RU2798874C1 - Compositions for the prevention or treatment of chronic obstructive pulmonary disease (copd) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions is described, including a method of preventing or treating chronic obstructive pulmonary disease, including the introduction of a therapeutically effective amount of a compound described by the following chemical formula I, or its pharmaceutically acceptable salts, the use of a compound described by the following chemical formula I, or its pharmaceutically acceptable salts to prevent or treatment of chronic obstructive pulmonary disease; and for the manufacture of a medicament for the treatment of chronic obstructive pulmonary disease.

(Chemical formula 1)

EFFECT: invention expands the arsenal of methods of the treatment of chronic obstructive pulmonary disease.

8 cl, 6 dwg, 2 tbl, 10 ex

Description

The field of technology to which the invention belongs

The present invention relates to a pharmaceutical composition for the prevention or treatment of chronic obstructive pulmonary disease, containing a compound described by the chemical formula I, its optical isomers or its pharmaceutically acceptable salts as an effective ingredient, a method for preventing or treating chronic obstructive pulmonary disease by using a compound or composition, and to the use of the compound or composition for the manufacture of a medicament for the treatment of chronic obstructive pulmonary disease.

State of the art

Chronic obstructive pulmonary disease (COPD) is a disease that results from pathological changes in the bronchioles and lung parenchyma caused by inflammation of the airways and lung parenchyma and leads to obstructive bronchiolitis and emphysema (destruction of the lung parenchyma). Types of chronic obstructive pulmonary disease include chronic obstructive bronchitis, chronic bronchiolitis, emphysema, and the like.

Smoking is considered the most important cause of COPD. Smoking acts as a highly toxic substance in lung tissues and causes the formation of oxides, pro-inflammatory factors and chemotactic factors, which cause an excess migration of inflammatory cells such as neutrophils. Inflammatory cells that have migrated to lung tissue produce many inflammatory mediators that further increase inflammation in lung tissue. As a mediator for promoting such an inflammatory response, TNF-α and the like. are generally known and used as an important marker of the inflammatory response induced by tobacco smoking.

A recent study reported that epithelial-mesenchymal transition (EMT) may be one of the pathogenic mechanisms of chronic obstructive disease (Courtney JM, et al. Cells Tissues Organs . 2017;203(2):99-104) and also reported that FN -EDA (containing additional domain A fibronectin), one of the major proteins in the extracellular matrix (ECM), found in the airways of COPD patients (Annoni R, et al. Eur Respir J. 2012;40(6):1362-73) .

At present, substances used to treat chronic obstructive disease are mainly designed to reduce inflammation in lung tissue, and steroids, anti-inflammatory drugs, and the like are mainly used. However, these substances lead to various side effects such as immunosuppression, tolerability, and the like, and are therefore unsuitable for patients who have chronic obstructive pulmonary disease, which require long-term treatment. Accordingly, the development of a drug capable of effectively treating COPD is urgently needed.

[Related Literature]

(Patent Document 1) Korean Patent Publication No. 10-2014-0128886

Detailed description of the invention

Technical task

The present invention relates to a pharmaceutical composition for the prevention or treatment of chronic obstructive pulmonary disease, containing a compound described by the chemical formula I, its optical isomers or its pharmaceutically acceptable salts as an effective ingredient.

The present invention relates to a method for preventing or treating chronic obstructive pulmonary disease, comprising administering said pharmaceutical composition to an individual.

The present invention relates to the use of said composition for the preparation of a medicament for the prevention or treatment of chronic obstructive pulmonary disease.

The present invention relates to a method for preventing or treating chronic obstructive pulmonary disease, comprising administering a therapeutically effective amount of a compound of formula I, its optical isomers, or pharmaceutically acceptable salts thereof to an individual.

The present invention relates to the use of a compound having the chemical formula I, its optical isomers or its pharmaceutically acceptable salts for the prevention or treatment of chronic obstructive pulmonary disease.

The present invention relates to the use of a compound having the chemical formula I, its optical isomers or its pharmaceutically acceptable salts for the preparation of a medicament for the treatment of chronic obstructive pulmonary disease.

Technical solution

In view of the above data, the present inventors conducted a study to develop a therapeutic agent for chronic obstructive pulmonary disease, and thus confirmed that the compound of the present invention has an inhibitory effect on immune cell infiltration, inflammatory cell infiltration, and inflammatory cytokine expression in tissues lungs of mice induced with COPD, as well as an inhibitory effect on TGF-β1-induced EMT and the expression of FN-EDA, which is the main protein of the ECM, and thus completed the present invention.

It is detailed below. However, each description and embodiment disclosed in the present invention can also be applied to other descriptions and embodiments thereof, respectively. In other words, all combinations of different elements disclosed in the present invention are within the scope of the present invention. It cannot be seen that the scope of the present invention is limited by the specific description given below.

The present invention relates to a pharmaceutical composition for the prevention or treatment of chronic obstructive pulmonary disease, containing a compound having the following chemical formula I, its optical isomers, or pharmaceutically acceptable salts thereof, as an effective ingredient:

[Chemical Formula I]

Where

,A means

,

Xa and Xb are all independently CH or N,

L ₁ and L ₂ are all independently hydrogen, halogen, -CF ₃ or -C _1-3 straight or branched alkyl,

Q means C(=O), S(=O) ₂ , S(=O) or C(=NH),

Y is selected from the following group:

M means C, N, O, S or S(=O) ₂ (in this case, if M means C, l and m are 1; if M means N, l is 1 and m is 0; and if M means O, S or S(=O) ₂ , l and m are 0),

, где R_c и R_d независимо означают водород или C_1-3 обладающий линейной или разветвленной цепью алкил;

или

,R _a1 and R _a2 are all independently hydrogen; a hydroxy group; -C _1-4 straight or branched alkyl which is unsubstituted or substituted with at least one halogen; -C _1-4 linear or branched chain alcohol; benzhydryl; -C _1-4 straight or branched chain alkyl which is substituted by a saturated or unsaturated 5-7 membered heterocyclic compound containing 1 to 3 heteroatoms selected from N, O or S as ring members (in this case the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen); a saturated or unsaturated 5-7 membered heterocyclic compound containing 1 to 3 heteroatoms selected from N, O or S as ring members (in which case the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with using OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen); phenyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; benzyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; -S(=O) ₂ CH ₃ ; halogen; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 alkoxyalkyl; -C(=O)R _x, where R _x is C _1-3 straight or branched alkyl or C _3-10 cycloalkyl;

where R _c and R _d are independently hydrogen or C _1-3 straight or branched alkyl;

or

,

n is an integer equal to 0, 1 or 2,

, _Rb is hydrogen; a hydroxy group; -C _1-6 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; -C(=O)CH ₃ ; -C _1-4 straight or branched hydroxyalkyl; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched chain alkoxyalkyl; _-CF3 ; halogen; or

,

R _e and R _f are all independently hydrogen or -C _1-3 straight or branched alkyl and

Z is selected from the following group:

водород; гидроксигруппу; -C_1-4 обладающий линейной или разветвленной цепью алкил, который является незамещенным или в котором по меньшей мере один водород замещен галогеном; галоген; -CF₃; -OCF₃; -CN; -C_1-6 обладающую линейной или разветвленной цепью алкоксигруппу; -C_2-6 обладающую линейной или разветвленной цепью алкилалкоксигруппу; -CH₂F; или -C_1-3 спирт,P _a and P _b all independently mean

hydrogen; a hydroxy group; -C _1-4 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; halogen; _-CF3 ; -OCF ₃ ; -CN; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; _-CH2F ; or -C _1-3 alcohol,

означает кольцо, выбранное из группы, включающей фенил, пиридин, пиримидин, тиазол, индол, индазол, пиперазин, хинолин, фуран, тетрагидропиридин, пиперидин, или из следующей группы:Where

means a ring selected from the group consisting of phenyl, pyridine, pyrimidine, thiazole, indole, indazole, piperazine, quinoline, furan, tetrahydropyridine, piperidine, or from the following group:

,

,

x, y, and z are all independently integers equal to 0 or 1, and

R_g1, R_g2 and R_g3 all independently selected from the group consisting of hydrogen; a hydroxy group; -C_1-3 alkyl; -CF₃; -C_1-6 having a linear or branched chain alkoxy group; -C_2-6 having a linear or branched chain alkylalkoxy group; -C(=O)CH₃; -C_1-4 having a linear or branched chain hydroxyalkyl; -N(CH₃)₂; halogen; phenyl; -S((=O)₂)CH₃; or from the following group:

.

