RU2798342C2 - Compounds and compositions for intracellular delivery of therapeutic agents - Google Patents

Abstract

FIELD: organic chemistry.

SUBSTANCE: invention relates to new lipids and compositions containing them. The invention relates to a compound of formula (IA), where l represents 5; m is 7; M₁ is M'; R₄ is -(CH₂)_n Q, where Q is -N(R)R₈ and n is 3; M and M' are independently selected from -C(O)O- and -OC(O)-; R₈ is cyclobutenyl substituted with one or more oxo, amino, heterocycloalkyl selected from piperidinyl, morpholinyl and 4-methylpiperazin-1-yl, and mono- or dialkylamino, where mono- and dialkylamino are substituted with one C_1-3 alkoxy or dialkylamino; R₂ and R₃ are independently C_8-10 alkyl; R is H; and R' is C_9-18 alkyl. The invention also relates to a nanoparticle composition for delivery of a therapeutic and/or prophylactic agent based on a compound of formula (IA).

EFFECT: new compounds and a composition based on them have been obtained, which can be used in medicine when delivering therapeutic and/or prophylactic agents to cells or organs of mammals, for example, to regulate the expression of a polypeptide, protein or gene.

28 cl, 39 dwg, 42 tbl, 26 ex

Description

Related Applications

[0001] This application claims priority to U.S. Provisional Application No. 62/471,937, filed March 15, 2017; and 62/475140, filed March 22, 2017; the entire contents of each are incorporated herein by reference.

Inclusion of a sequence listing by reference

[0002] This application has been filed with a sequence listing in electronic format. The sequence listing is provided as a file called "MRNA032001WO SequenceListing.txt", created on February 26, 2018, which is 715 bytes in size. The information in the electronic sequence listing format is incorporated herein by reference in its entirety.

Field of invention

[0003] This disclosure provides novel compounds, compositions containing such compounds, and methods involving the use of lipid nanoparticle compositions to deliver one or more therapeutic and/or prophylactic agents for and/or production of polypeptides in mammalian cells or organs. In addition to the new lipid, the lipid nanoparticle compositions of this invention may include one or more cationic and/or ionizable lipids, phospholipids including polyunsaturated lipids, PEG lipids, structural lipids and/or therapeutic and/or prophylactic agents in certain fractions.

State of the art

[0004] Efficient targeted delivery of biologically active substances, such as small molecule drugs, proteins and nucleic acids, is an ongoing medical problem. In particular, the delivery of nucleic acids into cells is difficult due to the relative instability and low cell permeability of such particles. Thus, there is a need to develop methods and compositions to facilitate the delivery of therapeutic and/or prophylactic agents, such as nucleic acids, to cells.

[0005] Lipid-containing compositions of nanoparticles, liposomes, and lipoplexes have proven effective as vehicles into cells and/or intracellular compartments for biologically active substances such as small molecule drugs, proteins, and nucleic acids. Such compositions typically include one or more "cationic" and/or amino (ionizable) lipids, phospholipids, including polyunsaturated lipids, structural lipids (eg, sterols), and/or polyethylene glycol-containing lipids (PEG lipids). Cationic and/or ionizable lipids include, for example, amine-containing lipids, which can be easily protonated. Although many such lipid-containing nanoparticle compositions have been demonstrated, improvements in safety, efficacy and specificity are still lacking.

SUMMARY OF THE INVENTION

[0006] This invention provides new compounds and compositions and methods including them.

[0007] The first aspect of the description relates to compounds of formula (I):

or their N-oxide,

or their salts, or their tautomer, where:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q ,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, heterocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC (O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R) ₂ , -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ ) N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R , -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(= NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C (O)N(R)OR and -C(R)N(R) ₂ C(O)OR, each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'', (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R'' is independently selected from the group consisting of C _3-15 alkyl and

C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and

C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0008] Another aspect of this invention relates to compounds of formula (III):

or their N-oxide,

or their salts, or their tautomer, where:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q ,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, heterocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC (O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R) ₂ , N(R)R ₈ , - N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N (R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C( O)N(R)OR and -C(R)N(R) ₂ C(O)OR, each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and

C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and

C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0009] In some embodiments, the subset of compounds of formula (I) includes compounds in which when R ₄ is -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR, or CQ(R) ₂ then (i) Q is not -N(R) ₂ when n is 1, 2, 3, 4, or 5, or (ii) Q is not 5, 6, or 7-membered heterocycloalkyl when n is 1 or 2 .

[0010] For example, when R ₄ is -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q, -CHQR or CQ( R) ₂ then (i) Q is not -N(R) ₂ when n is 1, 2, 3, 4 or 5, or (ii) Q is not 5, 6 or 7 membered heterocycloalkyl when n is 1 or 2.

[0011] In other embodiments, another subset of the compounds of formula (I) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q , -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O and S, - OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR , -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R )C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O) N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N (R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR and 5-14 membered heterocycloalkyl having one or more heteroatoms , selected from N, O and S, which is substituted with one or more substituents selected from oxo (=O), OH, amino, mono- or di-alkylamino and C _1-3 alkyl, each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H,

and each q is independently selected from 1, 2 and 3;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0012] In still other embodiments, another subset of the compounds of formula (I) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q , -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14-membered heterocycle having one or more heteroatoms selected from N, O and S, - OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR , -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R )C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O) N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N (R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR, and -C(=NR ₉ )N(R) ₂ , each o independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5; and when Q is a 5-14 membered heterocycle and (i) R ₄ is -(CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is -(CH ₂ ) _n CHQR in which n is 1, or (iii) R ₄ is CHQR and —CQ(R) ₂ then Q is both 5-14 membered heteroaryl and 8-14 membered heterocycloalkyl;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0013] In still other embodiments of the invention, another subset of the compounds of formula (I) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q , -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O and S, - OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR , -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R )C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O) N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N (R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR, each o being independently selected from 1, 2, 3 and 4 and -C(=NR ₉ )N(R) ₂ and each n are independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl,

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0014] In still other embodiments of the invention, another subset of the compounds of formula (I) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q ,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O )R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R) ₂ , N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O )N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O) OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , - N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR and - C(R)N(R) ₂ C(O)OR, where each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'', (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R'' is independently selected from the group consisting of C _3-15 alkyl and

C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and

C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0015] In still other embodiments, another subset of the compounds of formula (I) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _2-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is -(CH ₂ ) _n Q or -(CH ₂ ) _n CHQR, where Q is -N(R) ₂ and n is selected from 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _1-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0016] In still other embodiments of the invention, another subset of the compounds of formula (I) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR and -CQ(R) ₂ where Q is -N(R) ₂ and n is selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _1-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0017] In some embodiments, the subset of compounds of formula (III) includes those wherein when R ₄ is -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR, or CQ(R) ₂ , then (i) Q is not -N(R) ₂ when n is 1, 2, 3, 4 or 5, or (ii) Q is not 5, 6 or 7 membered heterocycloalkyl when n is 1 or 2 .

[0018] In other embodiments, another subset of the compounds of formula (III) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q , -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O and S, - OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR , -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R )C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O) N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N (R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR and 5-14 membered heterocycloalkyl having one or more heteroatoms , selected from N, O and S, which is substituted with one or more substituents selected from oxo (=O), OH, amino, mono- or di-alkylamino and C _1-3 alkyl, each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H,

and each q is independently selected from 1, 2 and 3;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0019] In still other embodiments, another subset of compounds of formula (III) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q , -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14-membered heterocycle having one or more heteroatoms selected from N, O and S, - OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR , -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R )C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O) N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N (R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR, and -C(=NR ₉ )N(R) ₂ , each o independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5; and when Q is a 5-14 membered heterocycle and (i) R ₄ is -(CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is -(CH ₂ ) _n CHQR in which n is 1, or (iii) R ₄ is CHQR and —CQ(R) ₂ then Q is both 5-14 membered heteroaryl and 8-14 membered heterocycloalkyl;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0020] In still other embodiments of the invention, another subset of the compounds of formula (III) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q , -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O and S, - OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O) N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C (S)N(R) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR , -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R )C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O) N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N (R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR, each o independently selected from 1, 2, 3 and 4 and -C(=NR ₉ )N(R) ₂ , each o is independently selected from 1, 2, 3, and 4, and each n is independently selected from 1, 2, 3, 4, and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0021] In still other embodiments of the invention, another subset of the compounds of formula (III) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q ,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O )R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R) ₂ , N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O )N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O) OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , - N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR and - C(R)N(R) ₂ C(O)OR, where each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'', (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R'' is independently selected from the group consisting of C _3-15 alkyl and

C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and

C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0022] In still other embodiments, another subset of compounds of formula (III) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _2-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is -(CH ₂ ) _n Q or -(CH ₂ ) _n CHQR, where Q is -N(R) ₂ and n is selected from 3, 4 and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _1-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0023] In still other embodiments of the invention, another subset of the compounds of formula (III) includes compounds in which

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR and -CQ(R) ₂ where Q is -N(R) ₂ and n is selected from 1, 2, 3, 4 and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _1-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is chosen from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their N-oxides, or their salts, or their isomers.

[0024] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (IA):

or their N-oxide, or their salt, or their isomer, where l is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9; M ₁ is a bond or M'; R ₄ is hydrogen, unsubstituted C _1-3 alkyl, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q or -(CH ₂ ) _n Q, where Q is OH, -NHC( S)N(R) ₂ , -NHC(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)R ₈ , -NHC(=NR ₉ )N(R) ₂ , -NHC(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR,

heteroaryl or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl and C _2-14 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R) ₂ or -NHC(O)N(R) ₂ . For example, Q is -N(R)C(O)R or -N(R)S(O) ₂ R.

[0025] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (IB):

or their N-oxide, or their salt, or their isomer, in which all variables have the meanings defined in this document. For example, m is selected from 5, 6, 7, 8 and 9; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl and C _2-14 alkenyl. For example, m is 5, 7, or 9.

[0026] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (II):

or their N-oxide, or their salt, or their isomer, and l is selected from 1, 2, 3, 4 and 5; M ₁ is a bond or M'; R ₄ is hydrogen, unsubstituted C _1-3 alkyl, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q or -(CH ₂ ) _n Q, wherein n is 2, 3 or 4 and Q is OH, -NHC(S)N(R) ₂ , -NHC(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)R ₈ , -NHC(=NR ₉ )N(R) ₂ , -NHC(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R) C(O)OR, heteroaryl or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-1 alkyl and C _2-14 alkenyl.

[0027] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (IIa), (IIb), (IIc) or (IIe):

or their N-oxide, or their salt, or their isomer, where R ₄ corresponds to the description in this document.

[0028] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (IId):

or their N-oxide, or their salt, or their isomer, where n is 2, 3 or 4; and m, R', R'' and R ₂ to R ₆ are described herein. For example, each of R ₂ and R ₃ can be independently selected from the group consisting of C _5-14 alkyl and C _5-14 alkenyl.

[0029] In another embodiment, a subset of compounds of formula (I) includes compounds of formula (IIf):

or their N-oxide, or their salt, or their isomer, where n is 2, 3 or 4; and m, M, M'', R', R'' and R ₂ to R ₆ are described herein. For example, each of R ₂ and R ₃ can be independently selected from the group consisting of C _5-14 alkyl and C _5-14 alkenyl and n is selected from 2, 3 and 4.

[0030] In another embodiment, a subset of compounds of formula (I) includes compounds of formula (IIg):

[0031] or their N-oxide, or their salt, or their isomer, where l, m, M, M ₁ , R', R ₂ and R ₃ are described in this document. For example, each of R ₂ and R ₃ can be independently selected from the group consisting of C _5-14 alkyl and C _5-14 alkenyl, l is selected from 1, 2, 3, 4 and 5 and m is selected from 5, 6, 7, 8 and 9. In another aspect, the description relates to a composition of nanoparticles comprising a lipid component containing a compound as described herein (for example, a compound of formula (I), (IA), (IB), (II), (IIa ), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III)).

[0032] In another aspect, the description relates to a pharmaceutical composition containing a nanoparticle composition in accordance with the preceding aspects, and a pharmaceutically acceptable carrier. For example, the pharmaceutical composition is refrigerated or frozen for storage and/or shipping (eg, stored at or below 4°C, such as at about -150°C and between about 0°C, or between about -80°C and about - 20°C (e.g. around -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60° C, -70°C, -80°C, -90°C, -130°C or -150°C) For example, a pharmaceutical composition is a solution that is kept in a refrigerator for storage and/or shipping, for example, around -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C.

[0033] In another aspect, the invention relates to a method for delivering a therapeutic and/or prophylactic agent (eg, mRNA) into a cell (eg, a mammalian cell). The method includes the step of administering to a subject (e.g., a mammal such as a human) a nanoparticle composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA) , (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) a therapeutic and/or prophylactic agent wherein the administration comprises contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the cell.

[0034] In another aspect, this invention relates to a method for obtaining a polypeptide of interest in a cell (eg, a mammalian cell). The method includes the step of contacting a cell with a nanoparticle composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (IB), (II ), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) mRNA encoding the polypeptide of interest, due to which the mRNA is able to be translated in the cell to form a polypeptide.

[0035] In another aspect, this invention relates to a method of treating a disease or disorder in a mammal (eg, human) in need thereof. The method includes the step of administering to a mammal a therapeutically effective amount of a nanoparticle composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (IB), (II ), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) a therapeutic and/or prophylactic agent (eg mRNA). In some embodiments, the disease or disorder is characterized by a dysfunctional or aberrant activity of a protein or polypeptide. For example, the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (eg, cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renovascular diseases, and metabolic diseases.

[0036] In another aspect, the invention relates to a nanoparticle composition for use in the treatment of a disease or disorder in a mammal (eg, human) in need thereof. The nanoparticle composition contains (i) a lipid component containing a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (IB), (II), (IIa), (IIb) , (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) a therapeutic and/or prophylactic agent (eg mRNA). In some embodiments, the disease or disorder is characterized by a dysfunctional or aberrant activity of a protein or polypeptide. For example, the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (eg, cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renovascular diseases, and metabolic diseases.

[0037] In another aspect, the invention relates to a nanoparticle composition for use in the manufacture of a medicament in the treatment of a disease or disorder in a mammal (eg, human) in need thereof. The nanoparticle composition contains (i) a lipid component containing a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (IB), (II), (IIa), (IIb) , (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) a therapeutic and/or prophylactic agent (eg mRNA). In some embodiments, the disease or disorder is characterized by a dysfunctional or aberrant activity of a protein or polypeptide. For example, the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (eg, cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renovascular diseases, and metabolic diseases.

[0038] In another aspect, the present invention provides a nanoparticle composition for use in the manufacture of a medicament in the treatment of a disease or disorder in a mammal (eg, human) in need thereof. The nanoparticle composition contains (i) a lipid component containing a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (IB), (II), (IIa), (IIb) , (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) a therapeutic and/or prophylactic agent (eg mRNA). In some embodiments, the disease or disorder is characterized by a dysfunctional or aberrant activity of a protein or polypeptide. For example, the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (eg, cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renovascular diseases, and metabolic diseases.

[0039] In another aspect, the invention relates to a method for delivering (eg, specific delivery) a therapeutic and/or prophylactic agent to a mammalian organ (eg, liver, spleen, lung, or femur). The method includes the step of administering to a subject (e.g., a mammal) a nanoparticle composition comprising (i) a lipid component comprising a phospholipid, a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (IB), (II), ( IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) and (ii) a therapeutic and/or prophylactic agent (e.g., mRNA) wherein the administration comprises bringing the cell into contact with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the target organ (eg, liver, spleen, lung, or femur).

[0040] In another aspect, the invention provides a method for improved delivery of a therapeutic and/or prophylactic agent (eg, mRNA) to a target tissue (eg, liver, spleen, lung, or femur). The method comprises administering to a subject (e.g., a mammal) a composition of nanoparticles, the composition comprising (i) a lipid component comprising a compound of Formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), a phospholipid, a structural lipid and a PEG lipid; and (ii) a therapeutic and/or prophylactic agent, the administration comprising contacting the target tissue with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the target tissue.

[0041] In yet another aspect, this invention relates to a method for reducing immunogenicity, comprising introducing a nanoparticle composition of this invention into cells, wherein the nanoparticle composition reduces the induction of a cellular immune response of cells to the nanoparticle composition compared to the induction of a cellular immune response in cells caused by a control composition , which contains a control lipid instead of a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). For example, the cellular immune response is an innate immune response, an adaptive immune response, or both.

[0042] This description also includes methods for synthesizing a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf) , (IIg) or (III) and methods for producing a nanoparticle composition comprising a lipid component containing a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), ( IId), (IIe), (IIf), (IIg) or (III).

BRIEF DESCRIPTION OF GRAPHICS

[0043] In FIG. 1 shows the results of pre-treatment of non-human primates with methotrexate or dexamethasone prior to administration of the MC3-containing nanoparticle composition.

[0044] In FIG. 2 shows hEPO mRNA expression measured after intravenous administration of various nanoparticle compositions at a dose of 0.01 mg/kg at a 60-minute infusion to naïve cynomolgus monkeys.

[0045] In FIG. 3-6 show, respectively, the results of hEPO expression measured intravenously in rats at various doses of various nanoparticle formulations containing compounds 26, 18, 25 and MC3.

[0046] In FIG. 7 shows the area under the curve (AUC) for nanoparticle formulations containing compounds 18, 25 and 26 and MC3 at various doses from 0.005 mg/kg to 2 mg/kg.

[0047] In FIG. Figure 8 shows the results of luciferase expression measured by intramuscular administration to mice of various compositions of nanoparticles containing MC3, compounds 168-170 and 173-175 at a dose of 0.01 mg/kg at various time points: 3 hours (left block), 6 hours (middle block) and 24 hours (right block). Numbers 1-7 in this figure correspond to MC3, compounds 168-170 and 173-175, respectively.

[0048] In FIG. Figure 9 shows the results of hEPO expression measured by intramuscular administration to mice of various compositions of nanoparticles containing MC3, compounds 18, 25, 30, 108-112, 60 and 122 at a dose of 0.01 mg/kg at various time points: 3 hours (left panel ), 6 hours (middle block) and 24 hours (right block). Numbers 1-11 in this figure correspond to MC3, compounds 18, 25, 30, 108-112, 60 and 122, respectively.

[0049] In FIG. 10 shows the results of luciferase expression (total flux) measured by intravenous administration of various nanoparticle formulations containing MC3 or various compounds disclosed herein. Numbers 1-12 in this figure correspond to compound 18, MC3, compounds 48-50, 54, 111, 60, 75, 68, 66, 128, 65, 130, 133-135, 147, 96 and 151, respectively.

[0050] In FIG. 11A and 11B show the results of anti-HA antibody (anti-hemagglutinin antibody) expression measured after intravenous administration of various formulations of nanoparticles containing MC3 and compound 18 at a dose of 0.1 mg/kg (Fig. 11A) or 0.3 mg/kg ( Fig. 11B) via a 60 minute infusion to naïve cynomolgus monkeys.

[0051] FIG. 12A-12C are a series of graphs showing luciferase expression levels at 3 hours (FIG. 12A), 6 hours (FIG. 12B) and 24 hours (FIG. 12C) after intravenous administration of nanoparticulate compositions containing compounds of the invention to mice. Total flux values were obtained using luminescent body imaging (BLI). In these figures, numbers 1-14 refer to compositions containing compounds 160, 98, 161-165, 171, 172, 183-186 and MC3, respectively.

[0052] FIG. 13A-13C are a series of graphs showing luciferase expression levels at 3 hours (FIG. 13A), 6 hours (FIG. 13B) and 24 hours (FIG. 13C) after intravenous administration of nanoparticulate compositions containing compounds of the invention to mice. Total flux values were obtained using luminescent body imaging (BLI). PBS (sodium phosphate buffer) was used as a control. The results are presented on a logarithmic scale. In these figures, the numbers 1-15 refer to compositions containing MC3, compounds 18, 111, 168-170, 174, 175, 178, 179, 181, 182, 218, 198 and PBS, respectively.

[0053] FIG. 14A-14C are a series of graphs showing luciferase expression levels in the liver (FIG. 14A), spleen (FIG. 14B) and kidney (FIG. 14C), ex vivo , 6 hours after intravenous administration of nanoparticulate compositions containing compounds of the invention to mice. . Total flux values were obtained using luminescent body imaging (BLI). PBS (sodium phosphate buffer) was used as a control. In these figures, the numbers 1-15 refer to compositions containing MC3, compounds 18, 111, 168-170, 174, 175, 178, 179, 181, 182, 218, 198 and PBS, respectively.

[0054] FIG. 15A and 15B are a pair of graphs showing the frequencies of activated B cells in the spleen of CD-1 mice treated with compounds of the invention compared to MC3 and compared to mice not receiving any treatment (naive test subject). PBS was used as a control. On FIG. 15A shows the percentage of CD19+ cells. On FIG. 15B shows the percentage of CD19+CD69+CD86+ cells. Numbers 1-16 referring to compositions containing mRNA expressing luciferase are as follows: 1: MC3, 2: Compound 18, 3: Compound 111, 4: Compound 168, 5: Compound 169, 6: Compound 170, 7: Compound 174, 8: Compound 175, 9: Compound 178, 10: Compound 179, 11: Compound 181, 12: Compound 182, 13: Compound 218, 14: Compound 198, 15: PBS, 16: Naive subject treatment.

[0055] FIG. 16A and 16B are a pair of graphs showing the frequencies of activated B cells in the spleens of CD-1 mice treated with compounds of the invention compared to MC3 and compared to mice not receiving any treatment (naive test subject). PBS was used as a control. On FIG. 16A shows the percentage of CD19+ cells. On FIG. 16B shows the percentage of CD19+CD69+CD86+ cells. Numbers 1-14 referring to compositions containing mRNA expressing luciferase are as follows: 1: Compound 147, 2: Compound 184, 3: Compound 232, 4: Compound 189, 5: Compound 200, 6: Compound 233, 7: Compound 234, 8: Compound 235, 9: Compound 237, 10: Compound 239, 11: Compound 243, 12: MC3; 13: PBS, 14: naive treatment.

[0056] FIG. 17 is a graph showing hEPO mRNA expression in CD1 mice measured at 3 hours (left panel), 6 hours (middle panel) and 24 hours (right panel) after intravenous administration of various nanoparticle compositions. Numbers 1-13 referring to compositions containing mRNA expressing hEPO are as follows: 1: Compound 147, 2: Compound 184, 3: Compound 232, 4: Compound 189, 5: Compound 200, 6: Compound 233, 7: Compound 234, 8: Compound 235, 9: Compound 237, 10: Compound 239, 11: Compound 243, 12: MC3; 13: PBS.

[0057] In FIG. 18A and 18B show the results of luciferase expression measured by intramuscular administration of various formulations of nanoparticles to CD-1 mice at a dose of 0.01 mg/kg. Fig. 18A is a bar graph showing total flow 6 hours after administration. The numbers above each column indicate the level of expression relative to MC3. Fig. 18B shows total flux values at 3 hours, 6 hours and 24 hours after administration. Numbers 1-11 in the figures denote compositions containing the following: 1: MC3, 2: Compound 143, 3: Compound 49, 4: Compound 113, 5: Compound 61, 6: Compound 72, 7: Compound 75, 8: Compound 71 , 9: Compound 128, 10: Compound 156, 11: Compound 157.

[0058] In FIG. 19A and 19B show the results of luciferase expression measured by subcutaneous administration of various formulations of nanoparticles to CD-1 mice at a dose of 0.05 mg/kg. Fig. 19A is a bar graph showing total flow 6 hours after administration. The numbers above each column indicate the level of expression relative to MC3. Fig. 19B shows total flux values at 3 hours, 6 hours and 24 hours after administration. Numbers 1-12 in the figures denote compositions containing the following: 1: PBS, 2: MC3, 3: Compound 25, 4: Compound 30, 5: Compound 20, 6: Compound 110, 7: Compound 112, 8: Compound 113, 9: Compound 72, 10: Compound 75, 11: Compound 122, 12: Compound 24.

[0059] FIG. 20A-20C are a series of graphs showing the levels of luciferase expression in the liver (Fig. 20A) spleen (Fig. 20B) and (Fig. 20C) at the ex vivo injection site, 24 hours after administration of CD-1 to mice with nanoparticle compositions containing compounds according to this invention. Total flux values were obtained using luminescent body imaging (BLI). PBS (sodium phosphate buffer) was used as a control. Numbers 1-12 in the figures denote compositions containing the following: 1: PBS, 2: MC3, 3: Compound 25, 4: Compound 30, 5: Compound 20, 6: Compound 110, 7: Compound 112, 8: Compound 113, 9: Compound 72, 10: Compound 75, 11: Compound 122, 12: Compound 24.

[0060] FIG. 21A-21J are a series of graphs showing cytokine expression induced by compositions containing lipids of this disclosure. Fig. 21A: G-CSF (12); Fig. 21B: IFN-gamma (38); Fig. 21C: MCP-1 (51); Fig. 21D: IFN-alpha (30); Fig. 21E: IL-6 (28); Fig. 21F: IL-12p70 (39); Fig. 21G: IL-10 (22); Fig. 21H: MIP-1 beta (72); Fig. 21I: TNF-alpha (45); Fig. 21J: RANTES (44). Numbers 1-12 in the figures denote compositions containing the following: 1: PBS, 2: MC3, 3: Compound 25, 4: Compound 30, 5: Compound 20, 6: Compound 110, 7: Compound 112, 8: Compound 113, 9: Compound 72, 10: Compound 75, 11: Compound 122, 12: Compound 24.

[0061] FIG. 22A-22C are a series of graphs showing luciferase expression levels at 3 hours (FIG. 22A), 6 hours (FIG. 22B), and 24 hours (FIG. 22C) after subcutaneous administration of nanoparticulate compositions containing compounds of the invention to mice. Total flux values were obtained using luminescent body imaging (BLI). PBS (sodium phosphate buffer) was used as a control. Numbers 1-12 in the figures denote compositions containing the following: 1: PBS, 2: MC3, 3: Compound 168, 4: Compound 23, 5: Compound 19, 6: Compound 108, 7: Compound 109, 8: Compound 111, 9: Compound 60, 10: Compound 61, 11: Compound 69, 12: Compound 128.

[0062] In FIG. Figure 23 shows the results of hEPO expression measured by subcutaneous administration of various compositions of nanoparticles containing compounds of disclosure to mice at a dose of 0.05 mg/kg at various time points: 3 hours (left block), 6 hours (middle block) and 24 hours (right block). block). Numbers 1-11 in this figure correspond to MC3, PBS, and compounds 18, 25, 48, 49, 111, 60, 168, 207, and 233, respectively.

[0063] In FIG. Figure 24 shows the results of luciferase expression measured by intramuscular administration to mice of various compositions of nanoparticles containing compounds by opening at a dose of 0.01 mg/kg at various time points: 3 hours (left block), 6 hours (middle block) and 24 hours (right block). block). Numbers 1-9 in this figure correspond to MC3 and compounds 178, 181, 182, 218, 198, 200, 233 and 239, respectively.

[0064] In FIG. 25 shows the results of hEPO expression measured at 3 h, 6 h and 24 h after administration, when CD-1 mice were administered intravenously with nanoparticle compositions containing compound 18 or MC3 and modified mRNAs in which each uridine was replaced by N1-methyl pseudouridine. or in which each uridine has been replaced by 5-methoxyuridine, at a dose of 0.5 mg/kg. Numbers 1-4 in the figure denote compositions containing the following: 1: Modified mRNAs in which each uridine is replaced by 5-methoxyuridine and MC3; 2: Modified mRNAs in which each uridine is replaced by N1-methyl pseudouridine, and MC3; 3: Modified mRNAs in which each uridine is replaced by 5-methoxyuridine and compound 18; 4: Modified mRNAs in which each uridine is replaced by N1-methyl pseudouridine and compound 18.

[0065] FIG. 26 is a graph showing B cell activation in mouse splenocytes injected with nanoparticle formulations containing Compound 18 or MC3 and modified mRNAs in which each uridine was replaced with N1-methyl pseudouridine or in which each uridine was replaced with 5- methoxyuridine. PBS was used as a control. Numbers 1-5 in the figure denote compositions containing the following: 1: Modified mRNAs in which each uridine is replaced by 5-methoxyuridine and MC3; 2: Modified mRNAs in which each uridine is replaced by N1-methyl pseudouridine, and MC3; 3: Modified mRNAs in which each uridine is replaced by 5-methoxyuridine and compound 18; 4: Modified mRNAs in which each uridine is replaced by N1-methyl pseudouridine and compound 18; 5: PBS.

[0066] FIG. 27 is a graph showing hEPO mRNA expression in CD1 mice measured at 3 hours (left panel), 6 hours (middle panel), and 24 hours (right panel) after subcutaneous administration of various nanoparticle formulations at a dose of 0.5 mg/kg. Numbers 1-9 referring to compositions containing mRNA expressing hEPO are as follows: 1: PBS, 2: Compound 18, 3: Compound 30, 4: Compound 96, 5: Compound 151, 6: Compound 98, 7: Compound 163, 8: Compound 164, 9: Compound 165.

[0067] FIG. 28A-28J are a series of graphs showing cytokine expression induced by compositions containing the lipids of this disclosure and modified mRNA expressing hEPO in which each uridine has been replaced with N1-methyl pseudouridine measured 6 hours after subcutaneous administration to CD-1 mice. Fig. 28A: G-CSF; Fig. 28B: IFN-gamma; Fig. 28C: IFN-alpha; Fig. 28D: IL-12p70; Fig. 28E: IP-10; F: IL-6; Fig. 28G: MCP-1; Fig. 28H: MIP-1 beta; Fig. 28I: RANTES; Fig. 28J: TNF-alpha. Numbers 1-9 in the figure denote compositions containing the following: 1: PBS, 2: Compound 18, 3: Compound 30, 4: Compound 96, 5: Compound 151, 6: Compound 98, 7: Compound 163, 8: Compound 164 , 9: Compound 165.

[0068] FIG. 29A-29C are a series of graphs illustrating the optimization of aminolipid efficacy and clearance. On FIG. 29A shows whole body luciferase bioluminescence of novel LNPs versus LNP MC3 measured in CD-1 mice (n=6) 6 hours after intravenous administration of 0.5 mg/kg hEPO mRNA into lipid. The graph shows serum hEPO concentrations; error bars indicate the standard deviation of the ratio of new lipid expression to MC3 expression. *p < 0.05, **p < 0.01, ***p < 0.001, n.s. = is not statistically significant. Numbers 1-9 referring to compositions containing: 1: Compound 281, 2: Compound 138, 3: Compound 136, 4: Compound 6, 5: Compound 18, 6: Compound 29, 7: Compound 14, 8: Compound 25 and 9: Connection 26. FIG. 29B shows Compound 18 and Compound 25 levels versus MC3 measured in liver tissue of Sprague Dawley rats (n=3 at each time point) dosed with 0.2 mg/kg LNP containing hEPO mRNA. p<0.05 for Compound 18 and Compound 25 AUC relative to MC3. Fig. 29C is a graph showing hEPO expression in Sprague-Dawley rats. Serum hEPO concentrations were measured following an intravenous dose of 1 mg/kg LNP containing Compound 18, Compound 25, Compound 26, or MC3 and hEPO mRNA (n=3).

[0069] FIG. 30A-30C are a series of graphs showing the pharmacokinetic and expression profile of Compound 18 after multiple doses. On FIG. 30A shows a comparison of tissue distribution of MC3 and Compound 18 after intravenous administration of three bolus doses containing 0.05 mg/kg mRNA to CD-1 mice (n=3 at each time point) given weekly. On FIG. 30B shows serum hEPO concentration 6 hours after intravenous administration of bolus doses containing 0.5 mg/kg LNP containing hEPO mRNA to CD-1 mice (n=8) given weekly. On FIG. 30C illustrates the liver tissue clearance of compound 18 and its major metabolite, compound 166, after weekly doses containing 0.25 mg/kg mRNA (n=3 at time point) in CD-1 mice.

[0070] FIG. 31A-31C are a series of graphs showing the expression profile for lipid nanoparticles of the invention in a cynomolgus monkey study. On FIG. 31A shows serum hEPO concentrations following delivery of 0.01 mg/kg hEPO mRNA in MC3 or Compound 18. Liquid nanoparticles were administered intravenously by infusion over 60 min (n=3). p<0.05 for Compound 18 AUC relative to MC3. On FIG. 31B shows serum concentrations of human IgG antibody against influenza A after delivery of 0.3mg/kg into LNP of mRNA of MC3 antibody or Compound 18 administered intravenously by infusion over 60 minutes (n=3), p<0.05 for AUC. connection 18 relative to MC3. On FIG. 31C shows serum hEPO concentrations following delivery of 0.2 mg/kg hEPO mRNA Compound 18, weekly dosing intravenously, by infusion over 60 minutes into the LNP (n=4).

[0071] FIG. 32A-32C are a series of graphs showing the results of a one-month toxicological assessment in rats and non-human primates. PBS (sodium phosphate buffer) was used as a control. On FIG. 32A shows serum levels of alanine aminotransferase in Sprague-Dawley rats administered intravenously by infusion over 10 minutes administered weekly for 5 weeks. Serum levels were measured 24 hours after the fifth dose (n=10). No statistical difference was observed between PBS and each dose level. On FIG. 32B shows serum levels of aspartate aminotransferase in Sprague-Dawley rats administered intravenously by infusion over 10 minutes, weekly for 5 weeks. Serum levels were measured 24 hours after the fifth dose (n=10). * p < 0.05, no statistical difference was observed between PBS and doses of 0.05 and 2.0 mg/kg. On FIG. 32C shows serum alanine aminotransferase levels in cynomolgus monkeys treated with 1 mg/kg mRNA intravenously by infusion over 60 minutes administered weekly. Serum levels were measured 24 hours after the fifth dose (n=4). No statistical difference was observed between PBS and Compound 18 levels pre-dose and on day 30. On FIG. 32D shows serum levels of aspartate aminotransferase in cynomolgus monkeys treated with 1 mg/kg mRNA intravenously by infusion over 60 minutes administered weekly. Serum levels were measured 24 hours after the fifth dose (n=4). No statistical difference was observed between PBS and Compound 18 levels pre-dose and on day 30.

[0072] FIG. 33A and 33B are a pair of graphs showing the results of a one-month toxicological assessment in rats and non-human primates. On FIG. 33A shows serum C5b9 concentration in cynomolgus monkeys injected with 1 mg/kg mRNA on days 1 and 29 (n=4). No statistical difference was found between PBS and Compound 18 at all time points. On FIG. 33B shows the serum concentration of MCP-1 in cynomolgus monkeys injected with 1 mg/kg mRNA on days 1 and 29. n=4, * p < 0.05, no statistical difference was observed between PBS and Compound 18 at any other time point.

[0073] FIG. 34A-34C are a series of images of the endosomal release efficiency of the lipid nanoparticles of this invention in fixed cells. HeLa cells were transfected with LNP MC3 and Compound 18 encapsulating luciferase mRNA, which were labeled with rhodamine and treated for single molecule FISH (fluorescence in situ hybridization) (smFISH, red) after 4 hours incubation along with cells electroporated with unformed mRNA. The mRNA molecules that release endocytic organelles into the cytosol are shown in green (image analysis overlay). Endosomal yield efficiency was assessed by calculating the ratio between the amount of cytosolic mRNA and the amount of internalized LNP per cell. Fig. 34A is an image showing electroporated HeLa cells. Fig. 34B is an image showing HeLa cells treated with MC3. Fig. 34B is an image showing HeLa cells treated with Compound 18.

[0074] FIG. 35A and 35B are a pair of graphs comparing tissue distribution of MC3 and Compound 18. On FIG. 35A shows tissue distribution of MC3 and Compound 18 after three intravenous injections of 0.05 mg/kg mRNA administered to CD-1 mice (n=3 at each time point). On FIG. 35B shows tissue distribution of MC3 and Compound 18 12 hours after 0.2 mg/kg mRNA administration to cynomolgus monkeys (n=2).

[0075] FIG. 36 is a graph illustrating the expression of human IgG in a cynomolgus monkey that was injected with 0.1 mg/kg of human IgG mRNA in a composition containing MC3 or Compound 18 intravenously by infusion over 60 minutes (n=3).

[0076] FIG. 37 is a series of graphs illustrating single MC3 cell necrosis in rat liver and liver enzyme. The top row is a pair of liver images of rats injected with 0.3mg/kg mRNA-free liquid nanoparticle (LNP) (right) and PBS (sodium phosphate buffer) as control (left). The bottom row is a pair of graphs showing the expression of ALT (left) and AST (right) in the liver after administration of 0.3 mg/kg LNP based on MC3 containing mRNA. ALT and AST were elevated and the pathology showed signs of necrosis.

[0077] FIG. 38 is a graph showing mRNA levels in NHP after repeated dosing for 29 days.

[0078] FIG. 39A and 39B are a pair of graphs showing hEPO expression in ApoE knockout mice and LDLr knockout mice treated with Compound 18-based LNP. FIG. 39A shows hEPO expression in ApoE knockout mice. On FIG. 39B shows hEPO expression in LDLr knockout mice.

DETAILED DESCRIPTION OF THE INVENTION

[0079] This invention relates to novel compositions of lipids and lipid nanoparticles, including a new lipid. The invention also provides methods for delivering a therapeutic and/or prophylactic agent to a mammalian cell, in particular delivering a therapeutic and/or prophylactic agent to a mammalian organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof. For example, a method for producing a polypeptide of interest in a cell includes contacting a nanoparticle composition comprising an mRNA with a mammalian cell, whereby the mRNA can be self-translated to produce the polypeptide of interest. A method for delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ may include administering a nanoparticle composition comprising the therapeutic and/or prophylactic agent to a subject, wherein the administration comprises contacting the cell or organ with the composition, whereby the therapeutic and/or the prophylactic agent is delivered to a cell or organ.

Lipids

[0080] This invention relates to lipids containing a central amine moiety and at least one biodegradable group. The lipids described herein can advantageously be used in lipid nanoparticle compositions to deliver therapeutic and/or prophylactic agents to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, a lipid compound of any formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) has lower immunogenicity than a reference lipid (eg MC3, KC2 or DLinDMA). For example, a composition containing a lipid described herein and a therapeutic or prophylactic agent has an increased therapeutic index compared to a corresponding composition that contains a reference lipid (eg, MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

[0081] In the first aspect of this invention, the compounds described herein have the formula (I):

or their N-oxide, or their salt, or their isomer, where

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q ,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, heterocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC (O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R) ₂ , -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ ) N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R , -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(= NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C (O)N(R)OR and -C(R)N(R) ₂ C(O)OR, each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- ,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and

C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and

C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13; and wherein when R ₄ is -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR or CQ(R) ₂ then (i) Q is not -N(R) ₂ when n is 1, 2, 3, 4 or 5, or (ii) Q is not 5, 6 or 7 membered heterocycloalkyl when n is 1 or 2.

[0082] Another aspect of this invention relates to compounds of formula (III):

or its N-oxide,

or its salt, or its tautomer, where:

or its salt, or its tautomer, where:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of hydrogen, C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q ,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, heterocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC (O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R) ₂ , N(R)R ₈ , - N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N (R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C( O)N(R)OR and -C(R)N(R) ₂ C(O)OR, each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5;

R _x is selected from the group consisting of C _1-6 alkyl, C _2-6 alkenyl, -(CH ₂ ) _r OH and -(CH ₂ ) _r NR ₂ ,

where r is selected from 1, 2, 3, 4, 5 and 6;

each R ₅ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of OH, C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group, in which M'' represents a bond, C _1-13 alkyl or C _2-13 alkenyl;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

R ₁₀ is selected from the group consisting of H, OH, C _1-3 alkyl and C _2-3 alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, (CH ₂ ) _q OR* and H,

and each q is independently selected from 1, 2 and 3;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-15 alkyl and

C _3-15 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and

C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0083] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (IA):

or their N-oxide, or their salt, or their isomer, where l is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9; M ₁ is a bond or M'; R ₄ is hydrogen, unsubstituted C _1-3 alkyl, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q or -(CH ₂ ) _n Q, where Q is OH, -NHC( S)N(R) ₂ , -NHC(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)R ₈ , -NHC(=NR ₉ )N(R) ₂ , -NHC(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR,

heteroaryl or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group,; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl and C _2-14 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R) ₂ or -NHC(O)N(R) ₂ . For example, Q is -N(R)C(O)R or -N(R)S(O) ₂ R.

[0084] In specific embodiments, a subset of compounds of formula (I) includes compounds of formula (IB):

or its N-oxide, or its salt, or isomer, in which all variables have the meanings defined in this document. For example, m is selected from 5, 6, 7, 8 and 9; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl and C _2-14 alkenyl. For example, m is 5, 7, or 9. In specific embodiments, the subset of compounds of formula (I) includes compounds of formula (II):

or its N-oxide, or its salt, or its isomer, where l is selected from 1, 2, 3, 4 and 5; M ₁ is a bond or M'; R ₄ is hydrogen, unsubstituted C _1-3 alkyl, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q or -(CH ₂ ) _n Q, wherein n is 2, 3 or 4 and Q is OH, -NHC(S)N(R) ₂ , -NHC(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)R ₈ , -NHC(=NR ₉ )N(R) ₂ , -NHC(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R) C(O)OR,

heteroaryl or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl and C _2-14 alkenyl.

[0085] The compounds of any formula (I) or (IA) include one or more of the following features, if applicable.

[0086] In some embodiments, M ₁ is M'.

[0087] In some embodiments, M and M' are independently C(O)O- or -OC(O)-.

[0088] In some embodiments, at least one of M and M' is C(O)O- or -OC(O)-.

[0089] In specific embodiments, at least one of M and M' is -OC(O)-.

[0090] In specific embodiments, M is -OC(O)- and M' is -C(O)O-. In some embodiments, M is -C(O)O- and M' is -OC(O)-. In particular embodiments, M and M' are each -OC(O)-. In some embodiments, M and M' are each -C(O)O-.

[0091] In specific embodiments, at least one of M and M' is -OC(O)-M''-C(O)O-.

[0092] In some embodiments, M and M' are independently -S-S-.

[0093] In some embodiments, at least one of M and M' is -S-S.

[0094] In some embodiments, one of M and M' is C(O)O- or -OC(O)- and the other is -S-S-. For example, M is C(O)O- or -OC(O)- and M' is -S-S- or M' is C(O)O- or -OC(O)- and M is -S-S -

[0095] In some embodiments, one of M and M' is -OC(O)-M''-C(O)O-, where M'' is a bond, C _1-13 alkyl, or C _{2- 13} alkenyl. In other embodiments, M'' is C _1-6 alkyl or C _2-6 alkenyl. In specific embodiments, M'' is C _1-4 alkyl or C _2-4 alkenyl.

[0096] In some embodiments, m is 1, 3, or 5.

[0097] In some embodiments, R ₄ is hydrogen.

[0098] In some embodiments, R ₄ is hydrogen.

[0099] In some embodiments, R ₄ is unsubstituted methyl or -(CH ₂ ) _n Q, wherein Q is OH, -NHC(S)N(R) ₂ , -NHC(O)N(R) ₂ , -N(R)C(O)R or -N(R)S(O) ₂ R.

[00100] In some embodiments, Q is OH.

[00101] In some embodiments, Q is -NHC(S)N(R) ₂ .

[00102] In some embodiments, Q is -NHC(O)N(R) ₂ .

[00103] In some embodiments, Q is -N(R)C(O)R.

[00104] In some embodiments, Q is -N(R)S(O) ₂ R.

[00105] In some embodiments, Q is -O(CH ₂ ) _n N(R) ₂ .

[00106] In some embodiments, Q is -O(CH ₂ ) _n OR.

[00107] In some embodiments, Q is -N(R)R ₈ .

[00108] In some embodiments, Q is -NHC(=NR ₉ )N(R) ₂ .

[00109] In some embodiments, Q is -NHC(=CHR ₉ )N(R) ₂ .

[00110] In some embodiments, Q is -OC(O)N(R) ₂ .

[00111] In some embodiments, Q is -N(R)C(O)OR.

[00112] In some implementations, n is 2.

[00113] In some implementations, n is 3.

[00114] In some implementations, n is 4.

[00115] In some embodiments, M ₁ is missing.

[00116] In some embodiments, at least R ₅ is hydroxyl. For example, one R ₅ is hydroxyl.

[00117] In some embodiments, at least R ₆ is hydroxyl. For example, one R ₆ is hydroxyl.

[00118] In some embodiments, one of R ₅ and R ₆ is hydroxyl. For example, one R ₅ is hydroxyl and each R ₆ is hydrogen. For example, one R ₆ is hydroxyl and each R ₅ is hydrogen.

[00119] In some embodiments, R _x is C _1-6 alkyl. In some embodiments, R _x is C _1-3 alkyl. For example, R _x is methyl. For example, R _x is ethyl. For example, R _x is propyl.

[00120] In some embodiments, R _x is -(CH ₂ ) _r OH and r is 1, 2, or 3. For example, R _x is methanol. For example, R _x is ethanol. For example, R _x is propanoyl.

[00121] In some embodiments, R _x is -(CH ₂ ) _r NR ₂ , r is 1, 2, or 3, and each R is H or methyl. For example, R _x is methanamino, methylmethanamino, or dimethylmethanamino. For example, R _x is aminomethanyl, methylaminomethanyl, or dimethylaminomethanyl. For example, R _x is aminoethanyl, methylaminoethanyl, or dimethylaminoethanyl. For example, R _x is aminopropanyl, methylaminopropanyl, or dimethylaminopropanyl.

[00122] In some embodiments, R' is C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', or -YR''.

[00123] In some embodiments, R ₂ and R ₃ are independently C _3-14 alkyl or C _3-14 alkenyl.

[00124] In one embodiment, compounds of formula (I) have formula (IIa),

or their N-oxides, or their salts, or their isomers, where R ₄ is as described herein.

[00125] In another embodiment, compounds of formula (I) have formula (IIb),

or their N-oxides, or their salts, or their isomers, where R ₄ is as described herein.

[00126] In another embodiment, compounds of formula (I) have formula (IIc) or (IIe):

or their N-oxides, or their salts, or their isomers, where R ₄ is as described herein.

[00127] In another embodiment, compounds of formula (I) have formula (IIf):

or their N-oxides, or their salts, or their isomers.

where M is -C(O)O- or -OC(O)-, M'' is C _1-6 alkyl or C _2-6 alkenyl, R ₂ and R ₃ are independently selected from the group consisting of C _{5 -14} alkyl and C _5-14 alkenyl, and n is selected from 2, 3 and 4.

[00128] In an additional embodiment, the compounds of formula (I) have formula (IId),

or their N-oxides, or their salts, or their isomers, where n is 2, 3 or 4; and m, R', R'' and R ₂ to R ₆ are described herein. For example, each of R ₂ and R ₃ can be independently selected from the group consisting of C _5-14 alkyl and C _5-14 alkenyl.

[00129] In an additional embodiment, the compounds of formula (I) have formula (IIg),

or their N-oxides, or their salts, or their isomers, where l is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9; M ₁ is a bond or M'; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M''-C(O)O-, -C(O)N(R')- , -P(O)(OR')O-, -SS-, aryl group and heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl and C _2-14 alkenyl. For example, M'' is C _1-6 alkyl (eg C _1-4 alkyl) or C _2-6 alkenyl (eg C _2-4 alkenyl). For example, R ₂ and R ₃ are independently selected from the group consisting of C _5-14 alkyl and C _5-14 alkenyl.

[00130] Compounds of any of formulas (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) and (III) include one or more of the following features, if applicable.

[00131] In some embodiments, R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q, -CHQR and -CQ(R) ₂ where Q is selected from

C _3-6 carbocycle, 5-14 membered aromatic or non-aromatic heterocycle having one or more

heteroatoms selected from N, O, S and P, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ ,

-CX ₂ H, -CXH ₂ , -CN, -N(R) ₂ , -N(R)S(O) ₂ R ₈ , -C(O)N(R) ₂ , -N(R)C( O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ ,

-N(R)C(S)N(R) ₂ and -C(R)N(R) ₂ C(O)OR, where each o is independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5.

[00132] In another embodiment, R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ ( CH ₂ ) _no Q, -CHQR and -CQ(R) ₂ where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O and S, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N( R) ₂ , -N(R)S(O) ₂ R ₈ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N (R) ₂ , -N(R)C(S)N(R) ₂ , -C(R)N(R) ₂ C(O)OR, and 5-14 membered heterocycloalkyl having one or more heteroatoms, selected from N, O and S which are substituted with one or more substituents selected from oxo (=O), OH, amino and C _1-3 alkyl, each o being independently selected from 1, 2, 3 and 4 and each n being independently choose from 1, 2, 3, 4 and 5.

[00133] In another embodiment, R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ ( CH ₂ ) _no Q, -CHQR and -CQ(R) ₂ where Q is selected from C _3-6 carbocycle, 5-14 membered heterocycle having one or more heteroatoms selected from N, O and S, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N( R) ₂ , -N(R)S(O) ₂ R ₈ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N (R) ₂ , -N(R)C(S)N(R) ₂ , -C(R)N(R) ₂ C(O)OR, each o being independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5; and when Q is a 5-14 membered heterocycle and (i) R ₄ is -(CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is -(CH ₂ ) _n CHQR in which n is 1, or (iii) R ₄ is CHQR and -CQ(R) ₂ then Q is both 5-14 membered heteroaryl or 8-14 membered heterocycloalkyl.

[00134] In another embodiment, R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -(CH ₂ ) _o C(R ₁₀ ) ₂ ( CH ₂ ) _no Q, -CHQR and -CQ(R) ₂ where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O and S, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N( R) ₂ , -N(R)S(O) ₂ R ₈ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N (R) ₂ , -N(R)C(S)N(R) ₂ , -C(R)N(R) ₂ C(O)OR, each o being independently selected from 1, 2, 3 and 4 and each n is independently selected from 1, 2, 3, 4 and 5.

[00135] In another embodiment, R ₄ is -(CH ₂ ) _n Q, where Q is -N(R)S(O) ₂ R ₈ and n is selected from 1, 2, 3, 4 and 5. In a further embodiment, R ₄ is -(CH ₂ ) _n Q, where Q is -N(R)S(O) ₂ R ₈ , wherein R ₈ is a C _3-6 carbocycle such as C _{3 -6} cycloalkyl and n is selected from 1, 2, 3, 4 and 5. For example, R ₄ is -(CH ₂ ) ₃ NHS(O) ₂ R ₈ and R ₈ is cyclopropyl.

[00136] In another embodiment, R ₄ is -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q, where Q is -N(R)C(O)R, where n is selected from 1, 2, 3, 4 and 5 and o is selected from 1, 2, 3 and 4. In an additional embodiment, R ₄ is -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q, where Q is -N(R)C(O)R where R is C ₁ -C ₃ alkyl and n is selected from 1, 2, 3, 4 and 5 and o is selected from 1, 2, 3 and 4. B in another embodiment, R ₄ is -(CH ₂ ) _o C(R ₁₀ ) ₂ (CH ₂ ) _no Q, where Q is -N(R)C(O)R, where R is C ₁ -C ₃ alkyl, where n is 3 and o is 1. In some embodiments, R ₁₀ is H, OH, C _1-3 alkyl, or C _2-3 alkenyl. For example, R ₄ is 3-acetamido-2,2-dimethylpropyl.

[00137] In some embodiments, one R ₁₀ is H and one R ₁₀ is C _1-3 alkyl or C _2-3 alkenyl. In another embodiment, each R ₁₀ is C _1-3 alkyl or C _2-3 alkenyl. In another embodiment, each R ₁₀ is C _1-3 alkyl (eg methyl, ethyl or propyl). For example, one R ₁₀ is methyl and one R ₁₀ is ethyl or propyl. For example, one R ₁₀ is ethyl and one R ₁₀ is methyl or propyl. For example, one R ₁₀ is propyl and one R ₁₀ is methyl or ethyl. For example, each R ₁₀ is methyl. For example, each R ₁₀ is ethyl. For example, each R ₁₀ is propyl.

[00138] In some embodiments, one R ₁₀ is H and one R ₁₀ is OH. In another embodiment, each R ₁₀ is OH.

[00139] In another embodiment, R ₄ is unsubstituted C _1-4 alkyl, eg unsubstituted methyl.

[00140] In another embodiment, R ₄ is hydrogen.

[00141] In specific embodiments, the specification provides a compound of formula (I) wherein R ₄ is -(CH ₂ ) _n Q or -(CH ₂ ) _n CHQR, where Q is -N(R) ₂ and n is selected from 3, 4 and 5.

[00142] In specific embodiments, the specification provides a compound of formula (I) wherein R ₄ is selected from the group consisting of -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR, and -CQ(R) ₂ where Q is -N(R) ₂ and n is selected from 1, 2, 3, 4 and 5.

[00143] In specific embodiments, the specification provides a compound of formula (I) wherein R ₂ and R ₃ are independently selected from the group consisting of C _2-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR '' and -R*OR'' or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle and R ₄ is -(CH ₂ ) _n Q or -(CH ₂ ) _n CHQR, where Q is -N(R) ₂ and n is selected from 3, 4 and 5.

[00144] In specific embodiments, R ₂ and R ₃ are independently selected from the group consisting of C _2-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'' or R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle.

[00145] In some embodiments, R ₁ is selected from the group consisting of C _5-20 alkyl and C _5-20 alkenyl.

[00146] In other embodiments, R ₁ is selected from the group consisting of -R*YR'', -YR'' and -R''M'R'.

[00147] In specific embodiments, R ₁ is selected from -R*YR'' and -YR''. In some embodiments, Y is a cyclopropyl group. In some embodiments, R* is C ₈ alkyl or C ₈ alkenyl. In specific embodiments, R'' is C _3-12 alkyl. For example, R'' may be C ₃ alkyl. For example, R'' may be C _4-8 alkyl (eg, C ₄ , C ₅ , C ₆ , C ₇ , or C ₈ alkyl).

[00148] In some embodiments, R is (CH ₂ ) _q OR*, wherein q is selected from 1, 2, and 3, and R* is C _1-12 alkyl substituted with one or more substituents selected from the group consisting of amino, C ₁ -C ₆ alkylamino and C ₁ -C ₆ dialkylamino. For example, R is (CH ₂ ) _q OR*, where q is selected from 1, 2 and 3 and R* is C _1-12 alkyl substituted with C ₁ -C ₆ dialkylamino. For example, R is (CH ₂ ) _q OR*, where q is selected from 1, 2 and 3 and R* is C _1-3 alkyl substituted with C ₁ -C ₆ dialkylamino. For example, R is (CH ₂ ) _q OR*, q is selected from 1, 2, and 3, and R* is C _1-3 alkyl substituted with dimethylamino (eg, dimethylaminoethanyl).

[00149] In some embodiments, R ₁ is C _5-20 alkyl. In some embodiments, R ₁ is C ₆ alkyl. In some embodiments, R ₁ is C ₈ alkyl. In other embodiments, R ₁ is C ₉ alkyl. In certain embodiments, R ₁ is C ₁₄ alkyl. In other embodiments, R ₁ is C ₁₈ alkyl.

.[00150] In some embodiments, R ₁ is C _21-30 alkyl. In some embodiments, R ₁ is C ₂₆ alkyl. In some embodiments, R ₁ is C ₂₈ alkyl. In specific embodiments, R ₁ is

.

[00151] In some embodiments, R ₁ is C _5-20 alkenyl. In specific embodiments, R ₁ is C ₁₈ alkenyl. In some embodiments, R ₁ is linoleoyl.

[00152] In specific embodiments, R ₁ is branched (e.g., decan-2-yl, undecan-3-yl, dodecan-4-yl, tridecan-5-yl, tetradecan-6-yl, 2-methylundecan-3- yl, 2-methyldecan-2-yl, 3-methylundecan-3-yl, 4-methyldodecan-4-yl or heptadeca-9-yl). In specific embodiments, R ₁ is

[00153] In specific embodiments, R ₁ is unsubstituted C _5-20 alkyl or C _5-20 alkenyl. In specific embodiments, R' is a substituted C _5-20 alkyl or C _5-20 alkenyl (eg, substituted with a C _3-6 carbocycle, such as 1-cyclopropylnonyl, or substituted with OH or alkoxy). For example, R ₁ is

, где x равно целому числу между 1 и 13 (например, выбрано из 3, 4, 5 и 6), s равно целому числу между 1 и 13 (например, выбрано из 1, 2 и 3) и t равно целому числу между 2 и 14 (например, выбрано из 4, 5 и 6). Например, x выбирают из 3, 4, 5 и 6, s выбирают из 1, 2 и 3 и t выбирают из 4, 5 и 6.[00154] In other embodiments, R ₁ is -R''M'R'. In particular embodiments, M' is -OC(O)-M''-C(O)O-. For example, R ₁ is

, where x is an integer between 1 and 13 (e.g., selected from 3, 4, 5, and 6), s is an integer between 1 and 13 (e.g., chosen from 1, 2, and 3), and t is an integer between 2 and 14 (eg, selected from 4, 5, and 6). For example, x is selected from 3, 4, 5, and 6, s is selected from 1, 2, and 3, and t is selected from 4, 5, and 6.

[00155] In other embodiments, R ₁ is different from -(CHR ₅ R ₆ ) _m -M-CR ₂ R ₃ R ₇ .

[00156] In some embodiments, R' is selected from -R*YR'' and -YR''. In some embodiments, Y is C _3-8 cycloalkyl. In some embodiments, Y is C _6-10 aryl. In some embodiments, Y is a cyclopropyl group. In some embodiments, Y is a cyclohexyl group. In specific embodiments, R* is C ₁ alkyl.

[00157] In some embodiments, R'' is selected from the group consisting of C _3-12 alkyl and C _3-12 alkenyl. In some embodiments, the R'' adjacent to Y is C ₁ alkyl. In some embodiments, R'' adjacent to Y is C _4-9 alkyl (eg, C ₄ , C ₅ , C ₆ , C ₇ or C ₈ or C ₉ alkyl).

.[00158] In some embodiments, R'' is substituted C _3-12 (eg, C _3-12 alkyl substituted, eg, hydroxyl). For example, R'' represents

.

[00159] In some embodiments, R' is selected from C ₄ alkyl and C ₄ alkenyl. In specific embodiments, R' is selected from C ₅ alkyl and C ₅ alkenyl. In some embodiments, R' is selected from C ₆ alkyl and C ₆ alkenyl. In some embodiments, R' is selected from C ₇ alkyl and C ₇ alkenyl. In some embodiments, R' is selected from C ₉ alkyl and C ₉ alkenyl.

или

. В некоторых вариантах осуществления, R' представляет собой

или

и M' представляет собой-OC(O)-. В других вариантах осуществления, R' представляет собой

или

и M' представляет собой -C(O)O-.[00160] In some embodiments, R' is

or

. In some embodiments, R' is

or

and M' is -OC(O)-. In other embodiments, R' is

or

and M' is -C(O)O-.

[00161] In other embodiments, R' is selected from C ₁₁ alkyl and C ₁₁ alkenyl. In other embodiments, R' is selected from C ₁₂ alkyl, C ₁₂ alkenyl, C ₁₃ alkyl, C 13 alkenyl, C ₁₄ alkyl, C ₁₄ alkenyl, C ₁₅ alkyl, _{C 15 alkenyl} , C ₁₆ alkyl, C ₁₆ alkenyl, C ₁₇ alkyl, C ₁₇ alkenyl, C ₁₈ alkyl and C ₁₈ alkenyl. In specific embodiments, R' is linear C _4-18 alkyl or C _4-18 alkenyl. In specific embodiments, R' is branched (e.g., decan-2-yl, undecan-3-yl, dodecan-4-yl, tridecan-5-yl, tetradecan-6-yl, 2-methylundecan-3-yl, 2 -methyldecan-2-yl, 3-methylundecan-3-yl, 4-methyldodecan-4-yl or heptadeca-9-yl). In specific embodiments, R' is

или

[00162] In specific embodiments, R' is unsubstituted C _1-18 alkyl. In specific embodiments, R' is a substituted C _1-18 alkyl (e.g., C _1-15 alkyl substituted with, e.g., alkoxy, such as methoxy, or a C _3-6 carbocycle, such as 1-cyclopropylnonyl, or C(O )O-alkyl or OC(O)-alkyl such as C(O)OCH ₃ or OC(O)CH ₃ ). For example, R' is

or

.[00163] In specific embodiments, R' is branched C _1-18 alkyl. For example, R' is

.

[00164] In some embodiments, R'' is selected from the group consisting of C _3-15 alkyl and C _3-15 alkenyl. In some embodiments, R'' is C ₃ alkyl, C ₄ alkyl, C ₅ alkyl, C ₆ alkyl, C ₇ alkyl, or C ₈ alkyl. In some embodiments, R'' is C ₉ alkyl, C ₁₀ alkyl, C ₁₁ alkyl, C ₁₂ alkyl, C ₁₃ alkyl, C ₁₄ alkyl, or C ₁₅ alkyl.

[00165] In some embodiments, M' is C(O)O-. In some embodiments, M' is -OC(O)-. In some embodiments, M' is -OC(O)-M''-C(O)O-.

[00166] In other embodiments, M' is an aryl group or a heteroaryl group. For example, M' may be selected from the group consisting of phenyl, oxazole and thiazole.

[00167] In some embodiments, M is C(O)O-. In some embodiments, M is -OC(O)-. In some embodiments, M is C(O)N(R')-. In some embodiments, M is -P(O)(OR')O-. In some embodiments, M is -OC(O)-M''-C(O)O-.

[00168] In other embodiments, M is an aryl group or a heteroaryl group. For example, M may be selected from the group consisting of phenyl, oxazole and thiazole.

[00169] In some embodiments, M is the same as M'. In other embodiments, M is different from M'.

[00170] In some embodiments, L is a bond. In some embodiments, M'' is C _1-13 alkyl or C _2-13 alkenyl. In some embodiments, M'' is C _1-6 alkyl or C _2-6 alkenyl. In specific embodiments, M'' is linear alkyl or alkenyl. In specific embodiments, M'' is branched, eg -CH(CH ₃ )CH ₂ -.

[00171] In some embodiments, each R ₅ is H. In certain embodiments, each R ₆ is also H.

[00172] In some embodiments, R ₇ is H. In other embodiments, R ₇ is C _1-3 alkyl (eg, methyl, ethyl, propyl, or isopropyl).

[00173] In some embodiments, R ₂ and R ₃ are independently C _5-14 alkyl or C _5-14 alkenyl.

[00174] In some embodiments, R ₂ and R ₃ are each H. In some embodiments, R ₂ and R ₃ are C ₈ alkyl. In specific embodiments, R ₂ and R ₃ are C ₂ alkyl. In other embodiments, R ₂ and R ₃ are C ₃ alkyl. In some embodiments, R ₂ and R ₃ are C ₄ alkyl. In specific embodiments, R ₂ and R ₃ are C ₅ alkyl. In other embodiments, R ₂ and R ₃ are C ₆ alkyl. In some embodiments, R ₂ and R ₃ are C ₇ alkyl.

[00175] In some embodiments, R ₂ and R ₃ are different. In certain embodiments, R ₂ is C ₈ alkyl. In some embodiments, R ₃ is C _1-7 (eg, C ₁ , C ₂ , C ₃ , C ₄ , C ₅ , C ₆ or C ₇ alkyl) or C ₉ alkyl.

[00176] In some embodiments, R ₇ and R ₃ are each H.

[00177] In specific embodiments, R ₂ is H.

[00178] In some embodiments, m is 7 or 9.

[00179] In some embodiments, R ₄ is selected from -(CH ₂ ) _n Q and -(CH ₂ ) _n CHQR.

[00180] In some embodiments, Q is selected from the group consisting of -OR, -OH, -O(CH ₂ ) _n N(R) ₂ , -OC(O)R, -CX ₃ , -CN, -N( R)C(O)R, -N(H)C(O)R, -N(R)S(O) ₂ R,

-N(H)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(H)C(O)N(R) ₂ , -N(H)C(O )N(H)(R), -N(R)C(S)N(R) ₂ ,

-N(H)C(S)N(R) ₂ , -N(H)C(S)N(H)(R), -C(R)N(R) ₂ C(O)OR, -N (R)S(O) ₂ R ₈ , carbocycle and heterocycle.

[00181] In specific embodiments, Q is -N(R)R ₈ , -N(R)S(O) ₂ R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ or -N(R)C(O)OR.

[00182] In specific embodiments, Q is -N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C (O)N(R) ₂ , -N(OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ or -N(OR)C(=CHR ₉ )N(R) ₂ .

или -NHC(=NR₉)N(R)₂.[00183] In specific embodiments, Q is thiourea or an isostere thereof, e.g.,

or -NHC(=NR ₉ )N(R) ₂ .

[00184] In specific embodiments, Q is C(=NR ₉ )N(R) ₂ . For example, when Q is C(=NR ₉ )N(R) ₂ , n is 4 or 5. For example, R ₉ is -S(O) ₂ N(R) ₂ .

[00185] In specific embodiments, Q is C(=NR ₉ )R or C(O)N(R)OR, e.g., -CH(=N-OCH ₃ ), -C(O)NH-OH, - C(O)NH-OCH ₃ , -C(O)N(CH ₃ )-OH or C(O)N(CH ₃ )-OCH ₃ .

[00186] In specific embodiments, Q is -OH.

[00187] In specific embodiments, Q is substituted or unsubstituted 5-10 membered heteroaryl, e.g., Q is triazole, imidazole, pyrimidine, purine, 2-amino-1,9-dihydro- 6H- purin-6-one -9-yl-(or guanine-9-yl), adenine-9-yl, cytosin-1-yl or uracil-1-yl, each of which is optionally substituted with one or more substituents selected from alkyl, OH, alkoxy, -alkyl-OH, -alkyl-O-alkyl, and the substituent may be further substituted. In specific embodiments, Q is a substituted 5-14 membered heterocycloalkyl, for example, substituted with one or more substituents selected from oxo (=O), OH, amino, mono- or di-alkylamino, and C _1-3 alkyl. For example, Q is 4-methylpiperazinyl, 4-(4-methoxybenzyl)piperazinyl, isoindolin-2-yl-1,3-dione, pyrrolidin-1-yl-2,5-dione, or imidazolidin-3-yl-2, 4-dione.

[00188] In specific embodiments, Q is -NHR ₈ , wherein R ₈ is C _3-6 cycloalkyl optionally substituted with one or more substituents selected from oxo (=O), amino (NH ₂ ), mono-, or di-alkylamino, C _1-3 alkyl and halogen. For example, R ₈ is cyclobutenyl, eg 3-(dimethylamino)-cyclobut-3-en-4-yl-1,2-dione. In additional embodiments, R ₈ is C _3-6 cycloalkyl optionally substituted with one or more substituents selected from oxo (=O), thio (=S), amino (NH ₂ ), mono- or di-alkylamino, C _{1 -3} alkyl _, heterocycloalkyl and halogen, with mono- or di-alkylamino, C _1-3 alkyl and heterocycloalkyl additionally substituted , one or more of C _1-3 alkoxy, amino, mono- or di-alkylamino, and halo. For example, R ₈ is 3-(((dimethylamino)ethyl)amino)cyclobut-3-enyl-1,2-dione. For example, R ₈ is cyclobutenyl substituted with one or more of oxo and alkylamino. For example, R ₈ is 3-(ethylamino)cyclobut-3-ene-1,2-dione. For example, R ₈ is cyclobutenyl substituted with one or more of oxo, thio and alkylamino. For example, R ₈ is 3-(ethylamino)-4-thioxocyclobut-2-en-1-one or 2-(ethylamino)-4-thioxocyclobut-2-en-1-one. For example, R ₈ is cyclobutenyl substituted with one or more of thio and alkylamino. For example, R ₈ is 3-(ethylamino)cyclobut-3-ene-1,2-dithione. For example, R ₈ is cyclobutenyl substituted with one or more of oxo and dialkylamino. For example, R ₈ is 3-(diethylamino)cyclobut-3-ene-1,2-dione. For example, R ₈ is cyclobutenyl substituted with one or more of oxo, thio and dialkylamino. For example, R ₈ is 2-(diethylamino)-4-thioxocyclobut-2-en-1-one or 3-(diethylamino)-4-thioxocyclobut-2-en-1-one. For example, R ₈ is cyclobutenyl substituted with one or more of thio and dialkylamino. For example, R ₈ is 3-(diethylamino)cyclobut-3-ene-1,2-dithione. For example, R ₈ is cyclobutenyl substituted with one or more oxo and alkylamino or dialkylamino, with the alkylamino or dialkylamino further substituted with, for example, one or more alkoxy. For example, R ₈ is 3-(bis(2-methoxyethyl)amino)cyclobut-3-ene-1,2-dione. For example, R ₈ is cyclobutenyl substituted with one or more of oxo and heterocycloalkyl. For example, R ₈ is cyclobutenyl substituted with one or more of oxo and piperidinyl, piperazinyl, or morpholinyl. For example, R ₈ is cyclobutenyl substituted with one or more of oxo and heterocycloalkyl, with heterocycloalkyl further substituted with, for example, one or more C _1-3 alkyl. For example, R ₈ is cyclobutenyl substituted with one or more of oxo and heterocycloalkyl, wherein the heterocycloalkyl (eg piperidinyl, piperazinyl or morpholinyl) is further substituted with methyl.

[00189] In specific embodiments, Q is -NHR ₈ , wherein R ₈ is heteroaryl optionally substituted with one or more substituents selected from amino (NH ₂ ), mono- or di-alkylamino, C _1-3 alkyl, and halogen. For example, R ₈ is a thiazole or imidazole.

[00190] In specific embodiments, Q is -NHC(=NR ₉ )N(R) ₂ , wherein R ₉ is CN, C _1-6 alkyl, NO ₂ , -S(O) ₂ N(R) ₂ , -OR, -S(O) ₂ R or H. For example, Q is -NHC(=NR ₉ )N(CH ₃ ) ₂ , -NHC(=NR ₉ )NHCH ₃ , -NHC(=NR ₉ ) _NH2 . In some embodiments, Q is -NHC(=NR ₉ )N(R) ₂ , wherein R ₉ is CN and R is C _1-3 alkyl substituted with mono- or di-alkylamino, e.g. R is ((dimethylamino)ethyl)amino. In some embodiments, Q is -NHC(=NR ₉ )N(R) ₂ , wherein R ₉ is C _1-6 alkyl, NO ₂ , -S(O) ₂ N(R) ₂ , -OR, -S(O) ₂ R or H and R is C _1-3 alkyl substituted with mono- or di-alkylamino, eg R is ((dimethylamino)ethyl)amino.

[00191] In specific embodiments, Q is -NHC(=CHR ₉ )N(R) ₂ , wherein R ₉ is NO ₂ , CN, C _1-6 alkyl, -S(O) ₂ N(R) ₂ , -OR, -S(O) ₂ R or H. For example, Q is -NHC(=CHR ₉ )N(CH ₃ ) ₂ , -NHC(=CHR ₉ )NHCH ₃ or -NHC(=CHR ₉ ) _NH2 .

[00192] In specific embodiments, Q is -OC(O)N(R)₂, -N(R)C(O)OR, -N(OR)C(O)OR such as -OC(O)NHCH₃, -N(OH)C(O)OCH₃, -N(OH)C(O)CH₃, -N(OCH₃)C(O)OCH₃, -N(OCH₃)C(O)CH₃, -N(OH)S(O)₂CH₃ or -NHC(O)OCH₃.

[00193] In specific embodiments, Q is -N(R)C(O)R where R is alkyl optionally substituted with C _1-3 alkoxy or S(O) _t C _1-3 alkyl where t is 0, 1, or 2.

[00194] In specific embodiments, Q is unsubstituted or substituted C _6-10 aryl (such as phenyl) or C _3-6 cycloalkyl.

[00195] In some embodiments, n is 1. In other embodiments, n is 2. In additional embodiments, n is 3. In certain other embodiments, n is 4. For example, R ₄ may be -(CH ₂ ) ₂ OH . For example, R ₄ may represent -(CH ₂ ) ₃ OH. For example, R ₄ may represent -(CH ₂ ) ₄ OH. For example, R ₄ may be benzyl. For example, R ₄ may be 4-methoxybenzyl.

[00196] In some embodiments, R ₄ is a C _3-6 carbocycle. In some embodiments, R ₄ is C _3-6 cycloalkyl. For example, R ₄ may be cyclohexyl optionally substituted with, for example, OH, halogen, C _1-6 alkyl, etc. For example, R ₄ may be 2-hydroxycyclohexyl.

[00197] In some embodiments, R is H.

[00198] In some embodiments, R is C _1-3 alkyl substituted with mono- or di-alkylamino, for example, R is ((dimethylamino)ethyl)amino.

[00199] In some embodiments, R is C _1-6 alkyl substituted with one or more substituents selected from the group consisting of C _1-3 alkoxy, amino, and C ₁ -C ₃ dialkylamino.

[00200] In some embodiments, R is unsubstituted C _1-3 alkyl or unsubstituted C _2-3 alkenyl. For example, R ₄ may be -CH ₂ CH(OH)CH ₃ , -CH(CH ₃ )CH ₂ OH, or -CH ₂ CH(OH)CH ₂ CH ₃ .

[00201] In some embodiments, R is a substituted C _1-3 alkyl, eg, CH ₂ OH. For example, R ₄ may be -CH ₂ CH(OH)CH ₂ OH, -(CH ₂ ) ₃ NHC(O)CH ₂ OH, -(CH ₂ ) ₃ NHC(O)CH ₂ OBn, -(CH ₂ ) ₂ O (CH ₂ ) ₂ OH, -(CH ₂ ) ₃ NHCH ₂ OCH ₃ , -(CH ₂ ) ₃ NHCH ₂ OCH ₂ CH ₃ , CH ₂ SCH ₃ , CH ₂ S(O)CH ₃ , CH ₂ S(O) ₂ CH ₃ or -CH(CH ₂ OH) ₂ .

[00202] In some embodiments, R ₄ is selected from any of the following groups:

[00203] In some embodiments, R ₄ is selected from any of the following groups:

.

[00204] In some embodiments, the compound of formula (III) further comprises an anion. As described herein, an anion can be any anion capable of reacting with an amine to form an ammonium salt. Examples include, but are not limited to, chloride, bromide, iodide, fluoride, acetate, formate, trifluoroacetate, difluoroacetate, trichloroacetate, and phosphate.

[00205] In some embodiments, a compound of any of the formulas described herein is suitable for preparing a nanoparticulate composition for intramuscular administration.

[00206] In some embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle. In some embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a 5-14 membered aromatic or non-aromatic heterocycle having one or more heteroatoms selected from N, O, S, and P. In some embodiments, implementation of R ₂ and R ₃ , together with the atom to which they are attached, form an optionally substituted C _3-20 carbocycle (for example, C _3-18 carbocycle, C _3-15 carbocycle, C _3-12 carbocycle, or C _3-10 carbocycle), both aromatic and non-aromatic. In some embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a C _3-6 carbocycle. In other embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a C ₆ carbocycle, such as a cyclohexyl or phenyl group. In specific embodiments, the heterocycle or C _3-6 carbocycle is substituted with one or more alkyl groups (eg, on the same ring atom or on adjacent or non-adjacent atoms). For example, R ₂ and R ₃ , together with the atom to which they are attached, can form a cyclohexyl or phenyl group bearing one or more C ₅ alkyl substituents. In specific embodiments, the heterocycle or C _3-6 carbocycle formed by R ₂ and R ₃ is substituted with carbocyclic groups. For example, R ₂ and R ₃ , together with the atom to which they are attached, can form a cyclohexyl or phenyl group which is substituted with cyclohexyl. In some embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a C _7-15 carbocycle, such as a cycloheptyl, cyclopentadecanyl, or naphthyl group.

[00207] In some embodiments, R ₄ is selected from -(CH ₂ ) _n Q and -(CH ₂ ) _n CHQR. In some embodiments, Q is selected from the group consisting of -OR, -OH, -O(CH ₂ ) _n N(R) ₂ , -OC(O)R,

-CX ₃ , -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O) ₂ R, -N(H)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(H)C(O)N(R) ₂ , -N(R)S(O) ₂ R ₈ , -N(H )C(O)N(H)(R), -N(R)C(S)N(R) ₂ , -N(H)C(S)N(R) ₂ , -N(H)C( S)N(H)(R) and heterocycle. In other embodiments, Q is selected from the group consisting of imidazole, pyrimidine, and purine.

[00208] In some embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a heterocycle or carbocycle. In some embodiments, R ₂ and R ₃ , together with the atom to which they are attached, form a C _3-6 carbocycle, such as a phenyl group. In specific embodiments, the heterocycle or C _3-6 carbocycle is substituted with one or more alkyl groups (eg, on the same ring atom or on adjacent or non-adjacent atoms). For example, R ₂ and R ₃ , together with the atom to which they are attached, can form a phenyl group bearing one or more C ₅ alkyl substituents.

[00209] In some embodiments, at least one of R ₅ and R ₆ is C _1-3 alkyl, eg, methyl. In some embodiments, one of R ₅ and R ₆ adjacent to M is C _1-3 alkyl, such as methyl, and the other is H. In some embodiments, one of R ₅ and R ₆ adjacent to M, is C _1-3 alkyl, eg methyl, and the other is H and M is -OC(O)- or -C(O)O-.

[00210] In some embodiments, at most one occurrence of R ₅ and R ₆ is C _1-3 alkyl, eg, methyl. In some embodiments, one of R ₅ and R ₆ adjacent to M is C _1-3 alkyl, such as methyl, and the other is H. In some embodiments, one of R ₅ and R ₆ adjacent to M, is C _1-3 alkyl, eg methyl, and the other is H and M is -OC(O)- or -C(O)O-.

[00211] In some embodiments, each occurrence of R ₅ and R ₆ is H.

[00212] In some embodiments, the compound of formula (I) is selected from the group consisting of:

[00213] In additional embodiments, the compound of formula (I) is selected from the group consisting of:

[00214] In some embodiments, the compound of formula (I) is selected from the group consisting of:

and their N-oxides, their salts and their isomers.

[00215] In some embodiments, the lipid of this invention contains compound 340:

[00216] The central amine moiety of a lipid of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III) can be protonated at physiological pH. Thus, a lipid may have a positive or partial positive charge at physiological pH. Such lipids can be referred to as both cationic and ionizable (amino) lipids. Lipids can also be zwitterionic, that is, neutral molecules that have both a positive and a negative charge.

[00217] In the context of this document, the term "alkyl" or "alkyl group" means a linear or branched, saturated hydrocarbon containing one or more carbon atoms (for example, one, two, three, four, five, six, seven, eight, nine , ten, eleven, twelve thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms) which is optionally substituted. The designation "C _1-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon containing 1-14 carbon atoms. Unless otherwise indicated, an alkyl group as described herein refers to both unsubstituted and substituted alkyl groups.

[00218] In the context of this document, the term "alkenyl" or "alkenyl group" means a linear or branched hydrocarbon containing two or more carbon atoms (for example, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms) and at least one double bond which is optionally substituted. The designation "C _2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon containing 2-14 carbon atoms and at least one carbon-carbon double bond. The alkenyl group may include one, two, three, four or more carbon-carbon double bonds. For example, C ₁₈ alkenyl may include one or more double bonds. The C ₁₈ alkenyl group containing two double bonds may be a linoleyl group. Unless otherwise indicated, the alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.

[00219] In the context of this document, the term "alkynyl" or "alkynyl group" means a linear or branched hydrocarbon containing two or more carbon atoms (for example, two, three, four, five, six, seven, eight, nine, ten, eleven , twelve, thirteen, fourteen fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms) and at least one carbon-carbon triple bond which is optionally substituted. The designation “C _2-14 alkynyl” means an optionally substituted linear or branched hydrocarbon containing 2-14 carbon atoms and at least one carbon-carbon triple bond. The alkynyl group may include one, two, three, four or more carbon-carbon triple bonds. For example, C ₁₈ alkynyl may contain one or more carbon-carbon triple bonds. Unless otherwise indicated, the alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.

[00220] In the context of this document, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multicyclic system containing one or more rings of carbon atoms. The rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The designation "C _3-6 carbocycle" means a carbocycle comprising one ring with 3-6 carbon atoms. Carbocycles may include one or more double or triple carbon-carbon bonds and may be non-aromatic or aromatic groups (eg, cycloalkyl or aryl). Examples of the carbocycle include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl and 1,2-dihydronaphthyl groups. In the context of this document, the term "cycloalkyl" means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise indicated, the carbocycle described herein refers to both unsubstituted and substituted carbocyclic groups, i.e. optionally substituted carbocycles.

[00221] In the context of this document, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multicyclic system comprising one or more rings, where at least one ring includes at least one heteroatom. The heteroatoms may be, for example, nitrogen, oxygen or sulfur atoms. The rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (eg, heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, pi peridinyl, quinolyl and isoquinolyl groups. As used herein, the term "heterocycloalkyl" means a non-aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise indicated, the heterocycles described herein refer to both unsubstituted and substituted heterocyclic groups, i.e. optionally substituted heterocycles.

[00222] As used herein, a "biodegradable group" is a group that can promote faster lipid metabolism in a mammal. The biodegradable group may be selected from the group consisting of, but not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C (O)-, -C(O)-,

-C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O) ₂ -, aryl group and a heteroaryl group. As used herein, "aryl" is an optionally substituted carbocyclic radical containing one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group containing one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' may be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the formulas provided herein, M and M' may be independently selected from the list of biodegradable groups above. Unless otherwise indicated, aryl or heteroaryl groups described herein refer to both unsubstituted and substituted groups, ie, optionally substituted aryl or heteroaryl groups.

[00223] Alkyl, alkenyl, and cyclic (eg, carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise indicated. Optional substituents may be selected from the group consisting of, but not limited to, a halogen atom (for example, chloride, bromide, fluoride or iodide group), carboxylic acid (for example, -C(O)OH), alcohol (for example, hydroxyl, -OH), ester (e.g. -C(O)OR or -OC(O)R), aldehyde (e.g. -C(O)H), carbonyl (e.g. -C(O)R, alternatively represented as C=O), acyl halide (for example, -C(O)X, in which X is a halide selected from bromide, fluoride, chloride and iodide), carbonate (for example, -OC(O)OR), alkoxy (for example, -OR), acetal (for example, -C(OR) ₂ R'''', in which each OR represents alkoxy groups, which may be the same or different, and R'''' represents an alkyl or alkenyl group), phosphate (eg P(O) ₄ ^3- ), thiol (eg -SH), sulfoxide (eg -S(O)R), sulfinic acid (eg -S(O)OH), sulfonic acid (eg -S(O) ₂ OH), thial (eg -C(S)H), sulfate (eg S(O) ₄ ^2- ), sulfonyl (eg -S(O) ₂ -), amide (eg , -C(O)NR ₂ or -N(R)C(O)R), azido (eg -N ₃ ), nitro (eg -NO ₂ ), cyano (eg -CN), isocyano (eg , -NC), acyloxy (eg -OC(O)R), amino (eg -NR ₂ , -NRH or -NH ₂ ), carbamoyl (eg -OC(O)NR ₂ , -OC(O) NRH or -OC(O)NH ₂ ), sulfonamide (for example, -S(O) ₂ NR ₂ , -S(O) ₂ NRH, -S(O) ₂ NH ₂ , -N(R)S(O) ₂ R, -N(H)S(O) ₂ R, -N(R)S(O) ₂ H or -N(H)S(O) ₂ H), an alkyl group, an alkenyl group, and a cyclyl group (for example, carbocyclyl or heterocyclyl) group. In any of the preceding descriptions, R is an alkyl or alkenyl group as defined herein. In some embodiments, the substituent groups themselves may be further substituted, for example, with one, two, three, four, five, or six substituents, as defined herein. For example, a C _1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.

[00224] Compounds of this invention that contain nitrogen atoms can be converted to N-oxides by treatment with an oxidant (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxide) to give other compounds of this invention. Thus, all illustrated and claimed nitrogen compounds, if permitted by valence and structure, are considered to include both the illustrated compound and its N-oxide derivative (which may be denoted as N→O or N ⁺ -O ^- ). In addition, in other cases, the nitrogen in the compounds of this invention may be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be obtained by oxidation of the original amine with an oxidizing agent such as m -CPBA. All illustrated and claimed nitrogen compounds are also contemplated, where permitted by valency and structure, to encompass both the illustrated compound and its N-hydroxy (i.e. N-OH) and N-alkoxy (i.e. N-OR, where R is a substituted or unsubstituted C ₁ -C ₆ alkyl, C ₁ -C ₆ alkenyl, C ₁ -C ₆ alkynyl, 3-14 membered carbocycle or 3-14 membered heterocycle) derivatives.

