation, 3 - CALR type 1 (p.1092_1143del).

The method is carried out as follows.

Multiplex polymerase chain reaction is carried out in a mixture with a volume of 25 μl per 1 DNA sample. For each analyzed patient DNA sample, 2 test tubes are prepared into which reaction mixtures corresponding to the test tube number are added (Table 1). Taq polymerase (5 units/μl) in a volume of 0.5 μl is added to each tube, and then DNA of the test sample with a concentration of at least 40 ng in a volume of 10 μl is added. For each study, it is necessary to use two additional tubes, into which, instead of DNA, control samples PKO (positive control sample) and NCO (negative control sample) are added. PKO is human genomic DNA with the presence of mutant alleles of all genes studied. OCO is human genomic DNA from a healthy donor who does not have mutations in the genes under study.

The reaction mixtures listed in Table 1 included in the kit include specific primers and probes:

Reaction mixture No. 1 contains primers: JAK2-W-F, JAK2-R, JAK2-P, CALR-D, CALR-R, 515K, 515-R5 and TaqMan probes: JAK2-P, CALR-P, 515-P6 with dyes: fluorescein (FAM), carboxy-X-rhodamine (ROX) and chlorinated fluorescein (HEX) at the 5' end, and Black Hole Quencher-1 (BHQ1) and Black Hole Quencher-2 (BHQ2) at the 3' end are used for fluorescence quenching end.

Reaction mixture No. 2 contains primers: JAK2-W-F, JAK2-P, CALR-R, JAK2-RM, CALR-I, 515L, 515-R9 and TaqMan probes: JAK2-P, CALR-P, 515-P10 with dyes: fluorescein (FAM), carboxy-X-rhodamine (ROX) and chlorinated fluorescein (HEX) at the 5' end, and Black Hole Quencher-1 (BHQ1) and Black Hole Quencher-2 (BHQ2) at the 3' end are used for fluorescence quenching end.

The primers have the following nucleotide composition:

JAK2-W-F: AGCAGCAAGTATGATGAGC,

JAK2-R: GATGCTCTGAGAAAGGCAT,

JAK2-P: FAM-CACAGACACATACTC-BHQ1,

JAK2-RM: GATGCTCTGAGAAAGGCAT,

CALR-D: GAGGAGTTTGGCAACGAGAC,

CALR-R: CCTCATCCTCCTCATCCCTCA,

CALR-P: HEX-AGGAGCAGAGGACAAGGAGGATGA-BHQ2,

CALR-I: GCAACGAGACGTGGGGCGTA

515-R9: TAGCCTGGATCTCCTTGGTG,

515L: ACAGAGCGAACCAAGAATGC,

515-P6: HEX-TGCTGCTGAGGAAGCAGTTTCC-BHQ2,

515K: TAGCCTGGATCTCCTTGGTG,

515-R5: ACAGAGCGAACCAAGAATGC,

515-P10: HEX-CTGCTGAGGTTGCAGTTTC-BHQ2

Primers and probes were selected using the Primer 3 program. The selected sequences were analyzed in GenBank using the BLAST program (Table 2). Based on the results of the analysis, no sequences were found in the human genome that were homologous to the selected primers and probes.

Reaction mixtures No. 1 and No. 2, the composition of which is indicated in Table 1, are prepared in two corresponding test tubes and simultaneously placed in the thermal block of the amplifier. The temperature-time reaction mode for the CFX96 amplifier (Bio-Rad, USA) is as follows: preliminary activation at 95°C - 5 minutes and subsequent cycles including denaturation at 95°C - 15 seconds and annealing and elongation at 60° C - 60 seconds, the cycle is repeated 50 times.

The obtained data - fluorescent signal accumulation curves from both tubes are analyzed using the software of the device used to carry out PCR in real time in accordance with the instructions for the device (Fig. 1-3).

An automatic calculation must be used to determine the threshold cycle (Ct) for each tube. Interpretation of the results is possible provided that the threshold cycles of the TCO are greater than 35, and the threshold cycles of the PCO are less than 35 in both tubes. Otherwise, the result is considered unreliable. For all biological samples under study, the threshold cycle of mixture No. 1 via the FAM channel must be less than 30. Failure to comply with this condition indicates a small amount of DNA added to the sample. Threshold cycles of fluorescent signals in any of the tubes should not be less than which indicates an excess amount of DNA has been added to the sample. In this case, it is necessary to repeat the analysis with preliminary DNA dilution.

To calculate the allelic load of the V617F mutation, you must use the formula:

If the allelic load is >0.5%, the sample is considered positive for the JAK2 V617F mutation.

To determine the presence of mutations in the CALR gene, you must use the formulas:

If the CALR value is c.1092_1143del>3, the sample is considered positive for mutation c. 1092_1143del of the CALR gene.

If the value c.1154_1155insTTGTC>3, the sample is considered positive for mutation c. 1154_1155insTTGTC of the CALR gene.

The presence of the W515K mutation in the MPL gene is determined at Ct<35 of mixture 1 via the ROX channel. The presence of the W515L mutation in the MPL gene is determined at Ct<35 of mixture 2 via the ROX channel. In rare cases, patient samples may contain multiple mutations at the same time.

The fluorescent signal accumulation curves for a sample that does not contain any of the analyzed mutations have the form shown in Fig. 1. In FIG. Figure 2 shows curves for a sample with one somatic mutation, in this case the JAK2 V617F mutation. In fig. Figure 3 shows fluorescence intensity curves for a sample with two simultaneously detected somatic mutations - JAK2 V617F and CALR type 1. In all examples, the X axis indicates the amplification cycles, and the Y axis indicates the fluorescence level of the amplification product.