.

In the present invention, the compound having the above chemical formula I may be the compound having the following chemical formula Ia:

[Chemical formula Ia]

Where

Y is selected from the following group:

where M, l, m, n, R _a1 , R _a2 , and R _b are all the same as defined for the above chemical formula I,

иZ means

And

P _a and P _b are all independently hydrogen; a hydroxy group; -C _1-4 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; halogen; _-CF3 ; -OCF ₃ ; -CN; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; _-CH2F ; or -C _1-3 alcohol.

In one embodiment, the object of the present invention,

Y is selected from the following group:

,

,

where n and R _b are all the same as defined for the above chemical formula I,

иZ means

And

P _a and P _b are all independently hydrogen; halogen; _-CF3 ; or -C _1-6 having a linear or branched chain alkoxy group.

In the present invention, "halogen" means F, Cl, Br, or I.

In a specific embodiment of the present invention, the compound represented by the above chemical formula I may be the compound described in the following table.

Compound Structure Compound Structure

In a specific embodiment of the present invention, the compound represented by the above chemical formula I may be the compound described in the following table.

Compound Structure Compound Structure

In the present invention, the compound having the above chemical formula I can be produced by the method disclosed in, but not limited to, Korean Unexamined Patent Application Publication No. 2014-0128886.

In the present invention, the term "pharmaceutically acceptable" may mean a compound that is physiologically acceptable and, when administered to individuals, does not usually cause an allergic reaction such as gastrointestinal illness, dizziness, etc., or other similar responses.

The pharmaceutically acceptable salt of the present invention can be obtained by conventional methods known to those skilled in the art.

Pharmaceutically acceptable salts of the present invention may include, for example, inorganic ion salts derived from calcium, potassium, sodium, magnesium, and the like; inorganic acid salts derived from hydrochloric acid, nitric acid, phosphoric acid, bromic acid, iodic acid, perchloric acid, sulfuric acid, hydroiodic acid, and the like; organic acid salts derived from acetic acid, trifluoroacetic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, mandelic acid, propionic acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid , glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, and the like; sulfonic acid salts derived from methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, naphthalenesulfonic acid, and the like; amino acid salts derived from glycine, arginine, lysine, and the like; amine salts derived from trimethylamine, triethylamine, ammonia, pyridine, picoline, and the like; and the like, but are not limited to them. In the present invention, preferred salts may include salts of hydrochloric acid, trifluoroacetic acid, citric acid, bromic acid, maleic acid, phosphoric acid, sulfuric acid and tartaric acid.

In the present invention, the term "chronic obstructive pulmonary disease (COPD)" may mean a disease that is accompanied by irreversible airway occlusion and is caused by pathological changes in the bronchioles and lung parenchyma caused by inflammation of the airways and lung parenchyma, and includes chronic obstructive bronchitis, chronic bronchiolitis, emphysema (destruction of the lung parenchyma), etc.

In the present invention, the term "prevention" may mean all actions that suppress or delay the onset of a disease by administering a compound of the chemical formula I of the present invention, its optical isomers, or its pharmaceutically acceptable salts.

In the present invention, the term "treatment" can mean all treatments by which a symptom in an individual likely to develop or suffering from a disease is relieved or favorably reversed by administering a compound, the chemical formula I of the present invention, its optical isomers, or its pharmaceutically acceptable salts.

The compound having the chemical formula I of the present invention, its optical isomers or its pharmaceutically acceptable salts can be used for the prevention or treatment of chronic obstructive pulmonary disease.

A pharmaceutical composition containing a compound having the chemical formula I of the present invention, its optical isomers or its pharmaceutically acceptable salts as an effective ingredient can be used to prevent or treat chronic obstructive pulmonary disease.

In this regard, in one preferred embodiment of the present invention, it was confirmed that the compound having the chemical formula I of the present invention, its optical isomers, or its pharmaceutically acceptable salts inhibit immune cell infiltration (Fig. 2), inhibit inflammatory cell infiltration by a decrease in the total number of cells, macrophages and neutrophils (Fig. 3) and reduce the expression of inflammatory cytokines, especially IL-6, IFN-γ, MCP-1 and TNF-α (Fig. 4).

In addition, the above compound was confirmed to significantly increase the expression of E-Cad, an epithelial marker protein, significantly decrease the expression of N-Cad, a mesenchymal marker protein for inhibition of EMT induced by TGF-β1 (Fig. 5), and reduce the expression FN-EDA, the main ECM protein (Fig. 6).

The pharmaceutical composition of the present invention can exhibit an effect of preventing or treating chronic obstructive pulmonary disease at a level that can be considered similar to, substantially the same as, or better than using a standard known composition for the treatment of COPD.

The pharmaceutical composition of the present invention may further include at least one type of pharmaceutically acceptable carrier, in addition to the compound of the above chemical formula I, its optical isomers, or its pharmaceutically acceptable salts. The pharmaceutically acceptable carrier may be those commonly used in the art, including but not limited to lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, calcium phosphate, alginate, gelatin, calcium silicate. , microcrystalline cellulose, polyvinylpyrrolidine, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil. The pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, a dispersing agent, a stabilizing agent, and the like, in addition to the above ingredients. In addition, the pharmaceutical composition of the present invention may be formulated into an oral dosage form such as a tablet, powder, granule, pill, capsule, suspension, emulsion, oral liquid, lubricant, syrup, and the like. , as well as in the form of an external preparation, a suppository and a sterile solution for injection by using a pharmaceutically acceptable carrier and an inert excipient, and thus can be prepared in a single dosage form or prepared by placing in a multi-dose container. Such formulations can be prepared according to the usual method used for preparation in the art, or according to the method disclosed in Remington's Pharmaceutical Science ( ^19th ed., 1995), and can be prepared in different formulations depending on each disease or ingredient.

As a non-limiting example of oral preparations prepared using the pharmaceutical composition of the present invention, they can be tablets, lozenges, lozenges, water-soluble suspensions, oily suspensions, prepared powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc. For the preparation of the pharmaceutical composition of the present invention as preparations for oral administration, the following can be used: binders such as lactose, sucrose, sorbitol, mannitol, starch, amylopectin, cellulose, gelatin, and the like; excipients such as dicalcium phosphate and the like; leavening agents such as corn starch, sweet potato starch, and the like; lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate, polyethylene glycol wax, and the like; and the like, where sweeteners, flavoring agents, syrups, and the like can also be used. Further, in the case of capsules, liquid carriers such as fixed liquid oil and the like can be additionally used in addition to the above materials.

As a non-limiting example of parenteral preparations made using the pharmaceutical composition of the present invention, they can be injection solutions, suppositories, powders for respiratory inhalation, aerosols for spraying, ointments, powders for application, oils, creams, and the like. The following can be used to prepare the pharmaceutical composition of the present invention as parenteral preparations: sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, topical preparations, and the like. As said non-aqueous solvents and suspensions, the following can be used, but not limited to: propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like.

The pharmaceutical composition of the present invention can be used for oral administration or parenteral administration depending on the technique used, preferably oral administration, but not limited to them.

The daily dose of the compound having the chemical formula I of the present invention, its optical isomers or its pharmaceutically acceptable salts, in particular, may be from about 0.1 to 10000 mg/kg, from about 1 to 8000 mg/kg, from about 5 to 6000 mg/kg or about 10 to 4000 mg/kg and more preferably from but not limited to about 50 to 2000 mg/kg, and it can also be administered one or more times a day by dividing the daily dose of the compound.