[00225] About, approximately: In the context of this document, the terms "about" and "about" in relation to one or more values of interest refer to a value similar to the declared reference value. In specific embodiments, the term "about" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12% , 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in any direction (greater than or less than) the specified control value, unless specified otherwise evident from the context (except when such a number would exceed 100% of the possible value). For example, when used in the context of the amount of a given compound in the lipid component of a nanoparticle composition, "about" can mean +/- 10% of the value given. For example, a nanoparticle composition containing a lipid component containing about 40% of a given compound may contain 30-50% of the compound.

[00226] In the context of this document, the term "compound" means the inclusion of all isomers and isotopes of the depicted structure. "Isotopes" refer to atoms that have the same atomic number but different mass numbers resulting from different numbers of neutrons in nuclei. For example, isotopes of hydrogen include tritium and deuterium. In addition, the compound, salt or complex of this invention can be obtained in combination with solvent or water molecules to form solvates and hydrates by conventional methods.

[00227] In the context of this document, the term "bringing into contact" means the establishment of a physical connection between two or more objects. For example, contacting a mammalian cell with a composition of nanoparticles means that the mammalian cell and the nanoparticle are designed to have a common physical bond. Methods for bringing cells into contact with external entities both in vivo and ex vivo are well known in biology. For example, bringing the nanoparticle composition into contact with a mammalian cell in the mammalian body can be performed by various routes of administration (eg, intravenous, intramuscular, intradermal and subcutaneous) and can include different amounts of nanoparticle compositions. Moreover, more than one mammalian cell may be brought into contact with the nanoparticle composition.

[00228] In the context of this document, the term "delivery" means the provision of an object to its destination. For example, delivery of a therapeutic and/or prophylactic agent to a subject may include administering a nanoparticulate composition containing the therapeutic and/or prophylactic agent to the subject (eg, by intravenous, intramuscular, intradermal, or subcutaneous route). Administration of the nanoparticle composition to a mammal or into a mammalian cell may include bringing one or more cells into contact with the nanoparticle composition.

[00229] In the context of this document, the term "extended delivery" means the delivery of more (for example, at least 1.5 times more, at least 2 times more, at least 3 times more, at least 4 times more, at least 5 times more, at least 6 times more, at least 7 times more, at least 8 times, at least 9 times, at least 10 times) therapeutic and/or nanoparticle prophylactic agent for the tissue of interest (eg, mammalian liver) compared to the level of delivery of the therapeutic and/or prophylactic agent by the control nanoparticle to the target tissue of interest (eg, MC3, KC2, or DLinDMA). The level of delivery of nanoparticles to a particular tissue can be measured by comparing the amount of protein produced in a tissue with the weight of said tissue, comparing the amount of a therapeutic and/or prophylactic agent in a tissue with the weight of said tissue, comparing the amount of protein produced in a tissue with the amount of total protein. in said tissue, or by comparing the amount of the therapeutic and/or prophylactic agent in the tissue with the amount of the total therapeutic and/or prophylactic agent in said tissue. It is understood that the enhanced delivery of nanoparticles to the target tissue does not need to be determined in the subject being treated, but can be determined in a surrogate such as an animal model (eg a rat model). In specific embodiments, a nanoparticle composition comprising a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) has almost the same level of improvement in delivery regardless of the route of administration. For example, some of the compounds described herein exhibit a similar enhancement in delivery when used to deliver a therapeutic and/or prophylactic agent intravenously or intramuscularly. In other embodiments, certain compounds described herein (e.g., a compound of formula (IA) or (II), such as compound 18, 25, 30, 60, 108-112, or 122) exhibit a higher level of delivery enhancement, when they are used to deliver therapeutic and/or prophylactic agents intramuscularly rather than intravenously.

[00230] As used herein, the term "delivery specific", "deliver specific", or "deliver specific" means delivering more (e.g., at least 1.5 times more, at least 2 times more, at least at least 3 times more, at least 4 times more, at least 5 times more, at least 6 times more, at least 7 times more, at least 8 times more, at least 9 times more times, at least 10 times) of the therapeutic and/or prophylactic nanoparticle into the target tissue of interest (eg, mammalian liver) compared to non-target tissue (eg, mammalian spleen). The level of delivery of nanoparticles to a particular tissue can be measured by comparing the amount of protein produced in a tissue with the weight of said tissue, comparing the amount of a therapeutic and/or prophylactic agent in a tissue with the weight of said tissue, comparing the amount of protein produced in a tissue with the amount of total protein. in said tissue, or by comparing the amount of the therapeutic and/or prophylactic agent in the tissue with the amount of the total therapeutic and/or prophylactic agent in said tissue. For example, for renovascular targeting, a therapeutic and/or prophylactic agent is specifically delivered to the kidney of a mammal compared to the liver and spleen if 1.5, 2, 3, 5, 10, 15, 15, or 20 times the therapeutic and/or prophylactic agent per gram of tissue is delivered to the kidney compared to delivery to the liver or spleen after systemic administration of a therapeutic and/or prophylactic agent. It is understood that the ability of the nanoparticles to specifically deliver to a target tissue does not need to be determined in the subject being treated, but can be determined in a surrogate such as an animal model (eg a rat model).

[00231] As used herein, "encapsulation efficiency" refers to the amount of therapeutic and/or prophylactic agent that becomes part of the nanoparticle composition relative to the initial total amount of therapeutic and/or prophylactic agent used in the preparation of the nanoparticle composition. For example, if 97 mg of a therapeutic and/or prophylactic agent is encapsulated in a nanoparticle composition out of a total of 100 mg of a therapeutic and/or prophylactic agent originally provided in the composition, the encapsulation efficiency can be considered to be 97%. In the context of this document, "encapsulation" may refer to a complete, essential, or partial wrapper, constraint, environment, or wrapper.

[00232] As used herein, "expression" of a nucleic acid sequence refers to translation of an mRNA into a polypeptide or protein and/or post-translational modification of the polypeptide or protein.

[00233] In the context of this document, the term "in vitro" refers to events that occur in an artificial environment, for example, in a test tube or reaction vessel, in a cell culture, in a Petri dish, etc., and not inside the body (for example , animal, plant or microbe).

[00234] In the context of this document, the term "in vivo" refers to events that occur in an organism (eg, animal, plant or microbe, cell or tissue).

[00235] In the context of this document, the term "ex vivo" refers to events that occur outside the body (eg, animal, plant or microbe, cell or tissue). Ex vivo events may occur in an environment that is minimally different from the natural environment (eg, in vivo).

[00236] As used herein, the term "isomer" means any geometric isomer, tautomer, zwitterion, stereoisomer, enantiomer, or diastereomer of a compound. Compounds may contain one or more chiral centers and/or double bonds and thus may exist as stereoisomers such as double bond isomers (i.e. E/Z geometric isomers) or diastereomers (i.e. enantiomers (i.e. (+) or (-)) or cis/trans isomers). This description covers any and all isomers of the compounds described herein, including stereomerically pure forms (eg, geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, such as racemates. Enantiomeric and stereomeric mixtures of compounds and methods for separating them into their constituent enantiomers or stereoisomers are well known.

[00237] A "tautomer" is one of two or more structural isomers that exist in equilibrium and are easily converted from one isomeric form to another. This transformation leads to the formal migration of the hydrogen atom, accompanied by a redistribution of neighboring conjugated double bonds. Tautomers exist as a mixture of a tautomer set in solution. In solutions where tautomerization is equally possible, the chemical equilibrium of the tautomers will be reached. The exact ratio of tautomers depends on several factors including temperature, solvent, and pH. The concept of tautomers that can be converted by tautomerization is called tautomerism.

[00238] Of the various possible types of tautomerism, two are commonly observed. With keto-enol tautomerism, a simultaneous displacement of electrons and a hydrogen atom occurs. Circular chain tautomerism results from the reaction of an aldehyde group (-CHO) in a sugar chain molecule with one of the hydroxy groups (-OH) in the same molecule to produce its cyclic (ring-shaped) form, which glucose exhibits.

[00239] Common tautomeric pairs are: ketone-enol, amide-nitrile, lactam-lactim, amide-imidic acid tautomerism in heterocyclic rings (for example, in nucleic bases such as guanine, thymine, and cytosine), imine-enamine, and enamine- enamine. An example of tautomerism in di-substituted guanidine is shown below.

[00240] It should be understood that the compounds of this invention may be depicted as different tautomers. It should also be understood that when compounds have tautomeric forms, all tautomeric forms are intended to be included within the scope of the description, and the naming of the compounds does not exclude any tautomeric form.

[00241] As used herein, a "lipid component" is that component of a nanoparticle composition that contains one or more lipids. For example, the lipid component may include one or more cationic/ionizable, PEGylated, structural or other lipids such as phospholipids.

[00242] In the context of this document, a "linker" is a fragment connecting two fragments, for example, a connection between two nucleosides, capped particles. The linker may include one or more groups including, but not limited to, phosphate groups (eg, phosphates, boranophosphates, thiophosphates, selenophosphates, and phosphonates), alkyl groups, amidates, or glycerols. For example, two kerated analogue nucleosides may be linked at their 5' positions by a triphosphate group or a chain including two phosphate moieties and a boranophosphate moiety.

[00243] As used herein, "modes of administration" may include intravenous, intramuscular, intradermal, subcutaneous, or other means of delivering the composition to a subject. The route of administration may be selected for targeted delivery (eg, for a specific delivery) to a specific region or body system.

[00244] As used herein, "modified" means not naturally occurring. For example, the RNA may be modified RNA. That is, the RNA may include one or more nucleobases, nucleosides, nucleotides, or linkers that do not occur naturally. "Modified" particles may also be referred to herein as "modified" particles. The particles may be altered or altered chemically, structurally or functionally. For example, the modified nucleobase particles may include one or more substitutions that do not occur naturally.

[00245] In the context of this document, the "N:P ratio" is the molar ratio of ionizable (in the physiological pH range) nitrogen atoms in the lipid and phosphate groups in RNA, for example, in a composition of nanoparticles containing a lipid component and RNA.

[00246] As used herein, a "nanoparticle composition" is a composition containing one or more lipids. Nanoparticle compositions are typically on the order of micrometers or less in size and may contain a lipid bilayer. Nanoparticle compositions include lipid nanoparticles (LNPs), liposomes (eg, lipid vesicles), and lipoplexes. For example, the nanoparticle composition may be a liposome having a lipid bilayer with a diameter of 500 nm or less.

[00247] In the context of this document, "naturally occurring" means existence in nature without artificial assistance.

[00248] As used herein, "patient" refers to a subject who may be seeking or in need of treatment, is in need of treatment, is receiving treatment, will receive treatment, or is being treated by a person skilled in the art for a particular disease or condition.

[00249] As used herein, "PEG lipid" or "PEGylated lipid" refers to a lipid containing a polyethylene glycol component.

[00250] The term “pharmaceutically acceptable” is used herein to refer to those compounds, materials, compositions, and/or dosage forms that are medically suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[00251] The phrase "pharmaceutically acceptable excipient" as used herein refers to any component other than the compounds described herein (e.g., a carrier medium capable of suspending, complexing, or dissolving the active compound) and having properties essentially non-toxic and non-inflammatory in the patient. Excipients may include, for example: release agents, antioxidants, binders, coatings, compression aids, disintegrants, colorants (dyes), emollients, emulsifiers, fillers (diluents), film formers or coatings, fragrances, fragrances, glidants (flow enhancers) lubricants, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners, and water of hydration. Examples of excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate , maltitol, mannitol, methylone, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid , sucrose, talc, titanium dioxide, vitamin A, vitamin E (alpha-tocopherol), vitamin C, xylitol, and other species described herein.

[00252] In this description, the structural formula of a compound for convenience is a specific isomer in some cases, but this description includes all isomers, such as geometric isomers, asymmetric carbon-based optical isomers, stereoisomers, tautomers, and the like, it should be understood that not all isomers may have the same level of activity. In addition, the compounds represented by the formula may have a crystalline polymorphism. It should be noted that any crystalline form, mixture of crystalline forms, or anhydride or hydrate thereof is included within the scope of this invention.

[00253] The terms "crystalline polymorphs", "polymorphs", or "crystalline forms" mean crystalline structures in which a compound (or a salt or solvate thereof) can crystallize in different crystal packings, all of which have the same elemental composition. Different crystal forms usually have different X-ray diffraction patterns, infrared spectra, melting points, density, hardness, crystal form, optical and electrical properties, stability and solubility. Recrystallization solvent, crystallization rate, storage temperature and other factors may cause one crystal form to dominate. Crystalline polymorphs of the compounds can be obtained by crystallization under various conditions.

[00254] Compositions may also include salts of one or more compounds. Salts may be pharmaceutically acceptable salts. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the described compounds in which the parent compound is modified by converting an existing acidic or basic moiety to its salt form (eg, by reacting a free base group with an appropriate organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts with basic groups such as amines; alkali or organic base salts with acidic groups such as carboxylic acids; etc. Illustrative examples of acid addition salts include acetate, adipate, alginate, ascorbate, aspartic, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentane propionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glitch heptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine , triethylamine, ethylamine and the like. Pharmaceutically acceptable salts of this invention include the accepted non-toxic salts of the parent compound derived, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of this invention can be synthesized from a parent compound that contains a basic or acid moiety using conventional chemical methods. Typically, such salts can be prepared by contacting these compounds in their free acidic or basic forms with a stoichiometric amount of a suitable base or acid in water or in an organic solvent or mixtures thereof; in general, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred. Lists of suitable salts are found in Remington Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, Pharmaceutical Salts: Properties, Selection and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008 and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

[00255] As used herein, the term "phospholipid" is a lipid that contains a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains. The phospholipid may include one or more multiple (eg, double or triple) bonds (eg, one or more unsaturated bonds). Specific phospholipids may promote fusion with the membrane. For example, a cationic phospholipid may interact with one or more negatively charged phospholipids of a membrane (eg, cell or intracellular membrane). Fusion of the phospholipid to the membrane may allow one or more elements of the lipid-containing composition to pass through the membrane, allowing, for example, one or more elements to be delivered to a cell.

[00256] As used herein, the term "polydispersity factor" is a ratio that describes the uniformity of the particle size distribution of the system. A small value, for example less than 0.3, indicates a narrow particle size distribution.

[00257] As used herein, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues, typically linked by peptide bonds, which can be produced naturally (eg, isolated or purified) or synthetically.

[00258] As used herein, the term "RNA" refers to ribonucleic acid, which may or may not occur naturally. For example, RNA may contain modified and/or non-naturally occurring components, such as one or more nucleobases, nucleosides, nucleotides, or linkers. The RNA may include a cap structure, a chain-terminal nucleoside, a stem loop, a polyA sequence, and/or a polyadenylation signal. The RNA may have a nucleotide sequence encoding the polypeptide of interest. For example, the RNA may be messenger RNA (mRNA). Translation of an mRNA encoding a particular polypeptide, such as in vivo translation of the mRNA within a mammalian cell, can produce the encoded polypeptide. RNAs can be selected from the non-limiting group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (siRNA), microRNA (miRNA), dicer-substrate mRNA (dsRNA), small hairpin RNA (shRNA), mRNA, single guide RNA ( sRNA), cas9 mRNA, and mixtures thereof.

[00259] As used herein, the term "single unit dose" is the dose of any therapeutic agent administered at a single dose/at the same time/single route/single point of contact, i.e. in the case of a single administration.

[00260] As used herein, the term "fractional dose" is a division of a single unit dose or total daily dose into two or more doses.

[00261] As used herein, the term "total daily dose" is the amount administered or administered over a 24 hour period. It can be administered as a single unit dose.

[00262] As used herein, the term "size" or "average size" in the context of nanoparticle compositions refers to the average diameter of the nanoparticle composition.

[00263] As used herein, the term "subject" or "patient" refers to any organism to which a composition according to the present invention may be administered, for example, for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (eg, mammals such as mice, rats, rabbits, non-human primates, and humans) and/or plants.

[00264] As used herein, the term "target cells" refers to any one or more cells of interest. Cells can be found in vitro, in vivo, in situ , or in a tissue or organ of the body. The organism may be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[00265] As used herein, the term "target tissue" refers to any one or more tissue types of interest in which delivery of a therapeutic and/or prophylactic agent will result in the desired biological and/or pharmacological effect. Examples of target tissues of interest include specific tissues, organs and systems, or groups thereof. In specific applications, the target tissue may be kidney, lung, spleen, vascular endothelium in vessels (eg, intracoronary or intrafemoral), or tumor tissue (eg, via intratumoral injection). "Tissue outside the target" refers to any one or more types of tissues in which the expression of the encoded protein does not lead to the desired biological and/or pharmacological effect. In specific applications, non-target tissues may include the liver and spleen.

[00266] The term "therapeutic agent" or "prophylactic agent" refers to any agent that, when administered to a subject, has a therapeutic, diagnostic and/or prophylactic effect and/or produces a desired biological and/or pharmacological effect. Therapeutic agents are also referred to as "assets" or "active agents". Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[00267] As used herein, the term "therapeutically effective amount" means the amount of an agent to be delivered (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient upon administration a subject suffering from or susceptible to an infection, disease, disorder and/or condition, for treatment, symptomatic relief, diagnosis, prevention and/or delay onset of the infection, disease, disorder and/or condition.

[00268] As used herein, the term "transfection" refers to the introduction of a species (eg, RNA) into a cell. Transfection may occur, for example, in vitro, ex vivo or in vivo .

[00269] As used herein, the term "treatment" refers to the partial or complete alleviation, amelioration, positive change, delay onset, inhibition of progression, reduction in severity, and/or reduction in the incidence of one or more symptoms or signs of a particular infection, disease, disorder, and/ or states. For example, "treatment" of cancer may refer to inhibiting the survival, growth and/or spread of a tumor. Treatment may be administered to a subject who is not showing signs of a disease, disorder, and/or condition and/or to a subject who is showing only early signs of a disease, disorder, and/or condition, in order to reduce the risk of developing a pathology associated with the disease, disorder, and /or state.

[00270] As used herein, "zeta potential" is the electrokinetic potential of a lipid, for example, in a particle composition.

Compositions of nanoparticles

[00271] This invention also relates to nanoparticle compositions containing a lipid component containing a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) as described herein.

[00272] In some embodiments, the largest nanoparticle size of the composition is 1 µm or less (e.g., 1 µm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm , 150 nm, 125 nm, 100 nm, 75 nm, 50 nm or less), such as when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or other method. Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, lipid vesicles, and lipoplexes. In some embodiments, the nanoparticle compositions are vesicles containing one or more lipid bilayers. In particular embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers may be functionalized and/or cross-linked with each other. The lipid bilayer may contain one or more ligands, proteins or channels.

[00273] Nanoparticle compositions contain a lipid component containing at least one compound in formulas (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), ( IIe), (IIf), (IIg) or (III). For example, the lipid component of the nanoparticle composition may contain one or more compounds 1-280. The nanoparticle compositions may also contain a variety of other components. For example, the lipid component of the nanoparticle composition may contain one or more other lipids in addition to the lipid of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III).

Cationic/ionizable lipids

[00274] The nanoparticle composition may include one or more cationic and/or ionizable lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH) in addition to the lipid of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Cationic and/or ionizable lipids may be selected from the non-limiting group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(dioddecylamino)ethyl]-N1,N4 , N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraazaoctatriacontane (KL25), 1,2-dilinoleyloxy-N, N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin- MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N, N-dimethylaminopropane (DODMA), 2 -({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N, N-dimethyl-3-[(9Z, 12Z)-octadeca-9,12-diene-1- yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N, N-dimethyl-3 -[(9Z,12Z)-octadeca-9,12 dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)) and (2S)-2-({8-[(3β)-cholest- 5-en-3-yloxy]octyl}oxy)-N, N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA ( 2S)). In addition, the cationic lipid may also be a lipid containing a cyclic amine group.

PEG lipids

[00275] The lipid component of the nanoparticle composition may include one or more PEG or PEG-modified lipids. Such particles may be otherwise referred to as PEGylated lipids. PEG lipid is a lipid modified with polyethylene glycol. The PEG lipid may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides (PEG-CER), PEG-modified dialkylamines, PEG-modified diacylglycerols (PEG-DEG), PEG- modified dialkylglycerols and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

Structural lipids

[00276] The lipid component of the nanoparticle composition may include one or more structural lipids. Structural lipids can be isolated from the groups consisting of, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid comprises cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or a combination thereof.

Phospholipids

[00277] The lipid component of the nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. Phospholipids may assemble into one or more lipid bilayers. Typically, phospholipids may include a phospholipid moiety and one or more fatty acids. For example, the phospholipid may be a lipid of formula (IV):

in which R _p is a phospholipid fragment, and R ₁ and R ₂ are fatty acid fragments with or without unsaturation, which may be the same or different. The phospholipid moiety can be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid moiety can be selected from the non-limiting group consisting of lauric acid, myristic acid, myristolenic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid and docosahexaenoic acid. Also covered by this invention are natural species, including natural species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. For example, the phospholipid may be functionalized or cross-linked with one or more alkynes (eg, an alkenyl group in which one or more double bonds are replaced by a triple bond). Under appropriate reaction conditions, the alkyne group can undergo copper-catalyzed cycloaddition when exposed to an azide. Such reactions may be useful for functionalizing the lipid bilayer of the nanoparticle composition to facilitate membrane penetration or cellular recognition, or for conjugating the nanoparticle composition with a suitable component such as a targeting or imaging moiety (eg, a dye).

[00278] Phospholipids useful in compositions and methods can be selected from the non-limiting group consisting of 1,2-distearoyl- sn -glycero-3-phosphocholine (DSPC), 1,2-dioleoyl- sn -glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine ( DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenoyl- sn -glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl- sn -glycero-3-phosphocholine (OChemsPC), 1- hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn -glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn- glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, sodium salt 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoylphosphatidylethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanol amine (LPE ) and their mixtures. In some embodiments, the implementation of the composition of nanoparticles contains DSPC. In specific embodiments, the implementation of the composition of nanoparticles contains DOPE. In some embodiments, the nanoparticle composition contains both DSPC and DOPE.

Adjuvants

[00279] In some embodiments, a nanoparticle composition that includes one or more of the lipids described herein may further include one or more adjuvants, e.g., glucopyranosyl lipid adjuvant (GLA), CpG oligodeoxynucleotides (e.g., class A or B ), poly(I:C), aluminum hydroxide and Pam3CSK4.

Therapeutic agents

[00280] Nanoparticle compositions may include one or more therapeutic and/or prophylactic agents. The invention describes methods for delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ, obtaining a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof, including administering to a mammal and/or bringing a mammalian cell into contact with a composition of nanoparticles, containing a therapeutic and/or prophylactic agent.

[00281] Therapeutic and/or prophylactic agents include biologically active agents and are alternatively referred to as "active agents". A therapeutic and/or prophylactic agent may be a substance that, upon delivery to a cell or organ, causes desired changes in the cell, organ, or other tissue or body system. Such particles may be found useful in the treatment of one or more diseases, disorders or pathological conditions. In some embodiments, the therapeutic and/or prophylactic agent is a small molecule drug useful in the treatment of a specific disease, disorder, or condition. Examples of drugs useful in nanoparticle formulations include, but are not limited to, an antineoplastic agent (eg, vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antineoplastic agents (eg, actimin D), vinblastine , cytosine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs such as methotrexate and purine and pyrimidine analogs), anti-infectives, local anesthetics (eg, dibucaine and chlorpromazine), beta-adrenergic blockers (eg, propranolol, timolol, and labetalol), antihypertensives (eg clonidine and hydralazine), antidepressants (eg imipramine, amitriptyline and doxepin), anticonvulsants (eg phenytoin), antihistamines (eg diphenhydramine, chlorpheniramine and promethazine), antibiotics/antibacterials (eg , gentamicin, ciprofloxacin, and cefoxitin), antifungals (eg, miconazole, terconazole, econazole, isoconazole, butoconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitic agents, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, anti- glaucoma, vitamins, drugs and imaging.

[00282] In some embodiments, the therapeutic and/or prophylactic agent is a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, an immune response eliciting compound, and/or another therapeutic and/or prophylactic agent. A cytotoxin or cytotoxic agent includes any agent that may be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, eg maytansinol, rachelmicin (CC-1065) and analogues or homologues thereof. Radioactive ions include, but are not limited to, iodine (eg, iodine 125 or iodine 131), strontium 89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium 90, samarium 153, and praseodymium. Vaccines include compounds and preparations that are capable of conferring immunity against one or more of the conditions associated with infectious diseases such as influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis, and may include mRNAs encoding infectious diseases derived from antigens and/or epitopes. Vaccines also include compounds and preparations that direct an immune response against cancer cells and may include mRNAs encoding antigens derived from tumor cells, epitopes and/or neoepitopes. Compounds that elicit immune responses may include vaccines, corticosteroids (eg dexamethasone), and other particles. In some embodiments, the vaccine and/or a compound capable of inducing an immune response is administered intramuscularly in a composition containing a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc) , (IId), (IIe), (IIf), (IIg) or (III) (eg compound 3, 18, 20, 25, 26, 29, 30, 60, 108-112 or 122). Other therapeutic and/or prophylactic agents include, but are not limited to, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil-dacarbazine), alkylating agents (eg, mechlorethamine, thiotepa, chlorambucil rachelmicin (CC -1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannite, streptozotocin, mitomycin C and cis-dichlorodiamine platinum(II), cisplatin), anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin) , antibiotics (eg, dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)) and antimitotic agents (eg, vincristine, vinblastine, taxol, and maytansinoids).

[00283] In other embodiments, the therapeutic and/or prophylactic agent is a protein. Therapeutic proteins useful in the nanoparticles of this invention include, but are not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), VIR , analogues releasing luteinizing hormone (LHRH), interferons, heparin, hepatitis B surface antigen, typhoid vaccine and cholera vaccine.

Polynucleotides and nucleic acids

[00284] In some embodiments, the therapeutic agent is a polynucleotide or nucleic acid (eg, ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide" in its broadest sense includes any compound and/or substance that can be included in the oligonucleotide chain. Illustrative examples of polynucleotides for use in the present invention include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA , shRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, aptamers, vectors, etc. In some aspects, RNA is a therapeutic and/or prophylactic agent. Suitable RNAs for the compositions and methods described herein can be selected from the group consisting of, but not limited to, shortmers, antagonists, antisense, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), miRNAs ( miRNA), dicer-substrate RNA (dsRNA), short hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and mixtures thereof. In specific embodiments, the RNA is mRNA.

[00285] In specific embodiments, the therapeutic and/or prophylactic agent is an mRNA. The mRNA may encode any polypeptide of interest, including any polypeptide, whether naturally occurring or not naturally occurring, or otherwise modified. The polypeptide encoded by the mRNA may be of any size and may have any secondary structure or activity. In some embodiments, an mRNA-encoded polypeptide can exert a therapeutic effect when expressed in a cell.

[00286] In other embodiments, the therapeutic and/or prophylactic agent is an siRNA. siRNA may be able to selectively knock out or regulate the expression of a gene of interest. For example, an siRNA can be selected to silence a gene associated with a particular disease, disorder, or pathological condition when administered to a subject in need thereof a nanoparticle composition comprising the siRNA. The siRNA may contain a sequence that is complementary to an mRNA sequence that encodes a gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA.

[00287] In specific embodiments, the therapeutic and/or prophylactic agent is sgRNA and/or cas9 mRNA. sgRNA and/or cas9 mRNA can be used as editing tools. For example, the sgRNA-cas9 complex can influence the translation of mRNA of cellular genes.

[00288] In some embodiments, the therapeutic and/or prophylactic agent is a shRNA or a vector or plasmid encoding them. shRNA can be produced within the target cell upon delivery of the appropriate construct to the nucleus. ShRNA constructs and mechanisms are well known in the relevant arts.

[00289] Nucleic acids and polynucleotides suitable for this invention typically include a first region of linked nucleosides encoding the polypeptide of interest (e.g., a coding region), a first flanking region located at the 5' end of the first region (e.g., a 5'-UTR ), a second flanking region located at the 3' end of the first region (eg, 3'-UTR), at least one 5'-cap region and a 3'-stabilizing region. In some embodiments, the nucleic acid or polynucleotide further comprises a poly-A region or a Kozak sequence (eg, in the 5'-UTR). In some cases, polynucleotides may contain one or more intron nucleotide sequences that can be cut from the polynucleotide. In some embodiments, a polynucleotide or nucleic acid (eg, mRNA) may include a 5'-cap structure, a nucleotide terminator, a stem loop, a polyA sequence, and/or a polyadenylation signal. Any of the nucleic acid regions may include one or more alternative components (eg, an alternative nucleoside). For example, the 3' stabilizing region may contain an alternative nucleoside such as L-nucleoside, inverted thymidine, or 2'-O-methylnucleoside and/or the coding region, 5'-UTR, 3'-UTR or cap region may include an alternative nucleoside , such as 5-substituted uridine (eg 5-methoxyuridine), 1-substituted pseudouridine (eg 1-methylpseudouridine or 1-ethylpseudouridine) and/or 5-substituted cytidine (eg 5-methylcytidine).

[00290] Typically, the shortest polynucleotide length may be the length of the polynucleotide sequence sufficient to encode the dipeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tripeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tetrapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a pentapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a hexapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a heptapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode an octapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a nonapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a decapeptide.

[00291] Examples of dipeptides that can encode alternative polynucleotide sequences include, but are not limited to, carnosine and anserine.

[00292] In some cases, the length of the polynucleotide molecule exceeds 30 nucleotides. In another embodiment, the length of the polynucleotide molecule is greater than 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides or more than 5000 nucleotides.

[00293] Nucleic acids and polynucleotides may include one or more naturally occurring components, including any of the canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In one embodiment, all or substantially all of the nucleotides comprising (a) a 5'-UTR, (b) an open reading frame (ORF), (c) a 3'-UTR, (d) a poly-A tail, and any combination of (a, b, c or d above) include the naturally occurring canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

[00294] Nucleic acids and polynucleotides may include one or more of the alternative components described herein that confer useful properties, including increased stability and/or no significant induction of the innate immune response of the cell into which the polynucleotide is introduced. For example, an alternative polynucleotide or nucleic acid exhibits reduced degradation in the cell into which the polynucleotide or nucleic acid is introduced compared to the corresponding unchanged polynucleotide or nucleic acid. These alternative species may increase the efficiency of protein production, intracellular retention of polynucleotides and/or the viability of the cells brought into contact, as well as have reduced immunogenicity.

[00295] Polynucleotides and nucleic acids may be naturally occurring or non-naturally occurring. Polynucleotides and nucleic acids may include one or more modified (eg, altered or alternative) nucleic bases, nucleosides, nucleotides, or combinations thereof. Nucleic acids and polynucleotides used in the composition of the nanoparticles may include any suitable modification or change, such as a nucleic backbone, a sugar, or an internucleoside bond (eg, phosphate/phosphodiester bond/phosphodiester backbone). In specific embodiments, the changes (eg, one or more changes) are present in each of the nucleobases, the sugar, and the internucleoside bond. Changes according to the invention may be changes from ribonucleic acids (RNA) to deoxyribonucleic acids (DNA), for example, the replacement of the 2'-OH ribofuranosyl ring with 2'-H, threosonucleic acids (TNA), glycolic nucleic acids (GNA), peptide nucleic acids acids (PNA), closed nucleic acids (LNA), or hybrids thereof. Additional changes are described here.

[00296] Polynucleotides and nucleic acids may or may not be uniformly altered throughout the length of the molecule. For example, one or more or all types of nucleotides (eg, purine or pyrimidine, or any one or more or all of A, G, U, C) may or may not be uniformly altered in a polynucleotide or nucleic acid or in a given sequence region thereof. In some cases, all of the X nucleotides in a polynucleotide (or in a given sequence region) are changed, where X can be any of the nucleotides A, G, U, C, or any one of the combinations of A+G, A+U, A+C, G +U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[00297] Various changes in sugar and/or internucleoside bonds (eg, backbone structure) can exist at different positions in a polynucleotide. One skilled in the art will appreciate that nucleotide analogs or other alterations may be found at any position(s) of a polynucleotide such that the function of the polynucleotide is not significantly reduced. The change can also be a change at the 5' or 3' end. In some embodiments, the implementation of the polynucleotide includes a change at the 3'-end. A polynucleotide may contain from about 1% to about 100% alternative nucleotides (either based on total nucleotide content, or based on one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any percentage in between (e.g. 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, from 1 % to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% up to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80 %, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100% , 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It is understood that any remaining percentage is due to the presence of the canonical nucleotide (eg, A, G, U, or C).

[00298] Polynucleotides may contain at least zero and at most 100% alternative nucleotides, or any percentage in between, such as at least 5% alternative nucleotides, at least 10% alternative nucleotides, at least 25% alternative nucleotides, at least 50% alternative nucleotides, at least 80% alternative nucleotides, or at least 90% alternative nucleotides. For example, polynucleotides may contain an alternative pyrimidine such as an alternative uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracil in the polynucleotide is replaced with an alternative uracil (e.g. , 5-substituted uracil). The alternative uracil may be replaced by a compound having a single unique structure, or may be replaced by multiple compounds having different structures (eg 2, 3, 4 or more unique structures). In some cases, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosine in a polynucleotide is replaced by an alternative cytosine (e.g., 5-substituted cytosine). The alternative cytosine may be replaced by a compound having a single unique structure, or may be replaced by a plurality of compounds having different structures (eg 2, 3, 4 or more unique structures).

[00299] In some cases, nucleic acids do not substantially induce an innate immune response of the cell into which the polynucleotide (eg, mRNA) is introduced. Features of the induced innate immune response include 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular PRRs (RIG-I, MDA5, etc., and/or 3) cessation or reduction of protein translation.

[00300] Nucleic acids may optionally include other agents (e.g., RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, siRNAs, antisense RNAs, ribozymes, catalytic DNA, tRNAs, RNAs that cause triple helix formation, aptamers, and vectors). In some instances, claimed nucleic acids may include one or more messenger RNAs (mRNAs) having one or more alternative nucleosides or nucleotides (ie, alternative mRNA molecules).

[00301] In some embodiments, the nucleic acid molecule (e.g., mRNA), formula, composition, or method associated therewith comprises one or more polynucleotides having features as described in WO 2002/098443, WO 2003/051401, WO 2008/052770, WO 2009127230, WO 2006122828, WO 2008/083949, WO 2010088927, WO 2010/037539, WO 2004/004743, WO 2005/016376, WO 2006 /024518, WO 2007/095976, WO 2008/014979, WO 2008 /077592, WO 2009/030481, WO 2009/095226, WO 2011069586, WO 2011026641, WO 2011/144358, WO 2012019780, WO 2012013326, WO 2012089338 WO 2012113513, WO 2012116811, WO 2012116810, WO 2013113502, WO 2013113501, WO 2013113736 WO 2013143698 WO 2013143699 WO 2013143700 WO 2013/120626 WO 2013120627 WO 2013120628 WO 2013120629 WO 2013174409 127917, WO 2015/024669, WO 2015/024668, WO 2015/024667, WO 2015/024665, WO 2015/024666, WO 2015/024664, WO 2015101415, WO 2015101414, WO 2015024667, WO 2015062738, WO 2015101416, each of which is incorporated by reference herein.

Alternative nucleobases

[00302] Alternative nucleosides and nucleotides may include an alternative nucleobase. The nucleic acid base of a nucleic acid is an organic base such as a purine or a pyrimidine or a derivative thereof. The nucleic base may be a canonical base (eg, adenine, guanine, uracil, thymine, and cytosine). These nucleobases can be modified or completely replaced to provide polynucleotide molecules with improved properties, such as increased stability, such as nuclease resistance. Non-canonical or modified bases may include, for example, one or more substitutions or modifications, including, but not limited to, substitutions with alkyl, aryl, halogen, oxo, hydroxyl, alkyloxy and/or thio; one or more fused or open rings; oxidation; and/or recovery.

[00303] Alternative nucleotide base pairings include not only standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or alternative nucleotides, including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors provide a hydrogen bond between a non-standard base and a standard base, or between two complementary non-standard base structures. One example of such nonstandard base pairing is the base pairing between an alternative nucleotide, inosine, and adenine, cytosine, or uracil.

[00304] In some embodiments, the nucleic backbone is an alternative to uracil. Typical nucleobases and nucleosides having an alternative uracil include pseudouridine (ψ), pyridine-4-oneribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-azauracil, 2-thiouracil (s ² U) , 4-thiouracil (s ⁴ U), 4-thiopseudouridine, 2-thiopseudouridine, 5-hydroxyuracil (ho ⁵ U), 5-aminoallyluracil, 5-halogenuracil (for example, 5-ioduracil or 5-bromouracil), 3-methyluracil ( m ³ U), 5-methoxyuracil (mo ⁵ U), uracil-5-hydroxyacetic acid (cmo ⁵ U), uracil-5-hydroxyacetic acid methyl ester (mcmo ⁵ U), 5-carboxymethyluracil (cm ⁵ U), 1 -carboxymethylpseudouridine, 5-carboxyhydroxymethyluracil (chm ⁵ U), 5-carboxyhydroxymethyluracil methyl ester (mchm ⁵ U), 5-methoxycarbonylmethyluracil (mcm ⁵ U), 5-methoxycarbonylmethyl-2-thiouracil (mcm ⁵ s ² U), 5-aminomethyl -2-thiouracil (nm ⁵ s ² U), 5-methylaminomethyluracil (mnm ⁵ U), 5-methylaminomethyl-2-thio-uracil (mnm ⁵ s ² U), 5-methylaminomethyl-2-selenouracil (mnm ⁵ se ² U), 5-carbamoylmethyluracil (ncm ⁵ U), 5-carboxymethylaminomethyluracil (cmnm ⁵ U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm ⁵ s ² U), 5-propynyluracil, 1-propynylpseudouracil, 5-taurinomethyluracil (τm ⁵ U), 1-taurinomethylpseudouridine, 5-taurinomethyl-2-thiouracil (τm ⁵ s ² U), 1-taurinomethyl-4-thiopseudouridine, 5-methyluracil (m ⁵ U, i.e. having a nucleic base deoxythymine), 1-methylpseudouridine (m ¹ ψ), 1-ethylpseudouridine (Et ¹ ψ), 5-methyl-2-thiouracil (m ⁵ s ² U), 1-methyl-4-thiopseudouridine (m ¹ s ⁴ ψ ⁾ (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyldihydrouracil (m ⁵ D), 2-thiodihydrouracil, 2-thio-dihydropseudouridine, 2-methoxyuracil, 2-methoxy-4-thiouracil, 4-methoxypseudouridine, 4-methoxy -2-thiopseudouridine, N1-methylpseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp ³ U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp ³ ψ), 5 -(isopentenylaminomethyl)uracil (inm ⁵ U), 5-(isopentenylaminomethyl)-2-thiouracil (inm ⁵ s ² U), 5,2'-O-dimethyluridine (m ⁵ Um), 2-thio-2'-O_methyl -uridine (s ² Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm ⁵ Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm ⁵ Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm ⁵ Um), 3,2'-O-dimethyluridine (m ³ Um) and 5-(isopentenylaminomethyl)-2'-O-methyluridine (inm ⁵ Um), 1-thiouracil, deoxythymidine, 5-(2-carbomethoxyvinyl )-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thiouracil, 5-carboxymethyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thio-uracil and 5-[3-(1- E-propenylamino)]uracil.

[00305] In some embodiments, the nucleobase is an alternative to cytosine. Illustrative examples of nucleobases and nucleosides having an alternative cytosine include 5-azacytosine, 6-azacytosine, pseudoisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methylcytosine (m4C), 5-methylcytosine (m5C), 5-halocytosine (e.g. 5-iodocytosine), 5-hydroxymethylcytosine (hm5C), 1-methylpseudoisocytidine, pyrrolopseudoisocytidine, pyrrolopseudoisocytidine, 2-thiocytosine (s2C), 2-thio-5-methylcytosine, 4- thiopseudisocytidine, 4-thio-1-methylpseudoisocytidine, 4-thio-1-methyl-1-deazapseudoisocytidine, 1-methyl-1-deazapseudoisocyt zebularine, 5-azazebularine, 5-methylzebularine, 5-aza-2-thiosebularine, 2-thiozebularine , 2-methoxycytosine, 2-methoxy-5-methylcytosine, 4-methoxypseudoisocytidine, 4-methoxy-1-methylpseudoisocytidine, lyzidine (k2C), 5,2'-O-dimethylcytidine (m5Cm), N4-acetyl-2'-O -methylcytidine (ac4Cm), N4,2'-O-dimethylcytidine (m4Cm), 5-formyl-2'-O-methylcytidine (f5Cm), N4, N4,2'-O-trimethylcytidine (m42Cm), 1-thiocytosine, 5-hydroxycytosine, 5-(3-azidopropyl)-cytosine and 5-(2-azidoethyl)-cytosine.

[00306] In some embodiments, the nucleobase is an alternative to adenine. Illustrative examples of nucleobases and nucleosides having an alternative adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g. 2-amino-6-chloropurine), 6-halopurine (e.g. 6-chloropurine ), 2-amino-6-methylpurine, 8-azidoadenine, 7-deazaadenin, 7-deaza-8-azaadenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenine (m1A), 2-methyladenine (m2A), N6-methyladenine (m6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-isopentynyladenine (i6A), 2-methylthio-N6-isopentynyladenine (ms2i6A), N6-(cis-hydroxyisopentyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms6) N6 -glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), 2-methylthio-N6-threonylcarbamoyladenine (ms2g6A), N6,N6-dimethyladenine (m62A), N6-hydroxynorvalylcarbamoyladenine (hn6A) , 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6-acetyladenine (ac6A), 7-methyladenine, 2-methylthioadenine, 2-methoxyadenine, N6,2'-O-dimethyladenosine (m6Am), N6,N6,2'- O-trimethyladenosine (m62Am), 1,2'-O-dimethyladenosine (m1Am), 2-amino-N6-methylpurine, 1-thioadenine, 8-azidoadenine, N6-(19-aminopentaoxanonadecyl)-adenine, 2,8-dimethyladenine , N6-formyladenine and N6-hydroxymethyladenine.

[00307] In some embodiments, the nucleobase is an alternative to guanine. Illustrative examples of nucleobases and nucleosides having an alternative guanine include inosine (I), 1-methylinosine (m1I), viosin (imG), methylviosin (mimG), 4-demethylviosin (imG-14), isoviosin (imG2), vibutosin ( yW), peroxyvibutosin (o2yW), hydroxyvibutosin (OHyW), unmodified hydroxyvibutosin (OHyW*), 7-deazaguanine, queuosin (Q), epoxyqueuosin (oQ), galactosylqueuosin (galQ), mannosylqueuosin (manQ), 7-cyano-7- deazaguanine (preQ0), 7-aminomethyl-7-deazaguanine (preQ1), archeosin (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deazaguanine, 6-thio-7 -deaza-8-azaguanine, 7-methylguanine (m7G), 6-thio-7-methylguanine, 7-methylinosine, 6-methoxyguanine, 1-methylguanine (m1G), N2-methylguanine (m2G), N2,N2-dimethylguanine ( m22G), N2,7-dimethylguanine (m2.7G), N2, N2,7-dimethylguanine (m2.2.7G), 8-oxoguanine, 7-methyl-8-oxoguanine, 1-methyl-6-thioguanine, N2 -methyl-6-thioguanine, N2,N2-dimethyl-6-thioguanine, N2-methyl-2'-O-methylguanosine (m2Gm), N2,N2-dimethyl-2'-O-methylguanosine (m22Gm), 1-methyl -2'-O-methylguanosine (m1Gm), N2,7-dimethyl-2'-O-methylguanosine (m2.7Gm), 2'-O-methylinosine (Im), 1,2'-O-dimethylinosine (m1Im) , 1-thioguanine and O-6-methylguanine.

[00308] The alternative nucleobase of a nucleotide can be independently a purine, a pyrimidine, and a purine or pyrimidine analogue. For example, the nucleobase may be an alternative to adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobase may also include, for example, naturally occurring and synthetic base derivatives, including pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine , 2-aminoadenine, 6-methyl- and other alkyl derivatives of adenine and guanine, 2-propyl- and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen (e.g. 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, etc. 8-substituted adenines and guanines, 5-halogen, in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]-1,3,5-triazinones, 9-deazapurine, imidazo[4,5-d]pyrazines, thiazolo [4,5-d]pyrimidines, pyrazin-2-one, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When nucleotides are depicted using the abbreviation A, G, C, T, or U, each letter refers to a typical base and/or derivatives thereof, eg A includes adenine or adenine analogs, eg 7-deazaadenine).

Changes on sugar

[00309] Nucleosides include a sugar molecule (e.g., a 5 or 6 carbon sugar such as pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxy derivative thereof) in combination with a nucleotide, while nucleotides are nucleosides containing a nucleoside and a phosphate group or alternative group (eg, boranophosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). The nucleoside or nucleotide may be a canonical species, for example, a nucleoside or nucleotide comprising a canonical nucleobase, a sugar and, in the case of nucleotides, a phosphate group, or may be an alternative nucleoside or nucleotide comprising one or more alternative components. For example, alterations in the nucleoside or nucleotide may be made in the sugar of alternative nucleosides and nucleotides. In some embodiments, alternative nucleosides or nucleotides include the structure:

In each of formulas IV, V, VI and VII,

each of m and n is independently an integer from 0 to 5,

each of U and U' is independently O, S, N(R ^U ) _nu or C(R ^U ) _nu , where nu is an integer from 0 to 2, and each R ^U is independently H, halogen, or optionally substituted alkyl;

each of R ^1' , R ^2' , R ^1'' , R ^2'' , R ¹ , R ² , R ³ , R ⁴ and R ⁵ independently represents, if present, H, halogen, hydroxy, thiol, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted aminoalkoxy, optionally substituted alkoxyalkoxy, optionally substituted hydroxyalkoxy, optionally substituted amino, azido, optionally substituted aryl, optionally substituted aminoalkyl, optionally substituted aminoalkenyl, optionally substituted aminoalkynyl or absent ; where the combination of R ³ with one or more of R ^1' , R ^1'' , R ^2' , R ^2'' or R ⁵ (for example, the combination of R ^1' and R ³ , the combination of R ^1″ and R ³ , the combination of R ² ' and R ³ , a combination of R ^2″ and R ^{3 ,} or a combination of R ⁵ and R ³ ) may combine to form an optionally substituted alkylene or an optionally substituted heteroalkylene and, taken together with the carbon atoms to which they are attached, provide an optionally substituted heterocyclyl (for example , bicyclic, tricyclic or tetracyclic heterocyclyl); where the combination of R ⁵ with one or more of R ^1' , R ^1'' , R ^2' or R ^2'' (for example, the combination of R ^1' and R ⁵ , the combination of R ^1'' and R ⁵ , the combination of R ^2' and R ⁵ or a combination of R ^2'' and R ⁵ ) may combine to form an optionally substituted alkylene or an optionally substituted heteroalkylene and, taken together with the carbon atoms to which they are attached, provide an optionally substituted heterocyclyl (e.g. bicyclic, tricyclic or tetracyclic heterocyclyl) ; and where the combination of R ⁴ and one or more of R ^1' , R ^1'' , R ^2' , R ^2'' , R ³ or R ⁵ can combine into an optionally substituted alkylene or an optionally substituted heteroalkylene and, taken together with carbon atoms to which they are attached form an optionally substituted heterocyclyl (eg bicyclic, tricyclic or tetracyclic heterocyclyl)); each of m' and m″ is independently an integer from 0 to 3 (eg, 0 to 2, 0 to 1, 1 to 3, or 1 to 2);

each of Y ¹ , Y ² and Y ³ independently represents, O, S, Se, -NR ^N1 -, optionally substituted alkylene, or optionally substituted heteroalkylene, where R ^N1 represents H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, or absent;

each Y ⁴ is independently, H, hydroxy, thiol, boranyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted thioalkoxy, optionally substituted alkoxy, or optionally substituted amino ;

each Y ⁵ is independently O, S, Se, an optionally substituted alkylene (eg, methylene), or an optionally substituted heteroalkylene; And

B is a nucleobase, either modified or unmodified.

[00310] In some embodiments, the 2'-hydroxy group (OH) may be modified or replaced with a number of different substituents. Illustrative examples of substituents at the 2' position include, but are not limited to, H, azido, halogen (eg, fluorine), optionally substituted C _1-6 alkyl (eg, methyl); optionally substituted C _1-6 alkoxy (eg methoxy or ethoxy); optionally substituted C _6-10 aryloxy; optionally substituted C _3-8 cycloalkyl; optionally substituted C _6-10 aryl-C _1-6 alkoxy, optionally substituted C _1-12 (heterocyclyl) oxy; sugar (eg, ribose, pentose, or any of those described herein); polyethylene glycol (PEG), -O(CH ₂ CH ₂ O) _n CH ₂ CH ₂ OR, where R is H or optionally substituted alkyl and n is an integer from 0 to 20 (for example, from 0 to 4, from 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); "Locked" nucleic acids (LNAs) in which a 2'-hydroxy is linked by a C _1-6 alkylene or C _1-6 heteroalkylene bridge to the 4' carbon of the same ribose sugar, where illustrative examples of bridges include methylene, propylene, ether or amino -bridges; aminoalkyl as defined herein; aminoalkoxy as defined herein; amino as defined herein; and amino acids as defined herein.

[00311] Typically, RNA includes a ribose sugar group, which is a 5-membered ring with oxygen. Illustrative examples of non-limiting alternative nucleotides include the replacement of an oxygen in the ribose (eg, S, Se, or an alkylene such as methylene or ethylene); addition of a double bond (for example, to replace ribose with cyclopentenyl or cyclohexenyl); contraction of the ribose ring (for example, to form a 4-membered cyclobutane or oxetane ring); ribose ring expansion (eg to form a 6- or 7-membered ring having an additional carbon or heteroatom, eg for anhydrohexite, altrite, mannitol, cyclohexanyl, cyclohexenyl and morpholino (which also has a phosphoamidate backbone)); multicyclic forms (e.g. tricyclo and "unlocked" forms such as glycolic nucleic acid (GNA) (e.g. R-GNA or S-GNA where the ribose is replaced by glycol units attached to phosphodiester bonds), threosine nucleic acid (TNA where ribose is replaced by α-L-threofuranosyl- (3'→2')) and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine bonds replace ribose and phosphodiester backbone).

[00312] In some embodiments, the implementation of the sugar group contains one or more carbon atoms that have the opposite stereochemical configuration of the corresponding carbon in the ribose. Thus, a polynucleotide molecule may include nucleotides containing, for example, arabinose or L-ribose as a sugar.

[00313] In some embodiments, the polynucleotide comprises at least one nucleoside, wherein the sugar is L-ribose, 2'-O-methylribose, 2'-fluororibose, arabinose, hexitol, LNA, or PNA.

Internucleoside bond changes

[00314] Alternative nucleotides may be altered in the internucleoside bond (eg, phosphate backbone). In this document, in the context of a polynucleotide backbone, the phrases "phosphate" and "phosphodiester" are used interchangeably. The basic phosphate groups can be changed by replacing one or more oxygen atoms with another substituent.

[00315] Alternative nucleotides may include the entire replacement of the unchanged phosphate moiety with another internucleoside bond, as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrophosphorinates, phosphoramidates, phosphodiamidates, alkyl or aryl phosphates, and phosphotriesters. Phosphorodithioates have both non-binding oxygens replaced with sulfur. The phosphate linker can also be changed by replacing the oxygen binder with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene phosphonates).

[00316] Alternative nucleosides and nucleotides may include the replacement of one or more non-bridging oxygen atoms with a borane moiety (BH ₃ ), sulfur (thio), methyl, ethyl, and/or methoxy. As a non-limiting example, two non-bridged oxygen atoms in the same position (eg alpha (α), beta (β) or gamma (γ) position) can be replaced with sulfur (thio) and methoxy.

[00317] The replacement of one or more oxygen atoms at the α-position of the phosphate moiety (eg, α-thiophosphate) is provided to confer stability (eg, against exonucleases and endonucleases) of RNA and DNA through non-naturally occurring phosphorothioate bonds in the backbone. Phosphorothioate DNA and RNA have increased resistance to nucleases and, as a result, a longer half-life in the cellular environment.

[00318] Other internucleoside bonds that can be used in accordance with this invention, including internucleoside bonds that do not contain a phosphorus atom, are described in this document.

Internal ribosome entry sites

[00319] Polynucleotides may contain an internal ribosome entry site (IRES). The IRES may act as a single ribosome binding site or may serve as one of several mRNA ribosome binding sites. A polynucleotide containing more than one functional ribosome binding site may encode multiple peptides or polypeptides that are independently translated by ribosomes (eg, multicistronic mRNA). When the polynucleotides are provided with IRES, a second translational region is optionally provided. Examples of IRES sequences that can be used in this invention include, but are not limited to, sequences of picornaviruses (e.g., FMDV), pest viruses (CFFV), poliomyelitis viruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease viruses (FMD), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immunodeficiency viruses (SIV), or cricket paralysis viruses (CrPV).

5' -cap structure

[00320] A polynucleotide (eg, mRNA) may include a 5' cap structure. The 5'-cap structure of the polynucleotide is involved in the export of nuclei and the increase in the stability of the polynucleotide and binds the mRNA to the cap-binding protein (CBP), which is responsible for the stability of the polynucleotide in the cell and the ability to translate through the association of CBP with the poly-A binding protein to form mature cyclic types of mRNA. In addition, the cap promotes the removal of 5'-proximal introns during mRNA splicing.

[00321] Endogenous polynucleotide molecules can be represented by a 5' end capped forming a 5'-ppp-5' triphosphate bond between the terminal guanosine cap residue and the 5' end of the transcribed sense nucleotide of the polynucleotide. This 5'-guanylate cap can then be methylated to form an N7-methyl guanylate residue. The ribose sugars of the terminal and/or anteroterminal transcribed nucleotides at the 5' end of the polynucleotide may optionally also be 2'-O-methylated. The 5'-decapped by hydrolysis and cleavage of the guanylate cap structure can be directed to a polynucleotide molecule, such as an mRNA molecule, for degradation.

[00322] Alterations in polynucleotides can generate a non-hydrolyzable cap structure, preventing decapping and thus increasing the half-life of the polynucleotide. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5'-phosphoester bonds, alternative nucleotides may be present during the capping reaction. For example, the Vaccinia Capping enzyme from New England Biolabs (Ipswich, MA) can be used with α-thioguanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate bond in the 5'-ppp-5'-cap. Additional alternative guanosine nucleotides may be used, such as α-methylphosphonate and selenophosphate nucleotides.

[00323] Additional changes include, but are not limited to, 2'-O-methylation of the ribose sugars of the 5'-terminal and/or 5'-anteterminal nucleotides of the polynucleotide (as mentioned above) at the 2'-hydroxy group of the sugar. A variety of different 5' cap structures can be used to create the 5' cap of a polynucleotide, such as an mRNA molecule.

[00324] 5' cap structures include those described in International Patent Publication Nos. WO 2008127688, WO 2008016473, and WO 2011015347, the cap structures of each of which are incorporated herein by reference.

[00325] Cap analogs, which are also referred to herein as synthetic cap analogs, chemical cap derivatives, chemical cap analogs, or structural or functional cap analogs, are different from natural (i.e., endogenous, wild-type, or physiological) 5' -caps by its chemical structure, while retaining the cap function. Cap analogs can be chemically (ie, non-enzymatically) or enzymatically synthesized and/linked to a polynucleotide.

[00326] For example, an anti-reverse cap analog (ARCA) contains two guanosines linked by a 5'-5'-triphosphate group, where one guanosine contains an N7-methyl group as well as a 3'-O-methyl group (i.e. .N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7G-3'mpp-G, which can be equivalently denoted as 3' O-Me-m7G(5')ppp(5 ')G). The 3'-O atom of another unchanged guanosine becomes linked to the 5'-terminal nucleotide of the capped polynucleotide (eg, mRNA). N7- and 3'-O-methylated guanosine provides the terminal fragment of the capped polynucleotide (eg, mRNA).

[00327] Another illustrative example of a cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m ⁷ Gm-ppp-G).

[00328] The cap may be a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog can be modified at various phosphate positions with a boranophosphate group or a phosphoroselenate group, such as the dinucleotide cap analogs described in US Pat. No. 8,519,110, the cap structures of which are incorporated herein by reference.

[00329] Alternatively, the cap analog may be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and/or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5') ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5 ')ppp(5')G cap analog (see, for example, the various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574; cap structures in which are incorporated herein by reference). In other instances, the cap analog used in the polynucleotides of this invention is the 4-chloro/bromophenoxyethyl analog.

[00330] While cap analogs allow concomitant capping of a polynucleotide in an in vitro transcription reaction, up to 20% of the transcripts remain uncapped. This, as well as the structural differences of the cap analog from the endogenous 5'-cap structures of polynucleotides produced by the endogenous cellular transcription mechanism, can lead to a decrease in translational ability and a decrease in cell stability.

[00331] Alternative polynucleotides can also be capped after transcription using enzymes to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to a trait that closely mirrors or mimics, structurally or functionally, an endogenous or wild-type trait. Thus, a “more authentic” trait better reflects endogenous, natural, or physiological wild-type cellular function and/or structure compared to synthetic traits or prior art analogues, or which is superior to the corresponding endogenous, wild-type, natural, or physiological trait in one or more ways. several respects. Non-limiting examples of more authentic 5'-cap structures useful in the polynucleotides of this invention are those which, inter alia, have improved binding to cap-binding proteins, increased half-life, reduced susceptibility to 5'-endonucleases, and/or reduced 5 '-decapping compared to synthetic 5'-cap structures known in the art (or natural or physiological wild-type 5'-cap structure). For example, a recombinant vaccine virus entry restriction enzyme and a recombinant 2'-O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate bond between the 5'-terminal nucleotide of a polynucleotide and the cap guanosine of the nucleotide, with the cap guanosine containing N7 - methylation and the 5'-terminal nucleotide of the polynucleotide contains 2'-O-methyl. Such a structure is called a Cap1 structure. This cap results in higher translational capacity, cellular stability, and reduced activation of cellular pro-inflammatory cytokines compared to, for example, other similar structures with 5'-cap analogs known in the art. Other illustrative examples of cap structures include 7mG(5')ppp(5')N, pN2p (Cap 0), 7mG(5')ppp(5')NlmpNp (Cap 1), 7mG(5')-ppp(5 ')NlmpN2mp (Cap 2) and m(7)Gpm.d.(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap 4).

[00332] Because alternative polynucleotides can be capped post-transcriptionally, and because this process is more efficient, nearly 100% of the alternative polynucleotides can be present on their own. This is in contrast to ~80% when the cap analog is bound to the polynucleotide during an in vitro transcription reaction.

[00333] 5'-terminal caps may include endogenous caps or cap analogs. The 5'-terminal cap may include a guanosine analogue. Suitable guanosine analogs include inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deazaguanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azidoguanosine.

[00334] In some cases, the polynucleotide contains a modified 5' cap. Modification to the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and can increase the translation efficiency of the polynucleotide. The modified 5' cap may include, but is not limited to, one or more of the following modifications: modification at the 2' and/or 3' position of the capped guanosine triphosphate (GTP), replacement of the ring oxygen atom of the sugar (which produced the carbocyclic ring ) methylene fragment (CH ₂ ), modification in the triphosphate bridging fragment of the cap structure, or modification in the (G) fragment of the nucleic base.

5'-UTR

[00335] The 5'-UTR can be proposed as a flanking region to polynucleotides (eg, mRNA). The 5'-UTR may be homologous or heterologous to the coding region found in the polynucleotide. Multiple 5'-UTRs may be included in the flanking region and may be the same or different sequences. Any portion of the flanking regions, including none, may be an optimized codon, and any may independently contain one or more different structural or chemical changes before and/or after codon optimization.

[00336] Table 21 of U.S. Provisional No. 61/775509 and Table 21 and Table 22 of U.S. Provisional No. 61/829372, incorporated herein by reference, provide a list of start and stop sites for alternative polynucleotides (e.g., mRNA) . In Table 21, each 5'-UTR (5'-UTR-005 to 5'-UTR 68511) is identified by its start and stop site relative to its native or wild-type (homologous) transcript (ENST; identifier used in the ENSEMBL database ).

[00337] To change one or more properties of a polynucleotide (eg, mRNA), 5'-UTRs can be constructed that are heterologous to the coding region of an alternative polynucleotide (eg, mRNA). Polynucleotides (e.g., mRNA) can then be introduced into cells, tissues, or organisms, and results such as protein level, localization, and/or half-life can be measured on their own to evaluate the beneficial effects that the heterologous 5'-UTR can have on alternative polynucleotides (mRNA). 5'-UTR variants can be used where one or more nucleotides are added or removed at the ends, including A, T, C, or G. 5'-UTRs can also be codon-optimized or altered in any manner described herein. .

5'-UTR, 3'-UTR and translation enhancer elements (TEE)

[00338] The 5'-UTR of polynucleotides (eg, mRNA) may include at least one translation enhancing element. The term "translation enhancer element" refers to sequences that increase the amount of a polypeptide or protein produced from a polynucleotide. As a non-limiting example, a TEE may be located between a transcription promoter and an initiation codon. Polynucleotides (eg, mRNA) with at least one TEE in the 5'-UTR may include a cap in the 5'-UTR. In addition, at least one TEE may be located in the 5'-UTR of polynucleotides (eg, mRNA), undergoing cap-dependent or cap-independent translation.

[00339] In one aspect, TEEs are conserved elements in the UTR that can stimulate the translational activity of a polynucleotide, such as, but not limited to, cap-dependent or cap-independent translation. The conservation of these sequences has been previously demonstrated by Panek et al. (Nucleic Acids Research, 2013, 1-10) in 14 species, including humans.

[00340] In one non-limiting example, known TEEs may be in the 5' leader sequence of the Gtx homeodomain protein (Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004, TEEs of which are incorporated herein via link).

[00341] In another non-limiting example, TEEs are described in US Patent Publications Nos. 2009/0226470 and 2013/0177581, International Patent Publications Nos. WO 2009/075886, WO 2012/009644 and WO 1999/024595, and US Patent Nos. 9405, TEE sequence each of which are incorporated herein by reference.

[00342] In yet another non-limiting example, a TEE may be an internal ribosome entry site (IRES), an HCV-IRES, or an IRES element such as, but not limited to, those described in US Patent No. 7,468,275, US Patent Publications No. 2007/0048776 and 2011/0124100 and International Patent Publication Nos. WO 2007/025008 and WO 2001/055369, the IRES sequences of each of which are incorporated herein by reference. IRES elements may include, but are not limited to, the Gtx sequences (eg, Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005) and US Patent Publication Nos. 2007/0048776 and 2011/0124100 and International Patent Publication No. WO 2007/025008, the IRES sequences of each of which are incorporated herein by reference.

[00343] "Translational enhancer polynucleotides" are polynucleotides that include one or more of a particular TEE exemplified herein and/or described in the art (see, for example, US Pat. Nos. 6,310,197, 6849405, 7456273, 7183395, US Patent Publication No. 20090/226470, 2007/0048776, 2011/0124100, 2009/0093049, 2013/0177581, International Patent Publication No. WO 2009/075886, WO 2007/025008, WO 2012/009644, WO 2001/055371 WO 1999/024595 and European Patent Nos. 2610341 and 2610340, the TEE sequences of each of which are incorporated herein by reference) or variants, homologues or functional derivatives thereof. One or more copies of a particular TEE may be present in a polynucleotide (eg, mRNA). TEEs in translational enhancer polynucleotides may be organized into one or more sequence segments. A sequence segment may contain one or more of the specific TEEs exemplified herein, with each TEE present in one or more copies. When multiple sequence segments are present in a translational enhancer polynucleotide, they may be homogeneous or heterogeneous. Thus, multiple sequence segments in a translation enhancer polynucleotide may contain identical or different types of specific TEEs exemplified herein, identical or different copy numbers of each of the specific TEEs, and/or identical or different organization of TEEs in each sequence segment.

[00344] A polynucleotide (e.g., mRNA) may include at least one TEE as described in International Patent Publication Nos. EP 2610341 and 2610340, US Pat. 9 and 2013/0177581 and TEE sequences, each included in this document by reference. TEE can be located in the 5'-UTR of polynucleotides (eg, mRNA).

[00345] A polynucleotide (e.g., mRNA) may include at least one TEE that has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the TEE described in US Patent Publications No. 2009/0226470, 2007 /0048776, 2013/0177581 and 2011/0124100; 0340, US Pat. Nos. 6310197, 6849405, 7456273, 7183395, TEE sequences, each of which is incorporated herein by reference.

[00346] The 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19 at least 20 at least 21 at least 22 at least 23 at least 24 at least 25 at least 30 at least 35 at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 5'-UTR of a polynucleotide (eg, mRNA) may be the same or different TEE sequences. The TEE sequences may be in the form of a pattern such as ABABAB, AABBAABBAABB, or ABCABCABBC, or variants thereof, repeated once, twice, or more than three times. In these schemes, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[00347] In some cases, the 5'-UTR may contain a spacer to separate the two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and/or other spacers known in the art. As another non-limiting example, the 5'-UTR may include a TEE sequence delimiter repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 5'-UTR.

[00348] In other cases, the spacer separating two TEE sequences may include other sequences known in the art that can regulate the translation of polynucleotides (e.g., mRNA) of this invention, such as, but not limited to, miR (microRNA) sequences ) (e.g., miR binding sites and seed miRs). As a non-limiting example, each spacer used to separate two TEE sequences may contain a different miR sequence or a miR sequence component (eg, a miR seed sequence).

[00349] In some cases, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more than 99% of the TEE sequences disclosed in US Patent Publication Nos. 2009/0226470, 2007/0048776, 2013/0177581 and 2011/0124100, International Patent Publication Nos. WO 1999/024595, WO 2012/009644, WO 2009/075886 and WO 2007/0 25008, European Patent Publication No. 2610341 and 2,610,340 and US Pat. Nos. 6,310,197; 6,849,405; In another embodiment, the TEE in the 5'-UTR of polynucleotides (e.g., mRNA) of this invention may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, a 5-10 nucleotide fragment TEE sequences disclosed in US Patent Publications Nos. 2009/0226470, 2007/0048776, 2013/0177581 and 2011/0124100, International Patent Publications Nos. WO 2007/025008, European Patent Publications Nos. 2610341 and 2610340, and US Pat. Nos. 6310197, 6849405, 7456273 and 7183395; the TEE sequences of each of which are incorporated herein by reference.

[00350] In certain cases, the TEE in the 5'-UTR of polynucleotides (e.g., mRNA) of the present invention may contain at least 5%, at least 10%, at least 15%, at least 20%, at least 25 %, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences, disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), in Supplementary Table 1 and Supplementary Table 2, disclosed in Wellensiek et al (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOI:10.1038/ NMETH.2522); the TEE sequences of each of which are incorporated herein by reference. In another embodiment, the TEE in the 5'-UTR of polynucleotides (e.g., mRNA) of this invention may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, a 5-10 nucleotide fragment TEE sequences disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), in Supplementary Table 1 and Supplementary Table 2, disclosed in Wellensiek et al (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOI:10.1038/ NMETH.2522); the TEE sequences of which are incorporated herein by reference.

[00351] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is an IRES sequence such as, but not limited to, the sequences described in US Pat. No. 7,468,275 and International Patent Publication No. WO 2001/ 055369, the TEE sequences of each of which are incorporated herein by reference.

[00352] In some instances, TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) can be identified by the methods described in US Patent Publications Nos. 2007/0048776 and 2011/0124100 and International Patent Publications Nos. 2012/009644, the methods of each of which are incorporated herein by reference.

[00353] In some instances, the TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) of this invention may be a transcriptional regulatory element as described in US Pat. No. WO 2001/055371, the TEE sequences of each of which are incorporated herein by reference. Transcriptional regulatory elements can be identified by methods known in the art, such as, but not limited to, the methods described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Publication No. each of which are incorporated herein by reference.

[00354] In other instances, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is a polynucleotide, or a portion thereof, as described in US Pat. 2001/055371, the TEE sequences of each of which are incorporated herein by reference.

[00355] A 5'-UTR containing at least one TEE described herein can be included in a monocistronic sequence such as, but not limited to, a vector system or a polynucleotide vector. As a non-limiting example, vector systems and polynucleotide vectors may include those described in U.S. Patent Nos. 7,456,273 and 7,183,395; U.S. Patent Publications Nos. 2007/0048776; and WO 2001/055371, the TEE sequences of each of which are incorporated herein by reference.

[00356] The TEEs described herein can be located in the 5'-UTR and/or 3'-UTR of polynucleotides (eg, mRNA). The TEEs located in the 3'-UTR may be the same and/or different from the TEEs located and/or described for inclusion in the 5'-UTR.

[00357] In some cases, the 3'-UTR of a polynucleotide (e.g., mRNA) may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 3'-UTRs of the polynucleotides (eg, mRNA) of the invention may be the same or different TEE sequences. The TEE sequences may be in the form of a pattern such as ABABAB, AABBAABBAABB, or ABCABCABBC, or variants thereof, repeated once, twice, or more than three times. In these schemes, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[00358] In one instance, the 3'-UTR may contain a spacer to separate two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and/or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a TEE sequence delimiter repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 3'-UTR.

[00359] In other cases, the spacer separating two TEE sequences may include other sequences known in the art that can regulate the translation of polynucleotides (e.g., mRNA) of this invention, such as, but not limited to, miR (microRNA) sequences ) disclosed herein (eg, miR binding sites and miR seeders). As a non-limiting example, each spacer used to separate two TEE sequences may contain a different miR sequence or a miR sequence component (eg, a miR seed sequence).

[00360] In other cases, the inclusion of the miR sequence and/or the TEE sequence changes the shape of the loop region on the stem, which can increase and/or decrease translation (see, for example, Kedde et al. Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-22 accessibility Nature Cell Biology 2010).

Loops on the stem

[00361] Polynucleotides (eg, mRNA) may contain a stalk loop, such as, but not limited to, a stalk histone loop. A stem loop may be a nucleotide sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, described in International Patent Publication No. WO 2013/103659, which is incorporated herein by reference. The histone loop on the stem may be located 3' from the coding region (eg, at the 3' end of the coding region). As a non-limiting example, a stem loop may be located at the 3' end of a polynucleotide described herein. In some cases, a polynucleotide (eg, mRNA) contains more than one loop per stem (eg, two loops per stem). Examples of stem loop sequences are described in International Patent Publication Nos. WO 2012/019780 and WO 2015/02667, the stem loop sequences of which are incorporated herein by reference. In some cases, the polynucleotide contains the stem loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In others, the polynucleotide contains the stem loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

[00362] The stalk loop may be located at the second terminal region of the polynucleotide. As a non-limiting example, a stem loop may be located in the non-translated region (eg, 3'-UTR) at the second end region.

[00363] In some instances, a polynucleotide, such as, but not limited to, an mRNA that contains a histone loop on the stem, can be stabilized by adding a 3' stabilizing region (e.g., a 3' stabilizing region containing at least one terminal chain nucleoside). Without wishing to be bound by any theory, the addition of at least one terminal nucleoside of the chain may slow down the degradation of the polynucleotide and thus may increase the half-life of the polynucleotide.

[00364] In other instances, a polynucleotide, such as, but not limited to, an mRNA that contains a histone loop on the stem, can be stabilized by altering the 3' region of the polynucleotide, which can prevent and/or inhibit the addition of an oligo (U) (see ., for example, International Patent Publication No. WO 2013/103659).

[00365] In other instances, a polynucleotide, such as, but not limited to, an mRNA that contains a histone loop on the stem, can be stabilized by adding an oligonucleotide that ends in a 3'-deoxynucleoside, 2',3'-dideoxynucleoside, 3'- O-methylnucleoside, 3'-O-ethylnucleoside, 3'-arabinoside, and other alternative nucleosides known in the art and/or described herein.

[00366] In some instances, the polynucleotides of this invention may contain a stalk histone loop, a poly-A region, and/or a 5'-cap structure. The histone loop on the stem may be before and/or after the poly-A region. Polynucleotides containing a stalk histone loop and a poly A region sequence may contain a chain-terminated nucleoside as described herein.

[00367] In other cases, the polynucleotides of this invention may contain a histone loop on the stem and a 5'-cap structure. The 5' cap structure may include, but is not limited to, those described herein and/or known in the art.

[00368] In some cases, the conserved loop region on the stem may contain the miR sequence described herein. As a non-limiting example, a loop region on a stem may contain a miR seed sequence as described herein. In another non-limiting example, a stem loop region may contain a miR-122 seed sequence.

[00369] In some cases, the conserved stem loop region may contain the miR sequence described herein and may also contain the TEE sequence.

[00370] In some cases, the inclusion of the miR sequence and/or the TEE sequence changes the shape of the loop region on the stem, which can increase and/or decrease translation (see, for example, Kedde et al. A Pumilio-induced RNA structure switch in p27-3 'UTR controls miR-221 and miR-22 accessibility Nature Cell Biology 2010, incorporated herein by reference in its entirety).

[00371] Polynucleotides may contain at least one histone loop on the stem and a poly-A region or a polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding at least one histone loop on the stem and a poly-A region or a polyadenylation signal are described in International Patent Publication Nos. WO 2013/120498, WO 2013/120626, WO 2013/120499 and WO 2013/120628, the sequences of each of which are incorporated herein by reference. In certain instances, a polynucleotide encoding a stem histone loop and a poly-A region or a polyadenylation signal may encode a pathogenic antigen or fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. of which are incorporated herein by reference. In other instances, a polynucleotide encoding a stem histone loop and a poly-A region or a polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication Nos. WO 2013/120497 and WO 2013/120629, both of which include sequences to this document by reference. In some instances, a polynucleotide encoding a stalk histone loop and a poly-A region or polyadenylation signal may encode a tumor antigen or fragment thereof, such as the polynucleotide sequences described in International Patent Publication Nos. of which are incorporated herein by reference. In other cases, a polynucleotide encoding a stem histone loop and a poly-A region or a polyadenylation signal may encode an allergic antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in International Patent Publications No. WO 2013/120498 and WO 2013/120626, sequences of both of which are incorporated herein by reference.

Poly-A area

[00372] A polynucleotide or nucleic acid (eg, mRNA) may contain a polyA sequence and/or a polyadenylation signal. The polyA sequence may consist wholly or primarily of adenine nucleotides or analogs or derivatives thereof. The polyA sequence may be a tail adjacent to the 3' untranslated region of the nucleic acid.

[00373] During RNA processing, a long chain of adenosine nucleotides (poly-A region) is typically added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3' end of the transcript is cleaved off to release the 3'-hydroxy. The poly-A polymerase then adds a chain of adenosine nucleotides to the RNA. A process called polyadenylation adds a poly-A region of 100 to 250 residues in length.

[00374] The unique lengths of the poly-A region may provide certain advantages to the alternative polynucleotides of this invention.

[00375] Typically, the length of the poly-A region according to this invention is at least 30 nucleotides in length. In another embodiment, the poly-A region is at least 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[00376] In some cases, the poly-A region may be 80 nucleotides, 120 nucleotides, 160 nucleotides in length in the alternative polynucleotide molecule described herein.

[00377] In other instances, the poly-A region may be 20, 40, 80, 100, 120, 140, or 160 nucleotides in length in the alternative polynucleotide molecule described herein.

[00378] In some cases, the poly-A region is designed relative to the length of a common alternative polynucleotide. This construct may be based on the length of the coding region of the alternative polynucleotide, the length of a particular feature or region of the alternative polynucleotide (such as mRNA), or the length of the final product expressed from the alternative polynucleotide. When relative to any feature of an alternative polynucleotide (e.g., other than the mRNA region that contains the poly-A region), the poly-A region may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 % is longer in length than the additional feature. The poly-A region can also be constructed as part of an alternative polynucleotide to which it belongs. In this context, the poly-A region may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% or more of the total construct length, or the total construct length minus the poly-A region.

[00379] In some instances, engineered binding sites and/or polynucleotide (eg, mRNA) conjugation for a poly-A binding protein can be used to enhance expression. The designed binding sites can be sensor sequences that can act as binding sites for local polynucleotide microenvironment ligands (eg, mRNA). As a non-limiting example, polynucleotides (eg, mRNA) may contain at least one engineered binding site to change the binding affinity of poly-A binding protein (PABP) and its analogs. The inclusion of at least one engineered binding site may increase the binding affinity of PABP and its analogs.

[00380] In addition, many different polynucleotides (eg, mRNA) can be linked together with PABP (poly-A binding protein) through the 3'end using alternative nucleotides at the 3'end of the poly-A region. Transfection experiments can be carried out in appropriate cell lines, and protein production can be analyzed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours and 7 days after transfection. As a non-limiting example, transfection experiments can be used to evaluate the effect on binding affinity of PABP or analogs thereof by adding at least one engineered binding site.

[00381] In some cases, the poly-A region can be used to modulate translation initiation. Without wishing to be bound by any theory, the poly-A region recruits PABP, which in turn may interact with the translation initiation complex and thus may be required for protein synthesis.

[00382] In some cases, the poly-A region can also be used in this invention to protect against cleavage by 3'-5'-exonuclease.

[00383] In some cases, a polynucleotide (eg, mRNA) may contain a poly-A-G quartet. The G-quartet is a cyclic hydrogen array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is located at the end of the poly-A region. The resulting polynucleotides (eg, mRNA) can be analyzed for stability, protein production, and other parameters, including half-life at various time points. The poly-A-G quartet has been found to result in protein production equivalent to at least 75% of what is observed when using only the 120 nucleotide poly-A region.

[00384] In some cases, a polynucleotide (eg, mRNA) may contain a poly-A region and may be stabilized by adding a 3' stabilizing region. Polynucleotides (eg, mRNA) with a poly-A region may additionally contain a 5'-cap structure.

[00385] In other cases, a polynucleotide (eg, mRNA) may contain a poly-A-G quartet. Polynucleotides (eg, mRNA) with a poly-A-G quartet may additionally contain a 5'-cap structure.

[00386] In some cases, a 3' stabilizing region that can be used to stabilize a polynucleotide (e.g., mRNA) containing a poly A region or a poly AG quartet can be, without limitation, described in an international patent publication No. WO 2013/103659, poly-A-regions and poly-AG-quartets, which are incorporated herein by reference. In other cases, the 3'-stabilizing region that can be used in this invention contains a chain termination nucleoside such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'- deoxythymine, 2',3'-dideoxynucleosides such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'- dideoxythymine, 2'-deoxynucleoside or O-methylnucleoside.

[00387] In other cases, a polynucleotide, such as, without limitation, an mRNA that contains a poly-A region or a poly-AG quartet, can be stabilized by altering the 3' region of the polynucleotide, which can prevent and/or inhibit the addition of oligo(U ) (see, for example, International Patent Publication No. WO 2013/103659).

[00388] In still other cases, a polynucleotide, such as, without limitation, an mRNA that contains a poly-A region or a poly-AG quartet, can be stabilized by adding an oligonucleotide that ends in a 3'-deoxynucleoside, 2', 3'- dideoxynucleoside, 3'-O-methylnucleoside, 3'-O-ethylnucleoside, 3'-arabinoside, and other alternative nucleosides known in the art and/or described herein.

Chain termination nucleosides

[00389] The nucleic acid may contain a terminating nucleoside. For example, a chain termination nucleoside may include those nucleosides that are deoxygenated at the 2' and/or 3' positions of their sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine and 2',3'-dideoxythymine.

Other components

[00390] The composition of nanoparticles may contain one or more components in addition to those described in the previous sections. For example, the nanoparticle composition may contain one or more low molecular weight hydrophobic substances such as a vitamin (eg, vitamin A or vitamin E) or a sterol.

[00391] Nanoparticle compositions may also include one or more permeation enhancing molecules, carbohydrates, polymers, surface modifying agents, or other components. The penetration enhancer molecule may be as described in, for example, US Patent Application Publication No. 2005/0222064. Carbohydrates may include simple sugars (eg glucose) and polysaccharides (eg glycogen and its derivatives and analogs).

[00392] The polymer can be incorporated into and/or used to encapsulate or partially encapsulate the nanoparticle composition. The polymer may be biodegradable and/or biocompatible. The polymer may be selected from, without limitation, polyamines, polyesters, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polysterols, polyamides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneemines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. For example, the polymer may include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly( lactic acid-glycolic acid) (PLGA), poly(L-lactic acid-glycolic acid) (PLLGA), poly(d,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(d, L-lactide-co-caprolactone), poly(d,L-lactide-co-caprolactone-co-glycolide), poly(d,L-lactide-co-PEO-co-D, L-lactide), poly(d ,L-lactide-co-PPO-co-D, L-lactide), polyalkyl cyanoacrylate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids) , polyanhydrides, polyorthoethers, poly(etheramides), polyamides, poly(esters), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly( ethylene terephthalates), polyvinyl alcohols (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone (PVP), polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkylcelluloses, hydroxyalkylcelluloses, cellulose ethers, cellulose esters, nitrocelluloses, hydroxypropylcellulose, carboxymethylcellulose, acrylic acid polymers such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly( butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate ), poly(methyl acrylate), poly(isopropylacrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and their copolymers and mixtures, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamers, polyoxamines, poly(ortho)ethers, poly( butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, poly(N-acryloylmorpholine) (PAcM), poly(2-methyl-2-oxazoline) (PMOX), poly(2-ethyl -2-oxazoline) (PEOZ) and polyglycerol.

[00393] Surface modifying agents may include, without limitation, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecylammonium bromide), sugars, or sugar derivatives (e.g., cyclodextrin) , nucleic acids, polymers (eg, heparin, polyethylene glycol, and poloxamer), mucolytic agents (eg, acetylcysteine, mugwort extract, bromelain, papain, clerodendrum, bromhexine, carbocysteine, eprasinone, mesnu, ambroxol, sobreroline, sesteropin, thiodeol, thiodol, thiomol ), gelsolin, thymosin β4, dornase alfa, neltenexin and erdostein) and DNases (eg rhDNase). The surface modifying agent may be located within the nanoparticles and/or on the surface of the nanoparticle composition (eg, by coating, adsorption, covalent bonding, or other process).

[00394] The nanoparticle composition may also contain one or more functionalized lipids. For example, a lipid may be functionalized with an alkyne group which, when exposed to an azide under appropriate reaction conditions, may undergo a cycloaddition reaction. In particular, the lipid bilayer may be functionalized in this way with one or more groups useful for facilitating membrane penetration, cell recognition, or imaging. The surface of the nanoparticle composition can also be conjugated to one or more useful antibodies. Functional groups and conjugates used for targeted cell delivery, imaging, and membrane penetration are well known in the art.

[00395] In addition to these components, the nanoparticle compositions may contain any substance useful in pharmaceutical compositions. For example, the nanoparticle composition may contain one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as, without limitation, one or more solvents, dispersion media, diluents, dispersion additives, suspension additives, granulating aids, disintegrants, fillers, glidants, liquid carriers, binders, surfactants, isotonic agents, thickeners or emulsifiers, buffering agents, lubricants, oils, preservatives and others. Excipients such as waxes, oils, colorants, coating agents, fragrances and fragrances may also be included in the composition. Pharmaceutically acceptable excipients are well known in the art (see, for example, Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[00396] Examples of diluents may include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, and/or combinations thereof. Granulating and dispersing agents may be selected from a non-limiting list consisting of potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation exchangers. resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, microcrystalline starch, water-insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, quaternary ammonium compounds, and/or combinations thereof.

[00397] Surfactants and/or emulsifiers may include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrus, cholesterol, xanthan, pectin, gelatin, egg yolk, casein , wool grease, cholesterol, wax and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and VEEGUM® [magnesium aluminum silicate]), derivatives of long chain amino acids, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glycerol monostearate and propylene monostearate glycol, polyvinyl alcohol), carbomers (e.g. carboxypolymethylene, polyacrylic acid, acrylic acid polymer and carboxyvinyl polymer), carrageenan, cellulose derivatives (e.g. sodium carboxymethylcellulose, cellulose powder, hydroxymethylcellulose, hydroxypropylcellulose, propylhydroxymethyl cellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [TWEEN®20] sorbitan polyethane) [TWEEN® 60], polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], sorbitan monostearate [SPAN®60] , sorbitan tristearate [SPAN®65], glyceryl monooleate, sorbitan monooleate [SPAN®80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [MYRJ® 45], polyoxyethylene hydrogenated castor oil, polyurethoxyl, polyethoxyl) stearate and SOLUTOL®), sucrose fatty acid esters , polyethylene glycol fatty acid esters (e.g. CREMOPHOR®), polyoxyethylene ethers (e.g. polyoxyethylene lauryl ether [BRIJ® 30]), poly(vinyl pyrrolidone), diethylene glycol monolaurate, triethanolaminoleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid , ethyl laurate, sodium lauryl sulfate, PLURONIC®F 68, POLOXAMER® 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, sodium docusate, and/or combinations thereof.

