RU2801708C2 - Hemaglutinin mutants of the influenza virus - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following is described: a modified influenza H3 hemagglutinin (HA) protein for producing a virus-like particle (VLP), wherein the HA protein contains an amino acid sequence containing at least one substitution compared to the corresponding wild-type amino acid sequence, wherein at least one substitution is a substitution of one or more than one amino acid corresponding to amino acids at position 382, 384, 392, or 431 of the reference sequence of SEQ ID NO: 92. Also a nucleic acid for producing a modified influenza H3 HA protein, wherein the nucleic acid contains a nucleotide sequence encoding the modified influenza H3 HA protein is described. Also the following is provided: a virus-like particle (VLP) for inducing an immune response to influenza infection in a subject, the VLP comprising a modified influenza H3 hemagglutinin (HA) protein and a method of producing such a VLP in a plant, a plant part, or a plant cell. Such a plant or a part of a plant or a plant cell is represented. The use of VLP to induce immunity to influenza infection in a subject is described, including in the form of a composition. Also a method of increasing the production yield of influenza virus-like particles (VLPs) in a plant, a plant part, or a plant cell is provided.

EFFECT: invention expands the arsenal of agents to prevent influenza.

17 cl, 9 dwg, 7 tbl, 4 ex

Description

The field of technology to which the present invention relates

[0001] The present invention relates to the production of mutant viral proteins in plants. More specifically, the present invention relates to the production and enhancement of the production of influenza virus-like particles in plants.

Background of the Invention

[0002] Influenza viruses are enveloped single-stranded RNA viruses of the Orthomyxoviridae family. Influenza viruses are highly contagious and can cause mild to severe illness in all age groups.

[0003] Vaccination remains the most effective way to prevent influenza infection. Typically, vaccination is carried out using live attenuated or whole inactivated forms of the virus that elicit an immune response when administered to a patient. To eliminate the potential risk of live attenuated and whole inactivated viruses re-acquiring the ability to replicate and become infectious, vaccines containing recombinant viral proteins have also been used to induce protective immunity to influenza infection.

[0004] However, the use of recombinant viral proteins as an immunogenic component of vaccines has a number of limitations. First, in the absence of a complete set of viral proteins and genetic components necessary for optimal expression and proper folding of proteins, the yield of recombinant viral proteins in standard in vitro expression systems may not be sufficient for the purpose of vaccine production. Second, vaccines with recombinant viral proteins may exhibit low immunogenicity due to misfolding, poor antigen presentation, and/or generation of a predominantly humoral immune response that is ineffective in conferring long-term protective immunity.

[0005] There are four types of influenza virus: A, B, C and D, of which influenza A and B are the causative agents of seasonal epidemics of diseases in humans.

[0006] Influenza A viruses are further subdivided based on the expression of hemagglutinin (HA) and neuraminidase (NA) glycoprotein subtypes on the surface of the virus. There are 18 different subtypes of HA (H1-H18).

[0007] HA is a trimeric lectin that facilitates binding of the influenza virus particle to sialic acid-containing proteins on the surface of target cells and mediates the release of the viral genome into the target cell. HA proteins contain two structural elements: a head, which is the main target of seroprotective antibodies, and a stem. HA is translated as a single HA0 polypeptide (assembled as trimers) that must be cleaved by a serine endoprotease between the HA1 (~40 kDa) and HA2 (~20 kDa) subdomains. After cleavage, the two domains of the disulfide-linked protein assume the necessary conformation required for viral infectivity. HA1 forms a globular head domain containing a receptor binding site (RBS) and RBS is the least conserved segment of the influenza virus. HA2 is a single-pass integral membrane protein with a fusion peptide (FP), soluble ectodomain (SE), transmembrane (TM) and cytoplasmic tail (CT) with corresponding lengths of approximately 25, 160, 25 and 10 residues. HA2, together with the N- and C-terminal residues of HA1, forms a "leg" domain that includes the transmembrane region and is relatively conserved.

[0008] Various mutations have been investigated in influenza virus proteins, especially in influenza HA.

[0009] For example, Castelán-Vega et al. (Adv Appl Bioinform Chem. 2014; 7:37-44) used a stability prediction algorithm to compare 7479 full-length amino acid sequences of HA from influenza A (H1N1)pdm09 virus and identified that D104N, A259T, S124N and E172K mutations resulted in the predicted increase in stability ON the flu. On the contrary, mutations S206T, K285E and E47K were characterized by a predicted destabilizing effect on HA.

[0010] In comparing the sequences of the original influenza A (H1N1)pdm [A/California/7/2009] and the later influenza strain [A/Brisbane/10/2010], Cotter et al. (PLoS Pathog. 2014; 10(1):e1003831) identified that the E47K mutation in the A/California/07/09 HA stem region stabilized the trimer structure, lowered the pH for membrane fusion, and increased the thermal and acidic stability of the virus. Cotter et al. further observed that the E47K A/California/7/2009 HA mutant was more infectious to ferrets than its wild-type counterpart.

[0011] Antanasijevic et al. (J Biol Chem. 2014;289(32):22237-45) examined the structural-functional properties of the loop-on-stem region of H5 HA by site-directed mutagenesis at 14 different positions. A/Vietnam/1203/04 (H5N1) mutants were expressed in HEK 293T cells, and Antanasijevic reported that most mutations in the loop-on-stem region did not impair expression, proteolytic processing, virus assembly, or receptor binding. However, Antanasijevic observed that the mutants HA1-D26K, HA1-M102L, HA2-V52A and HA2-I55A (based on H3 numbering) show significantly reduced levels of total HA, suggesting reduced expression and/or assembly of HA into viral particles. The HA1-D26K, HA2-T49A and HA2-M102L mutants also showed lower hemagglutination titers compared to the wild-type virus. Antanasijevic additionally observed that all single mutants show reduced A549 cell uptake into lung cells, with the HA1-D26K and HA2-I55A mutants being the most affected. Antanasijevic also demonstrated that the HA2-L99A mutant was more sensitive to inhibition of A549 lung cells by neutralizing C179 antibody compared to wild-type virus, suggesting that the mutation enhances antibody binding and/or neutralizing mode of action. In contrast, the HA1-I28A, HA1-M31A, HA1-M31L, HA2-I45A and HA2-I55V mutants were less sensitive to entry inhibition by the neutralizing antibody C179.

[0012] International application publication WO 2013/177444 and companion publication Lu et al. (Proc Natl Acad Sci USA. 2014; 111(1): 125-30) reports a method for obtaining a properly folded HA stem domain from A/California/05/2009 (H1N1) using an Escherichia coli cell-free protein expression system and a simple refolding protocol. To induce trimerization of the HA stem domain, either chloramphenicol acetyltransferase (CAT) or the assembly domain was fused to the C-terminus of HA. To reduce the newly revealed hydrophobicity and/or the formation of pairs of intermolecular ions causing aggregation of the expressed HA stem protein, five groups of mutations were evaluated: M1 (I69T + I72E + I74T + C77T); M2 (I69T + I72E + I74T + C77T + F164D); M3 (I69T + I72E + I74T + C77T + F164D + L174D); M4 (F164D) and M5 (F164D + L174D). Lu observed that the M5 mutations (F164D + L174D) were the most influential mutations for improving the solubility of HA stem proteins. Additional deletions (H38 to C43 and C49 to N61) and C77T mutations were introduced into the M5 mutants to avoid formation of unwanted disulfide bonds, reduce surface hydrophobicity and pI, and avoid regions of disordered structure.

[0013] U.S. Application No. 13/838796 and related publication Holtz et al. (ВМС Biotechnology. 2014; 14:111) it is reported about the increased stability and preservation of the activity of recombinant HA due to the mutation of cysteine residues in the carboxy-terminal region of the HA protein, including the transmembrane (TM) and cytosolic domain (CT). In particular, Holtz et al. show mutations C539A, C546A, C549A, C524S and C528A in recombinant HA Perth/16/2009 (H3N2). Mutation of all five cysteine residues, or various subsets thereof, resulted in yields, purity, particle size, hemagglutination activity, and thermal stability of HA comparable to wild-type recombinant HA protein. On the contrary, mutations in C64S and C76S led to a significant decrease in HA expression, which indicates the critical role of these residues in intrinsic HA folding. Using a simple radial immunodiffusion (SRID) assay, Holtz et al. also show that five mutations of cysteine residues improve the activity of recombinant HA compared to the wild-type protein by preventing cross-linking of disulfides in the TM and CT domains. The mutant HA proteins remain active for at least 12 months at 25° C., while the wild-type HA protein showed less than 40% activity only 50 days after purification.

[0014] International application publication WO 2015/020913 reports the mutation of specific residues at one or more positions selected from the group of 403, 406, 411, 422, 429, 432, 433 and 435 of influenza A virus /Puerto Rico/8/ 1934 (H1N1), to tyrosine. These mutations promote the formation of dityrosine crosslinks that stabilize or "lock" the influenza HA stem domain in its native trimeric conformation.

[0015] WO 2013/079473 discloses a modified influenza HA lacking the globular head domain. The polypeptide described in the publication of international application WO 2013/079473 contains a HA1 domain in which amino acids 53 to 620 (with reference to the numbering A/Brisbane/59/2007 [H1N1]) are deleted and replaced by a covalently linked sequence of 0-10 amino acids , and a HA2 domain, wherein the C-terminal amino acid of the HA1 domain is an amino acid other than arginine or lysine, and wherein one or more amino acids at positions 406, 409, 413, and 416 are mutated to an amino acid selected from the group consisting of serine, threonine , asparagine, glutamine, arginine, histidine, lysine, aspartic acid, glutamic acid and glycine.

[0016] WO 2014/191435 similarly describes a modified influenza HA comprising a HA1 domain in which the deleted segment is replaced by a covalently linked sequence of 0 to 50 amino acids and a HA2 domain, wherein the HA is resistant to cleavage at the junction between HA1 and HA2 and wherein one or more amino acids at positions 337, 340, 352, 353, 402, 406, 409, 413 and/or 416 have been mutated.

[0017] Virus-like particles (VLPs) are potential candidates for inclusion in immunogenic compositions. VLPs are very similar to mature virions, but they do not contain viral genomic material. Therefore, VLPs are non-replicating in nature, making them safe to administer as a vaccine. In addition, VLPs can be engineered to express viral glycoproteins on the surface of the VLP, which is their most natural physiological configuration. Moreover, since VLPs are similar to intact virions and are multivalent particulate structures, VLPs may be more effective in inducing neutralizing anti-glycoprotein antibodies than soluble envelope protein antigens.

[0018] VLPs have been produced in plants (see, for example, International Application Publications WO 2009/076778; WO 2009/009876; WO 2009/076778; WO 2010/003225; WO 2010/003235; WO 2010/006452; WO 2011/03 522 ; WO 2010/148511 and WO 2014153674, which are incorporated herein by reference).

[0019] International application WO 2009/076778 describes a method for producing influenza VLPs in plants, which involves the introduction of a nucleic acid containing a regulatory region active in a plant, operably linked to a nucleotide sequence encoding influenza HA from influenza type A or type B.

[0020] WO 2009/009876 describes a method for producing influenza HA VLPs in plants, in which influenza HA self-assembles into VLPs in plant cells and buds from plant cell membranes.

[0021] International application WO 2010/003225 discloses a method for producing influenza HA VLPs in plants, comprising introducing a nucleic acid containing a regulatory region active in a plant operably linked to a nucleotide sequence encoding influenza HA from A/California/04/09 (H1N1).

[0022] International application WO 2010/006452 reports the production of VLPs containing modified influenza HA proteins with glycosylation sites at positions 154, 165, 286, or combinations thereof (with reference to numbering A/Vietnam/1194/04 [H5N1] ) were abolished by mutating the residues at the indicated positions into amino acids other than asparagine. WO 2010/006452 also teaches that the amino acids at positions 156, 167, 288, or combinations thereof, can be mutated to residues other than serine or threonine to similarly abolish the N-linked "N-X-S/T" glycosylation signal triad . By selectively removing glycosylation sites located in the globular head of the HA protein, WO 2010/006452 demonstrates that the resulting HA protein is characterized by increased antigenicity and broader cross-reactivity.

[0023] In the publication of the international application WO 2011/035422, a method for obtaining VLPs of plant origin is reported, including: obtaining a plant or plant substance containing VLPs localized in the apoplast; obtaining a protoplast/spheroplast fraction and an apoplast fraction; and isolating the apoplast fraction containing plant VLPs.

[0024] International application WO 2010/148511 discloses a method for producing influenza VLPs in plants, the VLPs containing chimeric HA proteins. Chimeric HA proteins contain a stem domain cluster containing subdomains F'1, F'2 and F; a head domain cluster containing subdomains RB, E1 and E2; and a trans membrane domain cluster comprising a trans membrane domain and a C-terminal tail domain, wherein at least one subdomain is derived from a first influenza strain and the other subdomains are derived from one or more second influenza strains.

[0025] WO 2014/153674 discloses a process for producing influenza VLPs in a plant, wherein the VLPs comprise a modified influenza HA containing a modified proteolytic loop. The modified proteolytic loop comprises the removal of a proteolytic cleavage site between the HA1 and HA2 domains of the HA0 precursor. Thus, the HA protein is stabilized and higher protein yields are achieved compared to native HA protein.

The essence of the present invention

[0026] The present invention relates to the production of modified influenza virus proteins in plants. More specifically, the present invention relates to the production and enhancement of the production of influenza virus-like particles (VLPs) in plants, the VLPs containing modified influenza viral proteins, for example, a modified haemagglutinin (HA) protein.

[0027] The purpose of the present invention is to provide an improved method for increasing the production of influenza VLPs in plants.

[0028] In accordance with the present invention, the following is provided:

[0029] A. A nucleic acid comprising a nucleotide sequence encoding a modified influenza H3 hemagglutinin (HA) protein, wherein the HA protein comprises an amino acid sequence containing at least one substitution compared to the corresponding wild-type amino acid sequence, wherein at least one substitution is a substitution of one or more amino acids corresponding to amino acids at position 382, 384, 392, or 431 of A/Hong Kong/4801/14 HA.

[0030] The HA protein may comprise an amino acid sequence with a non-asparagine substitution at the amino acid corresponding to the amino acid at position 382 of A/Hong Kong/4801/14 HA. The HA protein may comprise an amino acid sequence with an alanine substitution or a conservative alanine substitution at the amino acid corresponding to the amino acid at position 382 of A/Hong Kong/4801/14 HA.

[0031] The HA protein may comprise an amino acid sequence with a non-leucine substitution at the amino acid corresponding to the amino acid at position 384 of A/Hong Kong/4801/14 HA. The HA protein may comprise an amino acid sequence with a valine substitution or a conservative valine substitution at the amino acid corresponding to the amino acid at position 384 of A/Hong Kong/4801/14 HA.

[0032] The HA protein may comprise an amino acid sequence with a non-phenylalanine substitution at the amino acid corresponding to the amino acid at position 392 of A/Hong Kong/4801/14 HA. The HA protein may comprise an amino acid sequence substituted with aspartic acid or a conservative substitution of aspartic acid at the amino acid corresponding to the amino acid at position 392 of A/Hong Kong/4801/14 HA.

[0033] The HA protein may comprise an amino acid sequence with a non-leucine substitution at the amino acid corresponding to the amino acid at position 431 of A/Hong Kong/4801/14 HA. The HA protein may comprise an amino acid sequence with a methionine substitution or a conservative methionine substitution at the amino acid corresponding to the amino acid at position 431 of A/Hong Kong/4801/14 HA.

[0034] Also provided:

[0035] C. A nucleic acid comprising a nucleotide sequence encoding a modified H3 influenza virus hemagglutinin (HA) protein, wherein the HA protein comprises an amino acid sequence containing at least one substitution, as compared to the corresponding wild-type amino acid sequence, wherein at least at least one substitution is a substitution of one or more amino acids corresponding to amino acids at positions 382, 384, 392, 431, 524, 525, 526, or 528 of A/Hong Kong/4801/14 HA.

[0036] The HA protein may further comprise an amino acid sequence with a first substitution for a non-asparagine at the amino acid corresponding to the amino acid at position 382 A/Hong Kong/4801/14 HA, a second substitution for a non-cysteine at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third non-cysteine substitution at the amino acid corresponding to the amino acid at position 528 A/Hong Kong/4801/14 HA. The HA protein may further comprise an amino acid sequence with a first substitution for alanine or a conservative substitution of alanine at the amino acid corresponding to the amino acid at position 382 of A/Hong Kong/4801/14 HA, a second substitution for serine or a conservative substitution of serine at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third substitution for leucine or a conservative leucine substitution at the amino acid corresponding to the amino acid at position 528 of A/Hong Kong/4801/14 HA.

[0037] The HA protein may further comprise an amino acid sequence with a first non-leucine substitution at the amino acid corresponding to the amino acid at position 384 A/Hong Kong/4801/14 HA, a second non-cysteine substitution at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third non-cysteine substitution at the amino acid corresponding to the amino acid at position 528 A/Hong Kong/4801/14 HA. The HA protein may further comprise an amino acid sequence with a first substitution for valine or a conservative substitution for valine at the amino acid corresponding to the amino acid at position 384 of A/Hong Kong/4801/14 HA, a second substitution for serine or a conservative substitution for serine at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third substitution for leucine or a conservative leucine substitution at the amino acid corresponding to the amino acid at position 528 of A/Hong Kong/4801/14 HA.

[0038] The HA protein may further comprise an amino acid sequence with a first non-phenylalanine substitution at the amino acid corresponding to the amino acid at position 392 A/Hong Kong/4801/14 HA, a second non-cysteine substitution at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third non-cysteine substitution at the amino acid corresponding to the amino acid at position 528 A/Hong Kong/4801/14 HA. The HA protein may further comprise an amino acid sequence with a first substitution for aspartic acid or a conservative substitution of aspartic acid for the amino acid corresponding to the amino acid at position 392 of A/Hong Kong/4801/14 HA, a second substitution for serine or a conservative substitution of serine for the amino acid corresponding to the amino acid in position 524 of A/Hong Kong/4801/14 HA, and a third substitution for leucine or a conservative leucine substitution at the amino acid corresponding to the amino acid at position 528 of A/Hong Kong/4801/14 HA.

[0039] The HA protein may further comprise an amino acid sequence with a first non-leucine substitution at the amino acid corresponding to the amino acid at position 431 A/Hong Kong/4801/14 HA, a second non-cysteine substitution at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third non-cysteine substitution at the amino acid corresponding to the amino acid at position 528 A/Hong Kong/4801/14 HA. The HA protein may further comprise an amino acid sequence with a first substitution for methionine or a conservative substitution of methionine at the amino acid corresponding to the amino acid at position 431 of A/Hong Kong/4801/14 HA, a second substitution for serine or a conservative substitution of serine at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a third substitution for leucine or a conservative leucine substitution at the amino acid corresponding to the amino acid at position 528 of A/Hong Kong/4801/14 HA.

[0040] The HA protein may further comprise an amino acid sequence with a first substitution for non-asparagine at the amino acid corresponding to the amino acid at position 382 A/Hong Kong/4801/14 HA, a second substitution for non-leucine at the amino acid corresponding to the amino acid at position 384 A/Hong Kong/4801/14 HA, a third non-cysteine substitution at the amino acid corresponding to the amino acid at position 524 A/Hong Kong/4801/14 HA, and a fourth non-cysteine substitution at the amino acid corresponding to the amino acid at position 528 A/Hong Kong/4801 /14 ON. The HA protein may further comprise an amino acid sequence with a first substitution for alanine or a conservative substitution of alanine for the amino acid corresponding to the amino acid at position 382 of A/Hong Kong/4801/14 HA, a second substitution for valine or a conservative substitution of valine for the amino acid corresponding to the amino acid at position 384 A/Hong Kong/4801/14 HA, a third substitution with serine or a conservative substitution of serine at the amino acid corresponding to the amino acid at position 524 of A/Hong Kong/4801/14 HA, and a fourth substitution with leucine or a conservative substitution of leucine at the amino acid corresponding to the amino acid at position 528 A/Hong Kong/4801/14 ON.

[0041] The HA protein may further comprise an amino acid sequence with amino acid substitutions corresponding to amino acids at positions 525, 526 or 525 and 526 of A/Hong Kong/4801/14 HA, wherein the amino acid substitution at position 525 is not phenylalanine but the amino acid change at position 526 is a non-leucine change. The HA protein may further comprise an amino acid sequence with amino acid substitutions corresponding to amino acids at positions 525, 526, or 525 and 526 of A/Hong Kong/4801/14 HA, wherein the amino acid substitution at position 525 is a substitution for leucine or a conservative substitution for leucine, and the amino acid substitution at position 526 is a valine substitution or a conservative valine substitution.

[0042] Additionally provided is a HA protein encoded by recombinant nucleic acids as described in sections A or B, and a virus-like particle (VLP) containing a HA protein encoded by recombinant nucleic acids as described in sections A or B.

[0043] Thus, a modified HA protein is further provided, comprising an amino acid sequence containing at least one substitution compared to the corresponding wild-type amino acid sequence, wherein said at least one substitution is a substitution at one or more than one amino acid corresponding to amino acids at position 382, 384, 392 or 431 in A/Hong Kong/4801/14 HA.

[0044] According to another aspect, a modified H3 influenza virus hemagglutinin (HA) protein is provided, wherein the HA protein comprises an amino acid sequence containing at least one substitution compared to the corresponding wild-type amino acid sequence, wherein said at least one substitution is a substitution one or more amino acids corresponding to amino acids at positions 382, 384, 392, 431, 524, 525, 526 or 528 A/Hong Kong/4801/14 HA.

[0045] Also provided is a method for producing a virus-like particle (VLP) in a plant, plant part, or plant cell, comprising:

a) introducing the recombinant nucleic acid, as described in section A or B, into a plant, plant part, or plant cell; and

b) incubating the plant, plant part or plant cell under conditions that allow expression of the HA protein encoded by the recombinant nucleic acid to produce a VLP. The method may further comprise step c) collecting the plant, plant part or plant cell and purifying the VLP.

[0046] Also provided is a method for producing an influenza virus-like particle (VLP) in a plant, plant part, or plant cell, comprising:

a) providing a plant, plant part or plant cell containing the recombinant nucleic acid as described in section A or B; and

b) incubating the plant, plant part or plant cell under conditions that allow expression of the HA protein encoded by the recombinant nucleic acid to produce a VLP. The method may further comprise step c) collecting the plant, plant part or plant cell and purifying the VLP.

[0047] In addition, a method is provided for increasing the production yield of virus-like particles (VLPs) in a plant, plant part, or plant cell, comprising: a) introducing a recombinant nucleic acid A or B into a plant, plant part, or plant cell, or providing a plant, plant part or a plant cell containing recombinant nucleic acid A or B; and b) incubating the plant, plant part, or plant cell under conditions that allow expression of the HA protein encoded by the recombinant nucleic acid, thereby producing VLPs in higher yield than a plant, plant part, or plant cell expressing unmodified influenza HA protein. The method may further comprise step c) collecting the plant, plant part or plant cell and purifying the VLP.

[0048] The methods may further comprise introducing a second nucleic acid encoding a proton channel protein; wherein the plant, plant part, or plant cell is incubated under conditions that allow expression of the proton channel protein encoded by the second nucleic acid. The proton channel protein may be an M2 subtype A protein.

[0049] In addition, a VLP obtained by the method described below is provided.

[0050] The VLP may comprise one or more lipids derived from a plant, plant part, or plant cell, plant-specific N-glycans, modified N-glycans, or combinations thereof.

[0051] Also provided is a method for producing an antibody or antibody fragment, comprising administering the described VLP to a subject or host animal, thereby producing an antibody or antibody fragment. Also provided are antibodies or antibody fragments obtained by this method.

[0052] Also provided is a plant, plant part, or plant cell containing a recombinant nucleic acid A or B, or a HA protein encoded by a recombinant nucleic acid A or B. The HA protein can form a VLP. Accordingly, a plant, plant part, or plant cell is also provided, containing a VLP containing a HA protein encoded by a recombinant nucleic acid A or B.

[0053] Also provided is a composition for inducing an immune response comprising an effective dose of VLP as described herein and a pharmaceutically acceptable carrier, adjuvant, excipient, or excipient. Also provided is a method for inducing immunity to influenza infection in a subject, comprising administering the described VLP. VLP can be administered to a subject orally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.

[0054] In addition, a modified influenza hemagglutinin (HA) protein is provided, comprising an amino acid sequence characterized by sequence identity or sequence similarity of from about 30% to about 100% with respect to a sequence selected from the sequences of SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO : 47, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86 , SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98, provided that the influenza HA protein contains at least one substitution as described herein and is capable of forming a VLP, induces an immune response when administered to a subject , induces hemagglutination, or a combination thereof.

[0055] This brief disclosure of the present invention does not necessarily describe all the features of the present invention.

Brief description of graphic materials

[0056] These and other features of the present invention will become more apparent from the following description, in which reference is made to the accompanying drawings, where:

[0057] FIG. 1 shows the alignment of the amino acid sequences of hemagglutinin (HA) A/Bangkok/3007/15 (H3N2) (SEQ ID NO: 91); A/Hongkong/4801/14 (H3N2) (SEQ ID NO: 92); A/Minnesota/40/15 (H3N2) (SEQ ID NO: 93); A/South Australia/1/16 (H3N2) (SEQ ID NO: 94); A/Pennsylvania/09/15 (H3N2) (SEQ ID NO: 95); A/Switzerland/9715293/13 (H3N2) (SEQ ID NO: 96); A/Mississippi/16/16 (H3N2) (SEQ ID NO: 97); isolated residues match the amino acids N382, L384, F392, L431 of HA from strains of influenza H3 (H3N2), for example, A/Hongkong/4801/14 (H3N2) (SEQ ID NO: 92).

[0058] FIG. 2 shows hemagglutination titers of A/Switzerland/9715293/13 H3 wild type, N382A A/Switzerland/9715293/13 H3 mutant, L384V A/Switzerland/9715293/13 H3 mutant, F392D A/Switzerland/9715293/13 H3 mutant and mutant L431M A/Switzerland/9715293/13 H3.

[0059] FIG. 3 shows hemagglutination titers of A/Indonesia/5/2005 H5 wt, A/Egypt/N04915/2014 H5 wt, F393D A/Indonesia/5/2005 H5 mutant, F393D A/Egypt/N04915/2014 H5 mutant, N383 mutant A A/Indonesia/5/2005 H5 and mutant N383 A A/Egypt/N04915/2014 H5. Numbering according to A/Indonesia/5/2005.

[0060] FIG. 4A shows a schematic representation of vector 3045 (H3 A-Swi-9715293-13 (F392D)). In FIG. 4B shows a schematic representation of vector 3022 (H3 A-Swi-9715293-13 (L431M)). In FIG. 4C shows a schematic representation of vector 3023 (H3 A-Swi-9715293-13 (N382A)). In FIG. 4D shows a schematic representation of vector 3034 (H3 A-Swi-9715293-13 (L384V)).

[0061] In FIG. 5A shows a schematic representation of the 3556 vector (an In-Fusion cloning vector into an expression cassette based on CPMV 160 in addition to the M2 accessory protein under the control of the alfalfa plastocyanin promoter and terminator). In FIG. 5B shows a schematic representation of vector 1190 (an In-Fusion cloning vector into an expression cassette based on CPMV 160).

[0062] In FIG. 6A shows hemagglutination titers of A/Switzerland/9715293/13 H3 wild-type and CysTM A/Switzerland/9715293/13 H3 mutant.

[0063] FIG. 6B shows hemagglutination titers of A/Pennsylvania/09/2015 H3 wild-type and CysTM A/Pennsylvania/09/2015 H3 mutant.

[0064] FIG. 7A shows hemagglutination titers of A/Switzerland/9715293/13 H3 wild type, N382A A/Switzerland/9715293/13 H3 mutant, L384V A/Switzerland/9715293/13 H3 mutant, F392D A/Switzerland/9715293/13 H mutant 3, mutant L431M A/Switzerland/9715293/13 H3, A/Switzerland/9715293/13 H3 with modification of CysTM, mutant N382A + CysTM A/Switzerland/9715293/13 H3, mutant L384V + CysTM A/Switzerland/9715293/13 H3, mutant F392 D+ CysTM A/Switzerland/9715293/13 H3 and mutant L431M + CysTM A/Switzerland/9715293/13 H3. In FIG. 7B shows VLP yields after density gradient of CysTM A/Switzerland/9715293/13 H3 mutant, N382A + CysTM A/Switzerland/9715293/13 H3 mutant, L384V + CysTM A/Switzerland/9715293/13 H3 mutant, F392D + CysTM A/ mutant. Switzerland/9715293/13 H3 and the L431M + CysTM A/Switzerland/9715293/13 H3 mutant, expressed as a percentage of the CysTM A/Switzerland/9715293/13 H3 mutant. In FIG. 7C shows hemagglutination titers of A/Pennsylvania/09/2015 H3 wild-type, CysTM A/Pennsylvania/09/2015 H3 mutant, N382A + CysTM A/Pennsylvania/09/2015 H3 mutant, and L384V + CysTM A/Pennsylvania/09/2015 mutant. H3. In FIG. 7D shows the hemagglutination titers of the CysTM A/S mutant. Australia/1/16 H3 and mutant N382A + L384V + CysTM A/S. Australia/1/16 H3. In FIG. 7E shows the hemagglutination titers of the CysTM A/Hong Kong/4801/14 H3 mutant and the N382A + L384V + CysTM A/Hong Kong/4801/14 H3 mutant; mutant CysTM A/Minnesota/40/15 H3 and mutant N382A + L384V + CysTM A/Minnesota/40/15 H3; mutant CysTM A/S. Australia/1/16 H3 and mutant N382A + L384V + CysTM A/S. Australia/1/16 H3; mutant CysTM A/Bangkok/3007/15 H3 and mutant N382A + L384V + CysTM A/Bangkok/3007/15 H3; mutant CysTM A/Switzerland/9715293/13 H3 and mutant L384V + CysTM A/Switzerland/9715293/13 H3; mutant CysTM A/Mississippi/16/16 H3 and mutant N382A + L384V + CysTM A/Mississippi/16/16 H3.