A pharmaceutically effective dose and an effective dose of the pharmaceutical composition of the present invention may vary depending on the method of preparation of the pharmaceutical composition, mode of administration, time of administration and/or route of administration, and the like, and may vary depending on various factors, including type and degree of response required upon administration of the pharmaceutical composition, type of individual administered, age of the individual, body weight, general health, symptom or disease severity, sex, diet and excretion, ingredients of other medicinal compositions concomitantly used for the respective individual , or different times, etc., as well as other similar factors well known in the pharmaceutical field, and specialists in the art can easily determine and prescribe an effective dose for the treatment being carried out.

The pharmaceutical composition of the present invention can be administered once a day or several times a day by dividing the daily dose of the composition. The pharmaceutical composition of the present invention may be administered as a single therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent. Considering all of the above factors, the pharmaceutical composition of the present invention can be administered in such an amount that the maximum effect can be achieved with the minimum amount without side effect, and such an amount can be easily determined by experts in the field of technology to which the present invention pertains. .

The pharmaceutical composition of the present invention can provide an excellent effect even when used alone, but can be additionally used in combination with various procedures such as hormone therapy, drug treatment, and the like. to increase therapeutic efficacy.

The present invention relates to a method for preventing or treating chronic obstructive pulmonary disease, comprising administering said pharmaceutical composition to an individual.

The present invention relates to a method for preventing or treating chronic obstructive pulmonary disease, comprising administering a therapeutically effective amount of a compound of formula I, its optical isomers, or pharmaceutically acceptable salts thereof to an individual.

These terms "chronic obstructive pulmonary disease", "prevention" and "treatment" may be the same as described above.

In the present invention, the term "administration" may mean the introduction of a given substance to an individual by a suitable method.

In the present invention, the term "individual" can mean all animals such as rats, mice, livestock, and the like, including humans, which are likely to develop or have already developed chronic obstructive pulmonary disease, and, in particular, means mammals, including people, but is not limited to them.

The method of preventing or treating chronic obstructive pulmonary disease (COPD) according to the present invention may mean administering a therapeutically effective amount of said pharmaceutical composition.

In the present invention, the term "therapeutically effective amount" may mean an amount sufficient to treat a disease with a reasonable risk/benefit ratio, applicable for medical treatment and not causing a side effect, and can be determined by those skilled in the art according to factors including sex , age, body weight and health status of the patient, type of disease, severity, drug activity, drug sensitivity, method of administration, time of administration, route of administration, rate of elimination, period of treatment, concomitant or concomitant drug, and other factors well known in the pharmaceutical field. Preferably, a particular therapeutically effective amount is used differently for a particular patient depending on various factors, including the type and extent of response provided, specific compositions, including the presence of other drugs used in some cases, age, body weight, general health, sex and the patient's diet, time of administration, routes of administration, elimination rates of the composition, period of treatment, and drug used with or concurrently with the particular composition, as well as other similar factors well known in the pharmaceutical art.

The method for preventing or treating chronic obstructive pulmonary disease according to the present invention may include not only controlling the disease itself before its symptoms appear, but also suppressing or eliminating such symptoms by administering a compound of the above chemical formula I, its optical isomers, or its pharmaceutically acceptable salts. In the treatment of diseases, the preventive or therapeutic dose of a particular active ingredient may vary depending on the characteristics and severity of the diseases or conditions and the route of administration of the active ingredient. Its dose and frequency of administration may vary depending on the age, body weight and response of the individual patient. A suitable dose and application can be easily selected by those skilled in the art, of course, taking into account such factors. In addition, the method of preventing or treating chronic obstructive pulmonary disease of the present invention may further comprise administering a therapeutically effective amount of an additional active agent that is useful in preventing or treating the disease, together with a compound having the above chemical formula I, its optical isomers or its pharmaceutically acceptable salts, and the additional active agent may exhibit a synergistic effect or an additive effect together with the compound of the above chemical formula I, its optical isomers, or its pharmaceutically acceptable salts.

The present invention relates to the use of a compound having the chemical formula I, its optical isomers or its pharmaceutically acceptable salts for the prevention or treatment of chronic obstructive pulmonary disease.

The present invention relates to the use of a compound having the chemical formula I, its optical isomers or its pharmaceutically acceptable salts for the preparation of a medicament for the prevention or treatment of chronic obstructive pulmonary disease.

The present invention relates to the use of a pharmaceutical composition according to the present invention for the preparation of a medicament for the prevention or treatment of chronic obstructive pulmonary disease.

These terms "chronic obstructive pulmonary disease", "prevention" and "treatment" may be the same as described above.

In order to prepare a medicament, the compound having the chemical formula I of the present invention, its optical isomers or its pharmaceutically acceptable salts can be mixed with pharmaceutically acceptable excipients, diluents, carriers, etc., and a complex preparation can be obtained together with other active means and thus ensure a synergistic effect.

The provisions specified for the pharmaceutical composition, method of treatment and use in the present invention are used in the same way, if they do not contradict each other.

Beneficial effects

The compound represented by the chemical formula I of the present invention, its optical isomers, or its pharmaceutically acceptable salts have an excellent inhibitory effect on immune cell infiltration and inflammatory cell infiltration, and an anti-inflammatory effect in COPD-induced mice, as well as an inhibitory effect on induced EMT. through TGF-β1, and the expression of FN-EDA, which is a major protein of the ECM and thus may be useful in the prevention or treatment of chronic obstructive pulmonary disease.

BRIEF DESCRIPTION OF THE DRAWINGS

In FIG. 1 shows reference images for determining the degree of cell infiltration in lung tissues.

In FIG. 2 shows the dependence for indicators determined by observing the degree of cell infiltration in groups of animals that were administered with a comparative composition and compositions of embodiments, respectively.

In FIG. 3 shows the dependence for the total number of cells, macrophages and neutrophils in groups of animals that were administered with a comparative composition and compositions of embodiments, respectively.

In FIG. 4 shows the relationship for the degree of expression of inflammatory cytokines (IL-6, IFN-γ, MCP-1, and TNF-α) in groups of animals that were administered a comparative composition and compositions of embodiments, respectively.

In FIG. 5 shows the relationship for the degree of expression of the epithelial marker protein (E-Cad) and mesenchymal marker protein (N-Cad) in groups of animals treated with comparative composition and compositions of examples, respectively.

In FIG. 6 shows the relationship for the degree of expression of the basic ECM protein (FN-EDA) in groups of animals treated with a comparative composition and compositions of the embodiments, respectively.

Best Mode for Carrying Out the Invention

Below, the present invention is described in more detail using typical embodiments. These exemplary embodiments are provided to illustrate the present invention only, and it should be apparent to those skilled in the art that the scope of the present invention is not limited to them.

Production Example 1 Synthesis of N-(4-(hydroxycarbamoyl)benzyl)-N-(3-(trifluoromethyl)phenyl)morpholine-4-carboxamide [compound 374]

[Step 1] Synthesis of methyl 4-((3-(trifluoromethyl)phenylamino)methyl)benzoate)

3-(Trifluoromethyl)benzenamine (0.30 g, 1.84 mmol) and potassium carbonate (0.76 g, 5.53 mmol) were dissolved in dimethylformamide (DMF, 5 ml), then methyl-4-(bromomethyl) was added benzoate (0.42 g, 1.84 mmol). The resulting solution was reacted at room temperature for a day and diluted with ethyl acetate. The reagent was washed with water and a saturated aqueous sodium chloride solution, then dried and filtered through anhydrous magnesium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=20%) to give the title compound (0.37 g, 65%).

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.93 (d, 2 H, J=8.3 Hz), 7.49 (d, 2 H, J=8.3 Hz), 7.24 (t, 1 H, J=7.9 Hz), 6.88-6.78 (m, 4 H), 4.42 (d, 2 H, J=6.1 Hz), 3.83 (s , 3H), MS (ESI) m/z 310 (M ⁺ + H).