[00398] The binding agent may be starch (eg, corn starch and starch paste); gelatin; sugars (eg sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., acacia, sodium alginate, Irish moss extract, panwar gum, ghatti gum, psyllium husk mucus, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinylpyrrolidone), magnesium aluminum silicate (VEEGUM®) and larch arabinogalactan); alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohol; and combinations thereof, or any other suitable coupling agent.

[00399] Examples of preservatives may include, but are not limited to, antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and/or other preservatives. Examples of antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerin, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and/or sodium sulfite. Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphorous acid, sodium edetate, tartaric acid and/or trisodium edetate. Examples of antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidourea, phenol, phenylethyl alcohol, phenylmercury nitrate, propylene glycol and/or thimerosal. Examples of antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and/or sorbic acid. Examples of alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, benzyl alcohol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and/or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and/or phytic acid. Other preservatives include, but are not limited to, tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium laureth sulfate (SLES), sodium bisulfite, sodium metabisulfite , potassium sulfite, potassium metabisulfite, GLYDANT PLUS®, PHENONIP®, methylparaben, GERMALL® 115, GERMABEN®II, NEOLONE™, KATHON™ and/or EUXYL®.

[00400] Examples of buffering agents include, but are not limited to, citrate buffers, acetate buffers, phosphate buffers, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid , calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphorous acid, tribasic calcium phosphate, calcium phosphate hydroxide, potassium acetate, potassium chloride, potassium gluconate, mixtures of potassium salts, dibasic potassium phosphate , potassium phosphate monobasic, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, sodium phosphate dibasic, sodium phosphate monobasic, sodium phosphate mixtures, tromethamine, aminosulfonate buffers (e.g. HEPES), magnesium hydroxide , aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and/or combinations thereof. Lubricants may be selected from the non-limiting group consisting of magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, lauryl sulfate sodium and combinations thereof.

[00401] Examples of oils include, but are not limited to, almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, juniper, chamomile, rapeseed, cumin, carnauba, castor oil, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish oil, linseed, geraniol, pumpkin, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, lacquer fruit, lavandin, lavender, lemon, cubeb lyceum , macadamia nut, mallow, mango seeds, meadowfoam seeds, mink fat, nutmeg, olive, orange, Atlantic bighead fat, palm, palm kernel, peach kernels, peanut, poppy seeds, pumpkin, rapeseed, rice bran, rosemary, safflower, sandalwood, sakvana, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, milk thistle, camellia, vetiver, walnut and wheat germ oils, as well as butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, simethicone, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and/or combinations thereof.

Preparations.

[00402] Nanoparticle compositions may contain a lipid component and one or more additional components such as therapeutic and/or prophylactic agents. The composition of nanoparticles may be intended for one or more specific applications or purposes. The elements of the nanoparticle composition may be selected based on a particular application or purpose and/or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more of the elements. Likewise, a particular formulation of the nanoparticle composition may be selected for a particular application or target according to, for example, the efficacy and toxicity of particular combinations of elements.

[00403] The lipid component of the nanoparticle composition may comprise, for example, a lipid of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) a phospholipid (such as an unsaturated lipid, eg DOPE or DSPC), a PEG lipid, and a structural lipid. The lipid component elements can be offered in certain fractions.

[00404] In some embodiments, the lipid component of the nanoparticle composition comprises a lipid of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), phospholipid, PEG lipid and structural lipid. In specific embodiments, the lipid component of the nanoparticle composition contains from about 30 to about 60% moles of a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId) , (IIe), (IIf), (IIg) or (III), from about 0 mol% to about 30% mol of phospholipid, from about 18.5% mol to about 48.5% mol of structural lipid, and from about 0% mol to about 10% mol of PEG lipid, provided that the total % mol does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises from about 35 to about 55 mole % of a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId) , (IIe), (IIf), (IIg) or (III), from about 5 mol% to about 25 mol% of phospholipid, from about 30 mol% to about 40 mol% of structural lipid, and from about 0 mol% to about 10 % mole of PEG lipid. In a specific embodiment, the lipid component contains about 50 mole % of said compound, about 10 mole % of phospholipid, about 38.5 mole % of structural lipid, and about 1.5 mole % of PEG lipid. In another embodiment, the lipid component contains about 40 mole % of said compound, about 20 mole % phospholipid, about 38.5 mole % structural lipid, and about 1.5 mole % PEG lipid. In some embodiments, the phospholipid may be DOPE or DSPC. In other embodiments, the PEG lipid may be PEG-DMG and/or the structural lipid may be cholesterol.

[00405] Nanoparticle compositions may be designed for one or more specific uses or purposes. For example, the nanoparticle composition may be designed to deliver a therapeutic and/or prophylactic agent, such as RNA, to a specific cell, tissue, organ, or system or group in a mammalian body. The physico-chemical properties of nanoparticle compositions can be modified to increase selectivity for certain targets in the body. For example, particle sizes can be adjusted depending on the sizes of various organs. The therapeutic and/or prophylactic agent included in the nanoparticle composition may also be selected based on the desired target or targets for delivery. For example, a therapeutic and/or prophylactic agent may be selected for a particular indication, condition, disease, or disorder and/or for delivery to a particular cell, tissue, organ, or system, or group thereof (eg, localized or specific delivery). In specific embodiments, the nanoparticle composition may include an mRNA encoding a polypeptide of interest capable of being translated in a cell to produce the polypeptide of interest. Such a composition may be designed for a specific delivery to a specific organ. In some embodiments, the implementation of the composition may be designed for specific delivery to the liver of a mammal.

[00406] The amount of therapeutic and/or prophylactic agent in the nanoparticle composition may depend on the size, composition, desired purpose and/or use, or other properties of the nanoparticle composition, as well as the properties of the therapeutic and/or prophylactic agent. For example, the amount of RNA suitable for nanoparticle composition may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and/or prophylactic and other elements (eg lipids) in the nanoparticle composition may also vary. In some embodiments, wt./wt. the ratio of the lipid component to the therapeutic and/or prophylactic component in the nanoparticle composition can be from about 5:1 to about 60:1, for example, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1 , 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35 :1, 40:1, 45:1, 50:1 and 60:1. For example, wt./wt. the ratio of lipid component to therapeutic and/or prophylactic agent may be from about 10:1 to about 40:1. In specific embodiments, wt./wt. the ratio is about 20:1. The amount of therapeutic and/or prophylactic agent in the nanoparticle composition can, for example, be measured by absorption spectroscopy (eg, visible in the ultraviolet range of spectroscopy).

[00407] In some embodiments, the nanoparticle composition contains one or more RNAs, and one or more RNAs, lipids, and amounts thereof can be selected to provide a particular N:P ratio. The N:P ratio in a composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. Generally, a lower N:P ratio is preferred. One or more RNAs, lipids, and amounts thereof may be selected to provide an N:P ratio of about 2:1 to about 30:1, e.g., 2:1, 3:1, 4:1, 5:1, 6 :1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1 , 28:1 or 30:1. In particular embodiments, the N:P ratio may be from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about 5:1 to about 8:1. For example, the N:P ratio may be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1 . For example, the N:P ratio may be about 5.67:1.

Physical Properties

[00408] The characteristics of the composition of nanoparticles may depend on their components. For example, a nanoparticle composition that includes cholesterol as a structural lipid may have different characteristics than a nanoparticle composition that includes a different structural lipid. Likewise, the characteristics of a nanoparticle composition may depend on the absolute or relative amount of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipid may have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipid. Characteristics may also vary depending on the method and conditions of preparation of the composition of nanoparticles.

[00409] Nanoparticle compositions can be characterized in a variety of ways. For example, microscopy (eg, transmission electron microscopy or scanning electron microscopy) can be used to study the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (eg potentiometric titration) can be used to measure zeta potentials. Dynamic light scattering can also be used to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure a variety of nanoparticle composition characteristics such as particle size, polydispersity ratio, and zeta potential.

[00410] The average size of the composition of nanoparticles can be from 10 s to 100 nm, for example, measured by dynamic light scattering (DLS). For example, the average size may be from about 40 nm to about 150 nm, for example, about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm. In some embodiments, the average nanoparticle size in the composition may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 150 nm , about 70 nm to about 130 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 150 nm, from about 80 nm up to about 130 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, about 90 nm to about 150 nm, about 90 nm to about 130 nm, or about 90 nm to about 100 nm. In specific embodiments, the average size of the nanoparticle composition may be from about 70 nm to about 130 nm, or from about 70 nm to about 100 nm. In a specific embodiment, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm. In other embodiments, the average size may be about 120 nm.

[00411] The composition of the nanoparticles can be relatively homogeneous. The polydispersity coefficient can be determined to indicate the uniformity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle compositions. A small (eg, less than 0.3) polydispersity index usually indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity factor of from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0, 08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24 or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition may be from about 0.10 to about 0.20.

[00412] The zeta potential of a nanoparticle composition can be used to denote the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. As a rule, nanoparticle compositions with relatively low charges, positive or negative, are desirable, since more charged particles may interact undesirably with cells, tissues and other elements in the body. In some embodiments, the zeta potential of the nanoparticle composition may be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV , about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[00413] Encapsulation efficiency of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with the nanoparticle composition after formulation, relative to the initial amount. It is desirable that the encapsulation efficiency be high (eg close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in the solution containing the nanoparticle composition before and after the nanoparticle composition is broken down by one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agent (eg, RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and/or prophylactic agent can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In specific embodiments, the encapsulation efficiency may be at least 90%.

[00414] The nanoparticle composition may optionally contain one or more coatings. For example, the composition of the nanoparticles may be in the form of a coated capsule, film, or tablet. The capsule, film, or tablet comprising the composition described herein may be of any suitable size, tensile strength, hardness, or density.

Pharmaceutical compositions

[00415] Nanoparticle compositions can be wholly or partially formulated as pharmaceutical compositions. Pharmaceutical compositions may include one or more nanoparticle compositions. For example, a pharmaceutical composition may include one or more nanoparticle compositions, including one or more different therapeutic and/or prophylactic agents. Pharmaceutical compositions may additionally include one or more pharmaceutically acceptable excipients or adjuvants such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents are available, for example, in Remington The Science and Practice of Pharmacy , 21st edition, AR Gennaro; Lippincott, Williams & Wilkins, Baltimore, Maryland, 2006. Conventionally accepted excipients and auxiliary components can be used in any pharmaceutical composition, except that any accepted excipient or auxiliary component may be considered incompatible with one or more components of the nanoparticle composition. An excipient or auxiliary component may be incompatible with a component of the nanoparticle composition if its combination with the component may lead to an undesirable biological effect or other harmful effects.

[00416] In some embodiments, one or more excipients or auxiliary components may constitute more than 50% of the total weight or volume of the pharmaceutical composition, including the composition of nanoparticles. For example, one or more excipients or auxiliary components may constitute 50%, 60%, 70%, 80%, 90% or more of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable excipient is at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99% pure, or 100% pure. In some embodiments, the excipient is approved for use in humans and for veterinary use. In some embodiments, the implementation of the excipient is approved by the US Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the implementation of the excipient complies with the standards of the United States Pharmacopoeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia and/or International Pharmacopoeia.

[00417] The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and/or any additional components in the pharmaceutical composition of this invention will vary depending on the individual, size and/or condition of the subject being treated, and further depending on from the way in which the composition is to be entered. For example, a pharmaceutical composition may contain from 0.1 to 100% (w/w) of one or more nanoparticle compositions.

[00418] In specific embodiments, the nanoparticle compositions and/or pharmaceutical compositions of this invention are refrigerated or frozen for storage and/or shipping (e.g., when stored at or below 4°C, such as between about -150°C and around 0°C or between around -80°C and around -20°C (e.g. around -5°C, -10°C, -15°C, -20°C, -25°C, -30° C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C or -150°C) For example, a pharmaceutical composition containing the compound any of formulas (I), (IA), (IB), (II) and (IIa) - (IIg), is a solution that is cooled for storage and/or shipment at, for example, about -20°C, - 30°C, -40°C, -50°C, -60°C, -70°C or -80°C In specific embodiments, the description also relates to a method for improving the stability of nanoparticle and/or pharmaceutical compositions comprising the compound any of formulas (I), (IA), (IB), (II) and (IIa)-(IIg) by storing the nanoparticle compositions and/or pharmaceutical compositions at a temperature of 4°C or lower, such as a temperature between about -150 °C and around 0°C or between around -80°C and around -20°C, e.g. around -5°C, -10°C, -15°C, -20°C, -25°C, - 30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C or -150°C). For example, the nanoparticle compositions and/or pharmaceutical compositions described herein are stable for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, e.g., at or below 4°C (e.g., between about 4°C C and -20°C). In one embodiment, stabilized for at least 4 weeks at about 4°C. In specific embodiments, the pharmaceutical composition of this invention comprises the nanoparticle composition described herein and a pharmaceutically acceptable carrier selected from one or more of Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS and sucrose. In specific embodiments, the pharmaceutical composition of this invention has a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7, 5, 7 6, 7.7, 7.8, 7.9 or 8.0, or between 7.5 and 8 or between 7 and 7.8). For example, the pharmaceutical composition of this invention contains the composition of nanoparticles described herein, Tris, saline and sucrose and has a pH of about 7.5-8, which is suitable for storage and/or shipping at, for example, about -20°C. For example, the pharmaceutical composition of this invention contains the composition of the nanoparticles described herein and PBS and has a pH of about 7-7.8, suitable for storage and/or shipping at, for example, about 4°C or below. "Stability", "stabilized" and "stable" in the context of this invention refers to the resistance of the compositions of nanoparticles and/or pharmaceutical compositions described in this invention to chemical or physical changes (for example, degradation, change in particle size, aggregation, change in encapsulation, etc.). e) under given conditions of manufacture, preparation, transport, storage and/or use, e.g. when stress is applied such as shear, freeze/thaw stress, etc.

[00419] Nanoparticle compositions and/or pharmaceutical compositions containing one or more nanoparticle compositions may be administered to the patient or subject himself, including those patients or subjects who may, regardless of the therapeutic effect, be provided with the delivery of a therapeutic and/or prophylactic agent to one or more specific cells, tissues, organs or systems or groups thereof, such as the renal system. While the nanoparticle compositions and pharmaceutical compositions provided herein, including nanoparticle compositions, are generally directed to compositions that are suitable for administration to humans, one of ordinary skill in the art will appreciate that such compositions are generally suitable for administration to any other mammal. Modification of compositions suitable for administration to humans in order to make compositions suitable for administration to various animals is well understood and the average veterinary pharmacologist can design and/or perform such modification simply by routine, if any, experimentation. Subjects for which administration of the compositions is contemplated include, but are not limited to, humans, other primates, and other mammals, including commercial mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats.

[00420] A pharmaceutical composition comprising one or more nanoparticle compositions may be prepared by any method known or further developed in the field of pharmacology. Typically, such preparation methods involve bringing the active ingredient into association with an excipient and/or one or more other auxiliary ingredients, and then, if desired or necessary, separating, shaping and/or packaging the product into the desired single or multiple unit dose.

[00421] The pharmaceutical composition of this invention can be prepared, packaged and/or sold in bulk, as a unit dose and/or as multiple unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (eg, a nanoparticle composition). The amount of the active ingredient is generally equal to the dosage of the active ingredient that is administered to the subject and/or a convenient fraction of that dosage, such as, for example, half or one third of that dosage.

[00422] Pharmaceutical compositions can be prepared in various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions may be formulated into liquid dosage forms (eg, emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injections, solid dosage forms (eg, capsules, tablets, pills, powders, and granules), topical and/or transdermal administration forms (eg ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.

[00423] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and/or elixirs. In addition, active ingredients, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (particularly cottonseed, peanut, corn, wheat germ, olive, castor, and sesame oils), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycols, and fatty acid esters of sorbitol, and also their mixtures. In addition to inert diluents, oral compositions may include additional therapeutic and/or prophylactic agents, additional agents such as wetting agents, emulsifying and suspending agents, sweeteners, flavoring agents, and/or flavoring agents. In specific embodiments, for parenteral administration, the compositions are admixed with solubilizing agents such as Cremophor®, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof.

[00424] Injectable preparations, for example sterile injectable aqueous or oily suspensions, can be formulated according to the known art using suitable dispersing agents, wetting agents and/or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions and/or emulsions in non-toxic parenterally acceptable diluents and/or solvents, for example as a solution in 1,3-butanediol. Acceptable carriers and solvents that may be used are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. Sterile, fixed oils are traditionally used as a solvent or suspending medium. For this purpose, any low-flavor fixed oil can be used, including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

[00425] Injectable preparations can be sterilized, for example, by filtration through a bacteria-retaining filter and/or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[00426] In order to prolong the action of the active ingredient, it is often desirable to slow down the absorption of the active ingredient from subcutaneous or intramuscular injection. This may be the use of a liquid suspension of a crystalline or amorphous material with poor water solubility. The rate of drug absorption depends on its rate of dissolution, which, in turn, may depend on the size of the crystals and the crystalline form. Alternatively, delaying the absorption of a parenterally administered dosage form can be achieved by dissolving or suspending the drug in an oily carrier medium. Depot injectables are prepared by forming microencapsulated drug matrices in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, as well as the nature of the particular polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectables are prepared by trapping the drug in liposomes or microemulsions that are compatible with body tissues.

[00427] Compositions for rectal or vaginal administration are typically suppositories, which can be prepared by mixing the compositions with suitable non-irritating excipients such as cocoa butter, polyethylene glycol, or suppository wax that are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active ingredient.

[00428] Solid dosage forms for oral administration include capsules, tablets, pills, films, powders and granules. In such solid dosage forms, the active ingredient is mixed with at least one inert pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and/or excipients or diluents (for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders ( e.g. carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose and acacia), humectants (e.g. glycerol), disintegrants (e.g. agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate), dissolution retarders (e.g. , paraffin), absorption accelerators (eg, quaternary ammonium compounds), wetting agents (eg, cetyl alcohol and glycerol monostearate), absorbents (eg, kaolin and bentonite clay, silicates), and lubricants (eg, talc, calcium stearate, magnesium stearate , solid polyethylene glycols, sodium lauryl sulfate) and mixtures thereof. In the case of capsules, tablets and pills, the dosage forms may additionally contain buffering agents.

[00429] Solid compositions of a similar type can be used as fillers in soft and hard gelatin capsules using excipients such as lactose or milk sugar, as well as high molecular weight polyethylene glycols, and the like. Solid dosage forms of tablets, dragees, capsules, pills and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical art. They may additionally optionally contain opacifiers and may be compositions that release the active ingredient(s) only or preferentially in a certain part of the intestine, optionally in a delayed manner. Examples of encapsulating compositions that may be used include polymeric materials and waxes. Solid compositions of a similar type can be used as fillers in soft and hard gelatin capsules using excipients such as lactose or milk sugar, as well as high molecular weight polyethylene glycols, and the like.

[00430] Dosage forms for topical and/or transdermal administration of the composition may include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and/or patches. Typically, the active ingredient is mixed under sterile conditions with a pharmaceutically acceptable excipient and/or any necessary preservatives and/or buffers that may be necessary. In addition, the invention contemplates the use of transdermal patches, which often have the added benefit of providing controlled delivery of a compound to the body. Such dosage forms can be prepared, for example, by dissolving and/or distributing the compound in a suitable medium. Alternatively or additionally, the rate can be controlled either by providing a rate-regulating membrane and/or by dispersing the compound in a polymer matrix and/or gel.

[00431] Suitable devices for use in delivering the intradermal pharmaceutical compositions described herein include short needle devices such as those described in US Pat. Nos. 4,886,499; 5190521; 5328483; 5527288; 4270537; 5015235; 5141496; and 5,417,662. Compositions for intradermal administration may be administered using devices that limit the effective length of needle penetration into the skin, such as those described in PCT publication WO 99/34850 and their functional equivalents. Suitable are needleless injection devices that deliver liquid compositions to the dermis via a liquid ejector and/or through a needle that pierces the stratum corneum and creates a jet that reaches the dermis. Jet injection devices are described in, for example, US Pat. Nos. 5,480,381; 5599302; 5334144; 5993412; 5649912; 5569189; 5704911; 5383851; 5893397; 5,466,220; 5339163; 5312335; 5503627; 5064413; 5520639; 4596556; 4790824; 4941880; 4940460; and PCT Publications WO 97/37705 and WO 97/13537. Suitable ballistic powder/particle delivery devices use pressurized gas to accelerate the delivery of the vaccine in powder form through the outer layers of the skin and into the dermis. Alternatively or additionally, conventional syringes may be used in the classical Mantoux method of intradermal administration.

[00432] Formulations suitable for topical application include, but are not limited to, liquid and/or semi-liquid preparations such as liniments, lotions, oil in water and/or water in oil emulsions such as creams, ointments and/or pastes and/or solutions and/or suspensions. Compositions for topical administration may, for example, contain from about 1% to about 10% (w/w) of the active ingredient, although the concentration of the active ingredient may appear to be as high as the solubility limit of the active ingredient in the solvent. Preparations for topical use may additionally contain one or more additional components described in this document.

[00433] The pharmaceutical composition may be formulated, packaged and/or sold in a formulation suitable for pulmonary administration through the oral cavity. Such a formulation may contain dry particles which contain the active ingredient. Such compositions are conventionally in the form of dry powders for administration using a device containing a dry powder reservoir into which a propellant stream can be directed to disperse the powder, and/or using a self-propelled solvent/powder dispenser, such as a device containing an active ingredient. , dissolved and/or suspended in a low boiling propellant in a sealed container. Dry powder compositions may contain a solid fine powder diluent such as sugar and are typically provided in unit dose form.

[00434] Low boiling propellants typically include liquid propellants having a boiling point below 65°F at atmospheric pressure. Typically, the propellant may comprise 50 to 99.9% (w/w) of the composition and the active ingredient may comprise 0.1 to 20% (w/w) of the composition. The propellant may further contain additional components such as a liquid non-ionic and/or solid anionic surfactant and/or a solid diluent (which may have a particle size of the same order as the particles containing the active ingredient).

[00435] Pharmaceutical compositions formulated for pulmonary delivery may provide the active ingredient in the form of solution and/or suspension droplets. Such preparations may be prepared, packaged and/or sold as aqueous and/or dilute alcoholic solutions and/or suspensions, optionally sterile, containing the active ingredient, and may be conveniently administered using any type of nebulization and/or nebulization device. Such preparations may additionally contain one or more additional components, including, but not limited to, a flavoring agent such as sodium saccharin, a volatile oil, a buffering agent, a surfactant, and/or a preservative such as methyl hydroxybenzoate. The droplets provided by this administration may have an average diameter ranging from about 1 nm to about 200 nm.

[00436] The formulations described herein as being suitable for pulmonary delivery are also suitable for intranasal delivery of the pharmaceutical composition. Another formulation suitable for intranasal administration is a coarse powder containing the active ingredient and having an average particle size of about 0.2 to 500 microns. Such a drug is administered by sniffing, that is, by rapidly inhaling through the nasal passage from a container of powder held close to the nose.

[00437] Formulations suitable for nasal administration may, for example, contain from about 0.1% (w/w) to 100% (w/w) of the active ingredient and may contain one or more additional components, described in this document. The pharmaceutical composition may be formulated, packaged and/or sold in a formulation suitable for buccal administration. Such preparations may, for example, be in the form of tablets and/or lozenges prepared using conventionally accepted methods and may, for example, contain from 0.1 to 20% (w/w) of the active ingredient, the remainder containing soluble in oral cavity and/or degradable composition and, optionally, one or more additional components described in this document. Alternatively, preparations suitable for buccal administration may contain a powder and/or aerosol and/or spray solution and/or suspension containing the active ingredient. Such powder, aerosol, and/or aerosol formulations, when dispersed, may have an average particle and/or droplet size in the range of about 0.1 nm to about 200 nm, and may further contain one or more of any of the additional components described herein.

[00438] The pharmaceutical composition may be formulated, packaged and/or sold in a formulation suitable for ophthalmic administration. Such formulations may, for example, be in the form of eye drops, including, for example, a 0.1/1.0% (w/w) solution and/or suspension of the active ingredient in an aqueous or oily liquid excipient. Such drops may additionally contain buffering agents, salts and/or one or more of any other additional components described herein. Other ophthalmologically administered preparations which are useful include those containing the active ingredient in microcrystalline form and/or in a liposomal formulation. Ear drops and/or eye drops are intended to be within the scope of this invention.

mRNA therapy

[00439] mRNA as a drug has the ability to deliver transmembrane and intracellular proteins, i. targets that standard biologics cannot access due to their inability to cross the cell membrane. ( See Sahin, U., Karikó K., Türeci Ö. Nat. Rev. Drug. Discov. 2014, 13 , 759-780, the entire contents of which are incorporated herein by reference). One of the main problems associated with the implementation of mRNA-based therapy is the determination of the optimal delivery vehicle. Due to its large size, chemical instability, and potential immunogenicity, mRNA requires a delivery vehicle that can provide protection against endo- and exonucleases, as well as protect the cargo from immune guardians. Lipid nanoparticles (LNPs) have been identified as the leading option in this regard. (See Hajj, KA, Whitehead, KA Nat. Rev. Mater. 2017, 2 , 1-17, the entire contents of which are incorporated herein by reference). This approach has recently been validated by demonstrating the safe and efficient delivery of an mRNA-based vaccine formulated with LNP. ( See Bahl, K. et al . Mol. Ther. 2017, 25 , 1316-1327, the entire contents of which are incorporated herein by reference.)

[00440] Key criteria for the effectiveness of a lipid nanoparticle delivery system are maximizing cellular uptake and ensuring efficient mRNA release from the endosome. At the same time, LNP must provide a stable drug product and be able to safely dose at therapeutically relevant levels. LNPs are multicomponent systems that typically consist of an aminolipid, a phospholipid, cholesterol, and a PEG lipid. Each component is essential to aspects of efficient delivery of nucleic acid cargo and stability of the particle. The key component thought to stimulate cellular uptake, endosomal release and tolerability is the aminolipid. Cholesterol and PEG-lipid contribute to the stability of the drug product both in vivo and on the shelf, while the phospholipid provides additional fusogenicity of LNP, thereby facilitating the removal of endosomes and ensuring the bioavailability of the nucleic acid in the cell cytosol.

[00441] Over the past couple of decades, several series of lipids have been developed for the delivery of oligonucleotides. ( See Stanton MG, Murphy-Benenato, KE RNA Therapeutics. Topics in Medicinal Chemistry, 2017, volume 27, A. Garner eds., (Springer, Cham) pp. 237-253, the contents of which are incorporated herein in their entirety. via link). The literature highlights direct links between aminolipid structure and resulting LNP delivery efficiency and tolerability. The MC3 aminolipid (DLin-MC3-DMA) is the most clinically developed oligonucleotide delivery system since siRNA formulated with MC3-based LNP has entered phase III for the treatment of transthyretin-mediated amyloidosis. ( See Coelho, T. et al . N. Engl. J. Med. 2013, 369 , 819-829.; Butler, JS et al . Amyloid 2016, 23 , 109-118, the entire contents of which are incorporated herein by links). More recently, literature reports have demonstrated the effectiveness of MC3-based LNP for mRNA delivery. ( See Nanbhan, JF et al . Sci. Rep. 2016, 6 , 20019, the entire contents of which are incorporated herein by reference.) LNPs of this class are rapidly opsonized by apolipoprotein E (ApoE) when delivered intravenously, allowing cellular uptake by the lipoprotein receptor low density (LDLr). ( See Akinc, A. et al . Mol. Ther. 2010, 18 , 1357-1364, the entire contents of which are incorporated herein by reference.) However, concerns still exist that the long tissue half-life of MC3 may contribute to adverse side effects preventing its use in chronic therapy. ( See Maier MA et al. Mol . Ther. 2013, 21 , 1570-1578, the full contents of which are incorporated herein by reference.) In addition, numerous literature data suggest that chronic dosing of lipid nanoparticles can cause several toxic side effects, including complement-activated pseudo-allergy (CARPA) and liver injury (see Szebeni J. Mol. Immunol. 2014, 61 , 163- 173, the entire content of which is incorporated herein by reference). Therefore, to unlock the potential of mRNA therapy in humans, a class of LNPs with increased delivery efficiency along with a metabolic and toxic profile that would allow for chronic dosing in humans is needed.

[00442] The ability to treat a wide range of diseases requires flexibility to allow chronic dosing safely at various dose levels. Through systematic optimization of the lipid structure of the aminolipid, the compounds of the invention were identified as compounds that balance chemical stability, improved delivery efficiency due to improved endosomal release, rapid in vivo metabolism, and a clean toxicity profile (Example 26). The combination of these features provides a drug candidate that can be dosed chronically without activating the immune system. The first rodent screens led to the identification of a leading lipid with good delivery efficiency and pharmacokinetics. Further, the non-human primate leading LNP profile was examined to study delivery efficiency after single and repeated dosing. Finally, optimized LNPs were evaluated in one-month repeated-dose toxicity studies in rats and non-human primates. Without wishing to be bound by any theory, the new ionizable lipids described in this invention allow the safe and effective use of mRNA-based therapy in acute and chronic diseases.

Methods for obtaining polypeptides in cells

[00443] This disclosure provides methods for producing a polypeptide of interest in a mammalian cell. Methods for obtaining polypeptides include bringing the cell into contact with a composition of nanoparticles containing mRNA encoding the polypeptide of interest. Upon contact of the cell with the nanoparticle composition, the mRNA can be captured and transferred into the cell to produce the polypeptide of interest.

[00444] Typically, the step of contacting a mammalian cell with a nanoparticle composition containing an mRNA encoding a polypeptide of interest can be done in vivo, ex vivo, in culture, or in vitro. The amount of a nanoparticle composition in contact with a cell and/or the amount of mRNA in it may depend on the type of cell or tissue contacted, the route of administration, the physicochemical characteristics of the nanoparticle composition and the mRNA in it (e.g., size, charge, and chemical composition). ) and other factors. In general, an effective amount of the nanoparticle composition will allow efficient production of the polypeptide in the cell. Metrics for efficacy may include translation of the polypeptide (indicated by expression of the polypeptide), the level of mRNA degradation, and measures of the immune response.

[00445] The step of bringing the nanoparticle composition containing the mRNA into contact with the cell may involve or cause transfection. The phospholipid included in the lipid component of the nanoparticle composition can facilitate transfection and/or increase transfection efficiency, for example, by interacting and/or fusion with the cell or intracellular membrane. Transfection can provide translation of mRNA within the cell.

[00446] In some embodiments, the nanoparticle compositions described herein can be used therapeutically. For example, mRNA included in a nanoparticle composition can encode a therapeutic polypeptide (eg, in a translated region) and produce a therapeutic polypeptide upon contact and/or entry (eg, transfection) into a cell. In other embodiments, the mRNA included in the nanoparticle composition can encode a polypeptide that can improve or increase the subject's immunity. For example, the mRNA may encode for granulocyte colony stimulating factor or trastuzumab.

[00447] In some embodiments, the mRNA included in the nanoparticle composition may encode a recombinant polypeptide that may replace one or more polypeptides that may be substantially absent in the cell contacting the nanoparticle composition. One or more substantially absent polypeptides may be absent due to a genetic mutation of the coding gene or its metabolic pathway. Alternatively, a recombinant polypeptide produced by translation of an mRNA may antagonize the activity of an endogenous protein present on the surface or secreted by the cell. An antagonistic recombinant polypeptide may be desirable to combat the detrimental effects caused by endogenous protein activities, such as altered activities or locations caused by a mutation. In another alternative, a recombinant polypeptide produced by translation of an mRNA may indirectly or directly interfere with the activity of a biological moiety present on the surface or secreted by the cell. Antagonized biological fragments may include, but are not limited to, lipids (eg, cholesterol), lipoproteins (eg, low density lipoprotein), nucleic acids, carbohydrates, and small molecule toxins. Recombinant polypeptides produced by translation of an mRNA can be engineered to be localized within a cell, such as within a particular compartment such as the nucleus, or can be engineered to be secreted from a cell or to be translocated to the cell's plasma membrane.

[00448] In some embodiments, contacting a cell with a nanoparticle composition containing mRNA can reduce the cell's innate immune response to exogenous nucleic acid. The cell can be brought into contact with the first nanoparticle composition containing the first amount of the first exogenous mRNA containing the translational region, and the level of the cell's innate immune response to the first exogenous mRNA can be determined. Subsequently, the cell may be contacted with a second composition containing a second amount of the first exogenous mRNA, the second amount being a smaller amount of the first exogenous mRNA compared to the first amount. Alternatively, the second composition may contain a first amount of a second exogenous mRNA that is different from the first exogenous mRNA. The steps of bringing the cell into contact with the first and second compositions may be repeated one or more times. In addition, the efficiency of producing a polypeptide (eg, translation) in a cell can optionally be determined and the cell can be repeatedly contacted with the first and/or second composition multiple times until the efficiency of producing the target protein is achieved.

Methods for delivering therapeutic agents to cells and organs

[00449] This disclosure provides methods for delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ. Delivery of a therapeutic and/or prophylactic agent to a cell includes administering the nanoparticle composition, including the therapeutic and/or prophylactic agent, to a subject, wherein administering the composition includes bringing the cell into contact with the composition. For example, a protein, a cytotoxic agent, a radioactive ion, a chemotherapeutic agent, or a nucleic acid (such as RNA, eg mRNA) can be delivered to a cell or organ. Where the therapeutic and/or prophylactic agent is an mRNA, upon contact of the cell with the nanoparticle composition, the cell can be translated into a translation-capable mRNA to produce the polypeptide of interest. However, mRNAs that are not substantially translated can also be delivered to cells. Essentially untranslated mRNAs may be useful as vaccines and/or may isolate translational components of a cell to reduce the expression of other species in the cell.

[00450] In some embodiments, the implementation of the composition of nanoparticles can target a specific type or class of cells (for example, cells of a particular organ or system). For example, a nanoparticle composition containing a therapeutic and/or prophylactic agent of interest can be specifically delivered to the liver, kidney, spleen, thigh, or lung of a mammal. Specific delivery to a specific class of cells, organ or system or group thereof implies that a higher proportion of nanoparticle compositions containing a therapeutic and/or prophylactic agent is delivered to the destination (e.g. tissue) of interest relative to other destinations, e.g. upon administration of the nanoparticle composition to a mammal. In some embodiments, a specific delivery may result in a 2, 5, 10, 15, or 20-fold increase in the amount of therapeutic and/or prophylactic agent per gram of target tissue (e.g., tissue of interest, e.g., liver) compared to another destination (for example, the spleen). In some embodiments, the tissue of interest is selected from the group consisting of liver, kidney, lung, spleen, thigh, ocular tissue (eg, via intraocular, subretinal, or intravitreal injection), vascular endothelium in vessels (eg, intracoronary or intrafemoral), or kidney and tumor tissue (eg, via intratumoral injection).

[00451] As another example of targeted or specific delivery, mRNA that encodes a protein-binding partner (for example, an antibody or functional fragment thereof, scaffold protein or peptide) or a receptor on the cell surface can be included in the nanoparticles. mRNA can additionally or instead be used to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties. Alternatively, other therapeutic and/or prophylactic agents or elements (e.g., lipids or ligands) of the nanoparticle composition may be selected based on their affinity for specific receptors (e.g., low density lipoprotein receptors), such that the nanoparticle composition can more easily interact with a population of cells. -target containing receptors. For example, ligands may include, but are not limited to, specific binding pair members, antibodies, monoclonal antibodies, Fv fragments, single chain Fv (scFv) fragments, Fab' fragments, F(ab')2 fragments, single domain antibodies, camelized antibodies, and their fragments, humanized antibodies and their fragments and their multivalent versions; multivalent binding reagents, including mono- or bispecific antibodies such as disulfide-stabilized Fv fragments, scFv, diabody, triabody or tetrabody tandems, and aptamers, receptors and fusion proteins.

[00452] In some embodiments, the implementation of the ligand may be a surface-bound antibody, which can provide customization of targeting specificity to cells. This is particularly useful as highly specific antibodies can be generated against an epitope of interest for the desired targeting site. In one embodiment, multiple antibodies are expressed on the cell surface and each antibody may have a different specificity for the desired target. Such approaches can increase the avidity and specificity of target interactions.

[00453] The ligand may be selected, for example, by those skilled in the art of biology, depending on the desired location or function of the cell. For example, an estrogen receptor ligand such as tamoxifen can target cells to estrogen-dependent breast cancer cells that have an increased number of estrogen receptors on the cell surface. Other non-limiting examples of ligand/receptor interactions include CCR1 (eg, to treat inflamed joint tissues or the brain in rheumatoid arthritis and/or multiple sclerosis), CCR7, CCR8 (eg, to target lymph node tissues), CCR6, CCR9, CCR10 ( eg for targeting intestinal tissue), CCR4, CCR10 (eg for targeting skin), CXCR4 (eg for general enhanced transport), HCELL (eg for treatment of inflammation and inflammatory bone marrow disorders), Alpha4beta7 (eg for targeting the intestinal mucosa) and VLA-4NCAM-1 (eg, targeting the endothelium). In general, any receptor involved in targeting (eg, cancer metastasis) can be used for use in the methods and compositions described herein.

[00454] Target cells may include, but are not limited to, hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, nerve cells, heart cells, adipocytes, smooth cells vascular muscles, cardiomyocytes, skeletal muscle cells, beta cells, pituitary cells, synovial mucosal cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells.

[00455] In some embodiments, the nanoparticle composition may target hepatocytes. Apolipoproteins such as apolipoprotein E (apoE) have been shown to bind to neutral or nearly neutral lipid-containing nanoparticle compositions in the body and are known to bind to receptors such as low density lipoprotein receptors (LDLRs) found on the surface of hepatocytes. Thus, a nanoparticle composition containing a charge-neutral or near-neutral lipid component that is administered to a subject can acquire apoE in the subject's body and can subsequently deliver a therapeutic and/or prophylactic agent (e.g., RNA) to hepatocytes, including LDLR, in a targeted manner.

Ways to treat diseases and disorders

[00456] Nanoparticle compositions may be useful in the treatment of a disease, disorder, or pathological condition. In particular, such compositions may be useful in the treatment of a disease, disorder, or condition characterized by the absence or impairment of protein or polypeptide activity. For example, a nanoparticle composition containing mRNA encoding a missing or aberrant polypeptide can be administered or delivered to a cell. Subsequent translation of the mRNA can produce the polypeptide, thereby reducing or eliminating the problem caused by the absence or aberrant activity caused by the polypeptide. Because translation can occur rapidly, the methods and compositions may be useful in the treatment of acute diseases, disorders, or conditions such as sepsis, stroke, and myocardial infarction. The therapeutic and/or prophylactic agent included in the nanoparticle composition may also be capable of altering the transcription rate of a given species, thereby affecting gene expression.

[00457] Diseases, disorders and/or pathological conditions characterized by dysfunctional or aberrant protein or polypeptide activity for which the composition may be administered include, but are not limited to, rare diseases, infectious diseases (like vaccines and drugs), cancer, and proliferative diseases, genetic diseases (eg, cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renovascular diseases, and metabolic disorders. Multiple diseases, disorders and/or pathological conditions can be manifested in that they are characterized by the absence (or a significant decrease, so that the proper function of the protein does not occur) of protein activity. Such proteins may not be present, or they may be essentially non-functional. A specific example of a dysfunctional protein is missense mutation variants of the cystic fibrosis transmembrane conductance regulator (CFTR) gene that produces a dysfunctional protein variant of the CFTR protein that causes cystic fibrosis. The present invention provides a method for treating such diseases, disorders and/or pathological conditions in a subject by administering a nanoparticle composition comprising RNA and a lipid component comprising a lipid of formula (I), (IA), (IB), (II), (IIa) , (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), a phospholipid (optionally unsaturated), a PEG lipid, and a structural lipid, wherein the RNA may be an mRNA encoding a polypeptide that counteracts or otherwise overcomes an aberrant protein activity present in a subject's cell.

[00458] The present invention provides methods comprising administering nanoparticle compositions comprising one or more therapeutic and/or prophylactic agents and pharmaceutical compositions comprising them. The terms therapeutic and prophylactic may be used herein interchangeably with respect to features and embodiments of the present invention. The therapeutic compositions or imaging, diagnostic or prophylactic compositions thereof may be administered to a subject using any reasonable amount and by any route of administration effective for the prevention, treatment, diagnosis or imaging of a disease, disorder and/or pathological condition and/or any other purpose. The specific amount administered to a given subject may vary depending on the species, age, and general condition of the subject; the purpose of the introduction; specific composition; mode of administration; and the like. Compositions of this invention may be formulated in unit dosage form for ease of administration and dosage uniformity. It is understood, however, that the total daily use of the composition of this invention will be decided by the attending physician within the limits of sound medical judgment. The specific therapeutically effective, prophylactically effective, or otherwise appropriate dose level (eg, for imaging) for any particular patient will depend on a variety of factors, including the severity and identification of the disorder being treated, if any; one or more used therapeutic and/or prophylactic agents; specific drug used; age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific pharmaceutical composition employed; duration of treatment; drugs used in combination or simultaneously with the specific pharmaceutical composition used; and similar factors well known in medicine.

[00459] A nanoparticle composition comprising one or more therapeutic and/or prophylactic agents may be administered by any route. In some embodiments, compositions, including prophylactic, diagnostic, or imaging compositions, comprising one or more of the nanoparticle compositions described herein, are administered by one or more different routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraparenchymal, subcutaneous , intraventricular, trans or intradermal, interdermal, rectal, intravaginal, intraperitoneal, intraocular, subretinal, intravitreal, topical (eg, powders, ointments, creams, gels, lotions and/or drops), mucosal, nasal, buccal, enteral, vitreal , intratumoral, sublingual, intranasal; by intratracheal instillation, bronchial instillation and/or inhalation; as an oral spray and/or powder, nasal spray and/or aerosol, and/or through a portal vein catheter. In some embodiments, the composition may be administered intravenously, intramuscularly, intradermally, intraarterially, intratumorally, subcutaneously, intraocularly, subretinally, intravitreally, intraparenchymally, or by any other parenteral route of administration or by inhalation. However, this description covers the delivery or administration of the compositions described herein, in any suitable way, taking into account the likely advances in the field of drug delivery. Generally, the most appropriate route of administration will depend on a variety of factors, including the nature of the nanoparticle composition, including one or more therapeutic and/or prophylactic agents (e.g., their stability in various body media such as the bloodstream and gastrointestinal tract), the condition of the patient (for example, whether the patient is able to tolerate certain routes of administration), etc.

[00460] In specific embodiments, the compositions of this invention may be administered at doses sufficient to deliver from about 0.0001 mg/kg to about 10 mg/kg, from about 0.001 mg/kg to about 10 mg/kg, from about 0.005 mg/kg to about 10 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 1 mg/kg to about 10 mg/kg, about 2 mg/kg to about 10 mg/kg, about 5 mg/kg to about 10 mg/kg, from about 0.0001 mg/kg to about 5 mg/kg, about 0.001 mg/kg to about 5 mg/kg, about 0.005 mg/kg to about 5 mg/kg, about 0.01 mg/kg to about 5 mg/kg , from about 0.05 mg/kg to about 5 mg/kg, from about 0.1 mg/kg to about 5 mg/kg, from about 1 mg/kg to about 5 mg/kg, from about 2 mg/kg up to about 5 mg/kg, from about 0.0001 mg/kg to about 2.5 mg/kg, from about 0.001 mg/kg to about 2.5 mg/kg, from about 0.005 mg/kg to about 2.5 mg/kg, about 0.01 mg/kg to about 2.5 mg/kg, about 0.05 mg/kg to about 2.5 mg/kg, about 0.1 mg/kg to about 2, 5 mg/kg, about 1 mg/kg to about 2.5 mg/kg, about 2 mg/kg to about 2.5 mg/kg, about 0.0001 mg/kg to about 1 mg/kg, from about 0.001 mg/kg to about 1 mg/kg, from about 0.005 mg/kg to about 1 mg/kg, from about 0.01 mg/kg to about 1 mg/kg, from about 0.05 mg/kg to about 1 mg/kg, about 0.1 mg/kg to about 1 mg/kg, about 0.0001 mg/kg to about 0.25 mg/kg, about 0.001 mg/kg to about 0.25 mg /kg, from about 0.005 mg/kg to about 0.25 mg/kg, from about 0.01 mg/kg to about 0.25 mg/kg, from about 0.05 mg/kg to about 0.25 mg/ kg, or from about 0.1 mg/kg to about 0.25 mg/kg of the therapeutic and/or prophylactic agent (e.g., mRNA) at a given dose, where the 1 mg/kg dose provides 1 mg of the therapeutic and/or prophylactic agent per 1 kg of the subject's body weight. In some embodiments, a dose of about 0.001 mg/kg to about 10 mg/kg of the therapeutic and/or prophylactic (eg, mRNA) of the nanoparticle composition may be administered. In other embodiments, a dose of about 0.005 mg/kg to about 2.5 mg/kg of the therapeutic and/or prophylactic agent may be administered. In specific embodiments, a dose of about 0.1 mg/kg to about 1 mg/kg may be administered. In other embodiments, a dose of 0.05 mg/kg up to about 0.25 mg/kg may be administered. The dose can be administered one or more times a day, in the same or different amount, to achieve the desired level of mRNA expression and/or therapeutic, diagnostic, prophylactic or visual effect. The desired dosage may be delivered, for example, three times a day, twice a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In specific embodiments, the desired dosage may be delivered by multiple administrations (eg, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). In some embodiments, a single dose may be administered, for example, before or after a surgical procedure or in the event of an acute disease, disorder, or condition.

[00461] Nanoparticle compositions comprising one or more therapeutic and/or prophylactic agents may be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. By "in combination with" it is not meant that the agents must be administered simultaneously and/or formulated for co-delivery, although these delivery methods are within the scope of this invention. For example, one or more nanoparticle compositions comprising one or more different therapeutic and/or prophylactic agents may be administered in combination. The compositions may be administered simultaneously, before or after one or more other desired therapeutic or medical procedures. Typically, each agent will be administered at a dose and/or schedule set for that agent. In some embodiments, this disclosure encompasses the delivery of the compositions or their imaging, diagnostic, or prophylactic compositions in combination with agents that improve their bioavailability, reduce and/or modify their metabolism, inhibit their excretion, and/or modify their distribution in the body.

[00462] In addition, it should be borne in mind that therapeutically, prophylactically, diagnostically or imaging active agents used in combination may be independently administered together in one composition or administered separately in different compositions. In general, agents used in combination are expected to be used at levels that do not exceed the levels at which they are used individually. In some embodiments, levels used in combination may be lower than levels used alone.

[00463] The particular combination of treatments (therapeutics or procedures) to be used in a combination regimen will take into account the compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It should also be kept in mind that the therapy used may achieve the desired effect in the same disorder (eg, a composition suitable for treating cancer may be administered simultaneously with a chemotherapeutic agent), or they may achieve different effects (eg, control of any side effects, such as infusion reactions).

[00464] The nanoparticle composition may be used in combination with an agent to increase the efficacy and/or therapeutic window of the composition. Such an agent may be, for example, an anti-inflammatory compound, a steroid (eg, a corticosteroid), a statin, an estradiol, a BTK inhibitor, an S1P1 agonist, a glucocorticoid receptor modulator (GRM), or an anti-histamine. In some embodiments, the nanoparticle composition may be used in combination with dexamethasone, methotrexate, acetaminophen, an H1 receptor blocker, or an H2 receptor blocker. In some embodiments, a method of treating a subject in need thereof or delivering a therapeutic and/or prophylactic agent to a subject (eg, a mammal) may include pretreatment of the subject with one or more agents prior to administration of the nanoparticle composition. For example, the subject may be pretreated with a suitable amount (e.g., 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 90 mg, 100 mg, or any other suitable amount) dexamethasone, methotrexate, acetaminophen, H1 receptor blocker, or H2 receptor blocker. The pre-treatment may take place in 24 hours or less (for example, 24 hours, 20 hours, 16 hours, 12 hours, 8 hours, 4 hours, 2 hours, 1 hour, 50 minutes, 40 minutes, 30 minutes, 20 minutes, or 10 minutes) before administration of the nanoparticle composition and may occur one, two or more times, for example in increasing dosages.

[00465] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimental techniques, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited by the above description, but rather is set forth as in the appended claims.

[0001] In the text of the claims, singular forms may mean one or more than one, unless otherwise indicated or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are deemed to be satisfied if one, more than one, or all of the members of the group are present, applicable, or related to a particular product or method, unless otherwise stated or otherwise not obvious from the context. The description of the invention includes embodiments of the invention in which exactly one member of the group is present in, applied to, or otherwise related to a given product or method. The description of the invention includes embodiments of the invention in which more than one of a group of members is present in, applied to, or otherwise related to a given product or method. In the context of this document, the expressions "one or more of A, B or C", "one or more of A, B or C", "one or more of A, B and C", "one or more of A, B and C ”, “selected from A, B and C,” “selected from the group consisting of A, B and C” and the like are used interchangeably and all refer to selection from the group consisting of A, B and/or C, i.e. one or more A's, one or more B's, one or more C's, or any combination thereof unless otherwise noted.

[0002] It is also noted that the term "comprising" is intended to be open-ended and allows, but does not require, the inclusion of additional elements or steps. When the term "comprising" is used herein, the terms "consisting essentially of" and "consisting of" are thus also covered and disclosed. Throughout the description, where the compositions are described as having, including or containing specific components, it is assumed that the compositions also consist essentially of or consist of the listed components. Similarly, when methods or processes are described as having or including specific method steps, the methods also consist essentially of or consist of the recited processing steps. In addition, it should be understood that the order of the steps or the order in which certain actions are performed does not matter as long as the invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0003] When ranges are specified, endpoints are included. In addition, it should be clear that unless otherwise indicated or otherwise obvious from the context and understanding of a person skilled in the art, values that are expressed as ranges can take on any particular value or subrange within the indicated ranges in various embodiments of the invention. , up to one tenth of the lower limit of the range, unless the context clearly dictates otherwise.

[0004] Synthetic methods of the present invention may allow for a wide variety of functional groups, so that various substituted starting materials may be used. The methods generally produce the desired end compound at or near the end of the entire process, although in some cases it may be desirable to further convert the compound to its pharmaceutically acceptable salt.

[0005] The compounds of this invention can be prepared in a variety of ways using commercially available starting materials, compounds known in the literature, or from readily prepared intermediates, using standard synthetic methods and techniques known to those skilled in the art or which will be readily apparent. for a qualified person in the light of the teachings herein. Standard synthetic methods and techniques for the preparation of organic molecules and transformations and manipulations with functional groups can be obtained from the relevant scientific literature or from standard textbooks in the field. Although not limited to one or more sources, classic texts such as Smith, MB, March, J., March Advanced Organic Chemistry: Reactions, Mechanisms, and Structure , 5th Edition, John Wiley & Sons: New York, 2001; Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis , 3rd edition, John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations , VCH Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser Reagents for Organic Synthesis , John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis , John Wiley and Sons (1995), incorporated herein by reference, are suitable and recognized reference texts on organic synthesis known to those skilled in the art. The following descriptions of synthetic methods are intended to illustrate, but not limit, general procedures for preparing the compounds of this invention.

[0006] Compounds of this invention having any of the formulas described herein can be prepared according to the procedures illustrated in Schemes 1, 2 and 3 below from commercially available starting materials or starting materials that can be obtained with using literary methods. The variables in the schemas (eg, R ₁ , R ₂ and R ₃ , etc.) are as defined herein. One skilled in the art will appreciate that during the reaction sequences and synthetic schemes described herein, the order of certain steps may be changed, such as the introduction and removal of protecting groups.

[0007] One skilled in the art will appreciate that certain groups may need to be protected from reaction conditions by the use of protecting groups. Protecting groups can also be used to differentiate similar functional groups in molecules. A list of protecting groups and how to enter and remove these groups can be found in Greene, TW, Wuts, PGM, Protective Groups in Organic Synthesis , 3rd edition, John Wiley & Sons: New York, 1999.

[0008] Preferred protecting groups include, but are not limited to:

[0009] For the hydroxyl moiety: TBS, benzyl, THP, Ac;

[0010] For carboxylic acids: benzyl ether, methyl ester, ethyl ester, allyl ether;

[0011] For amines: Fmoc, Cbz, BOC, DMB, Ac, Bn, Tr, Ts, trifluoroacetyl, phthalimide, benzylideneamine;

[0012] For diols: Ac (x2) TBS (x2) or when acetonides are taken together;

[0013] For thiols: Ac;

[0014] For benzimidazoles: SEM, benzyl, PMB, DMB;

[0015] For aldehydes: di-alkyl acetals such as dimethoxy acetal or diethyl acetal.

[0016] Many stereoisomers can be generated in the reaction schemes described herein. When a specific stereoisomer is not indicated, it is meant to mean all possible stereoisomers that can be obtained from the reaction. One skilled in the art will appreciate that reactions may be optimized to preferentially use a single isomer, or new schemes may be devised to produce a single isomer. If mixtures are obtained, methods such as preparative thin layer chromatography, preparative HPLC, preparative chiral HPLC or preparative SFC can be used to separate the isomers.

Scheme 1

[0017] As illustrated in Scheme 1 above, 8-bromooctanoic acid reacts with alcohol a1 (eg, heptadecan-9-ol) to form ester b1 (eg, heptadecan-9-yl-8-bromooctanoate). Step 1 can be carried out in an organic solvent (eg dichloromethane) in the presence of, for example, N-(3-dimethylaminopropyl) -N'- ethylcarbodiimide hydrochloride, N,N -diisopropylethylamine and DMAP. Stage 1 can take place at room temperature for 18 hours. The ester b1 then reacts with 2-aminoethane-1-ol to form the amine c1 (eg heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate). Stage 2 can take place in ethanol, for example, at a temperature of about 60°C. Amine c1 then reacts with bromoalkyl R ₁ -Br (eg 1-bromotetradecane) to form compound d1 (eg heptadecan-9-yl-8-((2-hydroxyethyl)(tetradecyl)amino)octanoate). Step 3 can be carried out in ethanol1 in the presence of N,N -diisopropylethylamine.

Scheme 2

[0018] As illustrated in Scheme 2 above, acid a2 (t is an integer from 1 to 7; e.g., 8-bromooctanoic acid) reacts with alcohol b2 (e.g., nonan-1-ol) to form ester c2 (e.g. , nonyl-8-bromooctanoate). Step 1 can be carried out in an organic solvent (eg dichloromethane) in the presence of, for example, N-(3-dimethylaminopropyl) -N' -ethylcarbodiimide hydrochloride, N,N -diisopropylethylamine and DMAP. Alcohol e2 (for example, heptadecan-9-ol) can be obtained by reacting aldehyde d2 (for example, nonanal1) with a Grignard reagent R ₃ -MgX (for example, H-C ₈ H ₁₇ MgBr) in Step 2. Then 8-bromooctanoic acid reacts with alcohol e2 (eg heptadecan-9-ol) to form ester f2 (eg heptadecan-9-yl-8-bromooctanoate). Step 3 can be carried out in an organic solvent (eg dichloromethane) in the presence of, for example, N-(3-dimethylaminopropyl) -N' -ethylcarbodiimide hydrochloride, N,N -diisopropylethylamine and DMAP. The ester f2 is then reacted with 2-aminoethane-1-ol to form the amine g2 (eg heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate). Step 4 can take place in ethanol in the presence of i- Pr ₂ EtN. Amine g2 then reacts with ester c2 (e.g. nonyl-8-bromooctanoate) to form compound h2 (e.g. heptadecan-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl) amino)octanoate). Step 5 can take place in an organic solvent (eg a mixture of CPME and MeCN), in the presence of a base (such as an inorganic base (eg K ₂ CO ₃ ) or a non-nucleophilic organic base (eg i- Pr ₂ EtN)) and a catalyst (eg , iodide, such as KI or NaI) at, for example, elevated temperature (such as at about 70-90°C, for example, about 80°C).

Scheme 3

[0019] As illustrated in Scheme 3 above, the haloalkanol (t is an integer between 1 and 12, e.g. 6-bromohexan-1-ol) reacts with the starting material a3 (s is an integer between 1 and 6, e.g., 4-(hexyloxy)-4-oxobutanoic acid) to give a halogenated diester b3 (eg 6-bromohexylhexyl succinate). Compound a3 can be prepared by reacting an alcohol (eg hexan-1-ol) with an acid anhydride (eg succinic anhydride, dihydro-2H-pyran-2,6(3H)-dione, 3-(tert-butoxy)-3 -oxopropanoic acid, 4-(tert-butoxy)-3-methyl-4-oxobutanoic acid or 4-(tert-butoxy)-2-methyl-4-oxobutanoic acid). Step 1 can be carried out in an organic solvent (eg dichloromethane) in the presence of, for example, N-(3-dimethylaminopropyl) -N' -ethylcarbodiimide hydrochloride, N,N -diisopropylethylamine and DMAP. The halogenated diester b3 then reacts with the amine c3 (u is an integer from 5 to 13, v is an integer from 1 to 5, e.g. heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate) with the formation of the product d3 . Step 2 can take place in an organic solvent (eg a mixture of CPME and MeCN) in the presence of a base (such as an inorganic base (eg K ₂ CO ₃ ) and a catalyst (eg an iodide such as KI) and an ethereal solvent (eg cyclopentyl methyl ether ) at elevated temperatures (eg around 90°C).

[0020] One skilled in the art will appreciate that in the above schemes, the order of certain steps may be interchangeable.

[0021] In certain aspects, the description also includes methods for synthesizing a compound of any of formulas (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe) , (IIf), (IIg) or (III) and intermediate (i) for the synthesis of the compound.

с R₁-Br с образованием соединения формулы (I), где все переменные имеют значения, определенные в данном документе. Например, m равно 5, 6, 7, 8 или 9, предпочтительно 5, 7, или 9. Например, каждый из R₅, R₆ и R₇ представляет собой H. Например, M представляет собой C(O)O- или -OC(O)-. Например, R₄ представляет собой незамещенный C_1-3 алкил или -(CH₂)_nQ, в котором n равно 2, 3 или 4 и Q представляет собой OH, -NHC(S)N(R)₂, -NHC(O)N(R)₂, -N(R)C(O)R или -N(R)S(O)₂R. Например, реакция соединения формулы (X2) с R₁-Br происходит в присутствии основания (такого как неорганическое основание) (например, K₂CO₃) или ненуклеофильное органическое основание (например, i-Pr₂EtN)). Например, реакция протекает в присутствии неорганического основания (например, K₂CO₃) и катализатора (например, иодида, такого как KI или NaI). Например, реакция протекает при повышенной температуре, например, около 50-100°С, 70-90°С или около 80°C).[0022] In some embodiments, a method for synthesizing a compound of formula (I) comprises reacting a compound of formula (X2):

with R ₁ -Br to form a compound of formula (I), where all variables have the meanings defined in this document. For example, m is 5, 6, 7, 8, or 9, preferably 5, 7, or 9. For example, each of R ₅ , R ₆ and R ₇ is H. For example, M is C(O)O- or -OC(O)-. For example, R ₄ is unsubstituted C _1-3 alkyl or -(CH ₂ ) _n Q where n is 2, 3 or 4 and Q is OH, -NHC(S)N(R) ₂ , -NHC( O)N(R) ₂ , -N(R)C(O)R or -N(R)S(O) ₂ R. For example, the reaction of a compound of formula (X2) with R ₁ -Br occurs in the presence of a base (such as an inorganic base) (eg K ₂ CO ₃ ) or a non-nucleophilic organic base (eg i -Pr ₂ EtN)). For example, the reaction proceeds in the presence of an inorganic base (eg K ₂ CO ₃ ) and a catalyst (eg iodide such as KI or NaI). For example, the reaction proceeds at an elevated temperature, eg about 50-100°C, 70-90°C or about 80°C).

с R₄NH₂ для получения соединения формула (X2), где все переменные имеют значения, определенные в данном документе.[0023] The method may also include introducing the reaction of a compound of formula (X1):

with R ₄ NH ₂ to obtain compounds of formula (X2), where all variables have the meanings defined in this document.

или

где все переменные имеют значения, определенные в данном документе. Например, промежуточное соединение включает гептадекан-9-ил-8-бромоктаноат и гептадекан-9-ил-8 - ((2-гидроксиэтил)амино)октаноат и его морфические формы (например, кристаллическая форма).[0024] In some embodiments, intermediates include those having any of formulas (X1) and (X2):

or

where all variables have the values defined in this document. For example, the intermediate includes heptadecan-9-yl-8-bromooctanoate and heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate and its morphic forms (eg, crystalline form).

[0025] In addition, it should be clear that any particular embodiment of the invention that relates to the prior art may be explicitly excluded from any one or more claims. Since such embodiments of the invention are considered to be known to a person skilled in the art, they can be excluded, even if this exception is not explicitly stated in this document.

[0026] All cited sources, such as references, publications, databases, database entries, and articles cited in this document, are incorporated into this application by reference, even if not expressly indicated in the citation. In the event of conflicting statements between the cited source and this application, the statement in this application shall prevail.

Examples

Example 1: Synthesis of compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe) (IIf) or (IIg)

A. General provisions

[0027] All solvents and reagents used were purchased commercially and used as such unless otherwise noted. ¹ H NMR spectra were recorded in CDCl ₃ at 300 K using a Bruker Ultrashield 300 MHz instrument. Chemical shifts are reported in parts per million (m.p.h.) relative to TMS (0.00) for ¹ H. Silica gel chromatography was performed on ISCO CombiFlash Rf+Lumen instruments using ISCO RediSep Rf Gold flash cartridges (particle size: 20- 40 microns). Reverse phase chromatography was performed on ISCO CombiFlash Rf+Lumen instruments using high performance RediSep Rf Gold C18 columns. All final compounds were determined to be greater than 85% pure by reverse-phase UPLC-MS analysis (retention time, RT, in minutes) using a Waters Acquity UPLC instrument with DAD and DSIO and a ZORBAX fast resolution high resolution (RRHD) column SB-C18 LC, 2.1 mm, 50 mm, 1.8 µm and gradient from 65 to 100% acetonitrile in water with 0.1% TFA over 5 minutes at 1.2 ml/min. The injection volume was 5 μl and the column temperature was 80°C. Detection was based on electrospray ionization (ESI) in positive mode using a Waters SQD mass spectrometer (Milford, MA, USA) and an evaporative light scattering detector.

[0028] The procedures described below are suitable for the synthesis of Compound 1-280.

[0029] The following abbreviations are used throughout this document:

THF: Tetrahydrofuran

MeCN: Acetonitrile

LAH: Lithium aluminum hydride

DXM: Dichloromethane

DMAP: 4-Dimethylaminopyridine

LDA: Lithium diisopropylamide

room temp.: room temperature

DME: 1,2-Dimethoxyethane

n -BuLi: n -Butyllithium

CPME: Cyclopentyl methyl ether

i -Pr ₂ EtN: N, N-Diisopropylethylamine

B. Compound 2: Heptadecan-9-yl-8-((2-hydroxyethyl)(tetradecyl)amino)octanoate

Illustrative example of the technique 1

Heptadecan-9-yl-8-bromooctanoate (Method A)

[0030] To a solution of 8-bromooctanoic acid (1.04 g, 4.6 mmol) and heptadecan-9-ol (1.5 g, 5.8 mmol) in dichloromethane (20 ml) was added N- (3-dimethylaminopropyl ) -N' -ethylcarbodiimide hydrochloride (1.1 g, 5.8 mmol), N,N -diisopropylethylamine (3.3 ml, 18.7 mmol) and DMAP (114 mg, 0.9 mmol). The reaction mixture was allowed to stir at room temperature. pace. for 18 hours. The reaction mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution. The organic layer was separated and washed with saturated aqueous sodium chloride and dried over MgSO ₄ . The organic layer was filtered off and evaporated in vacuo. The residue was purified by silica gel chromatography (0-10% ethyl acetate in hexanes) to give heptadecan-9-yl-8-bromooctanoate (875 mg, 1.9 mmol, 41%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 3.42 (m, 2H); 2.31 (m, 2H); 1.89 (m, 2H); 1.73-1.18 (broad m, 36H); 0.88 (m, 6H).

Heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (Method B)

[0031] A solution of heptadecan-9-yl-8-bromooctanoate (3.8 g, 8.2 mmol) and 2-aminoethan-1-ol (15 ml, 248 mmol) in ethanol (3 ml) was allowed to stir at 62° C for 18 hours. The reaction mixture was concentrated in vacuo and the residue taken up in ethyl acetate and water. The organic layer was separated and washed with water, saturated aqueous sodium chloride and dried over Na ₂ SO ₄ . The mixture was filtered and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (3 .1 g, 7 mmol, 85%). UHPLC/DSIO: RT=2.67 min. MS (ESI): m/z (MH ⁺ ) 442.68 for C ₂₇ H ₅₅ NO ₃

¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 3.67 (t, 2H); 2.81 (t, 2H); 2.65 (t, 2H); 2.30 (t, 2H); 2.05 (broad m, 2H); 1.72-1.41 (broad m, 8H); 1.40-1.20 (broad m, 30H); 0.88 (m, 6H).

Heptadecan-9-yl-8-((2-hydroxyethyl)(tetradecyl)amino)octanoate (Method C)

Chemical formula: C ₄₁ H ₈₃ NO ₃

Molecular weight: 638.12

[0032] A solution of heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (125mg, 0.28mmol), 1-bromotetradecane (94mg, 0.34mmol), andN, N-diisopropylethylamine (44 mg, 0.34 mmol) in ethanol was allowed to stir at 65° C. for 18 hours. The reaction mixture was cooled to room temperature. pace. and the solvents were evaporated in vacuo. The residue was taken up in ethyl acetate saturated sodium hydrogen carbonate solution. The organic layer was separated, dried over Na₂SO₄and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-hydroxyethyl)(tetradecyl)amino)octanoate (89 mg, 0.14 mmol, 50%). UHPLC/DSIO: RT=3.61 min. MS (IER):m/z (MH⁺) 638.91 for C₄₁H₈₃NO₃. ¹H NMR (300 MHz, CDCl₃) δ: ppm 4.86 (n, 1H); 3.72-3.47 (broad m, 2H); 2.78-2.40 (broad m, 5H); 2.28 (t, 2H); 1.70-1.40 (m, 10H); 1.38-1.17 (broad m, 54H); 0.88 (m, 9H).

Synthesis of intermediates :

Intermediate A: 2-Octyldecanoic acid

[0033] A solution of diisopropylamine (2.92 ml, 20.8 mmol) in THF (10 ml) was cooled to -78°C and a solution of n -BuLi (7.5 ml, 18.9 mmol, 2.5 M in mixtures of hexanes). The reaction mixture was left to warm to 0°C. To a solution of decanoic acid (2.96 g, 17.2 mmol) and NaH (754 mg, 18.9 mmol, 60% w/w) in THF (20 ml) was added a solution of LDA at 0°C and the mixture was left mix at room. pace. within 30 min. After the indicated time, 1-iodoctane (5 g, 20.8 mmol) was added and the reaction mixture was heated at 45° C. for 6 hours. The reaction mixture was quenched with 1N HCl (10 ml). The organic layer was dried over MgSO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography (0-20% ethyl acetate in hexanes) to yield 2-octyldecanoic acid (1.9 g, 6.6 mmol, 38%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 2.38 (broad m, 1H); 1.74-1.03 (broad m, 28H); 0.91 (m, 6H).

Intermediate B: 7-Bromoheptyl-2-octyldecanoate

[0034] 7-bromoheptyl 2-octyldecanoate was synthesized using method A from 2-octyldecanoic acid and 7-bromoheptan-1-ol. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.09 (broad m, 2H); 3.43 (broad m, 2H); 2.48-2.25 (broad m, 1H); 1.89 (broad m, 2H); 1.74-1.16 (broad m, 36H); 0.90 (m, 6H).

Intermediate C: (2-Hexylcyclopropyl)methanol

[0035] A solution of diethylzinc (20 ml, 20 mmol, 1 M in hexanes), in dichloromethane (20 ml) was allowed to cool to -40° C. over 5 minutes. A solution of diiodomethane (3.22 ml, 40 mmol) in dichloromethane (10 ml) was then added dropwise. The reaction mixture was then allowed to stir for 1 h at -40° C., a solution of trichloroacetic acid (327 mg, 2 mmol) and DME (1 ml, 9.6 mmol) in dichloromethane (10 ml) was added. The reaction mixture was allowed to warm to -15°C and stirred at this temperature for 1 h. Then, at -15°C, a solution of ( Z )-non-2-en-1-ol (1.42 g, 10 mmol ) in dichloromethane (10 ml). The reaction mixture was then allowed to warm slowly to room temperature. pace. and stirred for 18 hours. After the indicated time, saturated NH ₄ Cl (200 ml) was added and the reaction mixture was extracted with dichloromethane (3X), washed with saturated aqueous sodium chloride and dried over Na ₂ SO ₄ . The organic layer was filtered, evaporated in vacuo and the residue was purified by silica gel chromatography (0-50% ethyl acetate in hexanes) to yield (2-hexylcyclopropyl)methanol (1.43 g, 9.2 mmol, 92%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.64 (m, 2H); 1.57-1.02 (m, 12H); 0.99-0.80 (m, 4H); 0.72 (m, 1H), 0.00 (m, 1H).

C. Compound 1: Heptadecan-9-yl-8-((2-hydroxyethyl)(octadecyl)amino)octanoate

Chemical formula: C ₄₅ H ₉₁ NO ₃

Molecular weight: 694.23

[0036] Compound 1 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.86 min. MS (ESI): m/z (MH ⁺ ) 694.93 for C ₄₅ H ₉₁ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 1H); 3.77-3.47 (broad m, 2H); 2.78-2.37 (broad m, 5H); 2.28 (t, 2H); 1.73-1.40 (broad m, 10H); 1.38-1.18 (broad m, 62H); 0.88 (m, 9H).

D. Compound 3: Heptadecan-9-yl-8-((2-hydroxyethyl)(nonyl)amino)octanoate

Chemical formula: C ₃₆ H ₇₃ NO ₃

Molecular weight: 567.98

[0037] Compound 3 was synthesized according to the general procedure and Illustrative Method 1 and Illustrative Method 1 described above. UHPLC/DSIO: RT=3.36 min. MS (ESI): m/z (MH ⁺ ) 568.80 for C ₃₆ H ₇₃ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 3.72-3.45 (broad m, 2H); 2.79-2.34 (broad m, 5H); 2.28 (t, 2H); 1.70-1.38 (m, 10H); 1.38-1.16 (broad m, 44H); 0.88 (m, 9H).

E. Compound 4: Heptadecan-9-yl-8-((2-hydroxyethyl)(octyl)amino)octanoate

Chemical formula: C ₃₅ H ₇₁ NO ₃

Molecular weight: 553.96

[0038] Compound 4 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.99 min. MS (ESI): m/z (MH ⁺ ) 554.777 for C ₃₅ H ₇₁ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 3.71 (br. s, 2H); 2.70 (br. s, 5H); 2.26 (t, 2H); 1.48-1.59 (br. m., 10H); 1.24 (m, 42H); 0.86 (t, 9H).

F. Compound 5: Heptadecan-9-yl-8-(hexyl(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₃₃ H ₆₇ NO ₃

Molecular weight: 525.90

[0039] Compound 5 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.10 min. MS (ESI): m/z (MH ⁺ ) 526.73 for C ₃₃ H ₆₇ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 3.67-3.48 (broad m, 2H); 2.74-2.39 (broad m, 5H); 2.28 (t, 2H); 1.68-1.39 (broad m, 10H); 1.38-1.16 (broad m, 38H); 0.88 (m, 9H).

G. Compound 6: Heptadecan-9-yl-8-((2-hydroxyethyl)((9 Z ,12 Z )-octadeca-9,12-dien-1-yl)amino)octanoate

Chemical formula: C ₄₅ H ₈₇ NO ₃

Molecular weight: 690.20

[0040] Compound 6 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.77 min. MS (ESI): m/z (MH ⁺ ) 690.84 for C ₄₅ H ₈₇ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.37 (m, 4H); 4.86 (broad m, 1H); 3.53 (br. m; 2H); 2.78 (broad m, 2H); 2.58 (broad m, 2H); 2.45 (broad m, 4H); 2.28 (m, 2H); 2.05 (m, 4H); 1.68-1.15 (broad m, 57H); 0.89 (m, 9H).

H. Compound 7: Heptadecan-9-yl-8-((3-hydroxypropyl)(nonyl)amino)octanoate

Chemical formula: C ₃₇ H ₇₅ NO ₃

Molecular weight: 582.01

[0041] Compound 7 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.24 min. MS (ESI): m/z (MH ⁺ ) 582.987 for C ₃₇ H ₇₅ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.84 (n, 1H); 3.76 (t, 2H); 2.42-2.66 (br. s, 5H); 2.25 (t, 2H); 1.47-1.68 (broad m, 12H); 1.24 (m, 42H); 0.86 (t, 9H).

I. Compound 8: Heptadecan-9-yl-8-((3-(1H-imidazol-1-yl)propyl)(nonyl)amino)octanoate

Stage 1: Heptadecan-9-yl-8-((3-chloropropyl)(nonyl)amino)octanoate

Chemical formula: C ₃₇ H ₇₄ ClNO ₂

Molecular weight: 600.45

[0042] Mesyl chloride (0.070 ml, 0 .91 mmol) followed by the addition of triethylamine (0.13 ml, 0.91 mmol). The reaction mixture was allowed to warm slowly to room temperature. pace. and stirred overnight. The reaction mixture was quenched by the addition of water (~10 ml). The mixture was extracted three times with DCM and the extracted organics were washed with saturated aqueous sodium chloride, dried over MgSO ₄ , filtered and concentrated in vacuo. The crude oil was purified by silica gel chromatography to give heptadecan-9-yl-8-((3-chloropropyl)(nonyl)amino)octanoate (0.23g, 42%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.84 (n, 1H); 3.58 (t, 2H); 2.51 (br. s, 2H); 2.35 (br. s, 2H); 2.26 (2, 2H); 1.86 (br. s, 2H); 1.40-1.60 (broad m, 12H); 1.24 (broad m, 42H); 0.86 (t, 9H).

Stage 2: Heptadecan-9-yl-8-((3-(1H-imidazol-1-yl)propyl)(nonyl)amino)octanoate

Chemical formula: C ₄₀ H ₇₇ N ₃ O ₂

Molecular weight: 632.08

[0043] In a round bottom flask, heptadecan-9-yl-8-((3-chloropropyl)(nonyl)amino)octanoate (50 mg, 0.083 mmol) was mixed with imidazole (17 mg, 0.25 mmol), K ₂ CO ₃ (35 mg, 0.25 mmol) in MeCN (0.5 ml). The flask was equipped with a refrigerator and placed in a flask heater heated to 82°C and left to stir for 24 hours. After the indicated time, the reaction mixture was left to cool to room temperature. temp., filtered and the filtrate was concentrated in vacuo . The crude oil was purified by silica gel chromatography (0-100% [DCM, 20% MeOH, 1% NH ₄ OH]/MeOH) to give the desired product as a colorless oil (39 mg, 74%). UHPLC/DSIO: RT=2.92 min. MS (ESI): m/z (MH ⁺ ) 633.994 for C ₄₀ H ₇₇ N ₃ O ₂ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.46 (s, 1H); 7.05 (s, 1H); 6.91 (s, 1H); 4.84 (dt, 1H); 4.02 (br. s, 2H); 2.47 (br. s, 4H); 2.26 (t, 2H); 2.00 (br. s, 2H); 1.47-1.59 (broad m, 10H); 1.24 (broad m, 44H); 0.86 (t, 9H).

J. Compound 9: Heptadecan-9-yl-8-((2-acetoxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₈₉ NO ₆

Molecular weight: 752.22

[0044] To a solution of heptadecan-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (100 mg, 0.14 mmol) and acetic acid (8 mg, 0 .13 mmol) in dichloromethane (1 ml) was added N - (3-dimethylaminopropyl) - N '-ethylcarbodiimide hydrochloride (31 mg, 0.16 mmol), N, N -diisopropylethylamine (73 mg, 0.56 mmol) and DMAP (3 mg, 0.02 mmol). The reaction mixture was allowed to stir at room temperature. pace. for 18 hours. The reaction mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution. The organic layer was separated and washed with saturated aqueous sodium chloride, and dried over MgSO ₄ . The organic layer was filtered off and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-acetoxyethyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate (63 mg, 0.08 mmol). UHPLC/DSIO: RT=3.63 min. MS (ESI): m/z (MH ⁺ ) 753.07 for C ₄₆ H ₈₉ NO ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87 (n, 1H); 4.17-3.99 (m, 4H); 2.67 (m, 2H); 2.43 (m, 3H); 2.29 (m, 4H); 2.05 (s, 3H); 1.71-1.17 (broad m, 63H); 0.88 (m, 9H).

K. Compound 10: Heptadecan-9-yl-8-((2-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[0045] Compound 10 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.73 min. MS (ESI): m/z (MH ⁺ ) 725.10 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.80-3.54 (broad m, 1H); 2.61-2.13 (broad m, 9H); 1.69-1.03 (broad m, 67H); 0.88 (m, 9H).

L. Compound 11: Heptadecan-9-yl-( R )-8-((2-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.21

[0046] Compound 11 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UPLC/DSIO: RT=5.21 min. MS (ESI): m/z (MH ⁺ ) 725.02 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.72 (broad m, 1H); 2.65-2.10 (broad m, 8H); 1.71-0.99 (broad m, 68H); 0.88 (m, 9H).

M. Compound 12: Heptadecan-9-yl-( S )-8-((2-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.21

[0047] Compound 12 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=5.30 min. MS (ESI): m/z (MH ⁺ ) 725.10 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.71 (broad m, 1H); 2.64-2.10 (broad m, 8H); 1.71-1.03 (broad m, 68H); 0.88 (m, 9H).

N. Compound 13: Heptadecan-9-yl-8-((2-hydroxybutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.24

[0048] Compound 13 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.89 min. MS (ESI): m/z (MH ⁺ ) 739.21 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.58-3.38 (broad m, 1H); 2.65-2.15 (broad m, 9H); 1.72-1.12 (broad m, 66H); 0.98 (t, 3H); 0.88 (m, 9H).

O. Compound 14: Heptadecan-9-yl-8-((2-(dimethylamino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₂ N ₂ O ₄

Molecular weight: 737.252

[0049] Compound 14 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.51 min. MS (IER):m/z (MH⁺) 738.23 for C₄₆H₉₂N₂O₄. ¹H NMR (300 MHz, CDCl₃) δ: ppm 4.84 (n, 1H); 4.04 (t, 2H); 2.95 (m, 2H); 2.78 (m, 6H); 2.44 (s, 6H); 2.28 (m, 4H); 1.70-1.41 (broad m, 14H); 1.41-1.14 (broad m, 48H); 0.87 (m, 9H).

P. Compound 15: Heptadecan-9-yl-8-((2-methoxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.21

[0050] Compound 15 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.90 min. MS (IER):m/z (MH⁺) 725.19 for C₄₅H₈₉NO₅. ¹H NMR (300 MHz, CDCl₃) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.43 (m, 2H); 3.34 (s, 3H); 2.61 (m, 2H); 2.43 (m, 3H); 2.29 (m, 4H); 1.70-1.15 (broad m, 63H); 0.88 (m, 9H).

Q. Compound 16: Heptadecan-9-yl-8-((3-methoxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.236

[0051] Compound 16 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.90 min. MS (ESI): m/z (MH ⁺ ) 739.13 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.42 (m, 2H); 3.35 (s, 3H); 2.55-2.21 (m, 9H); 1.81-1.18 (broad m, 65H); 0.88 (m, 9H).

R. Compound 17: Heptadecan-9-yl-8-((2-(2-(dimethylamino)ethoxy)ethyl)-(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₆ N ₂ O ₅

Molecular weight: 781.305

[0052] Compound 17 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.72 min. MS (ESI): m/z (MH ⁺ ) 782.27 for C ₄₈ H ₉₆ N ₂ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (n, 1H); 4.08 (t, 2H); 3.57 (m, 4H); 2.72 (m, 2H); 2.52 (m, 5H); 2.38-2.13 (broad m, 12H); 1.73-1.19 (broad m, 61H); 0.90 (m, 9H).

S. Compound 18: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.18

[0053] Compound 18 was synthesized according to the general procedure and illustrative example of procedure 1 described above, or according to the scheme below:

[0054] UHPLC/DSIO: RT=3.59 min. MS (ESI): m/z (MH ⁺ ) 710.89 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 1H); 4.05 (t, 2H); 3.53 (broad m, 2H); 2.83-2.36 (broad m, 5H); 2.29 (m, 4H); 0.96-1.71 (m, 64H); 0.88 (m, 9H).

T. Compound 19: Heptadecan-9-yl-8-((3-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.21

[0055] Compound 19 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=4.51 min. MS (ESI): m/z (MH ⁺ ) 725.19 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.80 (m, 2H); 2.92-2.36 (broad m, 5H); 2.29 (m, 4H); 1.89-1.42 (broad m, 16H); 1.42-1.02 (broad m, 50H); 0.88 (m, 9H).

U. Compound 20: Heptadecan-9-yl-8-((4-hydroxybutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.24

[0056] Compound 20 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.84 min. MS (ESI): m/z (MH ⁺ ) 739.21 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.77-3.45 (broad m, 2H); 2.63-2.20 (broad m, 8H); 1.82-1.40 (broad m, 18H); 1.40-1.15 (broad m, 51H); 0.88 (m, 9H).

V. Compound 21: Heptadecan-9-yl-8-((2-cyanoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₆ N ₂ O ₄

Molecular weight: 719.19

[0057] Compound 21 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=4.04 min. MS (ESI): m/z (MH ⁺ ) 720.18 for C ₄₅ H ₈₆ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (n, 1H); 4.07 (t, 2H); 2.81 (m, 2H); 2.44 (m, 5H); 2.30 (m, 4H); 1.73-1.18 (broad m, 63H); 0.89 (m, 9H).

W. Compound 22: Heptadecan-9-yl-8-((2-hydroxycyclohexyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₃ NO ₅

Molecular weight: 764.27

[0058] Compound 22 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=4.54 min. MS (ESI): m/z (MH ⁺ ) 765.21 for C ₄₈ H ₉₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 2.89-2.34 (broad m, 4H); 2.28 (m, 4H); 2.00 (m, 1H); 1.86-0.99 (broad m, 72H); 0.88 (m, 9H).

X. Compound 23: Heptadecan-9-yl-10-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)decanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.24

[0059] Compound 23 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.75 min. MS (ESI): m/z (MH ⁺ ) 739.13 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 1H); 4.05 (m, 2H); 3.72-3.46 (broad m, 2H); 2.81-2.35 (broad m, 5H); 2.29 (m, 4H); 1.71-1.40 (broad m, 13H); 1.40-1.15 (broad m, 55H); 0.88 (m, 9H).

Y. Compound 24: Heptadecan-9-yl-( Z )-8_((2-hydroxyethyl) (8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₅ NO ₅

Molecular weight: 708.17

[0060] Compound 24 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.54 min. MS (ESI): m/z (MH ⁺ ) 708.95 for C ₄₄ H ₈₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.74-5.44 (broad m, 2H); 4.86 (m, 1H); 4.62 (m, 2H); 3.71-3.40 (broad m, 2H); 2.81-2.37 (broad m, 5H); 2.29 (m, 4H); 2.09 (m, 2H); 1.70-1.14 (broad m, 58H); 0.88 (m, 9H).

Z. Compound 25: Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.182

[0061] Compound 25 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.66 min. MS (ESI): m/z (MH ⁺ ) 711.00 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 1H); 4.05 (t, 2H); 3.68-3.46 (broad m, 2H); 2.77-2.37 (broad m, 5H); 2.29 (m, 4H); 1.74-1.41 (broad m, 14H); 1.39-1.18 (m, 50H); 0.88 (m, 9H).