[0065] FIG. 8A shows a schematic representation of vector 3340 (H3 A-HK-4801-14). In FIG. 8B shows a schematic representation of vector 3341 (H3 A-HK-4801-14). In FIG. 8C shows a schematic representation of vector 3375 (H3 A-HK-4801-14 (N382A+L384V)). On fig.8D shows a schematic representation of the vector 3914 (H3 A-Minn-40-15). In FIG. 8E shows a schematic representation of vector 3915 (H3 A-Minn-40-15 (N382A + L384V)). In FIG. 8F shows a schematic representation of vector 3924 (H3 A-SAus-1-16). In FIG. 8G shows a schematic representation of vector 3925 (H3 A-SAus-1-16 (N382A + L384V)). In FIG. 8H shows a schematic representation of vector 3904 (H3 A-Bang-3007-15). In FIG. 8I shows a schematic representation of vector 3905 (H3 A-Bang-3007-15 (N382A + L384V)). In FIG. 8J shows a schematic representation of vector 2801 (H3 A-Swi-9715293-13). In FIG. 8K shows a schematic representation of vector 2811 (H3 A-Swi-9715293-13). In FIG. 8L shows a schematic representation of vector 3063 (H3 A-Swi-9715293-13 (N382A)). In FIG. 8M shows a schematic representation of vector 3074 (H3 A-Swi-9715293-13 (L384V)). In FIG. 8N shows a schematic representation of vector 3085 (H3 A-Swi-9715293-13 (F392D)). In FIG. 80 shows a schematic representation of vector 3062 (H3 A-Swi-9715293-13 (L431M)). In FIG. 8P shows a schematic representation of vector 3312 (H3 A-Penn-09-15). In FIG. 8Q shows a schematic representation of vector 3313 (H3 A-Penn-09-15). In FIG. 8R shows a schematic representation of vector 3314 (H3 A-Penn-09-15 (N382A)). In FIG. 8S shows a schematic representation of vector 3315 (H3 A-Penn-09-15 (L384V)).

[0066] FIG. 9A shows a schematic representation of vector 2295 (H5 A-Indo-5-05). In FIG. 9B shows a schematic representation of a 3680 vector (H5 A-Indo-5-05 (F393D)). In FIG. 9C shows a schematic representation of vector 3645 (H5 A-Egypt-N04915-14). In FIG. 9D shows a schematic representation of the vector 3690 (H5 A-Egypt-N04915-14 (F392D)).

Detailed description of the present invention

[0067] The following description relates to the preferred embodiment.

[0068] As used herein, the terms "comprising", "having", "including", "consisting of" and their grammatical variations are inclusive or open-ended and do not exclude additional, uncited elements and/or method steps. The term "consisting essentially of" when used herein in connection with a product, application, or method, means that additional elements and/or method steps may be present, but these additions do not significantly affect the method by which the set forth functions. method or application. The term "consisting of" when used herein in connection with a product, application or method excludes the presence of additional elements and/or method steps. A product, use, or method described herein as comprising certain elements and/or steps may also, in certain embodiments, consist essentially of those elements and/or steps, and in other embodiments, consist of these elements and/or steps, whether or not specific embodiments are mentioned. In addition, the use of the singular includes the plural, and "or" means "and/or" unless otherwise noted. Unless otherwise indicated herein, all technical and scientific terms used in this document have the same meaning as generally understood by a person skilled in the art. As used herein, the term "approximately" refers to a deviation of approximately +/- 10% from the set value. It should be understood that such a change is always included in any given meaning provided herein, whether specifically mentioned or not. The use of the singular when used herein with the term "comprising" can mean "one", but it is also consistent with the meaning of "one or more", "at least one", and "one or more than one".

[0069] The term "plant", "plant part", "plant part", "plant matter", "plant biomass", "plant material", plant extract" or "plant leaves", as used herein, may include an entire plant, tissue, cells, or any fraction thereof, intracellular plant components, extracellular plant components, liquid or solid plant extracts, or a combination thereof, that is capable of providing a transcriptional, translational, and post-translational apparatus for the expression of one or more of the nucleic acids described in herein, and/or from which the expressed protein or VLP can be extracted and purified. Plants may include, without limitation, herbaceous plants. In addition, plants may include, without limitation, crops including, for example, canola, Brassica spp., corn, Nicotiana spp., (tobacco), e.g., Nicotiana benthamiana, Nicotiana rustica, Nicotiana, tabacum, Nicotiana alata, Arabidopsis thaliana, alfalfa, potato, sweet potato (Ipomoea batatus), ginseng, pea, oats, rice, soybean, wheat, barley, sunflower, cotton, corn, rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), safflower (Carthamus tinctorius).

[0070] As used herein, the term "plant part" refers to any part of a plant, including, but not limited to, leaves, stem, root, flowers, fruits, plant cells derived from leaves, stem, root, flowers, fruits, a plant extract obtained from leaves, stem, root, flower, fruit, or a combination thereof. As used herein, the term "plant extract" refers to a plant product that is obtained after processing a plant, plant part, plant cell, or combination thereof, physically (for example, by freezing followed by extraction in a suitable buffer), mechanically (for example, by grinding or homogenizing plant or plant parts followed by extraction in a suitable buffer), enzymatically (eg using cell wall degrading enzymes), chemically (eg using one or more chelators or buffers), or combinations thereof. The plant extract can be further processed to remove unwanted plant components such as cell wall debris. A plant extract may be prepared to aid in the extraction of one or more components from a plant, plant part, or plant cell, such as a protein (including protein complexes, protein surface structures, and/or VLPs), a nucleic acid, a lipid, a carbohydrate, or a combination thereof. from a plant, plant part, or plant cell. If a plant extract contains proteins, it may be referred to as a protein extract. The protein extract may be a crude plant extract, a partially purified plant or protein extract, or a purified product that contains one or more proteins, protein complexes, protein suprastructures, and/or VLPs from plant tissue. If desired, the protein extract or plant extract may be partially purified using techniques known to those skilled in the art, e.g., the extract may be subjected to salt or pH precipitation, centrifugation, density gradient centrifugation, filtration, chromatography, e.g. size exclusion chromatography, ion exchange chromatography, affinity chromatography or a combination thereof. The protein extract can also be purified using techniques known to those skilled in the art.

[0071] As used herein, the term "construct", "vector", or "expression vector" refers to a recombinant nucleic acid for transferring exogenous nucleic acid sequences into host cells (e.g., plant cells) and directing expression of the exogenous nucleic acid sequence in cells -owners. "Expression cassette" refers to a nucleotide sequence containing a nucleic acid of interest that is under the control of and operably (or operably) linked to a suitable promoter or other regulatory elements for transcription of the nucleic acid of interest in a host cell. As will be appreciated by one of skill in the art, an expression cassette may contain a termination sequence (terminator), which is any sequence that is active in the host plant. For example, the termination sequence may be derived from the RNA-2 genome segment of a bipartite RNA virus, such as comovirus, the termination sequence may be the NOS terminator, or the terminator sequence may be derived from the 3'UTR of the alfalfa plastocyanin gene.

[0072] The constructs of the present disclosure may further comprise a 3' untranslated region (UTR). The 3' untranslated region contains the polyadenylation signal and any other regulatory signals capable of influencing mRNA processing or gene expression. The polyadenylation signal is typically characterized by the addition of polyadenylic acid tracks to the 3' end of the mRNA precursor. Polyadenylation signals are generally recognized by the presence of homology to the canonical form 5'AATAAA-3', although variations are not uncommon. Non-limiting examples of suitable 3' regions are 3' transcribed untranslated regions containing the polyadenylation signal of Agrobacterium tumor-inducing plasmid (Ti) genes such as nopaline synthase (Nos gene) and plant genes such as soybean storage protein genes, ribulose-1 gene, Small subunit 5-bisphosphate carboxylase (ssRUBISCO; US 4962028; which is incorporated herein by reference), a promoter used to regulate the expression of plastocyanin.

[0073] By "regulatory region", "regulatory element", or "promoter" is meant the portion of a nucleic acid, usually, but not always, before the protein-coding region of a gene, which may be composed of DNA or RNA, or both DNA and RNA . When the regulatory region is active and operably linked or operably linked to a nucleotide sequence of interest, this can result in the expression of the nucleotide sequence of interest. A regulatory element may be able to mediate organ specificity or control gene activation during development or over time. "Regulatory region" includes promoter elements, basic promoter elements that exhibit basal promoter activity, elements that are induced in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. As used herein, "regulatory region" also includes elements that are active after transcription, such as regulatory elements that modulate gene expression, such as translational and transcriptional enhancers, translational and transcriptional repressors, activating sequences upstream of transcription, and instability determinants. mRNA. Some of these last elements may be located near the coding region.

[0074] In the context of the present disclosure, the term "regulatory element" or "regulatory region" generally refers to a DNA sequence, usually, but not always, upstream of transcription (5') from the coding sequence of a structural gene that controls expression coding region, providing recognition for RNA polymerase and/or other factors necessary to initiate transcription at a particular site. However, it should be understood that other nucleotide sequences located within the introns or 3' sequences may also contribute to the regulation of expression of the coding region of interest. An example of a regulatory element that provides recognition for RNA polymerase or other transcription factors to allow initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence consisting of adenosine and thymidine base pairs, typically located about 25 base pairs upstream of the transcription start site. The promoter element may contain a basal promoter element responsible for initiating transcription, as well as other regulatory elements that alter gene expression.

[0075] There are several types of regulatory regions, including those that are developmentally regulated, inducible, or constitutive. A regulatory region that is developmentally regulated or controls the differential expression of a gene under its control is activated in certain organs or tissues of an organ at certain times during the development of that organ or tissue. However, some regulatory regions that are developmentally regulated may preferentially be active in certain organs or tissues at certain developmental stages, they may also be active in a developmentally regulated manner or at a basal level in other plant organs or tissues. Examples of tissue-specific regulatory regions, such as specific regulatory regions, include the napin promoter and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125 -130). An example of a leaf-specific promoter includes the plastocyanin promoter (see US Pat. No. 7,125,978, which is incorporated herein by reference).

[0076] An inducible regulatory region is a region that is capable of directly or indirectly activating the transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, DNA sequences or genes will not be transcribed. Typically, a protein factor that specifically binds to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to an active form by an inducer. However, the protein factor may also be absent. The inducer may be a chemical agent such as a protein, metabolite, growth regulator, herbicide, or phenolic compound, or physiological stress caused directly by heat, cold, salt, or toxic elements, or indirectly through the action of a pathogen or disease agent, such as a virus. A plant cell containing an inducible regulatory region can be exposed to the inducer by externally exposing the cell or plant to the inducer, for example, by spraying, watering, heating, or the like. Inducible regulatory elements can be derived from both plant and non-plant genes (eg, Gatz, C. and Lenk, I.R.P., 1998, Trends Plant Sci. 3, 352-358). Examples of potential inducible promoters include, without limitation, tetracycline inducible promoter (Gatz, C., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108), steroid inducible promoter (Aoyama, T. and Chua, N.H., 1997, Plant J. 2, 397-404) and an ethanol inducible promoter (Salter, M.G., et al, 1998, Plant Journal 16, 127-132; Caddick, M.X., et al., 1998, Nature Biotech. 16, 177-180), cytokinin-induced IB6 and CKI1 genes (Brandstatter, I. and Kieber, J.J., 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985) and auxin-induced element DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971).

[0077] The constitutive regulatory region directs gene expression in various parts of the plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript (p35S; Odell et al., 1985, Nature, 313: 810-812; which is incorporated herein by reference), rice actin 1 (Zhang et al. , 1991, Plant Cell, 3: 1155-1165), actin 2 (An et al., 1996, Plant J., 10: 107-121) or tms 2 (US 5428147), and triose phosphate isomerase 1 genes (Xu et Al., 1994, Plant Physiol. 106: 459-467), maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al. , 1995, Plant Mol. Biol. 29: 637-646), tobacco translation initiation factor 4A gene (Mandel et al., 1995 Plant Mol. Biol. 29: 995-1004), grape leaf vein mosaic virus promoter, pCAS (Verdaguer et al., 1996); ribulose bisphosphate carboxylase small subunit promoter, pRbcS: (Outchkourov et al., 2003), pUbi (for monocots and dicots).

[0078] As used herein, the term "constitutive" does not necessarily mean that the nucleotide sequence under the control of the constitutive regulatory region is expressed at the same level in all cell types, but that the sequence is expressed in a wide range of cell types, although fluctuation in abundance is often observed. .

[0079] Expression constructs as described above may be present in the vector. The vector may contain border sequences that allow the transfer and integration of the expression cassette into the genome of the organism or host. The construct may be a plant binary vector, for example a pPZP-based binary transformation vector (Hajdukiewicz, et al., 1994). Other illustrative constructs include pBin19 (see Frisch, D.A., L.W. Harris-Haller, et al., 1995, Plant Molecular Biology 27: 405-409).

[0080] As used herein, the term "native", "native protein" or "native domain" refers to a protein or domain having a primary amino acid sequence identical to the wild type. Native proteins or domains can be encoded by nucleotide sequences having 100% sequence similarity to the wild type sequence. The native amino acid sequence may also be encoded by a human codon-optimized (hCod) nucleotide sequence or a nucleotide sequence containing increased GC content compared to a wild-type nucleotide sequence, provided that the amino acid sequence encoded by the hCod nucleotide sequence exhibits 100% sequence identity to relative to the natural amino acid sequence.

[0081] By a nucleotide sequence that is "human codon-optimized" or "hCod" nucleotide sequence, is meant the selection of suitable DNA nucleotides for the synthesis of an oligonucleotide sequence or fragment thereof that approximates the codon usage typically found in the oligonucleotide sequence of the nucleotide sequence person. By "increased GC content" is meant the selection of appropriate DNA nucleotides for synthesizing an oligonucleotide sequence or fragment thereof to approximate a codon usage frequency that, compared to a corresponding natural oligonucleotide sequence, is characterized by an increase in GC content in a ratio of, for example, from about 1 to about 30%. or any number in between, the length of the coding portion of the oligonucleotide sequence. For example, from about 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30%, or any number in between, along the length of the coding region of the oligonucleotide sequence. As described below, a nucleotide sequence with an optimized human codon or a nucleotide sequence containing an increased GC contact (compared to a wild-type nucleotide sequence) shows increased expression in a plant, plant part, or plant cell compared to non-human optimized (or with lower GC content) nucleotide sequence.

[0082] Modified influenza hemagglutinin (HA) proteins (also referred to as modified HA protein, modified influenza HA protein, modified HA, modified influenza HA, HA mutant, influenza HA mutant, influenza HA variants, or HA variants) and methods for producing modified influenza HA proteins in plants are described in this document. The modified influenza HA proteins described herein contain modifications or mutations that have been found to result in improved HA performance over wild-type or unmodified HA proteins. For example, the modified influenza HA protein may contain an amino acid sequence with at least one amino acid substitution compared to the corresponding wild-type amino acid sequence.

[0083] Examples of improved performance of the modified HA protein include increased yield of the HA protein when expressed in plant cells compared to wild-type or unmodified HA of the same influenza strain or subtype that does not contain the modification(s) or mutation(s); improved haemagglutination titer of the modified HA protein compared to wild-type HA protein or unmodified HA protein; improved integrity, stability, or both integrity and stability of virus-like particles (VLPs) that are composed of modified HA proteins, compared to the integrity, stability, or both, of VLPs containing wild-type HA that do not contain the modification(s) or mutation(s); increased yield of VLP when expressed in plant cells compared to the level of production of wild-type VLP, which does not contain the modification(s) or mutation(s); and their combination.

Subtypes and strains of influenza

[0084] As used herein, the term "influenza virus subtype" refers to variants of the influenza A virus that are characterized by different combinations of the viral surface proteins hemagglutinin (H or HA) and neuramidase (N). As used herein, influenza virus subtypes and haemagglutinin (HA) from such virus subtypes may be referred to by their H number, eg, "H3 subtype HA", "H3 HA" or "H3 influenza". The term "subtype", in particular, includes all individual "strains" within each subtype, which usually result from mutations and can show different pathogenic profiles. Such strains may also be referred to as various "isolates" of the viral subtype. Accordingly, in the context of the present description, the terms "strains" and "isolates" can be used interchangeably.

[0085] Traditionally, different strains of influenza are classified based on, for example, the ability of influenza to agglutinate red blood cells (RBCs or erythrocytes). Antibodies specific to certain influenza strains can bind to the virus and thus prevent such agglutination. Assays that define strain types based on such inhibition are generally known as hemagglutinin inhibition assays (HI assays or HAI assays) and are standard and well known methods for characterizing influenza strains.

[0086] However, HA proteins from different virus strains also show significant sequence similarity at both the nucleic acid and amino acid levels. This level of similarity varies when strains of different subtypes are compared, with some strains clearly showing higher levels of similarity than others (Air, Proc. Natl. Acad. Sci. USA, 1981, 78:7643). Levels of amino acid similarity vary between viral strains of one subtype and viral strains of other subtypes (Air, Proc. Natl. Acad. Sci. USA, 1981, 78:7643). This variation is sufficient to establish discrete subtypes and evolutionary origins of different strains, but the DNA and amino acid sequences of different strains are still easily aligned using conventional bioinformatics techniques (Air, Proc. Natl. Acad. Sci. USA, 1981, 78:7643; Suzuki and Nei, Mol. Biol. Evol. 2002, 19:501).

[0087] Multiple nucleotide sequences or corresponding hemagglutinin (HA) polypeptide sequences can be aligned to determine a "consensus" or "consensus sequence" subtype (see FIG. 1).

[0088] Based on sequence similarity, influenza virus subtypes can be further classified by their phylogenetic group. Phylogenetic analysis (Fouchier et al., J Virol. 2005 Mar; 79(5):2814-22) has demonstrated a subdivision of HA, which is a division into two main groups (Air, Proc. Natl. Acad. Sci. USA, 1981, 78:7643): among others, subtypes H1, H2, H5 and H9 in phylogenetic group 1 and, inter alia, subtypes H3, H4 and H7 in phylogenetic group 2.

[0089] New influenza HA proteins, HA modifications, variants, and HA protein mutants are created by making changes to the amino acid sequence of the HA protein, resulting in improved HA characteristics, as described above. Isolation of nucleic acids encoding such HA molecules is commonplace, as is modification of the nucleic acid to introduce changes in the amino acid sequence, for example, by site-directed mutagenesis.

[0090] This document describes modified influenza HA proteins and methods for producing modified influenza HA proteins in plants. It has been observed that modification, for example by substitution of certain amino acids in HA proteins, eg HA from the H3 subtype, results in improved performance of the modified HA protein compared to wild-type HA protein or unmodified HA protein.

[0091] One or more modifications, mutations, or substitutions of the HA protein, as described herein, are not located in the globular head domain of the HA protein, are not located in known epitope regions of the HA protein, and these modifications, mutations, or substitutions do not add or remove glycosylation sites in the HA protein.

[0092] An HA protein, a mutant HA protein, or a modified HA protein, as described herein, is modified and contains one or more mutations, modifications, or substitutions in its amino acid sequence at any one or more amino acids that correspond to one or more than one mutation or modifications at any one or more amino acids that correspond to positions 382, 384, 392, 431, 524, 525, 526, 527 or 528 of the amino acid sequence A/Hong Kong/4801/14 (SEQ ID NO: 92; see Fig. 1 ).

[0093] By "corresponding to an amino acid" or "corresponding to an amino acid" is meant that an amino acid corresponds to an amino acid in a sequence alignment with a reference influenza strain, as described below.

[0094] The amino acid residue number or residue position of the HA corresponds to the HA numbering of the influenza reference strain. For example, in the case of H3 influenza, the reference strain could be A/Hong Kong/4801/14 [SEQ ID NO: 92 see FIG. 1]. The corresponding amino acid positions can be determined by aligning the HA sequences (eg H3 HA) with the HA sequence of their respective reference strain. Methods for aligning sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed, for example, using the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), using the homology alignment algorithm of Needleman & Wunsch a, J. Mol. Biol. 48:443 (1970), Pearson & Lipman, Proc. Nat'l. Acad. sci. USA 85:2444 (1988), using computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) or by manual alignment and visual checks (see, for example, Current Protocols in Molecular Biology (Ausubel et al., eds. 1995, appendix)). Alignment of the amino acid sequences of several influenza A virus HA domains, which should not be considered limiting, is shown in FIG.

[0095] When referring to modifications, mutants, or variants, the wild-type amino acid residue (also referred to simply as "amino acid") is followed by the residue number and the new or substituted amino acid. For example, a substitution of asparagine (N, Asn) for alanine (A, Ala) at residue or amino acid position 382 is designated N382A (see Table 1). 382(N382A).

[0096] Modified HAs, HA mutants, or variants, such as H3 modified HAs, are designated in the same way using the one letter amino acid code for the wild-type residue followed by its position and the one letter amino acid code for the substitution residue. Multiple mutants are indicated by component single mutants separated by a slash (/) or a plus sign (+). Mutations or modifications of the trans membrane (TM) domain or region are designated as (CysTM). For example, the H3 HA mutant N382A + L384V (CysTM) is a mutant in which alanine (A, Ala) replaces asparagine (N, Asp) at residue position 382, and valine (V, Val) replaces leucine (L, Leu ) at residue position 384, and the H3 HA mutant contains additional mutations in the transmembrane domain.

[0098] The modified influenza hemagglutinin (HA) protein may comprise an amino acid sequence containing at least one amino acid substitution compared to the corresponding wild-type amino acid sequence.

[0099] By "amino acid substitution" or "substitution" is meant the replacement of an amino acid in the amino acid sequence of a protein with another amino acid. The terms "amino acid", "amino acid residue" or "residue" are used interchangeably in this disclosure. One or more amino acids can be replaced with one or more amino acids that differ from the original or wild-type amino acid at that position without changing the overall length of the amino acid sequence of the protein. The substitution or substitution can be experimentally induced by changing the codon sequence in the nucleotide sequence encoding the protein to the codon sequence of a different amino acid compared to the original or wild-type amino acid. The resulting protein is a modified protein, such as a modified influenza HA protein. The modified influenza HA protein does not occur naturally.

[00100] The modified HA includes a non-naturally occurring HA protein containing at least one modification of natural HA and having improved characteristics compared to the natural HA protein from which the amino acid sequence of the modified HA is derived. Modified HA proteins contain an amino acid sequence that is not naturally occurring, which is formed by replacing one or more amino acid residues of the HA protein with one or more different amino acids.

[00101] Accordingly, modified HA, mutant HA, or recombinant HA refers to HA in which the DNA sequence encoding natural HA is modified to produce a modified or mutated DNA sequence that encodes a modification, mutation, or substitution of one or more amino acids in the amino acid sequence of HA .

[00102] Some of the residues identified for modification, mutation, or substitution correspond to conservative residues, while others do not. In the case of residues that are non-conservative, substitution of one or more amino acids is limited to substitutions that produce a modified HA whose amino acid sequence does not match that found in nature. In the case of conservative residues, such modification, substitution or substitutions should also not result in natural HA sequences.

Conservative substitutions

[00103] As described herein, residues in HA proteins can be identified and modified, replaced, or mutated to produce a modified HA protein or variants of the HA protein. Substitutions or mutations at specific positions are not limited to the amino acid substitutions described herein or exemplified. For example, HA variants may contain conservative substitutions of the described amino acid substitutions.

[00104] As used herein, the term "conservative substitution" and its grammatical variations refer to the presence of an amino acid residue in a HA protein sequence that is different from but belongs to the same amino acid class as the described substitution or the described residue (i.e., a non-polar residue , replacing a non-polar residue, an aromatic residue replacing an aromatic residue, a polar-uncharged residue replacing a polar-uncharged residue, a charged residue replacing a charged residue). In addition, conservative substitutions may include a residue having an interfacial hydropathy value of the same sign and, as a rule, the same magnitude as the residue replacing the wild-type residue.

[00105] As used herein, the term "non-polar residue" refers to glycine (G, Gly), alanine (A, Ala), valine (V, Val), leucine (L, Leu), isoleucine (I, Ile), and proline (P, Pro); the term "aromatic residue" refers to phenylalanine (F, Phe), tyrosine (Y, Tyr) and tryptophan (W, Trp); the term "polar uncharged residue" refers to serine (S, Ser), threonine (T, Thr), cysteine (C, Cys), methionine (M, Met), asparagine (N, Asn) and glutamine (Q, Gln); the term "charged residue" refers to the negatively charged amino acids aspartic acid (D, Asp) and glutamic acid (E, Glu), as well as the positively charged amino acids lysine (K, Lys), arginine (R, Arg), and histidine (H, his). Another classification of amino acids may be as follows:

• amino acids with a hydrophobic side chain (aliphatic): alanine (A, Ala), isoleucine (I, He), leucine (L, Leu), methionine (M, Met) and valine (V, Val);

• amino acids with a hydrophobic side chain (aromatic): phenylalanine (F, Phe), tryptophan (W, Tgr), tyrosine (Y, Tyr);

• amino acids with a polar neutral side chain: asparagine (N, Asn), cysteine (C, Cys), glutamine (Q, Gin), serine (S, Ser) and threonine (T, Thr);

• amino acids with electrically charged side chains (acid): aspartic acid (D, Asp), glutamic acid (E, Glu);

• amino acids with electrically charged side chains (basic): arginine (R, Arg); histidine (H, His); lysine (K, Lys), glycine (G, Gly) and proline (P, Pro).

[00106] Conservative amino acid substitutions are likely to have the same effect on the activity of the resulting HA protein variant or modified HA protein as the original substitution or modification. Further information on conservative substitutions can be found, for example, in Ben Bassat et al. (J. Bacteriol, 169:751-757, 1987), O'Regan et al. (Gene, 77:237-251, 1989), Sahin-Toth et al. (Protein ScL, 3:240-247, 1994), Hochuli et al. (Bio/Technology, 6:1321-1325, 1988) and widely used textbooks in genetics and molecular biology.

[00107] Blosum arrays are typically used to determine the relationship of polypeptide sequences. Blosum matrices were generated using a large database of robust alignments (BLOCKS database) that counted pairwise sequence alignments associated with identity less than some threshold percentage (Henikoff et al., Proc. Natl. Acad. Sci. USA, 89: 10915 -10919, 1992). For the highly conservative target frequencies of the BLOSUM90 matrix, an identity threshold of 90% was used. For the BLOSUM65 matrix, an identity threshold of 65% was used. Scores of zero and above in the Blosum matrices are considered "conservative substitutions" for the chosen percentage identity. The following table shows examples of conservative amino acid substitutions: Table 2.

[00108] The nucleotide sequence encoding the modified HA protein can be optimized for human codon usage, to increase GC content, or a combination thereof. The modified HA protein may be expressed in a plant, plant part, or plant cell.

A. MODIFICATIONS H3 ON I

[00109] Modified influenza H3 HA proteins and methods for producing modified influenza H3 HA proteins in plants are described herein. It has been observed that modification of specific amino acids in HA proteins from the H3 subtype results in improved performance of the modified HA H3 protein compared to wild-type H3 HA protein or unmodified HA H3 protein.

[00110] A total of 33 single, double and/or triple residue modifications that are not part of the transmembrane (TM) and cytosolic HA domain (TM) and/or residue modifications that are part of the transmembrane (TM) domain were investigated. and the cytosolic domain (CT) of HA, in relation to improving the characteristics of the H3 protein of HA. As described below and as shown in the examples, only modifications or combinations of modifications at certain positions improve the performance of the H3 HA protein. Modifications at 13 positions or combinations of positions adversely affected the characteristics of the H3 HA protein (data not shown).

[00111] Examples of improved performance of a HA mutant H3 protein or modified HA H3 protein include increased yield or accumulation of HA protein when expressed in plant cells compared to wild-type or unmodified HA of the same influenza strain or subtype that does not contain the modification( i) or mutation(s); improved hemagglutination titer of the modified or mutated HA protein compared to wild-type or unmodified HA protein; improved integrity, stability, or both the integrity and stability of VLPs that are composed of modified HA proteins, compared to the integrity, stability, or both, of wild-type HA-containing VLPs that do not contain the mutation(s); increased yield of VLP when expressed in plant cells compared to the level of production of wild-type VLP, which does not contain the modification(s) or mutation(s); and their combination.

[00112] A modified H3 HA protein or a mutant H3 HA protein as described herein is modified and contains one or more mutations or modifications at any one or more residues when aligned to positions 382, 384, 392 and/or 431 of the reference strain A/Hong Kong/4801/14 (SEQ ID NO: 92; see Fig. 1). Therefore, influenza H3 HA polypeptides, proteins and/or protein complexes, such as, for example, virus-like particles (VLPs), are provided that contain modifications or mutations at one or more amino acid positions 382, 384, 392, and 431, such amino acid numbering being based on sequence A/Hong Kong/4801/14 as shown in FIG. 1 (SEQ ID NO: 92), or at amino acid positions that correspond to such amino acid positions, for example, as determined by aligning the HA amino acid sequence with SEQ ID NO: 92. Non-limiting examples of influenza H3 HA amino acid sequences that contain one or more of these mutations , include SEQ ID NOs: 91, 92, 93, 94, 95, 96, and 97.

[00113] The modified H3 HA protein described herein includes an H3 HA protein with amino acid sequences that are characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98, 99, 100%, or any number in between, relative to the amino acid sequence encoding HA from H3 (SEQ ID NOs: 91-97), wherein the amino acid sequence contains one or more mutations or modifications at any one or more residues in the alignment of sequences at positions 382, 384, 392 and 431 of A/Hong Kong/4801/14 HA (SEQ ID NO: 92).

[00114] In addition, the H3 HA protein can be encoded by nucleotide sequences that are characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, with respect to the nucleotide sequence encoding HA from H3 (SEQ ID NOs: 91-97), wherein the H3 protein of HA contains one or more mutations or modifications at any one or more residues when aligning the sequences at positions 382, 384, 392 and 431 of A/Hong Kong/4801/14 HA (SEQ ID NO: 92), the nucleotide sequence encodes a hemagglutinin protein which, when expressed, forms a VLP.

[00115] Non-limiting examples of strains from which H3 HA may originate are A/Bangkok/3007/15 (H3N2) (SEQ ID NO: 91); A/Hongkong/4801/14 (H3N2) (SEQ ID NO: 92); A/Minnesota/40/15 (H3N2) (SEQ ID NO: 93); A/South Australia/1/16 (H3N2) (SEQ ID NO: 94); A/Pennsylvania/09/15 (H3N2) (SEQ ID NO: 95); A/Switzerland/9715293/13 (H3N2) (SEQ ID NO: 96) and A/Mississippi/16/16 (H3N2) (SEQ ID NO: 97).