[Step 2] Synthesis of methyl 4-((((4-nitrophenoxy)carbonyl)(3-(trifluoromethyl)phenyl)amino)methyl)benzoate

Methyl 4-((3-(trifluoromethyl)phenylamino)methyl)benzoate (0.26 g, 0.82 mmol) and 4-nitrophenyl chloroformate (0.33 g, 1.65 mmol) were dissolved in acetonitrile (10 ml), then potassium carbonate (0.34 g, 2.47 mmol) was added. The resulting solution was reacted at room temperature for a day and diluted with ethyl acetate. The reagent was washed with a saturated aqueous sodium chloride solution, then dried and filtered through anhydrous sodium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=20%), so that the title compound (0.35 g, 89%) was obtained as a colorless oil.

¹ H NMR (400 MHz, CDCl ₃ ) δ 8.20 (d, 2 H, J=10.2 Hz), 8.01 (d, 2 H, J=7.8 Hz), 7.56-7 .46 (m, 3H), 7.35 (d, 3H, J=8.0 Hz), 7.26 (d, 2H, J=8.1 Hz), 5.01 (bs, 2H) , 3.90 (s, 3H).

[Step 3] Synthesis of methyl 4-((N-(3-(trifluoromethyl)phenyl)morpholine-4-carboxamido)methyl)benzoate

Methyl 4-((((4-nitrophenoxy)carbonyl)(3-(trifluoromethyl)phenyl)amino)methyl)benzoate (0.29 g, 0.60 mmol) was dissolved in dimethylformamide (10 ml), then potassium carbonate was added (0.25 g, 1.81 mmol) and morpholine (0.05 ml, 0.60 mmol). The resulting solution was reacted at 60°C for two days and then diluted with a saturated ammonium chloride solution. Extraction was carried out with ethyl acetate, then the resulting extract was dried and filtered through anhydrous sodium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=50%) to give the title compound (0.15 g, 60%).

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.97 (d, 2 H, J=8.2 Hz), 7.43-7.32 (m, 5H), 7.20 (d, 1 H, J=8.0 Hz), 4.94 (s, 2H), 3.90 (s, 3H), 3.50 (t, 4 H, J=4.8 Hz), 3.25 (t , 4H, J=4.8 Hz); MS (ESI) m/z 423 (M ⁺ + H).

[Step 4] Synthesis of N-(4-(hydroxycarbamoyl)benzyl)-N-(3-(trifluoromethyl)phenyl)morpholine-4-carboxamide

Methyl 4-((N-(3-(trifluoromethyl)phenyl)morpholine-4-carboxamido)methyl)benzoate (0.15 g, 0.36 mmol) was dissolved in methanol (5 ml), then an aqueous solution of hydroxylamine ( 50 wt%, 1 ml) and potassium hydroxide (0.10 g, 1.81 mmol) and stirred overnight. After completion of the reaction, the resulting solution was subjected to distillation under reduced pressure to remove methanol therefrom, then extraction was performed with ethyl acetate and water, so that workup was carried out. The resulting extract was dried and filtered through anhydrous sodium sulfate and then concentrated under reduced pressure. The residue was stirred in diethyl ether, then a solid was obtained, filtered and dried, so that the title compound (0.082 g, 54%) was obtained as a white solid.

¹ H NMR (400 MHz, MeOD-d ₃ ) δ 11.14 (brs, 1 H), 8.99 (brs, 1 H), 7.85 (d, 2 H, J=8.0 Hz), 7.66-7.27(m, 6H), 4.94(s, 2H), 3.41(s, 2H), 3.15(s, 2H). MS (ESI) m/z 424 (M ⁺ + H).

Production Example 2 Synthesis of N-(2,4-difluorophenyl)-N-(4-(hydroxycarbamoyl)benzyl)morpholine-4-carboxamide [compound 413]

[Step 1] Synthesis of methyl 4-((2,4-difluorophenylamino)methyl)benzoate

2,4-Difluorobenzamine (3.0 g, 23.2 mmol) and methyl 4-formyl benzoate (3.81 g, 23.2 mmol) were dissolved in methanol (500 ml) and stirred at room temperature for 2 h, then acetic acid (1.33 ml, 23.2 mmol) and sodium cyanoborohydride (1.46 g, 23.2 mmol) were added and stirred for a day. The methanol was partially removed with air, then the solid was precipitated, filtered and dried, so that the title compound (2.9 g, 45%) was obtained as a white solid.

[Step 2] Synthesis of methyl 4-(((2,4-difluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate

Methyl 4-((2,4-difluorophenylamido)methyl)benzoate (2 g, 7.21 mmol) and 4-nitrophenyl chloroformate (1.45 g, 7.21 mmol) were dissolved in dichloromethane (50 ml) and stirred at room temperature. temperature for 3 days, then water was added to the extract of its organic layer. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The residue was dried so that the title compound (2.5 g, 78%) was obtained as a yellow oil.

[Step 3] Synthesis of methyl 4-((N-(2,4-difluorophenyl)morpholine-4-carboxamido)methyl)benzoate

Methyl 4-(((2,4-difluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate (0.50 g, 1.13 mmol) and morpholine (0.098 ml, 1.13 mmol) were dissolved in dimethylformamide (10 ml) and heated and stirred at 60°C for 2 days. The dimethylformamide was removed under reduced pressure, then water was poured into the reaction mixture, and extraction was performed with ethyl acetate. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=30%) and concentrated so that the title compound (0.44 g, 98%) was obtained as a colorless oil.

[Step 4] Synthesis of N-(2,4-difluorophenyl)-N-(4-(hydroxycarbamoyl)benzyl)morpholine-4-carboxamide

Methyl 4-((N-(2,4-difluorophenyl)morpholine-4-carboxamido)methyl)benzoate (0.10 g, 0.256 mmol) was dissolved in methanol (20 ml), then hydroxylamine hydrochloride (0.089 g, 1. 28 mmol) and potassium hydroxide (0.144 g, 2.56 mmol) and stirred, so that hydroxylamine (50 wt.% aqueous solution; 0.329 ml, 5.12 mmol) was added dropwise and stirred at room temperature for 3 hours. After completion of the reaction, methanol was removed under reduced pressure, then water was poured into the reaction mixture, and extraction was performed with ethyl acetate. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The resulting concentrate was then dissolved in dichloromethane, then hexane was added and the solid was precipitated, filtered and dried, so that the title compound (0.076 g, 76%) was obtained as a light yellow solid.

¹ H NMR (400 MHz, MeOD-d ₃ ) δ 7.65 (d, 2 H, J=8.3 Hz), 7.41 (d, 2 H, J=8.2 Hz), 7.27 -7.25(m, 1H), 7.04-6.96(m, 2H), 4.80(s, 2H), 3.46-3.43(m, 4H), 3 .22-3.19 (m, 4H); MS (ESI) m/z 392.1 (M ⁺ + H).

Production Example 3 Synthesis of N-(3-chloro-4-fluorophenyl)-N-(4-(hydroxycarbamoyl)benzyl)morpholine-4-carboxamide [compound 458]

[Step 1] Synthesis of methyl 4-((3-chloro-4-fluorophenylamino)methyl)benzoate

3-Chloro-4-fluorobenzamine (2.0 g, 13.7 mmol) and methyl 4-formyl benzoate (2.26 g, 13.7 mmol) were dissolved in methanol (500 ml) and stirred at room temperature for 3 h, then acetic acid (0.786 ml, 13.7 mmol) and sodium cyanoborohydride (0.86 g, 13.7 mmol) were added and stirred for a day. The methanol was partially removed with air, then the solid was precipitated, filtered and dried, so that the title compound (2.9 g, 72%) was obtained as a gray solid.

[Step 2] Synthesis of methyl 4-(((3-chloro-4-fluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate

Methyl 4-((3-chloro-4-fluorophenylamido)methyl)benzoate (2.5 g, 8.51 mmol) and 4-nitrophenyl chloroformate (2.06 g, 10.2 mmol) were dissolved in dichloromethane (50 ml) and stirred at room temperature for 3 days, then water was added to the organic layer extract. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The residue was dried so that the title compound (2.5 g, 64%) was obtained as a violet oil.