AA. Compound 26: Heptadecan-9-yl-8-((2-hydroxyethyl)(4-(nonyloxy)-4-oxobutyl)amino)octanoate

Chemical formula: C ₄₀ H ₇₉ NO ₅

Molecular weight: 654.07

[0062] Compound 26 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=4.29 min. MS (ESI): m/z (MH ⁺ ) 655.07 for C ₄₀ H ₇₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.06 (t, 2H); 3.79 (broad m, 2H); 2.91-2.20 (broad m, 10H); 1.98-1.03 (broad m, 55H); 0.88 (m, 9H).

AB. Compound 27: Nonyl-8-((6-(heptadecan-9-yloxy)-6-oxohexyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₃ NO ₅

Molecular weight: 682.13

[0063] Compound 27 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.57 min. MS (ESI): m/z (MH ⁺ ) 683.12 for C ₄₂ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 1H); 4.05 (m, 2H); 3.70-3.45 (broad m, 2H); 2.78-2.35 (broad m, 5H); 2.29 (m, 4H); 1.73-1.41 (m, 13H); 1.41-1.16 (m, 47H); 0.88 (m, 9H).

AC. Compound 28: Heptadecan-9-yl-8-((8-(((2-hexylcyclopropyl)methoxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₇ NO ₅

Molecular weight: 722.19

[0064] Compound 28 was synthesized according to the general procedure and Illustrative Procedure Example 1 described above using Intermediate C. UPLC/DSIO: RT=5.17 min. MS (ESI): m/z (MH ⁺ ) 722.97 for C ₄₅ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.17 (m, 1H); 3.93 (m, 1H); 3.61 (broad m, 2H); 2.97-2.37 (broad m, 6H); 2.35-2.21 (m, 4H); 1.74-0.97 (broad m, 60H); 0.94-0.79 (m, 10H); 0.74 (m, 1H); 0.01 (m, 1H).

AD. Compound 29: Di(heptadecan-9-yl) 8,8 ' -((2-hydroxyethyl)azandiyl)dioctanoate

Chemical formula: C ₅₂ H ₁₀₃ NO ₅

Molecular weight: 822.40

[0065] Compound 29 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.98 min. MS (ESI): m/z (MH ⁺ ) 823.19 for C ₅₂ H ₁₀₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 2H); 3.72-3.44 (broad m, 2H); 2.83-2.34 (broad m, 5H); 2.28 (m, 4H); 1.69-1.39 (broad m, 16H); 1.39-1.16 (broad m, 62H); 0.88 (m, 12H).

AE. Compound 30: 7-((2-Hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.18

[0066] Compound 30 was synthesized according to the general procedure and Illustrative Procedure 1 described above using Intermediate B. UPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH ⁺ ) 711.16 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.06 (m, 4H); 3.69-3.44 (broad m, 2H); 2.71-2.39 (broad m, 5H); 2.29 (m, 3H); 1.70-1.16 (broad m, 64H); 0.88 (m, 9H).

A.F. Compound 31: heptadecan-9-yl-(Z)-8-((2-hydroxyethyl)(octadec-9-en-1-yl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₃

Molecular weight: 692.21

[0067] Compound 31 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.83 min. MS (ESI): m/z (MH ⁺ ) 693.20 for C ₄₅ H ₈₉ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.37 (m, 2H); 4.89 (n, 1H); 3.58 (broad m, 2H); 2.72-2.43 (broad m, 5H); 2.30 (m, 2H), 2.05 (m, 4H); 1.71-1.03 (br. m, 63H), 0.90 (m, 9H).

AG. Compound 32: nonyl-8-((2-hydroxyethyl)(8-oxo-8-(pentadecan-7-yloxy)octyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₃ NO ₅

Molecular weight: 682.13

[0068] Compound 32 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.45 min. MS (ESI): m/z (MH ⁺ ) 683.20 for C ₄₂ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.60 (broad m, 2H); 2.85-2.40 (broad m, 5H); 2.31(m, 4H), 1.78-1.01(m, 59H), 0.90(m, 9H).

AH. Compound 33: nonyl 8-((2-hydroxyethyl)(8-oxo-8-(tetradecan-6-yloxy)octyl)amino)octanoate

Chemical formula: C ₄₁ H ₈₁ NO ₅

Molecular weight: 668.10

[0069] Compound 33 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.39 min. MS (ESI): m/z (MH ⁺ ) 669.09 for C ₄₁ H ₈₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.84-3.54 (broad m, 2H); 2.99-2.41 (broad m, 5H); 2.31 (m, 4H), 1.76-1.02 (br. m, 57H), 0.90 (m, 9H).

AI. Compound 34: dodecan-4-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₃₉ H ₇₇ NO ₅

Molecular weight: 640.05

[0070] Compound 34 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.21 min. MS (ESI): m/z (MH ⁺ ) 641.05 for C ₃₉ H ₇₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (n, 1H); 4.08 (t, 2H); 3.67 (broad m, 2H); 3.03-2.44 (broad m, 5H); 2.30 (m, 4H), 1.75-1.00 (br. m, 53H), 0.90 (m, 9H).

AJ. Compound 35: nonyl-8-((2-hydroxyethyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₃₈ H ₇₅ NO ₅

Molecular weight: 626.02

[0071] Compound 35 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.16 min. MS (ESI): m/z (MH ⁺ ) 627.11 for C ₃₈ H ₇₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.83 (n, 1H); 4.08 (t, 2H); 3.63 (broad m, 2H); 2.81-2.39 (broad m, 5H); 2.31 (m, 4H), 1.74-1.01 (br. m, 51H), 0.90 (m, 9H).

AK. Compound 36: decan-2-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₃₇ H ₇₃ NO ₅

Molecular weight: 611.99

[0072] Compound 36 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.05 min. MS (ESI): m/z (MH ⁺ ) 613.00 for C ₃₇ H ₇₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (n, 1H); 4.08 (t, 2H); 3.55 (m, 2H); 2.60 (m, 2H); 2.47 (m, 4H); 2.29 (m, 4H), 1.731-1.01 (m, 51H), 0.90 (m, 6H).

AL. Compound 47: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-(2-octylcyclopropyl)octyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₃

Molecular weight: 706.24

[0073] Compound 47 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.92 min. MS (ESI): m/z (MH ⁺ ) 707.39 for C ₄₆ H ₉₁ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 3.56 (broad m, 2H); 2.72-2.38 (broad m, 5H); 2.28 (t, 2H); 1.70-1.02 (br. m, 67H), 0.88 (m, 9H); 0.71-0.49 (m, 4H); -0.33 (m, 1H).

AM. Compound 48: decan-2-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.21

[0074] Compound 48 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.60 min. MS (ESI): m/z (MH ⁺ ) 725.10 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 2H); 3.59 (broad m, 2H); 2.79-2.37 (broad m, 5H); 2.29 (m, 4H); 1.74-1.13 (m, 66H); 0.90 (m, 9H).

AN. Compound 49: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.24

[0075] Compound 49 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.68 min. MS (ESI): m/z (MH ⁺ ) 739.21 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 2H); 3.56 (broad m, 2H); 2.68-2.39 (broad m, 5H); 2.30 (m, 4H); 1.71-1.19 (m, 66H); 0.90 (m, 12H).

AO. Compound 50: dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₃ NO ₅

Molecular weight: 752.26

[0076] Compound 50 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.73 min. MS (ESI): m/z (MH ⁺ ) 753.23 for C ₄₇ H ₉₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 2H); 3.60 (broad m, 2H); 2.75-2.43 (broad m, 5H); 2.30 (m, 4H); 1.71-1.44 (m, 16H); 1.28 (m, 51H); 0.90 (m, 12H).

A.P. Compound 51: heptadecan-9-yl-8-((4-butoxy-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₃₅ H ₆₉ NO ₅

Molecular weight: 583.94

[0077] Compound 51 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.05 min. MS (ESI): m/z (MH ⁺ ) 584.87 for C ₃₅ H ₆₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.10 (t, 2H); 3.61 (broad m, 2H); 2.81-2.21 (broad m, 9H); 1.87(m, 2H), 1.70-1.04(m, 43H), 0.98-0.82(m, 9H).

A.Q. Compound 52: Heptadecan-9-yl-8-((2-hydroxyethyl)(4-oxo-4-(pentyloxy)butyl)amino)octanoate

Chemical formula: C ₃₆ H ₇₁ NO ₅

Molecular weight: 597.97

[0078] Compound 52 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.11 min. MS (ESI): m/z (MH ⁺ ) 598.90 for C ₃₆ H ₇₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.09 (t, 2H); 3.61 (broad m, 2H); 2.89-2.22 (broad m, 9H); 1.87(m, 2H), 1.73-1.43(m, 11H), 1.28(m, 34H); 0.90 (m, 9H).

AR. Compound 53: heptadecan-9-yl-8-((4-(hexyloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₃₇ H ₇₃ NO ₅

Molecular weight: 611.99

[0079] Compound 53 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.22 min. MS (ESI): m/z (MH ⁺ ) 612.92 for C ₃₇ H ₇₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.06 (t, 2H); 3.55 (broad m, 2H); 2.68-2.38 (broad m, 5H); 2.28 (m, 4H); 1.79 (broad m, 2H); 1.71-0.96 (m, 48H); 0.88 (m, 9H).

AS. Compound 54: Heptadecan-9-yl-8-((4-(heptyloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₃₈ H ₇₅ NO ₅

Molecular weight: 626.02

[0080] Compound 54 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.28 min. MS (ESI): m/z (MH ⁺ ) 626.94 for C ₃₈ H ₇₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.09 (t, 2H); 3.60 (broad m, 2H); 2.77-2.42 (broad m, 5H); 2.32 (m, 4H); 1.84 (broad m, 2H); 1.75-1.03 (m, 49H); 0.90 (m, 9H).

AT. Compound 55: Heptadecan-9-yl-8-((4-((2-hexylcyclopropyl)methoxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₁ H ₇₉ NO ₅

Molecular weight: 666.09

[0081] Compound 55 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.37 min. MS (ESI): m/z (MH ⁺ ) 667.04 for C ₄₁ H ₇₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.83 (n, 1H); 4.15 (m, 1H); 3.95 (m, 1H); 3.53 (broad m, 2H); 2.66-2.39 (broad m, 5H); 2.34-2.19 (m, 4H); 1.78 (broad m, 2H); 1.66-0.98 (m, 50H); 0.85 (m, 10H); 0.70 (m, 1H); 0.00 (m, 1H).

AU. Compound 56: nonyl-8-((2-hydroxyethyl)(8-oxo-8-(tridecan-7-yloxy)octyl)amino)octanoate

Chemical formula: C ₄₀ H ₇₉ NO ₅

Molecular weight: 654.07

[0082] Compound 56 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.28 min. MS (ESI): m/z (MH ⁺ ) 654.99 for C ₄₀ H ₇₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.60 (broad m, 2H); 2.77-2.40 (broad m, 5H); 2.30 (m, 4H); 1.78-0.99 (m, 55H); 0.90 (m, 9H).

A.V. Compound 57: nonan-5-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₃₆ H ₇₁ NO ₅

Molecular weight: 597.97

[0083] Compound 57 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.88 min. MS (ESI): m/z (MH ⁺ ) 598.98 for C ₃₆ H ₇₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.59 (broad m, 2H); 2.82-2.37 (broad m, 5H); 2.31 (m, 4H); 1.73-1.03 (m, 47H); 0.91 (m, 9H).

A.W. Compound 58: heptan-4-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₃₄ H ₆₇ NO ₅

Molecular weight: 569.91

[0084] Compound 58 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.67 min. MS (ESI): m/z (MH ⁺ ) 570.93 for C ₃₄ H ₆₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.93 (n, 1H); 4.08 (t, 2H); 3.57 (broad m, 2H); 2.69-2.42 (broad m, 5H); 2.30 (m, 4H); 1.72-1.04 (m, 43H); 0.93 (m, 9H).

AX. Compound 59: nonyl 8-((2-hydroxyethyl)(8-oxo-8-(pentan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₃₂ H ₆₃ NO ₅

Molecular weight: 541.86

[0085] Compound 59 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.39 min. MS (ESI): m/z (MH ⁺ ) 542.80 for C ₃₂ H ₆₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.78 (n, 1H); 4.08 (t, 2H); 3.57 (broad m, 2H); 2.71-2.39 (broad m, 5H); 2.31 (m, 4H); 1.77-1.05 (m, 39H); 0.90 (m, 9H).

AY. Compound 60: (5Z,12Z)-Heptadeca-5,12-dien-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

(5 Z ,12 Z )-Heptadeca-5,12-dien-9-ol

Chemical formula: C ₁₇ H ₃₂ O

Molecular weight: 252.44

[0086] To a solution of ( Z )-1-bromoct-3-ene (6.2 g, 32.4 mmol) in THF (45 ml) was added turnings of Mg (0.843 g, 34.7 mmol). The reaction mixture was heated to 45° C. for 3 hours. The reaction mixture was cooled to 0° C. and ethyl formate (2.4 g, 32.4 mmol) in THF (5 ml) was added dropwise. The reaction mixture was allowed to warm to room temperature. pace. and stirred for 30 min. The reaction mixture was cooled to 0° C. and quenched with water (15 ml) and 6N HCl (15 ml). The reaction mixture was stirred until all the Mg had dissolved. Water (25 ml) was added and the mixture was extracted with a mixture of hexanes (3X25 ml). The combined organic layer was washed with saturated aqueous sodium chloride, separated, dried over Na ₂ SO ₄ , filtered and evaporated under vacuum. The residue was dissolved in EtOH (20 ml), a solution of KOH in water (1.76 g in 8 ml of water) was added and left to stir for 15 minutes. The EtOH was evaporated in vacuo. The residue was diluted with water (20 ml), acidified with 6N HCl (20 ml) and extracted with a mixture of hexanes (3x). The combined organic layers were washed with saturated aqueous sodium chloride, separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-5%) EtOAc in hexanes to give ( 5Z , 12Z )-heptadeca-5,12-dien-9-ol (2.3 g, 9.1 mmol, 28%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.41 (m, 4); 3.66 (m, 1H); 2.13 (m, 8H); 1.51 (m, 5H); 1.36 (m, 8H); 0.92 (m, 6H).

(5 Z ,12 Z )-Heptadeca-5,12-dien-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₃ NO ₅

Molecular weight: 706.15

[0087] Compound 60 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.36 min. MS (ESI): m/z (MH ⁺ ) 707.10 for C ₄₄ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.37 (m, 4H); 4.92 (n, 1H); 4.08 (t, 2H); 3.57 (broad m, 2H); 2.73-2.38 (broad m, 5H); 2.31 (m, 4H); 2.04 (m, 8H); 1.73-1.01 (m, 47H); 0.92 (m, 9H).

AZ. Compound 61: (5Z,12Z)-heptadeca-5,12-dien-9-yl-8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₃ NO ₅

Molecular weight: 706.15

[0088] Compound 61 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.39 min. MS (ESI): m/z (MH ⁺ ) 707.10 for C ₄₄ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.37 (m, 4H); 4.92 (n, 1H); 4.08 (t, 2H); 3.58 (broad m, 2H); 2.70-2.41 (broad m, 5H); 2.32 (m, 4H); 2.04 (m, 8H); 1.77-1.03 (m, 47H); 0.92 (m, 9H).

B.A. Compound 65: 1-Cyclopropylnonyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₁ NO ₅

Molecular weight: 750.247

[0089] Compound 65 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.72 min. MS (ESI): m/z (MH ⁺ ) 750.9 for C ₄₇ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.28 (m, 1H); 3.54 (m, 2H); 2.59 (m, 2H); 2.46 (m, 4H); 2.29 (m, 4H), 1.73-1.18 (m, 61H); 0.90 (m, 10H); 0.62-0.33 (m, 3H); 0.28 (m, 1H).

B.B. Compound 66: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-oxo-8-((4-pentylcyclohexyl)oxy)octyl)amino)octanoate

Chemical formula: C ₄₆ H ₈₉ NO ₅

Molecular weight: 736.220

[0090] Compound 66 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.72 min. MS (ESI): m/z (MH ⁺ ) 736.9 for C ₄₆ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.00 (m, 0.5H); 4.89 (m, 1H); 4.68 (m, 0.6H); 3.56 (m, 2H), 2.61 (br. m, 2H); 2.48 (m, 4H); 2.30 (m, 4H); 1.98 (m, 1H); 1.82 (m, 2H); 1.73-1.14 (m, 61H); 1.04 (m, 1H); 0.90 (m, 9H).

BC. Compound 67: Heptadecan-9-yl-8-((2-hydroxyethyl)(4-oxo-4-((4-pentylcyclohexyl)oxy)butyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₁ NO ₅

Molecular weight: 680.112

[0091] Compound 67 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.56 min. MS (ESI): m/z (MH ⁺ ) 680.8 for C ₄₂ H ₈₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.01 (m, 0.4H); 4.89 (m, 1H); 4.68 (m, 0.6H); 3.59 (m, 2H), 2.72-2.43 (broad m, 6H); 2.30 (m, 4H); 1.98 (m, 1H); 1.83 (m, 4H); 1.69-1.44 (m, 10H); 1.28 (m, 41H); 1.03 (m, 1H); 0.90 (m, 9H).

B.D. Compound 68: Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((4-pentylcyclohexyl)oxy)hexyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₅ NO ₅

Molecular weight: 708.166

[0092] Compound 68 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.66 min. MS (ESI): m/z (MH ⁺ ) 708.9 for C ₄₄ H ₈₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.00 (m, 0.5H); 4.89 (m, 1H); 4.68 (m, 0.6H); 3.55 (m, 2H), 2.66-2.39 (broad m, 6H); 2.30 (m, 4H); 1.97 (m, 1H); 1.83 (m, 2H); 1.73-1.41 (m, 15H); 1.41-1.17 (m, 42H); 1.04 (m, 1H); 0.90 (m, 9H).

B.E. Compound 69: Heptadecan-9-yl-8-((2,3-dihydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₆

Molecular weight: 740.21

[0093] Compound 69 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.60 min. MS (ESI): m/z (MH ⁺ ) 741.0 for C ₄₅ H ₈₉ NO ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.76 (broad m, 2H); 3.51 (m, 1H); 2.57 (m, 6H); 2.31 (m, 4H); 1.71-1.41 (m, 14H); 1.41-1.12 (m, 48H); 0.90 (m, 9H).

b.f. Compound 70: Heptadecan-9-yl-8-((4-(decan-2-yloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₁ H ₈₁ NO ₅

Molecular weight: 667.61

[0094] Compound 70 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.44 min. MS (ESI): m/z (MH ⁺ ) 668.9 for C ₄₁ H ₈₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 2H); 3.57 (m, 2H); 2.71-2.40 (m, 5H); 2.30 (m, 4H), 1.80 (m, 2H); 1.71-1.40 (m, 11H); 1.39-1.05 (m, 45H); 0.90 (m, 9H).

bg. Compound 71: Heptadecan-9-yl-8-((2-hydroxyethyl)(4-oxo-4-(tetradecan-6-yloxy)butyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[0095] Compound 71 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.72 min. MS (ESI): m/z (MH ⁺ ) 724.9 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 2H); 3.56 (m, 2H); 2.70-2.41 (m, 6H); 2.33 (m, 4H), 1.80 (m, 2H); 1.69-1.41 (m, 13H); 1.28 (m, 48H); 0.90 (m, 12H).

B.H. Compound 72: Heptadecan-9-yl-8-((2-hydroxyethyl)(4-oxo-4-(undecan-3-yloxy)butyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₃ NO ₅

Molecular weight: 682.13

[0096] Compound 72 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.57 min. MS (ESI): m/z (MH ⁺ ) 683.0 for C ₄₂ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 2H); 3.58 (broad m, 2H); 2.75-2.41 (broad m, 5H); 2.30 (m, 4H), 1.81 (br. m, 2H); 1.70-1.42 (m, 13H); 1.40-1.18 (m, 42H); 0.90 (m, 12H).

B.I. Compound 73: Heptadecan-9-yl-8-((2-hydroxyethyl)(4-oxo-4-(pentadecan-7-yloxy)butyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.236

[0097] Compound 73 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.80 min. MS (ESI): m/z (MH ⁺ ) 739.09 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 2H); 3.59 (broad m, 2H); 2.81-2.43 (broad m, 6H); 2.31 (m, 4H); 1.83 (m, 2H); 1.69-1.42 (m, 12H); 1.28 (m, 50H); 0.90 (m, 12H).

b.j. Compound 74: Heptadecan-9-yl-8-((4-(dodecan-4-yloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₃ H ₈₅ NO ₅

Molecular weight: 696.155

[0098] Compound 74 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.68 min. MS (ESI): m/z (MH ⁺ ) 696.9 for C ₄₃ H ₈₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 2H); 3.56 (m, 2H); 2.70-2.41 (m, 6H); 2.30 (m, 4H), 1.80 (m, 2H); 1.70-1.40 (m, 12H); 1.28 (m, 44H); 0.90 (m, 12H).

B.K. Compound 75: Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-(undecan-3-yloxy)hexyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.18

[0099] Compound 75 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.67 min. MS (ESI): m/z (MH ⁺ ) 711.1 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (m, 2H); 3.57 (m, 2H); 2.72-2.40 (broad m, 5H); 2.30 (m, 4H); 1.70-1.42 (m, 16H); 1.28 (m, 45H); 0.90 (m, 12H).

B.L. Compound 79: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-((4-pentylcyclohexyl)oxy)octyl)amino)octanoate

Chemical formula: C ₃₈ H ₇₃ NO ₅

Molecular weight: 624.00

[00100] Compound 79 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.10 min. MS (ESI): m/z (MH ⁺ ) 624.8 for C ₃₈ H ₇₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.00 (broad m, 0.5H); 4.68 (m, 0.5H); 4.08 (t, 2H); 3.56 (m, 2H); 2.72-2.38 (m, 6H); 2.31(m, 4H), 1.97(m, 1H); 1.82 (m, 2H); 1.73-0.95 (m, 48H), 0.90 (m, 6H).

bm. Compound 80: [1,1' -Bi(cyclohexane)]-4-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₃₉ H ₇₃ NO ₅

Molecular weight: 636.02

[00101] Compound 80 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.10 min. MS (ESI): m/z (MH ⁺ ) 636.9 for C ₃₉ H ₇₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.01 (broad m, 0.5H); 4.65 (m, 0.5H); 4.08 (t, 2H); 3.56 (m, 2H); 2.69-2.36 (m, 6H); 2.31(m, 4H); 2.07-0.84 (m, 57H).

bn. Compound 81: Cyclopentadecyl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₁ NO ₅

Molecular weight: 680.11

[00102] Compound 81 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.36 min. MS (ESI): m/z (MH ⁺ ) 681.0 for C ₄₂ H ₈₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (n, 1H); 4.08 (t, 2H); 3.57 (broad m, 2H); 2.74-2.39 (m, 6H); 2.30(m, 4H), 1.73-1.03(m, 62H), 0.90(m, 3H).

B.O. Compound 94: Heptadecan-9-yl)-8-(benzyl(8-nonyloxy)-8-oxooctyl)amino)octanoate

Heptadecan-9-yl-8-(benzylamino)octanoate

Chemical formula: C ₃₂ H ₅₇ NO ₂

Molecular weight: 487.81

[00103] A solution of heptadecan-9-yl-8-bromooctanoate (250 mg, 0.542 mmol) in phenylmethanamine (1.2 ml, 10.83 mmol) was allowed to stir at room temperature. pace. within 6 hours the Reaction mixture was cooled to room. pace. and the solvents were evaporated in vacuo. The residue was taken up in ethyl acetate and washed with saturated aqueous sodium hydrogen carbonate. The organic layer was separated and washed with saturated aqueous sodium chloride, dried over Na ₂ SO ₄ and evaporated in vacuo. The residue was purified by silica gel chromatography (20-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(benzylamino)octanoate (200 mg, 0.41 mmol, 76%). UPLC/DSIO: RT=2.87 min. MS (ESI): m/z (MH ⁺ ) 488.4 for C ₃₂ H ₅₇ NO ₂ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.35-7.25 (broad m, 5H); 4.89 (n, 1H); 3.81 (s, 2H); 2.65 (t, 2H); 2.29 (t, 2H); 1.65-1.51 (broad m, 8H); 1.28 (m, 30H); 0.90 (m, 6H).

Heptadecan-9-yl-8-(benzyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₈₉ NO ₄

Molecular weight: 756.25

[00104] A solution of heptadecan-9-yl-8-(benzylamino)octanoate (200 mg, 0.41 mmol), nonyl-8-bromooctanoate (172 mg, 0.49 mmol) and N,N -diisopropylethylamine (100 µl, 0.57 mmol) was dissolved in ethanol and left to stir at 62°C for 48 h. The reaction mixture was cooled to room temperature. pace. and the solvents were evaporated in vacuo. The residue was taken up in ethyl acetate and washed with saturated aqueous sodium hydrogen carbonate. The organic layer was separated and washed with saturated aqueous sodium chloride, dried over Na ₂ SO ₄ and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(benzyl(8-(nonyloxy)-8- oxooctyl) amino) octanoate (138 mg, 0.18 mmol, 45%). UHPLC/DSIO: RT=3.78 min. MS (ESI): m/z (MH ⁺ ) 757.0 for C ₄₉ H ₈₉ NO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.33-7.23 (broad m, 5H); 4.89 (n, 1H); 4.08 (t, 2H); 3.55 (s, 2H); 2.40 (m, 4H); 2.30 (m, 4H); 1.64-1.28 (broad m, 62H); 0.90 (m, 9H).

BP. Compound 96: 7-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)heptyldecanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.182

[00105] Compound 96 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.74 min. MS (ESI): m/z (MH ⁺ ) 711.0 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.61 (m, 2H); 2.88-2.37 (broad m, 6H); 2.31 (m, 4H), 1.79-1.04 (m, 62H); 0.90 (m, 9H).

B.Q. Compound 98: 8-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octan-2-yldecanoate

Octane-1,7-diol

Chemical formula: C ₈ H ₁₈ O ₂

Molecular weight: 146.230

[00106] A solution of 7-oxooctanoic acid (4 g, 25.29 mmol) in THF (10 ml) was added to a stirred solution of LAG in THF (70 ml) under N ₂ at 0°C. The mixture was allowed to warm to room temperature. pace. And stirred at room. pace. within 4 h, after the specified time to this solution was slowly added 10 ml of sat. Na ₂ SO ₄ , 10H ₂ O (aq.). The white solid was ground. Added additional amount of Na ₂ SO ₄ ,10H ₂ O and the mixture was filtered through a pad of celite. The filtrate was diluted with EtOAc and washed with saturated aqueous sodium chloride. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give octane-1,7-diol (2.97 g, 20.31 mmol, 80%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.81 (m, 1H); 3.66 (t, 2H); 1.66-1.31 (m, 12H); 1.22 (d, 3H).

8-(( tert -Butyldiphenylsilyl)oxy)octan-2-ol

Chemical formula: C ₂₄ H ₃₆ O ₂ Si

Molecular weight: 384.635

[00107] To a solution of octane-1,7-diol (1 g, 6.84 mmol) in DCM (75 ml) at 0°C was added imidazole (0.94 g, 13.81 mmol) followed by slow addition of a solution of tert - butyl(chloro)diphenylsilane (2.14 mL, 8.21 mmol) in DCM (using an addition funnel). The reaction mixture was allowed to stir at 0° C. for 1.5 hours. The reaction mixture was quenched with saturated NH ₄ Cl _(aq.) solution. The aqueous layer was extracted 3 times with DCM (3 x 50 ml). The organic layer was dried over anhydrous MgSO ₄ and filtered and the solvent was evaporated. The crude product was purified by silica gel flash column chromatography with 0-10% EtOAc in hexanes to give 8-(( tert- butyldiphenylsilyl)oxy)octan-2-ol (2.29 g, 5.95 mmol, 87%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.69 (m, 4H); 7.42 (m, 6H); 3.80 (m, 1H); 3.68 (t, 2H); 1.59 (m, 2H); 1.50-1.26 (m, 9H); 1.21 (d, 3H); 1.07 (s, 9H).

8-(( tert -Butyldiphenylsilyl)oxy)octan-2-yldecanoate

Chemical formula: C ₃₄ H ₅₄ O ₃ Si

Molecular weight: 538.888

[00108] 8-(( tert -Butyldiphenylsilyl)oxy)octan-2-yl decanoate was synthesized according to method A. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm. 7.69 (m, 4H); 7.42 (m, 6H); 4.92 (m, 1H); 3.67 (t, 2H); 2.29(t, 2H); 1.67-1.42 (m, 6H); 1.41-1.17 (m, 21H); 1.07 (s, 9H); 0.90 (m, 3H).

8-Hydroxyoctan-2-yldecanoate

Chemical formula: C ₁₈ H ₃₆ O ₃

Molecular weight: 300.483

[00109] To a solution of 8-[( tert -butyldiphenylsilyl)oxy]octan-2-yl decanoate (1.08 g, 2 mmol) in THF was added TBAF (8.02 ml of a 1 M solution in THF, 8.02 mmol) and the mixture was left to mix at room. pace. for 3 hours. The organic solvents were evaporated in vacuo. The residue was diluted with EtOAc and washed with sat. NaHCO ₃ , followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give 8-hydroxyoctan-2-yldecanoate (0.55 g, 1.82 mmol, 91%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 1H); 3.66 (t, 2H); 2.29 (t, 2H); 1.72-1.17 (m, 28H); 0.90 (m, 3H).

8-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octan-2-yldecanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00110] Compound 98 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH ⁺ ) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 2H); 3.58 (broad m, 2H); 2.77-2.40 (m, 6H); 2.29 (m, 4H); 1.72-1.41(m, 14H); 1.28 (m, 51H); 0.90 (m, 9H).

B.R. Compound 101: Heptadecan-9-yl-8-((2-(4-methylpiperazin-1-yl)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Heptadecan-9-yl-8-((2-chloroethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₆ ClNO ₄

Molecular weight: 728.63

[00111] To a solution of heptadecan-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (1100 mg, 1.55 mmol) in dichloromethane (25 mL) at 0 °C, N -chlorosuccinimide was added in one portion. The reaction mixture was allowed to stir at 0°C for 1 h followed by stirring for 1 h at room temperature. 90 ml of a mixture of hexanes was added and the reaction mixture was allowed to stir at room temperature for 20 minutes. The white solid was filtered through a plug of silica gel and washed three times with a mixture of hexanes. The organic layers were concentrated in vacuo. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.57 (m, 2H); 2.85 (m, 2H); 2.54 (m, 4H); 2.33-2.27 (m, 4H); 1.66-1.28 (broad m, 62H); 0.90 (m, 9H).

Heptadecan-9-yl-8-((2-(4-methylpiperazin-1-yl)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₇ N ₃ O ₄

Molecular weight: 792.33

[00112] 1-methylpiperazine solution (15 mg, 0.151 mmol), heptadecan-9-yl-8-((2-chloroethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (110 mg, 0.151 mmol) , K ₂ CO ₃ (42 mg, 0.302 mmol) and KI (3 mg, 0.0151 mmol) were dissolved in 1:1 THF:MeCN (1 ml:1 ml). The reaction mixture was left to stir at 65°C for 18 hours. The reaction mixture was cooled to room temperature, filtered and washed with a mixture of hexanes and EtOAc. The organic filtrate was transferred to a separating funnel and washed with water and saturated aqueous sodium chloride. The organic layers dried over Na ₂ SO ₄ were filtered and concentrated in vacuo. The residue was purified by silica gel chromatography [0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane] to give heptadecan-9-yl-8-((2-(4-methylpiperazin-1- yl)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (36 mg, 0.045 mmol, 30%). UHPLC/DSIO: RT=3.25 min. MS (ESI): m/z (MH ⁺ ) 792.8 for C ₄₉ H ₉₇ N ₃ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (n, 1H); 4.08 (t, 2H); 2.57-2.45 (broad m, 20H); 2.31 (m, 3H); 1.64-1.28 (broad m, 62H); 0.90 (m, 9H).

BS. Compound 103: Heptadecan-9-yl-8-((2-(4-methylpiperazin-1-yl)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Heptadecan-9-yl-8-((2-chloroethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₆ ClNO ₄

Molecular weight: 728.63

[00113] To a stirred solution of heptadecan-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (1100 mg, 1.55 mmol) in dichloromethane (25 mL) at 0°C in one portion was added N -chlorosuccinimide. The reaction mixture was allowed to stir at 0°C for 1 h followed by stirring for 1 h at room temperature. 90 ml of a mixture of hexanes was added and the reaction mixture was allowed to stir at room temperature for 20 minutes. The white solid was filtered through a plug of silica gel and washed three times with a mixture of hexanes. The organic layers were concentrated in vacuo. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 3.57 (m, 2H); 2.85 (m, 2H); 2.54 (m, 4H); 2.33-2.27 (m, 4H); 1.66-1.28 (broad m, 62H); 0.90 (m, 9H).

Heptadecan-9-yl-8-((2-morpholinoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₅

Molecular weight: 779.29

[00114] Morpholine solution (13 mg, 0.151 mmol), heptadecan-9-yl-8-((2-chloroethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (110 mg, 0.151 mmol), K ₂ CO ₃ (42 mg, 0.302 mmol) and KI (3 mg, 0.0151 mmol) were dissolved in 1:1 THF:MeCN (1 ml:1 ml). The reaction mixture was left to stir at 65°C for 18 hours. The reaction mixture was cooled to room temperature, filtered and washed with a mixture of hexanes and EtOAc. The organic filtrate was transferred to a separating funnel and washed with water and saturated aqueous sodium chloride. The organic layers dried over Na ₂ SO ₄ were filtered and concentrated in vacuo. The residue was purified by silica gel chromatography [0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane] to give heptadecan-9-yl-8-((2-(4-methylpiperazin-1- yl)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (58 mg, 0.074 mmol, 49%). UHPLC/DSIO: RT=3.53 min. MS (ESI): m/z (MH ⁺ ) 779.8 for C ₄₈ H ₉₄ N ₂ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H); 4.05 (t, 2H); 3.70 (m, 4H); 2.59-2.54 (m, 2H); 2.48-2.38 (m, 10H); 2.31-2.25 (m, 4H); 1.64-1.26 (broad m, 62H); 0.88 (m, 9H).

BT. Compound 108: Heptadecan-9-yl-8-((3-acetamidopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₅

Molecular weight: 765.26

[00115] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400 mg, 0.553 mmol) and triethylamine (0.15 ml, 1. 10 mmol) in 10 ml dichloromethane was added dropwise at 0°C acetyl chloride (47 μl, 0.66 mmol) and the reaction mixture was allowed to warm to room temperature for 16 h. MS showed the formation of the product and the mixture was diluted with dichloromethane and washed with saturated hydrogen carbonate solution sodium and saturated aqueous sodium chloride solution. Then it was dried over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a colorless oil (300 mg, 71%) . LC/UV (202 nm): RT=9.14 min. MS (CIAD): m/z (MH ⁺ ) 765.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.41 (br. s, 1H); 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.40-3.25 (m, 2H); 2.53-2.23 (m, 10H); 1.91 (s, 3H); 1.65-1.16 (m, 64H); 0.86 (m, 9H).

BU. Compound 109: Heptadecan-9-yl-8-((3-(methylsulfonamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₂ N ₂ O ₆ S

Molecular weight: 801.31

[00116] Methanesulfonyl chloride (51 µl, 0.66 mmol) was added dropwise to a 0°C solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400 mg, 0.553 mmol) and triethylamine (0.15 ml, 1.10 mmol) in 10 ml dichloromethane and the reaction mixture was allowed to warm to room temperature over 16 h. saturated aqueous sodium chloride solution. After drying over sodium sulfate, the filtrate was concentrated and purified by ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a colorless oil (296 mg, 88%). LC/UV (214 nm): RT=11.51 min. MS (CIAD): m/z (MH ⁺ ) 801.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.22 (t, 2H, J= 5.8 Hz); 2.88 (s, 3H); 2.53-2.23 (m, 10H); 1.73-1.16 (m, 64H); 0.87 (m, 9H).

b.v. Compound 110: Heptadecan-9-yl-8-((3-(3,3-dimethylureido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ N ₃ O ₅

Molecular weight: 794.30

[00117] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400 mg, 0.553 mmol), dimethylaminopyridine (7 mg, 0.0553 mmol ) and triethylamine (0.15 ml, 1.10 mmol) in 10 ml dichloromethane dimethylcarbamic acid chloride (56 μl, 0.61 mmol) was added dropwise at 0°C and the reaction mixture was left stirring at room temperature for 16 h. MS showed product formation. The mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution and saturated aqueous sodium chloride solution. Then it was dried over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a colorless oil (267 mg, 60%) . LC/UV (202 nm): RT=9.81 min. MS (CIAD): m/z (MH ⁺ ) 794.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.13 (t, 1H, J= 4.5 Hz); 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.32-3.26 (m, 2H); 2.85 (s, 6H); 2.52-2.23 (m, 10H); 1.67-1.18 (m, 64H); 0.87 (m, 9H).

b.w. Compound 111: Heptadecan-9-yl-8-((3-(3,3-dimethylthioureido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ N ₃ O ₄ S

Molecular weight: 810.37

[00118] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400 mg, 0.553 mmol) and triethylamine (0.15 ml, 1. 10 mmol) in 10 ml dichloromethane was added dropwise at 0°C thiophosgene (51 μl, 0.664 mmol) and the reaction mixture was left to stir at room temperature for 6 hours. After the indicated time, the reaction mixture was cooled to 0°C and a solution of dimethylamine in THF (2.0 M, 0.55 ml, 1.10 mmol). The reaction mixture was then allowed to stir at room temperature for 16 hours. MS indicated product formation and the mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution and saturated aqueous sodium chloride solution. After drying over sodium sulfate, the filtrate was concentrated and purified by ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a brown oil (346 mg, 77%). LC/UV (202 nm): RT=9.89 min. MS (CIAD): m/z (MH ⁺ ) 810.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.12 (br. s, 1H); 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.74-3.64 (m, 2H); 3.20 (s, 6H); 2.62-2.23 (m, 10H); 1.77-1.17 (m, 64H); 0.87 (m, 9H).

BX. Compound 112: Heptadecan-9-yl-8-((3-(3-methylureido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₃ N ₃ O ₅

Molecular weight: 780.28

[00119] Methyl isocyanate ( 38 mg, 0.664 mmol) and the reaction mixture was allowed to stir at room temperature for 16 hours. MS showed the formation of the product. The mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution and saturated aqueous sodium chloride solution. Then it was dried over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a colorless oil (320 mg, 70%) . LC/UV (202 nm): RT=9.63 min. MS (CIAD): m/z (MH ⁺ ) 780.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.54 (br. s, 1H); 4.85 (n, 1H, J= 6.0 Hz); 4.76 (br. s, 1H); 4.04 (t, 2H, J= 6.6 Hz); 3.23 (t, 2H, J= 5.8 Hz); 2.74 (d, 3H, J= 2.0 Hz); 2.47 (t, 2H, J= 6.0 Hz); 2.37 (t, 4H, J= 7.4 Hz); 2.31-2.23 (m, 4H); 1.68-1.17 (m, 64H); 0.87 (m, 9H).

BY. Compound 113: Heptadecan-9-yl-8-((3-(3-methylthioureido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₃ N ₃ O ₄ S

Molecular weight: 795.69

[00120] Methyl isothiocyanate ( 45 µl, 0.664 mmol) and the reaction mixture was allowed to stir at room temperature for 16 hours. MS showed the formation of the product. The mixture was concentrated and purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a colorless oil (312 mg, 70%). LC/UV (202 nm): RT=9.96 min. MS (CIAD): m/z (MH ⁺ ) 796.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.51 (br. s, 2H); 2.93 (br. s, 3H); 2.52 (t, 2H, J= 6.0 Hz); 2.41 (t, 4H, J= 7.8 Hz); 2.31-2.23 (m, 4H); 1.68-1.17 (m, 66H); 0.86 (m, 9H).

b.z. Compound 114: Heptadecan-9-yl-8-((3-(2,4-dioxo-3,4-dihydropyrimidine-1(2 H )-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₁ N ₃ O ₆

Molecular weight: 818.28

[00121] A mixture of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500 mg, 0.67 mmol), uracil (300 mg, 2.67 mmol) and 1,8-diazabicycloundec-7-ene (150 μl, 1.07 mmol) in 3 ml DMF were heated at 100° C. in a sealed tube for 16 h. The reaction mixture was concentrated to dryness and partitioned between dichloromethane and water. The organic layer was washed with saturated sodium chloride aqueous solution. Then it was dried over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a yellow oil (268 mg, 49%) . LC/UV (202 nm): RT=8.91 min. MS (CIAD): m/z (MH ⁺ ) 818.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.19 (br. s, 1H); 7.24 (d, 1H, J= 7.7 Hz); 5.64 (d, 1H, J= 7.7 Hz); 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.76 (t, 2H, J= 7.0 Hz); 2.45-2.24 (m, 10H); 1.81 (n, 2H, J= 6.6 Hz); 1.68-1.17 (m, 62H); 0.87 (m, 9H).

ca. Compound 115: Heptadecan-9-yl-8-((3-(4-amino-2-oxopyrimidine-1(2 H )-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₂ N ₄ O ₅

Molecular weight: 817.30

[00122] To a suspension of cytosine (82 mg, 0.74 mmol) in 1 ml DMF was added NaH (30 mg, 0.74 mmol) and the reaction mixture was stirred at room temperature for 30 minutes. Then a solution of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500 mg, 0.67 mmol) in 2 ml of DMF was added and the mixture was heated at 100° C in a sealed tube for 16 hours. MS showed the presence of the product. The reaction mixture was quenched with saturated sodium hydrogen carbonate solution and extracted with a mixture of hexanes (2X). The combined organic layer was washed with water and saturated aqueous sodium chloride. Then it was dried over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a yellow oil (310 mg, 56%) . LC/UV (202 nm): RT=8.32 min. MS (CIAD): m/z (MH ⁺ ) 817.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.34 (d, 1H, J= 7.1 Hz); 5.61 (d, 1H, J= 7.1 Hz); 5.44 (br. s, 2H); 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 3.79 (t, 2H, J= 7.0 Hz); 2.42-2.22 (m, 9H); 1.84 (t, 2H, J= 6.6 Hz); 1.68-1.17 (m, 63H); 0.86 (m, 9H).

CB. Compound 116: Heptadecan-9-yl-8-((3-(6-amino-9 H -purin-9-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₂ N ₆ O ₄

Molecular weight: 841.32

[00123] A mixture of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500 mg, 0.67 mmol), adenine (135 mg, 1.0 mmol) and 1,8-diazabicycloundec-7-ene (137 μl, 1.0 mmol) in 2 ml DMF were heated at 90° C. in a sealed tube for 16 hours. The reaction mixture was concentrated to dryness and partitioned between dichloromethane and water. The organic layer was washed with saturated sodium chloride aqueous solution. Then it was dried over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a yellow oil (325 mg, 57%) . LC/UV (202 nm): RT=8.47 min. MS (CIAD): m/z (MH ⁺ ) 841.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.36 (s, 1H); 7.80 (s, 1H); 5.51 (br. s, 2H); 4.85 (n, 1H, J= 6.0 Hz); 4.24 (t, 2H, J= 7.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 2.45-2.24 (m, 10H); 2.01 (n, 2H, J= 6.9 Hz); 1.68-1.17 (m, 62H); 0.86 (m, 9H).

CC. Compound 118: 3,4-Dipentylphenyl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

5-Methoxy-2-(pent-1-yn-1-yl)benzaldehyde (see e.g. Bioorg. Med. Chem. Lett. 2013 , 23 , 1365)

Chemical formula: C ₁₃ H ₁₄ O ₂

Molecular weight: 202.25

[00124] A mixture of 2-bromo-5-methoxybenzaldehyde (4.30 g, 20 mmol), 1-pentine (3.0 ml, 30 mmol), bis(triphenylphosphino)palladium chloride (702 mg, 1 mmol), CuI ( 380 mg, 2.0 mmol) and triethylamine (5.6 ml, 40 mmol) in 60 ml THF were heated to 50° C. for 16 hours under nitrogen. TLC showed the disappearance of starting material. The reaction mixture was concentrated to dryness. The residue was dissolved in dichloromethane and washed with water and saturated aqueous sodium chloride. After drying over sodium sulfate, the filtrate was concentrated and the residue was purified by ISCO (SiO ₂ : EtOAc/hexanes 0 to 5%) to give the product as a dark brown oil (3.00 g, 74%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.49 (s, 1H); 7.42 (d, 1H, J =8.5 Hz); 7.36 (d, 1H, J =2.8 Hz); 7.07 (dd, 1H, J =8.5 Hz, 2.8 Hz); 3.84 (s, 3H); 2.44 (t, 2H, J= 7.0 Hz); 1.62 (m, 2H); 1.05 (t, 3H, J= 7.2 Hz).

4-Methoxy-2-(pent-1-en-1-yl)-1-(pent-1-yn-1-yl)benzene

Chemical formula: C ₁₇ H ₂₂ O

Molecular weight: 242.36

[00125] To a suspension of butyltriphenylphosphonium bromide (8.88 g, 22.2 mmol) in 75 mL of THF was added potassium tert-butoxide (2.50 g, 22.2 mmol) at 0°C. After 30 minutes, a solution of 5-methoxy-2-(pent-1-yn-1-yl)benzaldehyde (3.00 g, 14.8 mmol) in 25 ml THF was then slowly added to the orange suspension. The reaction mixture was allowed to warm to room temperature and stirred for 60 h. Saturated ammonium chloride solution was added and the mixture was extracted with ether (2X) and the combined organic layer was washed with saturated aqueous sodium chloride solution. After drying over sodium sulfate, the filtrate was concentrated and the residue was purified by ISCO (SiO ₂ : EtOAc/hexanes 0 to 5%) to give the product as a brown oil (3.46 g, 96%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.33 (d, 0.5H, J =8.5 Hz); 7.26 (d, 0.5H, J =8.5 Hz); 6.99 (d, 0.5H, J =2.8 Hz); 6.88-6.80 (m, 1H); 6.73-6.61 (m, 1.5H); 6.25 (dt, 0.5H, J =15.9 Hz, 6.9 Hz); 5.73 (dt, 0.5H, J =11.5 Hz, 7.4 Hz); 3.80 (s, 3H); 2.45-2.37 (m, 2H); 2.31-2.18 (m, 2H); 1.71-1.41 (m, 4H); 1.09-0.90 (m, 6H).

4-Methoxy-1,2-dipentylbenzene

Chemical formula: C ₁₇ H ₂₈ O

Molecular weight: 248.41

[00126] A mixture of 4-methoxy-2-(pent-1-en-1-yl)-1-(pent-1-yn-1-yl)benzene (3.46 g, 14.3 mmol) and Pd/ C (10%, 300 mg) in 60 ml EtOH was stirred for 60 h under hydrogen from a balloon. TLC showed completion of the reaction. The reaction mixture was filtered through Celite and concentrated to give the product as a yellow oil (3.70 g, quant) which was used in the next step without purification. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.05 (d, 1H, J =8.2 Hz); 6.72-6.55 (m, 2H); 3.78 (s, 3H); 2.59-2.50 (m, 4H); 1.62-1.48 (m, 4H); 1.39-1.28 (m, 8H); 0.93-0.86 (m, 6H).

3,4-Dipentylphenol

Chemical formula: C ₁₆ H ₂₆ O

Molecular weight: 234.38

[00127] To a solution of 4-methoxy-1,2-dipentylbenzene (3.40 g, 13.7 mmol) in 75 ml dichloromethane was added dropwise at -78°C BBr ₃ (1.65 ml, 17.1 mmol) and then the reaction mixture was left to warm to room temperature for 3 hours. TLC showed the completion of the reaction. The reaction mixture was quenched by adding saturated sodium hydrogen carbonate solution and then it was extracted with dichloromethane (2X). The combined organic layer was washed with saturated aqueous sodium chloride and dried over sodium sulfate. After concentration, the residue was purified by ISCO (SiO ₂ : EtOAc/hexanes 0 to 30%) to give the product as a brown oil (3.35 g, 97%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.99 (d, 1H, J =8.0 Hz); 6.64-6.59 (m, 2H); 4.45 (br. s, 1H); 2.55-2.47 (m, 4H); 1.66-1.43 (m, 4H); 1.39-1.28 (m, 8H); 0.93-0.86 (m, 6H).

3,4-Dipentylphenyl-8-bromooctanoate

Chemical formula: C ₂₄ H ₃₉ BrO ₂

Molecular weight: 439.48

[00128] N- (3-dimethylaminopropyl) -N'- ethylcarbodiimide hydrochloride (1.92 g, 10 mmol) and DMAP (244 mg, 2 mmol). The reaction mixture was allowed to stir at room temperature for 18 hours. The reaction mixture was diluted with dichloromethane and extracted with saturated sodium hydrogen carbonate solution. The organic layer was separated and washed with saturated aqueous sodium chloride solution, dried over sodium sulfate. The organic layer was filtered off and evaporated in vacuo. The residue was purified with ISCO (SiO ₂ : EtOAc/hexanes 0 to 10%) to give the product as a brown oil (4.30 g, 98%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.11 (d, 1H, J =7.7 Hz); 6.84-6.77 (m, 2H); 3.41 (t, 2H, J =6.9 Hz); 2.60-2.49 (m, 6H); 1.92-1.69 (m, 4H); 1.62-1.29 (m, 18H); 0.90 (m, 6H).

Nonyl-8-((2-hydroxyethyl)amino)octanoate

Chemical formula: C ₁₉ H ₃₉ NO ₃

Molecular weight: 329.53

[00129] A mixture of nonyl-8-bromooctanoate (2.50 g, 7.15 mmol) and 2-aminoethanol (4.3 ml, 71.5 mmol) in 10 ml of EtOH was stirred at room temperature for 60 hours. The reaction mixture partitioned between a mixture of hexanes and water, and the organic layer was washed with saturated aqueous sodium chloride. After drying over sodium sulfate, the filtrate was concentrated and purified using ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 20%) to give the product as a white solid (1.57 g, 66 %). MS (CIAD): m/z (MH ⁺ ) 330.3. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.04 (t, 2H, J =6.6 Hz); 3.63 (t, 2H, J =5.2 Hz); 2.77 (t, 2H, J =5.1 Hz); 2.61 (t, 2H, J =7.1 Hz); 2.28 (t, 2H, J =7.4 Hz); 1.99 (br. s, 2H); 1.67-1.20 (m, 4H); 1.62-1.29 (m, 17H); 0.87 (m, 6H).

3,4-Dipentylphenyl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₃ H ₇₇ NO ₅

Molecular weight: 688.09

[00130] A solution of nonyl 8-((2-hydroxyethyl)amino)octanoate (500 mg, 1.52 mmol), 3,4-dipentylphenyl 8-bromooctanoate (1.00 g, 2.27 mmol) and N, N -diisopropylethylamine (0.40 ml, 2.27 mmol) in tert-butanol (3 ml) was heated to 60° C. in a sealed tube for 60 h. The reaction mixture was cooled to room temperature and the solvents were evaporated under vacuum. The residue was purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give a mixture (365 mg) and then the mixture was purified with ISCO (EtOAc/hexanes/0.5 % Et ₃ N from 0 to 50%) to give the product as a colorless oil (80 mg). LC/UV (214 nm): RT=10.23 min. MS (CIAD): m/z (MH ⁺ ) 688.6. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.11 (d, 1H, J =8.0 Hz); 6.84-6.77 (m, 2H); 4.04 (t, 2H, J =6.6 Hz); 3.51 (t, 2H, J =5.5 Hz); 2.60-2.38 (m, 12H); 2.28 (t, 2H, J =7.4 Hz); 1.79-1.19 (m, 37H); 0.92-0.82 (m, 9H).

CD. Compound 119: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(4-pentylphenoxy)octyl)amino)octanoate

4-Pentylphenyl-8-bromooctanoate

Chemical formula: C ₁₉ H ₂₉ BrO ₂

Molecular weight: 369.34

[00131] To a solution of 8-bromooctanoic acid (2.00 g, 8.96 mmol) and 4-pentylphenol (3.07 ml g, 17.9 mmol) in dichloromethane (50 ml) was added N- (3-dimethylaminopropyl) - N' -ethylcarbodiimide hydrochloride (1.72 g, 8.96 mmol) and DMAP (220 mg, 1.79 mmol). The reaction mixture was allowed to stir at room temperature for 60 hours. The reaction mixture was diluted with dichloromethane and extracted with saturated sodium hydrogen carbonate solution. The organic layer was separated and washed with a saturated sodium chloride aqueous solution, and dried over sodium sulfate. The organic layer was filtered off and evaporated in vacuo. The residue was purified with ISCO (SiO ₂ : EtOAc/hexanes 0 to 10%) to give the product as a colorless oil (3.12 g, 94%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.16 (d, 2H, J =8.5 Hz); 6.96 (d, 2H, J =8.5 Hz); 3.41 (t, 2H, J =6.9 Hz); 2.61-2.49 (m, 4H); 1.92-1.69 (m, 4H); 1.65-1.25 (m, 10H); 0.88 (m, 3H).

Nonyl-8-((2-hydroxyethyl)(8-oxo-8-(4-pentylphenoxy)octyl)amino)octanoate

Chemical formula: C ₃₈ H ₆₇ NO ₅

Molecular weight: 617.96

[00132] A solution of nonyl 8-((2-hydroxyethyl)amino)octanoate (500mg, 1.52mmol), 4-pentylphenyl 8-bromooctanoate (840mg, 2.28mmol) and N,N -diisopropylethylamine (0 40 ml, 2.28 mmol) in tert -butanol (3 ml) was heated to 60° C. in a sealed tube for 48 hours. The reaction mixture was cooled to room temperature and the solvents were evaporated under vacuum. The residue was purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give a mixture (360 mg) and then the mixture was purified with ISCO (EtOAc/hexanes/0.5 % Et ₃ N from 0 to 50%) to give the product as a colorless oil (95 mg). LC/UV (214 nm): RT=9.63 min. MS (CIAD): m/z (MH ⁺ ) 618.5. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.11 (d, 1H, J =8.0 Hz); 6.84-6.77 (m, 2H); 4.04 (t, 2H, J =6.6 Hz); 3.51 (t, 2H, J =5.5 Hz); 2.60-2.38 (m, 12H); 2.28 (t, 2H, J =7.4 Hz); 1.79-1.19 (m, 37H); 0.92-0.82 (m, 9H).

CE. Compound 120: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(3-pentylphenoxy)octyl)amino)octanoate

3-Pentylphenol (Ref: Tetrahedron Lett. 2013 , 54 , 52)

Chemical formula: C ₁₁ H ₁₆ O

Molecular weight: 164.25

[00133] At -78°C, to a suspension of potassium tert-butoxide (6.73 g, 60 mmol) in 15 ml of pentane were added successively tetramethylethyldiamine (9.0 ml, 60 mmol) and BuLi (2.5 M in hexane, 24 ml, 60 mmol) and a solution of m-cresol (2.6 ml, 25 mmol) in 10 ml pentane was added slowly. The reaction mixture was heated to -20°C for 3 hours 30 ml of THF was added and the reaction mixture was cooled to -60°C. Butyl bromide (4.8 mL, 45 mmol) was added slowly and the mixture was allowed to warm to room temperature and stirred for 16 h. Then cooled to 0° C., the reaction mixture was acidified with 4 M HCl to pH~3 and then extracted with ether. The combined organic layer was washed with saturated aqueous sodium chloride and dried over sodium sulfate. After concentration, the residue was purified with ISCO (EtOAc/hexanes 0 to 5%) to give a mixture of product with starting material, which was distilled under vacuum to give the product as a colorless oil (1.23 g, 65%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.14 (t, 1H, J =7.7 Hz); 6.75 (d, 1H, J =7.7 Hz); 6.67-6.61 (m, 2H); 4.62 (s, 1H); 2.55 (t, 2H, J =7.7 Hz); 1.67-1.52 (m, 2H); 1.38-1.24 (m, 4H); 0.88 (t, 3H, J =6.9 Hz).

3-Pentylphenyl-8-bromooctanoate

Chemical formula: C ₁₉ H ₂₉ BrO ₂

Molecular weight: 369.34

[00134] To a solution of 8-bromooctanoic acid (1.84 g, 8.20 mmol) and 3-pentylphenol (1.23 g, 7.49 mmol) in dichloromethane (40 ml) was addedN-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (1.58 g, 8.20 mmol) and DMAP (183 mg, 1.50 mmol). The reaction mixture was allowed to stir at room temperature for 16 hours. The reaction mixture was diluted with dichloromethane and extracted with saturated sodium hydrogen carbonate solution. The organic layer was separated and washed with saturated aqueous sodium chloride solution, dried over sodium sulfate. The organic layer was filtered off and evaporated in vacuo. The residue was purified with ISCO (SiO₂: EtOAc/mixture of hexanes from 0 to 10%) to obtain the product as a colorless oil (2.23 g, 80%).¹H NMR (300 MHz, CDCl₃) δ: ppm 7.26 (t, 1H,J= 8.5 Hz); 7.03 (d, 1H,J= 7.6 Hz); 6.91-6.84 (m, 2H); 3.41 (t, 2H,J=6.9 Hz); 2.61-2.49 (m, 4H); 1.92-1.69 (m, 4H); 1.65-1.25 (m, 12H); 0.88 (t, 3H,J=6.9 Hz).

Nonyl-8-((2-hydroxyethyl)(8-oxo-8-(3-pentylphenoxy)octyl)amino)octanoate

Chemical formula: C ₃₈ H ₆₇ NO ₅

Molecular weight: 617.96

[00135] A solution of nonyl 8-((2-hydroxyethyl)amino)octanoate (500mg, 1.52mmol), 3-pentylphenyl 8-bromooctanoate (840mg, 2.28mmol) and N,N -diisopropylethylamine (0 40 ml, 2.28 mmol) in tert-butanol (3 ml) was stirred at 60° C. in a sealed tube for 16 hours. The reaction mixture was cooled to room temperature and the solvents were evaporated under vacuum. The residue was purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give a mixture (247 mg) and then the mixture was purified with ISCO (EtOAc/hexanes/0.5 % Et ₃ N 0 to 50%) to give the product as a colorless oil (150 mg). LC/UV (202 nm): RT=7.45 min. MS (CIAD): m/z (MH ⁺ ) 618.5. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.26 (t, 1H, J =8.5 Hz); 7.03 (d, 1H, J =7.6 Hz); 6.91-6.84 (m, 2H); 4.05 (t, 2H, J =6.6 Hz); 3.51 (t, 2H, J =5.5 Hz); 2.64-2.38 (m, 10H); 2.28 (t, 2H, J =7.8 Hz); 1.79-1.19 (m, 41H); 0.91-0.82 (m, 6H).

CF. Compound 121: Heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate Heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₈ ClNO ₄

Molecular weight: 742.65

[00136] To a solution of heptadecan-9-yl-8-((3-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (8.00 g, 11.0 mmol) and triethylamine (2.0 ml, 14.4 mmol) in dichloromethane (200 ml) was added dropwise methanesulfonyl chloride (1.07 ml, 13.8 mmol) at 0°C and the reaction mixture was allowed to warm to room temperature over 16 h. TLC and MS showed completion reactions. The reaction mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution and saturated aqueous sodium chloride solution. After drying over sodium sulfate, the solvent was removed in vacuo to give the product as a brown oil (7.30 g, 89%). NMR showed that the crude product contained a small amount of mesylate and the desired chloride. It was used in the next step without further purification MS (APCI): m/z (MH ⁺ ) 742.6. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (n, 1H, J= 6.0 Hz); 4.05 (t, 2H, J= 6.9 Hz); 3.58 (t, 2H, J= 6.6 Hz); 2.58-2.22 (m, 9H); 1.92-1.16 (m, 65H); 0.87 (m, 9H).

Heptadecan-9-yl-8-((3-azidopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₈ N ₄ O ₄

Molecular weight: 749.22

[00137] A mixture of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (4.20 g, 5.66 mmol) and sodium azide (1.75 g, 28.28 mmol) in 20 ml of DMF in a sealed tube was heated to 100°C for 16 hours. Then it was cooled to room temperature, the reaction mixture was diluted with water and extracted with a mixture of hexanes. The combined organic layer was washed with water and an aqueous saturated sodium chloride solution, and then dried over sodium sulfate. After filtration and concentration, the residue was purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 5%) to give the product as a brown oil (3.66 g, 86%). MS (CIAD): m/z (MH ⁺ ) 749.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.7 Hz); 3.32 (t, 2H, J= 6.9 Hz); 2.58-2.22 (m, 10H); 1.72-1.19 (m, 64H); 0.87 (m, 9H).

Heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₉₀ N ₂ O ₄

Molecular weight: 723.23

[00138] A mixture of heptadecan-9-yl-8-((3-azidopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (3.66 g, 4.89 mmol) and Pd/C (10% , 400 mg) in 150 ml of EtOH was stirred in a hydrogen atmosphere from a balloon for 16 h. MS indicated the completion of the reaction. The reaction mixture was filtered through celite and the filtrate was concentrated and purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ /1% NH ₄ OH 0 to 20%) to give the product as a brown oil (3.08 g, 87% ). LC/UV (202 nm): RT=8.39 min. MS (CIAD): m/z (MH ⁺ ) 723.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 2.70 (t, 2H, J= 6.9 Hz); 2.46-2.24 (m, 10H); 1.65-1.16 (m, 66H); 0.87 (m, 9H).

CG. Compound 122: Heptadecan-9-yl-8-((6-(decan-2-yloxy)-6-oxohexyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₃ H ₈₅ NO ₅

Molecular weight: 696.16

[00139] Compound 122 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.58 min. MS (ESI): m/z (MH ⁺ ) 697.1 for C ₄₃ H ₈₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 2H); 3.62 (m, 2H); 2.81-2.42 (broad m, 5H); 2.30 (m, 4H); 1.73-1.43 (m, 14H); 1.28 (m, 48H); 0.90 (m, 9H).

CH. Compound 123: Heptadecan-9-yl) 8-(methyl(8-nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₂₆ H ₅₃ NO ₂

Molecular weight: 411.72

[00140] A solution of heptadecan-9-yl-8-bromooctanoate (200 mg, 0.433 mmol) in methanamine (10 mL, 19.92 mmol, 2M in THF) was allowed to stir at room temperature. pace. within 18 hours the Reaction mixture was concentrated in vacuo. The residue was purified by silica gel chromatography (10-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(methylamino)octanoate (113 mg, 0.27 mmol, 63%). UPLC/DSIO: RT=2.76 min. MS (ESI): m/z (MH ⁺ ) 412.4 for C ₂₆ H ₅₃ NO ₂ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.92 (n, 1H); 2.62 (t, 2H); 2.48 (s, 3H); 2.32-2.27 (m, 2H); 1.66-1.52 (broad m, 8H); 1.28 (m, 30H); 0.90 (m, 6H).

Heptadecan-9-yl-8-(methyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₃ H ₈₅ NO ₄

Molecular weight: 680.16

[00141] A solution of heptadecan-9-yl-8-(methylamino)octanoate (113 mg, 0.27 mmol), nonyl-8-bromooctanoate (115 mg, 0.33 mmol) and N,N -diisopropylethylamine (67 µl, 0.38 mmol) and potassium iodide (5 mg, 0.027 mmol) were dissolved in ethanol and left to stir at 62°C for 48 hours. The reaction mixture was cooled to room. pace. and the solvents were evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(methyl(8-(nonyloxy)-8- oxooctyl)amino)octanoate (75 mg, 0.11 mmol, 41%). UHPLC/DSIO: RT=3.84 min. MS (ESI): m/z (MH ⁺ ) 681.0 for C ₄₃ H ₈₅ NO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (n, 1H); 4.08 (t, 2H); 2.88-2.67 (broad m, 7H); 2.34-2.27 (m, 4H); 1.80 (m, 4H); 1.63-1.52 (broad m, 10H); 1.37-1.28 (broad m, 48H); 0.90 (m, 9H).

C.I. Compound 124: Di(heptadecan-9-yl)-8,8 ' -(methylazandiyl)dioctanoate

Chemical formula: C ₅₁ H ₁₀₁ NO ₄

Molecular weight: 792.37

[00142] A solution of heptadecan-9-yl-8-bromooctanoate (500 mg, 1.08 mmol) in methanamine (11 mL, 21.67 mmol, 2M in THF) was allowed to stir at room temperature. pace. for 6 hours. The reaction mixture was concentrated in vacuo. The residue was purified by silica gel chromatography (20-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give di(heptadecan-9-yl) 8,8'-(methylazandiyl)dioctanoate (26 mg, 0.03 mmol, 3%). UHPLC/DSIO: RT=4.03 min. MS (ESI): m/z (MH ⁺ ) 793.3 for C ₅₁ H ₁₀₁ NO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 2H); 2.32-2.24 (m, 11H); 1.66-1.28 (broad m, 76H); 0.90 (m, 12H).

CJ. Compound 125: 3-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)propanoic acid

Heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₃ NO ₄

Molecular weight: 666.13

[00143] At -78°C, to a solution of oxalyl chloride (0.25 ml, 3.0 mmol) in 3 ml of dichloromethane was added dropwise a solution of DMSO (0.43 ml, 6.0 mmol) in 2 ml of dichloromethane and then instantly a solution of heptadecan-9-yl-8-((3-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (1.45 g, 2.0 mmol) in dichloromethane (10 ml) was added. Then stirred for 30 min at this temperature, was added triethylamine (1.45 ml, 10.4 mmol) and the reaction mixture was warmed to room temperature. TLC and MS showed completion of the reaction (M+1: 722.7) and the reaction mixture was diluted with water and extracted with a mixture of hexanes (2X). The combined organic layer was washed with saturated aqueous sodium chloride. After drying over sodium sulfate, the filtrate was concentrated and the residue was purified using ISCO (SiO ₂ : EtOAc/hexanes/0.5% Et ₃ N 0 to 50%) to give the product as a brown oil (810 mg, 61%) . MS (CIAD): m/z (MH ⁺ ) 666.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (n, 1H, J= 6.0 Hz); 4.05 (t, 2H, J= 6.9 Hz); 2.56 (t, 4H, J= 7.1 Hz); 2.31-2.24 (m, 4H); 1.67-1.19 (m, 63H); 0.87 (m, 9H).

Heptadecan-9-yl-8-((3-(benzyloxy)-3-oxopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₂ H ₉₃ NO ₆

Molecular weight: 828.32

[00144] A solution of heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate (798 mg, 1.2 mmol) and benzyl acrylate (293 mg, 1.8 mmol) in dichloromethane ( 20 ml) was stirred at room temperature for 16 h. TLC and MS showed no reaction, 10 ml of MeOH was added and the reaction mixture was stirred at room temperature for 16 h. MS showed the formation of the product with a small amount of methyl ester (M+1: 829 .8, 752.7). The reaction mixture was concentrated to dryness and purified with ISCO (SiO ₂ : EtOAc/hexanes 0 to 35%) to give the product as a colorless oil (280 mg, 28%). MS (CIAD): m/z (MH ⁺ ) 829.8. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.36-7.32 (m, 5H); 5.10 (s, 2H); 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.9 Hz); 2.78 (t, 2H, J= 6.9 Hz); 2.46 (t, 2H, J= 7.0 Hz); 2.36 (t, 4H, J= 6.9 Hz); 2.30-2.24 (m, 4H); 1.67-1.19 (m, 62H); 0.87 (m, 9H).

3-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)propanoic acid

Chemical formula: C ₄₅ H ₈₇ NO ₆

Molecular weight: 738.19

[00145] A mixture of heptadecan-9-yl-8-((3-(benzyloxy)-3-oxopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (280 mg, 0.34 mmol) and Pd/ C (10%, 28 mg) in 20 ml EtOAc was stirred under hydrogen from a balloon for 1 h. MS indicated completion of the reaction. The reaction mixture was filtered and the filtrate was concentrated. The residue was purified with ISCO (SiO ₂ : MeOH/CH ₂ Cl ₂ 0 to 10%) to give the product as a colorless oil (230 mg, 91%). LC/UV (214 nm): RT=12.38 min. MS (CIAD): m/z (MH ⁺ ) 838.7. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (n, 1H, J= 6.0 Hz); 4.04 (t, 2H, J= 6.6 Hz); 2.85 (t, 2H, J= 6.0 Hz); 2.65 (t, 4H, J= 7.7 Hz); 2.48 (t, 2H, J= 6.0 Hz); 2.32-2.24 (m, 4H); 1.67-1.17 (m, 63H); 0.87 (m, 9H).

CK. Compound 126: Heptadecan-9-yl-8-(methyl(4-(nonyloxy)-4-oxobutyl)amino)octanoate

Chemical formula: C ₃₉ H ₇₇ NO ₄

Molecular weight: 624.05

[00146] A solution of heptadecan-9-yl-8-(methylamino)octanoate (103 mg, 0.25 mmol), nonyl-4-bromobutanoate (88 mg, 0.30 mmol) and N,N -diisopropylethylamine (61 µl, 0.35 mmol) was dissolved in ethanol and left stirring at 62°C for 48 hours. The reaction mixture was cooled to room. pace. and the solvents were evaporated in vacuo. The residue was taken up in ethyl acetate and washed with saturated aqueous sodium hydrogen carbonate. The organic layer was separated and washed with saturated aqueous sodium chloride, dried over Na ₂ SO ₄ and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(methyl(4-(nonyloxy)-4- oxobutyl)amino)octanoate (90 mg, 0.14 mmol, 58%). UHPLC/DSIO: RT=3.58 min. MS (ESI): m/z (MH ⁺ ) 624.8 for C ₃₉ H ₇₇ NO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 4.08 (t, 2H); 2.38-2.24 (broad m, 11H); 1.82 (m, 2H); 1.64-1.28 (broad m, 52H); 0.90 (m, 9H).

CL. Compound 127: Nonyl-8-((9-((bis(nonyloxy)phosphoryl)oxy)nonyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₄ NO ₇ P

Molecular weight: 804.232

[00147] Compound 127 was synthesized in a similar manner to compound 131 and according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.58 min. MS (ESI): m/z (MH ⁺ ) 805.1 for C ₄₆ H ₉₄ NO ₇ P. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.05 (m, 8H); 3.55 (m, 2H); 2.59 (m, 2H); 2.46 (m, 4H); 2.31(t, 2H), 1.67(m, 11H); 1.29 (m, 55H); 0.90 (m, 9H).

CM. Compound 128: Heptadecan-9-yl-8-((6-((1-cyclopropylnonyl)oxy)-6-oxohexyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₇ NO ₅

Molecular weight: 722.193

[00148] Compound 128 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.67 min. MS (ESI): m/z (MH ⁺ ) 722.9 for C ₄₅ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.30 (m, 1H); 3.56 (m, 2H); 2.72-2.39 (m, 6H); 2.30 (m, 4H), 1.76-1.17 (m, 58H); 0.90 (m, 10H); 0.61-0.35 (m, 3H); 0.28 (m, 1H).

CN. Compound 129: Undecyl 6-((8-(dioctylamino)-8-oxooctyl)(2-hydroxyethyl)amino)hexanoate

Chemical formula: C ₄₃ H ₈₆ N ₂ O ₄

Molecular weight: 695.171

[00149] Compound 129 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.45 min. MS (ESI): m/z (MH ⁺ ) 695.9 for C ₄₃ H ₈₆ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (t, 2H); 3.54 (m, 2H), 3.28 (m, 4H); 2.59 (m, 2H); 2.47 (m, 4H); 2.32 (q, 4H); 1.73-1.19 (m, 58H); 0.90 (m, 9H).

CO. Compound 130: Decan-2-yl-8-((8-(dioctylamino)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₈ N ₂ O ₄

Molecular weight: 709.198

[00150] Compound 130 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.46 min. MS (ESI): m/z (MH ⁺ ) 709.9 for C ₄₄ H ₈₈ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 1H); 3.70 (br. m, 2H), 3.35-3.15 (m, 4H); 2.96-2.41 (broad m, 6H); 2.29 (m, 4H); 1.74-1.43 (m, 14H); 1.41-1.115 (m, 47H); 0.90 (m, 9H).

CP. Compound 131: Nonyl-8-((7-((bis(octyloxy)phosphoryl)oxy)heptyl)(2-hydroxyethyl)amino)octanoate

7-Bromoheptyldioctylphosphate

Chemical formula: C ₂₃ H ₄₈ BrO ₄ P

Molecular weight: 499.511

[00151] To a solution of POCl ₃ (1.91 ml, 20.5 mmol) in DCM (20 ml) at 0°C, was slowly added Et ₃ N (2.85 ml, 20.4 mmol) followed by the addition of 7- bromheptan-1-ol (4.0 g, 20.5 mmol). The reaction mixture was allowed to stir for 4 hours at 0°C. A solution of octan-1-ol (7.10 ml, 45.11 mmol) and Et ₃ N (8.9 ml, 63.8 mmol) in DCM was added and the reaction mixture was allowed to stir at room temperature. pace. within 16 hours the Reaction mixture was diluted with DCM and washed with saturated NaHCO ₃ . The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified with ISCO (0-30%) EtOAc in hexanes to give 7-bromoheptyldioctyl phosphate (0.58 g, 1.16 mmol, 6%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.03 (m, 6H); 3.43 (t, 2H); 1.88 (m, 2H); 1.70 (m, 6H); 1.54-1.23 (m, 26H); 0.90 (m, 6H).

Nonyl-8-((7-((bis(octyloxy)phosphoryl)oxy)heptyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₆ NO ₇ P

Molecular weight: 748.124

[00152] Compound 131 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.22 min. MS (ESI): m/z (MH ⁺ ) 750.0 for C ₄₂ H ₈₆ NO ₇ P. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.05 (m, 8H); 3.51 (m, 2H); 2.60 (broad m, 2H); 2.46 (m, 4H); 2.31 (t, 2H); 1.76-1.15 (m, 58H); 0.90 (m, 9H).

C.Q. Compound 132: Decan-2-yl-8-((7-((bis(octyloxy)phosphoryl)oxy)heptyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₃ H ₈₈ NO ₇ P

Molecular weight: 762.15

[00153] Compound 132 was synthesized in a similar manner to compound 131 and according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.27 min. MS (ESI): m/z (MH ⁺ ) 764.00 for C ₄₃ H ₈₈ NO ₇ P. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 1H); 4.03 (m, 6H); 3.56 (m, 2H); 2.73-2.38 (broad m, 6H); 2.29 (t, 2H); 1.79-1.16 (m, 61H); 0.90 (m, 9H).

CR. Compound 133: ((2-Hydroxyethyl)azandiyl)bis(nonan-9,1-diyl)bis(2-hexyldecanoate)

Chemical formula: C ₅₂ H ₁₀₃ NO ₅

Molecular weight: 822.398

[00154] Compound 133 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.91 min. MS (ESI): m/z (MH ⁺ ) 824.0 for C ₅₂ H103NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.09 (t, 4H); 3.60 (m, 2H); 2.74-2.42 (broad m, 6H); 2.33 (m, 3H); 1.72 -1.17 (m, 76H); 0.90 (m, 12H).

CS. Compound 134: 9-((2-Hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)nonyl 2-hexyldecanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.182

[00155] Compound 134 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.48 min. MS (ESI): m/z (MH ⁺ ) 712.0 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (m, 4H); 3.55 (m, 2H); 2.67-2.39 (broad m, 6H); 2.31 (m, 3H); 1.71 -1.19 (m, 62H); 0.90 (m, 12H).

CT. Compound 135: 7-((8-(Decan-2-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00156] Compound 135 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.63 min. MS (ESI): m/z (MH ⁺ ) 726.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 1H); 4.08 (t, 2H); 3.57 (m, 2H); 2.73-2.40 (broad m, 6H); 2.29 (m, 3H); 1.71 -1.16 (m, 66H); 0.90 (m, 9H).

CU. Compound 136: Nonyl-8-((2-hydroxyethyl)((9 Z ,12 Z )-octadeca-9,12-dien-1-yl)amino)octanoate

Illustrative example of methodology 2:

Nonyl-8-bromooctanoate (Method A)

[00157] To a solution of 8-bromooctanoic acid (5 g, 22 mmol) and nonan-1-ol (6.46 g, 45 mmol) in dichloromethane (100 ml) was added N- (3-dimethylaminopropyl) -N' -ethylcarbodiimide hydrochloride (4.3 g, 22 mmol) and DMAP (547 mg, 4.5 mmol). The reaction mixture was allowed to stir at room temperature. pace. for 18 hours. The reaction mixture was diluted with dichloromethane and washed with saturated sodium hydrogen carbonate solution. The organic layer was separated and washed with saturated aqueous sodium chloride solution, dried over MgSO ₄ . The organic layer was filtered off and evaporated in vacuo. The residue was purified by silica gel chromatography (0-10% ethyl acetate in hexanes) to give nonyl 8-bromooctanoate (6.1 g, 17 mmol, 77%).

[00158] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.06 (t, 2H); 3.40 (t, 2H); 2.29 (t, 2H); 1.85 (m, 2H); 1.72-0.97 (m, 22H); 0.88 (m, 3H).

Nonyl-8-((2-hydroxyethyl)amino)octanoate

[00159] A solution of nonyl-8-bromooctanoate (1.2 g, 3.4 mmol) and 2-aminoethan-1-ol (5 ml, 83 mmol) in ethanol (2 ml) was allowed to stir at 62°C for 18 h. The reaction mixture was concentrated in vacuo and the residue was extracted with ethyl acetate and water. The organic layer was separated and washed with water, saturated aqueous sodium chloride and dried over Na ₂ SO ₄ . The organic layer was filtered off and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give nonyl 8-((2-hydroxyethyl)amino)octanoate (295 mg, 0. 9 mmol, 26%).

[00160] UHPLC/DSIO: RT=1.29 min. MS (ESI): m/z (MH ⁺ ) 330.42 for C ₁₉ H ₃₉ NO ₃

[00161] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.07 (t, 2H); 3.65 (t, 2H); 2.78 (t, 2H); 2.63 (t, 2H); 2.32-2.19 (m, 4H); 1.73-1.20 (m, 24H); 0.89 (m, 3H)

Nonyl-8-((2-hydroxyethyl)((9 Z ,12 Z )-octadeca-9,12-dien-1-yl)amino)octanoate

Chemical formula: C ₃₇ H ₇₁ NO ₃

Molecular weight: 577.98

[00162] Nonyl 8-((2-hydroxyethyl)amino)octanoate solution (150mg, 0.46mmol), ( 6Z , 9Z )-18-bromooctadeca-6,9-diene (165mg, 0.46mmol) 5 mmol) and N,N -diisopropylethylamine (65 mg, 0.5 mmol) in ethanol (2 ml) was left to stir at the boil under reflux for 48 hours. The reaction mixture was left to cool to room. pace. and the solvents were evaporated in vacuo. The residue was purified by silica gel chromatography (0-10% MeOH in dichloromethane) to give nonyl 8-((2-hydroxyethyl)((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)octanoate (81 mg, 0.14 mmol, 30%) as HBr salt.

[00163] UHPLC/DSIO: RT=3.24 min. MS (ESI): m/z (MH ⁺ ) 578.64 for C ₃₇ H ₇₁ NO ₃

[00164] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.71 (br., 1H); 5.36 (broad m, 4H); 4.04 (m, 4H); 3.22-2.96 (broad m, 5H); 2.77 (m, 2H); 2.29 (m, 2H); 2.04 (broad m, 4H); 1.86 (broad m, 4H); 1.66-1.17 (broad m, 40H); 0.89 (m, 6H)

CV. Compound 137: Methyl 12-(dodecyl(2-hydroxyethyl)amino)dodecanoate

Methyl 12-bromododecanoate

Chemical formula: C ₁₃ H ₂₅ BrO ₂

Molecular weight: 293.25

[00165] To a solution of 12-bromododecanoic acid (2.5 g, 8.95 mmol) in THF (7 ml) was added methanol (7.2 ml, 179 mmol). Sulfuric acid (0.50 ml, 8.95 mmol) was added dropwise and the reaction mixture was allowed to stir at 65° C. for two hours. The reaction mixture was washed with 5% NaHCO₃ and saturated aqueous sodium chloride solution. The organic layer was dried over anhydrous Na₂SO₄, filtered and concentrated in vacuo. Purification by silica gel chromatography (0-20% EtOAc/hexanes) gave methyl 12-bromododecanoate (2.40 g, 92%).

[00166] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.69 (s, 3H); 3.44 (t, 2H); 2.33 (t, 2H); 1.88 (broad m, 2H); 1.64 (broad m, 2H); 1.45 (broad m, 2H); 1.31 (broad m, 12H).

Methyl 12-(dodecyl(2-hydroxyethyl)amino)dodecanoate

Chemical formula: C ₂₇ H ₅₅ NO ₃

Molecular weight: 441.74

[00167] To a solution of methyl 12-((2-hydroxyethyl)amino)dodecanoate K₂CO₃ (418 mg, 3.02 mmol) and KI (25 mg, 0.151 mmol). The reaction mixture was left to stir at 82°C for 16 hours. The reaction mixture was cooled to room temperature, diluted with H₂O and extracted with EtOAc. The combined organic layers were washed with saturated aqueous sodium chloride, dried over Na₂SO₄, filtered and concentrated in vacuo. Purification by silica gel chromatography (0-100% [DCM, 20% MeOH, 1% NH₄OH]/MeOH) gave methyl 12-(dodecyl(2-hydroxyethyl)amino)dodecanoate (409 mg, 61%).

[00168] UHPLC/DSIO: RT=2.39 min. MS (ESI): m/z (MH ⁺ ) 442.60 for C ₂₇ H ₅₅ NO ₃

[00169] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.69 (s, 3H); 3.61 (t, 2H); 2.68 (t, 2H); 2.54 (t, 4H); 2.32 (t, 2H); 1.64 (m, 2H); 1.50 (broad m, 4H); 1.28 (broad m, 32H); 0.90 (t, 3H).

c.w. Compound 138: Dinonyl-8,8 ' -((2-hydroxyethyl)azandiyl)dioctanoate

Illustrative example of methodology 3:

Dinonyl-8,8'-((2-hydroxyethyl)azandiyl)dioctanoate

Chemical formula: C ₃₆ H ₇₁ NO ₅

Molecular weight: 597.97

[00170] A solution of nonyl-8-bromooctanoate (200 mg, 0.6 mmol) and 2-aminoethane-1-ol (16 mg, 0.3 mmol) andN, N-diisopropylethylamine (74 mg, 0.6 mmol) in THF/CH₃CN (1:1) (3 ml) was allowed to stir at 63° C. for 72 hours. The reaction mixture was cooled to room temperature. pace. and the solvents were evaporated in vacuo. The residue was extracted with ethyl acetate and saturated sodium hydrogen carbonate solution. The organic layer was separated, dried over Na₂SO₄and evaporated under vacuum. The residue was purified by silica gel chromatography (0-10% MeOH in dichloromethane) to give dinonyl 8,8'-((2-hydroxyethyl)azandiyl)dioctanoate (80 mg, 0.13 mmol, 43%).

[00171] UHPLC/DSIO: RT=3.09 min. MS (ESI): m/z (MH ⁺ ) 598.85 for C ₃₆ H ₇₁ NO ₅

[00172] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.05 (m, 4H); 3.57 (broad m, 2H); 2.71-2.38 (broad m, 6H); 2.29 (m, 4H), 1.71-1.01 (br. m, 49H), 0.88 (m, 6H).

CX. Compound 139: Di(( Z )-non-2-en-1-yl)-8,8 ' -((2-hydroxyethyl)azandiyl)dioctanoate

[00173] Compound 139 was synthesized following Illustrative Example Method 3.

Chemical formula: C ₃₆ H ₆₇ NO ₅

Molecular weight: 593.93

[00174] UHPLC/DSIO: RT=2.88 min. MS (ESI): m/z (MH ⁺ ) 594.78 for C ₃₆ H ₆₇ NO ₅

[00175] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.60 (m, 2H); 5.50 (m, 2H); 4.59 (m, 4H); 3.96 (broad m, 2H); 3.20-2.94 (broad m, 5H); 2.28 (m, 4H); 2.07 (m, 4H); 1.80 (br. m 4H); 1.59 (broad m, 6H); 1.43-1.14 (br. m, 28H), 0.85 (m, 6H).

CY. Compound 140: Di(( Z )-undec-2-en-1-yl)-6,6 ' -((2-hydroxyethyl)azandiyl)dihexanoate

[00176] Compound 140 was synthesized following Illustrative Example Method 3.