Modification in position 382

[00116] In one aspect, an H3 HA is provided that may contain a modified residue at position 382 (numbered as A/Hong Kong/4801/14 HA, SEQ ID NO: 92).

[00117] Antanasijevic et al. (J Biol Chem. 2014; 289(32):22237-45) investigated the structural-functional properties of the H5 loop-on-stem region of HA by site-directed mutagenesis at 14 different positions. The mutated positions Thr ⁴¹ , Gln ⁴² , Ile ⁴⁵ , Asn ⁵³ and Leu ⁹⁹ of HA2 are highly conserved and were designed to analyze the importance of these residues for HA function. Antanasijevic observed that conserved mutations at positions HA1-I28V, HA2-T41A, HA2-T49A, HA2-N53A and HA2-D57E impair viral entry. In the case of a mutational effect on entry inhibition by the small MBX2329 molecule, substitutions for HA2-Ile ⁴⁵ , HA2-Val ⁵² , HA2-Asn ⁵³ , and HA2-Ser ⁵⁴ on the outer surface and HA2-Leu ⁹⁹ on the inner surface had the greatest effect. These residues are highly conserved in group 1 HA (eg H1 and H5). Position 53 in Antanasijevic's H5 HA corresponds to position 380 in the H1 HA and position 382 in the H3 HA of the current disclosure.

[00118] Surprisingly, modification of the conserved residue at position 380 in H1 HA from asparagine to alanine resulted in an approximately 80% reduction in the hemagglutination titer of the modified HA H1 compared to wild-type H1 HA (data not shown). An equivalent modification of HA from H5 also leads to a decrease in hemagglutination titer (see Fig. 3, table 7). However, changing the equivalent position in HA from H3 (N382A) from asparagine to alanine resulted in an approximately 130% increase in hemagglutination titer compared to wild-type HA (see Figure 2, Table 5).

[00119] Accordingly, the residue at position 382 of the H3 of HA can be modified so that it is not asparagine. For example, the residue at position 382 can be modified to be a hydrophobic amino acid, e.g., alanine, or a conservative alanine substitution, e.g., serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C , Cys) or valine (V, Val).

[00120] For example, the modified H3 HA protein may comprise an amino acid sequence that has sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, relative to the amino acid sequence HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains alanine (A, Ala) or a conservative alanine substitution ( A, Ala) at position 382 and the sequence is not found in nature. A conservative alanine substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val).

[00121] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA with a substitution at positions 382 as described above, operably linked to a regulatory region active in a plant.

[00122] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence encoding the HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains alanine (A, Ala) or a conservative substitution alanine (A, Ala) at position 382, and the sequence is not found in nature. A conservative substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val).

[00123] Nucleotide sequences can be characterized by sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains an alanine (A, Ala) or a conservative substitution of alanine (A, Ala) at position 382, and the sequence does not occur at nature. A conservative substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val).

[00124] In addition to the residue at position 382, residues at positions 384, 524, 525, 526, 527, 528, or any combination thereof, may be modified in H3 HA.

[00125] In addition, a method is provided for obtaining VLPs that contain a modified H3 HA substitution at least at position 382 and optionally at position 384, 524, 525, 526, 527, 528, or any combination thereof, in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00126] In addition, a method is provided to increase the yield of VLPs that contain a modified H3 HA with a substitution at least at position 382, and optionally substitutions at positions 384, 524, 525, 526, 527, 528, or any combination thereof, in a plant . The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00127] The present description further provides for a VLP containing H3 HA with a substitution at least at position 382 and optionally substitutions at positions 384, 524, 525, 526, 527, 528, or any combination thereof. VLP can be obtained by the method provided by the present description. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

Modification in position 384

[00128] According to another aspect, an H3 HA is provided that may contain a modified residue at position 384 (numbering A/Hong Kong/4801/14 HA, SEQ ID NO: 92).

[00129] As shown, for example, in FIG. 2 and Table 5, the presence of a residue at position 384 modified from leucine to valine results in an approximately 200% increase in hemagglutination titer compared to wild-type H3 HA.

[00130] Accordingly, the residue at position 384 of the H3 of HA can be modified to be non-leucine. For example, the residue at position 384 can be modified to be, for example, a valine or a conservative valine substitution that is not a leucine, such as isoleucine, methionine, alanine, or threonine.

[00131] For example, a modified H3 HA protein may contain an amino acid sequence that is characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, relative to the amino acid sequence HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains valine (V, Val) or a conservative valine substitution, which is not a leucine at position 384, the sequence is not naturally occurring, and the HA protein, when expressed, forms a VLP. A conservative replacement for valine may be, for example, isoleucine, methionine, alanine or threonine.

[00132] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA with a substitution at positions 384 as described above, operably linked to a regulatory region active in a plant.

[00133] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence encoding the HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains valine (V, Val) or a conservative substitution valine (V, Val), which is not a leucine, at position 384, the sequence is not naturally occurring, and the nucleotide sequence encodes an HA protein which, when expressed, forms a VLP. A conservative replacement for valine may be, for example, isoleucine, methionine, alanine or threonine.

[00134] Nucleotide sequences can be characterized by sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains valine (V, Val) or a conservative valine (V, Val) substitution that is not leucine at position 384 , wherein the sequence is not naturally occurring, and wherein the nucleotide sequence encodes an HA protein which, when expressed, forms a VLP. A conservative replacement for valine may be, for example, isoleucine, methionine, alanine or threonine.

[00135] In addition to the residue at position 384, residues at positions 382, 524, 525, 526, 527, 528, or any combination thereof, may be modified in H3 HA.

[00136] In addition, a method is provided for obtaining VLPs that contain a modified H3 HA with a substitution at least at positions 384, and optionally substitutions at positions 382, 524, 525, 526, 527, 528, or any combination thereof, in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00137] In addition, a method is provided for increasing the yield of VLPs that contain a modified H3 HA with a substitution at least at 384, and optionally with substitutions at positions 382, 524, 525, 526, 527, 528, or any combination thereof, as described above, in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00138] Provided herein is a VLP comprising an H3 HA with a substitution at least at position 384 and optionally substitutions at positions 382, 524, 525, 526, 527, 528, or any combination thereof. VLP can be obtained by the method provided in the present description. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

Modification in position 392

[00139] According to another aspect, an H3 HA is provided which may contain a modified residue at position 392 (numbering H3 A/Hong Kong/4801/14 HA, SEQ ID NO: 92).

[00140] As shown, for example, in FIG. 2 and Table 5, the presence of a residue at position 392 modified from phenylalanine to aspartic acid results in an approximately 140% increase in hemagglutination titer compared to wild-type H3 HA.

[00141] Accordingly, the residue at position 392 in H3 of HA can be modified so that it is not phenylalanine. For example, the residue at position 392 may be modified, for example, to be aspartic acid or a conservative substitution for aspartic acid, such as glutamic acid, asparagine, glutamine, or serine.

[00142] For example, a modified H3 HA protein may contain an amino acid sequence that is characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, with respect to the amino acid sequence HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains aspartic acid or a conservative substitution for aspartic acid, e.g., glutamic acid, asparagine, glutamine or serine at position 392, the sequence is not naturally occurring and the HA protein, when expressed, forms a VLP. A conservative substitution for aspartic acid may, for example, be glutamic acid, asparagine, glutamine or serine.

[00143] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA with a substitution at positions 392 as described above, operably linked to a regulatory region active in a plant.

[00144] For example, nucleotide sequences may have sequence identity or sequence similarity of about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence encoding the HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains aspartic acid or a conservative substitution of aspartic acid at position 392, wherein the sequence is not naturally occurring, and wherein the nucleotide sequence encodes an HA protein which, when expressed, forms a VLP. A conservative substitution for aspartic acid may, for example, be glutamic acid, asparagine, glutamine or serine.

[00145] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any the number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains aspartic acid or a conservative substitution of aspartic acid at position 392, wherein the sequence is not naturally occurring, and wherein the nucleotide sequence encodes an HA protein , which, when expressed, forms a VLP. A conservative substitution for aspartic acid may, for example, be glutamic acid, asparagine, glutamine or serine.

[00146] In addition, a method is provided for obtaining VLPs that contain a modified H3 HA with a substitution at least at 392 positions as described above in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00147] In addition, a method is provided to increase the yield of VLPs that contain a modified H3 HA with a substitution of at least 392 as described above in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00148] Provided herein is a VLP comprising an H3 HA with a substitution at least at position 392. A VLP can be produced by the method provided herein. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

Modification in position 431

[00149] According to another aspect, an H3 HA is provided which may contain a modified residue at position 431 (numbering H3 A/Hong Kong/4801/14 HA, SEQ ID NO: 92).

[00150] As shown, for example, in FIG. 2 and Table 5, the presence of a residue at position 431 modified from leucine to methionine results in an approximately 170% increase in hemagglutination titer compared to wild-type H3 HA.

[00151] Accordingly, the residue at position 431 in H3 of HA can be modified to be non-leucine. For example, the residue at position 431 may be modified, for example, to be methionine or a conservative replacement for methionine, such as leucine, isoleucine, glutamine, valine, or phenylalanine.

[00152] For example, a modified H3 HA protein may contain an amino acid sequence that is characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, with respect to the amino acid sequence HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains methionine or a conservative methionine substitution at position 431, wherein the sequence does not occur in nature and moreover, the HA protein, when expressed, forms a VLP. A conservative methionine substitution may be, for example, leucine, isoleucine, glutamine, valine or phenylalanine.

[00153] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA with a substitution at position 431 as described above, operably linked to a regulatory region active in a plant.

[00154] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any the number between them, with respect to the nucleotide sequence encoding the HA from H3 A/Hong Kong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains methionine or a conservative substitution of methionine at position 431, moreover, the sequence does not occur in nature and moreover, the nucleotide sequence encodes a HA protein, which, when expressed, forms a VLP. A conservative methionine substitution may be, for example, leucine, isoleucine, glutamine, valine or phenylalanine.

[00155] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any the number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains methionine or a conservative methionine substitution at position 431, the sequence is not naturally occurring, and the nucleotide sequence encodes a HA protein that forms a VLP when expressed. A conservative replacement for aspartic acid may, for example, be leucine, isoleucine, glutamine, valine or phenylalanine.

[00156] In addition, a method is provided for obtaining VLPs that contain a modified H3 HA with a substitution at least at position 431, as described above, in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00157] In addition, a method is provided to increase the yield of VLPs that contain a modified H3 HA with a substitution of at least 431 as described above in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00158] Provided herein is a VLP comprising an H3 HA with a substitution at least at position 431. A VLP can be produced by the method provided herein. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

B. MODIFICATIONS H3 ON II

Modification at position 382, 384, 392, 431 and/or 524-528 ("CysTM")

[00159] Modified influenza H3 HA proteins and methods for producing modified influenza H3 HA proteins in plants are described herein. It has been observed that modification of specific amino acids in HA proteins from the H3 subtype results in improved performance of the modified HA H3 protein compared to wild-type H3 HA protein or unmodified HA H3 protein.

[00160] In one aspect, cysteine residues at position 524 and/or 528 (numbering H3 A/Hong Kong/4801/14, SEQ ID NO: 92) or residues equivalent to these positions, as determined by alignment, can be replaced by residues no cysteine in these positions. In addition, the residues at position 525, 526 and/or 527 (numbering H3 A/Hong Kong/4801/14 HA) can also be modified. These modifications or substitutions may be referred to as "CysTM modification", "CysTM", "CysTM mutation", "CysTM replacement", or "CysTM substitution" or grammatically equivalent expressions.

[00161] U.S. Application No. 13/838796 and related publication Holtz et al. (BMC Biotechnology. 2014; 14: 111) report increased stability and activity of recombinant HA due to mutation of cysteine residues in the carboxy-terminal region of the HA protein, including the transmembrane (TM) and cytosolic domain (CT). In particular, Holtz et al. show mutations C539A, C546A, C549A, C524S and C528A in recombinant HA Perth/16/2009 (H3N2). Mutation of all five cysteine residues, or various subsets thereof, resulted in yields, purity, particle size, hemagglutination activity, and thermal stability of HA comparable to wild-type recombinant HA protein. In contrast, mutations of a pair of conserved cysteine residues in the ectodomain known to form a disulfide bond (C64S and C76S) resulted in a significant decrease in HA expression, indicating a critical role for these residues in HA self-folding. Using a simple one-dimensional radial immunodiffusion (SRID) assay, Holtz et al. also show that five cysteine residue mutations improve the performance of recombinant HA compared to wild-type protein by preventing disulfide cross-linking in the TM and CT domains. Mutant HA proteins remain active for at least 12 months at 25° C., while wild-type HA protein exhibits less than 40% activity only 50 days after purification.

[00162] Xu et al. (Virus Genes (2013) 47: 20-26) showed that mutant H3 HA with mutations of one or two TM cysteines (C540/544) can be correctly expressed in cells, however, the mutant exhibits lower heat resistance and increased fusion activity compared to proteins H3 HA wild type.

[00163] A total of 33 single, double or triple modifications in combination with transmembrane (TM) modifications as described herein ("TM Cys modification") were investigated to improve the performance of the H3 HA protein. As described below and as shown in the examples, only modifications or combinations of modifications at certain positions improve the performance of the H3 HA protein. Modifications at 13 positions or combinations of positions adversely affected the characteristics of the H3 HA protein (data not shown).

[00164] Examples of improved characteristics of the H3 HA mutant protein include increased yield of the HA protein when expressed in plant cells compared to wild-type or unmodified HA of the same influenza strain or subtype that does not contain the modification(s) or mutation(s) ; improved hemagglutination titer of the modified or mutated HA protein compared to wild-type HA protein or unmodified HA protein; improved integrity, stability, or both the integrity and stability of VLPs that are composed of modified HA proteins, compared to the integrity, stability, or both, of wild-type HA-containing VLPs that do not contain the mutation(s); increased yield of VLP when expressed in plant cells compared to the level of production of wild-type VLP, which does not contain the modification(s) or mutation(s); and their combination.

[00165] In one aspect, a modified H3 HA is provided containing cysteine residues at position 524 and/or 528 (numbering A/Hong Kong/4801/14) or residues equivalent to these positions, as determined by alignment, replaced with non-cysteine residues at these provisions. For example, cysteine residues at position 524 may be replaced with a serine (S, Ser) or a conservative serine substitution, or a cysteine at position 528 may be replaced with a leucine (L, Leu) or a conservative leucine substitution.

[00166] In addition, the sequence between the two cysteines at positions 524 and 528 (numbered A/Hong Kong/4801/14, SEQ ID NO: 92) can also be modified. For example, in the sequence "C ₅₂₄ X ₅₂₅ X ₅₂₆ X ₅₂₇ C ₅₂₈ " C524 (position 524) may be replaced by serine (S, Ser) or a conservative serine substitution; if X ₅₂₅ (position 525) is not leucine, the X ₅₂₅ residue may be substituted with leucine (L, Leu) or a conservative leucine substitution; if X ₅₂₆ (position 526) is not valine, X ₅₂₆ may be substituted by valine (V, Val) or a conservative valine substitution; if X ₅₂₇ (position 527) is not leucine, the residue at position X ₅₂₇ may be substituted with leucine (L, Leu) or a conservative leucine substitution and C ₅₂₈ (position 528) may be substituted with leucine (L, Leu) or a conservative leucine substitution . For example, in one embodiment, the sequence "CFLLC" at positions 524 to 528 may be replaced by the sequence "SLVLL" (SEQ ID NO: 98).

[00167] HA proteins from strains other than H3 influenza virus that contain cysteine residues at position 524 and/or 528 or residues equivalent to these positions, as determined by alignment, can also be modified as described below. For example, HA proteins from strains of influenza B virus that contain cysteine residues at positions that are equivalent to position 524 and/or 528 H3 of HA can be modified to non-cysteine residues as described below.

[00168] In addition to transmembrane domain mutation as described herein, the modified HA H3 proteins may additionally contain one or more amino acid substitutions at positions 382, 384, 392, and/or 431, resulting in improved characterization of the modified HA3 or VLP protein. obtained using the modified HA protein. It should be understood that improved characterization is not limited to substitution of a particular amino acid at certain sites, as one skilled in the art will appreciate that amino acids with similar properties can be substituted for amino acids at the identified positions.

[00169] Accordingly, a modified H3 HA protein or a mutant H3 HA protein as described herein may contain one or more mutations or modifications at any one or more residues when aligned with sequences at positions 382, 384, 392, 431, 524, 525, 526, 527 or 528 of reference strain H3 A/Hong Kong/4801/14 (SEQ ID NO: 92; see FIG. 1). Therefore, influenza H3 HA polypeptides, proteins and/or protein complexes, such as, for example, virus-like particles (VLPs), are provided that contain modifications or mutations at one or more amino acid positions 382, 384, 392, 431, 524, 525, 526, 527 or 528, with such amino acid numbering based on the H3 sequence of A/Hong Kong/4801/14 as shown in FIG. 1 (SEQ ID NO: 92), or at amino acid positions that correspond to such amino acid positions, for example, as determined by aligning the HA amino acid sequence with SEQ ID NO: 92. Non-limiting examples of H3 influenza virus HA amino acid sequences that contain one or more of these mutations include SEQ ID NOS: 91, 92, 93, 94, 95, 96 and 97.

[00170] The modified HA H3 protein described herein includes the HA H3 protein with amino acid sequences that are characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98, 99, 100%, or any number in between, with respect to the amino acid sequence encoding HA from H3 (SEQ ID NOs: 91-97), wherein the amino acid sequence contains one or more mutations or modifications at any one or more residues in a sequence alignment at positions 382, 384, 392, 431, 524, 525, 526, 527, or 528 A/Hong Kong/4801/14 HA (SEQ ID NO: 92).

[00171] In addition, the H3 HA protein can be encoded by nucleotide sequences that are characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, with respect to the nucleotide sequence encoding HA from H3 (SEQ ID NO: 91-97 sequences of H3 strains), wherein the H3 protein of the HA contains one or more mutations or modifications in any one or more residues in the alignment of sequences at positions 382, 384, 392, 431, 524, 525, 526, 527, or 528 H3 A/Hong Kong/4801/14 HA (SEQ ID NO: 92) and wherein the nucleotide sequence encodes a hemagglutinin protein that, when expression forms a VLP.

[00172] Non-limiting examples of strains from which H3 HA may originate are A/Bangkok/3007/15 (H3N2) (SEQ ID NO: 91); A/Hongkong/4801/14 (H3N2) (SEQ ID NO: 92); A/Minnesota/40/15 (H3N2) (SEQ ID NO: 93); A/South Australia/1/16 (H3N2) (SEQ ID NO: 94); A/Pennsylvania/09/15 (H3N2) (SEQ ID NO: 95); A/Switzerland/9715293/13 (H3N2) (SEQ ID NO: 96) and A/Mississippi/16/16 (H3N2) (SEQ ID NO: 97).

Modification at position 524-528 (CysTM) and 382

[00173] In another aspect, an H3 HA is provided that may contain a modified residue at position 382 and may be modified to contain a cysteine residue at positions 524 and/or 528 (H3 numbering A/Hongkong/4801/14, SEQ ID NO: 92). In addition, the residues at position 525, 526 and/or 527 (numbering H3 A/Hongkong/4801/14) can also be modified.

[00174] As shown, for example, in FIG. 7A, 7B and 7C, H3 HA containing non-cysteine modified cysteine residues at positions 524 and 528 and containing a residue at position 382 modified from asparagine to alanine results in an approximately 260% increase in hemagglutination titer compared to H3 HA. wild type.

[00175] Accordingly, a modified H3 HA protein is provided that contains one or more modifications at position 524, 525, 526, 527, or 528 and a modification at position 382. In a non-limiting example, a modified H3 HA contains modifications at least at positions 382 , 524 and 528.

[00176] The residue at position 382 of H3 of HA can be modified so that it is not asparagine. For example, the residue at position 382 can be modified to be a hydrophobic amino acid, e.g., alanine, or a conservative alanine substitution, e.g., serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C , Cys) or valine (V, Val). The residue at position 524 may be modified to a non-cysteine, serine, or conservative serine substitution (S, Ser) and the residue at position 528 may be modified to a non-cysteine, leucine (L, Leu) or conservative leucine substitution.

[00177] For example, a modified H3 HA protein may contain an amino acid sequence that is characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, with respect to the amino acid sequence HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains alanine (A, Ala) or a conservative alanine substitution (A , Ala) at position 382, does not contain a cysteine residue at positions 524 and 528, and the sequence does not occur in nature, and moreover, when expressed, it forms a VLP. A conservative alanine substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val). The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gln), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative leucine replacement may be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00178] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA with substitutions at positions 382, 524 and 528 as described above, operably linked to a regulatory region active in a plant.

[00179] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, relative to the nucleotide sequence encoding the HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 102), the nucleotide sequence encoding a modified H3 HA protein that contains alanine (A, Ala) or a conservative alanine substitution (A, Ala) at position 382, does not contain a cysteine residue at positions 524 and 528, the sequence is not naturally occurring and the HA when expressed forms a VLP. A conservative substitution for alanine may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val). The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gln), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative leucine replacement may be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00180] Nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains an alanine (A, Ala) or a conservative substitution of alanine (A, Ala) at position 382, does not contain a cysteine residue at positions 524 and 528, wherein the sequence is not naturally occurring and wherein the HA, when expressed, forms a VLP. A conservative alanine substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val).

[00181] In addition to the residues at positions 382, 524, and 528, the modified H3 HA may contain additional modified residues. For example, one or more residues at positions 384, 525, 526, and 527 may be modified. In a non-limiting example, a modified H3 HA may contain substituted residues at positions 382, 524, 528 and one or more substitutions at positions 384, 525, 526, 527 or a combination of them.

[00182] Also provided is a method for producing VLPs that contain a modified H3 HA with substitutions at least at positions 382, 524, and 528, and optionally substitutions at positions 384, 525, 526, 527 above, in the plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00183] In addition, a method is provided for increasing the yield of VLPs that contain a modified H3 HA with substitutions at least at positions 382, 524, and 528, and optionally with substitutions at positions 384, 525, 526, 527, as described above, in plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00184] Provided herein is a VLP comprising an H3 HA with substitutions at least at positions 382, 524, and 528, and optionally substitutions at positions 384, 525, 526, 527. A VLP can be prepared by the method provided herein. . VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

Modification at position 524-528 (CysTM) and 384

[00185] In another aspect, an H3 HA is provided that may contain a modified residue at position 384 and may be modified to not contain a cysteine residue at positions 524 and 528 (numbering H3 A/Hongkong/4801/14, SEQ ID NO: 92 ). In addition, the residues at position 525, 526 and/or 527 (numbering H3 A/Hongkong/4801/14) can also be modified.

[00186] As shown, for example, in FIG. 7A, 7B and 7C, H3 HA containing cysteine residues at positions 524 and 528 modified to non-cysteine residues and containing a residue at position 384 modified from leucine to valine resulted in an approximately 270% increase in hemagglutination titer compared to H3 HA wild type.

[00187] Accordingly, a modified H3 HA protein is provided that contains one or more modifications at position 524, 525, 526, 527, or 528 and a modification at position 384. In a non-limiting example, a modified H3 HA contains modifications at least at positions 384, 524 and 528.

[00188] The residue at position 384 of H3 of HA can be modified so that it is not leucine. For example, the residue at position 384 may be modified to another hydrophobic amino acid, such as valine or a conservative valine substitution, such as isoleucine, leucine, methionine, alanine, or threonine.

[00189] For example, a modified H3 HA protein may contain an amino acid sequence that is characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, relative to the amino acid sequence HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains valine or a conservative valine substitution at position 384, does not contain a residue cysteine at positions 524 and 528, and the sequence is not found in nature, and moreover, when expressed, it forms a VLP. A conservative valine replacement may be, for example, isoleucine, leucine, methionine, alanine or threonine.

[00190] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA substitution at positions 384, 524 and 528 as described above, operably linked to a regulatory region active in a plant.

[00191] For example, nucleotide sequences may have sequence identity or sequence similarity of about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, relative to the nucleotide sequence encoding the HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains a valine or a conservative valine substitution at position 384, not contains a cysteine residue at positions 524 and 528 and the sequence is not naturally occurring. A conservative substitution may be, for example, isoleucine, leucine, methionine, alanine or threonine.

[00192] Nucleotide sequences can be characterized by sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains valine or a conservative valine substitution at position 384, does not contain a cysteine residue at positions 524 and 528, and the sequence does not occur in nature and moreover, when expressed, it forms a VLP. A conservative valine replacement may be, for example, isoleucine, leucine, methionine, alanine or threonine.

[00193] In addition to the residues at positions 384, 524, and 528, the modified H3 HA may contain additional modified residues. For example, one or more residues at positions 382, 525, 526, and 527 may be modified. In a non-limiting example, a modified H3 HA may contain substituted residues at positions 384, 524, 528 and one or more substitutions at positions 382, 525, 526, 527 or a combination of them.

[00194] In addition, a method is provided for obtaining VLPs that contain a modified H3 HA with substitutions at least at positions 384, 524, and 528, and optionally substitutions at positions 382, 525, 526, 527 above, in the plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00195] In addition, a method is provided for increasing the yield of VLPs that contain modified H3 HA with substitutions at least at positions 384, 524, and 528, and optionally with substitutions at positions 382, 525, 526, 527, as described above, in plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00196] Provided herein is a VLP comprising an H3 HA with a substitution at at least positions 384, 524, and 528, and optionally substitutions at positions 382, 525, 526, 527. A VLP can be produced by the method provided herein. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

Modification at position 524-528 (CysTM) and 392

[00197] According to another aspect, H3 HA is provided which may contain a modified residue at position 392 and may not contain a cysteine residue at positions 524 and 528 (numbering H3 A/Hongkong/4801/14, SEQ ID NO: 92). In addition, the residues at position 525, 526 and/or 527 (numbering H3 A/Hongkong/4801/14) can also be modified.

[00198] As shown, for example, in FIG. 7A and 7B, H3 HA containing cysteine residues at positions 524 and 528 modified to non-cysteine and containing a residue at position 392 modified from phenylalanine to aspartic acid gives a 200% to 270% increase in hemagglutination titer compared to H3 HA. wild type.

[00199] Accordingly, a modified H3 HA protein is provided that contains one or more modifications at position 524, 525, 526, 527, or 528 and a modification at position 392. In a non-limiting example, a modified H3 HA contains modifications at least at positions 392, 524 and 528.

[00200] The residue at position 392 of the H3 of HA can be modified to not be phenylalanine. For example, the residue at position 392 can be modified to a charged amino acid, such as aspartic acid or a conservative substitution of aspartic acid, such as glutamine, asparagine, glutamic acid, or serine.

[00201] For example, a modified H3 HA protein may contain an amino acid sequence that is characterized by sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, relative to the amino acid sequence HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains aspartic acid or a conservative substitution of aspartic acid at position 392, not contains a cysteine residue at positions 524 and 528, and the sequence is not found in nature, and moreover, when expressed, it forms a VLP. A conservative substitution for aspartic acid may, for example, be glutamine, asparagine, glutamic acid, or serine. The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gln), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative leucine replacement may be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00202] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA substitution at positions 392, 524 and 528 as described above, operably linked to a regulatory region active in a plant.

[00203] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, relative to the nucleotide sequence encoding the HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains aspartic acid or a conservative substitution of aspartic acid at position 392 , does not contain a cysteine residue at positions 524 and 528, and the sequence does not occur in nature, and moreover, when expressed, it forms a VLP. A conservative substitution may be, for example, glutamine, asparagine, glutamic acid or serine.

[00204] Nucleotide sequences can be characterized by sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains aspartic acid or a conservative substitution of aspartic acid at position 392, does not contain a cysteine residue at positions 524 and 528, and the sequence does not occur in nature and moreover, when expressed, HA forms a VLP. A conservative substitution may be, for example, glutamine, asparagine, glutamic acid or serine.

[00205] In addition to the residues at positions 392, 524, and 528, the modified H3 HA may contain additional modified residues. For example, one or more residues at position 525, 526, and 527 may be modified. In a non-limiting example, the modified H3 HA may contain substituted residues at positions 392, 524, 528 and one or more substitutions at positions 525, 526, 527, or a combination thereof.

[00206] Also provided is a method for producing VLPs that contain a modified H3 HA with substitutions at least at positions 392, 524, and 528, and optionally substitutions at positions 525, 526, 527 above, in the plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00207] In addition, a method is provided to increase the yield of VLPs that contain modified H3 HA with substitutions at least at positions 392, 524, and 528, and optionally substitutions at positions 525, 526, 527, as described above, in a plant. The method involves introducing a nucleic acid encoding a modified HA H3 operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00208] Provided herein are VLPs containing H3 HA with substitutions at least at positions 392, 524, and 528, and optionally substitutions at positions 525, 526, 527. VLPs can be produced by the method provided herein. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

Modification at position 524-528 (CysTM) and 431

[00209] According to another aspect, an H3 HA is provided which may contain a modified residue at position 431 and may not contain a cysteine residue at positions 524 and 528 (numbering H3 A/Hongkong/4801/14, SEQ ID NO: 92). In addition, the residues at position 525, 526 and/or 527 (numbering H3 A/Hongkong/4801/14) can also be modified.

[00210] As shown, for example, in FIG. 7A and 7B, H3 HA containing cysteine residues at positions 524 and 528 modified to non-cysteine and containing residue at position 431 modified from leucine to methionine results in an approximately 250% increase in hemagglutination titer compared to wild H3 HA. type.

[00211] Accordingly, a modified H3 HA protein is provided that contains one or more modifications at position 524, 525, 526, 527, or 528 and a modification at position 431. In a non-limiting example, a modified H3 HA contains modifications at least at positions 431, 524 and 528.

[00212] The residue at position 431 H3 of HA can be modified so that it is not leucine. For example, the residue at position 431 may be modified to methionine or a conservative methionine substitution such as leucine, isoleucine, glutamine, valine, or phenylalanine.

[00213] For example, a modified HA H1 protein may comprise an amino acid sequence that has sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, relative to the amino acid sequence HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains methionine or a conservative methionine substitution at position 431, does not contain a residue cysteine at positions 524 and 528, and the sequence is not found in nature, and moreover, when expressed, it forms a VLP. A conservative substitute for methionine may be, for example, leucine, isoleucine, glutamine, valine or phenylalanine. The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gin), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative leucine replacement may be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00214] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA substitution at positions 431, 524 and 528 as described above, operably linked to a regulatory region active in a plant.