[Step 3] Synthesis of methyl 4-((N-(3-chloro-4-fluorophenyl)morpholine-4-carboxamido)methyl)benzoate

Methyl 4-(((-3-chloro-4-fluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate (0.20 g, 0.436 mmol) and morpholine (0.038 ml, 0.436 mmol) were dissolved in dimethylformamide (10 ml) and heated and stirred at 60° C. for 12 hours. Dimethylformamide was removed under reduced pressure, then water was poured into the reaction mixture and extraction was performed with ethyl acetate. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=20%) and concentrated so that the title compound (0.022 g, 12%) was obtained as a colorless oil.

[Step 4] Synthesis of N-(3-chloro-4-fluorophenyl)-N-(4-(hydroxycarbamoyl)benzyl)morpholine-4-carboxamide

Methyl 4-((N-(3-chloro-4-fluorophenyl)morpholine-4-carboxamido)methyl)benzoate (0.050 g, 0.123 mmol) was dissolved in methanol (5 ml), then hydroxylamine hydrochloride (0.043 g, 0.614 mmol) was added ) and potassium hydroxide (0.069 g, 1.23 mmol) and stirred, and then hydroxylamine (50 wt.% aqueous solution; 0.158 ml, 2.46 mmol) was added dropwise and stirred at room temperature for 3 hours. After completion of the reaction methanol was removed under reduced pressure, then a saturated aqueous sodium hydrogen carbonate solution was added and then a solid formed, it was filtered and dried, so that the title compound (0.017 g, 34%) was obtained as a white solid.

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.63 (d, 2 H, J=8.2 Hz), 7.44-7.42 (m, 1 H), 7.33-7, 29 (m, 3 H), 7.15-7.11 (m, 1 H), 4.84 (s, 2 H), 3.41-3.40 (m, 4 H), 3.14- 3.12 (m, 4H); MS (ESI) m/z 408.1 (M ⁺ + H).

Production Example 4 Synthesis of N-(4-(hydroxycarbamoyl)benzyl)-N-(3-methoxyphenyl)morpholine-4-carboxamide [compound 484]

[Step 1] Synthesis of methyl 4-(((3-methoxyphenyl)amino)methyl)benzoate

m-Anisidine (3.23 g, 26.2 mmol) and methyl 4-(bromomethyl)benzoate (5.00 g, 21.8 mmol) were dissolved in acetonitrile (50 mL), then N,N-diisopropylethylamine ( 5.80 ml, 32.7 mmol) and stirred at room temperature for 16 hours. After completion of the reaction, extraction was carried out with ethyl acetate and saturated aqueous sodium hydrogen carbonate, then the organic layer was dried over anhydrous magnesium sulfate and filtered. The remaining filtrate was concentrated under reduced pressure, then the residue was purified by column chromatography (silica; ethyl acetate/hexane=5%) and concentrated so that the title compound (5.14 g, 87%) was obtained as a bright yellow liquid.

[Step 2] Synthesis of methyl 4-(((3-methoxyphenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate

Methyl 4-(((3-methoxyphenyl)amino)methyl)benzoate (5.14 g, 18.9 mmol) and 4-nitrophenyl chloroformate (4.20 g, 20.8 mmol) were dissolved in acetonitrile (100 ml), then potassium carbonate (3.93 g, 28.4 mmol) was added and stirred at room temperature for 3 hours. After completion of the reaction, extraction was carried out with ethyl acetate and saturated aqueous sodium hydrogen carbonate, then the organic layer was dried over anhydrous magnesium sulfate and filtered. The remaining filtrate was concentrated under reduced pressure, then the residue was purified by column chromatography (silica; ethyl acetate/hexane=20%) and concentrated, so that the title compound (5.88 g, 71%) was obtained as a yellow liquid.

[Step 3] Synthesis of methyl 4-((N-(3-methoxyphenyl)morpholine-4-carboxamido)methyl)benzoate

Methyl 4-(((3-methoxyphenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate (5.88 g, 13.5 mmol) was dissolved in dimethylformamide (50 ml), then morpholine (2.35 g, 27.0 mmol) and potassium carbonate (5.60 g, 40.5 mmol) and stirred at 60°C for 16 h. anhydrous magnesium sulfate and filtered. The remaining filtrate was concentrated under reduced pressure, then the residue was purified by column chromatography (silica; ethyl acetate/hexane=30%) and concentrated so that the title compound (3.69 g, 71%) was obtained as a yellow solid.

[Step 4] Synthesis of N-(4-(hydroxycarbamoyl)benzyl)-N-(3-(methoxyphenyl)morpholine-4-carboxamide

Methyl 4-((N-(3-(methoxyphenyl)morpholine-4-carboxamido)methyl)benzoate (0.180 g, 0.468 mmol) was dissolved in methanol (10 ml), then hydroxylamine (50.0 wt% aqueous solution) was added ; 1.43 ml, 23.4 mmol) at room temperature and then potassium hydroxide (0.263 g, 4.68 mmol) was added and stirred at the same temperature for 30 minutes. The solvent was then removed from the reaction mixture under reduced pressure. Saturated an aqueous ammonium chloride solution was poured into the resulting concentrate, and extraction was performed with ethyl acetate.The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure.The residue was crystallized at room temperature from dichloromethane (2 ml) and hexane (10 ml ) so that the title compound (0.140 g, 78%) was obtained as a white solid.

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.63 (d, 2 H, J=8.1 Hz), 7.32 (m, 2 H), 7.19 (t, 1 H, J = 8.4 Hz), 6.69-6.67 (m, 2 H), 6.62 (m, 1 H), 4.84 (s, 2 H), 3.69 (s, 3 H) , 3.39-3.36 (m, 4 H), 3.15-3.12 (m, 4 H). MS (ESI) m/z 386 (M ⁺ + H).

Production Example 5 Synthesis of (N-(3-fluorophenyl)-N-(4-hydroxycarbamoyl)benzyl)morpholine-4-carboxamide [compound 530]

[Step 1] Synthesis of methyl 4-((3-fluorophenylamino)methyl)benzoate

Methyl 4-formylbenzoate (1.47 g, 8.99 mmol) was dissolved in methanol (50 ml), then 3-fluorobenzamine (1.0 g, 8.99 mmol) was added. The resulting solution was reacted at room temperature for 3 h, then sodium cyanoborohydride (NaCNBH ₃ , 0.56 g, 8.99 mmol) and acetic acid (1.03 ml, 17.99 mmol) were added. The reagent was reacted at room temperature for a day, then the reaction solvent was removed under reduced pressure, then a saturated sodium hydrogen carbonate aqueous solution was poured in, and then extraction was performed with ethyl acetate. The organic layer was dehydrated with anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=20%) to give the title compound (1.84 g, 79%).

[Step 2] Synthesis of methyl 4-(((3-fluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate

Methyl 4-((3-fluorophenylamino)methyl)benzoate (2.7 g, 10.4 mmol) and 4-nitrophenyl chloroformate (4.20 g, 20.8 mmol) were dissolved in acetonitrile (100 ml), then carbonate was added potassium (4.32 g, 31.2 mmol). The resulting solution was reacted at room temperature for a day and diluted with ethyl acetate. The reagent was washed with a saturated aqueous sodium chloride solution, then dried and filtered through anhydrous sodium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=20%), so that the title compound (2.65 g, 60%) was obtained as a colorless oil.

[Step 3] Synthesis of methyl 4-((N-(3-fluorophenyl)morpholine-4-carboxamido)methyl)benzoate

Methyl 4-(((3-fluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate (0.32 g, 0.75 mmol) was dissolved in dimethylformamide (5 ml), then potassium carbonate (0. 31 g, 2.24 mmol) and morpholine (0.13 ml, 1.49 mmol). The resulting solution was reacted at 60° C. for a day and then diluted with a saturated ammonium chloride solution. Extraction was carried out with ethyl acetate, then the resulting extract was dried and filtered through anhydrous sodium sulfate, and then concentrated under reduced pressure. The residue was purified by column chromatography (silica; ethyl acetate/hexane=30%) to give the title compound (0.13 g, 45%).