Chemical formula: C ₃₆ H ₆₇ NO ₅

Molecular weight: 593.93

[00177] UHPLC/DSIO: RT=2.87 min. MS (ESI): m/z (MH ⁺ ) 594.74 for C ₃₆ H ₆₇ NO ₅

[00178] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.73-5.44 (m, 4H); 4.62 (m, 4H); 3.55 (m, 2H); 2.73-2.39 (broad m, 6H); 2.39 (m, 4H); 2.09 (m, 4H); 1.64 (m, 4H); 1.55-1.14 (broad m, 33H); 0.88 (m, 6H).

cz. Compound 141: Diundecyl-6,6 ' -((2-hydroxyethyl)azandiyl)dihexanoate

[00179] Compound 141 was synthesized following Illustrative Example Method 3.

Chemical formula: C ₃₆ H ₇₁ NO ₅

Molecular weight: 597.97

[00180] UHPLC/DSIO: RT=3.03 min. MS (ESI): m/z (MH ⁺ ) 598.63 for C ₃₆ H ₇₁ NO ₅

[00181] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.05 (m, 4H); 3.53 (m, 2H); 2.95 (broad m, 1H); 2.65-2.35 (m, 6H); 2.30 (m, 4H); 1.73-1.54 (m, 8H); 1.54-1.15 (m, 40H); 0.88 (m, 6H).

D.A. Compound 142: 12,12 ' -((2-Hydroxyethyl)azandiyl)didodecanoate

12,12'-((2-Hydroxyethyl)azandiyl)didodecanoate

Chemical formula: C ₂₈ H ₅₅ NO ₅

Molecular weight: 485.75

[00182] Ethanolamine (0.310 ml, 5.12 mmol), K₂CO₃ (1.42 g, 10.2 mmol) and KI (85 mg, 0.512 mmol). The reaction mixture was left to stir at 82°C for 16 hours. The reaction mixture was cooled to room temperature, filtered and the solids were washed with a mixture of hexanes. The filtrate was extracted with a mixture of hexanes and the combined extracts were concentrated in vacuo. Purification by silica gel chromatography (0-100% [DCM, 20% MeOH, 1% NH₄OH]/MeOH) made it possible to obtain 12,12'-((2-hydroxyethyl)azandiyl)didodecanoate (563 mg, 45%).

[00183] UHPLC/DSIO: RT=1.81 min. MS (ESI): m/z (MH ⁺ ) 486.63 for C ₂₈ H ₅₅ NO ₅

[00184] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.69 (s, 6H); 3.59 (broad m, 2H); 2.75-2.40 (broad m, 6H); 2.32 (t, 4H); 1.64 (m, 4H); 1.48 (broad m, 4H); 1.29 (broad m, 28H).

D.B. Compound 143: Nonyl 8-((2-hydroxyethyl)(7-((2-octyldecyl)oxy)-7-oxoheptyl)amino)octanoate

2-Octyldecanoic acid

Chemical formula: C ₁₈ H ₃₆ O ₂

Molecular weight: 284.48

[00185] A solution of diisopropylamine (2.92 ml, 20.8 mmol) in THF (10 ml) was cooled to -78°C and a solution of n -BuLi (7.5 ml, 18.9 mmol, 2.5 M in mixtures of hexanes). The reaction mixture was left to warm to 0°C. To a solution of decanoic acid (2.96 g, 17.2 mmol) and NaH (754 mg, 18.9 mmol, 60% w/w) in THF (20 ml) at 0°C was added a solution of LDA and the mixture was left mix at room. pace. within 30 min. After the indicated time, 1-iodoctane (5 g, 20.8 mmol) was added and the reaction mixture was heated at 45° C. for 6 hours. The reaction mixture was quenched with 1N HCl (10 ml). The organic layer was dried over MgSO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography (0-20% ethyl acetate in hexanes) to yield 2-octyldecanoic acid (1.9 g, 6.6 mmol).

[00186] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 2.38 (broad m, 1H); 1.74-1.03 (broad m, 28H); 0.91 (m, 6H).

2-Octyldecan-1-ol

Chemical formula: C ₁₈ H ₃₈ O

Molecular weight: 270.50

[00187] A solution of 2-octyldecanoic acid (746 mg, 2.6 mmol) in dry THF (12 ml) was added to a stirred solution of LAH (5.2 ml, 5.2 mmol, 1M solution in THF) in dry THF (6 ml) under nitrogen atmosphere at 0°C. The reaction mixture was allowed to warm to room temperature. pace. and stirred at rt. pace. within 12 hours Added a saturated solution of Na ₂ SO ₄ *10H ₂ O (10 ml). The solids were filtered through a pad of celite. The filtrate was evaporated in vacuo and the residue was purified by silica gel chromatography (0-20% ethyl acetate in hexanes) to yield 2-octyldecan-1-ol (635 mg, 2.3 mmol).

[00188] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.54 (d, 2H); 1.56-1.21 (broad m, 30H); 0.91 (t, 6H).

2-Octyldecyl-7-bromoheptanoate

[00189] 2-Octyldecyl-7-bromoheptanoate synthesized according to method A.

[00190] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.96 (d, 2H); 3.40 (t, 2H); 2.31 (t, 2H); 1.86 (m, 2H); 1.71-1.19 (m, 35H); 0.88 (m, 6H).

[00191] Nonyl 8-((2-hydroxyethyl)(7-((2-octyldecyl)oxy)-7-oxoheptyl)amino)octanoate was synthesized using Illustrative Method 2.

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.182

[00192] UHPLC/DSIO: RT=5.23 min. MS (ESI): m/z (MH ⁺ ) 711.08 for C ₄₄ H ₈₇ NO ₅

[00193] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.05 (t, 2H); 3.96 (d, 2H); 3.58 (broad m, 2H); 2.79-2.36 (broad m, 5H); 2.30 (m, 4H); 1.72-1.01 (broad m, 63H); 0.88 (m, 9H).

DC. Compound 144: Nonyl 8-((8-(dioctylamino)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

8-bromo- N, N -dioctyloctanamide

Chemical formula: C ₂₄ H ₄₈ BrNO

Molecular weight: 446.56

[00194] To a solution of 8-bromooctanoic acid (1 g, 2.2 mmol) and DMF (1 drop) in dichloromethane was added oxalyl chloride (0.416 ml, 2.5 mmol) dropwise. The reaction mixture was allowed to stir for 1 hour at room temperature. The solvents were evaporated and the residue was added to a solution of dioctylamine (1.14 g, 4.8 mmol) and DMAP (100 mg, 0.8 mmol). Triethylamine was added dropwise to the reaction mixture and the reaction mixture was allowed to stir for 18 hours. The solvents were evaporated and the residue was taken up in ethyl acetate and saturated NaHCO ₃ . The organic layer was separated and washed with water and saturated aqueous sodium chloride. The organic solution was dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane to give a mixture of 8-bromo -N,N -dioctyloctanamide and chloro- N,N -dioctyloctanamide (736 mg, 1.6 mmol).

[00195] UHPLC/DSIO: RT=4.02 min. MS (ESI): m/z (MH ⁺ ) 446.53 for C ₂₄ H ₄₈ BrNO

[00196] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.55 (t, 0.6H); 3.42 (t, 1.4H); 3.36-3.15 (m, 4H); 2.31 (t, 2H); 1.96-1.18 (m, 34H); 0.91 (m, 6H).

[00197] Nonyl 8-((8-(dioctylamino)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate was synthesized using Illustrative Method 2.

Chemical formula: C ₄₃ H ₈₆ N ₂ O ₄

Molecular weight: 695.17

[00198] UHPLC/DSIO: RT=4.24 min. MS (ESI): m/z (MH ⁺ ) 696.16 for C ₄₃ H ₈₆ N ₂ O ₄

[00199] ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.05 (t, 2H); 3.57 (broad m, 2H); 3.35-3.14 (m, 4H); 2.80-.2.20 (m, 10H); 1.74-1.00 (br. m, 59H); 0.88 (m, 9H).

D.D. Compound 145: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-(methyl(octyl)amino)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₈ N ₂ O ₄

Molecular weight: 709.198

[00200] Compound 145 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.17 min. MS (ESI): m/z (MH ⁺ ) 710.0 for C ₄₄ H ₈₈ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 3.55 (m, 2H); 3.37 (t, 1H); 3.27 (t, 1H); 2.98 (s, 1.5H); 2.93 (s, 1.5H); 2.59 (m, 2H); 2.47 (m, 4H); 2.30 (m, 4H), 1.75-1.20 (m, 60H); 0.90 (m, 9H).

D.E. Compound 146: Heptadecan-9-yl-8-((2-hydroxyethyl)(6-(methyl(octyl)amino)-6-oxohexyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₄ N ₂ O ₄

Molecular weight: 681.144

[00201] Compound 146 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.01 min. MS (ESI): m/z (MH ⁺ ) 682.0 for C ₄₂ H ₈₄ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (m, 1H); 3.55 (m, 2H); 3.37 (t, 1H); 3.26 (t, 1H); 2.98 (s, 1.5H); 2.93 (s, 1.5H); 2.59 (m, 2H); 2.48 (m, 4H); 2.31 (m, 4H), 1.76-1.18 (m, 56H); 0.90 (m, 9H).

D.F. Compound 147: Tridecan-7-yl-10-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)decanoate

Chemical formula: C ₄₂ H ₈₃ NO ₅

Molecular weight: 682.128

[00202] Compound 147 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.16 min. MS (ESI): m/z (MH ⁺ ) 683.0 for C ₄₂ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (m, 2H); 3.55 (m, 2H); 2.59 (m, 2H); 2.46 (m, 4H); 2.30 (m, 4H), 1.72-1.18 (m, 58H); 0.90 (m, 9H).

DG. Compound 148: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-((2-methoxynonyl)oxy)-8-oxooctyl)amino)octanoate

1-(( tert -Butyldiphenylsilyl)oxy)nonan-2-ol

Chemical formula: C ₂₅ H ₃₈ O ₂ Si

Molecular weight: 398.662

[00203] TBDPSCl (8.58 g, 31.2 mmol) was added to a mixture of nonane-1,2-diol (5.0 g, 31.2 mmol) and imidazole (4.24 g, 62.4 mmol) in DMF at room pace. The reaction mixture was stirred at rt. pace. during the night. The reaction mixture was diluted with water (150 mL) and extracted with EtOAc/hexanes (1:1) (4X). The combined organic layer was washed with saturated aqueous sodium chloride, separated, dried over Na ₂ SO ₄ , filtered and evaporated under vacuum. The residue was purified by ISCO with (0-10%) EtOAc in hexanes to give 1-(( tert -butyldiphenylsilyl)oxy)nonan-2-ol (7.75 g, 19.4 mmol). ¹ H NMR (300 MHz, DMSO) δ: ppm 7.63 (m, 4H); 7.43 (m, 6H); 4.51 (d, 1H); 3.54 (m, 2H); 3.43 (m, 1H); 1.57 (m, 1H); 1.24 (m, 11H); 1.00 (s, 9H); 0.85 (m, 3H).

2-Methoxynonyl-8-bromooctanoate

Chemical formula: C ₁₈ H ₃₅ BrO ₃

Molecular weight: 379.379

[00204] 2-Methoxynonyl-8-bromooctanoate was synthesized following method A in illustrative example of procedure 1. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm. 4.19 (m, 1H); 4.04 (m, 1H); 3.42 (m, 6H); 2.36 (t, 2H); 1.87 (m, 2H); 1.73-1.22 (m, 20H); 0.93 (m, 3H).

Heptadecan-9-yl-8-((2-hydroxyethyl)(8-((2-methoxynonyl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₆

Molecular weight: 740.208

[00205] Compound 148 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.48 min. MS (ESI): m/z (MH ⁺ ) 741.0 for C ₄₅ H ₈₉ NO ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.19 (m, 1H); 4.04 (m, 1H); 3.57 (m, 2H); 3.42 (s, 3H); 3.37 (m, 1H); 2.73-2.41 (m, 6H); 2.33 (m, 4H), 1.73-1.19 (m, 61H); 0.90 (m, 9H).

D.H. Compound 149: Heptyl 10-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)decanoate

Chemical formula: C ₄₃ H ₈₅ NO ₄

Molecular weight: 680.156

[00206] Compound 149 was synthesized analogously to compound 123 and according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.55 min. MS (ESI): m/z (MH ⁺ ) 681.0 for C ₄₃ H ₈₅ NO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 2.42-2.14 (m, 11H); 1.73-1.17 (m, 62H); 0.90 (m, 9H).

D.I. Compound 150: Pentyl 12-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)dodecanoate

Chemical formula: C ₄₃ H ₈₅ NO ₄

Molecular weight: 680.156

[00207] Compound 150 was synthesized analogously to compound 123 and according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.47 min. MS (ESI): m/z (MH ⁺ ) 681.0 for C ₄₃ H ₈₅ NO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 2.42-2.16 (m, 10H); 1.73-1.20 (m, 63H); 0.90 (m, 9H).

DJ. Compound 151: 7-((7-(Decanoyloxy)heptyl)(2-hydroxyethyl)amino)heptyl-2-octyldecanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.182

[00208] Compound 151 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UPLC/DSIO: RT=2.83 min. MS (ESI): m/z (MH ⁺ ) 711.0 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.07 (m, 4H); 3.57 (m, 2H); 2.63 (broad m, 2H); 2.50 (m, 4H); 2.31(m, 3H), 1.71-1.19(m, 62H); 0.90 (m, 9H).

DC. Compound 152: Nonyl-( Z )-8-((2-hydroxyethyl)(10-octyloctadec-8-en-1-yl)amino)octanoate

N -Methoxy- N -methyl-2-octyldecanamide

Chemical formula: C ₂₀ H ₄₁ NO ₂

Molecular weight: 327.553

[00209] Oxalyl chloride (3.63 ml, 42.92 mmol). The reaction mixture was allowed to stir for 2 hours at room temperature. pace. Solvents and volatiles were evaporated under vacuum. The resulting residue (crude 2-octyldecanoyl chloride) (11.82 g, 39.02 mmol) was taken up in DCM (100 ml) and N,O -dimethylhydroxylamine hydrochloride (4 g, 40.97 mmol) and 4-dimethylaminopyridine (0. 48 g, 3.9 mmol). The mixture was allowed to cool to 0° C. and triethylamine (19.04 ml, 136.57 mmol) was added slowly. The reaction mixture was allowed to warm to room temperature. pace. and stirred for 1 hour. The solvents were evaporated in vacuo. The residue was diluted with EtOAc and washed with sat. NaHCO ₃ , followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give N -methoxy- N -methyl-2-octyldecanamide (7.10 g, 21.68 mmol, 56%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.70 (s, 3H); 3.22 (s, 3H); 2.82 (broad m, 1H); 1.62 (m, 2H); 1.51-1.19 (m, 26H); 0.90 (m, 6H).

2-Octyldecanal

Chemical formula: C ₁₈ H ₃₆ O

Molecular weight: 268.485

[00210] A solution of N -methoxy- N -methyl-2-octyldecanamide (7.1 g, 21.68 mmol) in dry THF (2 ml) was added to a suspension of LAH (27.53 ml 1 M in THF, 27.53 mmol) in dry THF (5 yl) prt -45°C. The resulting suspension was stirred for 1 h at -45°C, after the indicated time was left to warm to room temperature and stirred for 0.5 h. The reaction mixture was cooled back to -45°C and quenched with sat. an aqueous solution of sodium sulfate decahydrate (2 ml). The mixture was stirred for 20 minutes at room temperature and filtered through a pad of celite. The filtrate was washed with a saturated aqueous sodium chloride solution. The organic layer was separated, dried over sodium sulfate, filtered and evaporated under vacuum. The residue was purified by silica gel chromatography with (0-10%) EtOAc in hexanes to give 2-octyldecanal (4.45 g, 16.57 mmol, 76%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 9.58 (d, 1H); 2.23 (m, 1H); 1.63 (m, 2H); 1.53-1.19 (m, 26H); 0.90 (m, 6H).

( Z )-10-Octylocadec-8-en-1-ol

Chemical formula: C ₂₆ H ₅₂ O

Molecular weight: 380.701

[00211] A solution of (8-hydroxyoctyl)triphenylphosphonium bromide (3.68 g, 7.81 mmol) in THF (16 ml) and HMPA was cooled in an ice bath and NaHMDS (19.52 ml 1 M, 19.52 mmol) was added . 2-Octyldecanal (1.05 g, 3.9 mmol) in THF (5 ml) was added slowly and the reaction mixture was heated to 30°C. After 16 h the reaction mixture was diluted with 20 ml of water and acidified with 2N HCl. The reaction mixture was extracted with EtOAc (3×50 ml). The combined organic extracts were dried over sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel chromatography (0-50%) EtOAc in hexanes to give ( Z )-10-octylocadedec-8-en-1-ol (0.5 g, 1.30 mmol, 33%). ¹ H NMR (300 MHz, CDCl ₃ )δ: ppm 5.24 (m, 1H); 4.90 (m, 1H); 3.53 (t, 2H); 2.14 (m, 1H); 1.89 (m, 2H); 1.45 (m, 3H); 1.33-0.95 (m, 36H); 0.77 (m, 6H).

( Z )-1-Bromo-10-octyloctadec-8-ene

Chemical formula: C ₂₆ H ₅₁ Br

Molecular weight: 443.598

[00212] To a solution of PPh ₃ (0.29 g, 1.11 mmol) and (8 Z )-10-octyloctadec-8-en-1-ol (0.4 g, 1.05 mmol) in DCM (10 ml) at 0°C, NBS (0.22 g, 1.22 mmol) was added in one portion. The reaction mixture was allowed to stir at 0° C. for 1 h and then warmed to room temperature. temp. and stirred for 1 h. Added 300 ml of a mixture of hexanes and the mixture was filtered through a plug of silica gel and evaporated under vacuum. 200 ml of a mixture of hexanes was added and the mixture was filtered through a pad of silica gel and evaporated in vacuo to give ( Z )-1-bromo-10-octyloctadec-8-ene (0.39 g, 0.88 mmol, 83%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.24 (m, 1H); 4.90 (m, 1H); 3.53 (t, 2H); 2.14 (m, 1H); 1.89 (m, 2H); 1.45 (m, 3H); 1.33-0.95 (m, 36H); 0.77 (m, 6H).

Nonyl-( Z )-8-((2-hydroxyethyl)(10-octyloctadec-8-en-1-yl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₃

Molecular weight: 693.211

[00213] Compound 152 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.00 min. MS (ESI): m/z (MH ⁺ ) 694.0 for C ₄₅ H ₈₉ NO ₃ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.36 (m, 1H); 5.03 (m, 1H); 4.07 (t, 2H); 3.54 (t, 2H); 2.59 (t, 2H); 2.46 (m, 4H); 2.30 (m, 3H); 2.01 (m, 2H); 1.63 (m, 4H); 1.53-1.03 (m, 58H); 0.90 (m, 9H).

D.L. Compound 153: Nonyl-8-((2-hydroxyethyl)(10-octyloctadecyl)amino)octanoate

Chemical formula: C ₄₅ H ₉₁ NO ₃

Molecular weight: 694.227

[00214] The flask was charged with Pd(OH)₂ (20 mg) and blew N₂. A solution of nonyl-8-[(2-hydroxyethyl)[(8Z)-10-octylocadedec-8-en-1-yl]amino]octanoate (100 mg, 0.14 mmol) in EtOH (1 mL). The reaction mixture was purged with H₂ and placed in an atmosphere H₂ (balloon) with stirring for 16 h at room. pace. After the indicated time, the reaction mixture was purged with N₂. The reaction mixture was filtered through a pad of celite and washed with EtOH (50 ml). The filtrate was evaporated under vacuum. The residue was dissolved in EtOAc and washed with water. The organic layer was separated, dried over Na₂SO₄, filtered and evaporated in vacuo. The residue was purified by silica gel chromatography (0-50%) (1%, 20% MeOH in DCM) in DCM to give nonyl 8-((2-hydroxyethyl)(10-octyloctadecyl)amino)octanoate (0.069 g, 0.099 mmol, 69%). UHPLC/DSIO: RT=3.21 min. MS (ESI): m/z (MH+) 695.08 for C₄₅H₉₁NO₃.¹H NMR (300 MHz, CDCl₃) δ: ppm 4.08 (t, 2H); 3.56 (t, 2H); 2.62 (m, 2H); 2.48 (m, 4H); 2.31 (m, 2H); 1.64 (m, 4H); 1.54-1.16 (m, 66H); 0.90 (m, 9H).

DM. Compound 154: Heptadecan-9-yl-8-((2-(2-hydroxyethoxy)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₆

Molecular weight: 754.235

[00215] Compound 154 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.54 min. MS (ESI): m/z (MH ⁺ ) 755.0 for C ₄₆ H ₉₁ NO ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (m, 1H); 4.62 (m, 1H); 4.08 (t, 2H); 3.79-3.56 (m, 6H); 2.64 (m, 2H); 2.47 (m, 4H); 2.31 (m, 4H), 1.73-1.20 (m, 61H); 0.90 (m, 9H).

DN. Compound 155: tert -Butyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

tert -Butyl-8-bromooctanoate

Chemical formula: C ₁₂ H ₂₃ BrO ₂

Molecular weight: 279.218

[00216] Trifluoroacetic anhydride (2.77 ml, 19.9 mmol) was added dropwise to a solution of 8-bromooctanoic acid (2 g, 8.96 mmol) in DCM (20 ml) at 0°C. After 2.5 hours, ^t BuOH (3.1 ml, 32.27 mmol) was added slowly. After 1 h, the reaction was heated to room temperature. pace. and left stirring for 2.5 hours. The reaction mixture was quenched with water and extracted with diethyl ether. The organic layer was separated, dried over MgSO ₄ , filtered and evaporated under vacuum. The residue was purified by silica gel chromatography (0-10%) with EtOAc in hexanes to give tert -butyl 8-bromooctanoate (1.5 g, 5.37 mmol, 60%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.42 (t, 2H); 2.23 (t, 2H); 1.87 (m, 2H); 1.60 (m, 2H); 1.47 (s, 11H); 1.35(m, 4H).

tert -Butyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₃₉ H ₇₇ NO ₅

Molecular weight: 640.047

[00217] Compound 155 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.18 min. MS (ESI): m/z (MH ⁺ ) 641.0 for C ₃₉ H ₇₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 3.58 (broad m, 2H); 2.75-2.36 (broad m, 6H); 2.26 (m, 4H); 1.71-1.40 (m, 22H); 1.28 (m, 35H); 0.90 (m, 6H).

DO. Compound 156: Heptadecan-9-yl-8-((1,3-dihydroxypropan-2-yl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₆

Molecular weight: 740.208

[00218] Compound 156 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.53 min. MS (ESI): m/z (MH ⁺ ) 741.0 for C ₄₅ H ₈₉ NO ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (m, 1H); 4.08 (t, 2H); 3.67 (broad m, 4H); 3.04 (m, 1H); 2.65 (m, 4H); 2.32 (m, 4H), 1.72-1.44 (m, 15H); 1.28 (m, 48H); 0.90 (m, 9H).

D.P. Compound 157: Heptadecan-9-yl-8-((1-hydroxypropan-2-yl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00219] Compound 157 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.56 min. MS (ESI): m/z (MH ⁺ ) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.45-3.17 (broad m, 2H); 2.94 (broad m, 1H); 2.55-2.22 (m, 8H); 1.70-1.17 (m, 62H); 0.90 (m, 12H).

D.Q. Compound 158: tert -Butyl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₃₁ H ₆₁ NO ₅

Molecular weight: 527.831

[00220] Compound 158 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.23 min. MS (ESI): m/z (MH ⁺ ) 528.0 for C ₃₁ H ₆₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (t, 2H); 3.55 (broad m, 2H); 2.60 (broad m, 2H); 2.47 (m, 4H); 2.31 (t, 2H); 2.22 (t, 2H); 1.64 (broad m, 6H); 1.53-1.23 (m, 37H); 0.90 (m, 3H).

D.R. Compound 159: Heptadecan-9-yl-8-((2-hydroxyethyl)(2-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)ethyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₆ N ₂ O ₆

Molecular weight: 797.304

[00221] Compound 159 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.15 min. MS (ESI): m/z (MH ⁺ ) 798.0 for C ₄₈ H ₉₆ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.88 (m, 1H); 4.07 (t, 2H); 3.62 (broad m, 4H); 2.72-2.47 (broad m, 12H); 2.31 (m, 4H); 1.72-1.42 (m, 14H); 1.28 (m, 47H); 0.90 (m, 12H).

D.S. Compound 160: 1,5-Bis(2-butylcyclopropyl)pentan-3-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

2-(2-Butylcyclopropyl)ethan-1-ol

Chemical formula: C ₉ H ₁₈ O

Molecular weight: 142.242

[00222] 2-(2-Butylcyclopropyl)ethan-1-ol in a manner analogous to the synthesis of Intermediate C. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm: 3.94 (t, 2H); 1.93 (m, 1H); 1.59 (m, 7H); 1.39 (m, 1H); 1.12 (m, 3H); 0.90 (m, 3H); 0.00 (m, 1H).

1-(2-Bromoethyl)-2-butylcyclopropane

Chemical formula: C ₉ H ₁₇ Br

Molecular weight: 205.139

[00223] 1-(2-Bromoethyl)-2-butylcyclopropane was synthesized in a manner analogous to the synthesis of ( Z )-1-bromo-10-octyloctadec-8-ene. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm: 3.64 (t, 2H); 2.18 (m, 1H); 1.92 (m, 1H); 1.47 (m, 6H); 0.96 (m, 6H); 0.00 (m, 1H).

1,5-Bis(2-butylcyclopropyl)pentan-3-ol

Chemical formula: C ₁₉ H ₃₆ O

Molecular weight: 280.496

[00224] 1,5-Bis(2-butylcyclopropyl)pentan-3-ol was synthesized in a manner analogous to the synthesis of (5Z,12Z)-heptadeca-5,12-dien-9-ol. ¹H NMR (300 MHz, CDCl₃) δ: ppm: 3.96 (t, 1H); 1.64 (m, 21H); 1.16 (m, 6H); 0.91 (m, 6H); 0.03 (m, 2H).

1,5-Bis(2-butylcyclopropyl)pentan-3-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₈₇ NO ₅

Molecular weight: 734.204

[00225] Compound 160 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.51 min. MS (ESI): m/z (MH ⁺ ) 735.0 for C ₄₆ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.97 (m, 1H); 4.08 (t, 2H); 3.56 (broad m, 2H); 2.75-2.37 (broad m, 6H); 2.31 (m, 4H); 1.74-1.05 (m, 54H); 0.92 (m, 9H); 0.67 (m, 6H); 0.31 (m, 2H).

D.T. Compound 161: Heptadecan-9-yl-8-((2-hydroxyethyl)(10-(octanoyloxy)decan-2-yl)amino)octanoate

10-(Benzyloxy)decan-2-ol

Chemical formula: C ₁₇ H ₂₈ O ₂

Molecular weight: 264.409

[00226] A solution of 10-(benzyloxy)decan-2-one (3.5 g, 13.34 mmol) in THF (10 ml) was added to a stirred solution of LAH in THF (10 ml) under N ₂ at 0°C . The mixture was allowed to warm to room temperature. pace. and stirred for 2 h after the indicated time was slowly added 10 ml of sat. Na ₂ SO ₄ , 10H ₂ O (aq.) solution. A white precipitate fell out. Added more solid Na ₂ SO ₄ ,10H ₂ O and the mixture was filtered through a pad of celite. The filtrate was diluted with EtOAc and washed with saturated aqueous sodium chloride. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and concentrated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give 10-(benzyloxy)decan-2-ol (3.2 g, 12.1 mmol, 91%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.32 (m, 5H); 4.53 (s, 2H); 3.80 (m, 1H); 3.49 (t, 2H); 1.64 (m, 2H); 1.55-1.25 (m, 132H); 1.21 (d, 3H).

9-Hydroxydecyloctanoate

Chemical formula: C ₁₈ H ₃₆ O ₃

Molecular weight: 300.483

[00227] 9-Hydroxydecyloctanoate was synthesized following method A. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm. 4.08 (t, 2H); 3.80 (m, 1H); 2.30 (t, 2H); 1.64 (m, 4H); 1.52-1.17 (m, 23H); 0.90 (m, 3H).

Heptadecan-9-yl-8-((2-hydroxyethyl)(10-(octanoyloxy)decan-2-yl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00228] Compound 161 was synthesized in a similar manner to compound 152 and according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.46 min. MS (ESI): m/z (MH ⁺ ) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.49 (broad m, 2H); 2.77-2.55 (m, 2H); 2.54-2.23 (m, 7H); 1.71-1.20 (m, 63H); 0.91 (m, 12H).

D.U. Compound 162: 7-((2-Hydroxyethyl)(10-(octanoyloxy)decan-2-yl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00229] Compound 162 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.49 min. MS (ESI): m/z (MH ⁺ ) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.99 (m, 4H); 2.72-2.48 (m, 2H); 2.48-2.17 (m, 6H); 1.55 (m, 8H); 1.44-1.10 (m, 56H); 0.92-0.75 (m, 12H).

D.V. Compound 163: 7-((2-Hydroxyethyl)(7-methyl-8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

8-Methoxyoctanoic acid

Chemical formula: C ₉ H ₁₈ O ₃

Molecular weight: 174.240

[00230] KOH (7.54 g, 134.46 mmol) was added to anhydrous MeOH (80 ml) at 0° C. and stirred for 30 minutes. A solution of 8-bromooctanoic acid (10 g, 44.82 mmol) in anhydrous MeOH (70 ml) was added and the resulting solution was boiled for 18 hours. The MeOH was removed in vacuo and the residue acidified with 1N HCl and extracted with diethyl ether. The organic layer was washed with saturated aqueous sodium chloride, separated, dried over Na ₂ SO ₄ , filtered and evaporated under vacuum. The residue was purified by silica gel chromatography with (0-50%) EtOAc in hexanes to give 8-methoxyoctanoic acid (6.3 g, 36.16 mmol, 81%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.35 (m, 5H); 2.37 (t, 2H); 1.61 (m, 4H); 1.36 (m, 6H).

8-Methoxy-2-methyloctanoic acid

Chemical formula: C ₁₀ H ₂₀ O ₃

Molecular weight: 188.267

[00231] To a suspension of NaH in THF (100 mL) at 0°C was added 8-methoxyoctanoic acid (5.6 g, 32.14 mmol) in THF (30 mL) dropwise. The reaction mixture was allowed to stir at room temperature. pace. within 30 min. The reaction mixture was cooled to 0° C. and LDA (17.86 ml, 2M in THF, 35.71 mmol) was added dropwise. After completion of the addition, the reaction mixture was allowed to stir at 45° C. for 2 hours. The reaction mixture was cooled to room temperature. pace. and slowly added methyl iodide (2.45 ml, 39.28 mmol) in THF (15 ml). The reaction mixture was stirred at 45° C. for 16 hours. The reaction mixture was quenched with 1N HCl (20 ml). The quenched reaction mixture was evaporated under vacuum to remove volatiles. The residue was dissolved in a mixture of hexanes/EtOAc (1:1) and washed with 1N HCl (100 ml X 2) followed by the addition of a saturated aqueous solution of sodium chloride. The organic layer was separated, dried over sodium sulfate, filtered and evaporated under vacuum. The residue was purified by silica gel chromatography with (0-15%) EtOAc in hexanes to give 8-methoxy-2-methyloctanoic acid (3.25 g, 17.26 mmol, 54%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.35 (m, 5H); 2.49 (m, 1H); 1.70 (m, 1H); 1.59(m, 2H); 1.36 (m, 7H); 1.21 (d, 3H).

8-Hydroxy-2-methyloctanoic acid

Chemical formula: C ₉ H ₁₈ O ₃

Molecular weight: 174.240

[00232] Boron tribromide (13.28 ml 1 M in DCM, 13, 28 mmol). The reaction mixture was allowed to warm to room temperature. pace. and stirred at rt. pace. for 2 hours. The reaction mixture was poured onto ice and extracted with DCM. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give 8-hydroxy-2-methyloctanoic acid (0.77 g, 4.41 mmol, 83%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.43 (t, 2H); 2.50 (m, 1H); 1.94-1.64 (m, 4H); 1.56-1.26 (m, 7H); 1.20 (d, 3H).

Nonyl 8-hydroxy-2-methyloctanoate

Chemical formula: C ₁₈ H ₃₆ O ₃

Molecular weight: 300.483

[00233] A solution of 8-hydroxy-2-methyloctanoic acid (0.75 g, 4.31 mmol), nonan-1-ol (6.22 g, 43.1 mmol), 4-dimethylaminopyridine (0.11 g, 0.86 mmol) in DCM (20 ml) under N ₂ was added to (3-{[(ethylimino)methylidene]amino}propyl)dimethylamine hydrochloride (0.83 g, 4.31 mmol). The reaction mixture was allowed to stir at room temperature. pace. for 16 h. The reaction mixture was diluted with DCM and washed with sat. NaHCO ₃ , followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-20%) EtOAc in hexanes to give nonyl 8-hydroxy-2-methyloctanoate (0.68 g, 2.26 mmol, 53%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (t, 2H); 3.42 (t, 2H); 2.45 (m, 1H); 1.87 (m, 2H); 1.75-1.57 (m, 4H); 1.52-1.22 (m, 19H); 1.15 (d, 3H); 0.91 (m, 3H).

7-((2-Hydroxyethyl)(7-methyl-8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00234] Compound 163 was synthesized in a manner similar to compound 152 according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.50 min. MS (ESI): m/z (MH ⁺ ) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (t, 4H); 3.55 (m, 2H); 2.67 (m, 2H); 2.53-2.24 (m, 6H); 1.72-1.10 (m, 65H); 0.90 (m, 9H).

D.W. Compound 164: Nonyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)-2-methyloctanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00235] Compound 164 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.51 min. MS (ESI): m/z (MH+) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.55 (m, 2H); 2.69-2.38 (m, 8H); 2.30 (t, 2H); 1.74-1.09 (m, 65H); 0.90 (m, 9H).

dx. Compound 165: 7-((7-(Decanoyloxy)octyl)(2-hydroxyethyl)amino)heptyl-2-octyldecanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00236] Compound 165 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH+) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 1H); 4.08 (t, 2H); 3.55 (m, 2H); 2.68-2.39 (m, 8H); 2.29 (m, 3H); 1.72-1.15 (m, 64H); 0.90 (m, 9H).

D.Y. Compound 166: 8-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoic acid

Chemical formula: C ₃₅ H ₆₉ NO ₅

Molecular weight: 583.939

[00237] Trifluoroacetic acid was added to a solution of heptadecan-9-yl-8-{[8-( tert -butoxy)-8-oxooctyl](2-hydroxyethyl)amino}octanoate (0.11 g, 0.17 mmol) in DCM (0.06 ml, 0.69 mmol) and the reaction mixture was left to stir at room. pace. within 40 h. The volatiles were evaporated under vacuum. The residue was taken up in ethyl acetate and water and extracted with ethyl acetate. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and concentrated in vacuo. The residue was purified by silica gel chromatography (0-50%) (1%, 20% MeOH in DCM) in DCM to give 8-{[8-(heptadecan-9-yloxy)-8-oxooctyl](2-hydroxyethyl) amino}octanoic acid (0.023 g, 0.04 mmol) as a colorless liquid. UHPLC/DSIO: RT=2.72 min. MS (ESI): m/z (MH+) 585.0 for C ₃₅ H ₆₉ NO _5. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87 (m, 1H); 3.98 (m, 2H); 3.25-3.05(m, 6H); 2.32 (m, 4H); 1.82-1.45 (m, 12H); 1.45-1.19 (m, 37H); 0.89 (m, 6H).

D.Z. Compound 167: 8-((2-Hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoic acid

Chemical formula: C ₂₇ H ₅₃ NO ₅

Molecular weight: 471.723

[00238] Compound 167 was synthesized following a procedure similar to the synthesis of compound 166. UHPLC/DSIO: RT=1.57 min. MS (ESI): m/z (MH+) 472.0 for C ₂₇ H ₅₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (m, 2H); 4.00 (m, 2H); 3.44-2.98 (m, 10H); 2.35 (t, 4H); 1.85-1.55 (m, 10H); 1.33 (m, 23H); 0.90 (m, 3H).

EA. Compound 168: Heptadecan-9-yl-( Z )-8-((3-(2-cyano-3,3-dimethylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₅ N ₅ O ₄

Molecular weight: 818.33

[00239] Triethylamine was added to a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (220 mg, 0.3 mmol) in 5 ml of 2-propanol (0.04 ml, 0.3 mmol) followed by the addition of diphenylcyanocarbonimidate (72 mg, 0.3 mmol) and the mixture was stirred at room temperature. pace. in two hours. To the reaction mixture was added a 2M solution of dimethylamine in THF (0.75 ml, 1.5 mmol) and the resulting solution was heated to 75°C for 18 hours. An additional 2M dimethylamine/THF solution (0.75 ml, 1.5 mmol) was added and the temperature raised to 85 ^° C. After six hours the reaction was complete according to LC/MS, so the solution was concentrated in vacuo, diluted with DCM and washed once with saturated aqueous solution sodium bicarbonate. The organic phase was dried (MgSO ₄ ), filtered and the filtrate was evaporated in vacuo. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-( Z )-8-((3-(2- cyano-3,3-dimethylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (119.2 mg, 0.14 mmol, 49%) as a colorless syrup. UHPLC/DSIO: RT=3.52 min. MS (ESI): m/z (MH ⁺ ) 819.0 for C ₄₉ H ₉₅ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.62 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =7.5 Hz); 3.68 (d, 2H, J =3 Hz); 2.99 (s, 6H); 2.59 (br. s, 2H); 2.43 (br. s, 3H); 2.28 (m, 4H); 1.71 (br. s, 2H); 1.62 (m, 8H); 1.49 (m, 5H); 1.26 (broad m, 50H); 0.88 (t, 9H, J =7.5 Hz).

EB. Compound 169: Heptadecan-9-yl-8-((3-((2-(dimethylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8- oxooctyl)amino)octanoate

3-(Dimethylamino)-4-methoxycyclobut-3-ene-1,2-dione

Chemical formula: C ₇ H ₉ NO ₃

Molecular weight: 155.15

[00240] To a solution of 3,4-dimethoxy-3-cyclobutene-1,2-dione (1 g, 7 mmol) in 100 ml of diethyl ether was added a 2M solution of dimethylamine in THF (3.8 ml, 7.6 mmol) and a precipitate formed almost immediately. The mixture was stirred at rt. pace. for 24 hours and then filtered. The filtered solid was washed with diethyl ether and air dried. The filtered solid was dissolved in hot MeOH, filtered, the filtrate was left to cool to room temperature, then cooled to 0°C to obtain a precipitate. This was isolated by filtration, washed with cold MeOH, air dried, then dried in vacuo to give 3-(dimethylamino)-4-methoxycyclobut-3-ene-1,2-dione (0.42 g, 2.7 mmol, 39 %) as a pale yellow solid ¹ H NMR (300 MHz, DMSO- d ₆ ) δ: ppm 4.28 (s, 3H); 3.21 (s, 3H); 3.05 (s, 3H).

Heptadecan-9-yl-8-((3-((2-(dimethylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino )octanoate

Chemical formula: C ₅₁ H ₉₅ N ₃ O ₆

Molecular weight: 846.34

[00241] 3-( dimethylamino)-4-methoxycyclobut-3-en-1,2-dione (47 mg, 0.3 mmol) and the resulting colorless solution was stirred at room temperature. pace. within 20 hours after which, according to LC/MS, no starting amine remained. The solution was concentrated in vacuo and the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(( 2-(dimethylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (135 mg, 0.16 mmol, 53%) as a colorless syrup. UHPLC/DSIO: RT=3.51 min. MS (ESI): m/z (MH ⁺ ) 847.3 for C ₅₁ H ₉₅ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.86 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.92 (d, 2H, J =3 Hz); 3.20 (s, 6H); 2.63 (br. s, 2H); 2.42 (br. s, 3H); 2.28 (m, 4H); 1.74 (br. s, 2H); 1.61 (m, 8H); 1.50 (m, 5H); 1.41 (m, 3H); 1.25 (broad m, 47H); 0.88 (t, 9H, J =7.5 Hz).

EC. Compound 170: Heptadecan-9-yl-(E)-8-((3-((1-(methylamino)-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₄ O ₆

Molecular weight: 823.30

[00242] 1-Methylthio -1-methylamino-2-nitroetene (45 mg, 0.3 mmol), the resulting solution was heated to 70°C and stirred for 24 hours, after which, according to LC/MS, no starting amine remained. The solution was diluted with DCM and washed once with saturated aqueous sodium hydrogen carbonate. The organic phase was dried (MgSO ₄ ), filtered and the filtrate was evaporated in vacuo. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(E)-8-((3-((1 -(methylamino)-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (90 mg, 0.11 mmol, 36%) as a pale yellow syrup. UHPLC/DSIO: RT=3.33 min. MS (ESI): m/z (MH ⁺ ) 824.3 for C ₄₈ H ₉₄ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.15 (d, 1H, J =9 Hz); 8.26 (d, 1H, J =27 Hz); 6.55 (d, 1H, J =9 Hz); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.32 (br. s, 1H); 3.24 (br. s, 1H); 2.81 (dd, 3H, J =3 Hz, 12 Hz); 2.63 (br. s, 1H); 2.47 (br. s, 4H); 2.28 (m, 4H); 1.77 (br. s, 2H); 1.62 (m, 5H); 1.59 (m, 6H); 1.49 (m, 3H); 1.43 (m, 3H); 1.26 (broad m, 46H); 0.88 (t, 9H, J =7.5 Hz).

ED. Compound 171: Heptadecan-9-yl-8-((9-hydroxy-9-methyloctadecyl)(2-hydroxyethyl)amino)octanoate

((Dec-9-en-1-yloxy)methyl)benzene

Chemical formula: C ₁₇ H ₂₆ O

Molecular weight: 246.394

[00243] To a suspension of sodium hydride (3.88 g, 96.99 mmol) in THF (100 mL) was added 9-decen-1-ol (10 g, 63.99 mmol) slowly. After 30 minutes, benzyl bromide (10.57 ml, 88.9 mmol) was added. The reaction mixture was allowed to stir at room temperature. pace. within 18 hours the Reaction mixture was quenched with water. The solvents were evaporated under vacuum. The residue was diluted with EtOAc and washed with sat. NaHCO ₃ , followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated under vacuum. The residue was purified by silica gel chromatography with (0-20%) EtOAc in hexanes to give ((dec-9-en-1-yloxy)methyl)benzene (8.5 g, 34.5 mmol, 54%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.32 (m, 5H); 5.83 (m, 1H); 4.98 (m, 2H); 4.53 (s, 2H); 3.49 (t, 2H); 2.06 (m, 2H); 1.64 (m, 2H); 1.46-1.26 (broad m, 10H).

10-(Benzyloxy)decan-2-one

Chemical formula: C ₁₇ H ₂₆ O ₂

Molecular weight: 262.393

[00244] [(dec- 9-en-1-yloxy)methyl]benzene (6.4 g, 25.98 mmol) and dark brown solution were allowed to stir for 3 days at room temperature. pace. The mixture was dissolved in 2N HCl (50 ml) and extracted with ether (3×50 ml). The combined organic phase was washed with 2N NaOH (3×50 ml) and dried over MgSO ₄ . The solvents were removed in vacuo and the residue was purified by silica gel chromatography (0-40%) ethyl acetate in hexanes to give 10-(benzyloxy)decan-2-one (3.44 g, 13.11 mmol, 50%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.36 (m, 5H); 4.52 (s, 2H); 3.48 (t, 2H); 2.43 (t, 2H); 2.15 (s, 3H); 1.61 (m, 4H); 1.45-1.24 (broad m, 8H).

1-(Benzyloxy)-9-methyloctadecan-9-ol

Chemical formula: C ₂₆ H ₄₆ O ₂

Molecular weight: 390.652

[00245] Bromo(nonyl)magnesium (4.57 ml 1 M in diethyl ether, 4.57 mmol). The reaction mixture was allowed to warm to room temperature. pace. and stirred for 4 hours. The reaction mixture was quenched with water (2 ml), diethyl ether (200 ml) was added and the resulting white solid was filtered through a plug of silica gel. The filtrate was extracted with ether. The organic layer was washed with water, followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and concentrated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give 1-(benzyloxy)-9-methyloctadecan-9-ol (0.99 g). The product contained impurities but was used in the next step without further purification.

9-Methyloctadecane-1,9-diol

Chemical formula: C ₁₉ H ₄₀ O ₂

Molecular weight: 300.527

[00246] Under N ₂ , the flask was charged with 1-(benzyloxy)-9-methyloctadecan-9-ol (1 g, 2.56 mmol), Pd(OH) ₂ (100 mg) and EtOH. The reaction mixture was purged with H ₂ and placed under H ₂ atmosphere (balloon) with stirring for 16 h at room temperature. pace. The reaction mixture was purged with N ₂ . The reaction mixture was filtered through a pad of celite and the celite was washed with EtOAc (200 ml). The filtrate was evaporated under vacuum. The residue was dissolved in EtOAc and washed with water. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with EtOAc in hexanes (0-40%) to give 9-methyloctadecan-1,9-diol (0.65 g, 2.16 mmol, 84%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.66 (t, 2H); 1.59 (m, 2H); 1.49-1.22 (broad m, 29H); 1.17 (s, 3H); 0.90 (m, 3H).

1-Bromo-9-methyloctadecan-9-ol

Chemical formula: C ₁₉ H ₃₉ BrO

Molecular weight: 363.42

[00247] 1-Bromo-9-methyloctadecan-9-ol was synthesized in a manner analogous to the synthesis (Z)-1-bromo-10-octylocadec-8-ene.¹H NMR (300 MHz, CDCl₃) δ: ppm 3.43 (t, 2H); 1.88 (m, 2H); 1.53-1.23 (broad m, 28H); 1.17 (s, 3H); 0.91 (m, 3H).

Heptadecan-9-yl-8-((9-hydroxy-9-methyloctadecyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₃ NO ₄

Molecular weight: 724.253

[00248] Compound 171 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.56 min. MS (ESI): m/z (MH+) 725.0 for C ₄₆ H ₉₃ NO ₄ . ¹ H NMR (300 MHz, CDCl3) δ: ppm 4.89 (m, 1H); 3.55 (m, 2H); 2.60 (m, 2H); 2.47 (m, 4H); 2.30 (t, 2H); 1.74-1.21(m, 69H); 1.17 (s, 3H); 0.90 (m, 9H).

EE. Compound 172:( R )-Decan-2-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00249] Compound 172 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.53 min. MS (ESI): m/z (MH+) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl3) δ: ppm 4.91 (m, 2H); 3.54 (m, 2H); 2.59 (m, 2H); 2.46 (m, 4H); 2.30 (m, 4H); 1.70-1.19 (m, 66H); 0.90 (m, 9H).

EF. Compound 173: Heptadecan-9-yl-8-((3-( N -methylsulfonamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₄ N ₂ O ₆ S

Molecular weight: 815.34

[00250] To a solution of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200mg, 0.27mmol) and N -methylmethanesulfonamide (50µl, 0.54 mmol) in 4 ml of dry DMF was added cesium carbonate (130 mg, 0.40 mmol), the resulting mixture was heated to 60°C and stirred for 24 hours, after which, according to LC/MS, no starting chloride remained. The mixture was left to cool to room. temp., diluted with 50% saturated aqueous sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated to give a yellow oil. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-( N -methylmethylsulfonamido)propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (85 mg, 0.11 mmol, 39%) as a pale yellow oil. UHPLC/DSIO: RT=3.57 min. MS (ESI): m/z (MH ⁺ ) 816.1 for C ₄₇ H ₉₄ N ₂ O ₆ S. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.15 (t, 2H, J =7.5 Hz); 2.85 (s, 3H); 2.79(3,3H); 2.40 (broad m, 5H); 2.28 (m, 4H); 1.72 (broad m, 2H); 1.64-1.49 (m, 13H); 1.26 (broad m, 50H); 0.88 (t, 9H, J =7.5 Hz).

EG. Compound 174: Heptadecan-9-yl-8-((3-(2,5-dioxoimidazolidin-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₁ N ₃ O ₆

Molecular weight: 806.27

[00251] To a solution of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200 mg, 0.27 mmol) and hydantoin (50 mg, 0. 54 mmol) in 4 ml of dry DMF was added cesium carbonate (130 mg, 0.40 mmol), the resulting mixture was heated to 60°C and stirred for 24 hours, after which, according to LC/MS, no starting chloride remained. The mixture was left to cool to room. temp., diluted with 50% saturated aqueous sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2,5-dioxoimidazolidine- 1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (35 mg, 0.05 mmol, 18%) as a pale yellow oil. UHPLC/DSIO: RT=3.52 min. MS (ESI): m/z (MH ⁺ ) 807.2 for C ₄₈ H ₉₁ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.27 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.95 (s, 2H); 3.55 (t, 2H, J =7.5 Hz); 2.50-2.34 (broad m, 5H); 2.26 (m, 4H); 1.77 (br. s, 2H); 1.64-1.49 (m, 15H); 1.26 (broad m, 48H); 0.88 (t, 9H, J =7.5 Hz).

EH. Compound 175: Heptadecan-9-yl-8-((3-((methylcarbamoyl)oxy)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₆

Molecular weight: 781.26

[00252] To a solution of heptadecan-9-yl-8-((3-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200 mg, 0.27 mmol) and triethylamine (60 µl, 0. 41 mmol) methyl isocyanate (22 μl, 0.35 mmol) was added dropwise to 5 ml dry DCM at 0°C. The cooling bath was removed and the solution was stirred at room temperature. pace. for 2 hours, after which, according to LC/MS, no starting alcohol remained. The reaction was quenched with three drops of methanol, the mixture was concentrated under a stream of nitrogen and the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl- 8-((3-((methylcarbamoyl)oxy)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (115 mg, 0.15 mmol, 53%) as a colorless oil. UHPLC/DSIO: RT=3.54 min. MS (ESI): m/z (MH ⁺ ) 782.3 for C ₄₇ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J =6 Hz); 4.62 (br. s, 1H); 4.05 (m, 4H); 2.79 (d, 3H, J =3 Hz); 2.47 (br. s, 2H); 2.37 (broad m, 3H); 2.27 (m, 4H); 1.73 (br. s, 2H); 1.61 (m, 7H); 1.50 (broad m, 4H); 1.40 (broad m, 4H); 1.25 (broad m, 48H); 0.87 (t, 9H, J =7.5 Hz).

EI. Compound 176: Heptadecan-9-yl-8-((3-(2,5-dioxopyrrolidin-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₂ N ₂ O ₆

Molecular weight: 805.28

[00253] To a solution of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200mg, 0.27mmol) and succinimide (50mg, 0.27mmol) 54 mmol) in 4 ml of dry DMSO was added cesium carbonate (130 mg, 0.40 mmol), the resulting mixture was heated to 80°C and stirred for 48 hours, after which, according to LC/MS, no starting chloride remained. The mixture was left to cool to room. temp., diluted with 50% saturated aqueous sodium bicarbonate solution and extracted three times with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated. The residue was purified twice by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2,5-dioxopyrrolidin-1 -yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (44 mg, 0.05 mmol, 19%) as a yellowish oil. UHPLC/DSIO: RT=3.56 min. MS (ESI): m/z (MH ⁺ ) 806.1 for C ₄₉ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.52 (t, 2H, J =7.5 Hz); 2.69 (s, 4H); 2.42-2.25 (broad m, 9H); 1.71-1.58 (m, 10H); 1.50 (br. d, 4H, J=3 Hz); 1.26 (broad m, 51H); 0.88 (t, 9H, J =7.5 Hz).

EJ. Compound 177: Heptadecan-9-yl-8-((3-(4-(tert-butoxymethyl)-1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl )amino)octanoate

Chemical formula: C ₅₂ H ₁₀₀ N ₄ O ₅

Molecular weight: 861.40

[00254] To a solution of heptadecan-9-yl-8-((3-azidopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500mg, 0.67mmol) and tert -butylpropargyl ether (100µl , 0.73 mmol) in 4 ml of THF was added a suspension of anhydrous copper (II) sulfate (5 mg, 0.03 mmol) and sodium ascorbate (14 mg, 0.07 mmol) in 1 ml of water, and the mixture was stirred at room temperature. pace. within 24 hours, after which, according to LC/MS, no starting azide remained. The mixture was diluted with saturated aqueous sodium hydrogen carbonate and extracted three times with DCM. The organic phases were combined, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(4-(tert-butoxymethyl )-1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (485 mg, 0.56 mmol, 84%) as a yellowish oil. UHPLC/DSIO: RT=3.63 min. MS (ESI): m/z (MH ⁺ ) 862.2 for C ₅₂ H ₁₀₀ N ₄ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.50 (s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.59 (s, 2H); 4.36 (t, 2H, J =7.5 Hz); 4.05 (t, 2H, J =6 Hz); 2.36 (broad m, 5H); 2.28 (m, 4H); 2.02 (broad m, 2H); 1.62 (broad m, 8H); 1.50 (br. d, 4H, J=3 Hz); 1.28 (broad m, 60H); 0.88 (t, 9H, J =7.5 Hz).

EK. Compound 178: Heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆

Molecular weight: 795.29

[00255] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200 mg, 0.27 mmol) and triethylamine (60 µl, 0. 41 mmol) in 5 ml dry DCM at 0° C. was added dropwise methoxyacetyl chloride (30 μl, 0.33 mmol). The cooling bath was removed and the solution was stirred at room temperature. pace. within 24 hours, after which, according to LC/MS, no starting amine remained. The mixture was diluted with a 50% aqueous saturated sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (50 mg, 0.06 mmol, 23%) as a colorless oil. UHPLC/DSIO: RT=3.56 min. MS (ESI): m/z (MH ⁺ ) 796.2 for C ₄₈ H ₉₄ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.53 (s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.87 (s, 2H); 3.39 (m, 5H); 2.47 (br. s, 2H); 2.36 (broad m, 3H); 2.27 (m, 4H); 1.61 (m, 8H); 1.46 (broad m, 9H); 1.26 (broad m, 48H); 0.88 (t, 9H, J =7.5 Hz).

EL. Compound 179: Heptadecan-9-yl-8-((3-(1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)(3-(4-(trimethylsilyl)-1H-1,2,3-triazol-1-yl)propyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₈ N ₄ O ₄ Si

Molecular weight: 847.44

[00256] To a solution of heptadecan-9-yl-8-((3-azidopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200 mg, 0.27 mmol) and ethynyltrimethylsilane (41 µl, 0. 29 mmol) in 2 ml of THF was added a suspension of anhydrous copper (II) sulfate (2 mg, 0.01 mmol) and sodium ascorbate (5 mg, 0.02 mmol) in 0.5 ml of water and the mixture was stirred at room temperature. pace. for 20 hours, after which, according to LC/MS, no starting azide remained. The mixture was diluted with saturated aqueous sodium hydrogen carbonate and extracted three times with DCM. The organic phases were combined, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl )(3-(4-(trimethylsilyl)-1H-1,2,3-triazol-1-yl)propyl)amino)octanoate (150 mg, 0.18 mmol, 66%) as a yellowish oil which was product TMS/des-TMS mixture 2:1 according to ¹ H-NMR. Used as is. UHPLC/DSIO: RT=3.63 min. MS (ESI): m/z (MH ⁺ ) 848.3 for C ₅₀ H ₉₈ N ₄ O ₄ Si. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.55 (s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.45 (t, 2H, J =7.5 Hz); 4.05 (t, 2H, J =6 Hz); 3.42 (br. s, 1H); 2.28 (m, 5H); 1.65-1.45 (broad m, 14H); 1.25 (broad m, 48H); 0.87 (t, 9H, J =7.5 Hz); 0.33 (s, 6H).

Heptadecan-9-yl-8-((3-(1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₀ N ₄ O ₄

Molecular weight: 775.26

[00257] To a solution (150 mg, 0.18 mmol) in 5 ml THF was added a solution of 1M tetrabutylammonium fluoride in THF (0.21 ml, 0.21 mmol) and the solution was stirred at room temperature. pace. within 24 hours, after which the reaction was approximately 25%. The solution was heated to 55°C and stirred for 24 hours, after which, according to LC/MS, the reaction was complete. The solution was diluted with saturated aqueous sodium hydrogen carbonate and extracted twice with DCM. The organic phases were combined, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(1H-1,2, 3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (53 mg, 0.07 mmol, 39%) as a colorless oil. UHPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH ⁺ ) 776.2 for C ₄₇ H ₉₀ N ₄ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.69 (s, 1H); 7.55 (s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.44 (t, 2H, J =7.5 Hz); 4.05 (t, 2H, J =6 Hz); 2.37 (broad m, 5H); 2.28 (m, 4H); 2.05 (broad m, 2H); 1.61 (broad m, 8H); 1.49 (broad m, 4H); 1.26 (broad m, 51H); 0.88 (t, 9H, J =7.5 Hz).

EM. Compound 181: Heptadecan-9-yl-8-((3-((methoxycarbonyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₆

Molecular weight: 781.26

[00258] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200 mg, 0.27 mmol) and triethylamine (60 μl, 0. 41 mmol) in 5 ml of dry DCM at 0°C was added dropwise methyl chloroformate (27 μl, 0.33 mmol). The cooling bath was removed and the solution was stirred at room temperature. pace. within 24 hours, after which, according to LC/MS, no starting amine remained. The mixture was diluted with a 50% aqueous saturated sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-((methoxycarbonyl)amino)propyl )(8-(nonyloxy)-8-oxooctyl)amino)octanoate (120 mg, 0.15 mmol, 54%) as a colorless oil. UHPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH ⁺ ) 782.1 for C ₄₇ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.11 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.64 (s, 3H); 3.25 (br. d, 2H, J =6 Hz); 2.46 (br. s, 2H); 2.38-2.24 (m, 7H); 1.61 (br. t., 9H, J = 7.5 Hz); 1.50 (m, 4H); 1.42 (broad m, 3H); 1.26 (broad m, 49H); 0.88 (t, 9H, J =7.5 Hz).

EN. Compound 182: Heptadecan-9-yl-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8- oxooctyl)amino)octanoate

3-Methoxy-4-(methylamino)cyclobut-3-ene-1,2-dione

Chemical formula: C ₆ H ₇ NO ₃

Molecular weight: 141.13

[00259] To a solution of 3,4-dimethoxy-3-cyclobutene-1,2-dione (1 g, 7 mmol) in 100 ml of diethyl ether was added a 2M solution of methylamine in THF (3.8 ml, 7.6 mmol) and a precipitate formed almost immediately. The mixture was stirred at rt. pace. for 24 hours, then filtered, the filtered solids were washed with diethyl ether and air dried. The filtered solid was dissolved in hot EtOAc, filtered, the filtrate was allowed to cool to room temperature. temp., then cooled to 0°C to obtain a precipitate. It was isolated by filtration, washed with cold EtOAc, air dried, then dried in vacuo to give 3-methoxy-4-(methylamino)cyclobut-3-ene-1,2-dione (0.70 g, 5 mmol, 73%) in form of a white solid. ¹ H NMR (300 MHz, DMSO- d ₆ ) δ: ppm 8.50 (br. d, 1H, J=69 Hz); 4.27 (s, 3H); 3.02 (sdd, 3H, J=42Hz, 4.5Hz).

Heptadecan-9-yl-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino )octanoate

Chemical formula: C ₅₀ H ₉₃ N ₃ O ₆

Molecular weight: 832.31

[00260] 3-methoxy -4-(methylamino)cyclobut-3-ene-1,2-dione (39 mg, 0.28 mmol) and the resulting colorless solution was stirred at room temperature. pace. within 20 hours after which, according to LC/MS, no starting amine remained. The solution was concentrated in vacuo and the residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(( 2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (138 mg, 0.17 mmol, 60%) as a tarry white solid. UHPLC/DSIO: RT=3. min. MS (ESI): m/z (MH ⁺ ) 833.4 for C ₅₁ H ₉₅ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.86 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.92 (d, 2H, J =3 Hz); 3.20 (s, 6H); 2.63 (br. s, 2H); 2.42 (br. s, 3H); 2.28 (m, 4H); 1.74 (br. s, 2H); 1.61 (m, 8H); 1.50 (m, 5H); 1.41 (m, 3H); 1.25 (broad m, 47H); 0.88 (t, 9H, J =7.5 Hz).

EO. Compound 183: 1,3-Bis(hexyloxy)propan-2-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

(((1,3-Bis(hexyloxy)propan-2-yl)oxy)methyl)benzene

Chemical formula: C ₂₂ H ₃₈ O ₃

Molecular weight: 350.543

[00261] To a suspension of NaH (1.76 g, 43.9 mmol) in THF (40 ml) under N ₂ was added 2-(benzyloxy)propane-1,3-diol (2 g, 10.98 mmol) and a mixture left stirring at 40° C. for 2 hours. After the indicated time, 1-bromohexane (4.35 g, 26.34 mmol) in DMF (2 ml) and a catalytic amount of KI were added. The reaction mixture was refluxed for 16 hours. The solvents were evaporated in vacuo. The residue was diluted with EtOAc and washed with sat. NaHCO ₃ , followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-40%) EtOAc in hexanes to give (((1,3-bis(hexyloxy)propan-2-yl)oxy)methyl)benzene (1.7 g, 4. 75 mmol, 43%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.34 (m, 5H); 4.73 (s, 2H); 3.75 (m, 1H); 3.61-3.40 (m, 8H); 1.59 (m, 4H); 1.32 (m, 12H); 0.91 (m, 6H).

1,3-Bis(hexyloxy)propan-2-ol

Chemical formula: C ₁₅ H ₃₂ O ₃

Molecular weight: 260.418

[00262] 1,3-Bis(hexyloxy)propan-2-ol was synthesized in a manner analogous to the synthesis of 9-methyloctadecan-1,9-diol. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.96 (m, 1H); 3.48 (m, 8H); 2.37 (br. s, 1H); 1.64 (m, 2H); 1.60 (m, 4H); 1.32 (m, 12H); 0.91 (m, 6H).

1,3-Bis(hexyloxy)propan-2-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₂ H ₈₃ NO ₇

Molecular weight: 714.126

[00263] Compound 183 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.17 min. MS (ESI): m/z (MH ⁺ ) 715.0 for C ₄₂ H ₈₃ NO ₇ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.15 (m, 1H); 4.08 (t, 2H); 3.66-3.34 (m, 10H); 2.71-2.41 (m, 6H); 2.34 (m, 4H); 1.74-1.20 (m, 50H); 0.91 (m, 9H).

ep. Compound 184: Heptadecan-9-yl-8-((2-hydroxyethyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate

2-Methylnonyl-8-bromooctanoate

Chemical formula: C ₁₈ H ₃₅ BrO ₂

Molecular weight: 363.380

[00264] To a solution of 8-bromooctanoic acid (3.83 g, 17.18 mmol), 2-methylnonan-1-ol (2.72 g, 17.18 mmol), 4-dimethylaminopyridine (0.42 g, 3 .44 mmol) in vDHM (25 ml) under N ₂ was added (3-{[(ethylimino)methylidene]amino}propyl)dimethylamine hydrochloride (3.29 g, 17.18 mmol). The reaction mixture was allowed to stir at room temperature. pace. for 16 h. The reaction mixture was diluted with DCM and washed with sat. NaHCO ₃ , followed by the addition of a saturated aqueous sodium chloride solution. The organic layer was separated, dried over Na ₂ SO ₄ , filtered and evaporated in vacuo. The residue was purified by silica gel chromatography with (0-20%) EtOAc in hexanes to give 2-methylnonyl-8-bromooctanoate (5.1 g, 14.04 mmol, 82%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.98 (m, 2H); 3.43 (t, 2H); 2.33 (t, 2H); 1.93-1.74 (m, 3H); 1.72-1.09 (m, 20H); 0.93 (m, 6H).

Heptadecan-9-yl-8-((2-hydroxyethyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00265] Compound 184 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.60 min. MS (ESI): m/z (MH ⁺ ) 725.0 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 3.92 (m, 2H); 3.57 (m, 2H); 2.70-2.41 (m, 6H); 2.31 (m, 4H); 1.79 (m, 1H); 1.70-1.07(m, 60H); 0.93 (m, 12H).

EQ. Compound 185: Genicosan-11-yl 6-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)hexanoate

Chemical formula: C ₄₆ H ₉₁ NO ₅

Molecular weight: 738.236

[00266] Compound 185 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.72 min. MS (ESI): m/z (MH ⁺ ) 739.0 for C ₄₆ H ₉₁ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ )δ: ppm 4.88 (m, 1H); 4.08 (t, 2H); 3.55 (m, 2H); 2.60 (m, 2H); 2.48 (m, 4H); 2.32 (m, 4H); 1.72-1.41 (m, 15H); 1.28 (m, 52H); 0.90 (m, 9H).

er. Compound 186: Heptyl 10-((2-hydroxyethyl)(10-oxo-10-(tridecan-7-yloxy)decyl)amino)decanoate

Chemical formula: C ₄₂ H ₈₃ NO ₅

Molecular weight: 682.128

[00267] Compound 186 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UPLC/DSIO: RT=3.31 min. MS (ESI): m/z (MH ⁺ ) 739.0 for C ₄₂ H ₈₃ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.55 (m, 2H); 2.58 (m, 2H); 2.47 (m, 4H); 2.30 (m, 4H); 1.71-1.18 (m, 58H); 0.90 (m, 9H).

ES. Compound 189: Heptyl 10-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)decanoate

Chemical formula: C ₄₄ H ₈₇ NO ₅

Molecular weight: 710.182

[00268] Compound 189 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.47 min. MS (ESI): m/z (MH ⁺ ) 710.98 for C ₄₄ H ₈₇ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.55 (m, 2H); 2.61 (m, 2H); 2.47 (m, 4H); 2.31 (m, 4H); 1.70-1.20 (m, 62H); 0.90 (m, 9H).

ET. Compound 194: Heptadecan-9-yl-8-((3-isobutyramidopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₅

Molecular weight: 793.32

[00269] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (150 mg, 0.21 mmol) and triethylamine (90 µl, 0. 62 mmol) isobutyryl chloride (35 μl, 0.31 mmol) was added dropwise to 5 ml dry DCM at 0°C. After 30 minutes, the cooling bath was removed and the solution was stirred at room temperature. pace. for 90 minutes, after which, according to LC/MS, no starting amine remained. The mixture was diluted with a 50% aqueous saturated sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-isobutyramidopropyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate (65 mg, 0.08 mmol, 39%) as a colorless oil. UHPLC/DSIO: RT=3.65 min. MS (ESI): m/z (MH ⁺ ) 794.3 for C ₄₉ H ₉₆ N ₂ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.53 (s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.87 (s, 2H); 3.39 (m, 5H); 2.47 (br. s, 2H); 2.36 (broad m, 3H); 2.27 (m, 4H); 1.61 (m, 8H); 1.46 (broad m, 9H); 1.26 (broad m, 48H); 0.88 (t, 9H, J =7.5 Hz).

EU. Compound 197: Heptadecan-9-yl-8-((3-(2-(benzyloxy)acetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₄ H ₉₈ N ₂ O ₆

Molecular weight: 871.39

[00270] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (300mg, 0.41mmol) and triethylamine (145µl, 1mmol ) in 10 ml dry DCM at 0° C. was added dropwise benzyloxyacetyl chloride (82 μl, 0.52 mmol). The cooling bath was removed and the solution was stirred at room temperature. pace. within 24 hours, after which, according to LC/MS, no starting amine remained. The mixture was diluted with a 50% aqueous saturated sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-(benzyloxy)acetamido ) propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (179 mg, 0.21 mmol, 50%) as a colorless oil. UHPLC/DSIO: RT=3.66 min. MS (ESI): m/z (MH ⁺ ) 872.4 for C ₅₄ H ₉₈ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.55 (s, 1H); 7.33 (m, 5H); 4.86 (quint, 1H, J =6 Hz); 4.55 (s, 2H); 4.05 (t, 2H, J =6 Hz); 3.97 (s, 2H); 3.35 (q.t., 2H, J = 6 Hz); 2.46 (broad m, 2H); 2.28 (m, 7H); 1.65-1.48 (m, 15H); 1.26 (broad m, 50H); 0.88 (t, 9H, J =7.5 Hz).

EV. Compound 198: Heptadecan-9-yl-8-((3-(2-hydroxyacetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₆

Molecular weight: 781.26

[00271] To a solution of heptadecan-9-yl-8-((3-(2-(benzyloxy)acetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (130 mg, 0.15 mmol) in 5 ml of ethanol in a nitrogen atmosphere was added palladium 10% wt. on carbon (approximately 20, cat.), the walls of the flask were washed with ethanol, and the flask was equipped with a hydrogen balloon. The flask was evacuated and filled three times with hydrogen, then stirred at room temperature. pace. within 24 hours, after which, according to LC/MS, the original ether remained. The flask was purged with nitrogen, the mixture was filtered through diatomaceous earth, the filtered solids were washed with ethanol, and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-hydroxyacetamido)propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (55 mg, 0.07 mmol, 47%) as a colorless oil. UHPLC/DSIO: RT=3.46 min. MS (ESI): m/z (MH ⁺ ) 782.2 for C ₄₇ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.73 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (m, 4H); 3.40 (q.t., 2H, J = 6 Hz); 2.50 (m, 2H); 2.37 (t, 4H, J =6 Hz); 2.28 (m, 4H); 1.63 (m, 8H); 1.46 (broad m, 8H); 1.26 (broad m, 49H); 0.88 (t, 9H, J =7.5 Hz).

ew. Compound 200: Heptadecan-9-yl-( E )-8-((3-(3-methyl-2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Methyl-( E/Z )-N - methyl- N' - nitrocarbamimidothioate

Chemical formula: C ₃ H ₇ N ₃ O ₂ S

Molecular weight: 149.17

[00272] Iodomethane (0. 69 ml, 11.1 mmol) and the mixture was stirred at room temperature for 24 hours The yellow mixture was diluted with water and extracted twice with EtOAc The organic phases were combined, washed three times with 50% saturated aqueous sodium hydrogen carbonate solution, once with saturated aqueous chloride solution sodium, dried (MgSO ₄ ), filtered and concentrated to give a yellow solid.This was dissolved in hot water, the solution was filtered and the filtrate was cooled to 4°C for three days.The resulting solids were isolated by filtration, washed with water, dried with air, then dried in vacuo to give methyl-( E/Z ) -N -methyl- N' -nitrocarbamimidothioate (85 mg, 0.57 mmol, 8%) as a pale yellow solid.1 ^H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.02 (br s, 1H), 3.12 (d, 1H, J =6 Hz), 2.53 (s, 3H).

Chemical formula: C ₄₇ H ₉₃ N ₅ O ₆

Molecular weight: 824.29

[00273] Methyl-( E/Z ) -N -methyl- N' -nitrocarbamimidothioate (45 mg, 0.3 mmol), the resulting solution was heated to 70°C and stirred for 24 hours, after which, according to LC/MS, no starting amine remained. The solution was diluted with DCM and washed once with saturated aqueous sodium hydrogen carbonate. The organic phase was dried (MgSO ₄ ), filtered and the filtrate was evaporated in vacuo. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-( E )-8-((3-(3- methyl 2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (75 mg, 0.09 mmol, 33%) as a pale yellow syrup. UHPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH ⁺ ) 825.3 for C ₄₇ H ₉₃ N ₅ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 9.26 (br. s, 1H); 8.27 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.42 (br. s, 2H); 2.86 (d, 3H, J =6 Hz); 2.60-2.40 (broad m, 5H); 2.28 (m, 4H); 1.73 (br. s, 2H); 1.65-1.40 (m, 16H); 1.26 (broad m, 47H); 0.88 (t, 9H, J =7.5 Hz).

Etc. Compound 207: Heptadecan-9-yl-8-((3-guanidinopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Heptadecan-9-yl-6-((tert-butoxycarbonyl)amino)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5,7,11 -triazano-6-en-19-oat

Chemical formula: C ₅₆ H ₁₀₈ N ₄ O ₈

Molecular weight: 965.50

[00274] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (300 mg, 0.41 mmol) and triethylamine (230 µl, 1, 66 mmol) in 10 ml dry DCM at 0°C were added in one portion 1,3-bis( tert -butoxycarbonyl)-2-(trifluoromethylsulfonyl)guanidine (325 mg, 0.83 mmol) and the resulting solution and left to gradually warm to room temperature. . pace. with stirring overnight. LC/MS indicated that no starting material remained, so the solution was diluted with DCM, washed with 50% saturated aqueous sodium hydrogen carbonate, the organic layer was dried (MgSO ₄ ), filtered and concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-6-((tert-butoxycarbonyl)amino)-2, 2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5,7,11-triazanodec-6-ene-19-oate (310 mg, 0.32 mmol, 77%) as a colorless oil of about 95% purity. The largest single impurity has a mass corresponding to the product with the loss of one Boc group. Used as is. UHPLC/DSIO: RT=3.90 min. MS (ESI): m/z (MH ⁺ ) 966.0 for C ₅₆ H ₁₀₈ N ₄ O ₈ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 11.49 (s, 1H); 8.55 (br. s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =7.5 Hz); 3.45 (q.t., 2H, J = 6 Hz); 2.46 (m, 2H); 2.36 (m, 4H); 2.27 (m, 4H); 1.61 (m, 8H); 1.50 (m, 22H); 1.40 (m, 4H); 1.25 (broad m, 48H); 0.88 (t, 9H, J =7.5 Hz).

Chemical formula: C ₄₆ H ₉₂ N ₄ O ₄

Molecular weight: 765.27

[00275] To a solution of heptadecan-9-yl 6-((tert-butoxycarbonyl)amino)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5 ,7,11-triazanodec-6-en-19-oate (310 mg, 0.32 mmol) in 10 ml DCM was added trifluoroacetic acid (500 μl, excess) and the solution was stirred at room temperature. pace. within 48 hours, after which, according to LC/MS, no starting material remained. The solution was concentrated, the residue was co-distilled twice with DCM and purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(( 3-guanidinopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (210 mg, 0.27 mmol, 84%) as a colorless oil. UHPLC/DSIO: RT=3.16 min. MS (ESI): m/z (MH ⁺ ) 766.3 for C ₄₆ H ₉₂ N ₄ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.92 (br. s, 1H); 8.82 (br. s, 1H); 7.25 (br. s, 2H); 4.85 (quint, 1H, J =6 Hz); 4.05 (t, 2H, J =6 Hz); 3.38 (br. s, 2H); 3.15 (br. s, 2H); 3.00 (br. s, 4H); 2.29 (m, 4H); 2.05 (br. s, 2H); 1.91 (br. s, 3H); 1.70-1.45 (broad m, 12H); 1.26 (broad m, 47H); 0.88 (t, 9H, J =7.5 Hz).

EY. Compound 218: Heptadecan-9-yl-8-((3-(4-(hydroxymethyl)-1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino )octanoate

Chemical formula: C ₄₈ H ₉₂ N ₄ O ₅

Molecular weight: 805.29

[00276] To a solution of heptadecan-9-yl-8-((3-(4-(tert-butoxymethyl)-1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8 -oxooctyl)amino)octanoate (190 mg, 0.22 mmol) in 4 ml DCM was added trifluoroacetic acid (675 μl, excess) and the solution was stirred at room temperature. pace. within 72 hours, after which, according to LC/MS, no starting material remained. The solution was concentrated, the residue was co-distilled twice with DCM and purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(( 3-(4-(hydroxymethyl)-1H-1,2,3-triazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (113 mg, 0.14 mmol, 64% ) as a colorless oil. UHPLC/DSIO: RT=3.41 min. MS (ESI): m/z (MH ⁺ ) 806.1 for C ₄₈ H ₉₂ N ₄ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.54 (s, 1H); 4.86 (quint, 1H, J =6 Hz); 4.80 (s, 2H); 4.40 (t, 2H, J =7.5 Hz); 4.05 (t, 2H, J =6 Hz); 2.38 (broad m, 5H); 2.28 (m, 5H); 2.04 (broad m, 2H); 1.61 (broad m, 7H); 1.50 (br. d, 4H, J=3 Hz); 1.26 (broad m, 51H); 0.88 (t, 9H, J =7.5 Hz) (hydroxyl proton not observed).

ez. Compound 232: Nonyl 8-((2-hydroxyethyl)(6-oxo-6-((4-pentylcyclohexyl)oxy)hexyl)amino)octanoate

Chemical formula: C ₃₆ H ₆₉ NO ₅

Molecular weight: 595.950

[00277] Compound 232 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=2.84 min. MS (ESI): m/z (MH ⁺ ) 596.84 for C ₃₆ H ₆₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.01 (m, 0.5H); 4.68 (m, 0.5H); 4.08 (t, 2H); 3.56 (m, 2H), 2.67-2.55 (broad m, 2H); 2.55-2.40 (broad m, 4H); 2.31 (m, 4H); 1.97 (m, 1H); 1.82 (m, 2H); 1.73-1.15 (m, 43H); 1.02 (m, 1H); 0.90 (m, 6H).

FA. Compound 233: Heptadecan-9-yl-(Z)-8-((3-(3,3-dimethyl-2-(methylsulfonyl)guanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Diphenyl(methylsulfonyl)carbonimidate

Chemical formula: C ₁₄ H ₁₃ NO ₄ S

Molecular weight: 291.32

[00278] In a 100 ml round bottom flask, 2.0 g (7.4 mmol) of dichlorodiphenoxymethane and 1.56 g (16.4 mmol) of methanesulfonamide were suspended in 15 ml of ethyl acetate with stirring to give a white mixture. It was heated to boiling (85 ^° C.) and stirred for 24 hours, after which only product could be seen on LC/MS. The mixture was left to cool to room. temp., concentrated, the residue was suspended in DCM and filtered. The filtered solid was washed with DCM, the filtrates were combined and concentrated. The residue was purified by silica gel chromatography (0-40% EtOAc in hexanes), product containing fractions were combined and concentrated to give a yellowish solid. It was triturated with a mixture of hexanes, filtered, the filtered solids were washed with a mixture of hexanes and air dried to give diphenyl(methylsulfonyl)carbonimidate (0.84 g, 2.88 mmol, 39%) as a white solid. UHPLC/DSIO: RT=0.50 min. MS (ESI): m/z (MH ⁺ ) 292.2 for C ₁₄ H ₁₃ NO ₄ S. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.45-7.37 (m, 4H); 7.30 (m, 2H); 7.21 (m, 4H); 3.01 (s, 3H).

Heptadecan-9-yl-(Z)-8-((3-(3,3-dimethyl-2-(methylsulfonyl)guanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₈ N ₄ O ₆ S

Molecular weight: 871.41

[00279] Triethylamine was added to a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (200 mg, 0.28 mmol) in 5 ml of 2-propanol (40 μl, 0.28 mmol) followed by the addition of diphenyl(methylsulfonyl)carbonimidate (81 mg, 0.28 mmol) and the white mixture was stirred at room temperature. pace. Within three hours, after which, according to LC/MS, no starting amine remained. A 2.0M solution of dimethylamine in THF (0.75 ml, 1.5 mmol) was added to the solution, the yellowish solution was heated to 80° C. and stirred for 24 hours. According to LC/MS, there was no starting material left, so the solution was allowed to cool to room temperature. temp., concentrated in a stream of nitrogen and the residue was dissolved in DCM. The solution was washed once with saturated aqueous sodium hydrogen carbonate, then dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. This oil was purified by silica gel chromatography (0-50% (1% NH4OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-((3-(3.3 -dimethyl-2-(methylsulfonyl)guanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (80 mg, 0.09 mmol, 33%) as a colorless oil. UHPLC/DSIO: RT=3.53 min. MS (ESI): m/z (MH+) 872.1 for C49H98N4O6S. 1H NMR (300 MHz, CDCl3) δ: ppm 7.22 (br. s, 1H); 4.86 (quint, 1H, J=12.3 Hz, 5.9 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.40 (br. d, 2H, J=5.4 Hz); 2.97 (s, 9H); 2.52 (br. s, 2H); 2.39 (br. s, 3H); 2.29 (m, 4H); 1.69-1.49 (m, 15H); 1.45-1.15 (m, 50H); 0.87 (t, 9H, J=5.8Hz)

FB. Compound 234: 8-((2-Hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octan-2-yl 2-octyldecanoate

8-Hydroxyoctan-2-yl-2-octyldecanoate

Chemical formula: C ₂₆ H ₅₂ O ₃

Molecular weight: 412.699

[00280] The compound 8-hydroxyoctan-2-yl-2-octyldecanoate was synthesized according to the general procedure for the synthesis of 8-hydroxyoctan-2-yldecanoate. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.93 (m, 1H); 3.66 (t, 2H); 2.29 (m, 1H); 1.69-1.16 (m, 42H); 0.90 (m, 6H).

8-Bromooctan-2-yl-2-octyldecanoate

Chemical formula: C ₂₆ H ₅₁ BrO ₂

Molecular weight: 475.596

[00281] The compound 8-bromooctan-2-yl-2-octyldecanoate was synthesized according to the general procedure of ( Z )-1-bromo-10-octyloctadec-8-ene. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.94 (m, 1H); 3.42 (t, 2H); 2.30 (m, 1H); 1.87 (m, 2H); 1.69-1.16 (m, 39H); 0.90 (m, 6H).

8-((2-Hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octan-2-yl 2-octyldecanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.209

[00282] Compound 234 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.61 min. MS (ESI): m/z (MH ⁺ ) 725.08 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.93 (m, 1H); 4.08 (t, 2H); 3.71 (broad m, 2H); 3.00-2.50 (broad m, 6H); 2.32 (m, 3H); 1.73-1.15(m, 65H); 0.90 (m, 9H).

FC. Compound 235: Heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)(3-propionamidopropyl)amino)octanoate

9-Hydroxydecylacetate

Chemical formula: C ₁₂ H ₂₄ O ₃

Molecular weight: 216.321

[00283] 9-Hydroxydecyl acetate was synthesized according to the general procedure for the synthesis of 8-hydroxyoctan-2-yldecanoate. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.07 (t, 2H); 3.80 (m, 1H); 2.07 (s, 3H); 1.76 (m, 2H); 1.54-1.16 (m, 16H).

10-Acetoxydecan-2-yl-6-hydroxyhexanoate

Chemical formula: C ₁₈ H ₃₄ O ₅

Molecular weight: 330.465

[00284] 10-Acetoxydecan-2-yl-6-hydroxyhexanoate was synthesized according to the general procedure for the synthesis of 8-hydroxyoctan-2-yldecanoate. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.07 (t, 2H); 3.80 (m, 1H); 2.07 (s, 3H); 1.76 (m, 2H); 1.76 (m, 2H); 1.54-1.42 (m, 8H); 1.41-1.17 (m, 16H).

10-Acetoxydecan-2-yl-6-bromohexanoate

Chemical formula: C ₁₈ H ₃₃ BrO ₄

Molecular weight: 393.362

[00285] 10-Acetoxydecan-2-yl-6-bromohexanoate was synthesized according to the general procedure for the synthesis of ( Z )-1-bromo-10-octyloctadec-8-ene. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.93 (m, 1H); 4.07 (t, 2H); 3.43 (t, 2H); 2.32 (t, 2H); 2.07 (s, 3H); 1.90 (m, 2H); 1.76-1.42 (m, 8H); 1.41-1.17 (m, 13H).

Heptadecan-9-yl-8-((6-((10-acetoxydecan-2-yl)oxy)-6-oxohexyl)(2-hydroxyethyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₇ NO ₇

Molecular weight: 754.191

[00286] Compound 235 was synthesized according to the general procedure and illustrative example of procedure 1 described above. UHPLC/DSIO: RT=3.33 min. MS (ESI): m/z (MH ⁺ ) 755.10 for C ₄₅ H ₈₇ NO ₇ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 2H); 4.07 (t, 2H); 3.56 (m, 2H); 2.67-2.41 (m, 6H); 2.30 (t, 4H); 2.07 (s, 3H); 1.73-1.08(m, 61H); 0.90 (m, 6H).