[00215] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence encoding the HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 102), wherein the nucleotide sequence encodes a modified H3 HA protein that contains methionine or a conservative substitution of methionine at position 431, not contains a cysteine residue at positions 524 and 528, and the sequence is not found in nature, and moreover, when expressed, it forms a VLP. A conservative substitution may be, for example, leucine, isoleucine, glutamine, valine or phenylalanine.

[00216] Nucleotide sequences can be characterized by sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains methionine or a conservative methionine substitution at position 431, does not contain a cysteine residue at positions 524 and 528, and the sequence does not occur in nature and moreover, when expressed, it forms a VLP. A conservative substitution may be, for example, leucine, isoleucine, glutamine, valine or phenylalanine.

[00217] In addition to the residues at positions 431, 524, and 528, the modified H3 HA may contain additional modified residues. For example, one or more residues at positions 525, 526, and 527 may be modified. In a non-limiting example, a modified H3 HA may contain substituted residues at positions 431, 524, 528 and one or more substitutions at positions 525, 526, 527, or a combination thereof.

[00218] Also provided is a method for producing VLPs that contain a modified H3 HA with substitutions at least at positions 431, 524, and 528, and optionally substitutions at positions 525, 526, 527 above, in the plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00219] In addition, a method is provided to increase the yield of VLPs that contain modified H3 HA with substitutions at least at positions 431, 524, and 528, and optionally substitutions at positions 525, 526, 527, as described above, in a plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00220] Provided herein is a VLP containing H3 HA with substitutions at least at positions 431, 524, and 528, and optionally substitutions at positions 525, 526, 527. A VLP can be produced by the method provided herein. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein. Modification at position 524-528 (CysTM), 382 and 384

[00221] According to another aspect, H3 HA is provided which may contain modified residues at positions 382 and 384 and may not contain a cysteine residue at positions 524 and 528 (numbering H3 A/Hongkong/4801/14, SEQ ID NO: 92). In addition, the residues at position 525, 526 and/or 527 (numbering H3 A/Hongkong/4801/14) can also be modified.

[00222] As shown, for example, in FIG. 7E, H3 HA containing cysteine residues at positions 524 and 528 modified to non-cysteine, and containing a residue at position 382 modified from asparagine to alanine and a residue at position 384 modified from leucine to valine, gives an increase in hemagglutination titer of approximately 400-500% compared to wild-type H3 HA.

[00223] Accordingly, a modified H3 HA protein is provided that contains one or more modifications at position 524, 525, 526, 527, or 528 and a modification at positions 382 and 384. In a non-limiting example, a modified H3 HA contains modifications at least at positions 382 , 384, 524 and 528.

[00224] The residue at position 382 of H3 of HA can be modified so that it is not asparagine. For example, the residue at position 382 can be modified to be a hydrophobic amino acid, e.g., alanine, or a conservative alanine substitution, e.g., serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C , Cys) or valine (V, Val). The residue at position 384 of the H3 of HA can be modified so that it is not leucine. For example, the residue at position 384 may be modified to another hydrophobic amino acid, such as valine, or a conservative valine substitution, such as isoleucine, leucine, methionine, alanine, or threonine.

[00225] For example, the modified HA H1 protein may comprise an amino acid sequence that has sequence identity or sequence similarity of approximately 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98 , 99, 100%, or any number in between, with respect to the amino acid sequence HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 92), wherein the amino acid sequence contains alanine (A, Ala) or a conservative alanine substitution (A , Ala) at position 382, a valine or a conservative valine substitution at position 384, does not contain a cysteine residue at positions 524 and 528, and the sequence is not naturally occurring, and moreover, HA when expressed forms a VLP. A conservative alanine substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val). A conservative valine replacement may be, for example, isoleucine (I, He), leucine (L, Leu), methionine (M, Met), alanine A, Ala) or threonine (T, Thr). The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gln), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative leucine replacement may be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00226] Also provided herein is a nucleic acid comprising a nucleotide sequence encoding a modified H3 HA substitution at positions 382, 384, 524 and 528 as described above, operably linked to a regulatory region active in a plant.

[00227] For example, nucleotide sequences may have sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any the number between them, with respect to the nucleotide sequence encoding the HA from H3 A/Hongkong/4801/14 (SEQ ID NO: 102), the nucleotide sequence encoding a modified H3 HA protein that contains alanine (A, Ala) or a conservative substitution of alanine (A, Ala) at position 382, a valine or a conservative valine substitution at position 384, does not contain a cysteine residue at positions 524 and 528, and the sequence is not naturally occurring, and the HA when expressed forms a VLP. A conservative alanine substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val). A conservative valine replacement may be, for example, isoleucine (I, He), leucine (L, Leu), methionine (M, Met), alanine A, Ala) or threonine (T, Thr). The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gln), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative leucine replacement may be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00228] Nucleotide sequences can be characterized by sequence identity or sequence similarity of approximately 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number between them, with respect to the nucleotide sequence of SEQ ID NO: 102, wherein the nucleotide sequence encodes a modified H3 HA protein that contains an alanine (A, Ala) or a conservative alanine (A, Ala) substitution at position 382, a valine or a conservative valine substitution at position 384, does not contain a cysteine residue at positions 524 and 528, and moreover, the sequence does not occur in nature, and moreover, HA, when expressed, forms a VLP. A conservative alanine substitution may, for example, be serine (S, Ser), glycine (G, Gly), threonine (T, Thr), cysteine (C, Cys) or valine (V, Val). A conservative valine replacement may be, for example, isoleucine (I, Ile), leucine (L, Leu), methionine (M, Met), alanine A, Ala) or threonine (T, Thr). The non-cysteine at position 524 may be a serine (S, Ser) or a conservative serine substitution, and the non-cysteine at position 528 may be a leucine (L, Leu) or a conservative leucine substitution. A conservative substitution for serine (Se, Ser) may be, for example, threonine (T, Thr), alanine (A, Ala), asparagine (N, Asn), aspartic acid (D, Asp), glutamine (Q, Gln), glycine (G, Gly), glutamic acid (E, Glu), or lysine (L, Lys). A conservative replacement for leucine can be, for example, isoleucine (I, He), valine (V, Val), methionine (M, Met), phenylalanine (F, Phe) or valine (V, Val).

[00229] In addition to the residues at position 382, 384, 524, and 528, the modified H3 HA may contain additional modified residues. For example, one or more residues at positions 525, 526, and 527 may be modified. In a non-limiting example, a modified H3 HA may contain substituted residues at positions 382, 384, 524, 528 and one or more substitutions at positions 525, 526, 527, or their combination.

[00230] In addition, a method is provided for obtaining VLPs that contain a modified H3 HA with substitutions at least at positions 382, 384, 524, and 528, and optionally substitutions at positions 525, 526, 527 above, in the plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00231] In addition, a method is provided for increasing the yield of VLPs that contain a modified H3 HA with substitutions at least at positions 382, 384, 524, and 528, and optionally with substitutions at positions 525, 526, 527, as described above, in plant. The method involves introducing a nucleic acid encoding a modified H3 HA operably linked to a regulatory region active in a plant into a plant or plant part, and incubating the plant or plant part under conditions that allow expression of the nucleic acid, thereby producing a VLP.

[00232] Provided further herein is a VLP comprising H3 HA with substitutions at least at positions 382, 384, 524, and 528, and optionally substitutions at positions 525, 526, 527. A VLP may be prepared by the method as provided herein. description. VLPs containing modified H3 HA show improved performance compared to VLPs that contain unmodified H3 HA protein.

[00233] This document also provides methods for increasing the production or yield of VLPs containing influenza HA mutants in plants. For example, the method may include introducing a nucleic acid encoding a mutant influenza HA, as described herein, into a plant, plant part, or plant cell. The nucleic acid encoding the influenza HA mutant can be optimized for human codon usage, increased GC content, or a combination thereof. One or more mutant influenza HA proteins may be expressed in a plant, plant part, or plant cell to produce a VLP containing one or more mutated influenza HA proteins. Alternatively, the method may include obtaining a plant, plant part, or plant cell that contains a nucleic acid encoding a mutant influenza HA protein to obtain a VLP containing one or more mutant influenza HA proteins.

[00234] Methods for producing a VLP comprising mutant influenza HA may further comprise the step of introducing a second nucleic acid sequence into a plant, plant part, or plant cell, wherein the second nucleic acid encodes a proton channel protein that is co-expressed with the mutant influenza HA. For example, the proton channel protein may be an influenza A subtype M2 protein, such as A/New Caledonia/20/99 M2. Co-expression of the proton channel protein can lead to increased accumulation of mutant influenza HA protein and/or VLPs containing mutant influenza HA protein, as for example described in WO 2013/044390, which is incorporated herein by reference.

[00235] In addition, mutant influenza HA may further comprise a modified proteolytic loop or cleavage site, as described in International Application Publications WO 2013/044390 and WO 2014/153674, which are incorporated herein by reference.

[00236] By "co-expression" is meant the introduction and expression of two or more nucleotide sequences, where the two or more nucleotide sequences each encode a protein of interest, or a fragment of a protein of interest, in a plant, plant part, or plant cell. Two or more nucleotide sequences can be introduced into a plant, plant part, or plant cell in a single vector, such that each of the two or more nucleotide sequences is under the control of a separate regulatory region (eg, containing a binary construct). Alternatively, two or more nucleotide sequences may be introduced into the plant, plant part, or plant cell in separate vectors (eg, containing single constructs), and each vector contains appropriate regulatory regions for the expression of the respective nucleic acid. For example, two nucleotide sequences, each in a separate vector and introduced to separate hosts of Agrobacterium tumefaciens, can be co-expressed by mixing suspensions of each A. tumefaciens host at the desired volume (e.g., equal volume or ratio of each A. tumefaciens host can be varied) prior to vacuum infiltration. Thus, co-infiltration of multiple suspensions of A. tumifaciens allows the co-expression of multiple transgenes.

[00237] A nucleic acid encoding a mutant influenza HA as described herein may further comprise sequences that enhance expression of the mutant influenza HA in a plant, plant part, or plant cell. Sequences that enhance expression may include a cowpea mosaic virus (CPMV) enhancer element operably linked to a nucleic acid encoding a mutant influenza HA protein.

[00238] A nucleic acid comprising a nucleotide sequence encoding a modified influenza hemagglutinin (HA) protein as described herein may further comprise sequences that enhance expression of the HA protein in a plant, plant part, or plant cell. Sequences that enhance expression may include a CPMV enhancer element or a plant derived expression enhancer operably linked to a nucleic acid encoding a modified influenza hemagglutinin (HA) protein. The modified influenza hemagglutinin (HA) coding sequence can also be optimized for human codon usage, increased GC content, or a combination thereof.

[00239] As used herein, the term "CPMV enhancer element" refers to a nucleotide sequence encoding a 5'UTR regulating cowpea mosaic virus (CPMV) RNA2 polypeptide or a modified CPMV sequence as is known in the art. For example, a CPMV enhancer element or CPMV expression enhancer includes a nucleotide sequence as described in WO 2015/14367; WO2015/103704; WO 2007/135480; W02009/087391; Sainsbury F., and Lomonossoff G.P., (2008, Plant Physiol. 148: pp. 1212-1218), each of which is incorporated herein by reference. The CPMV enhancer sequence can enhance the expression of a heterologous open reading frame (ORF) downstream of the transcription to which they are attached. CPMV expression enhancer may include CPMV HT, CPMVX (where X=160, 155, 150, 114), e.g. CPMV 160, CPMVX+ (where X=160, 155, 150, 114), e.g. CPMV 160+, CPMV -HT+, CPMV HT+ [WT115] or CPMV HT+ [511] (International Application Publications WO 2015/143567; WO 2015/103704, which are incorporated herein by reference). The CPMV expression enhancer can be used in a plant expression system containing a regulatory region that is operably linked to a CPMV expression enhancer sequence and a nucleotide sequence of interest.

[00240] As used herein, the term "CPMV enhancer element" refers to a nucleotide sequence encoding a 5'UTR regulating cowpea mosaic virus (CPMV) RNA2 polypeptide or a modified CPMV sequence as known in the art. For example, a CPMV enhancer element or CPMV expression enhancer includes a nucleotide sequence as described in WO 2015/14367; WO2015/103704; WO 2007/135480; W02009/087391; Sainsbury F., and Lomonossoff G.P., (2008, Plant Physiol. 148: pp. 1212-1218), each of which is incorporated herein by reference. The CPMV enhancer sequence can enhance the expression of a heterologous open reading frame (ORF) downstream of the transcription to which they are attached. The CPMV expression enhancer may include CPMV HT, CPMVX, CPMVX+, CPMV-HT+, CPMV HT+ [WT115] or CPMV HT+ [511] (International Application Publications WO 2015/14367; WO 2015/103704, which are incorporated herein by links). The CPMV expression enhancer can be used in a plant expression system containing a regulatory region that is operably linked to a CPMV expression enhancer sequence and a nucleotide sequence of interest.

[00241] The term "5'UTR" or "5'-untranslated region", or "5'-leader sequence" refers to areas of mRNA that are not translated. The 5'UTR typically starts at the transcription start site and ends just before the translation start site or the start codon of the coding region. The 5'UTR can modulate the stability and/or translation of an mRNA transcript.

[00242] As used herein, the term "plant derived expression enhancer" refers to a nucleotide sequence derived from a plant, a nucleotide sequence encoding a 5'UTR. Examples of a plant derived expression enhancer are described in U.S. Provisional Application No. 62/643053 (filed March 14, 2018; incorporated herein by reference) or Diamos A.G. et al. (2016, Front Plt Sci. 7: 1-15; which is incorporated herein by reference). The plant derived expression enhancer can be selected from nbMT78, nbATL75, nbDJ46, nbCHP79, nbEN42, atHSP69, atGRP62, atPK65, atRP46, nb30S72, nbGT61, nbPV55, nbPPI43, nbPM64, and nbH2A, as described in US 62/533A). A plant derived expression enhancer can be used in a plant expression system comprising a regulatory region that is operably linked to a plant derived expression enhancer sequence and a nucleotide sequence of interest.

[00243] By "operably linked" is meant that particular sequences interact either directly or indirectly to perform an intended function, such as mediating or modulating the expression of a nucleic acid sequence. The interaction of operably linked sequences may, for example, be mediated by proteins that interact with operably linked sequences.

[00244] When one or more mutant influenza HA proteins are expressed in a plant, plant part, or plant cell, the one or more mutant influenza HA proteins self-assemble into VLPs. The plant, plant part, or plant cell can be harvested under suitable extraction and purification conditions to maintain the integrity of the VLP, and VLPs containing one or more influenza HA mutants can be purified.

[00245] The present invention also contemplates the use of a mutant influenza HA, or a VLP containing a mutant influenza HA, as described herein, to induce immunity to influenza infection in a subject. Also disclosed herein is an antibody or antibody fragment obtained by introducing a mutant influenza HA or a VLP containing a mutant influenza HA into a subject or host animal. Also provided is a composition comprising an effective dose of a mutant influenza HA or a VLP comprising a mutant influenza HA as described herein and a pharmaceutically acceptable carrier, adjuvant, excipient or excipient for inducing an immune response in a subject. Also provided is a vaccine for inducing an immune response in a subject that contains an effective dose of HA mutant influenza.

[00246] Also provided herein are methods of inducing immunity to influenza infection in a subject, comprising administering to the subject an influenza HA mutant, or a VLP containing the influenza HA mutant, orally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.

[00247] As used herein, the term "influenza virus" refers to a strain of enveloped viruses in the Orthomyxoviridae family that is characterized by a negatively directed single-stranded RNA genome. The influenza virus genome contains eight gene segments encoding 12-14 proteins, depending on the strain.

[00248] There are four types of influenza virus: A, B, C and D, of which influenza A or B are the causative agents of seasonal epidemics of diseases in humans. Influenza A is further classified based on the expression of HA and neuraminidase (NA) glycoprotein subtypes.

[00249] As used herein, the term "hemagglutinin" or "HA" refers to a trimeric lectin that facilitates the binding of an influenza virus particle to sialic acid-containing proteins on the surface of target cells and mediates the release of the viral genome into the target cell. There are 18 different subtypes of HA (H1-H18). HA proteins consist of two structural elements: the head, which is the main target of seroprotective antibodies; and legs. HA is translated as a single polypeptide, HAO (assembled as trimers), which must be cleaved by a serine endoprotease between the HA1 (~40 kDa) and HA2 (~20 kDa) subdomains. After cleavage, the two domains of the disulfide-linked protein assume the necessary conformation required for viral infectivity.

[00250] Influenza A HA proteins or modified influenza A HA proteins as disclosed herein include any known HA proteins derived from any known influenza A strain, as well as modifications of known influenza A strains that evolve over time. For example, influenza HA may be derived from A/Hong Kong/4801/14 (H3N2), A/Minnesota/40/15 (H3N2), A/South Australia/1/16 (H3N2), A/Bangkok/3007/15 ( H3N2), A/Switzerland/9715293/13 (H3N2), A/Mississippi/16/16 (H3N2) or A/Pennsylvania/09/2015 (H3N2). Influenza A HA may include HA derived from strains where the HA has an amino acid sequence identity of approximately 30-100%, or any number in between, to any HA derived from the influenza A strains listed above, provided that the influenza HA protein contains at least one substitution as described herein and is capable of forming a VLP, inducing an immune response when administered to a subject, inducing hemagglutination, or a combination thereof.

[00251] For example, influenza HA proteins can have an amino acid sequence identity (sequence similarity, percent identity, percent similarity) of 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54 , 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100% or any number between them, with respect to any HA derived from the influenza A strains listed above, and contain at least one substitution, as described herein, and are capable of forming a VLP, inducing an immune response when administered to a subject, inducing hemagglutination, or a combination of both. An alignment of the amino acid sequences of several influenza A HA domains, which should not be considered limiting, is shown in FIG. 1.

[00252] The terms "percent similarity", "sequence similarity", "percent identity", or "sequence identity", when referring to a particular sequence, are used, for example, as set forth in the University of Wisconsin GCG software, or by manual and visual alignment. inspection (see, for example, Current Protocols in Molecular Biology, Ausubel et al., eds. 1995, appendix). Methods for aligning sequences for comparison are well known in the art. Optimal sequence alignment for comparison can be performed, for example, using the local homology algorithm of Smith & Waterman, (1981, Adv. Appl. Math. 2:482), using the homology alignment algorithm of Needleman & Wunsch, (1970, J. Mol. Biol. 48:443), the Pearson & Lipman similarity search method, (1988, Proc. Natl. Acad. Sci. USA 85:2444), using computerized implementations of these algorithms (for example, GAP, BESTFIT, FASTA and TFASTA in a software package Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.).

[00253] An example of an algorithm suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977, Nuc. Acids Res. 25: 3389-3402) and Altschul et al. (1990, J. Mol. Biol. 215: 403-410), respectively. BLAST and BLAST 2.0 are used with the parameters described herein to determine the percent sequence identity of the nucleic acids and proteins of the present invention. For example, the BLASTN program (for nucleotide sequences) may default to a word length (W) of 11, an expectation value (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, BLASTP can use a default word length of 3 and a mean (E) of 10, as well as a BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89: 10915) of alignment (B) 50, expectation value (E) 10, M=5, N=-4, and comparison of both circuits. BLAST analysis software is publicly available through the National Center for Biotechnology Information (see URL: ncbi.nlm.nih.gov/).

[00254] As used herein, the term "virus-like particle", VLP, "virus-like particles", or "VLP" refers to influenza virus particles that contain one or more influenza HA proteins and that self-assemble into non-replicating, non-infectious viral capsid structures, stripped of all parts of the influenza genome.

Influenza HA protein production in plants

The influenza A HA protein includes any HA protein containing an amino acid sequence having sequence identity or sequence similarity of about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, from about 70 to about 100%, from about 80 to about 100%, from about 85 to about 100%, from about 90 to about 100%, from 95 to about 100%, or from about 97 to about 100 %, from about 98 to about 100%, or any number in between, relative to the influenza A HA sequence of A/Hong Kong/4801/14 (H3N2, SEQ ID NO: 92), A/Minnesota/40/15 (H3N2 , SEQ ID NO: 93), A/South Australia/1/16 (H3N2, SEQ ID NO: 94), A/Bangkok/3007/15 (H3N2, SEQ ID NO: 91), A/Switzerland/9715293/13 (H3N2, SEQ ID NO: 96), A/Mississippi/16/16 (H3N2, SEQ ID NO: 97) and A/Pennsylvania/09/2015 (H3N2, SEQ ID NO: 95), provided that the HA protein influenza contains at least one substitution, as described herein, and is capable of forming a VLP, inducing an immune response when administered to a subject, inducing hemagglutination, or a combination thereof.

[00255] In addition, the modified influenza HA protein includes any HA protein containing an amino acid sequence characterized by sequence identity or sequence similarity of from about 30% to about 100%, from about 40% to about 100%, from about 50 % to about 100%, from about 60%. to about 100%, from about 70% to about 100%, from about 80% to about 100%, from about 85% to about 100%, from about 90% to about 100%, from 95% to about 100%, or from about 97% to about 100%, about 98% to about 100%, or any number in between, relative to the sequence of SEQ ID NO: 25, SEQ ID NO: 30, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, provided that the influenza HA protein contains at least one substitution as described herein and is capable of forming a VLP, causes an immune response, when administered to a subject, induces hemagglutination, or a combination thereof.

[00256] As described herein, one or more specific mutations or modifications in influenza HA result in increased accumulation of HA protein and increased VLP production in plants compared to wild-type influenza HA.

[00257] Examples of mutant influenza A HA proteins characterized by increased production of influenza A HA and/or VLP in plants include, without limitation, the following:

mutant CysTM A/Hong Kong/4801/14 H3 (construct No. 3341, SEQ ID NO: 21), mutant N382A + L384V + CysTM A/Hong Kong/4801/14 H3 (construct No. 3375, SEQ ID NO: 25); mutant CysTM A/Minnesota/40/15 H3 (construct No. 3914, SEQ ID NO: 27); mutant N382A + L384V + CysTM A/Minnesota/40/15 H3 (construct #3915, SEQ ID NO: 30); CysTM A/S mutant. Australia/1/16 H3 (design #3924, SEQ ID NO: 33); mutant N382A + L384V + CysTM A/S. Australia/1/16 H3 (design #3925, SEQ ID NO: 35); mutant N382A + L384V + CysTM A/Bangkok/3007/15 H3 (construct No. 3905, SEQ ID NO: 39); mutant N382A A/Switzerland/9715293/13 H3 (construct No. 3023, SEQ ID NO: 82); mutant L384V A/Switzerland/9715293/13 H3 (construct No. 3034, SEQ ID NO: 84); mutant F392D A/Switzerland/9715293/13 H3 (construct #3045, SEQ ID NO: 43; mutant L431M A/Switzerland/9715293/13 H3 (construct #3022, SEQ ID NO: 47); mutant CysTM A/Switzerland/9715293 /13 H3 (construct #2811, SEQ ID NO: 49), mutant N382A + CysTM A/Switzerland/9715293/13 H3 (construct #3063, SEQ ID NO: 53), mutant L384V + CysTM A/Switzerland/9715293/13 H3 (construct #3074, SEQ ID NO: 57), mutant F392D + CysTM A/Switzerland/9715293/13 H3 (construct #3085, SEQ ID NO: 59) and mutant L431M + CysTM A/Switzerland/9715293/13 H3 ( construct No. 3062, SEQ ID NO: 61), CysTM A/Pennsylvania/09/2015 H3 mutant (construct No. 3313, SEQ ID NO: 86), N382A + CysTM A/Pennsylvania/09/2015 H3 mutant (construct No. 3314, SEQ ID NO: 88) and the L384V + CysTM A/Pennsylvania/09/2015 H3 mutant (construct #3315, SEQ ID NO: 90).

Induction of immunity against influenza infection

[00258] "Immune response" generally refers to the response of the subject's adaptive immune system. The adaptive immune system typically includes a humoral response and a cell-mediated response. The humoral response is an aspect of immunity that is mediated by secreted antibodies produced by the B-lymphocyte lineage (B-cells). Secreted antibodies bind to antigens on the surface of invading microbes (such as viruses or bacteria), indicating their destruction. Humoral immunity is generally used to refer to the production of antibodies and the processes that accompany it, as well as the effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell formation, opsonin stimulation of phagocytosis, pathogen elimination, and the like. The terms "modulate" or "modulation" or the like refer to an increase or decrease in a particular response or parameter, as defined by any of several commonly known or used assays, some of which are provided herein as examples.

[00259] A cell-mediated response is an immune response that does not involve antibodies, but rather includes the activation of macrophages, natural killer (NK) cells, antigen-specific cytotoxic T lymphocytes, and the release of various cytokines in response to an antigen. Cell mediated immunity is generally used to refer to some Th cell activation, Tc cell activation, and T cell mediated responses. Cellular immunity may be of particular importance in response to viral infections.

[00260] For example, the induction of antigen-specific CD8-positive T-lymphocytes can be measured using an ELISPOT assay; stimulation of CD4-positive T-lymphocytes can be measured using a proliferation assay. Influenza HA antibody titers can be quantified using an ELISA assay; isotypes of antigen-specific or cross-reactive antibodies can also be measured using anti-isotypic antibodies (for example, to IgG, IgA, IgE or IgM). Methods and techniques for performing such assays are well known in the art.

[00261] The presence or levels of cytokines can also be quantified. For example, T helper cell (Th1/Th2) response will be characterized by measuring IFN-β and IL-4 secreting cells using ELISA (eg, BD Biosciences OptEIA kits). Peripheral blood mononuclear cells (PBMCs) or splenocytes obtained from a subject can be cultured and the supernatant analyzed. T lymphocytes can also be quantified by fluorescence activated cell sorting (FACS) using marker fluorescent labels and methods known in the art.

[00262] A microneutralization assay can also be performed to characterize the immune response in a subject, see e.g. methods of Rowe et al., 1973. Virus neutralization titers can be quantified in several ways, including: hemolytic plaque lysis count (plaque assay) after fixation/staining of cells with crystal violet; microscopic examination of cell lysis in in vitro culture; and 2) ELISA and spectrophotometric detection of influenza virus.

[00263] As used herein, the term "epitope" or "epitopes" refers to the structural portion of an antigen to which an antibody specifically binds.

[00264] Immune responses elicited in response to administration of wild-type influenza HA proteins or VLPs or mutant influenza HA proteins or plant-derived VLPs can, for example, be observed in Balb/C mice. Animal serum samples can be analyzed by ELISA for H3-specific total IgG and IgA antibodies. Mice immunized with wild-type influenza HA proteins or plant-derived mutated influenza HA proteins may exhibit HA-specific IgG antibody titers in sera for each treatment group.

Expression in plants

[00265] The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. For reviews of such methods see, for example, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988) and Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. D.T. Dennis, D.H. Turpin, D.D. Lefebrvre, D.B. Layzell (eds), Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997). Other methods include direct DNA uptake, the use of liposomes, electroporation, for example using protoplasts, microinjection, microparticles or whiskers, and vacuum infiltration. See, for example, Bilang, et al. (1991, Gene 100: 247-250), Scheid et al. (1991, Mol. Gen. Genet. 228: 104-112), Guerche et al. (1987, Plant Science 52: 111-116), Neuhause et al. (1987, Theor. Appl Genet. 75: 30-36), Klein et al. (2987, Nature 327:70-73); Freeman et al. (1984, Plant Cell Physiol. 29: 1353), Howell et al. (1985, Science 227: 1229-1231), DeBlock et al. (1989, Plant Physiology 91: 694-701), Methods in Plant Molecular Biology (Weissbach and Weissbach, eds., Academic Press Inc., 1988), Methods in Plant Molecular Biology (Schuler and Zielinski, eds., Academic Press Inc., 1989), international patent publications WO 92/09696, WO 94/00583, EP 331083, EP 175966, Liu and Lomonossoff (2002, J Virol Meth, 105: 343-348), EP 290395; publication of international application WO 8706614; US patents No. 4945050; 5,036,006 and 5,100,792, US Patent Application No. 08/438666 filed May 10, 1995, and 07/951715 filed September 25, 1992 (all incorporated herein by reference).

[00266] Transient expression methods can be used to express constructs of the present invention (see D'Aoust et al., 2009, Methods in molecular biology, Vol 483, pages 41-50; Liu and Lomonossoff, 2002, Journal of Virological Methods, 105:343-348, which are incorporated herein by reference). Alternatively, the vacuum-based transient expression method as described in Kapila et al. (1997, Plant Sci. 122, 101-108; which is incorporated herein by reference) or International Application Publications WO 00/063400, WO 00/037663 (which are incorporated herein by reference). These methods may include, for example, without limitation, the method of agroinoculation or agroinfiltration, syringe infiltration, however, as indicated above, other temporary methods can also be used. In agroinoculation, agroinfiltration or syringe infiltration, a mixture of agrobacteria containing the desired nucleic acid penetrates into the intercellular spaces of the tissue, for example, into the leaves, the aerial part of the plant (including the stem, leaves and flower), other parts of the plant (stem, root, flower) or the whole plant. After crossing the epidermis, agrobacteria are infected and copies of the t-DNA are transferred into cells. t-DNA is transcribed episomal and mRNA is translated, resulting in the production of a protein of interest in infected cells, however, the passage of t-DNA within the nucleus is transient.

[00267] Also contemplated by the present invention are transgenic plants, plant cells or seeds containing the gene construct of the present invention, which can be used as platform plants suitable for transient protein expression as described herein. Methods for regenerating whole plants from plant cells are also known in the art (for example, see Guerineau and Mullineaux (1993, Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148 Generally, the transformed plant cells are cultured in a suitable medium which may contain selective agents such as antibiotics, selectable markers being used to facilitate the identification of the transformed plant cells. methods, and the shoots are transferred to a rooting medium for plant regeneration.Plants can then be used to create repeat generations, either from seeds or using vegetative propagation methods.Transgenic plants can also be obtained without the use of tissue culture. Methods for stable transformation and regeneration of these organisms are known in the present technical field and known to the person skilled in the present technical field. Available methods are discussed in Vasil et al. (Cell Culture and Somatic Cell Genetics of Plants, Vol I, Il and III, Laboratory Procedures and Their Applications, Academic Press, 1984) and Weissbach and Weissbach (Methods for Plant Molecular Biology, Academic Press, 1989). The method of obtaining transformed and regenerated plants is not critical to the present invention.