[Step 4] Synthesis of N-(3-fluorophenyl)-N-(4-hydroxycarbamoyl)benzyl)morpholine-4-carboxamide

Methyl 4-((N-(3-fluorophenyl)morpholine-4-carboxamido)methyl)benzoate (0.108 g, 0.290 mmol) was dissolved in methanol (10 ml) followed by hydroxylamine (50.0 wt% aqueous solution; 1 , 19 ml, 19.4 mmol) was added at room temperature and then potassium hydroxide (0.156 g, 2.78 mmol) was added and stirred at the same temperature for 16 hours. Then, the solvent was removed from the reaction mixture under reduced pressure, then a saturated aqueous sodium hydrogen carbonate solution was poured into the resulting concentrate, and extraction was performed with ethyl acetate. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The solid that precipitated was filtered off and dried, so that the title compound (0.062 g, 57%) was obtained as a white solid.

¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.14 (brs, 1 H), 8.99 (brs, 1 H), 7.65 (d, 2 H, J=7.0 Hz), 7.38-7.30 (m, 3H), 7.05-6.85 (m, 3H), 4.89 (s, 1H), 3.44-3.42 (m, 4H), 3, 18-3.15 (m, 4H), 2.08 (s, 3H). MS (ESI) m/z 374 (M ⁺ + H).

Production Example 6 Synthesis of N-(3-fluorophenyl)-N-(4-hydroxycarbamoyl)benzyl)-1,4-oxazepan-4-carboxamide [compound 652]

[Step 1] Synthesis of methyl 4-((N-(3-fluorophenyl)-1,4-oxazepane-4-carboxamido)methyl)benzoate

Methyl 4-(((3-fluorophenyl)((4-nitrophenoxy)carbonyl)amino)methyl)benzoate (0.290 g, 0.683 mmol) prepared in Preparation 5 Step 2, 1,4-oxazepane (0.188 g, 1.367 mmol) and potassium carbonate (0.283 g, 2.050 mmol) were dissolved in DMF (10 ml), then the reaction mixture solution was stirred at 60°C for a day, then a saturated aqueous NaHCO ₃ solution was poured into the reaction mixture, and then extraction was performed with ethyl acetate. The organic layer was washed with an aqueous saturated sodium chloride solution, then dehydrated with anhydrous magnesium sulfate, and then concentrated under reduced pressure. The resulting concentrate was purified by column chromatography (silica, 15 g cartridge; ethyl acetate/hexane=20 to 50%) and concentrated so that the title compound (0.116 g, 43.9%) was obtained as a colorless liquid.

[Step 2] Synthesis of N-(3-fluorophenyl)-N-(4-hydroxycarbamoyl)benzyl)-1,4-oxazepan-4-carboxamide

Methyl 4-((N-(3-(fluorophenyl)-1,4-oxazepane-4-carboxamide)methyl)benzoate (0.116 g, 0.3 mmol) was dissolved in methanol (10 ml), then an aqueous solution of hydroxylamine was added (50 wt%, 1 ml) and potassium hydroxide (0.168 g, 3.01 mmol) and stirred overnight After completion of the reaction, the resulting solution was subjected to distillation under reduced pressure to remove methanol therefrom, then extraction was carried out with ethyl acetate and water, so that work-up was carried out.The resulting extract was dried and filtered through anhydrous sodium sulfate and concentrated under reduced pressure, then the residue was stirred in diethyl ether so that a solid was obtained, filtered and dried, and thus the title compound (0.032 g, 27.5% ) was obtained as a white solid.

<Example 1> Analysis of therapeutic effect in an animal model of induced COPD

<Example 1-1> Construction of an animal model of induced COPD (smoking+poly I:C COPD model)

C57BL/6 mice (female at 7 weeks of age) were placed in a sealed smoking chamber and exposed to cigarette smoke for a period of time to induce COPD disease. More precisely, mice were placed in a smoking chamber, then a cigarette was placed and its filter was connected to a negative pressure tube so that cigarette smoke could be continuously generated. The smoking chamber was then closed, so that the mice were forced to breathe in cigarette smoke as they breathed. The mice were allowed to smoke for only 4 weeks. Mice were exposed to one, two and four cigarettes once during the first, second and third days of the first week, respectively, and were re-exposed to four cigarettes two and three times a day on the fourth and fifth days, respectively. The mice were then exposed to four cigarettes three times a day for the remaining 3 weeks. poly I:C (polyinosinic:polycytidylic acid) was injected into the nasal cavity of the anesthetized mice twice a week at the third and fourth weeks during smoking induction, so that the smoking+poly I:C COPD (chronic obstructive pulmonary disease) model was run.

In order to confirm the administration effect of the drug compound of the present invention, COPD-induced mice were divided into groups of 6 mice, and each group was classified as shown in the following Table 1 according to the administered substance [diluent (Veh), Compound 374 ( SM+1), or compound 458 (SM+2)], by administration [oral administration (P.O.)], and the interval between administrations [daily (Q.D.)].

Table 1

Group Administered dose (mg/kg) Route of administration Interval between injections Number of animals Veh - P.O. Q.D. 6 SM+1 thirty P.O. Q.D. 6 SM+2 thirty P.O. Q.D. 6

(Veh: 0.5% MC in DW)

<Example 1-2> Immune cell infiltration test

To confirm the effect of the compound of the present invention on the prevention or treatment of chronic obstructive pulmonary disease, the degree of immune cell infiltration was determined. After lung extraction from mice in each group, lung tissue sections were stained with H&E and subjected to pathological analysis. According to the reference image in Fig. 1, the degree of cell infiltration was determined as scores from 0 to 3, and the score was determined by slices for each group [FIG. 1: 0 - absent, 1 - weak, 2 - moderate and 3 - strong].

As a result, as shown in FIG. 2, the groups of animals treated with the compound of the present invention (SM+1 and SM+2) showed a decrease in cell infiltration scores compared to the smoking+poly I:C (SM+no drug) group. Thus, it could be concluded that the compound of the present invention has an inhibitory effect on immune cell infiltration and is therefore useful for preventing or treating chronic obstructive pulmonary disease.

<Example 1-3> Analysis of bronchoalveolar lavage fluid (BAL fluid)

To confirm the effect of the compound of the present invention on the prevention or treatment of chronic obstructive pulmonary disease, bronchoalveolar lavage fluid (BAL fluid) was analyzed. 2 ml BAL fluid was isolated from each group of mice and centrifuged. The resulting liquid was then suspended in phosphate buffered saline (PBS), then the total number of cells was counted, and 2×10 ⁵ were fixed on a glass slide using a cytocentrifuge. After staining with Diff-Quick stain, the resulting cells were classified into macrophages, neutrophils, and the like. based on the properties of stained cells with a total of 300 cells counted, then the content of the corresponding cells was calculated in terms of the total number of cells, and group comparisons were made.