F.D. Compound 236: Heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)(3-propionamidopropyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₅

Molecular weight: 779.29

[00287] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (160 mg, 0.22 mmol) and triethylamine (95 µl, 0. 66 mmol) propionyl chloride (30 μl, 0.33 mmol) was added dropwise to 5 ml dry DCM at 0°C. After 30 minutes, the cooling bath was removed and the solution was stirred at room temperature. pace. for 30 minutes, after which, according to LC/MS, no starting amine remained. The mixture was diluted with a 50% aqueous saturated sodium hydrogen carbonate solution and extracted twice with DCM. The organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-50% (1% NH4OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)( 3-propionamidopropyl) amino) octanoate (90 mg, 0.12 mmol, 52%) as a colorless oil. UHPLC/DSIO: RT=3.59 min. MS (ESI): m/z (MH+) 780.1 for C ₄₈ H ₉₄ N ₂ O ₅ . 1H NMR (300 MHz, CDCl3) δ: ppm 7.29 (br. s, 1H); 4.86 (quint, 1H, J=12.4 Hz, 5.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.34 (q.t., 2H, J=11.3 Hz, 5.9 Hz); 2.63-2.33 (m, 6H); 2.31-2.25 (m, 4H); 2.16 (Q, 2H, J=15.1 Hz, 7.6 Hz); 1.61 (br. t., 8H, J=6.8 Hz); 1.55-1.38 (broad m, 9H); 1.35-1.20 (broad m, 47H); 1.14 (t, 3H, J=7.6 Hz); 0.87 (t, 9H, J=6.4 Hz).

F.E. Compound 244: Heptadecan-9-yl-8-((2-acetamidoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Heptadecan-9-yl-8-((2-((tert-butoxycarbonyl)amino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₆

Molecular weight: 809.32

[00288] To a solution of heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate

(1.0 g, 1.5 mmol) and N-Boc-glycinal (0.36 g, 2.25 mmol) in 10 ml dry THF was added MgSO ₄ (approximately 0.5 g, excess) and the white mixture was stirred at room pace. within 30 minutes. To the mixture was added sodium triacetoxyborohydride (0.67 g, 3.0 mmol) in portions over five minutes, and the resulting mixture was stirred at room temperature. pace. during the night. According to LC/MS, no starting material remained, so the reaction mixture was quenched by the addition of approximately 5 ml of saturated aqueous sodium hydrogen carbonate. The resulting mixture was diluted with water, extracted three times with DCM, the organic phases were combined, washed once with water, dried (MgSO4), filtered and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-((tert-butoxycarbonyl)amino )ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (930 mg, 1.15 mmol, 77%) as a pale yellow oil. UHPLC/DSIO: RT=3.66 min. MS (ESI): m/z (MH+) 809.6 for C ₄₉ H ₉₆ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl3) δ: ppm 4.88 (quint, 1H, J=11.9 Hz, 6.0 Hz); 4.07 (t, 2H, J=6.7 Hz); 2.60-2.25 (m, 8H); 1.70-1.55 (m, 6H); 1.53-1.43 (m, 22H); 1.37-1.22 (m, 48H); 0.90 (t, 9H, J=6.8Hz)

Heptadecan-9-yl-8-((2-aminoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₄ H ₈₈ N ₂ O ₄

Molecular weight: 709.20

[00289] To a solution of heptadecan-9-yl-8-((2-((tert-butoxycarbonyl)amino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (820 mg, 1.0 mmol) in 20 ml DCM at 0°C was added a 4N solution of HCl in 1,4-dioxane (2.5 ml, 10 mmol), the resulting yellow solution was left to warm to room. pace. and stirred for three hours, after which, according to LC/MS, no starting material remained. The red/brown solution was diluted with DCM and washed with a 1:1 mixture of saturated aqueous sodium hydrogen carbonate and saturated aqueous sodium chloride. The phases were separated and the aqueous phase was extracted twice with DCM. The organic phases were combined, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a brown oil. This was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-aminoethyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate (520 mg, 0.73 mmol, 72%) as a brown oil. UHPLC/DSIO: RT=3.15 min. MS (ESI): m/z (MH+) 709.5 for C ₄₄ H ₈₈ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J=12.4 Hz, 5.9 Hz); 4.05 (t, 2H, J=6.7 Hz); 2.74 (t, 2H, J=6.0 Hz); 2.52-2.35 (m, 5H); 2.31-2.25 (m, 4H); 1.75-1.67 (br. s, 5H); 1.61 (br. t., 6H, J=6.8 Hz); 1.55-1.37 (broad m, 8H); 1.36-1.16 (broad m, 46H); 0.88 (t, 9H, J=6.1 Hz).

Heptadecan-9-yl-8-((2-acetamidoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₀ N ₂ O ₅

Molecular weight: 751.24

[00290] To a solution of heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate (1.0 g, 1.5 mmol) and N-Boc-glycinal (0.36 g , 2.25 mmol) in 10 ml of dry THF was added MgSO ₄ (approximately 0.5 g, excess) and the white mixture was stirred at room. pace. within 30 minutes. To the mixture was added sodium triacetoxyborohydride (0.67 g, 3.0 mmol) in portions over five minutes, and the resulting mixture was stirred at room temperature. pace. during the night. According to LC/MS, no starting material remained, so the reaction mixture was quenched by the addition of approximately 5 ml of saturated aqueous sodium hydrogen carbonate. The resulting mixture was diluted with water, extracted three times with DCM, the organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-((tert-butoxycarbonyl)amino )ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (930 mg, 1.15 mmol, 77%) as a pale yellow oil. UHPLC/DSIO: RT=3.66 min. MS (ESI): m/z (MH+) 809.6 for C ₄₉ H ₉₆ N ₂ O ₆ . 1H NMR (300 MHz, CDCl3) δ: ppm 4.88 (quint, 1H, J=11.9 Hz, 6.0 Hz); 4.07 (t, 2H, J=6.7 Hz); 2.60-2.25 (m, 8H); 1.70-1.55 (m, 6H); 1.53-1.43 (m, 22H); 1.37-1.22 (m, 48H); 0.90 (t, 9H, J=6.8Hz)

F.F. Compound 246: Heptadecan-9-yl-8-((2-(methylsulfonamido)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₉₀ N ₂ O ₆ S

Molecular weight: 787.28

[00291] Triethylamine ( 63 μl, 0.45 mmol) and the solution was cooled to 0 ^o C. To it was added methanesulfonyl chloride (24 μl, 0.32 mmol), the solution was left to warm to room. pace. and stirred for four hours. According to LC/MS no starting material remained, so the solution was diluted with DCM, washed once with a 50% aqueous saturated sodium hydrogen carbonate solution, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-40% (1% NH4OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((2-(methylsulfonamido)ethyl)(8-( nonyloxy)-8-oxooctyl)amino)octanoate (130 mg, 0.165 mmol, 73%) as a yellow oil. UHPLC/DSIO: RT=3.48 min. MS (ESI): m/z (MH+) 787.6 for C ₄₅ H ₉₀ N ₂ O ₆ S. 1H NMR (300 MHz, CDCl3) δ: ppm 4.86 (quint, 1H, J=12.4 Hz, 5.2 Hz); 4.05 (t, 2H, J=6.8 Hz); 3.14 (br. s, 2H); 2.95 (s, 3H); 2.61 (br. s, 2H); 2.42 (br. s, 3H); 2.32-2.25 (m, 4H); 1.61 (br. t., 6H, J=7.0 Hz); 1.55-1.38 (m, 8H); 1.37-1.14 (m, 50H); 0.88 (t, 9H, J=6.1 Hz).

FG. Compound 247: Heptadecan-9-yl-(Z)-8-((2-(2-cyano-3,3-dimethylguanidino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₃ N ₅ O ₄

Molecular weight: 804.30

[00292] Triethylamine was added to a solution of heptadecan-9-yl-8-((2-aminoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (160 mg, 0.23 mmol) in 4 ml of 2-propanol (31 μl, 0.23 mmol) followed by the addition of diphenylcyanocarbonimidate (54 mg, 0.23 mmol) and the white mixture was stirred at room temperature. pace. within two hours after which it turned into a colorless solution. According to LC/MS, no starting material remained and only monophenylcarbamimidate (MW=853.3) was observed. To this was added a 2M solution of dimethylamine in methanol (1.1 ml, 2.2 mmol), the resulting pale yellow solution was heated to 55° C. and stirred for 20 hours, after which, according to LC/MS, no carbamimidate intermediate remained. The reaction mixture was left to cool to room. temp., concentrated, the residue was dissolved in DCM, washed twice with saturated aqueous sodium hydrogencarbonate solution, dried (MgSO ₄ ), filtered and the filtrate was concentrated to obtain a yellow oil. This was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-((2-(2- cyano-3,3-dimethylguanidino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (75 mg, 0.09 mmol, 41%) as a colorless oil. UHPLC/DSIO: RT=3.46 min. MS (ESI): m/z (MH+) 804.6 for C ₄₈ H ₉₃ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.80 (br. s, 1H); 4.86 (quint, 1H, J=12.5 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.60 (br. s, 2H); 3.01 (s, 6H); 2.59 (br. s, 2H); 2.40 (br. s, 3H); 2.32-2.25 (m, 4H); 1.68-1.45 (m, 12H); 1.38-1.12 (m, 51H); 0.88 (t, 9H, J=6.0 Hz).

FH. Compound 251: Heptadecan-9-yl-8-((3-((2-amino-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl) amino)octanoate

Chemical formula: C ₄₉ H ₉₁ N ₃ O ₆

Molecular weight: 818.28

[00293] 3-Amino -4-methoxycyclobut-3-ene-1,2-dione [JACS, 88(7), 1533-1536 (1966)] (35 mg, 0.28 mmol), the resulting colorless solution was heated to 40°C and stirred in for 20 hours, after which, according to LC/MS, no starting amine remained. The solution was concentrated in vacuo and the residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(( 2-amino-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (175 mg, 0.21 mmol, 77%) as resinous white solid. UHPLC/DSIO: RT=3.38 min. MS (ESI): m/z (MH+) 818.6 for C ₄₉ H ₉₁ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.43 (br. s, 1H); 4.85 (quint, 1H, J=12.6 Hz, 5.8 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.65 (br. s, 2H); 2.78-2.38 (m, 5H); 2.29 (m, 4H); 1.84 (br. s, 2H); 1.68-1.41 (m, 14H); 1.40-1.14 (m, 51H); 0.88 (t, 9H, J=6.0 Hz).

F.I. Compound 252: Heptadecan-9-yl-8-((3-(2-(methylthio)acetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₅ S

Molecular weight: 811.35

[00294] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (1.0 g, 1.38 mmol) and (methylthio)acetic acid (Matrix Scientific, Columbia, SC) (150 µl, 1.66 mmol) 4-(dimethylamino)pyridine (42 mg, 0.35 mmol) was added to 20 ml dry DCM followed by the addition of 1-[bis(dimethylamino)methylene ]-1H-1,2,3-triazolo[4,5-b]pyridinium-3-oxide hexafluorophosphate (HATU; 790 mg, 2.1 mmol) and finally N,N-diisopropylethylamine (740 µl, 4, 1 mmol) and the resulting mixture was stirred at room temperature. pace. during the night. According to LC/MS, no starting amine remained, so the yellow solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered, and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-50% methanol in DCM) to give heptadecan-9-yl-8-((3-(2-(methylthio)acetamido)propyl)(8-(nonyloxy)-8-oxooctyl )amino)octanoate (1.0 g, 1.23 mmol, 89%) as a yellow oil. UHPLC/DSIO: RT=3.54 min. MS (ESI): m/z (MH+) 811.56 for C ₄₈ H ₉₄ N ₂ O ₅ S. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.79 (br. s, 1H); 4.86 (quint, 1H, J=12.5 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.40 (br. s, 2H); 3.17 (s, 2H); 2.96 (br. s, 2H); 2.66-2.34 (broad m, 3H); 2.28 (m, 4H); 2.15 (s, 3H); 1.88-1.41 (m, 16H); 1.39-1.18 (broad m, 49H); 0.88 (t, 9H, J=5.8 Hz).

FJ. Compound 255: Heptadecan-9-yl-8-((4-acetamidobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Benzyl-(4,4-diethoxybutyl)carbamate

Chemical formula: C ₁₆ H ₂₅ NO ₄

Molecular weight: 295.38

[00295] To a solution of 4-aminobutanal diethyl acetal (Aldrich, St. Louis, MO) (1 g, 6.2 mmol) in 25 ml of ether was added 25 ml of water, followed by the addition of potassium carbonate (2.6 g, 18.6 mmol ) and the resulting colorless two-phase solution was cooled to 0°C with vigorous stirring. Benzyl chloroformate (0.88 mL, 6.2 mmol) was added dropwise thereto over ten minutes and the resulting mixture was allowed to slowly warm to room temperature. pace. during the night. The phases were separated and the aqueous phase was extracted with ether. The organic phases were combined, washed twice with 10% aqueous citric acid, then with saturated aqueous sodium chloride, dried (MgSO4), filtered, and the filtrate was concentrated to give a colorless oil. It was purified by silica gel chromatography (0-50% EtOAc in hexanes) to give benzyl (4,4-diethoxybutyl) carbamate (1.56 g, 5.3 mmol, 85%) as a colorless oil. 1H NMR (300 MHz, CDCl3) δ: ppm 7.32 (m, 5H); 5.09 (s, 2H); 4.88 (s, 1H); 4.48 (t, 2H, J=5.3 Hz); 3.70-3.55 (m, 2H); 3.54-3.40 (m, 2H); 3.22 (q.t.; 2H, J=12.5 Hz, 6.2 Hz); 1.71-1.51 (m, 4H); 1.20 (t, 6H, J=7.0 Hz).

Benzyl-(4-oxobutyl)carbamate

Chemical formula: C ₁₂ H ₁₅ NO ₃

Molecular weight: 221.26

[00296] To a solution of benzyl-(4,4-diethoxybutyl)carbamate (1.56 g, 5.3 mmol) in 25 ml of acetogen was added 1N aqueous HCl solution (25 ml, 25 mmol) to obtain a cloudy mixture, which quickly became transparent. It was stirred at rt. pace. overnight, after which, according to TLC, no starting acetal remained. The solution was extracted twice with Et ₂ O, the organic phases were mixed, washed once with saturated aqueous sodium hydrogen carbonate, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a colorless oil. It was purified by silica gel chromatography ( 0-50% EtOAc in hexanes) to give benzyl (4-oxobutyl) carbamate (0.82 g, 5.3 mmol, 70%) as a colorless liquid. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.36 (m, 5H); 5.52 (br. d, 1H, J=12.0 Hz); 5.15 (s, 2H); 3.68-3.52 (m, 1H); 3.44-3.30 (m, 1H); 2.18-1.79 (m, 4H) (aldehyde proton not observed).

Heptadecan-9-yl-8-((4-(((benzyloxy)carbonyl)amino)butyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₄ H ₉₈ N ₂ O ₆

Molecular weight: 871.39

[00297] To a solution of heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate (1.65 g, 2.5 mmol) and benzyl-(4-oxobutyl)carbamate (0 ,82 g, 3.71 mmol) in 15 ml of dry THF was added anhydrous MgSO ₄ (approximately 0.5 g, excess) and the white mixture was stirred at room. pace. within 30 minutes. Sodium triacetoxyborohydride (1.1 g, 4.9 mmol) was added portionwise to the mixture over five minutes, and the resulting white mixture was stirred at room temperature. pace. during the night. According to LC/MS, no starting material remained, so the reaction mixture was quenched by the addition of approximately 5 ml of saturated aqueous sodium hydrogen carbonate. The resulting mixture was diluted with water, extracted three times with DCM, the organic phases were combined, washed once with water, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((4-(((benzyloxy)carbonyl) amino)butyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (1.43 g, 1.64 mmol, 66%) as a pale yellow oil. UHPLC/DSIO: RT=3.54 min. MS (ESI): m/z (MH+) 871.52 for C54H98N2O6. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.34 (m, 5H); 5.51 (m, 1H); 5.15 (m, 2H); 5.09 (s, 2H); 4.86 (quint, 1H, J=12.3 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.8 Hz); 3.60 (m, 1H); 3.38 (m, 1H); 3.20 (br. d, 2H, J=3.8 Hz); 2.40 (br. s, 4H); 2.27 (m, 4H); 2.15-1.75 (m, 4H); 1.61 (br. t., 6H, J=6.3 Hz); 1.55-1.43 (m, 8H); 1.37-1.15 (m, 46H); 0.88 (t, 9H, J=5.8 Hz).

Heptadecan-9-yl-8-((4-aminobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₂ N ₂ O ₄

Molecular weight: 737.25

[00298] Heptadecan-9-yl-8-((4-(((benzyloxy)carbonyl)amino)butyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (1.42 g, 1.63 mmol ) was dissolved in 20 ml of ethanol with stirring to give a pale yellow solution. The reaction vessel was purged with nitrogen and 10% wt. palladium on charcoal (about 200 mg, cat.), the walls of the vessel were washed with 5 ml of ethanol, and the vessel was again purged with nitrogen. The flask was filled with a balloon of hydrogen, evacuated and filled three times with hydrogen. The resulting dark mixture was stirred at room temperature. pace. within five hours, after which, according to LC/MS, no starting material remained. The flask was purged with nitrogen, the mixture was filtered through Celite, the filtered solids were washed with ethanol, and the filtrate was concentrated to give a cloudy white oil. This was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((4-aminobutyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate (706 mg, 0.96 mmol, 59%) as a colorless oil. UHPLC/DSIO: RT=3.09 min. MS (ESI): m/z (MH+) 737.43 for C ₄₆ H ₉₂ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J=12.2 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 2.71 (t, 1H, J=6.4 Hz); 2.48-2.34 (m, 6H); 2.33-2.23 (m, 4H); 1.95 (br. s, 2H); 1.61 (br. t., 6H, J=6.6 Hz); 1.55-1.38 (m, 12H); 1.37-1.17 (m, 49H); 0.88 (t, 9H, J=5.9 Hz).

Heptadecan-9-yl-8-((4-acetamidobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₅

Molecular weight: 779.29

[00299] Triethylamine ( 125 µl, 0.9 mmol) and the solution was cooled to 0 ^o C. To it was added acetic anhydride (42 µl, 0.45 mmol) and the solution was left to warm to room. pace. with stirring overnight. According to LC/MS no starting material remained, so the solution was diluted with DCM, washed once with a 50% aqueous saturated sodium hydrogen carbonate solution, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((4-acetamidobutyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate (160 mg, 0.20 mmol, 69%) as a colorless oil. UHPLC/DSIO: RT=3.50 min. MS (ESI): m/z (MH+) 779.66 for C ₄₈ H ₉₄ N ₂ O ₅ . 1H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.33 (br. s, 1H); 4.86 (quint, 1H, J=12.3 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.23 (q.t., 2H, J=11.9 Hz, 6.1 Hz); 2.46-2.33(m, 5H); 2.32-2.22 (m, 4H); 1.95 (s, 3H); 1.68-1.56 (m, 6H); 1.54-1.36 (m, 12H); 1.35-1.15 (m, 49H); 0.87 (t, 9H, J=5.8 Hz).

F.K. Compound 256: 8-(Heptadecan-9-yloxy)-N-(3-(2-(methylsulfinyl)acetamido)propyl)-N-(8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1-amine oxide

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₇ S

Molecular weight: 843.35

FL. Compound 257: 8-(Heptadecan-9-yloxy)-N-(3-(2-(methylsulfonyl)acetamido)propyl)-N-(8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1-amine oxide

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₈ S

Molecular weight: 859.35

[00300] To a solution of heptadecan-9-yl-8-((3-(2-(methylthio)acetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (350 mg, 0.43 mmol) m-chloroperoxybenzoic acid (50% by weight; 300 mg, 0.84 mmol) was added in 5 ml DCM at 0° C. in one portion. The ice bath was removed and the resulting yellow solution was stirred at room temperature. pace. within 24 hours, after which, according to LC/MS, no starting material remained. The solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a pale yellow oil. It was purified by silica gel chromatography (0-75% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give two sets of fractions. The first set was concentrated to give 8-(heptadecan-9-yloxy)-N-(3-(2-(methylsulfonyl)acetamido)propyl)-N-(8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1 α-amine oxide (60 mg, 0.07 mmol, 16%) as a colorless oil. UHPLC/DSIO: RT=3.44 min. MS (ESI): m/z (MH+) 859.62 for C ₄₈ H ₉₄ N ₂ O ₈ S (Compound 257). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.95 (br. s, 1H); 4.86 (quint, 1H, J=12.3 Hz, 5.9 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.93 (s, 2H); 3.38 (br. d, 3H, J=5.2 Hz); 3.15 (m, 6H); 2.62-2.36 (m, 1H); 2.34-2.21 (m, 4H); 2.02 (t, 2H, J=6.1 Hz); 1.86-1.55 (m, 10H); 1.54-1.43 (m, 5H); 1.41-1.14 (m, 48H); 0.88 (t, 9H, J=6.0 Hz).

[00301] A second set of fractions was concentrated to give 8-(heptadecan-9-yloxy)-N-(3-(2-(methylsulfinyl)acetamido)propyl)-N-(8-(nonyloxy)-8-oxooctyl)-8 α-oxooctane-1-amine oxide (75 mg, 0.09 mmol, 20%) as a waxy white solid. UHPLC/DSIO: RT=3.42 min. MS (ESI): m/z (MH+) 843.71 for C ₄₈ H ₉₄ N ₂ O ₇ S (Compound 256). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 10.15 (br. s, 1H); 4.86 (quint, 1H, J=12.5 Hz, 6.3 Hz); 4.05 (t, 2H, J=6.6 Hz); 3.57 (m, 2H); 3.44-3.25 (m, 3H); 3.14 (t, 3H, J=8.2 Hz); 2.72 (s, 3H); 2.54-2.34 (m, 1H); 2.33-2.24 (m, 4H); 2.04 (t, 2H, J=5.6 Hz); 1.88-1.71 (m, 2H); 1.69-1.55 (m, 8H); 1.54-1.43 (m, 4H); 1.41-1.14 (m, 49H); 0.88 (t, 9H, J=6.0 Hz).

FM. Compound 258: Heptadecan-9-yl-8-((3-(2-(methylsulfinyl)acetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆ S

Molecular weight: 827.35

[00302] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400mg, 0.55mmol) and methanesulfinylacetic acid [J. Med. Chem., 38(3), 508-525 (1995)] (81 mg, 0.66 mmol) 4-(dimethylamino)pyridine (17 mg, 0.14 mmol) was added to 10 ml dry DCM followed by the addition of 1- [bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium-3-oxide hexafluorophosphate (HATU; 315 mg, 0.83 mmol) and finally N,N-diisopropylethylamine was added (300 μl, 1.66 mmol) and the resulting mixture was stirred at room temperature. pace. during the night. According to LC/MS, no starting amine remained, so the dark orange solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered, and the filtrate was concentrated to give a dark yellow oil. This was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-(methylsulfinyl)acetamido ) propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (190 mg, 0.23 mmol, 41%) as a yellow oil. UHPLC/DSIO: RT=3.44 min. MS (ESI): m/z (MH+) 827.56 for C ₄₈ H ₉₄ N ₂ O ₆ S. ¹ H NMR (300 MHz, CDCl3) δ: ppm 7.74 (br. s, 1H); 4.86 (quint, 1H, J=12.5 Hz, 6.1 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.60 (d, 1H, J=13.7 Hz); 3.36 (m, 3H); 2.71 (s, 3H); 2.60-2.48 (br. s, 2H); 2.47-2.34 (br. s, 3H); 2.28 (m, 4H); 1.76-1.55 (m, 8H); 1.54-1.38 (m, 8H); 1.37-1.15 (broad m, 49H); 0.88 (t, 9H, J=5.9 Hz).

F.N. Compound 259: Heptadecan-9-yl-(Z)-8-((4-(2-cyano-3,3-dimethylguanidino)butyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₇ N ₅ O ₄

Molecular weight: 832.36

[00303] Triethylamine was added to a solution of heptadecan-9-yl-8-((4-aminobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (235 mg, 0.32 mmol) in 4 ml of 2-propanol (44 μl, 0.32 mmol) followed by the addition of diphenylcyanocarbonimidate (76 mg, 0.32 mmol) and the white mixture was stirred at room temperature. pace. within ninety minutes after which it became a clear solution. According to LC/MS no starting material remained and only monophenylcarbamimidate (MW=881.4) was observed. To this was added a 2M solution of dimethylamine in methanol (1.6 ml, 3.2 mmol), the resulting pale yellow solution was heated to 55°C and stirred for 20 hours, after which, according to LC/MS, no carbamimidate intermediate remained. The reaction mixture was left to cool to room. temp., concentrated, the residue was dissolved in DCM, washed twice with saturated aqueous sodium hydrogencarbonate solution, dried (MgSO ₄ ), filtered and the filtrate was concentrated to obtain a yellow oil. This was purified by silica gel chromatography (0-60% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-((4-(2- cyano-3,3-dimethylguanidino)butyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (130 mg, 0.16 mmol, 49%) as a colorless oil. UHPLC/DSIO: RT=3.43 min. MS (ESI): m/z (MH+) 832.48 for C ₅₀ H ₉₇ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.50 (br. s, 1H); 4.86 (quint, 1H, J=12.2 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.48 (q.t., 2H, J=11.4 Hz, 5.7 Hz); 3.02 (s, 6H); 2.49 (br. s, 6H); 2.32-2.22 (m, 4H); 1.70-1.55 (m, 8H); 1.54-1.45 (m, 6H); 1.44-1.15 (m, 52H); 0.87 (t, 9H, J=5.8 Hz).

F.O. Compound 260: Heptadecan-9-yl-(Z)-8-((3-(3,3-dimethyl-2-sulfamoylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Diphenylsulfamoylcarbonimidate

Chemical formula: C ₁₃ H ₁₂ N ₂ O ₄ S

Molecular weight: 292.31

[00304] Sulfamide (0.72 g, 7.4 mmol) was added to a solution of dichlorodiphenoxymethane (1 g, 3.7 mmol) in 10 ml of dry acetonitrile under nitrogen atmosphere and the pale yellow mixture was stirred at room temperature. pace. within 72 hours. The resulting mixture was concentrated, the residue was triturated with DCM, filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-60% EtOAc in hexanes) to give diphenyl sulfamoylcarbonimidate (295 mg, 1.01 mmol, 27%) as a colorless oil which solidified to a translucent white solid on standing. UHPLC/DSIO: RT=0.31 min. MS (ESI): m/z (M-SO ₂ NH ₂ ) 213.97 for C ₁₃ H ₁₂ N ₂ O ₄ S. ¹ H NMR (300 MHz, DMSO-d6) δ: ppm 7.54-7.29 (dt, 10H, J=44.5 Hz, 7.5 Hz); 7.19 (s, 2H).

Heptadecan-9-yl-(Z)-8-((3-(3,3-dimethyl-2-sulfamoylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₇ N ₅ O ₆ S

Molecular weight: 872.39

[00305] Triethylamine was added to a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) in 5 ml of 2-propanol (48 μl, 0.35 mmol) followed by the addition of diphenylsulfamoylcarbonimidate (101 mg, 0.35 mmol) and the mixture was stirred at room temperature. pace. for two hours, after which LC/MS starting material was gone and the only peak observed was that of the monophenylcarbamimidate intermediate (MW=921.4). A 2M solution of dimethylamine in methanol (1 ml, 2 mmol) was added to the reaction mixture, and the resulting pale yellow solution was heated to 55° C. for 18 hours. The reaction was complete according to LC/MS, so the solution was evaporated in vacuo, diluted with DCM and washed once with saturated aqueous sodium hydrogen carbonate. The organic phase was dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a hazy pale yellow oil. This was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-((3-(3, 3-dimethyl-2-sulfamoylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (155 mg, 0.18 mmol, 51%) as a yellowish syrup. UHPLC/DSIO: RT=3.34 min. MS (ESI): m/z (MH+) 872.58 for C ₄₈ H ₉₇ N ₅ O ₆ S. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.02 (br. s, 1H); 4.86 (quint, 1H, J=12.4 Hz, 6.4 Hz); 4.48 (br. s, 2H); 4.05 (t, 2H, J=6.7 Hz); 3.36 (q.t., 2H, J=11.5 Hz, 5.5 Hz); 2.97 (s, 6H); 2.54 (br. s, 2H); 2.41 (br. s, 3H); 2.28 (m, 4H); 1.79-1.68 (m, 2H); 1.67-1.55 (m, 6H); 1.54-1.45 (m, 4H); 1.44-1.37 (m, 2H); 1.36-1.14 (m, 51H); 0.87 (t, 9H, J=5.8 Hz).

FP. Compound 261: Heptadecan-9-yl-8-((3-hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₉ NO ₅

Molecular weight: 724.21

[00306] To a solution of heptadecan-9-yl-8-((3-hydroxypropyl)amino)octanoate (740mg, 1.62mmol) and undecyl 6-bromohexanoate (570mg (1.62mmol) in 16ml dry acetonitrile Potassium iodide (300 mg, 1.79 mmol) was added under nitrogen atmosphere followed by the addition of powdered potassium carbonate (900 mg, 6.5 mmol) and the mixture was diluted with 4 ml of dry cyclopentyl methyl ether.The resulting white mixture was heated to 90°C and stirred in for 24 hours, then left to cool to room temperature, filtered, the filtered solids were washed with DCM and the filtrate was concentrated.The residue was suspended in 50% saturated aqueous sodium hydrogen carbonate solution and extracted twice with DCM.The organic phases were combined, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil It was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3 -hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (780 mg, 1.08 mmol, 66%) as a yellowish oil. UHPLC/DSIO: RT=3.55 min. MS (ESI): m/z (MH+) 724.39 for C ₄₅ H ₈₉ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.60 (br. s, 1H); 4.86 (quint, 1H, J=12.2 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.78 (t, 2H, J=4.9 Hz); 2.62 (t, 2H, J=5.2 Hz); 2.40 (quint, 4H, J=8.3 Hz, 5.2 Hz); 2.28 (q.t., 4H, J=15.0 Hz, 7.7 Hz); 1.73-1.55 (m, 8H); 1.54-1.39 (m, 8H); 1.38-1.12 (m, 48H); 0.87 (t, 9H, J=5.9 Hz).

F.Q. Compound 263: Heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Heptadecan-9-yl-8-((3-chloropropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₈ ClNO ₄

Molecular weight: 742.65

[00307] To a solution of heptadecan-9-yl-8-((3-hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (700mg, 0.97mmol) and triethylamine (202µl, 1 .45 mmol) in dry DCM at 0°C was added methanesulfonyl chloride (90 μl, 1.16 mmol) and the resulting solution was allowed to warm to room. pace. overnight, after which, according to LC/MS, no starting material remained. The solution was diluted with DCM, washed once with saturated aqueous sodium hydrogen carbonate, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give heptadecan-9-yl-8-((3-chloropropyl)(6- oxo-6-(undecyloxy)hexyl)amino)octanoate (720 mg ˜quant) as a pale yellow oil/solid, which according to ¹ H-NMR contained some mesylate. The material was used without additional purification. UHPLC/DSIO: RT=3.61 min. MS (ESI): m/z (M-Cl) 706.68 for C ₄₅ H ₈₈ ClNO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J=12.1 Hz, 5.9 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.59 (t, 2H, J=6.5 Hz); 2.51 (t, 2H, J=6.8 Hz); 2.40-2.23 (m, 7H); 1.86 (t, 2H, J=6.0 Hz); 1.70-1.45 (m, 12H); 1.44-1.37 (m, 4H); 1.36-1.15 (m, 47H); 0.88 (t, 9H, J=5.9 Hz).

Heptadecan-9-yl-8-((3-azidopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₈ N ₄ O ₄

Molecular weight: 749.22

[00308] To a solution of heptadecan-9-yl-8-((3-chloropropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (720 mg, 0.97 mmol) in 10 ml dry DMF in a jar Pyrex high pressure was added with sodium azide (250 mg, 3.9 mmol), the vessel was purged with nitrogen and closed with a Teflon screw cap. The reaction mixture was heated to 100°C and stirred overnight, after which, according to TLC, no starting chloride remained. The reaction mixture was left to cool to room. temp., the solution was diluted with water and was extracted 3x with a mixture of hexanes. The organic phases were combined, washed once with water, water, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered, and the filtrate was concentrated to give a pale yellow oil. This was purified by silica gel chromatography (0-20% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-azidopropyl)(6-oxo- 6-(undecyloxy)hexyl)amino)octanoate (550 mg, 0.73 mmol, 75%) as a yellow oil. UHPLC/DSIO: RT=3.61 min. MS (ESI): m/z (MH+) 749.32 for C ₄₅ H ₈₈ N ₄ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J=12.5 Hz, 6.2 Hz); 4.06 (t, 2H, J=6.7 Hz); 3.33 (t, 2H, J=6.4 Hz); 2.46 (t, 2H, J=6.3 Hz); 2.42-2.34 (m, 3H); 2.28 (Q, 4H, J=14.3 Hz, 7.1 Hz); 1.77-1.55 (m, 8H); 1.54-1.38 (m, 8H); 1.37-1.14 (m, 49H); 0.88 (t, 9H, J=5.7 Hz).

Heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₅ H ₉₀ N ₂ O ₄

Molecular weight: 723.23

[00309] A flask containing a stirred dispersion of heptadecan-9-yl-8-((3-azidopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (550mg, 0.73mmol) in 8ml ethanol purged with nitrogen and added 10% wt. palladium on charcoal (about 50 mg, cat.) to give a black mixture. The walls of the vessel were washed off with 2 ml of ethanol and the flask was again purged with nitrogen. The flask was filled with a balloon of hydrogen, evacuated and filled three times with hydrogen and stirred at room temperature. pace. within two hours, after which, according to LC/MS, no starting azide remained. The flask was purged with nitrogen, the mixture was filtered through Celite, the filtered solids were washed with ethanol, and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-aminopropyl)(6-oxo- 6-(undecyloxy)hexyl)amino)octanoate (375 mg, 0.52 mmol, 71%) as a colorless oil. UHPLC/DSIO: RT=3.17 min. MS (ESI): m/z (MH+) 723.57 for C ₄₅ H ₉₀ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.91 (br. s, 2H); 4.86 (quint, 1H, J=12.3 Hz, 6.1 Hz); 4.05 (t, 2H, J=6.8 Hz); 3.06 (t, 2H, J=5.5 Hz); 2.65 (t, 2H, J=5.8 Hz); 2.48 (quint, 4H, J=9.7 Hz, 5.3 Hz); 2.29 (Q, 4H, J=17.1 Hz, 9.6 Hz); 1.89-1.72 (m, 2H); 1.70-1.55 (m, 6H); 1.54-1.39 (m, 8H); 1.38-1.13 (m, 48H); 0.87 (t, 9H, J=5.8 Hz).

Heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆

Molecular weight: 795.29

[00310] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (170mg, 0.23mmol) and triethylamine (100µl, 0 .7 mmol) in 4 ml of dry DCM at 0°C and methoxyacetyl chloride (32 μl, 0.35 mmol) was added dropwise, the resulting mixture was stirred and left to warm to room temperature. pace. during the night. According to LC/MS, no starting amine remained, so the yellow solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered, and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl) (6-oxo-6-(undecyloxy)hexyl)amino)octanoate (42 mg, 0.05 mmol, 22%) as a yellow oil. UHPLC/DSIO: RT=3.44 min. MS (ESI): m/z (MH+) 795.25 for C ₄₈ H ₉₄ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl3) δ: ppm 7.50 (s, 1H); 4.86 (quint, 1H, J=12.0 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.87 (s, 2H); 3.40 (m, 5H); 2.98 (br. s, 1H); 2.54-2.34 (m, 4H); 2.28 (quad, 4H, J=14.7 Hz, 7.4 Hz); 1.69-1.39 (m, 14H); 1.38-1.13 (m, 51H); 0.88 (t, 9H, J=5.9 Hz).

F.R. Compound 264: Heptadecan-9-yl-8-((3-(2-ethoxyacetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₆

Molecular weight: 809.32

[00311] Compound 264 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400 mg, 0.55 mmol) analogously to compound 178 except that that ethoxyacetyl chloride (Alfa Aesar, Tewkesbury, MA) (92 µl, 0.83 mmol) was used instead of methoxyacetyl chloride. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2 -ethoxyacetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (140 mg, 0.55 mmol, 31%) as a yellow oil. UHPLC/DSIO: RT=3.51 min. MS (ESI): m/z (MH+) 809.43 for C ₄₉ H ₉₆ N ₂ O ₆ . 1H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.48 (s, 1H); 4.86 (quint, 1H, J=12.6 Hz, 6.1 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.91 (s, 2H); 3.55 (q.t., 2H, J=13.8 Hz, 7.0 Hz); 3.36 (d, 2H, J=5.8 Hz); 2.53-2.43 (m, 2H); 2.41-2.32 (broad m, 3H); 2.31-2.23 (m, 4H); 1.70-1.56 (m, 8H); 1.55-1.37 (m, 8H); 1.36-1.14 (m, 52H); 0.88 (t, 9H, J=7.5 Hz).

F.S. Compound 265: Heptadecan-9-yl-(Z)-8-((3-(2-cyano-3,3-dimethylguanidino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₅ N ₅ O ₄

Molecular weight: 818.33

[00312] Compound 265 was prepared analogously to compound 168 except that heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (170 mg, 0. 23 mmol). After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-(( 3-(2-cyano-3,3-dimethylguanidino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (40 mg, 0.05 mmol, 21%) as a colorless syrup. UHPLC/DSIO: RT=3.52 min. MS (ESI): m/z (MH+) 818.78 for C ₄₉ H ₉₅ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.52 (br. s, 1H); 4.86 (quint, 1H, J=12.6 Hz, 6.3 Hz); 4.06 (t, 2H, J=6.7 Hz); 3.68 (d, 2H, J=4.3 Hz); 3.00 (s, 6H); 2.59 (br. s, 2H); 2.44 (br. s, 3H); 2.29 (q.t., 4H, J=13.4 Hz, 7.1 Hz); 1.80-1.58 (m, 8H); 1.56-1.38 (m, 6H); 1.37-1.13 (m, 51H); 0.88 (t, 9H, J=5.9 Hz).

FT. Compound 267: Heptadecan-9-yl-8-((3-(2-methoxypropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₆

Molecular weight: 809.32

[00313] Compound 267 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (300 mg, 0.42 mmol) analogously to compound 252 except that that 2-methoxypropanoic acid (Ark Pharm, Arlington Heights, IL) (66 mg, 0.62 mmol) was used instead of (methylthio)acetic acid. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2 -methoxypropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (45 mg, 0.06 mmol, 54%) as a yellowish oil. UHPLC/DSIO: RT=3.48 min. MS (ESI): m/z (MH+) 809.60 for C ₄₉ H ₉₆ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.43 (s, 1H); 4.86 (quint, 1H, J=12.2 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.71 (q.t., 1H, J=13.4 Hz, 6.7 Hz); 3.36 (m, 5H); 2.58-2.47 (m, 2H); 2.45-2.35 (m, 3H); 2.34-2.24 (m, 4H); 1.76-1.41 (m, 16H); 1.40-1.15 (m, 52H); 0.87 (t, 9H, J=5.7 Hz).

FU. Compound 268: Heptadecan-9-yl-8-((3-(2-methoxy-2-methylpropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₈ N ₂ O ₆

Molecular weight: 823.34

[00314] Compound 268 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 252 except that that 2-methoxy-2-methylpropanoic acid (Enamine, Monmouth Junction, NJ) (63 mg, 0.52 mmol) was used instead of (methylthio)acetic acid. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2 -methoxy-2-methylpropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (35 mg, 0.04 mmol, 12%) as a yellowish oil. UHPLC/DSIO: RT=3.58 min. MS (ESI): m/z (MH+) 823.62 for C ₅₀ H ₉₈ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.96 (s, 1H); 7.49 (t, 1H, J=6.7 Hz); 4.86 (quint, 1H, J=12.1 Hz, 6.1 Hz); 4.07 (t, 2H, J=6.6 Hz); 3.44-3.37 (m, 5H); 3.20-2.98 (m, 5H); 2.37-2.26 (m, 4H); 2.17-2.02 (m, 2H); 1.80-1.69 (m, 3H); 1.68-1.60 (m, 6H); 1.57-1.47 (m, 4H); 1.46-1.17 (m, 55H); 0.90 (t, 9H, J=5.9 Hz).

F.V. Compound 269: 6-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)hexylhexylsuccinate

4-(Hexyloxy)-4-oxobutanoic acid

Chemical formula: C ₁₀ H ₁₈ O ₄

Molecular weight: 202.25

[00315] A suspension of succinic anhydride (5 g, 49.4 mmol) in 1-hexanol (6.3 ml, 49.4 mmol) was heated to 80°C and stirred for 20 hours after which it turned into a colorless solution. He was left to cool to room. temp., diluted with EtOAc, washed twice with 1N HCl solution, once with saturated aqueous sodium chloride solution, dried (Na ₂ SO ₄ ), filtered and the filtrate was concentrated to obtain 4-(hexyloxy)-4-oxobutanoic acid

(9.87 g, 48.8 mmol, 99%) as a colorless liquid which was used without further purification. ¹ H NMR (300 MHz MHz, CDCl ₃ ) δ: ppm 10.59 (br. s, 1H); 4.10 (Q, 2H, J=11.9 Hz, 5.2 Hz); 2.65 (m, 4H); 1.62 (quint, 2H, J=13.0 Hz, 6.9 Hz); 1.30 (m, 6H); 0.89 (t, 3H, J=6.7 Hz) (carboxyl group proton not observed).

6-Bromohexylhexyl succinate

Chemical formula: C ₁₆ H ₂₉ BrO ₄

Molecular weight: 365.31

[00316] To a solution of 4-(hexyloxy)-4-oxobutanoic acid (1.0 g, 4.9 mmol) and 6-bromo-1-hexanol (0.75 ml, 5.2 mmol) in 20 ml dry DCM 1-ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (1.67 g, 7.4 mmol) was added under nitrogen, followed by 4-(dimethylamino)pyridine (0.3 g, 2.47 mmol) and finally added N,N-diisopropylethylamine (2.6 ml, 14.8 mmol) to give a pale yellow solution. It was stirred at rt. pace. within 24 hours, after which LC/MS indicated that no starting material remained. The solution was diluted with DCM, washed once with saturated aqueous sodium hydrogen carbonate (thick emulsion), dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a colorless liquid/white solid mixture. This was purified by silica gel chromatography (0-25% EtOAc in hexanes) to give 6-bromohexylhexyl succinate (0.92 g, 2.5 mmol, 51%) as a pale yellow oil. 1H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.11-4.06 (m, 4H); 3.41 (t, 2H, J=6.7 Hz); 2.62 (s, 4H); 1.87 (quint, 2H, J=13.9 Hz, 7.2 Hz); 1.69-1.57 (m, 4H); 1.50-1.30 (m, 10H); 0.89 (t, 3H, J=6.3 Hz).

6-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)hexylhexylsuccinate

Chemical formula: C ₄₃ H ₈₃ NO ₇

Molecular weight: 726.14

[00317] To a solution of heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (300mg, 0.61mmol) and 6-bromohexylhexylsuccinate (223mg (0.61mmol) in 8ml dry acetonitrile in potassium iodide (115 mg, 0.68 mmol) was added under nitrogen atmosphere followed by the addition of powdered potassium carbonate (340 mg, 2.4 mmol) and the mixture was diluted with 2 ml of dry cyclopentyl methyl ether.The resulting white mixture was heated to 90°C and stirred for 24 hours, then left to cool to room temperature, filtered, the solids on the filter were washed with DCM and the filtrate was concentrated.The residue was suspended in 50% saturated aqueous sodium hydrogen carbonate solution and extracted twice with DCM.The organic phases were combined, dried (MgSO ₄ ), filtered and the filtrate concentrated to give a yellow oil This was purified by silica gel chromatography (0-30% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give 6-((8-(heptadecan-9-yloxy) -8-oxooctyl)(2-hydroxyethyl)amino)hexylhexylsuccinate (40 mg, 0.06 mmol, 9%) as a colorless oil. UHPLC/DSIO: RT=3.15 min. MS (ESI): m/z (MH+) 726.36 for C ₄₃ H ₈₃ NO ₇ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J=12.2 Hz, 6.1 Hz); 4.08 (t, 4H, J=6.6 Hz); 3.52 (t, 2H, J=5.0 Hz); 2.96 (br. s, 1H); 2.62 (s, 4H); 2.57 (t, 2H, J=4.9 Hz); 2.44 (t, 4H, J=6.4 Hz); 2.27 (t, 2H, J=7.4 Hz); 1.70-1.56 (m, 6H); 1.54-1.37 (m, 8H); 1.36-1.15 (m, 40H); 0.87 (t, 9H, J=5.9 Hz).

F.W. Compound 238: Heptadecan-9-yl-8-((4-(dimethylamino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₅

Molecular weight: 779.29

[00318] To a solution of 4-bromobutanoyl chloride (1.6 g, 8.62 mmol) in 15 ml dry THF was cooled to -15°C, a 2M solution of dimethylamine in THF (12 ml, 24 mmol) was added, the resulting mixture was stirred and left to warm to room temp. The precipitated solids were removed by filtration and the filtrate was concentrated to give crude 4-bromo-N,N-dimethylbutanamide. This was dissolved in 20 ml of 1:1 acetonitrile/methylcyclopentyl ether, heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate (1g, 1.5mmol), potassium carbonate was added (0.8 g, 6 mmol), potassium iodide (0.3 g, 1.8 mmol), the mixture was heated to 80° C. and stirred overnight. The reaction mixture was left to cool to room. temp., filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (4:1 isocratic hexanes/acetone) to give heptadecan-9-yl-8-((4-(dimethylamino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl) amino)octanoate (180 mg, 0.23 mmol, 15%) as a light yellow oil MS (CI): m/z (MH+) 779.7 for C ₄₈ H ₉₄ N ₂ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.83 (quint, 1H, J=6 Hz); 4.03 (t, 2H, J=7.5 Hz); 3-2.7 (m, 10H); 2.5 (t, 2H, J=7.5 Hz); 2.26 (m, 4H); 2 (m, 2H); 1.7-1.4 (m, 14H); 1.4-1.2 (m, 50H); 0.8 (m, 9H).

fx. Compound 239: Heptadecan-9-yl-8-((4-(methylamino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₅

Molecular weight: 765.26

[00319] Compound 239 was prepared from heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate (0.8 g, 1.2 mmol) analogously to compound 238 except that 2M a solution of methylamine in methanol (8 ml, 16 mmol) was used instead of a 2M solution of dimethylamine in THF. The reaction residue after filtration and concentration was purified by silica gel chromatography (4:1 isocratic hexanes/acetone) to give heptadecan-9-yl-8-((4-(methylamino)-4-oxobutyl)(8-(nonyloxy )-8-oxooctyl)amino)octanoate (400 mg, 0.52 mmol, 43%) as a light yellow oil. MS (CI): m/z (MH+) 765.6 for C ₄₇ H ₉₂ N ₂ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.83 (quint, 1H, J=6 Hz); 4.04 (t, 2H, J=6 Hz); 3.6 (s, 3H); 2.4-2.2 (m, 12H); 1.8-1.4 (m, 14H); 1.4-1.2 (m, 50H); 0.8 (m, 9H); (the amide proton was not observed).

F.Y. Compound 240: Heptadecan-9-yl-8-((4-(methoxy(methyl)amino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

4-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)butanoic acid

Chemical formula: C ₄₆ H ₈₉ NO ₆

Molecular weight: 752.22

[00320] A mixture of periodic acid (7.3 g, 32 mmol) in 100 ml of acetonitrile was vigorously stirred for 15 minutes. at 0°C. To this was added a solution of heptadecan-9-yl-8-((4-hydroxybutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (10.75 g, 14.6 mmol) in 30 ml of acetonitrile followed by addition pyridinium chlorochromate (0.16 g, 0.73 mmol). The resulting mixture was allowed to warm to room temperature. pace. Within 4 hours, after which LC/MS showed predominantly the remaining original alcohol. An additional portion of pyridinium chlorochromate (0.16 g, 0.73 mmol) was added to the mixture and stirring was continued for 1 hour. LC/MS showed additional product formation after additional pyridinium chlorochromate was added, however this reaction step was slow. The reaction mixture was diluted with EtOAc, washed with water/saturated aqueous sodium chloride (1:1), saturated aqueous sodium hydrogencarbonate and finally saturated aqueous sodium chloride. After drying (MgSO ₄ ) and concentration, 13 g of crude material was obtained, which, according to NMR, contained 20% of the starting alcohol along with the aldehyde intermediate. The crude material was dissolved in 120 ml of 1:1 acetonitrile/TBME, periodic acid (13.0 g, 57 mmol) and pyridinium chlorochromate (0.16 g, 0.73 mmol) were added and the mixture was stirred at room temperature. pace. within 3 hours. An additional portion of pyridinium chlorochromate (0.16 g, 0.73 mmol) was added and the mixture was stirred at room temperature. pace. within 16 hours, after which LC/MS showed that almost no starting alcohol remained. The reaction mixture was diluted with EtOAc, washed with water/saturated aqueous sodium chloride (1:1), saturated aqueous sodium hydrogencarbonate and finally saturated aqueous sodium chloride. The organic phases were dried (MgSO ₄ ), filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-6% then 10% methanol in dichloromethane) to give 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl) amino)butanoic acid (8.80 g, 11.7 mmol, 80%) as a brown oil. MS (CI): m/z (MH+) 752.6 for C ₄₆ H ₈₉ NO ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.84 (quint, 1H, J=6.3 Hz); 4.03 (t, 2H, J=6.8 Hz); 3.12 (m, 2H); 3.00 (m, 4H); 2.52 (m, 2H); 2.27 (m, 4H); 2.08 (m, 2H); 1.81 (broad m, 4H); 1.60 (m, 6H); 1.48 (m, 4H); 1.24 (broad m, 48H); 0.86 (t, 9H, J=6.9 Hz); the proton of the carboxyl group was not observed.

Heptadecan-9-yl-8-((4-(methoxy(methyl)amino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆

Molecular weight: 795.29

[00321] To a solution of 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)butanoic acid (1.00 g, 1.33 mmol) in 40 ml of dichloromethane was added carbonyldiimidazole (259 mg, 1.6 mmol) at 0°C, the cooling bath was removed and the mixture was stirred at room temperature. pace. within 30 min. After cooling to 0°C, N,O-dimethylhydroxylamine hydrochloride (156 mg, 1.6 mmol) and triethylamine (0.23 ml, 1.6 mmol) were added and the resulting mixture was stirred at room temperature. pace. within 16 hours. Less than 10% of the starting acid remained according to LC/MS, so the reaction mixture was diluted with a mixture of hexanes, washed once with water, water and saturated aqueous sodium chloride. The organic layer was dried (MgSO ₄ ), filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-6% then 10% methanol in dichloromethane) to give 0.77 g of a mixture containing some starting acid. This material was again purified by silica gel chromatography (0-40% then 60% acetone in hexanes) to give heptadecan-9-yl-8-((4-(methoxy(methyl)amino)-4-oxobutyl)(8 -(nonyloxy)-8-oxooctyl)amino)octanoate (210 mg, 0.26 mmol, 20%) as a colorless oil. HPLC/UV (214 nm): RT=9.78 min. MS (CI): m/z (MH+) 795.7 for C ₄₈ H ₉₄ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (quint, 1H, J=6.3 Hz); 4.04 (t, 2H, J=6.8 Hz); 3.67 (s, 3H); 3.17 (s, 3H); 2.41 (m, 6H); 2.27 (m, 6H); 1.74 (m, 2H); 1.60 (m, 8H); 1.48 (m, 4H); 1.40 (m, 2H); 1.24 (broad m, 48H); 0.86 (t, 9H, J=6.8 Hz).

FZ. Compound 241: Heptadecan-9-yl-8-((4-(methoxyamino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₆

Molecular weight: 781.26

[00322] To a mixture of 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)butanoic acid (1.00 g, 1.33 mmol) and O-methylhydroxylamine hydrochloride (178 mg, 2.13 mmol) in 20 ml of dichloromethane was added 1-ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (460 mg, 2.39 mmol) followed by the addition of triethylamine (0.30 ml, 2.39 mmol) 13 mmol) and the mixture was stirred at room temperature. pace. within 16 hours. Only a small amount of starting acid remained according to LC/MS, so the reaction mixture was diluted with a mixture of hexanes, washed once with water, water, and saturated aqueous sodium chloride. The organic layer was dried (MgSO ₄ ), filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-6% then 10% methanol in dichloromethane) to give 0.63 g of a mixture containing some starting acid. This material was again purified by silica gel chromatography (0-40% then 80% acetone in hexanes) to give heptadecan-9-yl-8-((4-(methoxyamino)-4-oxobutyl)(8-(nonyloxy) -8-oxooctyl) amino) octanoate (0.56 g, 0.71 mmol, 53%) as a colorless oil. HPLC/UV (214 nm): RT=9.49 min. MS (CI): m/z (MH+) 781.6 for C ₄₇ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (quint, 1H, J=6.3 Hz); 4.04 (t, 2H, J=6.8 Hz); 3.73 (s, 3H); 2.48 (m, 2H); 2.42 (m, 4H); 2.28 (m, 6H); 1.73 (m, 4H); 1.60 (m, 6H); 1.48 (m, 6H); 1.24 (broad m, 48H); 0.87 (t, 9H, J=7.1 Hz); the proton of the hydroxamic group was not observed.

GA. Compound 242: Heptadecan-9-yl-8-((4-(hydroxy(methyl)amino)-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₂ O ₆

Molecular weight: 781.26

[00323] To a solution of 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)butanoic acid (1.08 g, 1.43 mmol) in Oxalyl chloride (121 μl, 1.43 mmol) was added in 25 ml of dichloromethane at 0° C. followed by the addition of 5 drops of DMF, the cooling bath was removed and the reaction mixture was stirred at room temperature. pace. within 16 hours. To the resulting solution was added N-methylhydroxylamine hydrochloride (0.36 g, 4.3 mmol) and DMAP (355 mg, 0.29 mmol) at 0°C, followed by the addition of triethylamine (1.0 ml, 7.2 mmol), the reaction mixture was left to warm to room. pace. and stirred for 16 hours. Only a small amount of starting acid remained according to LC/MS, so the reaction mixture was diluted with a mixture of hexanes, washed once with water, water, and saturated aqueous sodium chloride. The organic layer was dried (MgSO ₄ ), filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-50% then 80% acetone in hexanes) to give heptadecan-9-yl-8-((4-(hydroxy(methyl)amino)-4-oxobutyl)(8-( nonyloxy)-8-oxooctyl)amino)octanoate (0.61 g, 0.78 mmol, 54%) as a yellow oil. HPLC/UV (214 nm): RT=9.69 min. MS (CI): m/z (MH+) 781.6 for C ₄₇ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.85 (quint, 1H, J=6.0 Hz); 4.04 (t, 2H, J=6.9 Hz); 3.21 (s, 3H); 2.55 (m, 4H); 2.44 (m, 4H); 2.27 (m, 4H); 1.96 (m, 2H); 1.60 (m, 8H); 1.47 (m, 6H); 1.24 (broad m, 48H); 0.87 (t, 9H, J=7.1 Hz); the proton of the hydroxamic group was not observed.

GB. Compound 243: Heptadecan-9-yl-8-((4-amino-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₀ N ₂ O ₅

Molecular weight: 751.24

[00324] To a solution of 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(8-(nonyloxy)-8-oxooctyl)amino)butanoic acid (1.0 g, 1.33 mmol) in Oxalyl chloride (120 μl, 1.33 mmol) was added in 25 ml of dichloromethane at 0° C. followed by the addition of 5 drops of DMF, the cooling bath was removed and the reaction mixture was stirred at room temperature. pace. within 16 hours. The resulting solution was cooled to 0°C, gaseous ammonia was blown through it for 5 minutes, and the reaction was maintained at 0°C for two hours. Only a small amount of starting acid remained according to LC/MS, so the reaction mixture was diluted with dichloromethane and washed with saturated aqueous sodium chloride. The organic layer was dried (MgSO ₄ ), filtered and the filtrate was concentrated. The residue was purified by silica gel chromatography (0-40% then 80% acetone in hexanes) to give heptadecan-9-yl-8-((4-amino-4-oxobutyl)(8-(nonyloxy)-8-oxooctyl )amino)octanoate (0.30 g, 0.40 mmol, 30%) as a brown oil. HPLC/UV (214 nm): RT=9.09 min. MS (CI): m/z (MH+) 751.6 for C ₄₆ H ₉₀ N ₂ O ₅ . 1H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.73 (br. s, 1H); 5.22 (br. s, 1H); 4.85 (quint, 1H, J=6.3 Hz); 4.04 (t, 2H, J=6.6 Hz); 2.45 (m, 2H); 2.37 (m, 4H); 2.27 (m, 6H); 1.75 (m, 2H); 1.60 (m, 8H); 1.50 (m, 4H); 1.40 (m, 2H); 1.24 (broad m, 48H); 0.87 (t, 9H, J=6.5 Hz).

GC. Compound 248: Heptadecan-9-yl-(Z)-8-((3-(3,3-dimethyl-2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

S-Methyl-N-nitro-Nʹ-phthaloylisothiourea

Chemical formula: C ₁₀ H ₇ N ₃ O ₄ S

Molecular weight: 265.24

[00325] Phthaloyl chloride (14.5 g, 10.3 ml, 72 mmol) was added dropwise to a solution of S-methyl-N-nitroisothiourea (5.0 g, 37 mmol) in 70 ml of pyridine at 0°C over 25 min. The solution was stirred at 0°C for 30 min during which time a precipitate formed. The mixture was poured into 600 ml of ice-cold 2N hydrochloric acid, the resulting solids were filtered off, washed with water and air dried. The solids precipitated from ethanol to give S-methyl-N-nitro-Nʹ-phthaloylisothiourea (6.23 g, 23.5 mmol, 64%) as a white solid. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.97-7.95 (m, 2H); 7.87-7.86 (m, 2H); 2.66 (s, 3H).

Methyl N,N-dimethyl-Nʹ-nitrocarbamimidothioate

Chemical formula: C ₄ H ₉ N ₃ O ₂ S

Molecular weight: 163.20

[00326] To a solution of S-methyl-N-nitroso-Nʹ-phthaloylisothiourea (1.5 g, 5.68 mmol) in 10 ml of dichloromethane at 0°C was added a 2M solution of dimethylamine in THF (2.84 ml, 5.68 mmol) was added dropwise 5 ml of methanol over 25 min. The reaction mixture was stirred at rt. pace. over 3 hours, concentrated, the residue was dissolved in dichloromethane and purified by silica gel chromatography (4:1 isocratic hexanes/ethyl acetate) to give methyl-N,N-dimethyl-Nʹ-nitrocarbamimidothioate (678 mg, 4.15 mmol, 73%) as a waxy white solid. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 3.25 (s, 6H); 2.53 (s, 3H).

Heptadecan-9-yl-(Z)-8-((3-(3,3-dimethyl-2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ N ₅ O ₆

Molecular weight: 838.32

[00327] Methyl-N,N- dimethyl-Nʹ-nitrocarbamimidothioate (118 mg, 0.73 mmol), the reaction mixture was heated to boiling and stirred for 5 hours. According to LC/MS no starting amine remained, so the solvent was removed and the residue was purified by silica gel chromatography (eluent dichloromethane, methanol, 1% ammonium hydroxide) to give 520 mg of impure material. It was purified again by silica gel chromatography (first 0-100% ethyl acetate in hexanes, then 0-50% (1% NH4OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z) -8-((3-(3,3-dimethyl-2-nitroguanidino)propyl)(8-(nonyloxyl)-8-oxooctyl)amino)octanoate (220mg, 0.26mmol, 38%) as light yellow oil. HPLC/UV 214 nm: RT=9.48 min. MS (CI): m/z (MH+) 838.7 for C ₄₈ H ₉₅ N ₅ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.51 (t, 2H, J=5.2 Hz); 3.05 (s, 6H); 2.66 (br. s, 1H); 2.48 (br. s, 2H); 2.28 (dt, 4H, J=7.4 Hz, 3.8 Hz); 1.62-1.58 (m, 8H); 1.48-1.30 (m, 8H); 1.29-1.24 (m, 52H); 0.86 (t, 9H, J=6.6 Hz).

G.D. Compound 249: Heptadecan-9-yl-(E)-8-((3-(2-cyano-3-methylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₃ N ₅ O ₄

Molecular weight: 804.30

[00328] Compound 249 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-nonyloxy)-8-oxooctyl)aminooctanoate (400 mg, 0.55 mmol) analogously to compound 168 except that 2M a solution of methylamine in methanol (1.4 ml, 2.8 mmol) was used instead of a 2M solution of dimethylamine in THF. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (dichloromethane, methanol/1% NH ₄ OH) to give heptadecan-9-yl-(E)-8-((3-(2-cyano-3-methylguanidino) propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (260 mg, 0.32 mmol, 58%) as a light yellow oil. HPLC/UV 214 nm: RT=9.83 min. MS (CI): m/z (MH+) 804.7 for C ₄₈ H ₉₃ N ₅ O ₄ . 1H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.29 (m, 2H); 2.77 (d, 3H, J=4.6 Hz); 2.52 (m, 1H); 2.44-2.39 (m, 3H); 2.28 (dt, 4H, J=7.4 Hz, 3.6 Hz); 1.65-1.57 (m, 16H); 1.50-1.41 (m, 3H); 1.30-1.24 (m, 48H); 0.86 (t, 9H, J=6.4 Hz).

G.E. Compound 250: Heptadecan-9-yl-(Z)-8-((3-((1-(dimethylamino)-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

(E)-N,N-Dimethyl-1-(methylthio)-2-nitroethene-1-amine

Chemical formula: C ₅ H ₁₀ N ₂ O ₂ S

Molecular weight: 162.21

[00329] A 2M dimethylamine in tetrahydrofuran (3 ml, 6 mmol) and the reaction mixture was stirred at room temperature. pace. within 3 hours. The solvent was removed in vacuo and the crude product was purified by silica gel chromatography (hexane, ethyl acetate) to give (E)-N,N-dimethyl-1-(methylthio)-2-nitroethene-1-amine (200 mg, 20%) containing N, N, Nʹ, Nʹ-tetramethyl-2-nitroethene-1,1-diamine, as a reddish-yellow oil, which was used without further purification. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.67 (s, 1H); 3.20 (s, 6H); 2.46 (s, 3H).

Heptadecan-9-yl-(Z)-8-((3-((1-(dimethylamino)-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₄ O ₆

Molecular weight: 837.33

[00330] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500mg, 0.69mmol) in 20ml methanol was added (E) -N,N-dimethyl-1-(methylthio)-2-nitroethene-1-amine (112 mg, 0.69 mmol), the reaction mixture was heated to boiling and stirred for 5 hours. The solvent was removed and the compound was purified twice by silica gel chromatography [column 1: hexane/ethyl acetate, then dichloromethane, methanol/1% NH ₄ OH), column 2: hexane/ethyl acetate, then dichloromethane, methanol/1% NH ₄ OH)] to give heptadecan-9-yl-(Z)-8-((3-((1-(dimethylamino)-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (104 mg, 0.12 mmol, 18%) as a yellow oil. HPLC/UV 214 nm: RT=8.69 min. MS (CI): m/z (MH+) 837.7 for C ₄₈ H ₉₆ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 9.56 (br. s, 1H); 6.49 (s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.34-3.32 (m, 2H); 2.92 (s, 6H); 2.49 (m, 2H); 2.37-2.33 (m, 4H); 2.27 (dt, 4H, J=7.4 Hz, 3.8 Hz); 1.77-1.75 (m, 2H); 1.62-1.48 (m, 8H); 1.34-1.24 (m, 54H); 0.86 (t, 9H, J=6.5 Hz).

GF. Compound 254: Heptadecan-9-yl-4-imino-9-(8-(nonyloxy)-8-oxooctyl)-2-oxa-3,5,9-triazaheptadecan-17-oate

Heptadecan-9-yl-7-(tert-butoxycarbonyl)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-6-(1H-pyrazol-1-yl)- 3-oxa-5,7,11-triazanoad-5-en-19-oate

Chemical formula: C ₅₉ H ₁₀₉ N ₅ O ₈

Molecular weight: 1016.55

[00331] Triphenylphosphine (271, 8 mg, 1.04 mmol) and tert-butyl-(((tert-butoxycarbonyl)amino)(1H-pyrazol-1-yl)methylene)carbamate (Aldrich Chemical Co., St. Louis, MO; 214.3 mg , 0.69 mmol) and the reaction mixture was cooled to 0° C. Diisopropyl azodicarboxylate (0.2 ml, 1.04 mmol) was added dropwise to this, the cooling bath was removed, and the reaction mixture was stirred at room temperature for 24 hours. No starting alcohol remained according to LC/MS, so the solvent was removed and the residue was purified by silica gel chromatography (0-40% ethyl acetate in hexanes) to give heptadecan-9-yl-7-(tert)-butoxycarbonyl)-2.2 -dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-6-(1H-pyrazol-1-yl)-3-oxa-5,7,11-triazanodec-5-en-19 -oate (227 mg, 0.22 mmol, 32%) as a colorless oil. MS (CI): m/z (MH+) 1016.8 for C ₅₉ H ₁₀₉ N ₅ O ₈ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.93 (s, 1H); 7.67 (s, 1H); 6.40 (s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.69-3.67 (m, 2H); 2.45 (t, 2H, J=7.0 Hz) 2.35-2.23 (m, 8H); 1.88-1.84 (m, 2H); 1.57-1.49 (m, 10H); 1.38-1.24 (m, 70H); 0.86 (t, 9H, J=6.5 Hz).

Heptadecan-9-yl-7-(tert-butoxycarbonyl)-6-(methoxyamino)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5, 7,11-triazanonads-5-en-19-oat

Chemical formula: C ₅₇ H ₁₁₀ N ₄ O ₉

Molecular weight: 995.53

[00332] To a solution of heptadecan-9-yl-7-(tert-butoxycarbonyl)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-6-(1H-pyrazole- 1-yl)-3-oxa-5,7,11-triazanonedec-5-en-19-oate (227 mg, 0.22 mmol) O-methylhydroxylamine hydrochloride ( 93.3 mg, 1.12 mmol) followed by the addition of N,N-diisopropylethylamine (0.2 ml, 1.12 mmol), the reaction mixture was heated to 85°C and stirred for 24 hours. The reaction was allowed to progress to 80% by LC/MS, then an additional portion of O-methylhydroxylamine hydrochloride (93.3 mg, 1.12 mmol) was added followed by N,N-diisopropylethylamine (144.4 mg, 0.2 mL, 1 ,12 mmol) and the reaction mixture was stirred at 85°C for an additional 24 hours. According to LC/MS no starting material remained, so the solvent was removed and the residue was purified by silica gel chromatography (1:1 isocratic hexane/ethyl acetate) to give heptadecan-9-yl-7-(tert-butoxycarbonyl)-6-(methoxyamino )-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5,7,11-triazanodec-5-en-19-oate (189 mg, 0 .19 mmol, 85%) as a colorless oil. MS (CI): m/z (MH+) 995.8 for C ₅₇ H ₁₁₀ N ₄ O ₉ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.31 (s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.83 (s, 3H); 3.42 (t, 2H, J=7.5 Hz); 2.48-2.32 (m, 6H); 2.26 (dt, 4H, J=7.4 Hz, 3.8 Hz); 1.62-1.55 (m, 8H); 1.50-1.43 (m, 20H); 1.39-1.24 (m, 54H); 0.86 (t, 9H, J=6.4 Hz).

Heptadecan-9-yl-4-imino-9-(8-(nonyloxy)-8-oxooctyl)-2-oxa-3,5,9-triazaheptadecan-17-oate

Chemical formula: C ₄₇ H ₉₄ N ₄ O ₅

Molecular weight: 795.29

[00333] To a solution of heptadecan-9-yl-7-(tert-butoxycarbonyl)-6-(methoxyamino)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3 -oxa-5,7,11-triazanodec-5-en-19-oate (189 mg, 0.19 mmol) in 1 ml of ethyl acetate at 0°C was added dropwise a solution of 4M hydrogen chloride in 1,4-dioxane (8 ml , 32 mmol) and the reaction mixture was stirred at room temperature. pace. within 3 days. According to LC/MS, no starting material remained and only the product without protecting groups was observed. The reaction mixture was concentrated, the residue was dissolved in ethyl acetate, and the solution was washed once with saturated aqueous sodium hydrogen carbonate, then with saturated aqueous sodium chloride, dried (Na ₂ SO ₄ ), filtered, and the filtrate was concentrated. The residue was purified by silica gel chromatography (dichloromethane, methanol/1% NH ₄ OH) to give heptadecan-9-yl-4-imino-9-(8-(nonyloxy)-8-oxooctyl)-2-oxa-3, 5,9-triazaheptadecan-17-oate (120 mg, 0.15 mmol, 80%). MS (CI): m/z (MH+) 795.7 for C ₄₇ H ₉₄ N ₄ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.64 (s, 3H); 3.15 (br. s, 2H); 2.51-2.49 (m, 2H); 2.42-2.38 (m, 4H); 2.27 (dt, 4H, J=7.4 Hz, 3.7 Hz); 1.65-1.55 (m, 8H); 1.49-1.41 (m, 8H); 1.29-1.24 (m, 50H); 0.86 (t, 9H, J=6.4 Hz).

GG. Compound 266: Heptadecan-9-yl-(E)-8-((3-(2-cyanoguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₁ N ₅ O ₄

Molecular weight: 790.28

[00334] Compound 266 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-nonyloxy)-8-oxooctyl)aminooctanoate (400 mg, 0.55 mmol) analogously to compound 168 except that 7M a solution of ammonia in methanol (2 ml, 14 mmol) was used instead of a solution of 2M dimethylamine in THF and the reaction was carried out in a sealed tube. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (dichloromethane, methanol/1% NH4OH) to give heptadecan-9-yl-(E)-8-((3-(2-cyanoguanidino)propyl)(8-( nonyloxyl)-8-oxooctyl)amino)octanoate (170 mg, 0.21 mmol, 39%) as a light yellow oil. HPLC/UV 214 nm: RT=9.26 min. MS (CI): m/z (MH+) 790.7 for C ₄₇ H ₉₁ N ₅ O ₄ . ^1H NMR (300 MHz, CDCl ₃ ) δ: ppm δ 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.29-3.27 (m, 2H); 2.51-2.48 (m, 2H); 2.43-2.38 (m, 4H); 2.31-2.25 (m, 4H); 1.68-1.55 (m, 8H); 1.50-1.48 (m, 4H); 1.40-1.37 (m, 4H); 1.30-1.23 (m, 50H); 0.86 (t, 9H, J=6.6 Hz); one proton of the guanidine group was not observed.

G.H. Compound 274: Heptadecan-9-yl-(E)-8-((3-(2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ N ₅ O ₆

Molecular weight: 810.26

[00335] Methyl-Nʹ-nitrocarbamimidothioate ( 104 mg, 0.77 mmol), the reaction mixture was heated to boiling and stirred for 4 hours. According to LC/MS, no starting material remained and two product peaks were observed, which corresponded to the two nitroguanidine regioisomers (Z and E). The amount of the Z isomer decreases with the reaction time as it is converted to the more stable E isomer. The solvent was removed and the crude compound was purified by silica gel chromatography (first hexane, 0-100% ethyl acetate in hexanes, then 0-50% methanol/1% NH ₄ OH in dichloromethane) to give heptadecan-9-yl-(E) -8-((3-(2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (160 mg, 0.20 mmol, 27%) as a colorless oil. HPLC/UV 214 nm: RT=9.53 min. MS (CI): m/z (MH+) 810.7 for C ₄₆ H ₉₁ N ₅ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.41 (br. s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J=6.6 Hz); 3.36-3.34 (m, 2H); 2.51-2.41 (m, 6H); 2.28 (dt, 4H, J=7.6 Hz, 3.7 Hz); 1.78 (br. s, 2H); 1.63-1.58 (m, 8H); 1.50-1.38 (m, 6H); 1.30-1.23 (m, 50H); 0.86 (t, 9H, J=6.8 Hz).

[00336] Also isolated was heptadecan-9-yl-(Z)-8-((3-(2-nitroguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (65 mg, 0.08 mmol , 11%) as a light yellow oil which slowly converts to the E isomer on standing. HPLC/UV 214 nm: RT=10.66 min. MS (CI): m/z (MH+) 810.6 for C ₄₆ H ₉₁ N ₅ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87-4.80 (m, 1H); 4.04 (t, 2H, J=6.7 Hz); 3.36-3.34 (m, 2H); 2.48 (br. s, 4H); 2.30-2.24 (m, 4H); 2.16-2.15 (m, 1H); 1.79 (br. s, 1H); 1.62-1.42 (m, 15H); 1.30-1.24 (m, 52H); 0.86 (t, 9H, J=6.6 Hz).

G.I. Compound 275: 7-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)heptyl-(Z)-dec-3-enoate

Chemical formula: C ₁₂ H ₁₈ O ₃

Molecular weight: 210.27

[00337] Triethylamine (0.2 ml, 1 .4 mmol) and the pale yellow solution was stirred at room temperature. pace. within 20 hours, after which, according to TLC, no starting alcohol remained. The solution was concentrated and the residue was purified by silica gel chromatography (0-20% EtOAc in hexanes) to give methyl (E)-3-(oct-1-yn-3-yloxy)acrylate (2.92 g, 13. 9 mmol, 97%) as a colorless liquid. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.61 (d, 1H, J =12.5 Hz); 5.38 (d, 1H, J =12.5 Hz); 4.53 (td, 1H, J =6.6 Hz, 2.0 Hz); 3.70 (s, 3H); 2.58 (d, 1H, J =2.0 Hz); 1.91-1.75 (m, 2H); 1.52-1.41 (m, 2H); 1.37-1.26 (m, 4H); 0.90 (t, 3H, J =6.9 Hz).

Chemical formula: C ₁₀ H ₁₈ O ₂

Molecular weight: 170.25

[00338] In a 5 ml microwave tube, 840 mg (4 mmol) of methyl-( E )-3-(oct-1-yn-3-yloxy)acrylate and 2 ml of water were mixed to form a colorless biphasic solution. The tube was sealed and the mixture was subjected to microwave irradiation at 175°C for 90 minutes. The resulting biphasic solution was washed twice with DCM, the organic phases were washed, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a dark orange oil. This was dissolved in hexanes and purified by silica gel chromatography (0-20% EtOAc in hexanes) to give (Z)-dec-3-enoic acid (155 mg, 0.91 mmol, 23%) as an orange oil . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 11.03 (br. s, 1H); 5.70-5.44 (m, 2H); 3.14 (d, 2H, J =6.6 Hz); 2.04 (k, 2H, J =6.8 Hz); 1.43-1.13 (m, 8H); 0.88 (t, 3H, J =6.8 Hz). (Z)-Geometry confirmed by 1D NOEsy selective gradient experiments with irradiation at 2.07 ppm. (C-5 protons) and 3.16 ppm. (C-2 protons).

Chemical formula: C ₁₇ H ₃₁ BrO ₂

Molecular weight: 347.34

[00339] 1 - ethyl -3-(dimethylaminopropyl)carbodiimide hydrochloride (440 mg, 1.94 mmol) followed by DMAP (80 mg, 0.65 mmol) and finally N,N -diisopropylethylamine (680 μl, 3.88 mmol). The resulting orange solution was stirred at room temperature. pace. within 24 hours, after which LC/MS showed that the original acid was gone. The solution was diluted with DCM, washed once with saturated aqueous sodium hydrogen carbonate (thick emulsion), once with 10% aqueous citric acid, dried (MgSO ₄ ), filtered, and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-15% EtOAc in hexanes) to give 7-bromoheptyl-( Z )-dec-3-enoate (250 mg, 0.72 mmol, 56%) as a light yellow liquid . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.65-5.49 (m, 2H); 4.07 (t, 2H, J =6.7 Hz); 3.40 (t, 2H, J =6.8 Hz); 3.08 (d, 2H, J =5.5 Hz); 2.04 (k, 2H, J =6.8 Hz); 1.92-1.79 (m, 2H); 1.70-1.56 (m, 2H); 1.51-1.20 (m, 14H); 0.88 (t, 3H, J =6.3 Hz).

Chemical formula: C ₄₄ H ₈₅ NO ₅

Molecular weight: 708.17

[00340] Compound 285 was prepared from heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (350 mg, 0.71 mmol) analogously to compound 284 except that 7-bromoheptyl-( Z )-dec -3-enoate (250 mg, 0.72 mmol) was used instead of 5-bromopentyloctylmalonate. After working up the reaction mixture with water, the resulting yellow oil was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give 7-((8-(heptadecan-9-yloxy )-8-oxooctyl)(2-hydroxyethyl)amino)heptyl ( Z )-dec-3-enoate (205 mg, 0.29 mmol, 41%) as a colorless oil.

UHPLC/DSIO: RT=3.35 min. MS (ESI): m/z (MH ⁺ ) 708.75 for C ₄₄ H ₈₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.64-5.48 (m, 2H); 4.86 (quint, 1H, J =6.2 Hz); 4.07 (t, 2H, J =6.7 Hz); 3.55 (t, 2H, J =5.0 Hz); 3.40 (t, 2H, J =6.8 Hz); 3.08 (d, 2H, J =5.6 Hz); 2.61 (t, 2H, J =4.1 Hz); 2.47 (t, 4H, J =6.8 Hz); 2.27 (t, 2H, J =7.5 Hz); 2.04 (k, 2H, J =6.8 Hz); 1.70-1.55 (m, 4H); 1.54-1.40 (m, 6H); 1.39-1.13 (m, 45H); 0.87 (t, 9H, J =6.5 Hz).

GJ. Compound 276: Heptadecan-9-yl-8-((3-(3-methoxypropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₆

Molecular weight: 809.32

[00341] Compound 276 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 178 except that that 3-methoxypropanoyl chloride (OakWO od Chemical, Estille, SC) (57 µl, 0.52 mmol) was used in place of methoxyacetyl chloride. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(3 -methoxypropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (140 mg, 0.55 mmol, 31%) as a yellow oil. UHPLC/DSIO: RT=3.48 min. MS (ESI): m/z (MH+) 809.78 for C ₄₉ H ₉₆ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.48 (s, 1H); 4.86 (quint, 1H, J=12.6 Hz, 6.1 Hz); 4.05 (t, 2H, J=6.7 Hz); 3.91 (s, 2H); 3.55 (q.t., 2H, J=13.8 Hz, 7.0 Hz); 3.36 (d, 2H, J=5.8 Hz); 2.53-2.43 (m, 2H); 2.41-2.32 (broad m, 3H); 2.31-2.23 (m, 4H); 1.70-1.56 (m, 8H); 1.55-1.37 (m, 8H); 1.36-1.14 (m, 52H); 0.88 (t, 9H, J=7.5 Hz).

G.K. Compound 277: 4-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)butylheptylglutarate

Stage 1: 5-(Heptylyloxy)-5-oxopentanoic acid

Chemical formula: C ₁₂ H ₂₂ O ₄

Molecular weight: 230.30

[00342] A suspension of 5 g (41.6 mmol) of glutaric anhydride in 7.2 ml (50 mmol) of 1-heptanol was heated to 90° C. and stirred for 20 hours after which it turned into a colorless solution. He was left to cool to room. temp., diluted with saturated aqueous sodium hydrogen carbonate solution (~50 ml) and extracted three times with diethyl ether. The aqueous layer was adjusted to pH ~3 with 4N HCl aqueous solution and the resulting cloudy mixture was extracted three times with EtOAc. The EtOAc phases were combined, washed once with saturated aqueous sodium chloride, dried (Na ₂ SO ₄ ), filtered and the filtrate was concentrated to give 5-(heptyloxy)-5-oxopentanoic acid (7.36 g, 31.9 mmol, 77 %) as a colorless liquid, which was used in the next step without further purification. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 11.40 (br. s, 1H); 4.06 (t, 2H, J=6.8 Hz); 2.41 (m, 4H); 1.95 (quint, 2H, J=14.5 Hz, 7.3 Hz); 1.61 (m, 2H); 1.28 (m, 8H); 0.88 (t, 3H, J=5.8 Hz).

Stage 2: 4-bromobutylheptylglutarate

Chemical formula: C ₁₆ H ₂₉ BrO ₄

Molecular weight: 365.31

[00343] To a solution of 5-(heptyloxy)-5-oxo-pentanoic acid (1.5 g, 6.5 mmol) and 4-bromo-1-butanol (0.82 ml, 6.8 mmol) in 20 ml dry DCM 1-ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (2.2 g, 9.8 mmol) was added under nitrogen, followed by 4-(dimethylamino)pyridine (0.4 g, 3.26 mmol) and finally added N,N-diisopropylethylamine (3.4 ml, 19.5 mmol) to give a pale yellow solution. It was stirred at rt. pace. within 24 hours, after which LC/MS indicated that no starting material remained. The solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate (thick emulsion), dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-20% EtOAc in hexanes) to give 4-bromobutylheptylglutarate (0.34 g, 0.93 mmol, 14%) as a pale yellow oil. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.11-4.06 (m, 4H); 3.41 (t, 2H, J=6.7 Hz); 2.62 (s, 4H); 1.87 (quint, 2H, J=13.9 Hz, 7.2 Hz); 1.69-1.57 (m, 4H); 1.50-1.30 (m, 10H); 0.89 (t, 3H, J=6.3 Hz).

Stage 3: 4-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)butylheptylglutarate

Chemical formula: C ₄₃ H ₈₃ NO ₇

Molecular weight: 726.14

[00344] To a solution of heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (300mg, 0.61mmol) and 6-bromohexylhexylsuccinate (223mg (0.61mmol) in 8ml dry acetonitrile in potassium iodide (115 mg, 0.68 mmol) was added under nitrogen atmosphere followed by the addition of powdered potassium carbonate (340 mg, 2.4 mmol) and the mixture was diluted with 2 ml of dry cyclopentyl methyl ether.The resulting white mixture was heated to 90°C and stirred for 24 hours, then left to cool to room temperature, filtered, the solids on the filter were washed with DCM and the filtrate was concentrated.The residue was suspended in 50% saturated aqueous sodium hydrogen carbonate solution and extracted twice with DCM.The organic phases were combined, dried (MgSO ₄ ), filtered and the filtrate concentrated to give a yellow oil It was purified by silica gel chromatography (0-30% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give 4-((8-(heptadecan-9-yloxy) -8-oxooctyl)(2-hydroxyethyl)amino)butylheptylglutarate (140 mg, 0.19 mmol, 32%) as a colorless oil. UHPLC/DSIO: RT=3.22 min. MS (ESI): m/z (MH+) 726.63 for C ₄₃ H ₈₃ NO ₇ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J=12.2 Hz, 6.1 Hz); 4.07 (Q, 4H, J=12.1Hz, 6.0Hz); 3.53 (t, 2H, J=5.0 Hz); 2.88 (br. s, 1H); 2.58 (t, 2H, J=4.7 Hz); 2.47 (q.t., 4H, J=16.8 Hz, 7.0 Hz); 2.37 (t, 4H, J=7.0 Hz); 2.27 (t, 2H, J=7.4 Hz); 1.94 (quint, 2H, J=14.7 Hz, 7.3 Hz); 1.70-1.55 (m, 6H); 1.54-1.37 (m, 8H); 1.36-1.15 (m, 38H); 0.87 (t, 9H, J=6.1 Hz).

GL. Compound 278: Heptadecan-9-yl-8-((3-(cyclopropanesulfonamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆ S

Molecular weight: 827.35

[00345] Compound 278 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 109 except that that cyclopropanesulfonyl chloride (OakWO od Chemical, Estille, SC) (54 μl, 0.52 mmol) was used instead of methanesulfonyl chloride. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(cyclopropanesulfonamido ) propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (125 mg, 0.15 mmol, 44%) as a light yellow oil.

UHPLC/DSIO: RT=3.45 min. MS (ESI): m/z (MH+) 827.82 for C49H94N2O6S. 1H NMR (300 MHz, CDCl3) δ: ppm 6.95 (br. s, 1H); 4.86 (quint, 1H, J=12.4 Hz, 6.2 Hz); 4.05 (t, 2H, J=6.8 Hz); 3.48 (q.t., 1H, J=14.1 Hz, 7.0 Hz); 3.26 (t, 2H, J=5.6 Hz); 2.63-2.47 (broad m, 2H); 2.45-2.32 (broad m, 4H); 2.31-2.21 (m, 4H); 1.77-1.68 (m, 2H); 1.61 (br. t., 6H, J=6.8 Hz); 1.55-1.39 (m, 8H); 1.38-1.17 (m, 48H); 1.16-1.10 (m, 2H); 0.98-0.92 (m, 2H); 0.88 (t, 9H, J=6.0 Hz).