[00268] If plants, plant parts, or plant cells are to be transformed or co-transformed with two or more nucleic acid constructs, the nucleic acid construct can be introduced into Agrobacterium in a single transfection step such that the nucleic acids are combined and the bacterial cells are transfected. As an alternative, the constructs can be entered serially. In this case, the first construct is introduced into Agrobacterium as described, the cells are grown under selective conditions (eg in the presence of an antibiotic) where only singly transformed bacteria can grow. After this first selection step, a second nucleic acid construct is introduced into Agrobacterium as described and the cells are grown under double selection conditions where only doubly transformed bacteria can grow. The doubly transformed bacteria can then be used to transform a plant, plant part, or plant cell as described herein, or can be subjected to an additional transformation step to accommodate a third nucleic acid construct.

[00269] Alternatively, if plants, plant parts, or plant cells are to be transformed or co-transformed with two or more nucleic acid constructs, the nucleic acid construct can be introduced into the plant by co-infiltrating a mixture of Agrobacterium cells of the plant, plant part, or plant cell, each Agrobacterium cell may contain one or more structures for introduction into the plant. To change the relative levels of expression in the plant, plant part, or plant cell of the nucleotide sequence of interest within the construct during the infiltration step, the concentration of different populations of Agrobacteria containing the desired constructs can be varied.

[00270] The present invention will be further illustrated by the following examples.

Example 1 Influenza HA Constructs

[00271] Influenza HA constructs were prepared using methods well known in the art. For example, wild type H3 A-Switzerland/9715293/13 HA, N382A A/Switzerland/9715293/13 H3 HA, and CysTM A-Switzerland-9715293-13 were cloned as described below. Other H3 HA mutants were generated using similar methods, and primers, templates, and HA sequence products are described in Example 3 (Influenza HA and VLP production in plants) and Table 4.

[00272] A brief description of wild-type and mutant HA proteins, primers, templates, and products is provided in Table 4 below. For influenza H3 constructs other than the H3 A/Switzerland/9715293/13 HA proteins that were cloned into the 1190 M2-free cloning vector, the cloning vector used integrates the influenza M2 ion channel gene under the control of the alfalfa plastocyanin promoter and terminator in addition to the M2-based expression cassette. promoter 2X35S/CPMV 160 + CPMV 3'UTR/NOS. Plasmid number 3556 (SEQ ID NO: 66; FIG. 5A) was digested with restriction endonucleases SacII and Still and used for the In-Fusion reaction.

Modification H3 ON

2X35S/CPMV 160/PDISP-HA0 H3 A-Switzerland-9715293-13/NOS (design number 2801)

[00273] The coding sequence for mature HA0 from influenza HA from H3 A/Switzerland/9715293/13 fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into the 2X35S/CPMV 160/NOS expression system using the following PCR-based method. The fragment containing the PDISP-H3 A/Switzerland/9715293/13 coding sequence was amplified using primers IF-CPMV (f15'UTR)_SpPDI.c (SEQ ID NO: 15) and IF-H3A-Ala.r (SEQ ID NO : 17) using the A/Switzerland/9715293/13 PDISP-H1 gene sequence (SEQ ID NO: 9) as a template. The PCR product was cloned into a 2X35S/CPMV 160/NOS expression system using an In-Fusion cloning system (Clontech, Mountain View, CA). Construct number 1190 (FIG. 5B) was digested with restriction endonucleases SacII and StuL and the linearized plasmid was used for the In-Fusion assembly reaction. Construct number 1190 is an acceptor plasmid for "In Fusion" cloning of genes of interest in an expression cassette based on 2X35S/CPMV 160/NOS. It also includes a gene construct for co-expression of the TBSV silencing suppressor P19 under the promoter and terminator of the alfalfa plastocyanin gene. The framework is the pCAMBIA binary plasmid and the left-to-right t-DNA sequence is shown in SEQ ID NO: 62. The resulting construct was numbered 2801 (SEQ ID NO: 103). The amino acid sequence of mature HAO from influenza HA from A/Switzerland/9715293/13 fused to alfalfa PDI secretion signal peptide (PDISP) is shown in SEQ ID NO: 10. A representation of plasmid 2801 is shown in FIG. 8J.

2X35S/CPMV 160/PDISP-HA0 H3 A-Switzerland-9715293-13 (N382AYNOS (design number 3023)

[00274] The sequence encoding mature HAO from influenza HA from A/Switzerland/9715293/13 (N382A) fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into the 2X35S/CPMV 160/NOS expression system using the following method based on PCR. In the first round of PCR, a fragment containing PDISP-H3 A/Switzerland/9715293/13 with mutated amino acid N382A was amplified using primers IF-CPMV (f15'UTR) SpPDI.c (SEQ ID NO: 15) and H3 Swi (N382A) .r (SEQ ID NO: 50) using the A/Switzerland/9715293/13 PDISP-H3 gene sequence (SEQ ID NO: 9) as a template. A second fragment containing the N382A mutation with the remainder of H3 A/Switzerland/9715293/13 was amplified using H3_Swi (N382A).c (SEQ ID NO: 51) and IF-H3A-Ala.r (SEQ ID NO: 17), using the PDISP-H3 gene sequence A/Switzerland/9715293/13 (SEQ ID NO: 9) as a template. The PCR products from both amplifications were then mixed and used as template for the second round of amplification using IF-CPMV (f15'UTR)_SpPDI.c (SEQ ID NO: 15) and IF-H3A-Ala.r (SEQ ID NO: 17 ) as primers. The final PCR product was cloned into a 2X35S/CPMV 160/NOS expression system using an In-Fusion cloning system (Clontech, Mountain View, CA). Construct number 1190 (FIG. 5B) was digested with restriction endonucleases SacII and StuI and the linearized plasmid was used for the In-Fusion assembly reaction. Construct number 1190 is an acceptor plasmid for "In Fusion" cloning of genes of interest in an expression cassette based on 2X35S/CPMV 160/NOS. It also includes a gene construct for co-expression of the TBSV silencing suppressor P19 under the promoter and terminator of the alfalfa plastocyanin gene. The framework is the pCAMBIA binary plasmid and the left-to-right t-DNA sequence is shown in SEQ ID NO: 62. The resulting construct was numbered 3023 (SEQ ID NO: 104). The amino acid sequence of the mutated PDISP-H3 A-Switzerland-9715293-13 (N382A) is shown in SEQ ID NO: 82. A representation of plasmid 3023 is shown in FIG. 4C.

2X35S/CPMV 160/PDISP-HA0 H3 A-Switzerland-9715293-13 (CvsTM)/NOS (design number 2811)

[00275] The coding sequence for mature HAO from influenza HA from A/Switzerland/9715293/13 (CysTM) fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into the 2X35S/CPMV 160/NOS expression system using the following method based on PCR. In the first round of PCR, a fragment containing PDISP-H3 A/Switzerland/9715293/13 with mutated CysTM amino acids was amplified using primers IF-CPMV (f15'UTR)_SpPDI.c (SEQ ID NO: 15) and H3_Swi_SLVLL.r (SEQ ID NO: 18) using the A/Switzerland/9715293/13 PDISP-H3 gene sequence (SEQ ID NO: 9) as a template. A second fragment containing CysTm mutations with the remainder of H3 A/Switzerland/9715293/13 was amplified using H3_Swi_SLVLL.c (SEQ ID NO: 19) and IF-H3A-Ala.r (SEQ ID NO: 17) using the gene sequence PDISP-H3 A/Switzerland/9715293/13 (SEQ ID NO: 9) as a matrix. The PCR products from both amplifications were then mixed and used as template for a second round of amplification using IF-CPMV (fl5TJTR)_SpPDI.c (SEQ ID NO: 15) and IF-H3A-Ala.r (SEQ ID NO: 17) in as primers. The final PCR product was cloned into a 2X35S/CPMV 160/NOS expression system using an In-Fusion cloning system (Clontech, Mountain View, CA). Construct number 1190 (FIG. 5B) was digested with restriction endonucleases SacII and StuI and the linearized plasmid was used for the In-Fusion assembly reaction. Construct number 1190 is an acceptor plasmid for "In Fusion" cloning of genes of interest in an expression cassette based on 2X35S/CPMV 160/NOS. It also includes a gene construct for co-expression of the TBSV silencing suppressor P19 under the promoter and terminator of the alfalfa plastocyanin gene. The framework is the pCAMBIA binary plasmid and the left-to-right t-DNA sequence is shown in SEQ ID NO: 62. The resulting construct was numbered 2811 (SEQ ID NO: 105). The amino acid sequence of the mutated PDISP-H3 A-Switzerland-9715293-13 (CysTM) is shown in SEQ ID NO: 49. A representation of plasmid 2811 is shown in FIG. 8K.

Example 2: Ways

Transfection of Agrobacterium tumefaciens

[00276] The AGL1 strain of Agrobacterium tumefaciens was transfected by electroporation with wild type or HA mutant influenza HA expression vectors using the methods described by D'Aoust et al., 2008 (Plant Biotech. J. 6:930-40). Transfected Agrobacterium were grown in YEB medium supplemented with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES), 20 μM acetosyringone, 50 μg/ml kanamycin and 25 μg/ml carbenicillin with pH 5.6 to OD ₆₀₀ from 0.6 up to 1.6. Agrobacterium suspensions were centrifuged and resuspended in infiltration medium (10 mM MgCl ₂ and 10 mM MES pH 5.6) before use.

Preparation of plant biomass, inoculum and agroinfiltration

[00277] N. benthamiana plants were grown from seed on flat surfaces filled with commercial peat moss substrate. The plants were allowed to grow in the greenhouse with a photoperiod of 16/8 and a temperature regime of 25°C during the day/20°C at night. Three weeks after sowing, individual shoots were harvested, transplanted into pots and left to grow in the greenhouse for another three weeks under the same environmental conditions.

[00278] Agrobacteria transfected with each wild-type or mutant influenza HA HA expression vector were grown in YEB medium supplemented with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES), 20 μM acetosyringone, 50 μg/ml kanamycin, and 25 μM μg/ml carbenicillin pH 5.6 until they reached an OD ₆₀₀ of 0.6 to 1.6. Agrobacterium suspensions were centrifuged prior to use and resuspended in infiltration medium (10 mM MgCl ₂ and 10 mM MES pH 5.6) and stored overnight at 4°C. On the day of infiltration, batches of cultures were diluted in 2.5 culture volumes and allowed to warm before use. Whole N. benthamiana plants were placed upside down in the bacterial suspension in a sealed stainless steel tank under a vacuum of 20-40 mm Hg. for 2 min. Plants were returned to the greenhouse for a 6 or 9 day incubation period prior to harvest.

Leaf collection and total protein extraction

[00279] Proteins were extracted from fresh biomass, cut into pieces of ~1 cm ² by enzymatic extraction overnight at room temperature using an orbital shaker. The suspension was then filtered through a large pore nylon filter to remove coarse undigested plant tissue.

[00280] To obtain "total process yields", the suspension was centrifuged to remove protoplasts and intracellular contaminants. The supernatant was purified by deep filtration. The clarified fraction was then loaded through a cation exchange column with a stepwise elution step with increasing concentrations of NaCl. Purified VLPs were concentrated with TFF, diafiltered against formulation buffer and passed through a filter. The protein content of the purified VLPs was analyzed by BCA assay, and the activity was analyzed by hemagglutination assay. Relative yields were obtained by comparing protein yields from the novel construct and the native construct (or with CysTM for H3 strains) used as a control.

[00281] To obtain "density gradient yields", the suspension was centrifuged to remove protoplasts and intracellular contaminants. The supernatant was further centrifuged to remove additional particles. The supernatant was clarified by deep filtration using a glass fiber filter. The clarified fraction was then loaded into a discontinuous iodixanol density gradient. Density gradient centrifugation was performed as follows: 38 ml tubes were prepared containing a discontinuous density gradient of iodixanol in Tris buffer (successive layers of 35%, 30%, 25%, 20%, 15, 10% and 5%), which covered with the clarified extract. The gradients were centrifuged at 120,000 g for 2 hours (4°C). After centrifugation, the first 5 ml, collected from bottom to top, were discarded, and the next 5 ml were collected for protein content analysis (BCA), activity measurement (haemagglutination assay) and HAE band intensity measurement on SDS-PAGE under reduced conditions (densitometry). Relative yields were obtained by comparing the intensity of the HAO band from the new construct with the native construct (or CysTM for H3 strains) used as a control.

Hemagglutination analysis

[00282] The haemagglutination assay was based on the method described by Nayak and Reichl (2004). Briefly, serial duplicate dilutions of test samples (100 µl) were performed in 96-well V-bottomed microtiter plates containing 100 µl PBS, leaving 100 µl diluted sample per well. One hundred microliters of a 0.5% guinea pig erythrocyte suspension (Bio Link Inc., Syracuse, NY) was added to each well and the plates were incubated for 2 hours at room temperature. The reciprocal of the highest dilution, indicating complete haemagglutination, was recorded as HA activity. In parallel, a recombinant HA standard (A/Vietnam/1203/2004 H5N1) (Protein Science Corporation, Meriden, Conn.) was diluted in PBS and used as a control on each plate.

Protein analysis and immunoblotting

[00283] Immunoblotting was performed at the first incubation with the primary monoclonal antibody diluted 1/500 in 2% skim milk in 0.1% TBS-Tween 20. Peroxidase-conjugated goat anti-mouse antibody (Jackson Immunoresearch, catalog number 115-035- 146) diluted 1/10000 were used as secondary antibodies to detect chemiluminescence in 2% skim milk in TBS-Tween 20 0.1%. Immunoreactive complexes were determined by chemiluminescence using luminol as a substrate (Roche Diagnostics Corporation). Conjugation of human IgG antibody to horseradish peroxidase enzyme was performed using the EZ-Link Plus® Activated Peroxidase Conjugation Kit (Pierce, Rockford, Ill.).

Example 3 Production of Influenza HA and VLP in Plants

Modification H3 ON I

[00284] Influenza HA constructs were prepared using methods well known in the art (see Example 1). A brief description of wild-type and mutated HA proteins, primers, templates and products is provided in Table 4 below. The sequences used are shown in Example 4 and in the sequence listing.

Mutant N382A A/Switzerland/9715293/13 H3

The N382A A/Switzerland/9715293/13 H3 mutant (design #3023) was constructed by mutating the asparagine at position 382 of the wild type A/Switzerland/9715293/13 H3 to alanine. As shown in FIG. 2, purified N. benthamiana plant extracts agroinfiltrated with construct #3023 showed an approximately 30% increase in haemagglutination titer with extracts from N. benthamiana plants agroinfiltrated with A/Switzerland/9715293/13 H3 wt (design #2801) .

Mutant L384VA/Switzerland/9715293/13 H3

[00285] Mutant L384V A/Switzerland/9715293/13 H3 (design #3034) was constructed by mutating wild type leucine at position 384 of A/Switzerland/9715293/13 H3 to valine. As shown in FIG. 2, purified N. benthamiana plant extracts agroinfiltrated using construct #3034 showed an approximately 100% increase in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated with wild type A/Switzerland/9715293/13 H3 (construct # 2801).

Mutant F392D A/Switzerland/9715293/13 H3

[00286] The F392D A/Switzerland/9715293/13 H3 mutant was constructed by mutating wild-type phenylalanine at position 392 of A/Switzerland/9715293/13 H3 to aspartic acid (design #3045). As shown in FIG. 2, purified N. benthamiana plant extracts agroinfiltrated using construct #3045 showed an approximately 40% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using A/Switzerland/9715293/13 H3 wt (construct # 2801).

Mutant L431M A/Switzerland/9715293/13 H3

[00287] Mutant L431M A/Switzerland/9715293/13 H3 was constructed by mutating wild-type leucine at position 431 A/Switzerland/9715293/13 H3 to methionine (design #3022). As shown in FIG. 2, purified N. benthamiana plant extracts agroinfiltrated using construct #3022 showed an approximately 70% increase in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated with wild type A/Switzerland/9715293/13 H3 (construct # 2811).

[00288] One or more of the mutations described herein specifically increase influenza HA protein production and VLP yield in plants. It was observed that mutations at other positions significantly reduced or had no significant effect on influenza HA protein accumulation or VLP production in plant cells.

[00289] Elevated hemagglutination titers achievable with influenza HA proteins containing one or more of the mutations described herein have also been observed to be specific for influenza HA. Such an increase was not observed in plants agroinfiltrated with constructs encoding mutant influenza HA derived from non-H3 strains.

[00290] For example, the F393D A/Indonesia/5/2005 H5 mutant was constructed by mutating wild type phenylalanine at position 393 A/Indonesia/5/2005 H5 to aspartic acid (design #3680). As shown in FIG. 3, purified extracts of N. benthamiana plants agroinfiltrated using construct #3680 showed an approximately 98% reduction in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using wild type A/Indonesia/5/2005 H5 (construct # 2295).

[00291] Similarly, purified N. benthamiana plant extracts agroinfiltrated using the F392D A/Egypt/N04915/2014 H5 mutant (design #3690) showed an approximately 99% reduction in hemagglutination titer compared to N. benthamiana plant extracts, agroinfiltrated using A/Egypt/N04915/2014 wild type H5 (design #3645) (see Figure 3, Table 7).

Modification H3 ON II

Mutant CysTM A/Switzerland/9715293/13 H3

[00292] The CysTM A/Switzerland/9715293/13 H3 mutant (design #2811) was constructed by replacing the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) of A/Switzerland/9715293/13 H3 wild type with "SLVLL » (SEQ ID NO: 98). As shown in FIG. 6A, purified extracts of N. benthamiana plants agroinfiltrated using construct #2811 showed an approximately 60% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated with wild type A/Switzerland/9715293/13 H3 (construct # 2801).

Mutant CysTM A/Pennsylvania/09/2015 H3

[00293] The CysTM A/Pennsylvania/09/2015 H3 mutant (design #3313) was constructed by substituting the sequence "CFLLC" at positions 524-528 (SEQ ID NO: 99) of A/Pennsylvania/09/2015 H3 wild-type with "SLVLL » (SEQ ID NO: 98). As shown in FIG. 7C, purified N. benthamiana plant extracts agroinfiltrated using construct #3313 showed an approximately 100% increase in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using A/Pennsylvania/09/2015 WT H3 (construct # 3312).

Mutant N382A + CysTM A/Switzerland/9715293/13 H3

[00294] The N382A + CysTM A/Switzerland/9715293/13 H3 mutant (design #3063) was constructed by mutating asparagine at position 382 of A/Switzerland/9715293/13 H3 wild type to alanine and replacing the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) to "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7A, purified N. benthamiana plant extracts agroinfiltrated using construct #3063 showed an approximately 160% increase in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using wild type A/Switzerland/9715293/13 H3 (construct # 2801). As further shown in FIG. 7B, N. benthamiana plants agroinfiltrated with construct #3063 showed an approximately 30% increase in VLP yield after iodixanol gradient purification compared to plants infiltrated with CysTM A/Switzerland/9715293/13 H3 mutant (construct #2811 ).

Mutant N382A + CysTM A/Pennsylvania/09/2015 H3

[00295] The N382A + CysTM A/Pennsylvania/09/2015 H3 mutant (design #3314) was constructed by mutating asparagine at position 382 of A/Pennsylvania/09/2015 H3 wild type to alanine and replacing the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) to "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7C, purified extracts of N. benthamiana plants agroinfiltrated using construct #3314 showed an approximately 300% increase in hemagglutination titer compared to extracts of N. benthamiana plants agroinfiltrated using wild type A/Pennsylvania/09/2015 H3 (construct # 3312).

Mutant L384V + CysTM A/Switzerland/9715293/13 H3

[00296] Mutant L384V + CysTM A/Switzerland/9715293/13 H3 (design #3074) was constructed by mutating wild-type leucine at position 384 A/Switzerland/9715293/13 H3 to valine and replacing the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) to "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7C, purified N. benthamiana plant extracts agroinfiltrated with construct #3074 showed an approximately 380% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated with wild type A/Switzerland/9715293/13 H3 (construct #3074). 2801). In addition, as shown in FIG. 7B, N. benthamiana plants agroinfiltrated with construct #3074 showed an approximately 50% increase in VLP yield after sucrose gradient purification compared to plants infiltrated with CysTM A/Switzerland/9715293/13 H3 mutant (construct #2811) .

Mutant L384V + CysTM A/Pennsylvania/09/2015 H3

[00297] Mutant L384V + CysTM A/Pennsylvania/09/2015 H3 (design #3315) was constructed by mutating wild-type leucine at position 384 A/Pennsylvania/09/2015 H3 to valine and replacing the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) to "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7C, purified N. benthamiana plant extracts agroinfiltrated using construct #3315 showed an approximately 380% increase in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using wild type A/Pennsylvania/09/2015 H3 (construct # 3312).

Mutant F392D + CysTM A/Switzerland/9715293/13 H3

[00298] The F392D + CysTM A/Switzerland/9715293/13 H3 mutant (design #3085) was constructed by mutating wild-type phenylalanine at position 392 of A/Switzerland/9715293/13 H3 to aspartic acid and replacing the "CFLLC" sequence at positions 524- 528 (SEQ ID NO: 99) to "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7A, purified N. benthamiana plant extracts agroinfiltrated using construct #3085 showed an approximately 170% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using A/Switzerland/9715293/13 H3 wt (construct # 2801).

Mutant L431M + CysTM A/Switzerland/9715293/13 H3

[00299] Mutant L431M + CysTM A/Switzerland/9715293/13 H3 (design #3062) was constructed by mutating wild-type leucine at position 431 A/Switzerland/9715293/13 H3 to methionine and replacing the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) to "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7A, purified N. benthamiana plant extracts agroinfiltrated using construct #3062 showed an approximately 150% increase in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using wild type A/Switzerland/9715293/13 H3 (construct # 2801).

Mutant N382A + L384V + CysTM A/Hong Kong/4801/14 H3

[00300] Mutant N382A + L384V + CysTM A/Hong Kong/4801/14 H3 (design #3375) was constructed by mutating asparagine at position 382 A/Hong Kong/4801/14 wt to an alanine residue, leucine at position 384 to a residue valine and the "CFLLC" sequences at positions 524-528 (SEQ ID NO: 99) in "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7E, purified extracts of N. benthamiana plants agroinfiltrated using construct #3375 showed an approximately 300% increase in hemagglutination titer compared to extracts of N. benthamiana plants agroinfiltrated with the CysTM A/Hong Kong/4801/14 H3 mutant (construct No. 3341).

Mutant N382A + L384V + CysTM A/Minnesota/40/15 H3

[00301] Mutant N382A + L384V + CysTM A/Minnesota/40/15 H3 (design #3915) was constructed by mutating asparagine at position 382 A/Minnesota/40/15 wild type to an alanine residue, leucine at position 384 to a valine residue, and the sequence "CFLLC" at positions 524-528 (SEQ ID NO: 99) in "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7E, purified N. benthamiana plant extracts agroinfiltrated using construct #3915 exhibited an approximately 400% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using the CysTM A/Minnesota/40/ mutant. 15 H3 (design No. 3914).

Mutant N382A + L384V + CysTMA/S. Australia/1/1 6 H3

[00302] Mutant N382A + L384V + CysTM A/S. Australia/1/16 H3 (design #3925) was constructed by mutating asparagine at position 382 A/S. Australia/1/16 wild type to an alanine residue, leucine at position 384 to a valine residue, and the "CFLLC" sequence at positions 524-528 (SEQ ID NO: 99) in "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7D and 7E, purified N. benthamiana plant extracts agroinfiltrated using construct #3925 showed an approximately 400% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using the CysTM A/S mutant. Australia/1/16 H3 (design no. 3924).

Mutant N382A + L384V + CysTM A/Bangkok/3007/15 H3

[00303] Mutant N382A + L384V + CysTM A/Bangkok/3007/15 H3 (design #3905) was constructed by mutating asparagine at position 382 of A/Bangkok/3007/15 wild type to an alanine residue, leucine at position 384 to a valine residue, and the sequence "CFLLC" at positions 524-528 (SEQ ID NO: 99) in "SLVLL" (SEQ ID NO: 98). As shown in FIG. 7E, purified N. benthamiana plant extracts agroinfiltrated using construct #3905 showed an approximately 400% increase in hemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using the CysTM A/Bangkok/3007/15 H3 mutant (construct # 3904).

[00304] One or more of the mutations described herein specifically increase influenza HA protein production and VLP yield in plants. It was observed that mutations at other positions significantly reduced or had no significant effect on influenza HA protein accumulation or VLP production in plant cells.

[00305] Elevated hemagglutination titers achieved with influenza HA proteins containing one or more of the mutations described herein were also specific for influenza HA. Such an increase was not observed in plants agroinfiltrated with constructs encoding mutant influenza HA derived from non-H3 strains.

[00306] For example, the F393D A/Indonesia/5/2005 H5 mutant was constructed by mutating the wild-type phenylalanine at position 393 A/Indonesia/5/2005 H5 to aspartic acid (design #3680). As shown in FIG. 3, purified extracts of N. benthamiana plants agroinfiltrated using construct #3680 showed an approximately 98% reduction in haemagglutination titer compared to N. benthamiana plant extracts agroinfiltrated using wild type A/Indonesia/5/2005 H5 (construct # 2295).

[00307] Similarly, purified extracts of N. benthamiana plants agroinfiltrated using the F392D A/Egypt/N04915/2014 H5 mutant (design #3690) showed an approximately 99% reduction in hemagglutination titer compared to N. benthamiana plant extracts, agroinfiltrated using A/Egypt/N04915/2014 wild type H5 (design #3690) (see Fig. 3).

Example 3: Haemagglutination Titer, Density Gradient Yields, and Total Process Yields

[00308] A summary of the measured hemagglutination titer is presented in Tables 5 and 6A. Hemagglutination titer was measured as described in Example 2. Relative hemagglutination titer was obtained by comparing the hemagglutination titer of the mutated or modified HA protein with either wild-type HA (Table 5) or the mutant CysTM HA protein (Table 6A).

[00309] A summary of measured yields after density gradients is shown in Tables A 5B and C5B. Yields after density gradients were measured as described in Example 2. Relative yields were obtained by comparing the intensity of the HA0 band from the mutated or modified HA protein to either that of the wild-type HA0 band (Table A-5B) or the intensity of the HA0 band of the CysTM mutant HA protein ( table 6B).

[00310] A summary of the measured total process yield is shown in Table 6C. Overall process yields were obtained as described in Example 2 above. Relative yields were obtained by comparing the protein yield from the mutated or modified HA protein to either the wild type HA protein yield or the CysTM mutant HA protein yield (Table 6C).

Example 4: Sequences

[00311] The following sequences were used (see also Table 4):

[00312] All citations are incorporated herein by reference.

[00313] The present invention has been described in relation to one or more embodiments. However, it will be apparent to those skilled in the art that a number of variations and modifications can be made without departing from the scope of the present invention as defined in the claims.

--->

SEQUENCE LIST

<110> MEDICAGO INC.