The advantage of the claimed invention is that the developed set of reagents and the use of multiplex PCR allow the simultaneous study of five somatic mutations in one analytical series using only two reaction mixtures for the analysis of one biological sample, while in comparison with the prototype a twofold reduction in analysis time is achieved, consumption of laboratory test tubes and reagents, and also increases the efficiency of using amplifiers (Table 3).

A parallel analysis of 138 samples of clinical material established that positive and negative results of PCR tests coincided in all samples (Table 4).

The invention allows for the simultaneous study of five mutations in one analytical series, using only two test tubes with reaction mixtures, which leads to savings in the volume of biological sample used for analysis, reagents and analysis time. The set of inventive reagents allows for more efficient use of equipment for amplification of nucleic acids.

Claims (32)

1. A set of reagents for the simultaneous detection of five main somatic mutations of Ph-negative myeloproliferative neoplasms, containing specific primers and fluorescently labeled DNA probes; the following dyes are used as a source of fluorescence in TaqMan probes at the 5' end: fluorescein (FAM) and chlorinated fluorescein ( HEX), and for fluorescence quenching, Black Hole Quencher-1 (BHQ1) is used at the 3' end, characterized in that two reaction mixtures are used to analyze one biological sample, the first mixture including the primers: JAK2-W-F, JAK2-R, CALR-D, CALR-R, 515K, 515-R5 and TaqMan probes: JAK2-P, CALR-P, 515-P6, and the second mixture includes primers: JAK2-W-F, JAK2-R, CALR-R, JAK2-RM , CALR-I, 515L, 515-R9 and TaqMan probes: JAK2-P, CALR-P, 515-P10 and have the following nucleotide composition (5'-3'-): JAK2-W-F: AGCAGCAAGTATGATGAGC, JAK2-R: GATGCTCTGAGAAAGGCAT, JAK2-P: FAM-CACAGACACATACTC-BHQ1, JAK2-RM: GATGCTCTGAGAAAGGCAT, CALR-D: GAGGAGTTTGGCAACGAGAC, CALR-R: SSTSTSTSTSTSTSTSSA, CALR-P: HEX-AGGAGCAGAGGACAAGGAGGATGA-BHQ2, CALR-I: GCAACGAGACGTGGGGCGTA 515-R9: TAGCCTGGATCTCCTTGGTG, 515L: ACAGAGCGAACCAAGAATGC, 515-P6: HEX-TGCTGCTGAGGAAGCAGTTTCC-BHQ2, 515K: TAGCCTGGATCTCCTTGGTG, 515-R5: ACAGAGCGAACCAAGAATGC, 515-P10: HEX-CTGCTGAGGTTGCAGTTTC-BHQ2, Additionally, the dye carboxy-X-rhodamine (ROX) is used as a source of fluorescence in TaqMan probes at the 5' end, and Black Hole Quencher-2 (BHQ2) is used at the 3' end to quench fluorescence. 2. A method for diagnosing Ph-negative myeloproliferative neoplasms, including conducting a multiplex version of the polymerase chain reaction in real time by mixing buffer, dNTPs, specific primers, TaqMan probes, Taq polymerase, MgCl ₂ and water in optimal volumes, followed by amplification, which carried out in the following mode: preliminary activation at 95°C - 5 minutes and subsequent cycles, including denaturation at 95°C - 15 seconds, annealing and elongation at 60°C - 60 seconds, the cycle is repeated 50 times, characterized in that the multiplex polymerase the chain reaction is carried out simultaneously in two reaction mixtures, the first mixture includes primers: JAK2-WF, JAK2-R, CALR-D, CALR-R, 515K, 515-R5 and TaqMan probes: JAK2-P, CALR-P, 515-R6 , the second mixture includes primers: JAK2-WF, JAK2-R, CALR-R, JAK2-RM, CALR-I, 515L, 515-R9 and TaqMan probes: JAK2-P, CALR-P, 515-P10, having the following nucleotide composition (5'-3'-): JAK2-W-F: AGCAGCAAGTATGATGAGC, JAK2-R: GATGCTCTGAGAAAGGCAT, JAK2-P: FAM-CACAGACACATACTC-BHQ1, JAK2-RM: GATGCTCTGAGAAAGGCAT, CALR-D: GAGGAGTTTGGCAACGAGAC, CALR-R: SSTSTSTSTSTSTSTSSA, CALR-P: HEX-AGGAGCAGAGGACAAGGAGGATGA-BHQ2, CALR-I: GCAACGAGACGTGGGGCGTA 515-R9: TAGCCTGGATCTCCTTGGTG, 515L: ACAGAGCGAACCAAGAATGC, 515-P6: HEX-TGCTGCTGAGGAAGCAGTTTCC-BHQ2, 515K: TAGCCTGGATCTCCTTGGTG, 515-R5: ACAGAGCGAACCAAGAATGC, 515-P10: HEX-CTGCTGAGGTTGCAGTTTC-BHQ2, Additionally, the dye carboxy-X-rhodamine (ROX) is used as a source of fluorescence in TaqMan probes at the 5' end, and Black Hole Quencher-2 (BHQ2) is used at the 3' end to quench fluorescence, and the result is considered positive if the threshold cycle value (Ct) for the sample is no more than 35.

Images