G.M. Compound 279: Heptadecan-9-yl-(Z)-6-(cyanoimino)-2-methyl-11-(8-(nonyloxy)-8-oxooctyl)-2,5,7,11-tetraazanonedecane-19-oate

Chemical formula: C ₅₁ H ₁₀₀ N ₆ O ₄

Molecular weight: 861.40

[00346] Compound 279 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 168 except that that pure N,N-dimethylethylene-1,2-diamine (160 μl, 1.4 mmol) was used in place of the THF solution of dimethylamine. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-6-(cyanoimino )-2-methyl-11-(8-(nonyloxy)-8-oxooctyl)-2,5,7,11-tetraazanonedecane-19-oate (110 mg, 0.13 mmol, 37%) as light yellow oils. UHPLC/DSIO: RT=3.10 min. MS (ESI): m/z (MH ⁺ ) 861.94 for C ₅₁ H ₁₀₀ N ₆ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.91 (br. s, 1H); 4.86 (quint, 1H, J =6.2 Hz); 4.05 (t, 2H, J =6.8 Hz); 3.28-3.18 (m, 4H); 2.53-2.40 (m, 7H); 2.32-2.22 (m, 10H); 1.75-1.55 (m, 8H); 1.49-1.43 (m, 8H); 1.32-1.26 (broad m, 50H); 0.88 (t, 9H, J =6.1 Hz).

GN. Compound 280: Heptadecan-9-yl-8-((3-((2-((2-(dimethylamino)ethyl)amino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)( 8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₉ H ₁₄ N ₂ O ₃

Molecular weight: 198.22

[00347] A solution of 0.42 ml (3.8 mmol) of N , N -dimethylethylene-1,2-diamine in 10 ml of ether for five minutes and the resulting mixture was stirred at room temperature for 24 hours, then filtered, the filtered solids were washed with diethyl ether and dried in air. The filtered solid was dissolved in a mixture of hexanes, filtered, the filtrate was diluted with EtOAc until cloudy and the mixture was left to cool to room temperature, then cooled to 0°C to obtain a precipitate. It was isolated by filtration, washed with a mixture of hexanes, air dried, then dried in vacuo to give 3-((2-(dimethylamino)ethyl)amino)-4-methoxycyclobut-3-ene-1,2-dione (255 mg, 1 .29 mmol, 37%) as a white solid. The compound exists as two rotamers at room temperature in chloroform. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.35 (br. s, 0.65H); 6.09 (br. s, 0.35H); 4.39 (s, 3H); 3.73 (br. s, 0.75H); 3.46 (br. s, 1.25H); 2.50 (m, 2H); 2.25 (s, 6H).

Chemical formula: C ₅₃ H ₁₀₀ N ₄ O ₆

Molecular weight: 889.41

[00348] Compound 280 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (300 mg, 0.42 mmol) analogously to compound 169 except that that 3-((2-(dimethylamino)ethyl)amino)-4-methoxycyclobut-3-ene-1,2-dione (160 μl, 1.4 mmol) was used instead of 3-(dimethylamino)-4-methoxycyclobut- 3-ene-1,2-dione and the solution was heated to 40 ^° C. The solution was evaporated under a stream of nitrogen and the residue was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-((2-((2-(dimethylamino)ethyl)amino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl) (8-(nonyloxy)-8-oxooctyl) amino) octanoate (105 mg, 0.12 mmol, 28%) as a yellow paste. UHPLC/DSIO: RT=3.16 min. MS (ESI): m/z (MH ⁺ ) 890.06 for C ₅₃ H ₁₀₀ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.58 (br. s, 1H); 6.20 (br. s, 1H); 4.86 (quint, 1H, J =5.9 Hz); 4.05 (t, 2H, J =6.7 Hz); 3.76-3.60 (m, 4H); 2.63 (br. s, 2H); 2.54-2.44 (m, 6H); 2.28 (m, 10H); 1.74 (br. s, 2H); 1.61 (m, 6H); 1.49 (m, 8H); 1.25 (broad m, 48H); 0.88 (t, 9H, J =6.0 Hz).

GO. Compound 281: Heptadecan-9-yl-8-((3-(3-methoxy-2,2-dimethylpropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₁ H ₁₀₀ N ₂ O ₆

Molecular weight: 837.37

[00349] Compound 281 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 252 except that that 3-methoxy-2,2-dimethylpropanoic acid (Enamine LLC, Monmouth Junction, NJ) (63 mg, 0.52 mmol) was used instead of (methylthio)acetic acid. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(3 -methoxy-2,2-dimethylpropanamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (125 mg, 0.15 mmol, 43%) as a colorless oil. UHPLC/DSIO: RT=3.63 min. MS (ESI): m/z (MH ⁺ ) 837.99 for C ₅₁ H ₁₀₀ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 9.26 (s, 1H); 7.39 (t, 1H, J =6.3 Hz); 4.85 (quint, 1H, J =6.3 Hz); 4.05 (t, 2H, J =6.8 Hz); 3.42-3.32 (m, 7H); 3.12-2.98 (m, 5H); 2.33-2.23 (m, 4H); 2.04 (br. s, 2H); 1.75-1.53 (broad m, 14H); 1.51-1.10 (m, 54H); 0.88 (t, 9H, J =6.1 Hz).

GP. Compound 282: Heptadecan-9-yl-8-((3-((1-amino-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₂ N ₄ O ₆

Molecular weight: 809.28

[00350] A solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500 mg, 0.69 mmol) and (2-nitroethene-1,1 -diyl)bis(methylsulfane) (125 mg, 0.76 mmol) in methanol (5 ml) was stirred at 80° C. in a sealed tube for 5 hours. Then a solution of ammonia was added (7N in methanol, 5 ml, 35 mmol) and the reaction mixture was further heated at 80°C for 2 hours. The solvent was removed and the crude material was purified by silica gel chromatography (SiO₂: EtOAc/hexane 0 to 100% then methanol containing 1% ammonium hydroxide/dichloromethane 0 to 20%) to give heptadecan-9-yl-(E)-8-((3-((1-amino-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (80 mg, 12%) as a yellow oil. HPLC/UV (214 nm): RT=8.78 min. MS (HI):m/z (MH⁺) 809.6 for C₄₇H₉₂N₄O₆.¹H NMR (300 MHz, CDCl₃): δ ppm 6.49 (s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H,J=6.7 Hz); 3.36 (m, 2H); 2.49-2.39 (m, 6H); 2.27 (dt, 4H,J=4.3 Hz, 7.2 Hz); 1.77-1.75 (m, 2H); 1.62-1.48 (m, 15H); 1.34-1.24 (m, 50H); 0.86 (t, 9H,J=6.5 Hz).

GQ. Compound 283: Heptadecan-9-yl-8-((3-(methylamino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₂ N ₂ O ₄

Molecular weight: 737.25

[00351] Iodide was added to a solution of heptadecan-9-yl-8-((3-chloropropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (400 mg, 0.54 mmol) in 2 ml of 2-propanol sodium (10 mg, cat.) followed by the addition of 4 ml (8 mmol) of a 2M solution of methylamine in THF to give a yellow solution. It was heated to 55°C and stirred for three days, after which, according to LC/MS, no starting chloride remained. The mixture was concentrated under a stream of nitrogen and the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-( methylamino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (220 mg, 0.30 mmol, 55%) as a pale yellow oil. UHPLC/DSIO: RT=2.98 min. MS (ESI): m/z (MH ⁺ ) 737.70 for C ₄₆ H ₉₂ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, J =6.1 Hz); 4.05 (t, 2H, J =6.7 Hz); 2.72 (t, 2H, J =6.5 Hz); 2.51 (t, 2H, J =6.1 Hz); 2.46 (s, 3H); 2.40 (t, 4H, J =6.3 Hz); 2.32-2.23 (m, 4H); 1.76-1.55 (m, 8H); 1.54-1.36 (m, 8H); 1.35-1.12 (broad m, 49H); 0.87 (t, 9H, J =5.9 Hz).

G.R. Compound 284: 5-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)pentyloctylmalonate

Chemical formula: C ₁₅ H ₂₈ O ₄

Molecular weight: 272.39

[00352] To a solution of mono- tert -butylmalonate (OakWO od Products, Inc., Estill, S.C.) (1.5 g, 9.2 mmol) and 1-octanol (1.6 mL, 10.1 mmol) in 20 ml dry DCM was added 1-ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (3.1 g, 13.8 mmol) followed by 4-(dimethylamino)pyridine (0.34 g, 2.7 mmol) and finally N,N -diisopropylethylamine (4.8 mL, 27.5 mmol) was added with stirring under nitrogen to give a colorless solution. It was stirred at rt. pace. within 24 hours, after which LC/MS showed that the original acid was gone. The yellow solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate, twice with 10% aqueous citric acid, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil which was purified by silica gel chromatography (0-15% EtOAc in mixture of hexanes) to give t-butyl octyl malonate (1.86 g, 6.8 mmol, 74%) as a colorless liquid. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.11-4.06 (m, 4H); 3.41 (t, 2H, J =6.7 Hz); 2.62 (s, 4H); 1.87 (quint, 2H, J =7.2 Hz); 1.69-1.57 (m, 4H); 1.50-1.30 (m, 10H); 0.89 (t, 3H, J =6.3 Hz).

Chemical formula: C ₁₁ H ₂₀ O ₄

Molecular weight: 216.28

[00353] To a solution of tert -butyloctylmalonate (1.5 g, 5.5 mmol) in 10 ml DCM at 0° C., trifluoroacetic acid (5 ml, excess) was rapidly added dropwise with stirring to give a colorless solution. The resulting colorless solution was allowed to warm to room temperature. pace. and stirred for 24 hours, after which, according to TLC, the reaction was not completed. The solution was heated to 45° C. and stirred for three hours, after which, according to TLC, no starting material remained. The pale yellow solution was allowed to cool to room temperature. temp., concentrated and the residue was purified using silica gel chromatography (0-30% EtOAc in a mixture of hexanes) to obtain 3-(octyloxy)-3-oxopropanoic acid (0.9 g, 4.2 mmol, 75%) as colorless liquid. ¹ H-NMR (500 MHz, CDCl ₃ ) δ ppm 4.19 (t, 2H, J =6.8 Hz); 3.44 (s, 2H); 1.66 (quint, 2H, J =7.1 Hz); 1.40-1.19 (m, 10H); 0.88 (t, 3H, J =7.0 Hz); the proton of the carboxyl group was not observed.

Chemical formula: C ₁₆ H ₂₉ BrO ₄

Molecular weight: 365.31

[00354] 1 -ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (1.4 g, 6.2 mmol) followed by 4-(dimethylamino)pyridine (250 mg, 2.1 mmol) and finally N,N -diisopropylethylamine (2.2 ml, 12.5 mmol) with stirring under nitrogen atmosphere. The colorless solution was stirred at room temperature. pace. within 24 hours, after which TLC showed that the original acid was gone. The solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate (thick emulsion), once with 10% aqueous citric acid, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil. The oil was purified by silica gel chromatography (0-20% EtOAc in hexanes) to give 5-bromopentyl octyl malonate (810 mg, 2.2 mmol, 53%) as a colorless liquid. UHPLC/DSIO: RT=2.17 min. MS (ESI): m/z (M+Na ⁺ ) 387.24 for C ₁₆ H ₂₉ BrO ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.15 (dt, 4H, J =8.2 Hz, 6.6 Hz); 3.41 (t, 2H, J =6.8 Hz); 3.37 (s, 2H); 1.95-1.85 (m, 2H); 1.74-1.59 (m, 4H); 1.57-1.47 (m, 2H); 1.39-1.20 (m, 10H); 0.88 (t, 3H, J =6.6 Hz).

Chemical formula: C ₄₃ H ₈₃ NO ₇

Molecular weight: 726.14

[00355] To a solution of heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (400mg, 0.81mmol) and 6-bromohexylhexylsuccinate (300mg (0.81mmol) in 8ml dry acetonitrile in potassium iodide (150 mg, 0.9 mmol) was added under nitrogen atmosphere followed by the addition of powdered potassium carbonate (450 mg, 3.3 mmol) and the mixture was diluted with 2 ml of dry cyclopentyl methyl ether.The resulting white mixture was heated to 90°C and stirred for 24 hours, then left to cool to room temperature, filtered, the filtered solids were washed with DCM and the filtrate was concentrated.The residue was suspended in 50% saturated aqueous sodium hydrogen carbonate solution and extracted twice with DCM.The organic phases were combined, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a yellow oil It was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give 5-((8-(heptadecan-9-yloxy )-8-oxooctyl)(2-hydroxyethyl)amino)pentyloctylmalonate (225 mg, 0.31 mmol, 38%) as a colorless oil. UHPLC/DSIO: RT=3.24 min. MS (ESI): m/z (MH ⁺ ) 726.87 for C ₄₃ H ₈₃ NO ₇ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.86 (quint, 1H, 6.1 Hz); 4.14 (td, 4H, J =6.7 Hz, 2.9 Hz); 3.57 (m, 2H); 3.37 (s, 2H); 2.63 (br. s, 2H); 2.51 (br. s, 4H); 2.27 (t, 2H, J =7.4 Hz); 1.73-1.56 (m, 6H); 1.55-1.42 (m, 8H); 1.41-1.16 (m, 43H); 0.88 (t, 9H, J =6.1 Hz).

GS. Compound 285: 7-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)heptyl-(Z)-dec-3-enoate

Chemical formula: C ₁₂ H ₁₈ O ₃

Molecular weight: 210.27

[00356] Triethylamine (0.2 ml, 1 .4 mmol) and the pale yellow solution was stirred at room temperature. pace. within 20 hours, after which, according to TLC, no starting alcohol remained. The solution was concentrated and the residue was purified by silica gel chromatography (0-20% EtOAc in hexanes) to give methyl (E)-3-(oct-1-yn-3-yloxy)acrylate (2.92 g, 13. 9 mmol, 97%) as a colorless liquid. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 7.61 (d, 1H, J =12.5 Hz); 5.38 (d, 1H, J =12.5 Hz); 4.53 (td, 1H, J =6.6 Hz, 2.0 Hz); 3.70 (s, 3H); 2.58 (d, 1H, J =2.0 Hz); 1.91-1.75 (m, 2H); 1.52-1.41 (m, 2H); 1.37-1.26 (m, 4H); 0.90 (t, 3H, J =6.9 Hz).

Chemical formula: C ₁₀ H ₁₈ O ₂

Molecular weight: 170.25

[00357] In a 5 ml microwave tube, 840 mg (4 mmol) of methyl-( E )-3-(oct-1-yn-3-yloxy)acrylate and 2 ml of water were mixed to form a colorless biphasic solution. The tube was sealed and the mixture was subjected to microwave irradiation at 175°C for 90 minutes. The resulting biphasic solution was washed twice with DCM, the organic phases were washed, dried (MgSO ₄ ), filtered and the filtrate was concentrated to give a dark orange oil. This was dissolved in hexanes and purified by silica gel chromatography (0-20% EtOAc in hexanes) to give (Z)-dec-3-enoic acid (155 mg, 0.91 mmol, 23%) as an orange oil . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 11.03 (br. s, 1H); 5.70-5.44 (m, 2H); 3.14 (d, 2H, J =6.6 Hz); 2.04 (k, 2H, J =6.8 Hz); 1.43-1.13 (m, 8H); 0.88 (t, 3H, J =6.8 Hz). (Z)-Geometry confirmed by 1D NOEsy selective gradient experiments with irradiation at 2.07 ppm. (C-5 protons) and 3.16 ppm. (protons C-2).

Chemical formula: C ₁₇ H ₃₁ BrO ₂

Molecular weight: 347.34

[00358] 1 - ethyl -3-(dimethylaminopropyl)carbodiimide hydrochloride (440 mg, 1.94 mmol) followed by DMAP (80 mg, 0.65 mmol) and finally N,N -diisopropylethylamine (680 μl, 3.88 mmol). The resulting orange solution was stirred at room temperature. pace. within 24 hours, after which LC/MS showed that the original acid was gone. The solution was diluted with DCM, washed once with saturated aqueous sodium hydrogen carbonate (thick emulsion), once with 10% aqueous citric acid, dried (MgSO ₄ ), filtered, and the filtrate was concentrated to give a yellow oil. This was purified by silica gel chromatography (0-15% EtOAc in hexanes) to give 7-bromoheptyl-( Z )-dec-3-enoate (250 mg, 0.72 mmol, 56%) as a light yellow liquid . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.65-5.49 (m, 2H); 4.07 (t, 2H, J =6.7 Hz); 3.40 (t, 2H, J =6.8 Hz); 3.08 (d, 2H, J =5.5 Hz); 2.04 (k, 2H, J =6.8 Hz); 1.92-1.79 (m, 2H); 1.70-1.56 (m, 2H); 1.51-1.20 (m, 14H); 0.88 (t, 3H, J =6.3 Hz).

Chemical formula: C ₄₄ H ₈₅ NO ₅

Molecular weight: 708.17

[00359] Compound 285 was prepared from heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate (350 mg, 0.71 mmol) analogously to compound 284 except that 7-bromoheptyl-( Z )-dec -3-enoate (250 mg, 0.72 mmol) was used instead of 5-bromopentyloctylmalonate. After working up the reaction mixture with water, the resulting yellow oil was purified by silica gel chromatography (0-40% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give 7-((8-(heptadecan-9-yloxy )-8-oxooctyl)(2-hydroxyethyl)amino)heptyl ( Z )-dec-3-enoate (205 mg, 0.29 mmol, 41%) as a colorless oil. UHPLC/DSIO: RT=3.35 min. MS (ESI): m/z (MH ⁺ ) 708.75 for C ₄₄ H ₈₅ NO ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.64-5.48 (m, 2H); 4.86 (quint, 1H, J =6.2 Hz); 4.07 (t, 2H, J =6.7 Hz); 3.55 (t, 2H, J =5.0 Hz); 3.40 (t, 2H, J =6.8 Hz); 3.08 (d, 2H, J =5.6 Hz); 2.61 (t, 2H, J =4.1 Hz); 2.47 (t, 4H, J =6.8 Hz); 2.27 (t, 2H, J =7.5 Hz); 2.04 (k, 2H, J =6.8 Hz); 1.70-1.55 (m, 4H); 1.54-1.40 (m, 6H); 1.39-1.13 (m, 45H); 0.87 (t, 9H, J =6.5 Hz).

GT. Compound 286: Heptadecan-9-yl-8-((3-acetamido-2,2-dimethylpropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₂ H ₁₀₂ N ₂ O ₆

Molecular weight: 850.77

[00360] Heptadecan-9-yl-8-((3-((tert-butoxycarbonyl)amino)-2,2-dimethylpropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate was prepared from heptadecan-9- yl-8-((8-(nonyloxy)-8-oxooctyl)amino)octanoate (500 mg, 0.75 mmol) as 244 except that tert -butyl-(2,2-dimethyl-3-oxopropyl )carbamate (Enamine LLC, Monmouth Junction, NJ) (231 mg, 1.13 mmol) was used instead of N -Boc-glycinal, three equivalents of sodium triacetoxyborohydride were required and the reaction was carried out at 50° C. for three days. After working up the reaction mixture with water, the resulting yellow oil was purified by silica gel chromatography (0-50% methanol in DCM) and product containing fractions were collected and concentrated to give a colorless oil/white solid mixture. This mixture was purified by silica gel chromatography (0-25% EtOAc in hexanes) to give heptadecan-9-yl-8-((3-((tert-butoxycarbonyl)amino)-2,2-dimethylpropyl)(8- (nonyloxy)-8-oxooctyl)amino)octanoate (85 mg, 0.1 mmol, 13%) as a pale yellow oil. UHPLC/DSIO: RT=3.65 min. MS (ESI): m/z (MH ⁺ ) 852.01 for C ₅₂ H ₁₀₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.32 (br. s, 1H); 4.86 (quint, 1H, J= 6.1 Hz); 4.05 (t, 2H, J =6.8 Hz); 2.99 (d, 2H, J =4.6 Hz); 2.37 (t, 4H, J =7.4 Hz); 2.32-2.19 (m, 6H); 1.69-1.55 (m, 6H); 1.54-1.37 (m, 16H); 1.36-1.15 (m, 49H); 0.91-0.84m, 15H).

Chemical formula: C ₄₇ H ₉₄ N ₂ O ₄

Molecular weight: 751.28

[00361] To a solution of heptadecan-9-yl-8-((3-((tert-butoxycarbonyl)amino)-2,2-dimethylpropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (85 mg, 0.1 mmol) in 2 ml of DCM cooled to 0 ^° C., a 2M solution of hydrogen chloride in diethyl ether (0.5 ml, excess) was added with stirring to give a colorless solution. This solution was allowed to warm to room temperature. temp., then heated to 40°C and stirred for two hours after which, according to LC/MS, no starting material remained. The solution was allowed to cool to room temperature and concentrated under nitrogen flow, the residue was redissolved in ether, concentrated and placed under high vacuum overnight to give heptadecan-9-yl-8-((3-amino-2,2-dimethylpropyl)(8 -(nonyloxy)-8-oxooctyl)amino)octanoate (79.3 mg, 0.096 mmol, 96%) as a colorless foamy solid (presumably dihydrochloride). Used without further purification. UHPLC/DSIO: RT=3.12 min. MS (ESI): m/z (MH ⁺ ) 751.97 for C ₄₇ H ₉₄ N ₂ O ₄ .

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₅

Molecular weight: 793.32

[00362] To a solution of heptadecan-9-yl-8-((3-amino-2,2-dimethylpropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (presumably dihydrochloride)(79 mg (0.096 mmol) and triethylamine (41 µl, 0.29 mmol) in 2 ml dry DCM cooled to 0 ^° C, acetic anhydride (13 µl, 0.15 mmol) was added dropwise with stirring.After 15 minutes, the cooling bath was removed and the resulting mixture was stirred at room temperature for two hours According to LC/MS no starting amine remained, so the yellow solution was diluted with DCM, washed twice with saturated aqueous sodium hydrogen carbonate, once with saturated aqueous sodium chloride, dried (MgSO ₄ ), filtered and the filtrate concentrated to give a yellow oil It was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-acetamido -2,2-dimethylpropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (56mg, 0.07mmol, 73%) as a pale yellow oil UHPLC/DSIO: RT=3.52 min . MS (ESI): m/z (MH ⁺ ) 793.95 for C ₄₉ H ₉₆ N ₂ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.06 (t, 1H, J =4.2 Hz); 4.86 (quint, 1H, J= 6.2 Hz); 4.05 (t, 2H, J =6.8 Hz); 3.13 (d, 2H, J =4.6 Hz); 2.41 (t, 4H, J =7.4 Hz); 2.35-2.21 (m, 6H); 1.94 (s, 3H); 1.69-1.56 (m, 6H); 1.55-1.39 (m, 8H); 1.38-1.13 (m, 48H); 0.95-0.82m, 15H).

G.U. Compound 287: Heptadecan-9-yl-( Z )-6-(cyanoimino)-2,5-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-2,5,7,11-tetraazanonedecane-19-oat

Chemical formula: C ₅₂ H ₁₀₂ N ₆ O ₄

Molecular weight: 875.43

[00363] Compound 287 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 168 except that that N,N,N' -trimethylethylene-1,2-diamine (90 μl, 0.69 mmol) was used instead of dimethylamine solution and the second step was carried out at 70° C. for two days. After working up the reaction mixture with water, the resulting cloudy pale yellow oil was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-( Z ) -6-(cyanoimino)-2,5-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-2,5,7,11-tetraazanonedecane-19-oate (172 mg, 0.35 mmol, 57 %) as a colorless oil. UHPLC/DSIO: RT=3.00 min. MS (ESI): m/z (MH ⁺ ) 876.20 for C ₅₂ H ₁₀₂ N ₆ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 8.68 (br. s, 1H); 4.86 (quint, 1H, J =6.2 Hz); 4.05 (t, 2H, J =6.8 Hz); 3.54-3.43 (m, 2H); 3.31 (t, 2H, J =4.8 Hz); 3.03 (s, 3H); 2.55-2.44 (m, 4H); 2.44-2.33 (br. s, 3H); 2.32-2.23 (m, 10H); 1.74-1.55 (m, 8H); 1.54-1.37 (m, 8H); 1.36-1.18 (m, 49H); 0.87 (t, 9H, J =6.8 Hz).

g.v. Compound 288: Heptadecan-9-yl-( Z )-9-(cyanoimino)-2-methyl-14-(8-(nonyloxy)-8-oxooctyl)-5-oxa-2,8,10,14-tetraazadocosan-22-oate

Chemical formula: C ₅₃ H ₁₀₄ N ₆ O ₅

Molecular weight: 905.45

[00364] Compound 288 was prepared from heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (250 mg, 0.35 mmol) analogously to compound 168 except that that 2-(2-aminoethoxy)-N ,N -dimethylethane-1-amine (110 μl, 0.76 mmol) was used instead of the dimethylamine solution and the second step was carried out at 75° C. for two days. After working up the reaction mixture with water, the resulting pale yellow oil was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-( Z )- 9-(cyanoimino)-2-methyl-14-(8-(nonyloxy)-8-oxooctyl)-5-oxa-2,8,10,14-tetraazadocosan-22-oate (147 mg, 0.16 mmol, 47%) as a colorless oil. UHPLC/DSIO: RT=3.07 min. MS (ESI): m/z (MH ⁺ ) 906.05 for C ₅₃ H ₁₀₄ N ₆ O ₅ . ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 6.95 (br. s, 1H); 6.18 (br. s, 1H); 4.86 (quint, 1H, J =6.2 Hz); 4.05 (t, 2H, J =6.8 Hz); 3.56 (t, 4H, J =5.6 Hz); 3.37 (q, 2H, J =5.0 Hz); 3.26 (q, 2H, J=5.6 Hz); 2.52 (q, 4H, J=6.2 Hz); 2.44 (t, 4H, J =7.6 Hz); 2.35-2.20 (m, 10H); 1.75-1.55 (m, 8H); 1.54-1.38 (m, 8H); 1.37-1.15 (m, 48H); 0.87 (t, 9H, J =6.4 Hz).

GW. Compound 289: Heptadecan-9-yl-8-((8-(nonyloxy)-8-oxooctyl)(3-(thiazol-2-ylamino)propyl)amino)octanoate

Chemical formula: C ₅₃ H ₉₉ N ₃ O ₆ S

Molecular weight: 906.45

[00365] To a solution of heptadecan-9-yl-8-((3-hydroxypropyl)(8-nonyloxy)-8-oxooctyl)amino)octanoate (1.0 g, 1.38 mmol) in tetrahydrofuran (20 ml), containingtert-butylthiazol-2-ylcarbamate (276 mg, 1.38 mol) and triphenylphosphine (544 mg, 2.07 mmol) at 0°C, diisopropyl azodicarboxylate (DIAD) (0.4 ml, 2.07 mmol) was added dropwise and the reaction mixture was stirred at room temperature overnight. The solvent was removed in vacuo to give the crude product, which was purified by silica gel chromatography (0-50% EtOAc in hexanes) to give heptadecan-9-yl-8-((3-((tert-butoxycarbonyl)(thiazole-2 -yl)amino)propyl) (8-(nonyloxy)-8-oxooctyl)amino)octanoate (512 mg, 0.56 mmol, 41%) as a colorless oil (containing the by-product DIAD as an impurity). MS (HIAD):m/z (MH⁺) 906.7 for C₅₃H₉₉N₃O₆S.¹H NMR (300 MHz, CDCl₃): δ ppm 7.39 (d, 1H,J=3.6 Hz); 6.89 (d, 1H,J=3.6 Hz); 4.87-4.80 (m, 1H); 4.04 (t, 2H,J=6.6 Hz); 2.51-2.48 (m, 2H); 2.41-2.37 (m, 4H); 2.26 (dt, 4H,J=7.5 Hz, 3.7 Hz); 1.84-1.79 (m, 2H); 1.62-1.57 (m, 12H); 1.49-1.41 (m, 5H); 1.39-1.24 (m, 56H); 0.86 (t, 9H,J=6.6 Hz).

Chemical formula: C ₄₈ H ₉₁ N ₃ O ₄ S

Molecular weight: 806.33

[00366] To a solution of heptadecan-9-yl-8-((3-((tert-butoxycarbonyl)(thiazol-2-yl)amino)propyl) (8-(nonyloxy)-8-oxooctyl)amino)octanoate (512 mg, 0.56 mmol) in dichloromethane (15 ml) at 0°C was added dropwise trifluoroacetic acid (10 ml) and the reaction mixture was stirred at room temperature overnight. It was quenched with saturated aqueous sodium hydrogen carbonate at 0°C. The organic layer was washed with saturated sodium hydrogen carbonate solution, 0.1 N sodium hydroxide solution and saturated aqueous sodium chloride solution. After drying over anhydrous sodium sulfate, the organic layer was filtered and the solvent removed in vacuo to give the crude product, which was purified by silica gel chromatography (0-100% EtOAc in hexanes) to give heptadecan-9-yl-8-((8- (nonyloxy)-8-oxooctyl)(3-(thiazol-2-ylamino)propyl)amino)octanoate (280 mg, 0.34 mmol, 61%) as a light yellow oil. HPLC/UV (214 nm): RT=7.01 min. MS (APCI): m/z (MH ⁺ ) 806.6 for C ₄₈ H ₉₁ N ₃ O ₄ S. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm. 7.09 (d, 1H, J =3.6 Hz); 6.96 (br. s, 1H); 6.42 (d, 1H, J =3.9 Hz); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.39-3.35 (m, 2H); 2.54 (t, 2H, J =5.7 Hz); 2.40-2.35 (m, 4H); 2.26 (dt, 4H, J =3.7 Hz, 7.5 Hz); 1.77-1.73 (m, 2H); 1.61-1.57 (m, 6H); 1.48-1.43 (m, 8H); 1.29-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

GX. Compound 290: Heptadecan-9-yl-8-((3-((2-((2-methoxyethyl)amino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-( nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₂ H ₉₇ N ₃ O ₇

Molecular weight: 876.36

[00367] To a solution of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (500 mg, 0.69 mmol) in diethyl ether (50 mL) at 0°C was added 3,4-dimethoxycyclobut-3-ene-1,2-dione (148 mg, 1.04 mmol) and the reaction mixture was stirred at room temperature for 2 hours. LCMS showed no starting material. Then a solution of 2-methoxyethane-1-amine (0.6 ml, 6.9 mmol) in tetrahydrofuran (3.5 ml) was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was concentrated and purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-((2- ((2-methoxyethyl)amino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (350 mg, 58%) as light yellow oil. HPLC/UV (254 nm): 6.91 min. MS (CI): m/z (MH ⁺ ) 876.6 for C ₅₂ H ₉₇ N ₃ O ₇ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.10 (br. s, 1H); 6.20 (br. s, 1H); 4.86-4.82 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.76-3.68 (m, 4H); 3.52 (t, 2H, J =4.8 Hz); 3.35 (s, 3H); 2.53 (t, 2H, J =6.0 Hz); 2.39-2.36 (m, 4H); 2.31-2.25 (m, 4H); 1.75-1.71 (m, 2H); 1.66-1.55 (m, 6H); 1.50-1.48 (m, 4H); 1.40-1.38 (m, 4H); 1.29-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

GY. Compound 291: Heptadecan-9-yl-8-((3-((3,4-dioxo-2-(piperidin-1-yl)cyclobut-1-en-1-yl)amino)propyl)(8-( nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₄ H ₉₉ N ₃ O ₆

Molecular weight: 886.40

[00368] Compound 291 was prepared analogously to compound 290, but using piperidine instead of 2-methoxyethane-1-amine. Light yellow oil, 290 mg, 47%. HPLC/UV (254 nm): RT=6.70 min. MS (CI): m/z (MH ⁺ ) 886.7 for C ₅₄ H ₉₉ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 8.01 (br. s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.93-3.92 (m, 2H); 3.59 (br. s, 4H); 2.63-2.60 (m, 2H); 2.39 (m, 4H); 2.31-2.24 (m, 4H); 1.72-1.54 (m, 17H); 1.49-1.48 (m, 5H); 1.38-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

gz. Compound 292: Heptadecan-9-yl-8-((3-((2-(ethylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8- oxooctyl)amino)octanoate

Chemical formula: C ₅₁ H ₉₅ N ₃ O ₆

Molecular weight: 846.34

[00369] Compound 292 was prepared analogously to compound 290, but using ethylamine instead of 2-methoxyethane-1-amine. Light yellow resinous solid, 135 mg, 23%. HPLC/UV (254 nm): RT=6.81 min. MS (CI): m/z (MH ⁺ ) 846.6 for C ₅₁ H ₉₅ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 6.20 (br. s, 1H); 4.86-4.82 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.69-3.56 (m, 4H); 2.56 (t, 2H, J =5.5 Hz); 2.44-2.39 (m, 4H); 2.31-2.25 (m, 4H); 1.76-1.72 (m, 2H); 1.70-1.52 (m, 9H); 1.51-1.44 (m, 5H); 1.42-1.38 (m, 4H); 1.28-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

HA. Compound 293: Heptadecan-9-yl-8-((3-((2-(diethylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8- oxooctyl)amino)octanoate

Chemical formula: C ₅₃ H ₉₉ N ₃ O ₆

Molecular weight: 874.39

[00370] Compound 293 was prepared analogously to compound 290, but using diethylamine instead of 2-methoxyethane-1-amine. Yellow oil, 315 mg, 52%. HPLC/UV (254 nm): RT=6.63 min. MS (CI): m/z (MH ⁺ ) 874.7 for C ₅₃ H ₉₉ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.52 (br. s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.93-3.91 (m, 2H); 3.53 (m, 4H), 2.62-2.59 (m, 2H); 2.41-2.39 (m, 4H); 2.30-2.24 (m, 4H); 1.72 (m, 2H); 1.61-1.58 (m, 11H); 1.50-1.48 (m, 5H); 1.40-1.37 (m, 4H); 1.29-1.20 (m, 48H); 0.86 (t, 9H, J =6.7 Hz).

H.B. Compound 294: Heptadecan-9-yl-8-((3-((2-morpholino-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl) amino)octanoate

Chemical formula: C ₅₃ H ₉₇ N ₃ O ₇

Molecular weight: 888.37

[00371] Compound 294 was prepared analogously to compound 290, but using morpholine instead of 2-methoxyethane-1-amine. Light yellow oil, 297 mg, 48%. HPLC/UV (254 nm): RT=6.67 min. MS (CI): m/z (MH ⁺ ) 888.6 for C ₅₃ H ₉₇ N ₃ O ₇ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 8.12 (br. s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.92-3.91 (m, 2H); 3.77-3.73 (m, 4H); 3.67-3.66 (m, 4H); 2.62-2.60 (m, 2H); 2.41-2.36 (m, 4H); 2.31-2.25 (m, 4H); 1.72-1.71 (m, 2H); 1.63-1.58 (m, 10H); 1.50-1.48 (m, 4H); 1.29-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

HC. Compound 295: Heptadecan-9-yl-8-((3-((2-(bis(2-methoxyethyl)amino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8- (nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₅ H ₁₀₃ N ₃ O ₈

Molecular weight: 934.44

[00372] Compound 295 was prepared analogously to compound 290, but using bis(2-methoxyethyl)amine instead of 2-methoxyethane-1-amine. Yellow oil, 215 mg, 33%. HPLC/UV (254 nm): RT=6.73 min. MS (CI): m/z (MH ⁺ ) 934.7 for C ₅₅ H ₁₀₃ N ₃ O ₈ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 6.74 (t, 1H, J =5.9 Hz); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.77-3.71 (m, 4H); 3.57-3.56 (m, 4H); 3.35 (s, 6H); 2.50-2.47 (m, 2H); 2.40-2.36 (m, 4H); 2.30-2.24 (m, 4H); 1.77 (t, 2H, J =6.7 Hz); 1.62-1.52 (m, 8H); 1.50-1.42 (m, 4H); 1.40-1.36 (m, 4H); 1.29-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

HD. Compound 296: Heptadecan-9-yl-8-((3-(((2-(4-methylpiperazin-1-yl)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8- (nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₄ H ₁₀₀ N ₄ O ₆

Molecular weight: 901.42

[00373] Compound 296 was prepared analogously to compound 290, but using N -methylpiperazine instead of 2-methoxyethane-1-amine. Yellow oil, 210 mg, 34%. HPLC/UV (254 nm): RT=6.28 min. MS (APCI): m/z (MH ⁺ ) 901.7 for C ₅₄ H ₁₀₀ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 8.05 (br. s, 1H); 4.87-4.82 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.91-3.90 (m, 2H); 3.70 (br. s, 4H); 2.71 (m, 2H); 2.48-2.45 (m, 8H); 2.31 (s, 3H); 2.28-2.26 (m, 4H); 1.71-1.58 (m, 10H); 1.52-1.48 (m, 6H), 1.30-1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

HE. Compound 297: Nonyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)-7-hydroxyoctanoate

Stage 1: Nonyloct-7-enoate

Chemical formula: C ₁₇ H ₃₂ O ₂

Molecular weight: 268.44

[00374] To a solution of oct-7-enoic acid (2 g, 14.065 mmol), 4-(dimethylamino)pyridine (0.344 g, 2.813 mmol) and 1-nonanol (2.435 g, 16.878 mmol) in DCM (70 ml) was added EDC (2.696 g, 14.065 mmol). The reaction mixture was allowed to stir at room temperature. pace. for 16 h. The reaction mixture was diluted with DCM and extracted with sat. aqueous solution of sodium bicarbonate. The organic layer was separated, washed with saturated aqueous sodium chloride, dried over MgSO ₄ , filtered and evaporated under vacuum. The residue was purified by silica gel chromatography (0-20% ethyl acetate in hexanes) to give nonyloct-7-enoate (2.1 g, 7.82 mmol, 56%). ¹ H NMR (300 MHz, CDCl ₃ ) δ ppm 5.83 (m, 1H); 4.98 (m, 2H); 4.08 (t, 2H); 2.32 (t, 2H); 2.08 (m, 2H); 1.65 (m, 4H); 1.50-1.19 (m, 16H); 0.90 (m, 3H).

Stage 2: Nonyl-6-(oxiran-2-yl)hexanoate

Chemical formula: C ₁₇ H ₃₂ O ₃

Molecular weight: 284.44

[00375] To a solution of nonyloct-7-enoate (2.07 g, 7.71 mmol) in DCM (38 ml) at 0°C was added a solution of 3-chloroperbenzoic acid (2.129 g, 8.64 mmol) in DCM (38 ml). After 2 hours the reaction mixture was allowed to warm to room temperature. pace. and stirred for 16 hours. The reaction mixture was diluted with DCM and washed with sat. aqueous solution of sodium bicarbonate. The organic layer was separated, washed with saturated aqueous sodium chloride, dried over sodium sulfate, filtered and evaporated in vacuo. The residue was purified by silica gel chromatography (0-100% ethyl acetate in hexanes) to give nonyl 6-(oxiran-2-yl)hexanoate (1.1 g, 3.86 mmol, 50%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (t, 2H); 2.92 (m, 1H); 2.77 (t, 1H); 2.48 (m, 1H); 2.33 (t, 2H); 1.71-1.26 (m, 22H); 0.91 (m, 3H).

Stage 3: Nonyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)-7-hydroxyoctanoate

Chemical formula: C ₄₃ H ₈₅ NO ₅

Molecular weight: 696.15

[00376] Nonyl-6-(oxiran-2-yl)hexanoate (0.173 g, 0.61 mmol), heptadecan-9-yl-8-(methylamino)octanoate (0.25 g, 0. 61 mmol) and a catalytic amount of lithium perchlorate (0.003 g, 0.03 mmol). The vessel was sealed and the reaction mixture was heated to 100°C for 60 minutes. The reaction mixture was left to cool to room. temp., dissolved in a mixture of hexanes and purified using silica gel chromatography (0-40% ethyl acetate in a mixture of hexanes) to obtain nonyl-8-{[8-(heptadecan-9-yloxy)-8-oxooctyl](methyl)amino }-7-hydroxyoctanoate (0.097 g, 0.14 mmol, 23%). LC/DSIO: RT=3.33 min. MS (ESI): m/z (MH ⁺ ) 697.11 for C ₄₃ H ₈₅ NO _5. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.66 (broad m, 2H); 2.50 (broad m, 1H); 2.43-2.20 (m, 10H); 1.76-1.19 (m, 60H); 0.90 (m, 9H).

HF. Compound 298: Nonyl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)-7-hydroxyoctanoate

Chemical formula: C ₄₄ H ₈₇ NO ₆

Molecular weight: 726.18

[00377] Compound 298 was prepared analogously to compound 297 using heptadecan-9-yl-8-((2-hydroxyethyl)amino)octanoate instead of heptadecan-9-yl-8-(methylamino)octanoate. The yield was 0.121 g (0.167 mmol, 29%) LC/DSIO: RT=3.32 min. MS (ESI): m/z (MH ⁺ ) 727.12 for C ₄₄ H ₈₇ NO _6. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.66 (broad m, 3H); 2.79 (m, 1H); 2.69-2.24 (m, 10H); 1.74-1.22 (m, 60H); 0.90 (m, 9H) (primary hydroxyl proton not observed).

hg. Compound 299: Heptadecan-9-yl-7-hydroxy-8-(methyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Stage 1: Heptadecan-9-iloct-7-enoate

Chemical formula: C ₂₅ H ₄₈ O ₂

Molecular weight: 380.66

[00378] Heptadecan-9-yl-oct-7-enoate was synthesized in a manner analogous to the synthesis of nonyloct-7-enoate using heptadecan-9-ol and oct-7-enoic acid. The yield was 2.15 g (5.65 mmol, 80%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 5.83 (m, 1H); 5.08-4.81 (m, 3H); 2.31 (t, 2H); 2.06 (m, 2H); 1.73-1.15 (m, 34H); 0.90 (m, 6H).

Stage 2: Heptadecan-9-yl-6-(oxiran-2-yl)hexanoate

Chemical formula: C ₂₅ H ₄₈ O ₃

Molecular weight: 396.66

[00379] Heptadecan-9-yl 6-(oxiran-2-yl)hexanoate was synthesized in a manner analogous to the synthesis of nonyl-6-(oxiran-2-yl)hexanoate using heptadecan-9-yloct-7-enoate. The yield was 1.45 g (3.66 mmol, 69%). ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (n, 1H); 2.92 (m, 1H); 2.77 (t, 1H); 2.48 (m, 1H); 2.32 (t, 2H); 1.74-1.21 (m, 36H); 0.90 (m, 6H).

Stage 3: Nonyl-8-(methylamino)octanoate

Chemical formula: C ₁₈ H ₃₇ NO ₂

Molecular weight: 299.49

[00380] To a flask containing nonyl-8-bromooctanoate (1 g, 2.86 mmol) was added a 2M solution of methylamine (42.9 ml, 85.87 mmol) in THF. The reaction mixture was allowed to stir at room temperature. pace. for 16 hours, then concentrated in vacuo. The residue was diluted with ethyl acetate and washed with saturated sodium hydrogen carbonate solution. The organic layer was separated, washed with saturated aqueous sodium chloride, dried over Na ₂ SO ₄ , filtered and evaporated under vacuum. The residue was purified by silica gel chromatography (0-20% MeOH in DCM) to give nonyl 8-(methylamino)octanoate (0.625 g, 2.86 mmol, 73%). LC/DSIO: RT=1.19 min. MS (ESI): m/z (MH ⁺ ) 300.17 for C ₁₈ H ₃₇ NO _2. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.08 (t, 2H); 2.60 (t, 2H); 2.46 (s, 3H); 2.31 (t, 2H); 1.91-1.45 (m, 7H); 1.33 (m, 18H); 0.90 (m, 3H).

Stage 4: Heptadecan-9-yl-7-hydroxy-8-(methyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₃ H ₈₅ NO ₅

Molecular weight: 696.16

[00381] Compound 299 was synthesized in a manner analogous to the synthesis of compound 297 using nonyl-8-(methylamino)octanoate and heptadecan-9-yl-6-(oxiran-2-yl)hexanoate. The yield was 0.152 mg (0.218 mmol, 39%). LC/DSIO: RT=3.25 min. MS (ESI): m/z (MH ⁺ ) 697.85 for C ₄₃ H ₈₅ NO _5. ¹ H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.89 (m, 1H); 4.08 (t, 2H); 3.66 (broad m, 1H); 2.52 (broad m, 1H); 2.31 (broad m, 10H); 1.75-1.20 (m, 60H); 0.90 (m, 9H) (hydroxyl proton not observed).

HH. Compound 300: Heptadecan-9-yl-8-((3-(2-cyano-3,3-dimethylguanidino)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Stage 1: Undecan-3-yl-8-bromooctanoate

Chemical formula: C ₁₉ H ₃₇ BrO ₂

Molecular weight: 377.41

[00382] To a solution of 3-undecanol (4.14 g, 24 mmol), 8-bromooctanoic acid (8.01 g, 36 mmol) and DMAP (0.58 g, 4.8 mmol) in dichloromethane (50 ml) at 0°C was added EDCI (6.9 g, 36 mmol) and the reaction mixture was stirred at room temperature overnight. TLC showed that the reaction was complete. The reaction mixture was cooled to 0° C. and a hydrochloric acid solution (10 ml conc. HCl, 90 ml water, 7.5 g sodium chloride) was added very slowly over 20 minutes. Then acetonitrile (100 ml) was added and hexane (100 ml) was added, the layers were separated and the organic layer was dried and evaporated in vacuo to give an oil. The oil was dissolved in hexane (100 ml) and washed with a mixture of acetonitrile (100 ml) and 5% aqueous sodium hydrogen carbonate solution (100 ml). The hexane layer was separated and filtered through diatomaceous earth, the press cake was washed with hexane and the filtrate was concentrated in vacuo to give undecan-3-yl-8-bromooctanoate (8.76 g, 97%) as a colorless oil. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.82-4.76 (m, 1H); 3.39 (t, 2H, J =6.7 Hz); 2.44 (t, 0.3H, J =7.4 Hz, for C H ₂ Cl); 2.28 (t, 2H, J =7.5 Hz, for C H ₂ Br); 1.88-1.79 (m, 2H); 1.70-1.42 (m, 6H); 1.38-1.17 (m, 18H); 0.88-0.82 (m, 6H).

Stage 2: Heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)amino)octanoate

Chemical formula: C ₃₃ H ₆₆ N ₂ O ₄

Molecular weight: 554.90

[00383] A solution of heptadecan-9-yl-8-bromooctanoate (69.2 g, 0.15 mol) and tert -butyl-(3-aminopropyl)carbamate (130.6 g, 0.75 mol) in 500 ml of ethanol heated to 65°C during the night. The reaction mixture was concentrated and the crude product was purified by silica gel chromatography (0-20% methanol in DCM) to give heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)amino)octanoate (62 g, 74%) as a light yellow oil MS (CI): m/z (MH ⁺ ) 555.5 for C ₃₃ H ₆₆ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.15 (br. s, 1H); 4.85 (quint, 1H, J =6.0 Hz); 3.17 (m, 2H); 2.65 (t, 2H, J =6.6 Hz); 2.56 (t, 2H, J =6.8 Hz); 2.26 (t, 2H, J =7.6 Hz); 1.68-1.56 (m, 6H); 1.46 (m, 5H); 1.43 (s, 9H); 1.24 (m, 30H); 0.86 (t, 6H, J =6.6 Hz).

Stage 3: Heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₅₂ H ₁₀₂ N ₂ O ₆

Molecular weight: 851.40

[00384] A solution of heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)amino)octanoate (6.0 g, 12 mmol) and undecan-3-yl-8-bromooctanoate (4 .27 g, 11 mmol) in cyclopentylmethyl ether (50 ml) and acetonitrile (50 ml) containing potassium carbonate (6.02 g, 43 mmol) and potassium iodide (1.97 g, 12 mmol) was heated at 86°C within 18 hours. After cooling to room temperature, the reaction mixture was filtered through diatomaceous earth, the filter press cake was washed with ethyl acetate, and the filtrate was concentrated in vacuo to give the crude product, which was purified by silica gel chromatography (0-100% EtOAc in hexanes) to give heptadecane-9 -yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (6.8g, 74%) as oil . MS (CI): m/z (MH ⁺ ) 851.7 for C ₅₂ H ₁₀₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.66 (m, 1H); 4.87-4.80 (m, 2H); 3.17 (m, 2H); 2.42 (t, 2H, J =6.3 Hz); 2.35-2.24 (m, 8H); 1.64-1.56 (m, 12H); 1.53-1.44 (m, 9H); 1.44-1.36 (m, 3H); 1.42 (s, 9H); 1.32-1.12 (m, 42H); 0.86 (t, 12H, J =6.4Hz).

Stage 4: Heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₄₇ H ₉₄ N ₂ O ₄

Molecular weight: 751.28

[00385] To a solution of heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (6.8 g, 7.99 mmol) in dichloromethane (30 ml) at 0° C., trifluoroacetic acid (10 ml) was added dropwise and the reaction mixture was stirred at room temperature overnight. The reaction mixture was quenched with saturated aqueous sodium hydrogen carbonate at 0°C. The organic layer was washed with an aqueous saturated sodium hydrogen carbonate solution, a 0.1 N sodium hydroxide solution, and an aqueous saturated sodium chloride solution. After drying over anhydrous sodium sulfate, the solvent was removed in vacuo to give heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (5.7 g, 97%) as an oil. MS (CI): m/z (MH ⁺ ) 751.7 for C ₄₇ H ₉₄ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.87-4.79 (m, 2H); 2.70 (t, 2H, J =6.8 Hz); 2.42-2.33 (m, 6H); 2.27 (dt, 4H, J =2.8 Hz, 7.4 Hz); 1.68-1.46 (m, 22H); 1.44-1.35 (m, 4H); 1.34-1.16 (m, 42H); 0.88-0.84 (m, 12H).

Stage 5: Heptadecan-9-yl-8-((3-(2-cyano-3,3-dimethylguanidino)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₅₁ H ₉₉ N ₅ O ₄

Molecular weight: 846.38

[00386] Compound 300 was prepared analogously to compound 168 except that heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (500 mg, 0.66 mmol) was used instead of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-cyano-3,3-dimethylguanidino)propyl)(8-oxo-8-(undecane-3- yloxy)octyl)amino)octanoate (240 mg, 43%) as a colorless oil. HPLC/UV (254 nm): RT=8.60 min. MS (HI):m/z (MH⁺) 846.7 for C₅₁H₉₉N₅O₄.¹H NMR (300 MHz, CDCl₃): δ ppm 7.59 (br. s, 1H); 4.87-4.80 (m, 2H); 3.70-3.64 (m, 2H); 3.03 (s, 6H); 2.69-2.42 (m, 4H); 2.28 (dd, 4H,J=3.0 Hz, 7.4 Hz); 1.71-1.42 (m, 26H); 1.36-1.16 (m, 42H); 0.88-0.84 (m, 12H).

HI. Compound 301: Heptadecan-9-yl-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-oxo-8-(undecane -3-yloxy)octyl)amino)octanoate

Chemical formula: C ₅₂ H ₉₇ N ₃ O ₆

Molecular weight: 860.36

[00387] Compound 301 was prepared analogously to compound 182 except that heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (500 mg, 0.66 mmol) was used in place of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl )(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (180 mg, 32%) as a white waxy solid. HPLC/UV (254 nm): RT=6.77 min. MS (HI):m/z (MH⁺) 860.7 for C₅₂H₉₇N₃O₆.¹H NMR (300 MHz, CDCl₃): δ ppm 4.86-4.79 (m, 2H); 3.66 (br. s, 2H); 3.25 (d, 3H,J=4.9 Hz); 2.56-2.52 (m, 2H); 2.42-2.37 (m, 4H); 2.28 (dd, 4H,J=2.7 Hz, 7.4 Hz); 1.78-1.68 (m, 3H); 1.64-1.50 (m, 16H); 1.48-1.38 (m, 6H); 1.32-1.18 (m, 43H); 0.88-0.84 (m, 12H).

H.J. Connection 302: Heptadecan-9-yl-8-((3-(3,3-dimethylthioureido)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₉ N ₃ O ₄ S

Molecular weight: 838.42

[00388] Compound 302 was prepared analogously to compound 111 except that heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (500 mg, 0.66 mmol) was used instead of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(3,3-dimethylthioureido)propyl)(8-oxo-8-(undecan-3-yloxy)octyl) amino) octanoate (140 mg, 25%) as a yellow oil. HPLC/UV (254 nm): RT=6.03 min. MS (HI):m/z (MH⁺) 838.7 for C₅₀H₉₉N₃O₄S.¹H NMR (300 MHz, CDCl₃): δ ppm 4.87-4.80 (m, 2H); 3.83 (br. s, 2H); 3.27 (s, 6H); 2.91-2.64 (m, 4H); 2.27 (dd, 4H,J=3.1 Hz, 7.5 Hz); 1.68-1.42 (m, 27H); 1.38-1.12 (m, 42H); 0.88-0.84 (m, 12H).

H.K. Compound 303: Heptadecan-9-yl-8-((3-((1-(methylamino)-2-nitrovinyl)amino)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₈ N ₄ O ₆

Molecular weight: 851.36

[00389] Compound 303 was prepared analogously to compound 170 except that heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (500 mg, 0.66 mmol) was used in place of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-((1-(methylamino)-2-nitrovinyl)amino)propyl)(8-oxo-8-(undecane -3-yloxy)octyl)amino)octanoate (270 mg, 40%) as an oil. HPLC/UV (254 nm): RT=8.19 min. MS (HI):m/z (MH⁺) 851.6 for C₅₀H₉₈N₄O₆.¹H NMR (300 MHz, CDCl₃at 25°C): δ ppm 10.15 (br. s, 1H); 8.36, 8.22 (br. s, 1H); 6.55 (s, 0.5H); 6.53 (s, 0.5H); 4.85-4.80 (m, 2H); 3.32-3.23 (m, 2H); 2.85 (d, 1.5H,J=4.9 Hz); 2.74-2.72 (m, 1.5H); 2.64 (m, 1H); 2.46-2.44 (m, 5H); 2.28 (dd, 4H,J=2.7 Hz, 7.4 Hz); 1.76 (m, 2H); 1.68-1.38 (m, 22H); 1.31-1.18 (m, 42H); 0.88-0.84 (m, 12H).¹H NMR (300 MHz, CDCl₃at 60°C): δ ppm 10.15 (br. s, 1H); 7.70 (br. s, 1H); 6.51 (s, 1H); 4.86-4.80 (m, 2H); 3.27 (m, 2H); 2.82 (br. s, 3H); 2.64-2.39 (m, 6H); 2.28 (m, 4H); 1.76 (m, 2H); 1.68-1.38 (m, 22H); 1.31-1.18 (m, 42H); 0.88-0.84 (m, 12H).

HL. Compound 304: Heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₈ N ₂ O ₆

Molecular weight: 823.34

[00390] Compound 303 was prepared analogously to compound 170 except that heptadecan-9-yl-8-((3-aminopropyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate (500 mg, 0.66 mmol) was used in place of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino) octanoate (290 mg, 53%) as an oil. HPLC/UV (210 nm): RT=8.52 min. MS (HI):m/z (MH⁺) 823.7 for C₅₀H₉₈N₂O₆.¹H NMR (300 MHz, CDCl₃): δ ppm 7.59-7.56 (m, 1H); 4.87-4.80 (m, 2H); 3.86 (s, 2H); 3.38 (s, 3H); 3.38-3.32 (m, 2H); 2.48-2.32 (m, 6H); 2.27 (dd, 4H,J=2.7 Hz, 7.5 Hz); 1.68-1.36 (m, 24H); 1.34-1.18 (m, 42H); 0.88-0.83 (m, 12H).

H.M. Compound 305: 7-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(3-(2-methoxyacetamido)propyl)amino)heptyldecanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆

Molecular weight: 795.29

[00391] Compound 305 was prepared analogously to compound 178, but using 7-((3-aminopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Light yellow oil, 230 mg, 42%. HPLC/UV (210 nm): RT=5.76 min. MS (CI): m/z (MH ⁺ ) 795.6 for C ₄₈ H ₉₄ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.57 (br. s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.86 (s, 2H); 3.38 (s, 3H); 3.38-3.31 (m, 2H); 2.35-2.42 (m, 2H); 2.35-2.33 (m, 4H); 2.27 (dd, 2H, J =2.9 Hz, 7.4 Hz); 1.68-1.52 (m, 11H); 1.50-1.38 (m, 11H); 1.34-1.18 (m, 44H); 0.86 (t, 9H, J =6.5 Hz).

H.N. Connection 306: Heptadecan-9-yl-8-((3-(3,3-dimethylthioureido)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Stage 1: Heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₈ N ₂ O ₆

Molecular weight: 823.34

[00392] A solution of heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)amino)octanoate (5.55 g, 10 mmol), undecyl-6-bromohexanoate (5.24 g, 15 mmol) in cyclopentylmethyl ether (80 ml) and acetonitrile (80 ml) containing potassium carbonate (5.53 g, 40 mmol) and potassium iodide (2.49 g, 15 mmol) was heated at 86°C for 18 hours . After cooling to room temperature, the reaction mixture was filtered through diatomaceous earth, the filter cake was washed with ethyl acetate, and the filtrate was concentrated in vacuo to give the crude product, which was purified by silica gel chromatography (0-50% EtOAc in hexanes, then 1:1 acetone/hexane mixture) to give heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (6.2 g, 73%) as oil. MS (CI): m/z (MH ⁺ ) 823.7 for C ₅₀ H ₉₈ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.64 (br. s, 1H); 4.85 (quint, 1H, J =6.3 Hz); 4.04 (t, 2H, J =6.7 Hz); 3.17 (m, 2H); 2.42 (t, 2H, J =6.8 Hz); 2.35-2.24 (m, 8H); 1.64-1.56 (m, 8H); 1.53-1.44 (m, 8H); 1.42 (s, 9H); 1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

Stage 2: Heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₅ H ₉₀ N ₂ O ₄

Molecular weight: 723.23

[00393] To a solution of heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (6.2 g, 7, 53 mmol) in dichloromethane (75 ml) at 0°C was added dropwise triperoxonane acid (5.8 ml) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was quenched with saturated aqueous sodium hydrogen carbonate at 0°C. The organic layer was washed with an aqueous saturated sodium hydrogen carbonate solution, a 0.1 N sodium hydroxide solution, and an aqueous saturated sodium chloride solution. After drying over anhydrous sodium sulfate, the solvent was removed in vacuo to give heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (5.57 g, quant. ) as a yellow oil. MS (CI): m/z (MH ⁺ ) 723.7 for C ₄₅ H ₉₀ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.85 (quint, 1H, J =6.3 Hz); 4.04 (t, 2H, J =6.6 Hz); 2.85 (t, 2H, J =6.3 Hz); 2.53 (t, 2H, J =6.8 Hz); 2.45-2.37 (m, 4H); 2.28 (t, 2H, J =7.4 Hz); 2.26 (t, 2H, J =7.4 Hz); 1.70-1.55 (m, 8H); 1.54-1.40 (m, 8H); 1.24 (m, 50H); 0.86 (t, 9H, J =6.6 Hz).

Stage 3: Heptadecan-9-yl-8-((3-(3,3-dimethylthioureido)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ N ₃ O ₄ S

Molecular weight: 810.37

[00394] Compound 306 was prepared analogously to compound 111 except that heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (500 mg, 0.66 mmol) was used instead of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(3 ,3-dimethylthioureido)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (320 mg, 57%) as a yellow oil. HPLC/UV (210 nm): RT=5.98 min. MS (CI): m/z (MH ⁺ ) 810.6 for C ₄₈ H ₉₅ N ₃ O ₄ S. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm. 8.03 (br. s, 1H); 4.85 (quint, 1H, J =6.3 Hz); 4.04 (t, 2H, J =6.6 Hz); 3.70 (m, 2H); 3.20 (s, 6H); 2.57 (m, 2H); 2.42 (m, 4H); 2.28 (m, 4H); 1.71 (m, 2H); 1.62 (m, 6H); 1.54-1.40 (m, 8H); 1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

H.O. Connection 307: 7-((3-(2-Cyano-3,3-dimethylguanidino)propyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate

Chemical formula: C ₄₉ H ₉₅ N ₅ O ₄

Molecular weight: 818.33

[00395] Compound 307 was prepared analogously to compound 168, but using 7-((3-aminopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Colorless oil, 160 mg, 28%. HPLC/UV (214 nm): RT=5.88 min. MS (CI): m/z (MH ⁺ ) 818.7 for C ₄₉ H ₉₅ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.68-3.64 (m, 2H); 3.02 (s, 6H); 2.79-2.48 (m, 4H); 2.27 (dd, 4H, J =1.6 Hz, 7.4 Hz); 1.89 (br. s, 1H); 1.68-1.42 (m, 21H); 1.38-1.16 (m, 45H); 0.86 (t, 9H, J =6.7 Hz).

HP. Connection 308: 7-((3-(3,3-Dimethylthioureido)propyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate

Chemical formula: C ₄₈ H ₉₅ N ₃ O ₄ S

Molecular weight: 810.37

[00396] Compound 308 was prepared analogously to compound 111, but using 7-((3-aminopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Yellow oil, 150 mg, 27%. HPLC/UV (254 nm): RT=6.77 min. MS (CI): m/z (MH ⁺ ) 810.6 for C ₄₈ H ₉₅ N ₃ O ₄ S. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm. 8.20 (br. s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.73 (br. s, 2H); 3.23 (s, 6H); 2.68-2.38 (m, 4H); 2.30-2.25 (m, 4H); 1.68-1.42 (m, 22H); 1.38-1.14 (m, 44H); 0.86 (t, 9H, J =6.5 Hz).

H.Q. Connection 309: 7-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(3-((2-(methylamino)-3,4-dioxo cyclobut-1-en-1-yl)amino)propyl)amino) heptyldecanoate

Chemical formula: C ₅₀ H ₉₃ N ₃ O ₆

Molecular weight: 832.31

[00397] Compound 309 was prepared analogously to compound 182, but using 7-((3-aminopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. White waxy solid, 190 mg, 28%. HPLC/UV (254 nm): RT=6.71 min. MS (CI): m/z (MH ⁺ ) 832.6 for C ₅₀ H ₉₃ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.86-4.82 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.64 (br. s, 2H); 3.25 (d, 3H, J =4.9 Hz); 2.53 (t, 2H, J =5.6 Hz); 2.42-2.37 (m, 4H); 2.28 (t, 4H, J =7.5 Hz); 1.76-1.71 (m, 2H); 1.64-1.58 (m, 10H); 1.52-1.38 (m, 9H); 1.30-1.18 (m, 44H); 0.86 (t, 9H, J =6.5 Hz).

H.R. Connection 310: 7-((8-(Heptadecan-9-yloxy)-8-oxooctyl)(3-((1-(methylamino)-2-nitrovinyl)amino)propyl)amino)heptyldecanoate

Chemical formula: C ₄₈ H ₉₄ N ₄ O ₆

Molecular weight: 823.30

[00398] Compound 310 was prepared analogously to compound 170, but using 7-((3-aminopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)heptyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Brown oil, 195 mg, 28%. HPLC/UV (214 nm): RT=6.15 min. MS (CI): m/z (MH ⁺ ) 823.7 for C ₄₈ H ₉₄ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ at 25°C): δ ppm 10.14 (br. s, 1H); 8.32 (s, 0.5H); 8.18 (s, 0.5H); 6.55 (s, 0.5H); 6.53 (s, 0.5H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.33-3.23 (m, 2H); 2.86 (d, 1.5H, J =5.2 Hz); 2.73 (br. s, 1.5H); 2.65 (m, 1H); 2.48 (m, 5H); 2.27 (t, 4H, J =7.5 Hz); 1.77 (m, 2H); 1.67-1.58 (m, 10H); 1.49-1.43 (m, 8H); 1.30-1.14 (m, 44H); 0.86 (t, 9H, J =6.7 Hz). ¹ H NMR (300 MHz, CDCl ₃ at 60°C): δ ppm 10.14 (br. s, 1H); 7.70 (br. s, 1H); 6.51 (s, 1H); 4.87-4.83 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.28 (br. s, 2H); 2.83 (br. s, 3H); 2.65-2.41 (m, 6H); 2.27 (t, 4H, J =7.5 Hz); 1.77 (m, 2H); 1.67-1.58 (m, 10H); 1.49-1.43 (m, 8H); 1.30-1.14 (m, 44H); 0.86 (t, 9H, J =6.7 Hz).

HS. Connection 311: Heptadecan-9-yl-8-((3-(2-cyano-3,3-dimethylguanidino)propyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₇ N ₅ O ₄

Molecular weight: 832.36

[00399] Compound 311 was prepared analogously to compound 168, but using heptadecan-9-yl-8-((3-aminopropyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9- yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Colorless oil 350 mg, 62%. HPLC/UV (214 nm): RT=6.04 min. MS (CI): m/z (MH ⁺ ) 832.7 for C ₅₀ H ₉₇ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.62 (br. s, 1H); 4.87-4.80 (m, 1H); 3.94 (dd, 1H, J =5.9 Hz, 10.5 Hz); 3.83 (dd, 1H, J =6.8 Hz, 10.7 Hz); 3.70-3.64 (m, 2H); 2.99 (s, 6H); 2.69-2.38 (m, 4H); 2.28 (dd, 4H, J =7.6 Hz, 15.1 Hz); 1.80-1.52 (m, 7H); 1.52-1.16 (m, 58H); 0.91-0.82 (m, 12H).

HT. Connection 312: Heptadecan-9-yl-8-((3-(2-methoxyacetamido)propyl)(8-((2-methyl nonyl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₂ O ₆

Molecular weight: 809.32

[00400] Compound 312 was prepared analogously to compound 178, but using heptadecan-9-yl-8-((3-aminopropyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9- yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Colorless oil, 300 mg, 55%. HPLC/UV (210 nm): RT=6.02 min. MS (CI): m/z (MH ⁺ ) 809.7 for C ₄₉ H ₉₆ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.56 (br. s, 1H); 4.89-4.81 (m, 1H); 3.94 (dd, 1H, J =5.7 Hz, 10.4 Hz); 3.83 (dd, 1H, J =6.8 Hz, 10.7 Hz); 3.86 (s, 2H); 3.38 (s, 3H); 3.38-3.32 (m, 2H); 2.46 (m, 2H); 2.37-2.24 (m, 8H); 1.78-1.72 (m, 1H); 1.68-1.52 (m, 8H); 1.528-1.18 (m, 54H); 0.91-0.82 (m, 12H).

H.U. Connection 313: Heptadecan-9-yl-(Z)-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(non-2- en-1-yloxy)-8-oxooctyl)amino)octanoate

Step 1: ( Z )-Non-2-en-1-yl-8-bromooctanoate

Chemical formula: C ₁₇ H ₃₁ BrO ₂

Molecular weight: 347.34

[00401] To a solution of cis-2-nonen-1-ol (10.0 g, 70 mmol), 8-bromooctanoic acid (23.43 g, 105 mmol) and DMAP (1.72 g, 14 mmol) in dichloromethane EDCI (20.23 g, 105 mmol) was added at 0° C. and the reaction mixture was stirred at room temperature overnight. TLC indicated completion of the reaction. The reaction mixture was cooled to 0° C. and a hydrochloric acid solution (10 ml conc. HCl, 90 ml water, 7.5 g sodium chloride) was added very slowly over 20 minutes. Then acetonitrile (100 ml) was added and hexane (100 ml) was added, the layers were separated and the organic layer was dried (Na ₂ SO ₄ ) and evaporated in vacuo to give an oil. This was dissolved in hexane (100 ml) and washed with a mixture of acetonitrile (100 ml) and 5% aqueous sodium hydrogen carbonate solution (100 ml). The hexane layer was separated and filtered through diatomaceous earth, the filter press cake was washed with hexane and the filtrate was concentrated to give ( Z )-non-2-en-1-yl-8-bromooctanoate (19.98 g, 82%) as a colorless oil . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.65-5.59 (m, 1H); 5.53-5.49 (m, 1H); 4.61 (d, 2H, J =6.8 Hz); 3.92 (t, 2H, J =6.7 Hz); 2.44 (t, 0.5H, J =7.4 Hz, for C H ₂ Cl); 2.29 (t, 2H, J =7.4 Hz, for C H ₂ Br); 2.08 (dd, 2H, J =6.6 Hz, 13.7 Hz); 1.88-1.79 (m, 2H); 1.70-1.56 (m, 2H); 1.50-1.16 (m, 14H); 0.87 (t, 3H, J =6.7 Hz).

Stage 2: Heptadecan-9-yl-( Z )-8-((3-(( tert -butoxycarbonyl)amino)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₆ N ₂ O ₆

Molecular weight: 821.33

[00402] Heptadecan-9-yl-8-((3-(( tert -butoxycarbonyl)amino)propyl)amino)octanoate solution (6.0 g, 12 mmol), ( Z )-non-2-en-1 -yl-8-bromooctanoate (4.49 g, 13 mmol) and N,N -diisopropylethylamine (2.8 ml, 16 mmol) in ethanol (50 ml) were heated at 70°C for 3 days. The solvent was removed in vacuo to give the crude product, which was purified by silica gel chromatography (0-100% EtOAc in hexanes) to give heptadecan-9-yl-( Z )-8-((3-(( tert -butoxycarbonyl) amino)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate (5.2 g, 60%) as a light yellow oil. MS (CI): m/z (MH ⁺ ) 821.7 for C ₅₀ H ₉₆ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.72-5.58 (m, 2H); 5.56-5.48 (m, 1H); 4.87-4.83 (m, 1H); 4.60 (d, 2H, J =6.6 Hz); 3.20-3.12 (m, 2H); 2.42 (t, 2H, J =6.3 Hz); 2.35-2.24 (m, 9H); 2.12-2.02 (m, 4H); 1.68-1.56 (m, 8H); 1.42 (s, 9H); 1.50-1.12 (m, 47H); 0.88-0.84 (m, 9H).

Stage 3: Heptadecan-9-yl-( Z )-8-((3-aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₅ H ₈₈ N ₂ O ₄

Molecular weight: 721.21

[00403] To a solution of heptadecan-9-yl-( Z )-8-((3-(( tert -butoxycarbonyl)amino)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl) amino)octanoate (5.2 g, 6.33 mmol) in dichloromethane (20 mL) trifluoroacetic acid (8 mL) was added dropwise at 0° C. and the reaction mixture was stirred at room temperature overnight. The reaction mixture was quenched by adding saturated aqueous sodium hydrogen carbonate at 0°C. The organic layer was washed with saturated aqueous sodium hydrogen carbonate, 0.1 N sodium hydroxide, saturated aqueous sodium chloride, dried over anhydrous sodium sulfate, and the solvent was removed in vacuo to give heptadecan-9-yl-( Z )-8-((3 -aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate (4.2 g, 93%) as an oil. MS (APCI): m/z (MH ⁺ ) 721.6 for C ₄₅ H ₈₈ N ₂ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.68-5.58 (m, 1H); 5.54-5.46 (m, 1H); 4.89-4.82 (m, 1H); 4.60 (d, 2H, J =6.6 Hz); 2.72 (t, 2H, J =6.8 Hz); 2.44 (t, 2H, J =7.4 Hz); 2.40-2.34 (m, 4H); 2.27 (dt, 4H, J =7.5 Hz, 15.2 Hz); 2.11-2.03 (m, 2H); 1.84-1.72 (m, 4H); 1.68-1.55 (m, 6H); 1.54-1.46 (m, 6H); 1.44-1.16 (m, 44H); 0.86 (t, 9H, J =6.5 Hz).

Stage 4: Heptadecan-9-yl-(Z)-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(non-2- en-1-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₁ N ₃ O ₆

Molecular weight: 830.29

[00404] Compound 313 was prepared analogously to compound 182 except that heptadecan-9-yl-( Z )-8-((3-aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl ) amino)octanoate (500 mg, 0.66 mmol) was used in place of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-(( 3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate (200 mg, 29%) as a white waxy solid. HPLC/UV (254 nm): RT=6.56 min. MS (CI): m/z (MH ⁺ ) 830.6 for C ₅₀ H ₉₁ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.68-5.59 (m, 1H); 5.54-5.48 (m, 1H); 4.86-4.80 (m, 1H); 4.60 (d, 2H, J =6.8 Hz); 3.72-3.58 (m, 2H); 3.25 (d, 3H, J =4.9 Hz); 2.59-2.52 (m, 2H); 2.46-2.38 (m, 4H); 2.29 (dd, 4H, J =7.2 Hz, 14.6 Hz); 2.08 (dd, 2H, J =6.8 Hz, 14.0 Hz); 1.82-1.68 (m, 3H); 1.64-1.56 (m, 5H); 1.52-1.12 (m, 52H); 0.86 (t, 9H, J =6.7 Hz).

H.V. Compound 314: Heptadecan-9-yl-8-((3-((1-(methylamino)-2-nitrovinyl)amino)propyl)(8-((( Z )-non-2-en-1-yl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₂ N ₄ O ₆

Molecular weight: 821.29

[00405] Compound 314 was prepared analogously to compound 170 except that heptadecan-9-yl-( Z )-8-((3-aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl ) amino)octanoate was used instead of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(( 1-(methylamino)-2-nitrovinyl)amino)propyl)(8-((( Z )-non-2-en-1-yl)oxy)-8-oxooctyl)amino)octanoate (190mg, 28%) as a yellow oil. HPLC/UV (254 nm): RT=6.30 min. MS (CI): m/z (MH ⁺ ) 821.7 for C ₄₈ H ₉₂ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ at 25°C): δ ppm 10.13 (br. s, 1H); 8.36, 8.22 (br. s, 1H); 6.54 (s, 0.5H); 6.52 (s, 0.5H); 5.65-5.59 (m, 1H); 5.52-5.48 (m, 1H); 4.87-4.81 (m, 1H); 4.60 (d, 2H, J =6.6 Hz); 3.38-3.22 (m, 2H); 2.85 (d, 1.5H, J =5.2 Hz); 2.73-2.72 (m, 1.5H); 2.63 (m, 1H); 2.46 (m, 5H); 2.28 (dd, 4H, J =7.5 Hz, 14.9 Hz); 2.08 (dd, 2H, J =7.1 Hz, 14.0 Hz); 1.76 (m, 2H); 1.68-1.56 (m, 6H); 1.52-1.12 (m, 50H); 0.86 (t, 9H, J =6.6 Hz). ¹ H NMR (300 MHz, CDCl ₃ at 60°C): δ ppm 10.15 (br. s, 1H); 7.70 (br. s, 1H); 6.51 (s, 1H); 5.65-5.59 (m, 1H); 5.52-5.48 (m, 1H); 4.87-4.81 (m, 1H); 4.60 (d, 2H, J =6.6 Hz); 3.27 (br. s, 2H); 2.81 (br. s, 3H); 2.62-2.41 (m, 6H); 2.28 (dd, 4H, J =7.5 Hz, 14.9 Hz); 2.08 (dd, 2H, J =7.1 Hz, 14.0 Hz); 1.76 (m, 2H); 1.68-1.56 (m, 6H); 1.52-1.12 (m, 50H); 0.86 (t, 9H, J =6.6 Hz).

H.W. Connection 315: Heptadecan-9-yl-8-((3-(( Z )-2-cyano-3,3-dimethylguanidino)propyl)(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₃ N ₅ O ₄

Molecular weight: 816.31

[00406] Compound 315 was prepared analogously to compound 168, but using heptadecan-9-yl-(Z)-8-((3-aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9-yl-8-((3-aminopropyl)(8- (nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-((Z)-2-cyano-3,3-dimethylguanidino)propyl)(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl)amino)octanoate (150 mg, 26%) as a colorless oil. HPLC/UV (254 nm): RT=6.55 min. MS (HI):m/z (MH⁺) 816.7 for C₄₉H₉₃N₅O₄.¹H NMR (300 MHz, CDCl₃): δ ppm 7.66 (br. s, 1H); 5.68-5.58 (m, 1H); 5.56-5.44 (m, 1H); 4.87-4.81 (m, 1H); 4.61 (d, 2H,J=6.8 Hz); 3.72-3.64 (m, 2H); 2.98 (s, 6H); 2.59-2.54 (m, 2H); 2.44-2.38 (m, 4H); 2.28 (dd, 4H,J=7.5 Hz, 15.2 Hz); 2.08 (dd, 2H,J=7.1 Hz, 14.0 Hz); 1.68-1.58 (m, 7H); 1.52-1.42 (m, 5H); 1.38-1.12 (m, 46H); 0.88-0.84 (m, 9H).

HX. Connection 316: Heptadecan-9-yl-( Z )-8-((3-(2-methoxyacetamido)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₂ N ₂ O ₆

Molecular weight: 793.27

[00407] Compound 316 was prepared analogously to compound 178, but using heptadecan-9-yl-( Z )-8-((3-aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino )octanoate instead of heptadecan-9-yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-( Z )-8-(( 3-(2-Methoxyacetamido)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate (220 mg, 40%) as a colorless oil. HPLC/UV (210 nm): RT=5.73 min. MS (CI): m/z (MH ⁺ ) 793.7 for C ₄₈ H ₉₂ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.59-7.56 (m, 1H); 5.68-5.58 (m, 1H); 5.54-5.48 (m, 1H); 4.87-4.81 (m, 1H); 4.60 (d, 2H, J =6.8 Hz); 3.86 (s, 2H); 3.37 (s, 3H); 3.37-3.31 (m, 2H); 2.46 (t, 2H, J =6.3 Hz); 2.37-2.24 (m, 8H); 2.08 (dd, 2H, J =7.1 Hz, 13.7 Hz); 1.68-1.58 (m, 5H); 1.50-1.40 (m, 8H); 1.38-1.18 (m, 45H); 0.86 (t, 9H, J =6.7 Hz).

hy. Connection 317: Heptadecan-9-yl-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl) amino)octanoate

Chemical formula: C ₅₀ H ₉₃ N ₃ O ₆

Molecular weight: 832.31

[00408] Compound 317 was prepared analogously to compound 182, but using heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate instead of heptadecan-9-yl-8- ((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(( 2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (180mg, 32%) as white waxy solid. HPLC/UV (254 nm): RT=11.45 min. MS (CI): m/z (MH ⁺ ) 832.7 for C ₅₀ H ₉₃ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.86-4.79 (m, 1H); 4.06 (t, 2H, J =6.8 Hz); 3.66 (br. s, 2H); 3.26 (d, 3H, J =4.9 Hz); 2.56-2.52 (m, 2H); 2.40-2.25 (m, 8H); 1.78-1.68 (m, 2H); 1.64-1.55 (m, 8H); 1.48-1.38 (m, 8H); 1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz).

hz. Connection 318: Heptadecan-9-yl-8-((3-((1-(methylamino)-2-nitrovinyl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ N ₄ O ₆

Molecular weight: 823.30

[00409] Compound 318 was prepared analogously to compound 170, but using heptadecan-9-yl-8-((3-aminopropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate instead of heptadecan-9-yl-8- ((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-((3-(( 1-(methylamino)-2-nitrovinyl)amino)propyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (270mg, 40%) as yellow oil, 270mg, 40%. HPLC/UV (254 nm): RT=8.74 min. MS (CI): m/z (MH ⁺ ) 823.7 for C ₄₈ H ₉₄ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ at 25°C): δ ppm 10.15 (br. s, 1H); 8.21, 8.13 (br. s, 1H); 6.55 (s, 0.5H); 6.53 (s, 0.5H); 4.85 (quint, 1H, J =6.3 Hz); 4.04 (t, 2H, J =6.6 Hz); 3.32-3.23 (m, 2H); 2.85 (d, 1.5H, J =4.9 Hz); 2.74-2.72 (m, 1.5H); 2.64 (m, 1H); 2.46 (m, 5H); 2.28 (m, 4H); 1.76 (m, 2H); 1.66-1.53 (m, 6H); 1.53-1.40 (m, 8H); 1.24 (m, 48H); 0.86 (t, 9H, J =6.6 Hz). ¹ H NMR (300 MHz, CDCl ₃ at 50°C): δ ppm 10.15 (br. s, 1H); 7.79 (br. s, 1H); 6.52 (s, 1H); 4.85 (m, 1H); 4.05 (t, 2H, J =6.6 Hz); 3.29 (m, 2H); 2.84 (br. s, 3H); 2.64-2.44 (m, 6H); 2.28 (m, 4H); 1.76 (m, 2H); 1.61 (m, 6H); 1.53-1.40 (m, 8H); 1.24 (m, 48H); 0.86 (m, 9H).

ia. Connection 319: Heptadecan-9-yl-( Z )-8-((3-(3,3-dimethylthioureido)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₃ N ₃ O ₄ S

Molecular weight: 808.35

[00410] Compound 319 was prepared analogously to compound 111, but using heptadecan-9-yl-(Z)-8-((3-aminopropyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9-yl-8-((3-aminopropyl)(8- (nonyloxy)-8-oxooctyl)amino)octanoate. After working up the reaction mixture with water, the residue was purified by silica gel chromatography (0-50% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-(Z)-8-((3-(3,3-dimethylthioureido)propyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate (110mg, 20%) as yellow oil . HPLC/UV (254 nm): RT=6.67 min. MS (HI):m/z (MH⁺) 808.6 for C₄₈H₉₃N₃O₄S.¹H NMR (300 MHz, CDCl₃): δ ppm 7.72 (br. s, 1H); 5.64-5.58 (m, 1H); 5.53-5.48 (m, 1H); 4.86-4.80 (m, 1H); 4.60 (d, 2H,J=6.8 Hz); 3.78-3.77 (m, 2H); 3.26 (s, 6H); 2.91-2.64 (m, 4H); 2.27 (dd, 4H,J= 7.6 Hz, 15.3 Hz); 2.08 (dd, 4H,J=6.7 Hz, 13.8 Hz); 1.68-1.42 (m, 12H); 1.38-1.12 (m, 46H); 0.88-0.84 (m, 9H).

IB. Compound 320: Heptadecan-9-yl-8-((3-((1-(methylamino)-2-nitrovinyl)amino)propyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₆ N ₄ O ₆

Molecular weight: 837.33

[00411] Compound 320 was prepared analogously to compound 170, but using heptadecan-9-yl-8-((3-aminopropyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9- yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Yellow oil, 380 mg, 56%. HPLC/UV (254 nm): RT=6.85 min. MS (CI): m/z (MH ⁺ ) 837.7 for C ₄₉ H ₉₆ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ at 25°C): δ ppm 10.13 (br. s, 1H); 8.36 (s, 0.5H); 8.22 (s, 0.5H); 6.55 (s, 0.5H); 6.53 (s, 0.5H); 4.87-4.81 (m, 1H); 3.94 (dd, 1H, J =5.7 Hz, 10.4 Hz); 3.83 (dd, 1H, J =6.8 Hz, 10.7 Hz); 3.38-3.23 (m, 2H); 2.85 (d, 1.5H, J =5.1 Hz); 2.72 (d, 1.5H, J =4.1 Hz); 2.63 (m, 1H); 2.46 (m, 5H); 2.28 (dd, 4H, J =7.4 Hz, 15.1 Hz); 1.76 (m, 3H); 1.68-1.58 (m, 6H); 1.52-1.12 (m, 54H); 0.91-0.84 (m, 12H). ¹ H NMR (300 MHz, CDCl ₃ at 50°C): δ ppm 10.15 (br. s, 1H); 7.89 (br. s, 1H); 6.51 (s, 1H); 4.87-4.81 (m, 1H); 3.94 (dd, 1H, J =5.7 Hz, 10.4 Hz); 3.83 (dd, 1H, J =6.8 Hz, 10.7 Hz); 3.25 (br. s, 2H); 2.87-2.72 (m, 3H); 2.63 (m, 1H); 2.46 (m, 5H); 2.28 (dd, 4H, J =7.4 Hz, 15.1 Hz); 1.76 (m, 3H); 1.68-1.58 (m, 6H); 1.52-1.12 (m, 54H); 0.91-0.84 (m, 12H).