As a result, as shown in FIG. 3, the data for the group of animals administered with the compound of the present invention (SM+1 and SM+2) were compared with the data for the smoking+poly I:C (SM+no drug) group and it was found that the total amount cells, macrophages and neutrophils decreased. Thus, it could be concluded that the compound of the present invention has an inhibitory effect on inflammatory cell infiltration and is therefore useful for preventing or treating chronic obstructive pulmonary disease. (*P<0.05, **P<0.01 and ***P<0.001)

<Example 1-4> Expression analysis of inflammatory cytokines in lung tissue

In order to confirm the effect of the compound of the present invention on the prevention or treatment of chronic obstructive pulmonary disease, the expression of inflammatory cytokines in lung tissues was analyzed. Lungs were extracted from mice in each group, then RNA was isolated from lung tissue. For each RNA, cDNA synthesis was performed using reverse transcriptase, then the expression of inflammatory cytokine markers such as IL-6, IFN-γ, MCP-1 and TNF-α was analyzed by real-time PCR and compared the degree of induction of inflammation in groups. In this case, the primer sequence used in this experiment is as shown in the following Table 2. (* P < 0.05, ** P < 0.01 and *** P < 0.001)

table 2

Gene Subsequence SEQID NO: mIL-6 Straight CTGCAAGAGACTTCCATCCAG 1 Reverse AGTGGTATAGACAGGTCTGTTGG 2 mIFN-γ Straight ATGAACGCTACACACTGCATC 3 Reverse CCATCCTTTTGCCAGTTCCTC 4 mMCP-1 Straight TTAAAAACCTGGATCGGAACCAA 5 Reverse GCATTAGCTTCAGATTTACGGGT 6 mTNF-α Straight CTGAACTTCGGGGTGATCGG 7 Reverse GGCTTGTCACTCGAATTTTGAGA 8

As a result, as shown in FIG. 4, the data for the group of animals administered with the compound of the present invention (SM+1 and SM+2) were compared with the data for the smoking+poly I:C (SM+no drug) group and it was found that IL expression -6, IFN-γ, MCP-1 and TNF-α decreased. Thus, it could be concluded that the compound of the present invention has an anti-inflammatory effect and is therefore useful for the prevention or treatment of chronic obstructive pulmonary disease.

<Example 2> Inhibitory effect on TGF-β1-induced EMT

To confirm the effect of the compound of the present invention on the prevention or treatment of chronic obstructive pulmonary disease, the expression of epithelial marker protein (E-Cad) and mesenchymal marker protein (N-Cad) was analyzed. A549 cells were grown in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). 1.5×10 ⁵ Cells were placed in a 6-well plate and incubated overnight. Cells were grown with 5 ng/ml human recombinant transforming growth factor beta 1 (TGF-β1) to induce epithelial-mesenchymal transition (EMT). TGF-β1 was diluted with RPMI-1640 (1% FBS, 1% P/S) and incubated with cells for 48 h. 14000×g for 10 min. The enriched culture medium was boiled with 15 μl of 4× sample buffer at 100° C. for 5 min and analyzed by Western blotting. Cells were lysed with RIPA buffer containing a mixture of protease inhibitors and a mixture of phosphatase inhibitors. The lysate was incubated on ice for 3 min and centrifuged at 13000×g, 4°C for 20 min. The supernatant was quantified with a BCA protein assay kit and analyzed by Western blotting. The prepared sample was loaded onto NuPAGE Novex 4-12% Bis-Tris gel and digested at 120 V. Proteins were transferred to a nitrocellulose membrane using an iBlot apparatus. The membrane was blocked using EzBlock Chemi according to the manufacturer's instructions. Antibodies such as E-cadherin (E-Cad), N-cadherin (N-cad), fibronectin-EDA (FN-EDA) and the like have been used. After reaction with horseradish peroxidase (HRP)-conjugated secondary antibodies, immunoreactive proteins were visualized using the Amersham ^™ ECL select ^™ Western Blot detection reagent and detected using the ChemiDoc ^™ MP imaging system. Band intensity was quantified using ImageJ software and normalized to β-actin.

As a result, as shown in FIG. 5 groups of animals treated with the compound of the present invention (374, 458, 413, 484, 530 and 652) showed a significant increase in the expression of E-Cad, which is an epithelial marker protein, and a significant increase in the expression of N-Cad, which is a mesenchymal marker protein compared to Vhcl (TGF-β1).

Thus, it could be concluded that the compound of the present invention has an inhibitory effect on TGF-β1-induced EMT and is therefore useful for the prevention or treatment of chronic obstructive pulmonary disease. (*P<0.05, **P<0.01, and ***P<0.001)

<Example 3> Effect on FN-EDA protein reduction

To confirm the effect of the compound of the present invention on the prevention or treatment of chronic obstructive pulmonary disease, the expression of FN-EDA, a key extracellular matrix (ECM) protein, was analyzed. The analysis was carried out according to the same procedure as described above in example 2.

As a result, as shown in FIG. 6, groups of animals treated with the compound of the present invention (374, 458, 413, 484, 530 and 652) showed a significant increase in the expression of the key protein FN-EDA compared to Vhcl (TGF-β1).

Thus, it could be concluded that the compound of the present invention reduces the content of the key ECM protein FN-EDA, and is therefore useful for the prevention or treatment of chronic obstructive pulmonary disease. (*P<0.05, **P<0.01, and ***P<0.001)

<Example 4> Statistical analysis

For one-tailed T-test, Graph Pad Prism 5.0 software (post hoc: Dunnett) was used and all data were expressed as mean±SEM. P < 0.05 was considered statistically significant.

Although specific parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such a detailed description is provided only to illustrate exemplary embodiments and does not limit the scope of the present invention. Thus, it is to be understood that the true scope of the present invention is defined by the appended claims and their equivalents.

--->

SEQUENCE LIST

<110> CHONG KUN DANG PHARMACEUTICAL CORP.

<120> Compositions for the prevention or treatment of chronic

obstructive lung disease

(COPD)

<130> P20018-CKD

<150> KR 10-2019-0132501

<151> 2019-10-23

<160> 8

<170> KoPatentIn 3.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (F)_mIL-6

<400> 1

ctgcaagaga cttccatcca g 21

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (R)_mIL-6

<400> 2

agtggtatag acaggtctgt tgg 23

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (F)_mIFN-gamma

<400> 3

atgaacgcta cacactgcat c 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (R)_mIFN-gamma

<400> 4

ccatcctttt gccagttcct c 21

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (F)_mMCP-1

<400> 5

ttaaaaacct ggatcggaac caa 23

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (R)_mMCP-1

<400> 6

gcattagctt cagatttacg ggt 23

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (F)_mTNF-alpha

<400> 7

ctgaacttcg gggtgatcgg 20

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer (R)_mTNF-alpha

<400> 8

ggcttgtcac tcgaattttg aga 23

<---

Claims (91)

1. A method for preventing or treating chronic obstructive pulmonary disease, comprising administering to an individual a therapeutically effective amount of a compound having the following chemical formula I, or pharmaceutically acceptable salts thereof, as an effective ingredient: [Chemical Formula I]

, Where A means

, Xa and Xb are all independently CH or N, L ₁ and L ₂ are all independently hydrogen, halogen, -CF ₃ or -C _1-3 straight or branched alkyl, Q means C(=O), S(=O) ₂ , S(=O) or C(=NH) and Y is selected from the following group:

M is C, N, O, S, or S(=O) ₂ , wherein if M is C, l and m are 1; if M is N, l is 1 and m is 0; and if M is O, S or S(=O) ₂ , l and m are 0, R _a1 and R _a2 are all independently hydrogen; a hydroxy group; -C _1-4 straight or branched alkyl which is unsubstituted or substituted with at least one halogen; -C _1-4 linear or branched chain alcohol; benzhydryl; -C _1-4 straight or branched chain alkyl which is substituted by a saturated or unsaturated 5-7 membered heterocyclic compound containing 1 to 3 heteroatoms selected from N, O or S as ring members, wherein the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen; a saturated or unsaturated 5-7 membered heterocyclic compound containing from 1 to 3 heteroatoms selected from N, O or S as ring elements, wherein the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen; phenyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; benzyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; -S(=O) ₂ CH ₃ ; halogen; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 alkoxyalkyl; -C(=O)R _x , where R _x is C _1-3 straight or branched alkyl or C _3-10 cycloalkyl;

where R _c and R _d are independently hydrogen or C _1-3 straight or branched alkyl;

or

, n is an integer equal to 0, 1 or 2, _Rb is hydrogen; a hydroxy group; -C _1-6 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; -C(=O)CH ₃ ; -C _1-4 straight or branched hydroxyalkyl; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched chain alkoxyalkyl; _-CF3 ; halogen; or

, R _e and R _f are all independently hydrogen or -C _1-3 straight or branched alkyl and Z is selected from the following group:

P _a and P _b all independently mean

hydrogen; a hydroxy group; -C _1-4 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; halogen; _-CF3 ; -OCF ₃ ; -CN; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; _-CH2F ; or -C _1-3 alcohol, Where

means a ring selected from the group consisting of phenyl, pyridine, pyrimidine, thiazole, indole, indazole, piperazine, quinoline, furan, tetrahydropyridine, piperidine, or from the following group:

, x, y, and z are all independently integers equal to 0 or 1, and R_g1, R_g2 and R_g3 all independently selected from the group consisting of hydrogen; a hydroxy group; -C_1-3 alkyl; -CF₃; -C_1-6 having a linear or branched chain alkoxy group; -C_2-6 having a linear or branched chain alkylalkoxy group; -C(=O)CH₃; -C_1-4 having a linear or branched chain hydroxyalkyl; -N(CH₃)₂; halogen; phenyl; -S((=O)₂)CH₃; or from the following group:

. 2. The method according to claim 1, in which the compound described by the above chemical formula I may be a compound described by the following chemical formula Ia: [Chemical formula Ia]

, Where Y is selected from the following group:

, where M, l, m, n, R _a1 , R _a2 , and R _b are the same as in item 1, respectively, Z means

, P _a and P _b are all independently hydrogen; a hydroxy group; -C _1-4 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; halogen; _-CF3 ; -OCF ₃ ; -CN; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; _-CH2F ; or -C _1-3 alcohol. 3. The method according to claim 2, in which Y is selected from the following group:

, where n and R _b are the same as in paragraph 1, respectively, Z means

And P _a and P _b are all independently hydrogen; halogen; _-CF3 ; or -C _1-6 having a linear or branched chain alkoxy group. 4. The method according to claim 1, in which the compound described by the above chemical formula I is a compound described in the following table: Compound Structure Compound Structure

5. The method according to claim 1, in which the compound described by the above chemical formula I is a compound described in the following table: Compound Structure Compound Structure

6. The method of claim. 1, in which the compound described by the above chemical formula I, or its pharmaceutically acceptable salts are administered orally. 7. The use of a compound having the following chemical formula I, or pharmaceutically acceptable salts thereof, for the prevention or treatment of chronic obstructive pulmonary disease: [Chemical Formula I]

, Where A means

, Xa and Xb are all independently CH or N, L ₁ and L ₂ are all independently hydrogen, halogen, -CF ₃ or -C _1-3 straight or branched alkyl, Q means C(=O), S(=O) ₂ , S(=O) or C(=NH) and Y is selected from the following group:

M is C, N, O, S, or S(=O) ₂ , wherein if M is C, l and m are 1; if M is N, l is 1 and m is 0; and if M is O, S or S(=O) ₂ , l and m are 0, R _a1 and R _a2 are all independently hydrogen; a hydroxy group; -C _1-4 straight or branched alkyl which is unsubstituted or substituted with at least one halogen; -C _1-4 linear or branched chain alcohol; benzhydryl; -C _1-4 straight or branched chain alkyl which is substituted by a saturated or unsaturated 5-7 membered heterocyclic compound containing 1 to 3 heteroatoms selected from N, O or S as ring members, wherein the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen; a saturated or unsaturated 5-7 membered heterocyclic compound containing from 1 to 3 heteroatoms selected from N, O or S as ring elements, wherein the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen; phenyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; benzyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; -S(=O) ₂ CH ₃ ; halogen; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 alkoxyalkyl; -C(=O)R _x , where R _x is C _1-3 straight or branched alkyl or C _3-10 cycloalkyl;

where R _c and R _d are independently hydrogen or C _1-3 straight or branched alkyl;

or

, n is an integer equal to 0, 1 or 2, _Rb is hydrogen; a hydroxy group; -C _1-6 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; -C(=O)CH ₃ ; -C _1-4 straight or branched hydroxyalkyl; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched chain alkoxyalkyl; _-CF3 ; halogen; or

, R _e and R _f are all independently hydrogen or -C _1-3 straight or branched alkyl and Z is selected from the following group:

P _a and P _b all independently mean

hydrogen; a hydroxy group; -C _1-4 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; halogen; _-CF3 ; -OCF ₃ ; -CN; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; _-CH2F ; or -C _1-3 alcohol, Where

means a ring selected from the group consisting of phenyl, pyridine, pyrimidine, thiazole, indole, indazole, piperazine, quinoline, furan, tetrahydropyridine, piperidine, or from the following group:

, x, y, and z are all independently integers equal to 0 or 1, and R _g1 , R _g2 and R _g3 are all independently selected from the group consisting of hydrogen; a hydroxy group; -C _1-3 alkyl; _-CF3 ; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; -C(=O)CH ₃ ; -C _1-4 straight or branched hydroxyalkyl; -N(CH ₃ ) ₂ ; halogen; phenyl; -S((=O) ₂ )CH ₃ ; or from the following group:

. 8. The use of a compound having the following chemical formula I or pharmaceutically acceptable salts thereof for the preparation of a medicament for the treatment of chronic obstructive pulmonary disease: [Chemical Formula I]

, Where A means

, Xa and Xb are all independently CH or N, L ₁ and L ₂ are all independently hydrogen, halogen, -CF ₃ or -C _1-3 straight or branched alkyl, Q means C(=O), S(=O) ₂ , S(=O) or C(=NH) and Y is selected from the following group:

M is C, N, O, S, or S(=O) ₂ , wherein if M is C, l and m are 1; if M is N, l is 1 and m is 0; and if M is O, S or S(=O) ₂ , l and m are 0, R _a1 and R _a2 are all independently hydrogen; a hydroxy group; -C _1-4 straight or branched alkyl which is unsubstituted or substituted with at least one halogen; -C _1-4 linear or branched chain alcohol; benzhydryl; -C _1-4 straight or branched chain alkyl which is substituted by a saturated or unsaturated 5-7 membered heterocyclic compound containing 1 to 3 heteroatoms selected from N, O or S as ring members, wherein the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen; saturated or unsaturated 5-7-membered heterocyclic compound containing from 1 to 3 heteroatoms selected from N, O or S as ring elements, while the heterocyclic compound may be unsubstituted or at least one hydrogen may be optionally substituted with OH, OCH ₃ , CH ₃ , CH ₂ CH ₃ or halogen; phenyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; benzyl which is unsubstituted or in which at least one hydrogen is substituted by halogen, C _1-4 alkoxy, C _1-2 alkyl, or hydroxy; -S(=O) ₂ CH ₃ ; halogen; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 alkoxyalkyl; -C(=O)R _x, where R _x is C _1-3 straight or branched alkyl or C _3-10 cycloalkyl;

where R _c and R _d are independently hydrogen or C _1-3 straight or branched alkyl;

or

, n is an integer equal to 0, 1 or 2, _Rb is hydrogen; a hydroxy group; -C _1-6 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; -C(=O)CH ₃ ; -C _1-4 straight or branched hydroxyalkyl; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched chain alkoxyalkyl; _-CF3 ; halogen; or

, R _e and R _f are all independently hydrogen or -C _1-3 straight or branched alkyl and Z is selected from the following group:

P _a and P _b all independently mean

hydrogen; a hydroxy group; -C _1-4 straight or branched chain alkyl which is unsubstituted or in which at least one hydrogen has been replaced by halogen; halogen; _-CF3 ; -OCF ₃ ; -CN; -C _1-6 having a linear or branched chain alkoxy group; -C _2-6 straight or branched alkyl alkoxy group; _-CH2F ; or -C _1-3 alcohol, Where

means a ring selected from the group consisting of phenyl, pyridine, pyrimidine, thiazole, indole, indazole, piperazine, quinoline, furan, tetrahydropyridine, piperidine, or from the following group:

, x, y, and z are all independently integers equal to 0 or 1, and R_g1, R_g2 and R_g3 all independently selected from the group consisting of hydrogen; a hydroxy group; -C_1-3 alkyl; -CF₃; -C_1-6 having a linear or branched chain alkoxy group; -C_2-6 having a linear or branched chain alkylalkoxy group; -C(=O)CH₃; -C_1-4 having a linear or branched chain hydroxyalkyl; -N(CH₃)₂; halogen; phenyl; -S((=O)₂)CH₃; or from the following group:

.

Images