<120> HEMAGLUTININ MUTANTS OF INFLUENZA VIRUS

<130> V811304WO1

<150> US 62/690,780

<151> 2018-06-27

<160> 105

<170>PatentIn version 3.5

<210> 1

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 HK

<400> 1

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

catcatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg tgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagaatt caggaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tggaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 2

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 HK

<400> 2

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 3

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Minn

<400> 3

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagttggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagagaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catatccagc attgaacgtg actatgccaa acaaggaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg gttgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagagtt caagaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tgaaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattagatgc aacatttgca tttga 1725

<210> 4

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Minn

<400> 4

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Lys Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Val Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Glu Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 5

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 SAus

<400> 5

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagttggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagagaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaaaaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catatccagc attgaacgtg actatgccaa acaaggaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg gttgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagagtt caagaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tgaaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattagatgc aacatttgca tttga 1725

<210> 6

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 SAus

<400> 6

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Lys Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Lys Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Val Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Glu Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 7

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Bang

<400> 7

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggaaatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catacccagc attgaacgtg actgtgccaa acaatgaaca atttgacaaa 600

660

cgatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagaatt caggaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa tcaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tggaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 8

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Bang

<400> 8

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Lys Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Val

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Arg Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 9

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz

<400> 9

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 10

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz

<400> 10

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 11

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Miss

<400> 11

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcagagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

aaaccatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaaacac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 12

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Miss

<400> 12

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Arg Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Lys Pro Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Asn

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 13

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Penn

<400> 13

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggaaaaaa ctgcactcta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagag atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacgatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

tcaaacttca aatacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aaggaatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacaaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg aaggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat tggaacttat gaccacgatg tatacaggga tgaagcttta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 14

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Penn

<400> 14

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Lys Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Arg Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asp Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Ser Asn Phe Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asn Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Gln Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Lys Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 15

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> Primer IF-CPMV(fl5'UTR)_SpPDI.c

<400> 15

tcgtgcttcg gcaccagtac aatggcgaaa aacgttgcga ttttcggct 49

<210> 16

<211> 46

<212> DNA

<213> Artificial sequence

<220>

<223> Primer IF-H1cTMCT.S1-4r

<400> 16

actaaagaaa ataggccttt aaatacatat tctacactgt agagac 46

<210> 17

<211> 55

<212> DNA

<213> Artificial sequence

<220>

<223> Primer IF-H3A-Ala.r

<400> 17

actaaagaaa ataggccttc aaatgcaaat gttgcaccta atgttgccct tttgg 55

<210> 18

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi_SLVLL.r

<400> 18

agcaactaac agtacaaggg atgatatggc aaaggaaatc cataggatcc a 51

<210> 19

<211> 53

<212> DNA

<213> Artificial sequence

<220>

<223> H3_Swi_SLVLL.c

<400> 19

cat 53 tcctttgcca tatcatccct tgtactgtta gttgctttgt

<210> 20

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 HK-CysTm

<400> 20

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

catcatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg tgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagaatt caggaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tggaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 21

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 HK-CysTm

<400> 21

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 22

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_HK480114(N382A+L384V).r

<400> 22

ttggttttcc cgatcactcg agccagcttc ccattgattt gatcgatt 48

<210> 23

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_HK480114(N382A+L384V).c

<400> 23

gggaagctgg ctcgagtgat cgggaaaacc aacgagaaat tccatcag 48

<210> 24

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 HK-N382A+L384V-CysTm

<400> 24

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

catcatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg tgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg agtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagaatt caggaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tggaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 25

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 HK-N382A+L384V-CysTm

<400> 25

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 26

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Minn-CysTm

<400> 26

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagttggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagagaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catatccagc attgaacgtg actatgccaa acaaggaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg gttgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagagtt caagaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tgaaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattagatgc aacatttgca tttga 1725

<210> 27

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AC PDI-H3 Minn-CysTm

<400> 27

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Lys Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Val Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Glu Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 28

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3Minn(N382A+L384V).r

<400> 28

gttggttttc ccgatcaccc gagccagctt cccattgatt tgatcgattg ctgcttgagt 60

<210> 29

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3Minn(N382A+L384V).c

<400> 29

aatcaatggg aagctggctc gggtgatcgg gaaaaccaac gagaaattcc atcaga 56

<210> 30

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Minn-N382A+L384V-CysTm

<400> 30

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagttggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagagaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catatccagc attgaacgtg actatgccaa acaaggaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg ggtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagagtt caagaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tgaaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattagatgc aacatttgca tttga 1725

<210> 31

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Minn-N382A+L384V-CysTm

<400> 31

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Lys Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Val Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Glu Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 32

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 SAus-CysTm

<400> 32

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagttggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagagaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaaaaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catatccagc attgaacgtg actatgccaa acaaggaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg gttgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagagtt caagaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tgaaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattagatgc aacatttgca tttga 1725

<210> 33

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AC PDI-H3 SAus-CysTm

<400> 33

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Lys Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Lys Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Val Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Glu Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 34

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 SAus-N382A+L384V-CysTm

<400> 34

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagttggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagagaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaaaaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggagatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catatccagc attgaacgtg actatgccaa acaaggaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg ggtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagagtt caagaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tgaaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattagatgc aacatttgca tttga 1725

<210> 35

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 SAus-N382A+L384V-CysTm

<400> 35

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Lys Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Arg Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Lys Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Val Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Glu Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 36

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Bang-CysTm

<400> 36

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggaaatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catacccagc attgaacgtg actgtgccaa acaatgaaca atttgacaaa 600

660

cgatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagaatt caggaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa tcaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tggaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 37

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Bang-CysTm

<400> 37

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Lys Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Val

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Arg Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 38

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Bang-N382A+L384V-CysTm

<400> 38

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaaat tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca caaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tggactggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggaaatc tagtagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactaca catacccagc attgaacgtg actgtgccaa acaatgaaca atttgacaaa 600

660

cgatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccaaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcatagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg agtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga aggaagaatt caggaccttg agaaatatgt tgaggacact 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa tcaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg aaatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caataagaaa tggaacttat gaccacaatg tgtacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 39

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Bang-N382A+L384V-CysTm

<400> 39

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Ile Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Thr Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Lys Ser Ser Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Tyr Thr Tyr Pro Ala Leu Asn Val Thr Val

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Arg Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys His Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asn Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 40

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(F392D).r

<400> 40

ttttcaatct gatggtcttt ctcgttggtt ttcccgatca atcgattcag cttc 54

<210> 41

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(F392D).c

<400> 41

tcgggaaaac caacgagaaa gaccatcaga ttgaaaaaga attctcag 48

<210> 42

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-F392D

<400> 42

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaagacca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 43

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-F392D

<400> 43

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Asp

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 44

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(L431M).r

<400> 44

ttgtatgttg gttctccatg gcaacaagaa gctccgcgtt gtatgaccag 50

<210> 45

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(L431M).c

<400> 45

ggagcttctt gttgccatgg agaaccaaca tacaattgat ctaactgact caga 54

<210> 46

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-L431M

<400> 46

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccatggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 47

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-L431M

<400> 47

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Met Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 48

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-CysTm

<400> 48

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 49

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-CysTm

<400> 49

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 50

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(N382A).r

<400> 50

ttttcccgatc aatcgagcca gcttcccatt gatttgatcg attgctgc 48

<210> 51

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(N382A).c

<400> 51

tcaaatcaat gggaagctgg ctcgattgat cgggaaaacc aacgagaaat tcca 54

<210> 52

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-N382A-CysTm

<400> 52

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 53

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-N382A-CysTm

<400> 53

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 54

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(L384V).r

<400> 54

ttggttttcc cgatcactcg attcagcttc ccattgattt gatcgatt 48

<210> 55

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H3_Swi(L384V).c

<400> 55

gggaagctga atcgagtgat cgggaaaacc aacgagaaat tccatcag 48

<210> 56

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-L384V-CysTm

<400> 56

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg agtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 57

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-L384V-CysTm

<400> 57

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 58

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-F392D-CysTm

<400> 58

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaagacca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 59

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-F392D-CysTm

<400> 59

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Asp

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 60

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-L431M-CysTm

<400> 60

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccatggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 61

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-L431M-CysTm

<400> 61

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Met Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 62

<211> 4540

<212> DNA

<213> Artificial sequence

<220>

<223> Cloning vector 1190 from the left border of the T-DNA to the right

<400> 62

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga atcccgggct ggtatattta tatgttgtca 120

aataactcaa aaaccataaa agtttaagtt agcaagtgtg tacattttta cttgaacaaa 180

aatattcacc tactactgtt ataaatcatt attaaacatt agagtaaaga aatatggatg 240

ataagaacaa gagtagtgat attttgacaa caattttgtt gcaacatttg agaaaatttt 300

360

aaaacataat gtgagtatga gagagaaagt tgtacaaaag ttgtaccaaa atagttgtac 420

aaatatcatt gaggaatttg acaaaagcta cacaaataag ggttaattgc tgtaaataaa 480

taaggatgac gcattagaga gatgtaccat tagagaattt ttggcaagtc attaaaaaga 540

aagaataaat tatttttaaa attaaaagtt gagtcatttg attaaacatg tgattattta 600

atgaattgat gaaagagttg gattaaagtt gtattagtaa ttagaatttg gtgtcaaatt 660

taatttgaca tttgatcttt tcctatatat tgccccatag agtcagttaa ctcattttta 720

tatttcatag atcaaataag agaaataacg gtatattaat ccctccaaaa aaaaaaaacg 780

gtatatttac taaaaaatct aagccacgta ggaggataac aggatccccg taggaggata 840

acatccaatc caaccaatca caacaatcct gatgagataa cccactttaa gcccacgcat 900

ctgtggcaca tctacattat ctaaatcaca cattcttcca cacatctgag ccacacaaaa 960

accaatccac atctttatca cccattctat aaaaaatcac actttgtgag tctacacttt 1020

gattcccttc aaacacatac aaagagaaga gactaattaa ttaattaatc atcttgagag 1080

1140

gatggaggat caggaggtac cacttctccc ttcaaacttc ctgacgaaag tccgagttgg 1200

actgagtggc ggctacataa cgatgagacg aattcgaatc aagataatcc ccttggtttc 1260

aaggaaagct ggggtttcgg gaaagttgta tttaagagat atctcagata cgacaggacg 1320

gaagcttcac tgcacagagt ccttggatct tggacgggag attcggttaa ctatgcagca 1380

1440

agtatcaccg tttctggagg gtcgcgaact cttcagcatc tctgtgagat ggcaattcgg 1500

tctaagcaag aactgctaca gcttgcccca atcgaagtgg aaagtaatgt atcaagagga 1560

tgccctgaag gtactcaaac cttcgaaaaa gaaagcgagt aagttaaaat gcttcttcgt 1620

1680

1740

ataagtggag tcagaatcag aatgtttcct ccataactaa ctagacatga agacctgccg 1800

1860

gtggttaata tagctcaaat atatggtcaa gttcaataga ttaataatgg aaatatcagt 1920

tatcgaaatt cattaacaat caacttaacg ttattaacta ctaattttat atcatcccct 1980

ttgataaatg atagtacacc aattaggaag gagcatgctc gcctaggaga ttgtcgtttc 2040

ccgccttcag tttgcaagct gctctagccg tgtagccaat acgcaaaccg cctctccccg 2100

2160

cgacacactt gtctactcca aaaatatcaa agatacagtc tcagaagacc aaagggcaat 2220

tgagactttt caacaaaggg taatatccgg aaacctcctc ggattccatt gcccagctat 2280

ctgtcacttt attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat gccatcattg 2340

cgataaagga aaggccatcg ttgaagatgc ctctgccgac agtggtccca aagatggacc 2400

2460

ggattgatgt gataacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga 2520

tacagtctca gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa 2580

cctcctcgga ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga 2640

aggtggctcc tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc 2700

tgccgacagt ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga 2760

2820

tgacgcacaa tcccactatc cttcgcaaga cccttcctct atataaggaa gttcatttca 2880

tttggagagg tattaaaatc ttaataggtt ttgataaaag cgaacgtggg gaaacccgaa 2940

ccaaaccttc ttctaaactc tctctcatct ctcttaaagc aaacttctct cttgtctttc 3000

ttgcgtgagc gatcttcaac gttgtcagat cgtgcttcgg caccgcggat ggcgaaaaac 3060

gttgcgattt tcggcttatt gttttctctt cttgtgttgg ttccttctca gatcttcgcc 3120

tgcaggctcc tcagccaaaa cgacaccccc atctgtctat ccactggccc ctggatctgc 3180

tgcccaaact aactccatgg tgaccctggg atgcctggtc aagggctatt tccctgagcc 3240

agtgacagtg acctggaact ctggatccct gtccagcggt gtgcacacct tcccagctgt 3300

cctgcagtct gacctctaca ctctgagcag ctcagtgact gtcccctcca gcacctggcc 3360

cagcgagacc gtcacctgca acgttgccca cccggccagc agcaccaagg tggacaagaa 3420

aattgtgccc agggattgtg gttgtaagcc ttgcatatgt acagtcccag aagtatcatc 3480

tgtcttcatc ttccccccaa agcccaagga tgtgctcacc attactctga ctcctaaggt 3540

cacgtgtgtt gtggtagaca tcagcaagga tgatcccgag gtccagttca gctggtttgt 3600

agatgatgtg gaggtgcaca cagctcagac gcaaccccgg gaggagcagt tcaacagcac 3660

tttccgctca gtcagtgaac ttcccatcat gcaccaggac tggctcaatg gcaaggagcg 3720

atcgctcacc atcaccatca ccatcaccat caccattaaa ggcctatttt ctttagtttg 3780

aatttactgt tattcggtgt gcatttctat gtttggtgag cggttttctg tgctcagagt 3840

gtgtttattt tatgtaattt aatttctttg tgagctcctg tttagcaggt cgtcccttca 3900

3960

gatatcaagc ttatcgacct gcagatcgtt caaacatttg gcaataaagt ttcttaagat 4020

tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat tacgttaagc 4080

4140

tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca aactaggata 4200

aattatcgcg cgcggtgtca tctatgttac tagatctcta gagtctcaag cttggcgcgc 4260

ccacgtgact agtggcactg gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg 4320

ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt aatagcgaag 4380

aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tgctagagca 4440

gcttgagctt ggatcagatt gtcgtttccc gccttcagtt taaactatca gtgtttgaca 4500

ggatatattg gcgggtaaac ctaagagaaa agagcgttta 4540

<210> 63

<211> 3105

<212> DNA

<213> Artificial sequence

<220>

<223> Construct 1314 from 2X35S promoter to NOS terminator

<400> 63

gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360

tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420

agggtaatat ccggaaacct ccctcggattc cattgcccag ctatctgtca ctttattgtg 480

aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540

atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720

taaggaagtt catttcattt ggagaggtat taaaatctta ataggttttg ataaaagcga 780

acgtggggaa acccgaacca aaccttcttc taaactctct ctcatctctc ttaaagcaaa 840

cttctctctt gtctttcttg cgtgagcgat cttcaacgtt gtcagatcgt gcttcggcac 900

cagtacaatg gcgaaaaacg ttgcgatttt cggcttattg ttttctcttc ttgtgttggt 960

tccttctcag atcttcgctg acacattatg tataggttat catgcgaaca attcaacaga 1020

cactgtagac acagtactag aaaagaatgt aacagtaaca cactctgtta accttctaga 1080

agacaagcat aacgggaaac tatgcaaact aagaggggta gccccattgc atttgggtaa 1140

atgtaacatt gctggctgga tcctgggaaa tccagagtgt gaatcactct ccacagcaag 1200

ctcatggtcc tacattgtgg aaacacctag ttcagacaat ggaacgtgtt acccaggaga 1260

tttcatcgat tatgaggagc taagagagca attgagctca gtgtcatcat ttgaaaggtt 1320

tgagatattc cccaagacaa gttcatggcc caatcatgac tcgaacaaag gtgtaacggc 1380

agcatgtcct catgctggag caaaaagctt ctacaaaaat ttaatatggc tagttaaaaa 1440

aggaaattca tacccaaagc tcagcaaatc ctacattaat gataaaggga aagaagtcct 1500

cgtgctatgg ggcattcacc atccatctac tagtgctgac caacaaagtc tctatcagaa 1560

tgcagatgca tatgtttttg tggggtcatc aagatacagc aagaagttca agccggaaat 1620

agcaataaga cccaaagtga gggatcaaga agggagaatg aactattact ggacactagt 1680

agagccggga gacaaaataa cattcgaagc aactggaaat ctagtggtac cgagatatgc 1740

attcgcaatg gaaagaaatg ctggatctgg tattatcatt tcagatacac cagtccacga 1800

ttgcaataca acttgtcaaa cacccaaggg tgctataaac accagcctcc catttcagaa 1860

tatacatccg atcacaattg gaaaatgtcc aaaatatgta aaaagcacaa aattgagact 1920

ggccacagga ttgaggaata tcccgtctat tcaatctaga ggactatttg gggccattgc 1980

cggtttcatt gaaggggggt ggacagggat ggtagatgga tggtacggtt atcaccatca 2040

aaatgagcag gggtcaggat atgcagccga cctgaagagc acacagaatg ccattgacga 2100

2160

taaagagttc aaccacctgg aaaaaagaat agagaattta aataaaaaag ttgatgatgg 2220

tttcctggac atttggactt acaatgccga actgttggtt ctattggaaa atgaaagaac 2280

tttggactac cacgattcaa atgtgaagaa cttatatgaa aaggtaagaa gccagctaaa 2340

aaacaatgcc aaggaaattg gaaacggctg ctttgaattt taccacaaat gcgataacac 2400

gtgcatggaa agtgtcaaaa atgggactta tgactaccca aaatactcag aggaagcaaa 2460

attaaacaga gaagaaatag atggggtaaa gctggaatca acaaggattt accagatttt 2520

ggcgatctat tcaactgtcg ccagttcatt ggtactggta gtctccctgg gggcaatcag 2580

tttctggatg tgctctaatg ggtctctaca gtgtagaata tgtatttaaa ggcctatttt 2640

ctttagtttg aatttactgt tattcggtgt gcatttctat gtttggtgag cggttttctg 2700

2760

2820

ccgggaattc gatatcaagc ttatcgacct gcagatcgtt caaacatttg gcaataaagt 2880

ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 2940

3000

atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3060

aactaggata aattatcgcg cgcggtgtca tctatgttac tagat 3105

<210> 64

<211> 3105

<212> DNA

<213> Artificial sequence

<220>

<223> Construct 2980 from 2X35S promoter to NOS terminator

<400> 64

gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360

tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420

agggtaatat ccggaaacct ccctcggattc cattgcccag ctatctgtca ctttattgtg 480

aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540

atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720

taaggaagtt catttcattt ggagaggtat taaaatctta ataggttttg ataaaagcga 780

acgtggggaa acccgaacca aaccttcttc taaactctct ctcatctctc ttaaagcaaa 840

cttctctctt gtctttcttg cgtgagcgat cttcaacgtt gtcagatcgt gcttcggcac 900

cagtacaatg gcgaaaaacg ttgcgatttt cggcttattg ttttctcttc ttgtgttggt 960

tccttctcag atcttcgcgg acacattatg tataggttat catgcgaaca attcaacaga 1020

cactgtagac acagtactag aaaagaatgt aacagtaaca cactctgtta accttctaga 1080

agacaagcat aacgggaaac tatgcaaact aagaggggta gccccattgc atttgggtaa 1140

atgtaacatt gctggctgga tcctgggaaa tccagagtgt gaatcactct ccacagcaag 1200

ctcatggtcc tacattgtgg aaacacctag ttcagacaat ggaacgtgtt acccaggaga 1260

tttcatcgat tatgaggagc taagagagca attgagctca gtgtcatcat ttgaaaggtt 1320

tgagatattc cccaagacaa gttcatggcc caatcatgac tcgaacaaag gtgtaacggc 1380

agcatgtcct catgctggag caaaaagctt ctacaaaaat ttaatatggc tagttaaaaa 1440

aggaaattca tacccaaagc tcagcaaatc ctacattaat gataaaggga aagaagtcct 1500

cgtgctatgg ggcattcacc atccatctac tagtgctgac caacaaagtc tctatcagaa 1560

tgcagatgca tatgtttttg tggggtcatc aagatacagc aagaagttca agccggaaat 1620

agcaataaga cccaaagtga gggatcaaga agggagaatg aactattact ggacactagt 1680

agagccggga gacaaaataa cattcgaagc aactggaaat ctagtggtac cgagatatgc 1740

attcgcaatg gaaagaaatg ctggatctgg tattatcatt tcagatacac cagtccacga 1800

ttgcaataca acttgtcaaa cacccaaggg tgctataaac accagcctcc catttcagaa 1860

tatacatccg atcacaattg gaaaatgtcc aaaatatgta aaaagcacaa aattgagact 1920

ggccacagga ttgaggaata tcccgtctat tcaatctaga ggactatttg gggccattgc 1980

cggtttcatt gaaggggggt ggacagggat ggtagatgga tggtacggtt atcaccatca 2040

aaatgagcag gggtcaggat atgcagccga cctgaagagc acacagaatg ccattgacga 2100

2160

taaagagttc aaccacctgg aaaaaagaat agagaattta aataaaaaag ttgatgatgg 2220

tttcctggac atttggactt acaatgccga actgttggtt ctattggaaa atgaaagaac 2280

tttggactac cacgattcaa atgtgaagaa cttatatgaa aaggtaagaa gccagctaaa 2340

aaacaatgcc aaggaaattg gaaacggctg ctttgaattt taccacaaat gcgataacac 2400

gtgcatggaa agtgtcaaaa atgggactta tgactaccca aaatactcag aggaagcaaa 2460

attaaacaga gaagaaatag atggggtaaa gctggaatca acaaggattt accagatttt 2520

ggcgatctat tcaactgtcg ccagttcatt ggtactggta gtctccctgg gggcaatcag 2580

tttctggatg tgctctaatg ggtctctaca gtgtagaata tgtatttaaa ggcctatttt 2640

ctttagtttg aatttactgt tattcggtgt gcatttctat gtttggtgag cggttttctg 2700

2760

2820

ccgggaattc gatatcaagc ttatcgacct gcagatcgtt caaacatttg gcaataaagt 2880

ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 2940

3000

atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3060

aactaggata aattatcgcg cgcggtgtca tctatgttac tagat 3105

<210> 65

<211> 3105

<212> DNA

<213> Artificial sequence

<220>

<223> Construct 2995 from 2X35S promoter to NOS terminator

<400> 65

gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360

tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420

agggtaatat ccggaaacct ccctcggattc cattgcccag ctatctgtca ctttattgtg 480

aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540

atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720

taaggaagtt catttcattt ggagaggtat taaaatctta ataggttttg ataaaagcga 780

acgtggggaa acccgaacca aaccttcttc taaactctct ctcatctctc ttaaagcaaa 840

cttctctctt gtctttcttg cgtgagcgat cttcaacgtt gtcagatcgt gcttcggcac 900

cagtacaatg gcgaaaaacg ttgcgatttt cggcttattg ttttctcttc ttgtgttggt 960

tccttctcag atcttcgcgg acacattatg tataggttat catgcgaaca attcaacaga 1020

cactgtagac acagtactag aaaagaatgt aacagtaaca cactctgtta accttctaga 1080

agacaagcat aacgggaaac tatgcaaact aagaggggta gccccattgc atttgggtaa 1140

atgtaacatt gctggctgga tcctgggaaa tccagagtgt gaatcactct ccacagcaag 1200

ctcatggtcc tacattgtgg aaacacctag ttcagacaat ggaacgtgtt acccaggaga 1260

tttcatcgat tatgaggagc taagagagca attgagctca gtgtcatcat ttgaaaggtt 1320

tgagatattc cccaagacaa gttcatggcc caatcatgac tcgaacaaag gtgtaacggc 1380

agcatgtcct catgctggag caaaaagctt ctacaaaaat ttaatatggc tagttaaaaa 1440

aggaaattca tacccaaagc tcagcaaatc ctacattaat gataaaggga aagaagtcct 1500

cgtgctatgg ggcattcacc atccatctac tagtgctgac caacaaagtc tctatcagaa 1560

tgcagatgca tatgtttttg tggggtcatc aagatacagc aagaagttca agccggaaat 1620

agcaataaga cccaaagtga gggatcaaga agggagaatg aactattact ggacactagt 1680

agagccggga gacaaaataa cattcgaagc aactggaaat ctagtggtac cgagatatgc 1740

attcgcaatg gaaagaaatg ctggatctgg tattatcatt tcagatacac cagtccacga 1800

ttgcaataca acttgtcaaa cacccaaggg tgctataaac accagcctcc catttcagaa 1860

tatacatccg atcacaattg gaaaatgtcc aaaatatgta aaaagcacaa aattgagact 1920

ggccacagga ttgaggaata tcccgtctat tcaatctaga ggactatttg gggccattgc 1980

cggtttcatt gaaggggggt ggacagggat ggtagatgga tggtacggtt atcaccatca 2040

aaatgagcag gggtcaggat atgcagccga cctgaagagc acacagaatg ccattgacga 2100

2160

taaagagttc aaccacctgg aaaaaagaat agagaattta aataaaaaag ttgatgatgg 2220

tttcctggac atttggactt acaatgccga actgttggtt ctaatggaaa atgaaagaac 2280

tttggactac cacgattcaa atgtgaagaa cttatatgaa aaggtaagaa gccagctaaa 2340

aaacaatgcc aaggaaattg gaaacggctg ctttgaattt taccacaaat gcgataacac 2400

gtgcatggaa agtgtcaaaa atgggactta tgactaccca aaatactcag aggaagcaaa 2460

attaaacaga gaagaaatag atggggtaaa gctggaatca acaaggattt accagatttt 2520

ggcgatctat tcaactgtcg ccagttcatt ggtactggta gtctccctgg gggcaatcag 2580

tttctggatg tgctctaatg ggtctctaca gtgtagaata tgtatttaaa ggcctatttt 2640

ctttagtttg aatttactgt tattcggtgt gcatttctat gtttggtgag cggttttctg 2700

2760

2820

ccgggaattc gatatcaagc ttatcgacct gcagatcgtt caaacatttg gcaataaagt 2880

ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 2940

3000

atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 3060

aactaggata aattatcgcg cgcggtgtca tctatgttac tagat 3105

<210> 66

<211> 6360

<212> DNA

<213> Artificial sequence

<220>

<223> Cloning vector 3556 from the left border of the T-DNA to the right

<400> 66

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga atcccgggct ggtatattta tatgttgtca 120

aataactcaa aaaccataaa agtttaagtt agcaagtgtg tacattttta cttgaacaaa 180

aatattcacc tactactgtt ataaatcatt attaaacatt agagtaaaga aatatggatg 240

ataagaacaa gagtagtgat attttgacaa caattttgtt gcaacatttg agaaaatttt 300

360

aaaacataat gtgagtatga gagagaaagt tgtacaaaag ttgtaccaaa atagttgtac 420

aaatatcatt gaggaatttg acaaaagcta cacaaataag ggttaattgc tgtaaataaa 480

taaggatgac gcattagaga gatgtaccat tagagaattt ttggcaagtc attaaaaaga 540

aagaataaat tatttttaaa attaaaagtt gagtcatttg attaaacatg tgattattta 600

atgaattgat gaaagagttg gattaaagtt gtattagtaa ttagaatttg gtgtcaaatt 660

taatttgaca tttgatcttt tcctatatat tgccccatag agtcagttaa ctcattttta 720

tatttcatag atcaaataag agaaataacg gtatattaat ccctccaaaa aaaaaaaacg 780

gtatatttac taaaaaatct aagccacgta ggaggataac aggatccccg taggaggata 840

acatccaatc caaccaatca caacaatcct gatgagataa cccactttaa gcccacgcat 900

ctgtggcaca tctacattat ctaaatcaca cattcttcca cacatctgag ccacacaaaa 960

accaatccac atctttatca cccattctat aaaaaatcac actttgtgag tctacacttt 1020

gattcccttc aaacacatac aaagagaaga gactaattaa ttaattaatc atcttgagag 1080

1140

gatggaggat caggaggtac cacttctccc ttcaaacttc ctgacgaaag tccgagttgg 1200

actgagtggc ggctacataa cgatgagacg aattcgaatc aagataatcc ccttggtttc 1260

aaggaaagct ggggtttcgg gaaagttgta tttaagagat atctcagata cgacaggacg 1320

gaagcttcac tgcacagagt ccttggatct tggacgggag attcggttaa ctatgcagca 1380

1440

agtatcaccg tttctggagg gtcgcgaact cttcagcatc tctgtgagat ggcaattcgg 1500

tctaagcaag aactgctaca gcttgcccca atcgaagtgg aaagtaatgt atcaagagga 1560

tgccctgaag gtactcaaac cttcgaaaaa gaaagcgagt aagttaaaat gcttcttcgt 1620

1680

1740

ataagtggag tcagaatcag aatgtttcct ccataactaa ctagacatga agacctgccg 1800

1860

gtggttaata tagctcaaat atatggtcaa gttcaataga ttaataatgg aaatatcagt 1920

tatcgaaatt cattaacaat caacttaacg ttattaacta ctaattttat atcatcccct 1980

ttgataaatg atagtacacc aattaggaag gagcatgctc gcctaggaga ttgtcgtttc 2040

ccgccttcag tttgcaagct gctctagccg tgtagccaat acgcaaaccg cctctccccg 2100

2160

2220

acaaaaatat tcacctacta ctgttataaa tcattattaa acattagagt aaagaaatat 2280

ggatgataag aacaagagta gtgatatttt gacaacaatt ttgttgcaac atttgagaaa 2340

attttgttgt tctctctttt cattggtcaa aaacaataga gagagaaaaa ggaagaggga 2400

2460

2520

ataaataagg atgacgcatt agagagatgt accattagag aatttttggc aagtcattaa 2580

2640

2700

aaatttaatt tgacatttga tcttttccta tatattgccc catagagtca gttaactcat 2760

ttttatattt catagatcaa ataagagaaa taacggtata ttaatccctc caaaaaaaaa 2820

aaacggtata tttactaaaa aatctaagcc acgtaggagg ataacaggat ccccgtagga 2880

ggataacatc caatccaacc aatcacaaca atcctgatga gataacccac tttaagccca 2940

cgcatctgtg gcacatctac attatctaaa tcacacattc ttccacacat ctgagccaca 3000

caaaaaccaa tccacatctt tatcacccat tctataaaaa atcacacttt gtgagtctac 3060

actttgattc ccttcaaaca catacaaaga gaagagacta attaattaat taatcatctt 3120

gagagaaaat gagtcttcta accgaggtcg aaacgcctat cagaaacgaa tgggggtgca 3180

3240

tgatattgtg gattattgat cgcctttttt ccaaaagcat ttatcgtatc tttaaacacg 3300

3360

aggaacagca gaatgctgtg gatgctgacg atggtcattt tgtcagcata gagctggagt 3420

aagagctcta agttaaaatg cttcttcgtc tcctatttat aatatggttt gttattgtta 3480

3540

gatgaactgg tgtaatgtaa ttcatttaca taagtggagt cagaatcaga atgtttcctc 3600

cataactaac tagacatgaa gacctgccgc gtacaattgt cttatatttg aacaactaaa 3660

3720

3780

tattaactac taattttata tcatcccctt tgataaatga tagtacacca attaggaagg 3840

aactaggaga ttgtcgtttc ccgccttcag tttgcaagct gctctagccg tgtagccaat 3900

acgcaaaccg cctctccccg cgcgttggga attactagcg cgtgtcgaca agcttgcatg 3960

ccggtcaaca tggtggagca cgacacactt gtctactcca aaaatatcaa agatacagtc 4020

tcagaagacc aaagggcaat tgagactttt caacaaaggg taatatccgg aaacctcctc 4080

ggattccatt gcccagctat ctgtcacttt attgtgaaga tagtggaaaa ggaaggtggc 4140

tcctacaaat gccatcattg cgataaagga aaggccatcg ttgaagatgc ctctgccgac 4200

agtggtccca aagatggacc cccacccacg aggagcatcg tggaaaaaga agacgttcca 4260

accacgtctt caaagcaagt ggattgatgt gataacatgg tggagcacga cacacttgtc 4320

tactccaaaa atatcaaaga tacagtctca gaagaccaaa gggcaattga gacttttcaa 4380

4440

gtgaagatag tggaaaagga aggtggctcc tacaaatgcc atcattgcga taaaggaaag 4500

gccatcgttg aagatgcctc tgccgacagt ggtcccaaag atggaccccc acccacgagg 4560

agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa agcaagtgga ttgatgtgat 4620

atctccactg acgtaaggga tgacgcacaa tcccactatc cttcgcaaga cccttcctct 4680

4740

cgaacgtggg gaaacccgaa ccaaaccttc ttctaaactc tctctcatct ctcttaaagc 4800

aaacttctct cttgtctttc ttgcgtgagc gatcttcaac gttgtcagat cgtgcttcgg 4860

caccgcggat ggcgaaaaac gttgcgattt tcggcttatt gttttctctt cttgtgttgg 4920

ttccttctca gatcttcgcc tgcaggctcc tcagccaaaa cgacaccccc atctgtctat 4980

ccactggccc ctggatctgc tgcccaaact aactccatgg tgaccctggg atgcctggtc 5040

aagggctatt tccctgagcc agtgacagtg acctggaact ctggatccct gtccagcggt 5100

gtgcacacct tcccagctgt cctgcagtct gacctctaca ctctgagcag ctcagtgact 5160

gtcccctcca gcacctggcc cagcgagacc gtcacctgca acgttgccca cccggccagc 5220

agcaccaagg tggacaagaa aattgtgccc agggattgtg gttgtaagcc ttgcatatgt 5280

acagtcccag aagtatcatc tgtcttcatc ttccccccaa agcccaagga tgtgctcacc 5340

attactctga ctcctaaggt cacgtgtgtt gtggtagaca tcagcaagga tgatcccgag 5400

gtccagttca gctggtttgt agatgatgtg gaggtgcaca cagctcagac gcaaccccgg 5460

gaggagcagt tcaacagcac tttccgctca gtcagtgaac ttcccatcat gcaccaggac 5520

tggctcaatg gcaaggagcg atcgctcacc atcaccatca ccatcaccat caccattaaa 5580

ggcctatttt ctttagtttg aatttactgt tattcggtgt gcatttctat gtttggtgag 5640

cggttttctg tgctcagagt gtgtttattt tatgtaattt aatttctttg tgagctcctg 5700

5760

aaaaaaaaga ccgggaattc gatatcaagc ttatcgacct gcagatcgtt caaacatttg 5820

gcaataaagt ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt 5880

tctgttgaat tacgttaagcatgtaataat taacatgtaa

atgggttttt atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat 6000

atagcgcgca aactaggata aattatcgcg cgcggtgtca tctatgttac tagatctcta 6060

6120

tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc 6180

cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct 6240

gaatggcgaa tgctagagca gcttgagctt ggatcagatt gtcgtttccc gccttcagtt 6300

6360

<210> 67

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<223> Primer IF-H5ITMCT.s1-4r

<400> 67

actaaagaaa ataggccttt aaatgcaaat tctgcattgt aacgatccat 50

<210> 68

<211> 1731

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H5 Indo

<400> 68

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg ccgatcagat ttgcattggt taccatgcaa acaattcaac agagcaggtt 120

gacacaatca tggaaaagaa cgttactgtt acacatgccc aagacatact ggaaaagaca 180

cacaacggga agctctgcga tctagatgga gtgaagcctc taattttaag agattgtagt 240

gtagctggat ggctcctcgg gaacccaatg tgtgacgaat tcatcaatgt accggaatgg 300

tcttacatag tggagaaggc caatccaacc aatgacctct gttacccagg gagtttcaac 360

420

atccccaaaa gttcttggtc cgatcatgaa gcctcatcag gagttagctc agcatgtcca 480

tacctgggaa gtccctcctt ttttagaaat gtggtatggc ttatcaaaaa gaacagtaca 540

600

ggaattcacc atcctaatga tgcggcagag cagacaaggc tatatcaaaa cccaaccacc 660

tatatttcca ttgggacatc aacactaaac cagagattgg taccaaaaat agctactaga 720

tccaaagtaa acgggcaaag tggaaggatg gagttcttct ggacaatttt aaaacctaat 780

gatgcaatca acttcgagag taatggaaat ttcattgctc cagaatatgc atacaaaatt 840

gtcaagaaag gggactcagc aattatgaaa agtgaattgg aatatggtaa ctgcaacacc 900

aagtgtcaaa ctccaatggg ggcgataaac tctagtatgc cattccacaa catacaccct 960

ctcaccatcg gggaatgcc caaatatgtg aaatcaaaca gattagtcct tgcaacaggg 1020

ctcagaaata gccctcaaag agagagcaga agaaaaaaga gaggactatt tggagctata 1080

gcaggtttta tagagggagg atggcaggga atggtagatg gttggtatgg gtaccaccat 1140

agcaatgagc aggggagtgg gtacgctgca gacaaagaat ccactcaaaa ggcaatagat 1200

ggagtcacca ataaggtcaa ctcaatcatt gacaaaatga acactcagtt tgaggccgtt 1260

1320

gggtttctag atgtctggac ttataatgcc gaacttctgg ttctcatgga aaatgagaga 1380

actctagact ttcatgactc aaatgttaag aacctctacg acaaggtccg actacagctt 1440

agggataatg caaaggagct gggtaacggt tgtttcgagt tctatcacaa atgtgataat 1500

gaatgtatgg aaagtataag aaacggaacg tacaactatc cgcagtattc agaagaagca 1560

agattaaaaa gagaggaaat aagtggggta aaattggaat caataggaac ttaccaaata 1620

ctgtcaattt attcaacagt ggcgagttcc ctagcactgg caatcatgat ggctggtcta 1680

tctttatgga tgtgctccaa tggatcgtta caatgcagaa tttgcattta a 1731

<210> 69

<211> 576

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H5 Indo

<400> 69

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Asp Gln Ile Cys Ile Gly Tyr His

20 25 30

Ala Asn Asn Ser Thr Glu Gln Val Asp Thr Ile Met Glu Lys Asn Val

35 40 45

Thr Val Thr His Ala Gln Asp Ile Leu Glu Lys Thr His Asn Gly Lys

50 55 60

Leu Cys Asp Leu Asp Gly Val Lys Pro Leu Ile Leu Arg Asp Cys Ser

65 70 75 80

Val Ala Gly Trp Leu Leu Gly Asn Pro Met Cys Asp Glu Phe Ile Asn

85 90 95

Val Pro Glu Trp Ser Tyr Ile Val Glu Lys Ala Asn Pro Thr Asn Asp

100 105 110

Leu Cys Tyr Pro Gly Ser Phe Asn Asp Tyr Glu Glu Leu Lys His Leu

115 120 125

Leu Ser Arg Ile Asn His Phe Glu Lys Ile Gln Ile Ile Pro Lys Ser

130 135 140

Ser Trp Ser Asp His Glu Ala Ser Ser Gly Val Ser Ser Ala Cys Pro

145 150 155 160

Tyr Leu Gly Ser Pro Ser Phe Phe Arg Asn Val Val Trp Leu Ile Lys

165 170 175

Lys Asn Ser Thr Tyr Pro Thr Ile Lys Lys Ser Tyr Asn Asn Thr Asn

180 185 190

Gln Glu Asp Leu Leu Val Leu Trp Gly Ile His His Pro Asn Asp Ala

195 200 205

Ala Glu Gln Thr Arg Leu Tyr Gln Asn Pro Thr Thr Tyr Ile Ser Ile

210 215 220

Gly Thr Ser Thr Leu Asn Gln Arg Leu Val Pro Lys Ile Ala Thr Arg

225 230 235 240

Ser Lys Val Asn Gly Gln Ser Gly Arg Met Glu Phe Phe Trp Thr Ile

245 250 255

Leu Lys Pro Asn Asp Ala Ile Asn Phe Glu Ser Asn Gly Asn Phe Ile

260 265 270

Ala Pro Glu Tyr Ala Tyr Lys Ile Val Lys Lys Gly Asp Ser Ala Ile

275 280 285

Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn Thr Lys Cys Gln Thr

290 295 300

Pro Met Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn Ile His Pro

305 310 315 320

Leu Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val

325 330 335

Leu Ala Thr Gly Leu Arg Asn Ser Pro Gln Arg Glu Ser Arg Arg Lys

340 345 350

Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp

355 360 365

Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gln

370 375 380

Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln Lys Ala Ile Asp

385 390 395 400

Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys Met Asn Thr Gln

405 410 415

Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg Ile Glu

420 425 430

Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr

435 440 445

Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe

450 455 460

His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gln Leu

465 470 475 480

Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His

485 490 495

Lys Cys Asp Asn Glu Cys Met Glu Ser Ile Arg Asn Gly Thr Tyr Asn

500 505 510

Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile Ser

515 520 525

Gly Val Lys Leu Glu Ser Ile Gly Thr Tyr Gln Ile Leu Ser Ile Tyr

530 535 540

Ser Thr Val Ala Ser Ser Leu Ala Leu Ala Ile Met Met Ala Gly Leu

545 550 555 560

Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys Arg Ile Cys Ile

565 570 575

<210> 70

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H5Ind(F393D).r

<400> 70

cttccaacgg cctcgtcctg agtgttcatt ttgtcaatga ttgagttga 49

<210> 71

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> H5Ind(F393D).c

<400> 71

caaaatgaac actcaggacg aggccgttgg aagggaattt aataactta 49

<210> 72

<211> 1731

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H5 Indo-F393D

<400> 72

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cggatcagat ttgcattggt taccatgcaa acaattcaac agagcaggtt 120

gacacaatca tggaaaagaa cgttactgtt acacatgccc aagacatact ggaaaagaca 180

cacaacggga agctctgcga tctagatgga gtgaagcctc taattttaag agattgtagt 240

gtagctggat ggctcctcgg gaacccaatg tgtgacgaat tcatcaatgt accggaatgg 300

tcttacatag tggagaaggc caatccaacc aatgacctct gttacccagg gagtttcaac 360

420

atccccaaaa gttcttggtc cgatcatgaa gcctcatcag gagttagctc agcatgtcca 480

tacctgggaa gtccctcctt ttttagaaat gtggtatggc ttatcaaaaa gaacagtaca 540

600

ggaattcacc atcctaatga tgcggcagag cagacaaggc tatatcaaaa cccaaccacc 660

tatatttcca ttgggacatc aacactaaac cagagattgg taccaaaaat agctactaga 720

tccaaagtaa acgggcaaag tggaaggatg gagttcttct ggacaatttt aaaacctaat 780

gatgcaatca acttcgagag taatggaaat ttcattgctc cagaatatgc atacaaaatt 840

gtcaagaaag gggactcagc aattatgaaa agtgaattgg aatatggtaa ctgcaacacc 900

aagtgtcaaa ctccaatggg ggcgataaac tctagtatgc cattccacaa catacaccct 960

ctcaccatcg gggaatgcc caaatatgtg aaatcaaaca gattagtcct tgcaacaggg 1020

ctcagaaata gccctcaaag agagagcaga agaaaaaaga gaggactatt tggagctata 1080

gcaggtttta tagagggagg atggcaggga atggtagatg gttggtatgg gtaccaccat 1140

agcaatgagc aggggagtgg gtacgctgca gacaaagaat ccactcaaaa ggcaatagat 1200

ggagtcacca ataaggtcaa ctcaatcatt gacaaaatga acactcagga cgaggccgtt 1260

1320

gggtttctag atgtctggac ttataatgcc gaacttctgg ttctcatgga aaatgagaga 1380

actctagact ttcatgactc aaatgttaag aacctctacg acaaggtccg actacagctt 1440

agggataatg caaaggagct gggtaacggt tgtttcgagt tctatcacaa atgtgataat 1500

gaatgtatgg aaagtataag aaacggaacg tacaactatc cgcagtattc agaagaagca 1560

agattaaaaa gagaggaaat aagtggggta aaattggaat caataggaac ttaccaaata 1620

ctgtcaattt attcaacagt ggcgagttcc ctagcactgg caatcatgat ggctggtcta 1680

tctttatgga tgtgctccaa tggatcgtta caatgcagaa tttgcattta a 1731

<210> 73

<211> 576

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H5 Indo-F393D

<400> 73

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Asp Gln Ile Cys Ile Gly Tyr His

20 25 30

Ala Asn Asn Ser Thr Glu Gln Val Asp Thr Ile Met Glu Lys Asn Val

35 40 45

Thr Val Thr His Ala Gln Asp Ile Leu Glu Lys Thr His Asn Gly Lys

50 55 60

Leu Cys Asp Leu Asp Gly Val Lys Pro Leu Ile Leu Arg Asp Cys Ser

65 70 75 80

Val Ala Gly Trp Leu Leu Gly Asn Pro Met Cys Asp Glu Phe Ile Asn

85 90 95

Val Pro Glu Trp Ser Tyr Ile Val Glu Lys Ala Asn Pro Thr Asn Asp

100 105 110

Leu Cys Tyr Pro Gly Ser Phe Asn Asp Tyr Glu Glu Leu Lys His Leu

115 120 125

Leu Ser Arg Ile Asn His Phe Glu Lys Ile Gln Ile Ile Pro Lys Ser

130 135 140

Ser Trp Ser Asp His Glu Ala Ser Ser Gly Val Ser Ser Ala Cys Pro

145 150 155 160

Tyr Leu Gly Ser Pro Ser Phe Phe Arg Asn Val Val Trp Leu Ile Lys

165 170 175

Lys Asn Ser Thr Tyr Pro Thr Ile Lys Lys Ser Tyr Asn Asn Thr Asn

180 185 190

Gln Glu Asp Leu Leu Val Leu Trp Gly Ile His His Pro Asn Asp Ala

195 200 205

Ala Glu Gln Thr Arg Leu Tyr Gln Asn Pro Thr Thr Tyr Ile Ser Ile

210 215 220

Gly Thr Ser Thr Leu Asn Gln Arg Leu Val Pro Lys Ile Ala Thr Arg

225 230 235 240

Ser Lys Val Asn Gly Gln Ser Gly Arg Met Glu Phe Phe Trp Thr Ile

245 250 255

Leu Lys Pro Asn Asp Ala Ile Asn Phe Glu Ser Asn Gly Asn Phe Ile

260 265 270

Ala Pro Glu Tyr Ala Tyr Lys Ile Val Lys Lys Gly Asp Ser Ala Ile

275 280 285

Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn Thr Lys Cys Gln Thr

290 295 300

Pro Met Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn Ile His Pro

305 310 315 320

Leu Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val

325 330 335

Leu Ala Thr Gly Leu Arg Asn Ser Pro Gln Arg Glu Ser Arg Arg Lys

340 345 350

Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp

355 360 365

Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gln

370 375 380

Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln Lys Ala Ile Asp

385 390 395 400

Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys Met Asn Thr Gln

405 410 415

Asp Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg Ile Glu

420 425 430

Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr

435 440 445

Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe

450 455 460

His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gln Leu

465 470 475 480

Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His

485 490 495

Lys Cys Asp Asn Glu Cys Met Glu Ser Ile Arg Asn Gly Thr Tyr Asn

500 505 510

Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile Ser

515 520 525

Gly Val Lys Leu Glu Ser Ile Gly Thr Tyr Gln Ile Leu Ser Ile Tyr

530 535 540

Ser Thr Val Ala Ser Ser Leu Ala Leu Ala Ile Met Met Ala Gly Leu

545 550 555 560

Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys Arg Ile Cys Ile

565 570 575

<210> 74

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Primer IF-H5_Egy.r

<400> 74

actaaagaaa ataggccttt aaatgcaaat tctgcattgt agcgatccat t 51

<210> 75

<211> 1728

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H5 Egypt

<400> 75

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cggatcagat ttgcattggt taccatgcaa acaactcgac agagcaggtt 120

gacacaataa tggaaaagaa tgtcactgtt acacacgccc aagacatact ggaaaagaca 180

cacaacggga aactctgcaa tctagatgga gtgaagcctc tcattttgag agattgtagt 240

gtagctggat ggctcctcgg gaacccaatg tgcgatgaat tcctcaatgt gccggaatgg 300

tcttacatag tggagaaaat caatccagcc aatgacctct gttatccagg gaatttcaac 360

gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa aattcagatc 420

attcccaaag attcttggtc agatcatgaa gcctcgggag tgagctcagc atgcccatac 480

caaggaagat cctccttttt tagaaatgtt gtatggctta ccaaaaagaa cgatgcatac 540

ccaacaataa agaaaagtta caataatact aaccaagaag atcttttggt actatggggg 600

attcaccatc caaatgatgc tgcagagcag acaaggcttt atcaaaaccc aactacctat 660

atctccgttg ggacatcaac actaaaccag agattggtac ccaaaatagc tactagatct 720

aaggtaaacg ggcaaagtgg aaggatggag ttcttttgga caattttaaa atcgaatgat 780

gcaataaact ttgagagcaa tggaaacttc attgctccag aaaatgcata caaaattgtc 840

aagaaaggag attcaacaat tatgaaaagt gagttggaat atagtaactg caacaccaag 900

tgtcagactc caataggggc gataaactcc agtatgccat tccacaacat ccaccctctc 960

accatcgggg aatgccccaa atatgtgaaa tcaaacagat tagtccttgc tactgggctc 1020

aggaatagcc ctcaaggaga gaaaagaaga aaaaagagag gactattcgg agccatagca 1080

ggctttatag agggaggatg gcagggaatg gtagatggtt ggtatgggta ccaccatagc 1140

aacgagcagg ggagtgggta cgctgcagac aaagaatcca ctcaaagggc tatagatgga 1200

gtcaccaata aggtcaattc gatcattgac aaaatgaaca ctcagtttga ggctgttgga 1260

agggaattta ataacttaga aggagaata gaaaatttaa acaagaagat ggaagacgga 1320

ttcctagatg tctggactta taatgctgaa cttctggttc tcatggaaaa tgagagaact 1380

ctagactttc atgactcaaa tgtcaagaat ctttatgaca aggtccgact acagcttagg 1440

gataatgcaa aggagcttgg taacggttgt ttcgagttct atcacagatg tgataatgaa 1500

tgtatggaaa gtgtaagaaa cggaacgtat gactaccctc aatattcaga agaagcaaga 1560

ttaaaaagag aggaaataag tggagtaaaa ttggagtcaa taggaactta ccaaatactg 1620

tcaatttatt caacagtggc gagctcccta gcactggcaa tcatggtggc tggtctatct 1680

ttatggatgt gctccaatgg atcgctacaa tgcagaattt gcatttaa 1728

<210> 76

<211> 575

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H5 Egypt

<400> 76

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Asp Gln Ile Cys Ile Gly Tyr His

20 25 30

Ala Asn Asn Ser Thr Glu Gln Val Asp Thr Ile Met Glu Lys Asn Val

35 40 45

Thr Val Thr His Ala Gln Asp Ile Leu Glu Lys Thr His Asn Gly Lys

50 55 60

Leu Cys Asn Leu Asp Gly Val Lys Pro Leu Ile Leu Arg Asp Cys Ser

65 70 75 80

Val Ala Gly Trp Leu Leu Gly Asn Pro Met Cys Asp Glu Phe Leu Asn

85 90 95

Val Pro Glu Trp Ser Tyr Ile Val Glu Lys Ile Asn Pro Ala Asn Asp

100 105 110

Leu Cys Tyr Pro Gly Asn Phe Asn Asp Tyr Glu Glu Leu Lys His Leu

115 120 125

Leu Ser Arg Ile Asn His Phe Glu Lys Ile Gln Ile Ile Pro Lys Asp

130 135 140

Ser Trp Ser Asp His Glu Ala Ser Gly Val Ser Ser Ala Cys Pro Tyr

145 150 155 160

Gln Gly Arg Ser Ser Phe Phe Arg Asn Val Val Trp Leu Thr Lys Lys

165 170 175

Asn Asp Ala Tyr Pro Thr Ile Lys Lys Ser Tyr Asn Asn Thr Asn Gln

180 185 190

Glu Asp Leu Leu Val Leu Trp Gly Ile His His Pro Asn Asp Ala Ala

195 200 205

Glu Gln Thr Arg Leu Tyr Gln Asn Pro Thr Thr Tyr Ile Ser Val Gly

210 215 220

Thr Ser Thr Leu Asn Gln Arg Leu Val Pro Lys Ile Ala Thr Arg Ser

225 230 235 240

Lys Val Asn Gly Gln Ser Gly Arg Met Glu Phe Phe Trp Thr Ile Leu

245 250 255

Lys Ser Asn Asp Ala Ile Asn Phe Glu Ser Asn Gly Asn Phe Ile Ala

260 265 270

Pro Glu Asn Ala Tyr Lys Ile Val Lys Lys Gly Asp Ser Thr Ile Met

275 280 285

Lys Ser Glu Leu Glu Tyr Ser Asn Cys Asn Thr Lys Cys Gln Thr Pro

290 295 300

Ile Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn Ile His Pro Leu

305 310 315 320

Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val Leu

325 330 335

Ala Thr Gly Leu Arg Asn Ser Pro Gln Gly Glu Lys Arg Arg Lys Lys

340 345 350

Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp Gln

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gln Gly

370 375 380

Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln Arg Ala Ile Asp Gly

385 390 395 400

Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys Met Asn Thr Gln Phe

405 410 415

Glu Ala Val Gly Arg Glu Phe Asn Leu Glu Arg Arg Ile Glu Asn

420 425 430

Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr Asn

435 440 445

Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe His

450 455 460

Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gln Leu Arg

465 470 475 480

Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His Arg

485 490 495

Cys Asp Asn Glu Cys Met Glu Ser Val Arg Asn Gly Thr Tyr Asp Tyr

500 505 510

Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile Ser Gly

515 520 525

Val Lys Leu Glu Ser Ile Gly Thr Tyr Gln Ile Leu Ser Ile Tyr Ser

530 535 540

Thr Val Ala Ser Ser Leu Ala Leu Ala Ile Met Val Ala Gly Leu Ser

545 550 555 560

Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys Arg Ile Cys Ile

565 570 575

<210> 77

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H5Egy(F392D).r

<400> 77

cttccaacag cctcgtcctg agtgttcatt ttgtcaatga tcgaattga 49

<210> 78

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> Primer H5Egy(F392D).c

<400> 78

caaaatgaac actcaggacg aggctgttgg aagggaattt aataactta 49

<210> 79

<211> 1728

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H5 Egypt-F392D

<400> 79

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cggatcagat ttgcattggt taccatgcaa acaactcgac agagcaggtt 120

gacacaataa tggaaaagaa tgtcactgtt acacacgccc aagacatact ggaaaagaca 180

cacaacggga aactctgcaa tctagatgga gtgaagcctc tcattttgag agattgtagt 240

gtagctggat ggctcctcgg gaacccaatg tgcgatgaat tcctcaatgt gccggaatgg 300

tcttacatag tggagaaaat caatccagcc aatgacctct gttatccagg gaatttcaac 360

gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa aattcagatc 420

attcccaaag attcttggtc agatcatgaa gcctcgggag tgagctcagc atgcccatac 480

caaggaagat cctccttttt tagaaatgtt gtatggctta ccaaaaagaa cgatgcatac 540

ccaacaataa agaaaagtta caataatact aaccaagaag atcttttggt actatggggg 600

attcaccatc caaatgatgc tgcagagcag acaaggcttt atcaaaaccc aactacctat 660

atctccgttg ggacatcaac actaaaccag agattggtac ccaaaatagc tactagatct 720

aaggtaaacg ggcaaagtgg aaggatggag ttcttttgga caattttaaa atcgaatgat 780

gcaataaact ttgagagcaa tggaaacttc attgctccag aaaatgcata caaaattgtc 840

aagaaaggag attcaacaat tatgaaaagt gagttggaat atagtaactg caacaccaag 900

tgtcagactc caataggggc gataaactcc agtatgccat tccacaacat ccaccctctc 960

accatcgggg aatgccccaa atatgtgaaa tcaaacagat tagtccttgc tactgggctc 1020

aggaatagcc ctcaaggaga gaaaagaaga aaaaagagag gactattcgg agccatagca 1080

ggctttatag agggaggatg gcagggaatg gtagatggtt ggtatgggta ccaccatagc 1140

aacgagcagg ggagtgggta cgctgcagac aaagaatcca ctcaaagggc tatagatgga 1200

gtcaccaata aggtcaattc gatcattgac aaaatgaaca ctcaggacga ggctgttgga 1260

agggaattta ataacttaga aggagaata gaaaatttaa acaagaagat ggaagacgga 1320

ttcctagatg tctggactta taatgctgaa cttctggttc tcatggaaaa tgagagaact 1380

ctagactttc atgactcaaa tgtcaagaat ctttatgaca aggtccgact acagcttagg 1440

gataatgcaa aggagcttgg taacggttgt ttcgagttct atcacagatg tgataatgaa 1500

tgtatggaaa gtgtaagaaa cggaacgtat gactaccctc aatattcaga agaagcaaga 1560

ttaaaaagag aggaaataag tggagtaaaa ttggagtcaa taggaactta ccaaatactg 1620

tcaatttatt caacagtggc gagctcccta gcactggcaa tcatggtggc tggtctatct 1680

ttatggatgt gctccaatgg atcgctacaa tgcagaattt gcatttaa 1728

<210> 80

<211> 575

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H5 Egypt-F392D

<400> 80

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Asp Gln Ile Cys Ile Gly Tyr His

20 25 30

Ala Asn Asn Ser Thr Glu Gln Val Asp Thr Ile Met Glu Lys Asn Val

35 40 45

Thr Val Thr His Ala Gln Asp Ile Leu Glu Lys Thr His Asn Gly Lys

50 55 60

Leu Cys Asn Leu Asp Gly Val Lys Pro Leu Ile Leu Arg Asp Cys Ser

65 70 75 80

Val Ala Gly Trp Leu Leu Gly Asn Pro Met Cys Asp Glu Phe Leu Asn

85 90 95

Val Pro Glu Trp Ser Tyr Ile Val Glu Lys Ile Asn Pro Ala Asn Asp

100 105 110

Leu Cys Tyr Pro Gly Asn Phe Asn Asp Tyr Glu Glu Leu Lys His Leu

115 120 125

Leu Ser Arg Ile Asn His Phe Glu Lys Ile Gln Ile Ile Pro Lys Asp

130 135 140

Ser Trp Ser Asp His Glu Ala Ser Gly Val Ser Ser Ala Cys Pro Tyr

145 150 155 160

Gln Gly Arg Ser Ser Phe Phe Arg Asn Val Val Trp Leu Thr Lys Lys

165 170 175

Asn Asp Ala Tyr Pro Thr Ile Lys Lys Ser Tyr Asn Asn Thr Asn Gln

180 185 190

Glu Asp Leu Leu Val Leu Trp Gly Ile His His Pro Asn Asp Ala Ala

195 200 205

Glu Gln Thr Arg Leu Tyr Gln Asn Pro Thr Thr Tyr Ile Ser Val Gly

210 215 220

Thr Ser Thr Leu Asn Gln Arg Leu Val Pro Lys Ile Ala Thr Arg Ser

225 230 235 240

Lys Val Asn Gly Gln Ser Gly Arg Met Glu Phe Phe Trp Thr Ile Leu

245 250 255

Lys Ser Asn Asp Ala Ile Asn Phe Glu Ser Asn Gly Asn Phe Ile Ala

260 265 270

Pro Glu Asn Ala Tyr Lys Ile Val Lys Lys Gly Asp Ser Thr Ile Met

275 280 285

Lys Ser Glu Leu Glu Tyr Ser Asn Cys Asn Thr Lys Cys Gln Thr Pro

290 295 300

Ile Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn Ile His Pro Leu

305 310 315 320

Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val Leu

325 330 335

Ala Thr Gly Leu Arg Asn Ser Pro Gln Gly Glu Lys Arg Arg Lys Lys

340 345 350

Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp Gln

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gln Gly

370 375 380

Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln Arg Ala Ile Asp Gly

385 390 395 400

Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys Met Asn Thr Gln Asp

405 410 415

Glu Ala Val Gly Arg Glu Phe Asn Leu Glu Arg Arg Ile Glu Asn

420 425 430

Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr Asn

435 440 445

Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe His

450 455 460

Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gln Leu Arg

465 470 475 480

Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His Arg

485 490 495

Cys Asp Asn Glu Cys Met Glu Ser Val Arg Asn Gly Thr Tyr Asp Tyr

500 505 510

Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg Glu Glu Ile Ser Gly

515 520 525

Val Lys Leu Glu Ser Ile Gly Thr Tyr Gln Ile Leu Ser Ile Tyr Ser

530 535 540

Thr Val Ala Ser Ser Leu Ala Leu Ala Ile Met Val Ala Gly Leu Ser

545 550 555 560

Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys Arg Ile Cys Ile

565 570 575

<210> 81

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-N382A

<400> 81

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 82

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-N382A

<400> 82

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 83

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Switz-L384V

<400> 83

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggagaaaa ctgcacacta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagaa atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacaatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tcttcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

ttaaactcca aatacccagc attaaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aagggatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacgaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaga caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg gtggatggtt ggtacggctt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg agtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat caatcagaaa tggaacttat gaccacgatg tatacaggga tgaagcatta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atgttttttg ctttgtgttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 84

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Switz-L384V

<400> 84

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Glu Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Lys Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asn Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ser Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Leu Asn Ser Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asp Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Arg Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Arg Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 85

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Penn-CysTm

<400> 85

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggaaaaaa ctgcactcta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagag atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacgatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

tcaaacttca aatacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aaggaatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacaaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg aaggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat tggaacttat gaccacgatg tatacaggga tgaagcttta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 86

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Penn-CysTm

<400> 86

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Lys Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Arg Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asp Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Ser Asn Phe Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asn Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Gln Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Lys Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 87

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Penn-N382A-CysTm

<400> 87

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggaaaaaa ctgcactcta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagag atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacgatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

tcaaacttca aatacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aaggaatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacaaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg aaggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctggctcg attgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat tggaacttat gaccacgatg tatacaggga tgaagcttta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 88

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Penn-N382A-CysTm

<400> 88

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Lys Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Arg Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asp Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Ser Asn Phe Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asn Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Gln Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Lys Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Ala Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 89

<211> 1725

<212> DNA

<213> Artificial sequence

<220>

<223> DNA PDI-H3 Penn-L384V-CysTm

<400> 89

atggcgaaaa acgttgcgat tttcggctta ttgttttctc ttcttgtgtt ggttccttct 60

cagatcttcg cgcaaaaact tcctggaaat gacaatagca cggcaacgct gtgccttggg 120

caccatgcag taccaaacgg aacgatagtg aaaacaatca cgaatgaccg aattgaagtt 180

actaatgcta ctgagctggt tcagaattcc tcaataggtg aaatatgcga cagtcctcat 240

cagatccttg atggaaaaaa ctgcactcta atagatgctc tattgggaga ccctcagtgt 300

gatggctttc aaaataagag atgggacctt tttgttgaac gaagcaaagc ctacagcaac 360

tgttaccctt atgatgtgcc ggattatgcc tcccttaggt cactagttgc ctcatccggc 420

acactggagt ttaacgatga aagcttcaat tgggctggag tcactcaaaa cggaacaagt 480

tctgcttgca taaggggatc taatagtagt ttctttagta gattaaattg gttgacccac 540

tcaaacttca aatacccagc attgaacgtg actatgccaa acaatgaaca atttgacaaa 600

660

caatcatcag gaagaatcac agtatctacc aaaagaagcc aacaagctgt aatcccgaat 720

atcggatcta gacccagaat aaggaatatc cctagcagaa taagcatcta ttggacaata 780

gtaaaaccgg gagacatact tttgattaac agcacaggga atctaattgc tcctaggggt 840

tacttcaaaa tacaaagtgg gaaaagctca ataatgagat cagatgcacc cattggcaaa 900

tgcaagtctg aatgcatcac tccaaatgga agcattccca atgacaaacc attccaaaat 960

gtaaacagga tcacatacgg ggcctgtccc agatatgtta agcaaagcac tctgaaattg 1020

gcaacaggaa tgcgaaatgt accagagaaa caaactagag gcatatttgg cgcaaatagcg 1080

ggtttcatag aaaatggttg ggagggaatg aaggatggtt ggtacggttt caggcatcaa 1140

aattctgagg gaagaggaca agcagcagat ctcaaaagca ctcaagcagc aatcgatcaa 1200

atcaatggga agctgaatcg agtgatcggg aaaaccaacg agaaattcca tcagattgaa 1260

aaagaattct cagaagtaga agggagaatt caggaccttg agaaatatgt tgaggacaca 1320

aaaatagatc tctggtcata caacgcggag cttcttgttg ccctggagaa ccaacataca 1380

attgatctaa ctgactcaga aatgaacaaa ctgtttgaaa aaacaaagaa gcaactgagg 1440

gaaaatgctg aggatatggg caatggttgt ttcaaaatat accacaaatg tgacaatgcc 1500

tgcataggat tggaacttat gaccacgatg tatacaggga tgaagcttta 1560

aacaaccggt tccagatcaa gggagttgag ctgaagtcag ggtacaaaga ttggatccta 1620

tggatttcct ttgccatatc atcccttgta ctgttagttg ctttgttggg gttcatcatg 1680

tgggcctgcc aaaagggcaa cattaggtgc aacatttgca tttga 1725

<210> 90

<211> 574

<212> Protein

<213> Artificial sequence

<220>

<223> AK PDI-H3 Penn-L384V-CysTm

<400> 90

Met Ala Lys Asn Val Ala Ile Phe Gly Leu Leu Phe Ser Leu Leu Val

1 5 10 15

Leu Val Pro Ser Gln Ile Phe Ala Gln Lys Leu Pro Gly Asn Asp Asn

20 25 30

Ser Thr Ala Thr Leu Cys Leu Gly His His Ala Val Pro Asn Gly Thr

35 40 45

Ile Val Lys Thr Ile Thr Asn Asp Arg Ile Glu Val Thr Asn Ala Thr

50 55 60

Glu Leu Val Gln Asn Ser Ser Ile Gly Glu Ile Cys Asp Ser Pro His

65 70 75 80

Gln Ile Leu Asp Gly Lys Asn Cys Thr Leu Ile Asp Ala Leu Leu Gly

85 90 95

Asp Pro Gln Cys Asp Gly Phe Gln Asn Lys Arg Trp Asp Leu Phe Val

100 105 110

Glu Arg Ser Lys Ala Tyr Ser Asn Cys Tyr Pro Tyr Asp Val Pro Asp

115 120 125

Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser Ser Gly Thr Leu Glu Phe

130 135 140

Asn Asp Glu Ser Phe Asn Trp Ala Gly Val Thr Gln Asn Gly Thr Ser

145 150 155 160

Ser Ala Cys Ile Arg Gly Ser Asn Ser Ser Phe Phe Ser Arg Leu Asn

165 170 175

Trp Leu Thr His Ser Asn Phe Lys Tyr Pro Ala Leu Asn Val Thr Met

180 185 190

Pro Asn Asn Glu Gln Phe Asp Lys Leu Tyr Ile Trp Gly Val His His

195 200 205

Pro Gly Thr Asp Lys Asp Gln Ile Phe Leu Tyr Ala Gln Ser Ser Gly

210 215 220

Arg Ile Thr Val Ser Thr Lys Arg Ser Gln Gln Ala Val Ile Pro Asn

225 230 235 240

Ile Gly Ser Arg Pro Arg Ile Arg Asn Ile Pro Ser Arg Ile Ser Ile

245 250 255

Tyr Trp Thr Ile Val Lys Pro Gly Asp Ile Leu Leu Ile Asn Ser Thr

260 265 270

Gly Asn Leu Ile Ala Pro Arg Gly Tyr Phe Lys Ile Gln Ser Gly Lys

275 280 285

Ser Ser Ile Met Arg Ser Asp Ala Pro Ile Gly Lys Cys Lys Ser Glu

290 295 300

Cys Ile Thr Pro Asn Gly Ser Ile Pro Asn Asp Lys Pro Phe Gln Asn

305 310 315 320

Val Asn Arg Ile Thr Tyr Gly Ala Cys Pro Arg Tyr Val Lys Gln Ser

325 330 335

Thr Leu Lys Leu Ala Thr Gly Met Arg Asn Val Pro Glu Lys Gln Thr

340 345 350

Arg Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu

355 360 365

Gly Met Lys Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly

370 375 380

Arg Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln

385 390 395 400

Ile Asn Gly Lys Leu Asn Arg Val Ile Gly Lys Thr Asn Glu Lys Phe

405 410 415

His Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp

420 425 430

Leu Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn

435 440 445

Ala Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr

450 455 460

Asp Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Lys Lys Gln Leu Arg

465 470 475 480

Glu Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys

485 490 495

Cys Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His

500 505 510

Asp Val Tyr Arg Asp Glu Ala Leu Asn Arg Phe Gln Ile Lys Gly

515 520 525

Val Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe

530 535 540

Ala Ile Ser Ser Leu Val Leu Leu Val Ala Leu Leu Gly Phe Ile Met

545 550 555 560

Trp Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile

565 570

<210> 91

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 91

Gln Lys Ile Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Glu Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Asn Glu Ser Phe Asn Trp Thr

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ala Cys Ile Arg Lys Ser Ser

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Tyr Thr

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Val Pro Asn Asn Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Arg Ser Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys His Ser Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Gly Thr Tyr Asp His Asn Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 92

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 92

Gln Lys Ile Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Glu Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Asn Glu Ser Phe Asn Trp Thr

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ala Cys Ile Arg Arg Ser Ser

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Tyr Thr

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Asn Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Gln Ser Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys His Ser Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Gly Thr Tyr Asp His Asn Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 93

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 93

Gln Lys Ile Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Glu Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Asn Glu Ser Phe Asn Trp Thr

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ala Cys Ile Arg Arg Ser Ser

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Tyr Thr

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Lys Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Gln Ser Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys His Ser Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Val Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Glu Thr Tyr Asp His Asn Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 94

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 94

Gln Lys Ile Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Glu Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Lys Asn Glu Ser Phe Asn Trp Thr

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ala Cys Ile Arg Arg Ser Ser

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Tyr Thr

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Lys Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Gln Ser Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys His Ser Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Val Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Glu Thr Tyr Asp His Asn Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 95

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 95

Gln Lys Leu Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Lys Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Arg Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Asn Asp Glu Ser Phe Asn Trp Ala

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ala Cys Ile Arg Gly Ser Asn

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Ser Asn Phe Lys

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Asn Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Gln Ser Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asn Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Gln Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys Gln Ser Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Lys Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Gly Thr Tyr Asp His Asp Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 96

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 96

Gln Lys Leu Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Glu Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Asn Glu Ser Phe Asn Trp Ala

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ser Cys Ile Arg Gly Ser Asn

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Ser Lys

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Asn Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Gln Ser Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys Gln Ser Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Arg Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Gly Thr Tyr Asp His Asp Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 97

<211> 550

<212> Protein

<213> Alphainfluenza A virus

<400> 97

Gln Lys Leu Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

1 5 10 15

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

20 25 30

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

35 40 45

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Glu Asn Cys

50 55 60

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

65 70 75 80

Asn Lys Lys Trp Asp Leu Phe Val Glu Arg Ser Arg Ala Tyr Ser Asn

85 90 95

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

100 105 110

Ala Ser Ser Gly Thr Leu Glu Phe Asn Glu Ser Phe Asn Trp Ala

115 120 125

Gly Val Thr Gln Asn Gly Thr Ser Ser Ser Cys Ile Arg Gly Ser Asn

130 135 140

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Ser Lys

145 150 155 160

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Asn Glu Gln Phe Asp Lys

165 170 175

Leu Tyr Ile Trp Gly Val His His Pro Gly Thr Asp Lys Asp Gln Ile

180 185 190

Phe Leu Tyr Ala Lys Pro Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

195 200 205

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

210 215 220

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

225 230 235 240

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

245 250 255

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

260 265 270

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

275 280 285

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

290 295 300

Cys Pro Arg Tyr Val Lys Gln Asn Thr Leu Lys Leu Ala Thr Gly Met

305 310 315 320

Arg Asn Val Pro Glu Arg Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

325 330 335

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

340 345 350

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

355 360 365

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

370 375 380

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

385 390 395 400

Glu Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

405 410 415

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

420 425 430

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

435 440 445

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

450 455 460

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

465 470 475 480

Ile Arg Asn Gly Thr Tyr Asp His Asp Val Tyr Arg Asp Glu Ala Leu

485 490 495

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

500 505 510

Asp Trp Ile Leu Trp Ile Ser Phe Ala Ile Ser Cys Phe Leu Leu Cys

515 520 525

Val Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

530 535 540

Arg Cys Asn Ile Cys Ile

545 550

<210> 98

<211> 5

<212> Protein

<213> Artificial sequence

<220>

<223> CysTM sequence (amino acids)

<400> 98

Ser Leu Val Leu Leu

15

<210> 99

<211> 5

<212> Protein

<213> Artificial sequence

<220>

<223> Native TMCT (amino acids)

<400> 99

Cys Phe Leu Leu Cys

15

<210> 100

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> CysTM sequence (nucleotides)

<400> 100

tcccttgtac tgtta 15

<210> 101

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> Native TMCT (nucleotides)

<400> 101

tgttttttgc tttgt 15

<210> 102

<211> 1701

<212> DNA

<213> Alphainfluenza A virus

<400> 102

atgaagacta tcattgcttt gagctacatt ctatgtctgg ttttcgctca aaaaattcct 60

ggaaatgaca atagcacggc aacgctgtgc cttgggcacc atgcagtacc aaacggaacg 120

atagtgaaaa caatcacgaa tgaccgaatt gaagttacta atgctactga gctggttcag 180

aattcctcaa taggtgaaat atgcgacagt cctcatcaga tccttgatgg agaaaactgc 240

acactaatag atgctctatt gggagaccct cagtgtgatg gctttcaaaa taagaaatgg 300

gacctttttg ttgaacgaag caaagcctac agcaactgtt acccttatga tgtgccggat 360

tatgcctccc ttaggtcact agttgcctca tccggcacac tggagtttaa caatgaaagc 420

ttcaattgga ctggagtcac tcaaaacgga acaagttctg cttgcataag gagatctagt 480

agtagtttct ttagtagatt aaattggttg acccacttaa actacacata cccagcattg 540

aacgtgacta tgccaaacaa tgaacaattt gacaaattgt acatttgggg ggttcaccac 600

ccgggtacgg acaaggacca aatcttcctg tatgctcaat catcaggaag aatcacagta 660

tctaccaaaa gaagccaaca agctgtaatc ccaaatatcg gatctagacc cagaataagg 720

gatatcccta gcagaataag catctattgg acaatagtaa aaccgggaga catacttttg 780

attaacagca cagggaatct aattgctcct aggggttact tcaaaatacg aagtgggaaa 840

agctcaataa tgagatcaga tgcacccatt ggcaaatgca agtctgaatg catcactcca 900

aatggaagca ttcccaatga caaaccattc caaaatgtaa acaggatcac atacggggcc 960

tgtcccagat atgttaagca tagcactctg aaattggcaa caggaatgcg aaatgtacca 1020

gagaaacaaa ctagaggcat atttggcgca atagcgggtt tcatagaaaa tggttgggag 1080

ggaatggtgg atggttggta cggtttcagg catcaaaatt ctgagggaag aggacaagca 1140

gcagatctca aaagcactca agcagcaatc gatcaaatca atgggaagct gaatcgattg 1200

atcgggaaaa ccaacgagaa attccatcag attgaaaaag aattctcaga agtagaagga 1260

agaattcagg accttgagaa atatgttgag gacactaaaa tagatctctg gtcatacaac 1320

gcggagcttc ttgttgccct ggagaaccaa catacaattg atctaactga ctcagaaatg 1380

aacaaactgt ttgaaaaaac aaagaagcaa ctgagggaaa atgctgagga tatgggcaat 1440

ggttgtttca aaatatacca caaatgtgac aatgcctgca taggatcaat aagaaatgga 1500

acttatgacc acaatgtgta cagggatgaa gcattaaaca accggttcca gatcaaggga 1560

catatcatgt 1620

tttttgcttt gtgttgcttt gttggggttc atcatgtggg cctgccaaaa gggcaacatt 1680

aggtgcaaca tttgcatttg a 1701

<210> 103

<211> 3108

<212> DNA

<213> Artificial sequence

<220>

<223> Construct 2801 from 2X35S promoter to NOS terminator

<400> 103

gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360

tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420

agggtaatat ccggaaacct ccctcggattc cattgcccag ctatctgtca ctttattgtg 480

aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540

atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720

taaggaagtt catttcattt ggagaggtat taaaatctta ataggttttg ataaaagcga 780

acgtggggaa acccgaacca aaccttcttc taaactctct ctcatctctc ttaaagcaaa 840

cttctctctt gtctttcttg cgtgagcgat cttcaacgtt gtcagatcgt gcttcggcac 900

cagtacaatg gcgaaaaacg ttgcgatttt cggcttattg ttttctcttc ttgtgttggt 960

tccttctcag atcttcgcgc aaaaacttcc tggaaatgac aatagcacgg caacgctgtg 1020

ccttgggcac catgcagtac caaacggaac gatagtgaaa acaatcacga atgaccgaat 1080

tgaagttact aatgctactg agctggttca gaattcctca ataggtgaaa tatgcgacag 1140

tcctcatcag atccttgatg gagaaaactg cacactaata gatgctctat tgggagaccc 1200

tcagtgtgat ggctttcaaa ataagaaatg ggaccttttt gttgaacgaa gcaaagccta 1260

cagcaactgt tacccttatg atgtgccgga ttatgcctcc cttaggtcac tagttgcctc 1320

atccggcaca ctggagttta acaatgaaag cttcaattgg gctggagtca ctcaaaacgg 1380

aacaagttct tcttgcataa ggggatctaa tagtagtttc tttagtagat taaattggtt 1440

gacccactta aactccaaat acccagcatt aaacgtgact atgccaaaca atgaacaatt 1500

1560

gtatgcacaa tcatcaggaa gaatcacagt atctaccaaa agaagccaac aagctgtaat 1620

cccgaatatc ggatctagac ccagaataag ggatatccct agcagaataa gcatctattg 1680

gacaatagta aaaccgggag acatactttt gattaacagc acagggaatc taattgctcc 1740

taggggttac ttcaaaatac gaagtgggaa aagctcaata atgagatcag atgcacccat 1800

tggcaaatgc aagtctgaat gcatcactcc aaatggaagc attcccaatg acaaaccatt 1860

ccaaaatgta aacaggatca catacggggc ctgtcccaga tatgttaagc aaagcactct 1920

gaaattggca acaggaatgc gaaatgtacc agagagacaa actagaggca tattggcgc 1980

aatagcgggt ttcatagaaa atggttggga gggaatggtg gatggttggt acggcttcag 2040

gcatcaaaat tctgagggaa gaggacaagc agcagatctc aaaagcactc aagcagcaat 2100

cgatcaaatc aatgggaagc tgaatcgatt gatcgggaaa accaacgaga aattccatca 2160

gattgaaaaa gaattctcag aagtagaagg gagaattcag gaccttgaga aatatgttga 2220

ggacacaaaa atagatctct ggtcatacaa cgcggagctt cttgttgccc tggagaacca 2280

acatacaatt gatctaactg actcagaaat gaacaaactg tttgaaaaaa caaagaagca 2340

actgagggaa aatgctgagg atatgggcaa tggttgtttc aaaatatacc acaaatgtga 2400

caatgcctgc ataggatcaa tcagaaatgg aacttatgac cacgatgtat acagggatga 2460

agcattaaac aaccggttcc agatcaaggg agttgagctg aagtcaggggt acaaagattg 2520

gatcctatgg atttcctttg ccatatcatg ttttttgctt tgtgttgctt tgttggggtt 2580

catcatgtgg gcctgccaaa agggcaacat taggtgcaac atttgcattt gaaggcctat 2640

tttctttagt ttgaatttac tgttattcgg tgtgcatttc tatgtttggt gagcggtttt 2700

2760

ggtcgtccct tcagcaagga cacaaaaaga ttttaattttt attaaaaaaa aaaaaaaaaa 2820

agaccgggaa ttcgatatca agcttatcga cctgcagatc gttcaaacat ttggcaataa 2880

agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg 2940

aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt 3000

tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc 3060

gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagat 3108

<210> 104

<211> 3108

<212> DNA

<213> Artificial sequence

<220>

<223> Construct 3023 from 2X35S promoter to NOS terminator

<400> 104

gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360

tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420

agggtaatat ccggaaacct ccctcggattc cattgcccag ctatctgtca ctttattgtg 480

aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540

atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720

taaggaagtt catttcattt ggagaggtat taaaatctta ataggttttg ataaaagcga 780

acgtggggaa acccgaacca aaccttcttc taaactctct ctcatctctc ttaaagcaaa 840

cttctctctt gtctttcttg cgtgagcgat cttcaacgtt gtcagatcgt gcttcggcac 900

cagtacaatg gcgaaaaacg ttgcgatttt cggcttattg ttttctcttc ttgtgttggt 960

tccttctcag atcttcgcgc aaaaacttcc tggaaatgac aatagcacgg caacgctgtg 1020

ccttgggcac catgcagtac caaacggaac gatagtgaaa acaatcacga atgaccgaat 1080

tgaagttact aatgctactg agctggttca gaattcctca ataggtgaaa tatgcgacag 1140

tcctcatcag atccttgatg gagaaaactg cacactaata gatgctctat tgggagaccc 1200

tcagtgtgat ggctttcaaa ataagaaatg ggaccttttt gttgaacgaa gcaaagccta 1260

cagcaactgt tacccttatg atgtgccgga ttatgcctcc cttaggtcac tagttgcctc 1320

atccggcaca ctggagttta acaatgaaag cttcaattgg gctggagtca ctcaaaacgg 1380

aacaagttct tcttgcataa ggggatctaa tagtagtttc tttagtagat taaattggtt 1440

gacccactta aactccaaat acccagcatt aaacgtgact atgccaaaca atgaacaatt 1500

1560

gtatgcacaa tcatcaggaa gaatcacagt atctaccaaa agaagccaac aagctgtaat 1620

cccgaatatc ggatctagac ccagaataag ggatatccct agcagaataa gcatctattg 1680

gacaatagta aaaccgggag acatactttt gattaacagc acagggaatc taattgctcc 1740

taggggttac ttcaaaatac gaagtgggaa aagctcaata atgagatcag atgcacccat 1800

tggcaaatgc aagtctgaat gcatcactcc aaatggaagc attcccaatg acaaaccatt 1860

ccaaaatgta aacaggatca catacggggc ctgtcccaga tatgttaagc aaagcactct 1920

gaaattggca acaggaatgc gaaatgtacc agagagacaa actagaggca tattggcgc 1980

aatagcgggt ttcatagaaa atggttggga gggaatggtg gatggttggt acggcttcag 2040

gcatcaaaat tctgagggaa gaggacaagc agcagatctc aaaagcactc aagcagcaat 2100

cgatcaaatc aatgggaagc tggctcgatt gatcgggaaa accaacgaga aattccatca 2160

gattgaaaaa gaattctcag aagtagaagg gagaattcag gaccttgaga aatatgttga 2220

ggacacaaaa atagatctct ggtcatacaa cgcggagctt cttgttgccc tggagaacca 2280

acatacaatt gatctaactg actcagaaat gaacaaactg tttgaaaaaa caaagaagca 2340

actgagggaa aatgctgagg atatgggcaa tggttgtttc aaaatatacc acaaatgtga 2400

caatgcctgc ataggatcaa tcagaaatgg aacttatgac cacgatgtat acagggatga 2460

agcattaaac aaccggttcc agatcaaggg agttgagctg aagtcaggggt acaaagattg 2520

gatcctatgg atttcctttg ccatatcatg ttttttgctt tgtgttgctt tgttggggtt 2580

catcatgtgg gcctgccaaa agggcaacat taggtgcaac atttgcattt gaaggcctat 2640

tttctttagt ttgaatttac tgttattcgg tgtgcatttc tatgtttggt gagcggtttt 2700

2760

ggtcgtccct tcagcaagga cacaaaaaga ttttaattttt attaaaaaaa aaaaaaaaaa 2820

agaccgggaa ttcgatatca agcttatcga cctgcagatc gttcaaacat ttggcaataa 2880

agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg 2940

aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt 3000

tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc 3060

gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagat 3108

<210> 105

<211> 3108

<212> DNA

<213> Artificial sequence

<220>

<223> Construct 2811 from 2X35S promoter to NOS terminator

<400> 105

gtcaacatgg tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca 60

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 120

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 180

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 240

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 300

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac acttgtctac 360

tccaaaaata tcaaagatac agtctcagaa gaccaaaggg caattgagac ttttcaacaa 420

agggtaatat ccggaaacct ccctcggattc cattgcccag ctatctgtca ctttattgtg 480

aagatagtgg aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc 540

atcgttgaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 600

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 660

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagaccc ttcctctata 720

taaggaagtt catttcattt ggagaggtat taaaatctta ataggttttg ataaaagcga 780

acgtggggaa acccgaacca aaccttcttc taaactctct ctcatctctc ttaaagcaaa 840

cttctctctt gtctttcttg cgtgagcgat cttcaacgtt gtcagatcgt gcttcggcac 900

cagtacaatg gcgaaaaacg ttgcgatttt cggcttattg ttttctcttc ttgtgttggt 960

tccttctcag atcttcgcgc aaaaacttcc tggaaatgac aatagcacgg caacgctgtg 1020

ccttgggcac catgcagtac caaacggaac gatagtgaaa acaatcacga atgaccgaat 1080

tgaagttact aatgctactg agctggttca gaattcctca ataggtgaaa tatgcgacag 1140

tcctcatcag atccttgatg gagaaaactg cacactaata gatgctctat tgggagaccc 1200

tcagtgtgat ggctttcaaa ataagaaatg ggaccttttt gttgaacgaa gcaaagccta 1260

cagcaactgt tacccttatg atgtgccgga ttatgcctcc cttaggtcac tagttgcctc 1320

atccggcaca ctggagttta acaatgaaag cttcaattgg gctggagtca ctcaaaacgg 1380

aacaagttct tcttgcataa ggggatctaa tagtagtttc tttagtagat taaattggtt 1440

gacccactta aactccaaat acccagcatt aaacgtgact atgccaaaca atgaacaatt 1500

1560

gtatgcacaa tcatcaggaa gaatcacagt atctaccaaa agaagccaac aagctgtaat 1620

cccgaatatc ggatctagac ccagaataag ggatatccct agcagaataa gcatctattg 1680

gacaatagta aaaccgggag acatactttt gattaacagc acagggaatc taattgctcc 1740

taggggttac ttcaaaatac gaagtgggaa aagctcaata atgagatcag atgcacccat 1800

tggcaaatgc aagtctgaat gcatcactcc aaatggaagc attcccaatg acaaaccatt 1860

ccaaaatgta aacaggatca catacggggc ctgtcccaga tatgttaagc aaagcactct 1920

gaaattggca acaggaatgc gaaatgtacc agagagacaa actagaggca tattggcgc 1980

aatagcgggt ttcatagaaa atggttggga gggaatggtg gatggttggt acggcttcag 2040

gcatcaaaat tctgagggaa gaggacaagc agcagatctc aaaagcactc aagcagcaat 2100

cgatcaaatc aatgggaagc tgaatcgatt gatcgggaaa accaacgaga aattccatca 2160

gattgaaaaa gaattctcag aagtagaagg gagaattcag gaccttgaga aatatgttga 2220

ggacacaaaa atagatctct ggtcatacaa cgcggagctt cttgttgccc tggagaacca 2280

acatacaatt gatctaactg actcagaaat gaacaaactg tttgaaaaaa caaagaagca 2340

actgagggaa aatgctgagg atatgggcaa tggttgtttc aaaatatacc acaaatgtga 2400

caatgcctgc ataggatcaa tcagaaatgg aacttatgac cacgatgtat acagggatga 2460

agcattaaac aaccggttcc agatcaaggg agttgagctg aagtcaggggt acaaagattg 2520

gatcctatgg atttcctttg ccatatcatc ccttgtactg ttagttgctt tgttggggtt 2580

catcatgtgg gcctgccaaa agggcaacat taggtgcaac atttgcattt gaaggcctat 2640

tttctttagt ttgaatttac tgttattcgg tgtgcatttc tatgtttggt gagcggtttt 2700

2760

ggtcgtccct tcagcaagga cacaaaaaga ttttaattttt attaaaaaaa aaaaaaaaaa 2820

agaccgggaa ttcgatatca agcttatcga cctgcagatc gttcaaacat ttggcaataa 2880

agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg 2940

aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt 3000

tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc 3060

gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagat 3108

<---

Claims (41)

1. Modified influenza H3 hemagglutinin (HA) protein to produce a virus-like particle (VLP), wherein the HA protein contains an amino acid sequence containing at least one substitution compared to the corresponding wild-type amino acid sequence, wherein said at least one substitution is a substitution one or more amino acids corresponding to amino acids at position 382, 384, 392, or 431 of the reference sequence of SEQ ID NO: 92. 2. Modified influenza H3 HA protein according to claim 1, moreover: at least one amino acid substitution corresponding to the amino acid at position 382 of the reference sequence of SEQ ID NO: 92 is a non-asparagine substitution; at least one amino acid substitution corresponding to the amino acid at position 382 of the reference sequence of SEQ ID NO: 92 is an alanine substitution or a conservative alanine substitution; at least one amino acid substitution corresponding to the amino acid at position 384 of the reference sequence of SEQ ID NO: 92 is a non-leucine substitution; at least one amino acid substitution corresponding to the amino acid at position 384 of the reference sequence of SEQ ID NO: 92 is a valine substitution or a conservative valine substitution; at least one amino acid substitution corresponding to the amino acid at position 392 of the reference sequence of SEQ ID NO: 92 is a non-phenylalanine substitution; at least one amino acid substitution corresponding to the amino acid at position 392 of the reference sequence of SEQ ID NO: 92 is an aspartic acid substitution or a conservative aspartic acid substitution; at least one amino acid substitution corresponding to the amino acid at position 431 of the reference sequence of SEQ ID NO: 92 is a non-leucine substitution and/or at least one amino acid substitution corresponding to the amino acid at position 431 of the reference sequence of SEQ ID NO: 92 is a methionine substitution or a conservative methionine substitution. 3. Modified influenza H3 HA protein according to claim 2, moreover: a conservative alanine substitution is serine, glycine, threonine, cysteine, or valine; a conservative valine replacement is isoleucine, methionine, alanine, or threonine; a conservative replacement for aspartic acid is glutamic acid, glutamine, or serine; And a conservative replacement for methionine is isoleucine, glutamine, valine, or phenylalanine. 4. Nucleic acid for producing a modified influenza H3 HA protein, wherein the nucleic acid contains a nucleotide sequence encoding a modified influenza H3 HA protein according to any one of paragraphs. 1-3. 5. A virus-like particle (VLP) for inducing an immune response to an influenza infection in a subject, the VLP comprising a modified influenza H3 hemagglutinin (HA) protein according to any one of paragraphs. 1-3. 6. A method for producing an influenza virus-like particle (VLP) in a plant, plant part or plant cell, comprising: a) i) introducing the nucleic acid of claim 4 into a plant, plant part, or plant cell, and optionally further introducing a second nucleic acid encoding a proton channel protein, such as influenza A subtype M2 protein; or ii) optionally providing a plant, plant part, or plant cell comprising the nucleic acid of claim 4, wherein the plant, plant part, or plant cell further comprises a second nucleic acid encoding a proton channel protein, such as influenza A subtype M2 protein; And b) incubating the plant, plant part, or plant cell under conditions that allow expression of the influenza HA protein encoded by the nucleic acid, thereby producing a VLP, and optionally further incubating the plant, plant part, or plant cell under conditions that allow expression of the proton protein. channel encoded by the second nucleic acid, and c) optionally harvesting the plant, plant part or plant cell and purifying the VLP. 7. A VLP obtained by the method of claim 6 for inducing an immune response to an influenza infection in a subject, wherein the VLP comprises a modified influenza H3 HA protein according to any one of claims. 1-3. 8. A VLP according to claim 7, further comprising one or more lipids derived from a plant, plant part, or plant cell, plant-specific N-glycans, modified N-glycans, or a combination thereof. 9. A plant or plant part for producing a virus-like particle (VLP), wherein the plant or plant part contains the nucleic acid according to claim 4. 10. Plant cell for obtaining a virus-like particle (VLP), wherein the plant cell contains the nucleic acid according to claim 4. 11. A plant or plant part to obtain a virus-like particle (VLP), and the plant or plant part contains a modified influenza H3 H3 protein according to any one of paragraphs. 1-3 or VLP according to any one of paragraphs. 5, 7 or 8. 12. Plant cell to obtain a virus-like particle (VLP), and the plant cell contains a modified H3 influenza H3 protein according to any one of paragraphs. 1-3 or VLP according to any one of paragraphs. 5, 7 or 8. 13. A composition for inducing an immune response to an influenza infection in a subject, the composition comprising an effective dose of VLP according to any one of paragraphs. 5, 7 or 8 and a pharmaceutically acceptable carrier, adjuvant, excipient or excipient. 14. The use of VLP according to any one of paragraphs. 5, 7, or 8 to induce immunity to influenza infection in a subject. 15. Use according to claim 14, wherein the VLP is administered to the subject orally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously. 16. A method for increasing the production yield of influenza virus-like particles (VLP) in a plant, plant part or plant cell, comprising: a) i) introducing a nucleic acid according to claim 4 into a plant, plant part or plant cell, or ii) providing a plant, plant part or plant cell containing a nucleic acid according to claim 4; and b) incubating the plant, plant part, or plant cell under conditions that allow expression of the HA protein encoded by the nucleic acid, thereby producing VLPs in higher yield compared to a plant, plant part, or plant cell expressing unmodified influenza HA protein; And c) optionally harvesting the plant, plant part or plant cell and purifying the VLP. 17. Protein hemagglutinin (HA) influenza H3 to obtain a virus-like particle (VLP), and HA contains: an amino acid substitution corresponding to position 382 of the reference sequence of SEQ ID NO: 92, wherein the amino acid substitution is an alanine substitution or a conservative alanine substitution; an amino acid substitution corresponding to position 384 of the reference sequence of SEQ ID NO: 92, wherein the amino acid substitution is a valine substitution or a conservative valine substitution; an amino acid substitution corresponding to position 392 of the reference sequence of SEQ ID NO: 92, wherein the amino acid substitution is an aspartic acid substitution or a conservative aspartic acid substitution; and/or an amino acid substitution corresponding to position 431 of the reference sequence of SEQ ID NO: 92, wherein the amino acid substitution is a methionine substitution or a conservative methionine substitution.