IC. Compound 321: Heptadecan-9-yl-8-((3-((2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-((2-methylnonyl) hydroxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₁ H ₉₅ N ₃ O ₆

Molecular weight: 846.34

[00412] Compound 321 was prepared analogously to compound 182, but using heptadecan-9-yl-8-((3-aminopropyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9- yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. White waxy solid, 240 mg, 41%. HPLC/UV (DSIO): RT=7.10 min. MS (CI): m/z (MH ⁺ ) 846.7 for C ₅₁ H ₉₅ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.86-4.80 (m, 1H); 3.93 (dd, 1H, J =6.0 Hz, 10.7 Hz); 3.83 (dd, 1H, J =6.8 Hz, 10.7 Hz); 3.68-3.58 (m, 2H); 3.25 (d, 3H, J =4.9 Hz); 2.55-2.52 (m, 2H); 2.42-2.37 (m, 4H); 2.29 (dd, 4H, J =7.7 Hz, 15.1 Hz); 1.80-1.68 (m, 3H); 1.66-1.56 (m, 10H); 1.52-1.38 (m, 9H); 1.32-1.12 (m, 42H); 0.91-0.82 (m, 12H).

ID. Compound 322: Heptadecan-9-yl-8-((3-(3,3-dimethylthioureido)propyl)(8-((2-methyl nonyl)oxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₇ N ₃ O ₄ S

Molecular weight: 824.39

[00413] Compound 322 was prepared analogously to compound 111, but using heptadecan-9-yl-8-((3-aminopropyl)(8-((2-methylnonyl)oxy)-8-oxooctyl)amino)octanoate instead of heptadecan-9- yl-8-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Yellow oil, 150 mg, 27%. HPLC/UV (254 nm): RT=7.27 min. MS (CI): m/z (MH ⁺ ) 824.7 for C ₄₉ H ₉₇ N ₃ O ₄ S. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm. 7.60 (br. s, 1H); 4.87-4.82 (m, 1H); 3.94 (dd, 1H, J =5.7 Hz, 10.7 Hz); 3.86-3.80 (m, 3H); 3.27 (s, 6H); 3.04-2.74 (m, 4H); 2.28 (dd, 4H, J =7.6 Hz, 15.1 Hz); 1.80-1.72 (m, 3H); 1.68-1.42 (m, 12H); 1.38-1.18 (m, 50H); 0.91-0.82 (m, 12H).

IE. Compound 323: 7-((3-(2-Methoxyacetamido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₈ H ₉₄ N ₂ O ₆

Molecular weight: 795.29

[00414] Compound 323 was prepared analogously to compound 178, but using 7-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl-2-octyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Yellow oil, 220 mg, 40%. HPLC/UV (214 nm): RT=6.00 min. MS (CI): m/z (MH ⁺ ) 795.7 for C ₄₈ H ₉₄ N ₂ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.52 (m, 1H); 4.05-4.02 (m, 4H); 3.86 (s, 2H); 3.38 (s, 3H); 3.38-3.32 (m, 2H); 2.52-2.25 (m, 9H); 1.72-1.53 (m, 12H); 1.44-1.12 (m, 52H); 0.86 (t, 9H, J =6.7 Hz).

IF. Compound 324: 7-((3-(2-Cyano-3,3-dimethylguanidino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₉ H ₉₅ N ₅ O ₄

Molecular weight: 818.33

[00415] Compound 324 was prepared analogously to compound 168, but using 7-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl-2-octyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Colorless oil, 370 mg, 65%. HPLC/UV (214 nm): RT=6.04 min. MS (CI): m/z (MH ⁺ ) 818.7 for C ₄₉ H ₉₅ N ₅ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.64 (m, 1H); 4.06-4.02 (m, 4H); 3.68-3.62 (m, 2H); 2.98 (s, 6H); 2.59-2.56 (m, 2H); 2.44-2.39 (m, 4H); 2.32-2.26 (m, 3H); 1.72-1.53 (m, 12H); 1.44-1.12 (m, 52H); 0.86 (t, 9H, J =6.7 Hz).

IG. Compound 325: 7-((3-((1-(Methylamino)-2-nitrovinyl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₈ H ₉₄ N ₄ O ₆

Molecular weight: 823.30

[00416] Compound 325 was prepared analogously to compound 170, but using 7-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl-2-octyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Yellow oil, 355 mg, 52%. HPLC/UV (214 nm): RT=5.76 min. MS (CI): m/z (MH ⁺ ) 823.7 for C ₄₈ H ₉₄ N ₄ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ at 25°C): δ ppm 10.15 (br. s, 1H); 8.37-8.24 (m, 1H); 6.55 (s, 0.5H); 6.53 (s, 0.5H); 4.06-4.04 (m, 4H); 3.34-3.24 (m, 2H); 2.90-2.85 (m, 1.5H); 2.74-2.73 (m, 1.5H); 2.64 (m, 1H); 2.47 (br. s, 4H); 2.34-2.26 (m, 3H); 1.77 (m, 2H); 1.68-1.53 (m, 10H); 1.44-1.12 (m, 53H); 0.86 (t, 9H, J =6.6 Hz). ¹ H NMR (300 MHz, CDCl ₃ at 50°C): δ ppm 10.15 (br. s, 1H); 7.89 (br. s, 1H); 6.52 (s, 1H); 4.06-4.04 (m, 4H); 3.29 (br. s, 2H); 2.87 (m, 3H); 2.64-2.40 (m, 6H); 2.34-2.26 (m, 3H); 1.79 (m, 2H); 1.64-1.54 (m, 10H); 1.44-1.12 (m, 52H); 0.86 (t, 9H, J =6.6 Hz).

IH. Compound 326: 7-((3-((2-(Methylamino)-3,4-dioxocyclobut-1-en-1-yl)amino)propyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2 -octyldecanoate

Chemical formula: C ₅₀ H ₉₃ N ₃ O ₆

Molecular weight: 832.31

[00417] Compound 326 was prepared analogously to compound 182, but using 7-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl-2-octyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. White waxy solid, 330 mg, 57%. HPLC/UV (254 nm): RT=7.01 min. MS (CI): m/z (MH ⁺ ) 832.6 for C ₅₀ H ₉₃ N ₃ O ₆ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 6.90 (br. s, 1H); 4.05-4.01 (m, 4H); 3.63 (br. s, 2H); 3.25 (d, 3H, J =4.9 Hz); 2.53 (t, 2H, J =5.6 Hz); 2.40 (t, 4H, J =7.4 Hz); 2.33-2.26 (m, 3H); 1.74-1.71 (m, 2H); 1.68-1.52 (m, 11H); 1.48-1.12 (m, 52H); 0.86 (t, 9H, J =6.7 Hz).

II. Compound 327: 7-((3-(3,3-Dimethylthioureido)propyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

Chemical formula: C ₄₈ H ₉₅ N ₃ O ₄ S

Molecular weight: 810.37

[00418] Compound 327 was prepared analogously to compound 111, but using 7-((3-aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl-2-octyldecanoate instead of heptadecan-9-yl-8-((3 -aminopropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate. Yellow oil, 200 mg, 36%. HPLC/UV (254 nm): RT=6.95 min. MS (CI): m/z (MH ⁺ ) 810.6 for C ₄₈ H ₉₅ N ₃ O ₄ S. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm. 8.08 (br. s, 1H); 4.06-4.02 (m, 4H); 3.72 (br. s, 2H); 3.23 (s, 6H); 2.72-2.38 (m, 4H); 2.34-2.25 (m, 3H); 1.71-1.55 (m, 12H); 1.44-1.12 (m, 54H); 0.86 (t, 9H, J =6.7 Hz).

IJ. Compound 328: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-hydroxypropyl)amino)octanoate

Stage 1: dodecan-4-yl-8-((3-hydroxypropyl)amino)octanoate

Chemical formula: C ₂₃ H ₄₇ NO ₃

Molecular weight: 385.63

[00419] Propanolamine (9.8 ml, 130 mmol) was added to a solution of dodecan-4-yl-8-bromooctanoate (2.5 g, 6.4 mmol) in ethanol (100 ml) and the reaction mixture was allowed to stir at 50° C during the night. The solution was again warmed to room temperature and concentrated in vacuo. The crude material was taken up in DCM and washed twice with 5% NaHCO ₃ , dried over anhydrous Na ₂ SO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography (0-100% (DCM 20% MeOH 1% NH ₄ OH) in DCM) afforded dodecan-4-yl-8-((3-hydroxypropyl)amino)octanoate as a clear colorless oil ( 2.08 g, 84.5%). UHPLC/DSIO: RT=1.58 min. MS (ESI): m/z (MH ⁺ ) 386.42 for C ₂₃ H ₄₇ NO ₃ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 1H); 3.83 (t, 2H); 3.31 (br, 1H); 2.90 (t, 2H); 2.62 (t, 2H); 2.29 (t, 2H); 1.85-1.05 (broad m, 30H); 0.91 (m, 6H) (hydroxyl proton not observed).

Stage 2: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-hydroxypropyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ NO ₅

Molecular weight: 766.29

[00420] Dodecan-4-yl-8-[(3-hydroxypropyl)amino]octanoate (2.08 g, 5.39 mmol), heptadecan-9-yl-8-bromooctanoate (2.61 g, 5.66 mmol), potassium carbonate (1.49 g, 10.8 mmol) and potassium iodide (179 mg, 1.08 mmol) were suspended in MeCN (60 ml) and the mixture was allowed to stir at 82 ^° C. for 12 hours. The reaction mixture was allowed to cool to room temperature, filtered through a pad of celite and concentrated in vacuo. Purification by silica gel chromatography (0-50% (DCM 20% MeOH 1% NH ₄ OH) in DCM) gave dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl )(3-hydroxypropyl)amino)octanoate as a clear yellowish oil (3.26g, 78.9%). UHPLC/DSIO: RT=3.53 min. MS (ESI): m/z (MH ⁺ ) 766.97 for C ₄₈ H ₉₅ NO ₅ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.82 (t, 2H); 2.76 (t, 2H); 2.54 (t, 4H); 2.30 (t, 4H); 1.85-1.05 (broad m, 68H); 0.90 (m, 12H) (hydroxyl proton not observed).

IK. Connection 329: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(1-hydroxypropan-2-yl)amino)octanoate

Stage 1: Dodecan-4-yl-8-((1-hydroxypropan-2-yl)amino)octanoate

Chemical formula: C ₂₃ H ₄₇ NO ₃

Molecular weight: 385.63

[00421] In a manner analogous to step 1 for compound 328, dodecan-4-yl-8-((1-hydroxypropan-2-yl)amino)octanoate was synthesized from dodecan-4-yl-8-bromooctanoate (500 mg, 1.28 mmol ) and 2-aminopropanol (2.00 ml, 25.5 mmol) in ethanol (15 ml). Yield (343 mg, 69.6%). UHPLC/DSIO: RT=1.66 min. MS (ESI): m/z (MH ⁺ ) 386.50 for C ₂₃ H ₄₇ NO _3. ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.91 (m, 1H); 3.64-3.16 (broad m, 2H); 2.76 (broad m, 2H); 2.53 (broad m, 1H); 2.30 (t, 2H); 2.05-1.15 (broad m, 29H); 1.06 (d, 3H); 0.91 (m, 6H) (hydroxyl proton not observed).

Stage 2: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(1-hydroxypropan-2-yl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ NO ₅

Molecular weight: 766.29

[00422] Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(1-hydroxypropan-2-yl)amino)octanoate from dodecane- 4-yl-8-[(1-hydroxypropan-2-yl)amino]octanoate (343mg, 0.889mmol), heptadecan-9-yl-8-bromooctanoate (431mg, 0.934mmol), potassium carbonate (246mg, 1.78 mmol) and potassium iodide (30 mg, 0.18 mmol) in MeCN (12 ml). Yield (395 mg, 58.0%). UHPLC/DSIO: RT=3.54 min. MS (ESI): m/z (MH ⁺ ) 766.97 for C ₄₈ H ₉₅ NO ₅ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.60-2.10 (broad m, 11H); 1.81-1.05 (broad m, 66H); 0.90 (m, 15H) (hydroxyl proton not observed).

IL. Compound 330: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-(methylsulfonamido)propyl)amino)octanoate

Stage 1: Dodecan-4-yl-8-((3-chloropropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₄ ClNO ₄

Molecular weight: 784.73

[00423] To a 0°C solution of dodecan-4-yl-8-{[8-(heptadecan-9-yloxy)-8-oxooctyl](3-hydroxypropyl)amino}octanoate (3.16 g, 4.12 mmol ) and triethylamine (750 µl, 5.4 mmol) in DCM (50 ml) a solution of methanesulfonyl chloride (400 µl, 5.2 mmol) in DCM (4 ml) was added and the reaction mixture was allowed to return to room temperature and stirred for 4 hours . The reaction mixture was quenched with water and extracted x3 with DCM. The combined organic phases were washed with 5% NaHCO ₃ , saturated aqueous sodium chloride, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated in vacuo to give a clear orange oil. The material was used without further purification (3.15 g, 97.3%). UHPLC/DSIO: RT=3.50 min. MS (ESI): m/z (MH ⁺ ) 784.93 for C ₄₈ H ₉₄ ClNO ₄ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 4.55-4.20 (broad m, 2H); 3.70-3.40 (broad m, 2H); 3.15-2.15 (broad m, 8H); 2.00-1.05 (broad m, 68H); 0.90 (m, 12H).

Stage 2: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-(methylsulfonamido)propyl)amino)octanoate

Chemical formula: C ₄₉ H ₉₈ N ₂ O ₆ S

Molecular weight: 843.39

[00424] To a solution of dodecan-4-yl-8-[(3-chloropropyl)[8-(heptadecan-9-yloxy)-8-oxooctyl]amino]octanoate (300 mg, 0.382 mmol) and methanesulfonamide (364 mg, 3.82 mmol) in DMF (7 mL) was added cesium carbonate (186 mg, 0.573 mmol) and the reaction mixture was allowed to stir at 60° C. for 12 hours. The reaction mixture was left to cool to room temperature, diluted with 50% NaHCO ₃ and extracted twice with DCM. The combined organic phases were washed with water, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography (0-50% (DCM 20% MeOH 1% NH ₄ OH) in DCM) gave dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl )(3-(methylsulfonamido)propyl)amino)octanoate (79mg, 25%). UHPLC/DSIO: RT=3.44 min. MS (ESI): m/z (MH ⁺ ) 844.06 for C ₄₉ H ₉₈ N ₂ O ₆ S. ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.26 (t, 2H); 2.92 (s, 3H); 2.68-2.20 (broad m, 10H); 1.85-1.05 (broad m, 68H); 0.90 (m, 12H) (sulfonamide proton not observed).

im. Connection 331: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-(N-methylmethylsulfonamido)propyl)amino)octanoate

Chemical formula: C ₅₀ H ₁₀₀ N ₂ O ₆ S

Molecular weight: 857.42

[00425] Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-(N-methylmethylsulfonamido)propyl)amino)octanoate was synthesized from dodecane -4-yl-8-[(3-chloropropyl)[8-(heptadecan-9-yloxy)-8-oxooctyl]amino]octanoate (300mg, 0.382mmol), N -methylmethanesulfonamide (83mg, 0.77mmol ) and cesium carbonate (186 mg, 0.573 mmol) in DMF (7 ml). Yield (213 mg, 65.0%). UHPLC/DSIO: RT=3.45 min. MS (ESI): m/z (MH ⁺ ) 858.00 for C ₅₀ H ₁₀₀ N ₂ O ₆ S. ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.18 (t, 2H); 2.87 (s, 3H); 2.81 (s, 3H); 2.58-2.22 (broad m, 10H); 1.80-1.05 (broad m, 68H); 0.90 (m, 12H).

IN. Compound 332: Dodecan-4-yl-8-((3-acetamidopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₈ N ₂ O ₅

Molecular weight: 807.34

[00426] Dodecan-4-yl-8-((3-acetamidopropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)octanoate was synthesized from dodecan-4-yl- 8-[(3-chloropropyl)[8-(heptadecan-9-yloxy)-8-oxooctyl]amino]octanoate (300 mg, 0.382 mmol), acetamide (226 mg, 3.82 mmol) and cesium carbonate (125 mg , 0.382 mmol) in DMF (7 ml). Yield (74 mg, 24%). UHPLC/DSIO: RT=3.47 min. MS (ESI): m/z (MH ⁺ ) 807.98 for C ₅₀ H ₉₈ N ₂ O _5. ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.34 (m, 2H); 2.64-2.22 (broad m, 10H); 1.95 (s, 3H); 1.80-1.10 (broad m, 68H); 0.90 (m, 12H) (acetamide proton not observed).

IO. Compound 333: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-(3-methylthioureido)propyl)amino)octanoate

Chemical formula: C ₅₀ H ₉₉ N ₃ O ₄ S

Molecular weight: 838.42

[00427] Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(3-(3-methylthioureido)propyl)amino)octanoate was synthesized from dodecane -4-yl-8-[(3-chloropropyl)[8-(heptadecan-9-yloxy)-8-oxooctyl]amino]octanoate (300 mg, 0.382 mmol), N-methylthiourea (345 mg, 3.82 mmol ) and cesium carbonate (187 mg, 0.573 mmol) in DMF (7 mL). Yield (29 mg, 9.0%). ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.04 (t, 2H); 2.88 (s, 3H); 2.60-2.20 (broad m, 10H); 1.90-1.05 (broad m, 70H); 0.90 (m, 12H).

IP. Compound 334: Dodecan-4-yl-8-((2,3-dihydroxypropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)octanoate

Stage 1: Dodecan-4-yl-8-((2,3-dihydroxypropyl)amino)octanoate

Chemical formula: C ₂₃ H ₄₇ NO ₄

Molecular weight: 401.63

[00428] In a manner similar to step 1 for compound 328, dodecan-4-yl-8-((2,3-dihydroxypropyl)amino)octanoate was synthesized from dodecan-4-yl-8-bromooctanoate (500 mg, 1.28 mmol) and 3-aminopropane-1,2-diol (2.33 g, 1.97 mmol) in ethanol (15 ml). Yield (359 mg, 70.0%). UHPLC/DSIO: RT=1.49 min. MS (ESI): m/z (MH ⁺ ) 402.49 for C ₂₃ H ₄₇ NO ₄ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 1H); 3.76 (m, 2H); 3.65 (m, 1H); 2.96-2.52 (broad m, 7H); 2.30 (t, 2H); 1.75-1.10 (broad m, 28H); 0.90 (m, 6H).

Stage 2: Dodecan-4-yl-8-((2,3-dihydroxypropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₈ H ₉₅ NO ₆

Molecular weight: 782.29

[00429] Dodecan-4-yl-8-((2,3-dihydroxypropyl)(8-(heptadecan-9-yloxy)-8-oxooctyl)amino)octanoate was synthesized from dodecan-4- yl-8-[(2,3-dihydroxypropyl)amino]octanoate (359mg, 0.894mmol), heptadecan-9-yl-8-bromooctanoate (454mg, 0.983mmol), potassium carbonate (247mg, 1.79mmol ) and potassium iodide (30 mg, 0.18 mmol) in MeCN (10 ml). Yield (412 mg, 58.9%). UHPLC/DSIO: RT=3.39 min. MS (ESI): m/z (MH ⁺ ) 782.97 for C ₄₈ H ₉₅ NO ₆ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 3.77 (m, 2H); 3.51 (m, 1H); 2.74-2.38 (broad m, 6H); 2.30 (t, 4H); 1.75-1.10 (broad m, 66H); 0.90 (m, 12H) (hydroxyl protons not observed).

I.Q. Connection 335: Heptadecan-9-yl-8-((2-((2-aminoethyl)amino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Stage 1: tert -Butyl-(2-(( tert -butoxycarbonyl)amino)ethyl)(2-hydroxyethyl)carbamate(J.Med. Chem.,2003,46(26), 5712-5724)

Chemical formula: C ₁₄ H ₂₈ N ₂ O ₅

Molecular weight: 304.39

[00430] To a solution of 2-((2-aminoethyl)amino)ethanol (2.0 g, 20 mmol) in tetrahydrofuran (40 ml) at 0°C was added a solution of di- tert -butyl dicarbonate (9.2 g, 40 mmol ) in tetrahydrofuran (10 ml) and the reaction mixture was stirred overnight at room temperature. The solvent was removed and the residue was taken up in ethyl acetate. The solution was washed with saturated aqueous sodium chloride, dried over anhydrous sodium sulfate, and the solvent was removed in vacuo to give the crude product, which was purified by silica gel chromatography (0-40% EtOAc in hexanes) to give tert -butyl-(2-( ( tert -butoxycarbonyl)amino)ethyl)(2-hydroxyethyl)carbamate (3.8 g, 65%). ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.03-4.88 (m, 1H); 3.71 (br. s, 2H); 3.34-3.11 (m, 7H); 1.45 (s, 9H); 1.41 (s, 9H).

Stage 2: tert -Butyl-(2-(( tert -butoxycarbonyl)amino)ethyl)(2-(1,3-dioxoisoindolin-2-yl)ethyl)carbamate (J.Med. Chem.,2003,46(26), 5712-5724)

Chemical formula: C ₂₂ H ₃₁ N ₃ O ₆

Molecular weight: 433.51

[00431] To a solution of tert -butyl-(2-(( tert -butoxycarbonyl)amino)ethyl)(2-hydroxyethyl)carbamate (2.3 g, 7.56 mmol), phthalimide (1.21 g, 8.24 mmol) and triphenylphosphine (2.16 g, 8.24 mmol) in tetrahydrofuran (50 ml) diisopropyl azodicarboxylate (DIAD) (1.62 ml, 8.24 mmol) was added dropwise at 0°C and the reaction mixture was stirred at room temperature in three days. The solvent was removed to give the crude product, which was purified by silica gel chromatography (0-50% EtOAc in hexanes) to give t -butyl-(2-(( t -butoxycarbonyl)amino)ethyl)(2-(1.3 -dioxoisoindolin-2-yl)ethyl)carbamate (2.75 g, 84%) as a foamy white solid. ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 7.82 (m, 2H); 7.72-7.69 (m, 2H); 5.16 (br. s, 1H); 3.83-3.79 (m, 2H); 3.50-3.49 (m, 2H); 3.33-3.28 (m, 4H); 1.40 (s, 9H); 1.21 (s, 9H).

Stage 3: tert -Butyl-(2-aminoethyl)(2-(( tert -butoxycarbonyl)amino)ethyl)carbamate(J.Med. Chem.,2003,46(26), 5712-5724)

Chemical formula: C ₁₄ H ₂₉ N ₃ O ₄

Molecular weight: 303.40

[00432] Hydrazine monohydrate (0.7 ml, 12.69 mmol) was added to a solution of tert -butyl-(2-(( tert -butoxycarbonyl)amino)ethyl)(2-(1,3-dioxoisoindolin-2-yl) ethyl)carbamate (2.75 g, 6.35 mmol) in methanol (50 ml) and the reaction mixture was stirred at reflux for 18 hours. She was left to cool to room. temp., the mixture was filtered through a sintered glass filter funnel, the filter press cake was washed with methanol and the filtrate was concentrated to give a crude product which was purified by silica gel chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give tert -butyl-(2-aminoethyl)(2-(( tert -butoxycarbonyl)amino)ethyl)carbamate (1.6 g, 83%). ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.50-5.20 (m, 1H); 3.29-3.24 (m, 6H); 2.84-2.82 (m, 2H); 1.44 (s, 9H); 1.41 (s, 9H) (protons of the primary amino group were not observed).

Stage 4: Heptadecan-9-yl-8-( tert -butoxycarbonyl)-2,2-dimethyl-4-oxo-3-oxa-5,8,11-triazanonedecane-19-oate

Chemical formula: C ₃₉ H ₇₇ N ₃ O ₆

Molecular weight: 684.06

[00433] A solution of heptadecan-9-yl-8-bromooctanoate (0.97 g, 2.11 mmol) andtert-butyl-(2-aminoethyl)(2-((tert-butoxycarbonyl)amino)ethyl)carbamate (1.6 g, 5.27 mmol) in ethanol (20 ml) was heated at 65° C. for 18 hours. The solvent was removed in vacuo and the crude product was purified by silica gel chromatography (0-100% EtOAc in hexanes, then (0-100% (1% NH₄OH, 20% MeOH in dichloromethane) in dichloromethane) to give heptadecan-9-yl-8-(tert-butoxycarbonyl)-2,2-dimethyl-4-oxo-3-oxa-5,8,11-triazanonedecane-19-oate (670 mg, 50%) as an oil. MS (IER):m/z (MH⁺) 684.5 for C₃₉H₇₇N₃O₆.¹H NMR (300 MHz, CDCl₃): δ ppm 5.46-5.26 (broad s, 1H); 4.88-4.82 (m, 1H); 3.59 (br. s, 2H); 3.42-3.28 (m, 4H); 3.10-2.70 (m, 3H); 2.25 (t, 2H,J= 7.5 Hz); 1.78-1.57 (m, 4H); 1.45 (s, 9H); 1.41 (s, 9H); 1.41-1.27 (m, 4H); 1.26-1.22 (m, 32H); 0.86 (t, 6H,J=6.7 Hz).

Stage 5: Heptadecan-9-yl-8-( tert -butoxycarbonyl)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5,8,11-triazanonedecane-19-oat

Chemical formula: C ₅₆ H ₁₀₉ N ₃ O ₈

Molecular weight: 952.50

[00434] To a solution of heptadecan-9-yl-8-( tert -butoxycarbonyl)-2,2-dimethyl-4-oxo-3-oxa-5,8,11-triazanonedecane-19-oate (670 mg, 0. 98 mmol) in cyclopentylmethyl ether (10 ml) was added a solution of nonyl 8-bromooctanoate (358 mg, 1.029 mmol) in acetonitrile (10 ml) followed by the addition of potassium carbonate (546 mg, 3.92 mmol) and potassium iodide (179 mg , 1.07 mmol). The reaction mixture was heated to 90°C for 2 days. She was left to cool to room. temp., filtered through diatomaceous earth, the filter cake was washed extensively with ethyl acetate, and the filtrate was concentrated to give the crude product, which was purified by silica gel chromatography (0 to 100% EtOAc in hexanes) to give heptadecan-9-yl-8 -( tert -butoxycarbonyl)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5,8,11-triazanonedecane-19-oate (560 mg, 60%). MS (ESI): m/z (MH ⁺ ) 952.8 for C ₅₆ H ₁₀₉ N ₃ O ₈ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 6.65 (br. s, 0.5H); 5.70 (br. s, 0.5H); 4.88-4.82 (m, 1H); 4.04 (t, 2H, J =6.7 Hz); 3.32-3.12 (m, 6H); 2.68-2.48 (m, 2H); 2.44-2.34 (m, 4H); 2.29-2.22 (m, 4H); 1.68-1.54 (m, 8H); 1.52-1.38 (m, 10H); 1.44 (s, 18H); 1.38-1.12 (m, 44H); 0.86 (t, 9H, J =6.8 Hz).

Stage 6: Heptadecan-9-yl-8-((2-((2-aminoethyl)amino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₃ N ₃ O ₄

Molecular weight: 752.27

[00435] To a solution of heptadecan-9-yl-8-( tert -butoxycarbonyl)-2,2-dimethyl-11-(8-(nonyloxy)-8-oxooctyl)-4-oxo-3-oxa-5.8 ,11-triazanonedecane-19-oate (560 mg, 0.59 mmol) in dichloromethane (10 ml) trifluoroacetic acid (3 ml) was added at 0° C. and the reaction mixture was stirred at room temperature overnight. The reaction mixture was quenched with saturated aqueous sodium hydrogen carbonate. The organic layer was washed with 1 N sodium hydroxide solution, saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and the solvent was removed in vacuo to give the crude product, which was purified by silica gel chromatography (methanol containing 4% ammonia 0-100% in DCM ) to give heptadecan-9-yl-8-((2-((2-aminoethyl)amino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (256 mg, 58%) as a colorless oil . HPLC/UV (DSIO): RT=6.70 min. MS (ESI): m/z (MH ⁺ ) 752.7 for C ₄₆ H ₉₃ N ₃ O ₄ . ¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 4.87-4.82 (m, 1H); 4.03 (t, 2H, J =6.6 Hz); 2.78 (t, 2H, J =5.9 Hz); 2.63 (dd, 4H, J =5.9 Hz, 13.9 Hz); 2.50 (t, 2H, J =6.0 Hz); 2.36 (t, 4H, J =7.3 Hz); 2.26 (dt, 4H, J =3.8 Hz, 7.5 Hz); 1.68-1.54 (m, 7H); 1.52-1.42 (m, 8H); 1.42-1.36 (m, 7H); 1.36-1.12 (m, 43H); 0.86 (t, 9H, J =6.6 Hz).

IR. Compound 336: 8-(Heptadecan-9-yloxy)- N -(3-hydroxypropyl)- N -methyl- N -(8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1-aminium iodide

Chemical formula: C ₄₆ H ₉₂ INO ₅

Molecular weight: 866.15

[00436] To a solution of heptadecan-9-yl-8-[(3-hydroxypropyl)[8-(nonyloxy)-8-oxooctyl]amino]octanoate (0.21 g, 0.29 mmol) in dichloroethane mixture (2 mL) and acetonitrile (3 ml) methyl iodide (0.02 ml, 0.29 mmol) was added. The reaction mixture was stirred at rt. pace. in two hours. Solvents evaporated. The residue was diluted with DCM and extracted with sat. _NaHC03 . The organic layer was separated, washed with saturated aqueous sodium chloride, dried over Na ₂ SO ₄ , filtered and evaporated under vacuum. The residue was purified by flash chromatography (0-100% (1% NH ₄ OH, 20% MeOH in dichloromethane) in dichloromethane) to give 8-(heptadecan-9-yloxy) -N- (3-hydroxypropyl) -N -methyl - N- (8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1-aminium iodide (0.152 g, 0.29 mmol, 70%). LC/DSIO: RT=3.29 min. MS (ESI): m/z (M ⁺ ) 738.85 for C ₄₆ H ₉₂ NO ₅ ^{+ 1} H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87 (m, 1H); 4.08 (t, 2H); 3.91-3.68 (broad m, 4H); 3.38 (broad m, 4H); 3.26 (s, 3H); 2.33 (m, 4H); 2.07 (broad m, 3H); 1.90-1.18 (m, 62H); 0.90 (m, 9H).

IS. Compound 337: 8-(Heptadecan-9-yloxy)- N -(2-hydroxyethyl)- N -methyl- N -(8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1-aminium iodide

Chemical formula: C ₄₅ H ₉₀ INO ₅ ⁺

Molecular weight: 852.12

[00437] Compound 337 was synthesized in a manner analogous to the synthesis of compound 336 using heptadecan-9-yl-8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate and methyl iodide. The yield was 95 mg (0.111 mmol, 15%). LC/DSIO: RT=3.37 min. MS (ESI): m/z (M ⁺ ) 724.91 for C ₄₅ H ₉₀ NO ₅ ^{+ 1} H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87 (m, 1H); 4.20 (broad m, 2H); 4.07 (t, 2H); 3.74 (broad m, 2H); 3.50 (broad m, 4H); 3.33 (s, 3H); 2.33 (m, 4H); 1.87-1.17 (broad m, 62H); 0.90 (m, 9H).

IT. Compound 338: 8-(Heptadecan-9-yloxy)- N, N -dimethyl- N -(8-(nonyloxy)-8-oxooctyl)-8-oxooctane-1-aminium iodide

Chemical formula: C ₄₄ H ₈₈ INO ₄

Molecular weight: 822.09

[00438] Compound 338 was synthesized in a manner analogous to the synthesis of compound 336 using heptadecan-9-yl-8-(methyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate and methyl iodide. The yield was 202 mg (0.29 mmol, 39%). LC/DSIO: RT=3.33 min. MS (ESI): m/z (M ⁺ ) 694.89 for C ₄₄ H ₈₈ NO ₄ ^{+ 1} H NMR (300 MHz, CDCl ₃ ) δ: ppm 4.87 (n, 1H); 4.07 (t, 2H); 3.56 (broad m, 4H); 3.41 (s, 6H); 2.32 (m, 4H); 1.85-1.17 (broad m, 62H); 0.90 (m, 9H).

I.U. Compound 339: dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)octanoate

Stage 1: Dodecan-4-yl-8-(methylamino)octanoate

Chemical formula: C ₂₁ H ₄₃ NO ₂

Molecular weight: 341.58

[00439] To a 2M solution of methylamine (1.19 g, 38.3 mmol) in THF (19 ml) was added dodecan-4-yl-8-bromooctanoate (500 mg, 1.28 mmol) and the reaction mixture was allowed to stir at room temperature. temperature within 48 hours. The solution was concentrated in vacuo , taken up in EtOAc and washed x3 with water, saturated aqueous sodium chloride solution, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated in vacuo. Purification by silica gel chromatography (0-50% (DCM 20% MeOH 1% NH ₄ OH) in DCM) afforded dodecan-4-yl-8-(methylamino)octanoate (326 mg, 74.7%). UHPLC/DSIO: RT=1.55 min. MS (ESI): m/z (MH ⁺ ) 342.23 for C ₂₁ H ₄₃ NO ₂ . ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 1H); 2.58 (t, 2H); 2.45 (s, 3H); 2.30 (t, 2H); 1.80-1.05 (broad m, 29H); 0.92 (m, 6H).

Stage 2: Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)octanoate

Chemical formula: C ₄₆ H ₉₁ NO ₄

Molecular weight: 722.24

[00440] Dodecan-4-yl-8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(methyl)amino)octanoate was synthesized from dodecan-4-yl-8- (methylamino)octanoate (326 mg, 0.954 mmol), heptadecan-9-yl-8-bromooctanoate (485 mg, 1.05 mmol), potassium carbonate (264 mg, 1.91 mmol) and potassium iodide (32 mg, 0 .19 mmol) in MeCN (10 ml). Yield (392 mg, 56.9%). UHPLC/DSIO: RT=3.48 min. MS (ESI): m/z (MH ⁺ ) 722.94 for C ₄₆ H ₉₁ NO _4. ¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 4.90 (m, 2H); 2.55-2.05 (broad m, 11H); 1.75-1.10 (broad m, 66H); 0.90 (m, 12H).

IV. Compound 340: 2-(Di((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethan-1-ol

Chemical formula: C ₃₈ H ₇₁ NO

Molecular weight: 557.99

[00441] To solution (6Z,9Z)-18-bromoctadeca-6,9-diene (4 g, 12.1 mmol) in MeCN (26 ml) was added ethanolamine, (0.334 ml, 5.52 mmol), K₂CO₃ (3.36 g, 24.3 mmol) and KI (92 mg, 0.552 mmol). The reaction mixture was left to stir at 82°C for 48 hours. The reaction mixture was cooled to room temperature, filtered and the solids were washed with a mixture of hexanes. The filtrate was extracted with a mixture of hexanes and the combined extracts were concentrated in vacuo. Purification by ISCO flash chromatography on silica gel (0-20% MeOH/DCM) afforded 2-(di((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethan-1-ol. Yield (1.9 g, 62%).

UHPLC/DSIO: RT=6.80 min. MS (ESI): m/z (MH ⁺ ) 557.94 for C ₃₈ H ₇₁ NO

¹ H-NMR (300 MHz, CDCl ₃ ) δ: ppm 5.35 (m, 8H); 3.52 (t, 2H); 2.77 (t, 4H); 2.57 (t, 2H); 2.43 (t, 4H); 2.04 (q, 8H); 1.48-1.18 (broad m, 36H); 0.89 (t, 6H).

Example 2 Preparation of Nanoparticle Compositions

A. Preparation of nanoparticle compositions

[00442] In order to investigate safe and effective nanoparticle compositions for use in delivering therapeutic and/or prophylactic agents to cells, a number of formulations are being prepared and tested. In particular, specific elements and their ratios in the lipid component of nanoparticle compositions are optimized.

[00443] Nanoparticles can be prepared using mixing techniques such as microfluidics and T-connection mixing of two fluid streams, one containing a therapeutic and/or prophylactic agent and the other containing lipid components.

[00444] Lipid compositions are prepared by combining lipids of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), a phospholipid (such as DOPE or DSPC, available from Avanti Polar Lipids, Alabaster, Alabama), a PEG lipid (such as 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol, also known as PEG- DMG obtained from Avanti Polar Lipids, Alabaster, Alabama) and a structural lipid (such as cholesterol, available from Sigma-Aldrich, Taufkirchen, Germany, or a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) or combinations thereof) at concentrations about 50 mM in ethanol. Solutions should be stored in a refrigerator, for example at -20°C. The lipids are combined to yield the desired molar ratios (see, for example, Table 23) and diluted with water and ethanol to a final lipid concentration between about 5.5 mM and about 25 mM.

[00445] Nanoparticle compositions containing therapeutic and/or prophylactic and lipid components are prepared by combining a lipid solution with a solution containing an agent in the lipid component with a therapeutic and/or prophylactic agent in wt:wt ratios. from about 5:1 to about 50:1. The lipid solution is rapidly injected using a NanoAssemblr microfluidic solution system at flow rates of about 10 ml/min to about 18 ml/min into the therapeutic and/or prophylactic solution to form a suspension with a water to ethanol ratio of about 1:1. and about 4:1.

[00446] For nanoparticle compositions containing RNA, 0.1 mg/ml solutions of RNA in deionized water are diluted in 50 mM sodium citrate buffer at pH 3 to 4 to form a stock solution.

[00447] Nanoparticle compositions can be dialyzed to remove ethanol and achieve buffer exchange. The preparations are dialyzed twice with phosphate-buffered saline (PBS), pH 7.4, at 200 times the volume of the primary product, using Slide-A-Lyzer cassettes (Thermo Fisher Scientific Inc., Rockford, IL), with cut-off molecular weight 10 kDa. The first dialysis is carried out at room temperature for 3 hours. The preparations are then dialyzed overnight at 4°C. The resulting suspension of nanoparticles is equally filtered through sterile 0.2 μm filters (Sarstedt, Nümbrecht, Germany) into glass vials and sealed with lids. Typically, solutions of the nanoparticle composition are obtained from 0.01 to 0.10 mg/ml.

[00448] The method described above causes nanoprecipitation and particle formation. Alternative methods, including but not limited to T-connection and direct injection, can be used to achieve the same nanodeposition.

B. Characterization of nanoparticle compositions

[00449] Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can be used to determine particle size, polydispersity index (PDI) and zeta potential of nanoparticle formulations in 1×PBS for particle size determination and 15 mM PBS for zeta determination -potential.

[00450] Ultraviolet spectroscopy in the visible range can be used to determine the concentration of therapeutic and/or prophylactic (eg, RNA) in nanoparticle compositions. 100 μl of the diluted composition in 1×PBS is added to 900 μl of a 4:1 (v/v) mixture of methanol and chloroform. After stirring, the absorption spectrum of the solution is recorded, for example between 230 nm and 330 nm, on a DU 800 spectrophotometer (Beckman Coulter, Beckman Coulter, Inc., Bray, CA). The concentration of the therapeutic and/or prophylactic agent in the nanoparticle composition can be calculated based on the extinction coefficient of the therapeutic and/or prophylactic agent used in the composition and the difference between the optical density at a wavelength, for example, 260 nm, and the background value at a wavelength, for example , 330 nm.

[00451] For nanoparticle compositions containing RNA, the QUANT-IT™ RIBOGREEN® RNA assay (Invitrogen Corporation, Carlsbad, CA) can be used to assess RNA encapsulation with the nanoparticle composition. Samples are diluted to approximately 5 μg/ml in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5). 50 µl of diluted samples are transferred to a polystyrene 96-well plate and either 50 µl of TE buffer or 50 µl of 2% Triton X-100 solution is added to the wells. The tablet is incubated at 37°C for 15 minutes. The RIBOGREEN® reagent is diluted 1:100 in TE buffer and 100 µl of this solution is added to each well. Fluorescence intensity can be measured using a fluorescent plate reader (Wallac Victor 1420 Multilabel Counter; Perkin Elmer, Waltham, MA) at an excitation wavelength of, for example, about 480 nm and an emission wavelength of, for example, about 520 nm. Fluorescence values in the blank reagent are determined by the values of each sample, and the percentage of free fluctuation depends on the fluorescence value of the intact sample (without the addition of Triton X-100) against the fluorescence value of the destroyed sample (caused by the addition of Triton X-100).

C. In vivo drug studies

[00452] In order to monitor how effectively various nanoparticle compositions deliver therapeutic and/or prophylactic agents to target cells, various nanoparticle compositions are prepared and administered, including a specific therapeutic and/or prophylactic (e.g., modified or naturally occurring RNA, such as mRNA) of the rodent population. Mice are intravenously, intramuscularly, intraarterially, or intratumorally injected with a single dose containing a composition of nanoparticles with a drug, such as the drugs proposed in Example 3. In some cases, mice can be forced to inhale doses. The dose size can vary from 0.001 mg/kg to 10 mg/kg, with 10 mg/kg describing a dose containing 10 mg of therapeutic and/or prophylactic agent in the nanoparticle formulation for every 1 kg of mouse body weight. A control composition including PBS can also be used.

[00453] When nanoparticle compositions are administered to mice, dose delivery profiles, dose responses and toxicity of specific drugs and their doses can be measured using enzyme immunoassay (ELISA), bioluminescent imaging, or other methods. For nanoparticle compositions, including mRNA, the time course of protein expression can also be assessed. Samples taken from rodents for evaluation may include blood, serum, and tissues (eg, muscle tissue from an intramuscular injection site and internal tissue); collection of samples may include the killing of animals.

[00454] Nanoparticle compositions, including mRNA, are suitable for evaluating the efficacy and suitability of various formulations for the delivery of therapeutic and/or prophylactic agents. Higher levels of protein expression induced by the administration of the composition containing the mRNA will indicate a higher translation efficiency of the mRNA and/or the nanoparticle mRNA composition. Since non-RNA components are not believed to affect the translation mechanisms themselves, a higher level of protein expression probably indicates a higher efficiency of delivery of a therapeutic and/or prophylactic agent by this nanoparticle composition compared to other nanoparticle compositions or its absence.

Example 3 Sample Preparations

[00455] Nanoparticle compositions containing therapeutic and/or prophylactic agents can be optimized according to the choice of compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc) , (IId), (IIe), (IIf), (IIg) or (III), the choice of additional lipids, the amount of each lipid in the lipid component, and the weight ratio of the lipid component to the therapeutic and/or prophylactic agent described herein.

[00456] Initial studies were performed to compare the delivery efficiency of nanoparticle compositions, including various compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Cationic lipid MC3 is the current standard in this field. Accordingly, a standard MC3 formulation comprising about 50 mole MC3, about 10 mole DSPC, about 38.5 mole cholesterol, and about 1.5 mole PEG-DMG was used as the basis for this study. Nanoparticle compositions comprising DSPC as a phospholipid, cholesterol as a structural lipid, PEG-DMG as a PEG lipid, RNA and a compound of formula (I), (IA), (IB), (II), (IIa), (IIb ), (IIc), (IId), (IIe), (IIf), (IIg) or (III) selected from compounds 1-159, 168-170 and 173-175 were prepared according to or by methods analogous to those described. in Examples 1 and 2. Lipid ratios were 50:10:38.5:1.5 mol% for lipids according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III): DSPC: cholesterol:PEG-DMG. The RNA used was mRNA encoding luciferase (Luc) or hEPO, with each uridine replaced by N1-methylpseudouridine. Tables 1A-1E summarize the contents and characteristics of the preparations.

[00457] As shown in Tables 1A-1E, the choice of compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) significantly affects the size (eg, diameter), polydispersity ratio, and encapsulation efficiency (EE) of the compositions. The compositions had sizes from about 53 nm to 237 nm. Compositions containing compounds 5, 35, 36, 51, 59, 131, 132, 137-139, 145, 148, 155 and 158 gave the largest particles, while compositions containing compounds 9, 21, 29, 30, 65 , 7175, 94 107, 114-116, 119, 124, 133, 149, 150, 152, 174 and 175 gave the smallest particles. Polydispersity values ranged from 0.04 to 0.99 while encapsulation efficiency exceeded 75% for formulations containing each test compound except for compounds 21, 94, 107, 132, 148, 155 and 158. The highest encapsulation efficiency was observed for connections 1, 6, 18, 19, 24, 26, 28, 29, 49, 50, 55, 60, 61, 65-70, 72, 74, 75, 101, 109-116, 118, 119, 121, 122, 124, 126, 128, 130, 149, 152, 153, 156, 159, 169, 170 and 174.

Table 1A. Characteristics of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Compound Size (nm) PDI EE (%) pKa 1 72.7 0.091 97.04 6.50 2 83.9 0.14 93.88 6.73 3 97.5 0.20 92.25 6.72 4 120.5 0.21 95.10 6.33 5 196.4 0.21 77.07 6.84 6 73.1 0.066 97.60 6.32 7 118.9 0.22 86.10 6.75 8 121.0 0.15 95.8 6.64 9 68.5 0.12 75.7 4.87 10 102.9 0.18 89.60 6.09 eleven 129.6 0.13 92.47 5.97 12 116.7 0.17 92.44 5.99 13 79.4 0.13 92.28 5.67 14 130.1 0.15 95.24 6.58 15 111.1 0.094 92.47 5.58 16 119.0 0.16 91.32 5.52 17 85.2 0.24 91.84 7.76 18 87.9 018 95.9 6.56 19 101.1 0.17 97.21 6.78 20 86.7 0.13 96.72 6.87 21 53.5 No data -15.1 No data 22 80.2 0.22 96.00 6.21 23 104.5 0.09 92.68 6.84 24 99.5 0.13 97.16 6.71 25 85.8 0.10 95.80 6.68 26 91.9 0.16 97.43 6.64 27 82.3 0.18 94.27 6.78 28 99.4 0.20 97.03 6.04 29 66.8 0.11 96.99 6.00 thirty 59.4 0.15 95.69 6.75 31 73.9 0.15 95.11 6.64 32 105.6 0.18 94.87 6.75 33 107.3 0.13 95.66 6.80 34 133.8 0.14 92.52 6.64 35 151.1 0.18 90.82 6.85 36 163.5 0.17 81.45 7.38 47 80.6 0.10 96.40 No data 48 82.3 0.092 96.55 6.68 49 88 0.14 89.52 6.52 50 68.4 0.100 97.33 6.42 51 148.8 0.17 89.83 No data 52 130.5 0.19 93.25 No data 53 125.4 0.13 95.8 No data 54 112.9 0.19 96.71 6.51 55 91.6 0.16 97.03 6.44 56 112.1 0.17 95.18 No data 57 128.4 0.16 94.33 No data 58 130.8 0.14 92.54 No data 59 237.0 0.24 94.44 No data 60 95.1 0.12 97.6 6.73 61 82.1 0.15 97.40 6.70 65 63.9 0.12 98.2 6.36 66 76.7 0.120 96.52 76.7 67 77 0.13 98 6.38 68 76.8 0.14 97.7 6.69 69 77.2 0.13 98.4 6.92 70 73.7 0.15 97.5 6.51 71 71 0.24 97.54 5.88 72 76.8 0.10 94.69 6.29 73 59.2 0.13 95.7 5.95 74 65.6 0.15 97 6.08 75 92.1 0.17 92.3 6.67 79 93.7 0.18 89.1 7.53 80 118 0.19 90.7 7.52 81 99.2 0.14 95.4 7.14 94 62.4 0.24 0 4.43 96 120.5 0.160 79.04 6,600 101 91.7 0.230 98.96 7.27 103 78.8 0.160 90.77 6.13 107 55 0.74 0 4,802 108 119 0.14 96 7.17 109 81.1 0.13 98.6 6.78 110 91.5 0.21 91.9 8.03 111 116.7 0.22 76.8 7.13 112 83.7 0.22 99.0 7.78 113 86.8 0.13 96.92 6.93 114 65.1 0.11 98.8 6.42 115 64.5 0.11 99.7 No data 116 63.3 0.14 99.4 5.66 118 72.1 0.08 98 6.14 119 60.8 0.24 98.1 5.29 121 98.4 0.18 100 8.50 122 69.3 0.09 98.2 6.83 123 81.6 0.23 94.4 6.27 124 61.3 0.1 97.7 5.89 125 90.9 0.16 79.6 No data 126 77.4 0.18 96.8 6.00 127 110.4 0.19 89.5 6.98 128 104.1 0.22 92.45 6.56 129 86.3 0.19 77.2 7.3 130 107.1 0.13 97 6.83 131 167.9 0.095 75.44 7.76 132 298.0 0.180 30.77 7.34 133 66.0 0.098 91.48 6.38 134 85.6 0.110 94.62 6.66 135 89.5 0.130 90.20 6.47 136 140.4 0.5 90.9 6.95 137 184.4 <1 85.7 7.06 138 179.4 <0.5 91.8 7.39 139 174.0 0.54 78.2 7.04 140 120.3 0.84 89.2 7.71 141 91.3 0.99 94.1 7.47 143 98.8 0.21 97.37 6.47 144 135.9 0.22 90.3 7.09 145 176.5 0.140 89.15 7.25 146 97.0 0.210 91.94 7.78 147 99.5 0.130 88.31 6.66 148 192.7 0.200 25.49 6.646 149 62.1 0.110 98.00 6.284 150 63.1 0.082 96.72 6.101 151 105.7 0.140 87.86 6.593 152 62.6 0.072 99.29 6.465 153 83.7 0.150 98.39 6,580 154 92.9 0.110 94.28 6.827 155 208.3 0.240 37.36 6.576 156 68.1 0.11 98.47 6.572 157 61 0.093 96.04 6.275 158 251.8 0.080 35.70 6.953 159 75.9 0.190 99.29 7.873 160 89.0 0.15 94.0 6.54 161 67.6 0.09 94.3 6.08 162 72.7 0.14 94.1 6.08 163 88.3 0.10 93.2 6.41 164 84.5 0.13 91.2 6.39 165 84.6 0.14 92.9 6.50 168 102.3 0.20 91.4 6.74 169 87.4 0.17 99.4 6.77. 170 96.0 0.18 96.7 6.31 171 100.5 0.14 85.0 6.48 172 77.3 0.13 95.4 6.40 173 75.5 0.16 92.89 6.31 174 84.4 0.21 99.0 6.65 175 65.7 0.16 94.8 6.15 178 104.2 0.12 94.7 6.90 179 71.6 0.11 94.7 6.16 181 78.7 0.12 88.9 6.17 182 84.4 0.14 99.0 6.48 183 245.3 0.24 32.3 6.54 184 77.2 0.13 94.2 6.47 185 69.6 0.14 98.3 6.77 186 92.2 0.17 87.2 6.33 198 84.2 0.24 99.5 7.62 200 76.2 0.15 97.65 218 81.4 0.21 98.8 6.59 233 66.9 0.11 97.81 239 55.8 0.12 90.42 98 82.8 0.16 94.4 6.53 MC3 79.7 0.11 97.3 No data

Table 1B. Characteristics of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Compound Size (nm) PDI EE (%) Endotoxin (unit/ml) Apparent pKa 18 ^# 73.7 0.14 96.95 <1 6.56 25 ^# 69.7 0.14 97.92 1.8 6.68 30 ^# 76.3 0.13 96.32 <1 6.75 108 ^# 89.6 0.22 95.38 <1 7.17 109 ^# 75 0.099 98.29 <1 6.78 110 ^# 73.3 0.24 92.39 <1 8.03 111 ^# 93.3 0.13 91.23 1.4 7.13 112 ^# 60.6 0.21 96.40 1.8 7.78 60 ^# 88.9 0.15 95.20 <1 6.73 122 ^# 70.2 0.12 96.27 1.2 6.83 147 ^# 111.9 0.22 91.0 184 ^# 85.8 0.16 96.5 189 ^# 95.5 0.16 93.9 200 ^# 95.3 0.19 97.3 232 ^# 150.3 0.23 76.3 233 ^# 93.7 0.21 97.6 234 ^# 96.3 0.22 94.7 235 ^# 228 0.24 40.9 237 ^# 82.5 0.15 99.3 239 ^# 71.3 0.14 82.6 243 ^# 90.6 0.35 99.4 MC3 ^# 57.7 0.12 99.01 <1 6.35 ^# = compiled with hEPO mRNA

Table 1C. Characteristics of subcutaneous nanoparticle formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Lipids Size (nm) PDI %EE MC3 56.9 0.09 98.2 20 86.7 0.13 91.6 24 88.5 0.17 90.5 25 76.3 0.16 98.1 thirty 81.7 0.12 93.0 72 77.3 0.10 94.9 75 88.6 0.13 94.9 110 91.5 0.21 91.9 112 83.7 0.22 99.0 113 83.9 0.14 99.6 122 80.2 0.16 94.8

Table 1D. Characteristics of subcutaneous nanoparticle formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Lipids Size (nm) PDI %EE MC3 69.1 0.15 98.7 18 ^# 75.0 0.11 96.2 25 ^# 77.6 0.13 97.8 30 ^# 89.8 0.11 93.1 48 ^# 79.8 0.09 96.2 49 ^# 74.0 0.09 96.2 60 ^# 87.4 0.13 93.0 96 ^# 82.6 0.14 94.4 98 ^# 74.8 0.14 93.8 111 ^# 94.5 0.12 90.9 151 ^# 77.6 0.13 95.4 163 ^# 78.0 0.10 92.8 164 ^# 75.7 0.08 94.1 165 ^# 74.3 0.14 93.5 168 ^# 87.4 0.07 96.1 207 ^# 81.4 0.22 102 233 ^# 87.0 0.13 97.5 ^# = compiled with hEPO mRNA

Table 1E. Characteristics of subcutaneous nanoparticle formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Lipids Size (nm) PDI %EE MC3 62.4 0.10 98 168 85.0 0.08 95 23 70.5 0.13 98 19 80.7 0.13 93 108 96.1 0.15 96 109 67.0 0.10 98 111 88.9 0.16 88 60 93.3 0.12 88 61 80.0 0.08 96 69 71.8 0.09 99 128 73.9 0.13 94

Example 4 Luc Expression Induced by Sample Drugs

[00458] The effectiveness of the nanoparticle compositions presented in Table 1A was evaluated using a bioluminescence study. The formulations were administered intravenously to mice (n=6) at a dosage of 0.5 mg/kg and bioluminescence was measured after 3, 6 and 24 hours. The standard composition of MC3 and, in some cases, the control (eg, control PBS) were evaluated for comparison. As can be seen from Table 2, after 3 hours the total flux was highest for formulations containing compounds 4, 28, 32, 48, 66, 128 and 135, and the total flux after 3 hours was higher than or comparable to that of the MC3 formulations for compounds 2, 3, 18, 19, 20, 24, 26, 25, 27, 31, 33, 47, 49, 50, 53-55, 60, 61, 65-68, 70, 72, 74, 75, 96, 111, 122, 130, 133, 134, 143, 147, 148, 150, 151 and 153. These formulations also showed higher total flux at the 6 and 24 hour time points. Compositions containing compounds 9, 17, 57, 58, 59, 121, 125, 137, 140, 141 and 158 had significantly lower flux at all measured time points. In general, the flow decreased over time to less than 10% of the original flow. These results suggest that the compounds described herein may be useful in transfection applications.

Table 2. Luciferase expression induced by administration of nanoparticle compositions containing compounds of formula (I), (IA), (IIB), (II), (IIa), (IIb), (IIc), (IId), (IIe) , (IIf) or (IIg). General flow Compound 3 hours 6 hours 24 hours 1 3.48E+09 3.40E+09 4.10E+08 2 1.93E+10 4.31E+10 2.43E+09 3 6.55E+10 7.37E+10 4.96E+09 4 1.37E+11 6.01E+10 1.13E+09 5 2.77E+08 1.76E+08 2.40E+07 6 5.38E+09 7.60E+09 7.69E+08 7 4.13E+10 4.03E+10 1.68E+09 8 7.43E+09 6.71E+09 7.84E+08 9 1.43E+08 3.46E+06 1.01E+06 10 6.03E+08 2.37E+09 4.04E+07 eleven 3.38E+09 7.11E+09 1.15E+08 12 5.14E+09 1.27E+10 2.45E+08 13 1.02E+08 1.56E+08 1.47E+06 14 4.43E+08 2.29E+09 1.39E+08 15 4.31E+08 4.41E+07 2.05E+06 16 2.58E+08 5.45E+08 2.37E+07 17 7.72E+06 3.58E+06 6.79E+05 18 1.71E+10 2.13E+10 2.51E+09 19 3.38E+10 3.56E+09 4.68E+08 20 1.71E+10 2.48E+10 5.40E+08 22 6.57E+08 3.89E+08 2.73E+07 23 1.83E+09 1.15E+09 3.71E+08 24 1.72E+10 2.25E+10 1.83E+09 25 2.27E+10 1.59E+10 9.77E+08 26 6.75E+10 1.57E+10 1.54E+09 27 1.64E+10 1.03E+10 1.94E+09 28 8.98E+10 1.13E+11 1.20E+09 29 4.61E+09 2.89E+09 3.55E+08 thirty 1.19E+10 2.09E+10 1.21E+09 31 4.19E+10 5.31E+10 1.68E+09 32 8.65E+10 6.08E+10 1.92E+09 33 6.53E+10 1.20E+11 3.71E+09 34 1.06E+10 1.48E+10 6.69E+08 35 9.82E+08 1.24E+09 5.09E+07 36 6.97E+07 1.72E+08 4.44E+05 47 6.55E+10 5.38E+10 2.09E+09 48 8.73E+10 1.10E+11 2.92E+09 49 4.48E+10 1.08E+11 1.24E+09 50 3.81E+10 7.49E+10 5.02E+08 51 1.34E+08 2.80E+08 6.20E+06 52 2.91E+09 4.63E+09 2.55E+07 53 1.91E+10 2.32E+10 1.01E+09 54 5.36E+10 4.18E+10 9.07E+08 55 5.07E+10 1.68E+10 4.06E+08 56 1.27E+10 8.06E+09 2.53E+08 57 6.69E+06 6.21E+06 4.16E+05 58 5.69E+05 7.60E+05 3.64E+05 59 2.75E+05 2.79E+05 1.45E+05 60 7.91E+10 9.04E+10 2.90E+09 61 6.54E+10 6.20E+10 1.78E+09 65 6.56E+10 7.01E+10 7.50E+08 66 9.66E+10 4.577E+10 5.56E+09 67 4.24E+10 4.62E+10 4.51E+08 68 5.22E+10 8.16E+10 2.15E+09 69 3.38E+09 7.95E+09 1.15E+08 70 4.70E+10 2.49E+10 9.27E+08 71 4.09E+09 9.28E+09 6.51E+07 72 1.73E+10 4.07E+10 7.12E+08 73 8.10E+09 1.07E+10 1.27E+08 74 3.27E+10 2.23E+10 2.75E+08 75 3.51E+10 8.80E+10 2.13E+09 79 3.23E+08 5.27E+08 3.08E+07 80 2.76E+08 3.26E+08 1.54E+07 81 7.87E+09 9.96E+09 5.13E+08 96 4.54E+10 1.05E+11 3.86E+09 101 1.89E+08 1.41E+08 3.64E+06 103 2.68E+09 1.82E+09 9.45E+07 108 5.04E+09 5.53E+09 1.50E+08 109 3.82E+09 4.88E+09 8.06E+07 110 1.89E+09 2.57E+09 1.11E+08 111 1.89E+10 3.57E+10 8.86E+08 112 9.69E+08 1.04E+09 2.75E+07 113 5.16E+09 8.09E+09 1.30E+08 114 8.41E+07 5.98E+07 But. 115 2.13E+07 2.91E+07 But. 116 3.13E+07 3.86E+07 But. 118 1.46E+09 1.16E+09 4.37E+07 119 1.02E+07 3.74E+07 But. 121 1.29E+06 1.36E+06 But. 122 3.64E+10 8.64E+10 1.95E+09 123 4.06E+09 1.81E+10 5.18E+08 124 6.62E+07 3.91E+09 5.13E+06 125 2.44E+05 3.16E+05 But. 126 7.59E+09 1.09E+10 1.40E+08 127 3.81E+09 2.09E+09 4.56E+08 128 1.04E+11 8.99E+10 1.00E+09 129 5.97E+09 4.51E+09 2.22E+08 130 6.26E+10 8.92E+10 1.08E+09 131 6.97E+09 7.64E+09 2.47E+08 132 1.77E+09 1.36E+09 5.31E+07 133 3.32E+10 2.93E+10
2.91E+10 4.74E+08 134 2.01E+10 2.91E+10 8.00E+08 135 1.24E+11 9.90E+10 2.51E+09 136 7.21E+08 7.33E+08 3.39E+07 137 3.77E+05 5.02E+05 4.49E+05 138 2.97E+07 2.30E+07 1.63E+06 139 3.50E+07 1.17E+07 5.89E+05 140 3.74E+06 1.70E+06 5.67E+05 141 2.16E+0.06 1.21E+06 3.49E+05 143 1.76E+10 2.03E+10 2.47E+08 144 9.50E+09 1.82E+09 3.36E+08 145 7.11E+09 6.50E+09 2.38E+08 146 9.48E+07 8.39E+07 2.30E+06 147 3.24E+10 4.87E+10 3.32E+08 148 6.28E+10 3.71E+10 1.43E+09 149 1.01E+10 8.33E+09 3.45E+08 150 1.66E+10 2.31E+10 3.86E+08 151 5.63E+10 5.68E+10 2.23E+09 152 1.56E+09 2.45E+09 4.95E+07 153 1.69E+10 2.28E+10 5.10E+08 154 2.49E+09 4.89E+09 6.26E+07 155 2.49E+09 1.15E+10 1.99E+08 156 5.68E+09 1.03E+10 6.53E+07 157 8.54E+09 2.22E+10 1.90E+08 158 2.69E+05 9.82E+05 1.55E+05 159 3.32E+06 1.20E+07 4.98E+05 MC3 1.58E+10 2.12E+10 7.19E+08

[00459] The total flux (measured by area under the curve, AUC) induced by the administration of the composition containing a given lipid relative to the flux induced by the administration of the composition containing MC3 was also measured for several lipids. As shown in Table 3A (i.v. administration), the flux induced by formulations containing compounds 48 and 49, measured after 6 hours, was ten times higher than that induced by formulation MC3. Formulations containing compounds 50, 54 and 55 also exhibited higher flux than MC3 formulations. As shown in Table 3B, the flux induced by formulations containing compounds 108 and 168, measured after 6 hours, was fourteen and sixteen times higher than the flux induced by formulation MC3 via intramuscular (IM) administration. The results are also presented in Fig. 8. As shown in Table 3C (i.v. administration), the flux induced by formulations containing compounds 66, 133-135 and 147 measured after 6 hours and the total flux was markedly higher than that induced by formulation MC3. As shown in Table 3D, the total flux induced by formulations containing compounds 96, 148 and 151, measured after 6 hours, was markedly higher than that induced by formulation MC3.

Table 3A . Expression of luciferase upon administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), regarding the administration of formulations containing MC3. Compound Multifold increase in whole body luciferase (Luc) flux compared to MC3 after 6 hours 1 0.40 2 1.31 3 2.24 4 1.31 5 0.005 6 1.15 16 0.02 18 3.22 19 0.96 20 0.80 24 2.67 25 1.89 26 4.24 27 0.31 28 2.46 29 0.78 thirty 2.49 31 1.21 32 1.39 33 2.74 34 0.34 35 0.028 36 0.004 48 10.0 49 9.81 50 6.81 51 0.025 53 2.11 54 3.80 55 1.52 56 0.733 57 0.00056 58 0.00007 59 0.00003 65 3.16 66 0.103 67 2.08 68 3.68 71 0.418 73 0.48 74 1.005 127 0.094 128 4.05 129 0.203 130 4.02 MC3 1.00

Table 3B . Expression of luciferase upon administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), regarding the administration of formulations containing MC3. Compound i/v
lipid/MC3
0.5 mg/kg, Luc, 6 hours i/m
lipid/MC3
0.01 mg/kg, Luc, 6 hours 108 0.4 14.2 109 0.3 3.6 111 2.6 4.9 168 But. 16.0 169 But. 3.3 170 But. 5.3 173 But. 0.6 174 But. 0.2 175 But. 0.1 But. = not defined

Table 3C . Expression of luciferase upon administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), regarding the administration of formulations containing MC3. Compound 6 h lipid/MC3
Avg. Luc expression AUC (h*p/s) fold increase in AUC lipid/MC3 66 6.28 6.76E+11 8.20 101 0.019 1.8E+09 0.022 103 0.250 2.4E+10 0.291 131 1.05 9.29E+10 1.13 132 0.187 1.75E+10 0.212 133 4.02 3.62E+11 4.39 134 3.99 3.43E+11 4.16 135 13.6 1.25E+12 15.2 145 0.89 8.1E+10 0.983 146 0.011 1.04E+09 0.013 147 6.68 5.63E+11 6.83 MC3 1 8.24E+10 1 Avg.=average;

Table 3D . Luciferase expression and lipid clearance during intravenous administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), regarding the introduction of formulations containing MC3. Compound AUC (p/s*h) AUC lipid/MC3 % Doses
remaining
in the liver
6 h % Doses
remaining
in the liver
6 h 148 4.965 E+011 2.6 <1 <1 149 1.057E+011 0.55 150 2.704E+011 1.4 <1 <1 96 1.209E+012 6.3 <1 <1 151 7.010E+011 3.7 <1 <1 152 2.855E+010 0.15 153 2.697E+011 1.4 <1 <1 154 5.560E+010 0.29 155 1.266E+011 0.66 156 1.170E+011 0.61 157 2.481E+011 1.3 <1 <1 158 1.211E+007 <0.01 159 1.355E+008 <0.01 MC3 1.909E+011 1 80 54

Table 3E. Luciferase expression and lipid clearance during intravenous administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), regarding the introduction of formulations containing MC3. Compound 6 h BLI
lipid/MC3 Level in mouse liver tissue (ng/g)
6 h % remaining
doses after 6 hours Level in mouse liver tissue (ng/g)
24 hours % remaining
doses after 24 hours 98 3.16 24767 26.8 13567 14.7 160 0.29 51.5 0.056 0 0 161 0.12 187 0.203 0 0 162 0.28 261 0.283 0 0 163 3.45 32133 34.8 17900 19.4 164 1.24 35967 39.0 24200 26.2 165 2.12 26900 29.1 11720 12.7 171 2.26 47033 51.0 32800 35.5 172 1.72 16033 17.4 2993 3.24 183 0.031 69.9 0.076 0 0 184 7.46 260 0.282 0 0 185 0.87 31200 33.8 27033 29.3 186 1.13 42.8 0.051 0 0 MC3 85400 >98 67433 79.7

Table 3F . Luciferase expression and lipid clearance during intravenous, intramuscular, intratumoral and subcutaneous administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId ), (IIe), (IIf), (IIg) or (III), regarding the introduction of formulations containing MC3. Comm. Meas. pKa logp Expression ratio new lipid/MC3, time point 6 h (AUC) i/v i/m Luc IM hEPO s/c Luc (mg/kg) s/c hEPO 0.5 mg/kg 0.05 0.5 7 6.74 14.5 0.88 1.10 - 2.40 2.29 18 6.56 16.3 3.23 2.01 8.6 2.63 1.88 4.26 19 6.78 16.6 0.96 3.68 - - 2.13 20 6.87 16.4 0.80 2.21 - 4.00
(AUC: 4.02) 23 6.88 17.4 0.04 0.30 - - 1.02 24 6.71 16.1 2.67 1.10 - - 5.79
(AUC: 5.21) 25 6.68 16.3 1.89 1.46 7.1 - 1.73
(AUC: 1.7) 5.43 27 6.78 15.3 0.31 3.94 - 14.45 4.87 thirty 6.75 16.3 2.49 4.69 9.2 6.53
(AUC: 6.38) 48 6.68 16.6 10.0 0.31 - - - 8.09 49 6.52 17.2 9.81 12.99 - - - 8.01 60 6.73 15.4 3.37 2.93 11.2 - 1.72 6.59 61 6.70 15.4 2.31 3.51 - - 0.70 69 6.95 16.3 0.30 0.27 - - 0.14 71 5.88 17.4 0.42 0.08 - - - 72 6.29 15.8 1.52 1.03 - - 2.18
(AUC: 2.01) 75 6.67 16.1 3.29 1.22 - - 3.08
(AUC: 3.05) 108 7.17 16.5 0.40 14.2 3.7 0.22 109 6.78 16.7 0.35 3.65 5.3 - 0.49 6.78 110 8.03 16.8 0.19 3.74 1.2 0.78
(AUC: 0.76) 111 7.13 16.3 2.59 4.88 10.6 1.16 6.40 112 7.78 16.9 0.08 2.93 1.6 1.33
(AUC: 1.19) 113 6.93 17.2 0.59 1.58 - - 4.53
(AUC: 4.30) 122 6.83 15.6 3.23 2.84 10.7 4.12
(AUC: 3.42) 128 6.56 16.0 4.05 0.99 - - 0.47 143 6.47 16.4 0.44 4.05 - - - 156 6.57 16.3 0.60 0.06 - - - 157 6.27 16.7 1.29 0.79 - - - 168 6.90 17.7 0.11 16.0 6.3 0.58 2.36 169 7.63 16.9 0.11 3.3 - 170 6.60 16.3 0.02 5.3 - 178 6.90 16.7 0.03 7.14 - 181 6.17 17.3 0.27 0.97 - 182 6.48 16.3 0.66 6.80 - 218 6.59 15.7 >0.01 1.77 - 194 But. 17.4 - - 198 7.62 16.4 0 0.52 - 200 But. 15.1 - 8.11 - 207 But. 16.0 0 233 But. 16.8 - 0.05 - 0.03 239 But. 16.5 - 0.01 -

Table 3G. Luciferase expression and lipid clearance during intravenous, intramuscular, intratumoral and subcutaneous administration of formulations containing compounds of formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), (IIe ) or (IIf) regarding the administration of formulations containing MC3. Compound Measured pKa logp New lipid/MC3 ratio, time point 6 h i/v i/m Luc IM hEPO s/c Luc 6 h AUC 20 6.87 16.4 0.80 2.21 - 4.00 4.02 24 6.71 16.1 2.67 1.10 - 5.79 5.21 25 6.68 16.3 1.89 1.46 7.1 1.73 1.70 thirty 6.75 16.3 2.49 4.69 9.2 6.53 6.38 72 6.29 15.8 1.52 1.03 - 2.18 2.01 75 6.67 16.1 3.29 1.22 - 3.08 3.05 96 6.60 16.3 6.11 - - - - 98 6.53 16.6 3.16 - - - - 110 8.03 16.8 0.19 3.74 1.2 0.78 0.76 112 7.78 16.9 0.08 2.93 1.6 1.33 1.19 113 6.93 17.2 0.59 1.58 - 4.53 4.30 122 6.83 15.6 3.23 2.84 10.7 4.12 3.42 151 6.59 16.3 3.29 - - - - 163 6.41 16.6 3.45 - - - - 164 6.39 16.6 1.24 - - - - 165 6.50 16.6 2.12 - - - -

Table 3H . Luciferase expression upon intramuscular administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf) , (IIg) or (III), regarding the introduction of formulations containing MC3. Compound AUC (p/s*h) AUC lipid/MC3 MC3 5.88E+08 1 143 2.29E+09 3.89 49 7.54E+09 12.82 113 1.01E+09 1.71 61 2.30E+09 3.91 72 6.48E+08 1.10 75 1.29E+09 2.20 71 6.61E+07 0.11 128 8.59E+08 1.46 156 3.92E+07 0.07 157 4.68E+08 0.80

Table 3I . Expression of hEPO upon intramuscular administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf) , (IIg) or (III), regarding the introduction of formulations containing MC3. Compound Lipid/MC3 time point 6 h AUC lipid/MC3 48 8.2 7.5 49 11.0 9.9 169 4.6 4.7 170 5.9 5.7 178 10.4 9.3 182 1.6 1.2 194 5.5 6.2 200 2.6 2.7 244 0.4 0.4

Example 5 Luc Expression in Various Organs Induced by Sample Formulations

[00460] The efficacy of the nanoparticle compositions shown in Table 1A was further evaluated by measuring the expression of the modified luciferase in the liver, lung, spleen, and thigh when the composition was administered. The compositions were administered intravenously to mice (n=3) at a dose of 0.5 mg/kg and bioluminescence was measured after 6 hours. Standard formulation MC3 and control PBS were also tested. As can be seen from Table 4, the flux for almost all species was higher in the liver compared to other tissues. Liver flux was highest for formulations containing 3, 28, 33, 48, 96 and 135 and comparable to that of MC3 formulations for formulations containing compounds 2, 4, 6, 7, 18, 20, 24-27, 30-32, 34, 47, 49, 50, 53-56, 60, 65, 67, 68, 74, 75, 111, 113, 122, 128, 130, 133, 134, 143, 147-151, 153 and 157. Liver flux was lowest for compositions containing compounds 58, 59, 137 and 141. Spleen flux was highest for compositions containing compounds 4, 7, 33, 34, 48, 53, 108, 129, 130 and 148, and lowest for compositions containing compounds 9, 59, 124 and 141. Similar results were observed in the lungs and thigh.

Table 4. Expression of luciferase in various organs 6 hours after administration of nanoparticle compositions containing compounds according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId ), (IIe), (IIf), (IIg) or (III). General flow Compound Liver Lungs Spleen Hip 1 4.02E+08 1.72E+06 4.27E+06 7.52E+05 2 4.87E+09 2.52E+07 5.77E+07 3.86E+06 3 1.39E+10 4.76E+07 1.47E+08 7.36E+06 4 5.26E+09 6.22E+07 4.09E+08 But. 5 5.84E+07 1.89E+06 1.55E+08 1.22E+06 6 1.09E+09 4.30E+06 3.03E+07 2.15E+06 7 2.49E+09 3.95E+07 4.83E+08 But. 8 7.87E+08 4.06E+06 1.51E+08 But. 9 4.30E+05 2.56E+04 5.51E+04 2.57E+04 10 3.22E+08 8.85E+05 8.17E+06 5.09E+05 eleven 8.03E+08 1.35E+07 1.04E+08 But. 12 6.84E+08 7.45E+06 6.82E+07 But. 13 2.25E+07 2.21E+05 7.09E+05 1.35E+05 14 1.91E+08 4.74E+06 1.92E+08 4.91E+06 15 6.23E+06 6.41E+04 9.01E+05 5.93E+04 16 3.17E+07 4.18E+05 5.43E+06 2.55E+05 17 5.52E+05 9.95E+04 5.58E+06 9.55E+04 18 2.76E+09 1.25E+07 5.15E+07 4.68E+06 19 6.33E+08 5.99E+06 1.77E+07 1.68E+06 20 1.84E+09 2.66E+07 1.43E+08 1.31E+07 22 4.00E+07 4.73E+05 1.57E+06 1.16E+05 23 2.92E+08 1.82E+06 3.08E+07 1.19E+06 24 4.19E+09 1.71E+07 8.78E+07 4.54E+06 25 2.41E+09 1.51E+07 3.11E+07 4.40E+06 26 2.90E+09 1.18E+07 1.56E+07 4.67E+06 27 2.16E+09 6.35E+06 3.78E+06 2.00E+06 28 1.22E+10 2.17E+08 1.80E+08 But. 29 5.20E+08 9.83E+05 5.99E+06 9.56E+05 thirty 2.68E+09 1.02E+07 3.55E+07 6.38E+06 31 5.17E+09 7.55E+06 9.42E+07 But. 32 8.52E+09 1.16E+07 1.70E+08 But. 33 1.78E+10 2.92E+07 3.77E+08 But. 34 2.08E+09 9.49E+06 2.40E+08 But. 35 1.63E+08 2.06E+06 1.23E+08 But. 36 2.65E+07 5.82E+05 6.14E+07 But. 47 4.86E+09 8.71E+06 8.33E+07 But. 48 1.08E+10 3.31E+07 3.49E+08 But. 49 5.68E+09 2.52E+07 1.87E+08 But. 50 6.30E+09 2.81E+07 1.14E+08 But. 51 2.49E+07 3.67E+05 2.80E+07 But. 52 5.86E+08 2.80E+06 8.30E+07 But. 53 2.02E+09 2.47E+07 8.54E+08 But. 54 5.57E+09 1.12E+07 1.64E+08 But. 55 1.92E+09 7.02E+06 2.63E+07 But. 56 1.04E+09 4.62E+06 1.98E+08 But. 57 9.36E+05 3.18E+04 2.47E+06 But. 58 8.71E+04 1.21E+04 2.38E+05 But. 59 2.87E+05 4.41E+04 9.68E+04 But. 60 1.54E+09 6.25E+06 7.12E+06 But. 61 6.37E+08 3.56E+06 1.61E+07 But. 65 9.56E+09 3.79E+07 6.57E+07 But. 66 5.01E+09 4.20E+06 2.00E+07 But. 67 3.60E+09 1.68E+07 2.55E+07 But. 68 8.42E+09 3.98E+07 6.69E+07 But. 69 2.24E+08 7.34E+05 2.54E+06 But. 70 8.55E+08 6.32E+06 2.06E+06 But. 71 7.93E+08 4.86E+06 8.04E+06 But. 72 7.97E+08 1.05E+07 6.40E+06 But. 73 7.93E+08 6.17E+06 9.45E+06 But. 74 1.99E+09 6.93E+06 2.26E+07 But. 75 1.45E+09 3.92E+06 5.66E+06 But. 79 3.15E+06 6.13E+04 6.45E+05 But. 80 1.09E+07 8.97E+04 4.71E+06 But. 81 2.74E+08 6.23E+06 4.49E+07 But. 96 1.56E+10 3.43E+07 3.39E+08 But. 101 1.27E+07 1.77E+05 5.60E+06 But. 103 8.48E+07 2.06E+05 2.65E+06 But. 108 4.63E+08 9.81E+06 7.82E+08 But. 109 8.17E+08 6.03E+06 4.81E+07 But. 110 2.30E+08 5.76E+06 1.41E+08 But. 111 4.83E+09 2.57E+07 2.44E+08 But. 112 1.48E+08 1.83E+06 2.75E+07 But. 113 1.11E+09 5.55E+06 5.22E+07 But. 118 1.72E+08 1.98E+06 2.49E+07 But. 122 2.63E+09 2.77E+07 1.56E+07 But. 123 2.50E+08 1.78E+06 4.04E+06 But. 124 8.46E+06 5.67E+04 8.06E+04 But. 126 7.41E+08 2.68E+06 1.87E+07 But. 127 1.94E+08 5.26E+06 3.21E+08 But. 128 5.98E+09 2.16E+07 7.09E+07 But. 129 6.65E+08 9.89E+06 5.09E+08 But. 130 8.17E+09 5.88E+07 1.35E+09 But. 131 3.52E+08 1.45E+07 8.32E+08 But. 132 1.49E+08 1.39E+07 3.37E+08 But. 133 2.94E+09 3.18E+06 1.77E+07 But. 134 1.73E+09 2.82E+06 1.85E+07 But. 135 1.65E+10 2.71E+07 1.39E+08 But. 136 1.34E+08 8.91E+05 2.77E+07 6.60E+05 137 6.48E+04 1.66E+04 1.32E+05 2.02E+04 138 3.66E+06 9.47E+04 4.04E+06 1.58E+05 139 8.27E+05 5.26E+04 2.10E+06 5.12E+04 140 4.21E+05 2.14E+04 2.22E+05 3.26E+04 141 1.59E+05 3.85E+04 6.29E+04 2.86E+04 143 1.76E+09 3.60E+07 1.42E+08 But. 144 3.75E+08 4.81E+06 5.11E+07 2.44E+06 145 5.01E+08 1.36E+07 4.25E+08 But. 146 7.24E+06 3.88E+06 5.11E+07 But. 147 5.24E+09 6.73E+06 8.57E+07 But. 148 4.39E+09 3.27E+07 2.71E+09 But. 149 1.11E+09 2.69E+06 2.71E+07 But. 150 1.54E+09 2.20E+06 3.43E+07 But. 151 4.72E+09 9.20E+06 9.27E+07 But. 152 1.43E+08 3.16E+05 6.63E+06 But. 153 1.18E+09 6.42E+06 1.42E+08 But. 154 3.62E+08 2.89E+06 1.30E+07 But. 155 8.58E+08 1.00E+07 2.77E+08 But. 156 6.51E+08 1.92E+06 1.82E+07 But. 157 2.27E+09 6.70E+06 5.15E+07 But. 158 1.99E+05 1.71E+04 1.17E+05 But. 159 1.13E+06 2.17E+05 7.24E+05 But. MC3 2.57E+09 1.27E+07 2.85E+07 2.56E+06 But. = not defined

Example 6A: Expression induced by sample formulations when administered intramuscularly

[00461] Sample formulations containing both modified luciferase (Luc) mRNA and H10 mRNA were prepared and administered intramuscularly, and the resulting expression and immunogenicity were evaluated simultaneously. Compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) were prepared and administered at doses of 0.001 and 0.01 mg/kg (e.g. doses of 0.0005 mg/kg of a formulation containing Luc mRNA and a formulation containing H10 mRNA, or doses of 0.005 mg/kg of a formulation containing mRNA Luc, and a formulation containing H10 mRNA). As shown in Table 5A, Compound 20 showed the highest expression at both dose levels. The low dose of Compound 20 showed equivalent expression to the high dose of MC3. Formulations containing other compounds also showed a multiple increase in expression relative to MC3.

Table 5A . Total flux (p/c) measured 6 hours after intramuscular administration of nanoparticle compositions containing compounds according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc ), (IId), (IIe), (IIf), (IIg) or (III). Compound dose 0.001 mg/kg dose 0.01 mg/kg 2 3.55E+06 6.16E+07 3 3.58E+06 4.95E+07 5 9.84E+05 3.55E+06 7 3.65E+06 7.48E+07 8 7.81E+05 3.32E+06 12 8.02E+04 8.90E+05 18 But. 8.84E+07 19 3.28E+06 2.96E+07 20 2.59E+07 9.72E+07 23 8.27E+06 2.20E+06 24 3.78E+06 3.97E+07 25 3.53E+06 9.96E+07 26 3.90E+06 6.13E+07 27 2.55E+06 3.17E+07 28 6.73E+05 5.56E+06 29 7.64E+05 1.12E+07 thirty 2.47E+06 3.77E+07 32 7.37E+05 1.03E+07 35 2.45E+06 8.12E+06 48 4.69E+05 8.78E+06 50 6.56E+05 1.13E+07 57 1.16E+05 2.23E+05 137 7.57E+04 8.09E+04 138 2.72E+05 1.19E+06 140 2.03E+05 6.09E+05 144 2.72E+06 2.18E+07 MC3 2.76E+06 3.68E+07 But. = not defined

Example 6B: Expression induced by sample formulations when administered intramuscularly

[00462] Sample formulations containing modified luciferase mRNA (Luc) were prepared and administered intramuscularly, and the resulting expression and immunogenicity were evaluated simultaneously. Compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) were prepared and administered at a dose of 0.01 mg/kg. As shown in Table 5B, compound 108 showed the highest expression. Formulations containing other compounds also showed a multiple increase in expression relative to MC3.

Table 5B. Total flux (p/c) measured 6 hours after intramuscular administration of nanoparticle compositions containing compounds according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc ), (IId), (IIe), (IIf), (IIg) or (III). Compound dose 0.01 mg/kg 60 9.48E+07 69 8.83E+06 108 4.60E+08 109 1.18E+08 110 1.21E+08 111 1.58E+08 112 9.47E+07 114 3.31E+06 121 1.06E+06 122 9.19E+07 123 1.08E+07 MC3 3.23E+07

[00463] Fluxes measured intravenously and intramuscularly are compared in Table 6. Fluxes are presented as a fold increase over that measured for the MC3 formulations. Formulations containing Compound 20 showed the highest fold increase in Luc expression when administered intramuscularly, while formulations containing Compounds 18 and 26 showed the highest fold increase when administered intravenously. Notably, the intravenous data included in Table 6 were measured at higher doses than the intramuscular data.

Table 6. Relative flux measured after intravenous or intramuscular administration of nanoparticle compositions containing compounds according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), ( IId), (IIe), (IIf), (IIg) or (III). A fold increase in Luc expression relative to MC3 Compound pKa intravenous
(dose 0.5 mg/kg) Intramuscular
(dose 0.01 mg/kg) Intramuscular
(dose 0.001 mg/kg) 3 6.72 2.24 1.13 0.51 18 6.56 3.23 2.01 But. 20 6.87 0.80 2.21 3.70 26 6.64 4.24 1.39 0.56 29 6.00 1.03 0.25 0.11 But. = not defined

Example 7 Cytokine Production Induced by Sample Formulations

[00464] The introduction of foreign material into the body of a mammal causes an innate immune response that promotes the production of cytokines. Such immune responses to, for example, nanoparticle compositions, including therapeutic and/or prophylactic, are undesirable. Thus, the induction of certain cytokines is measured to evaluate the effectiveness of nanoparticle compositions. The concentrations of various cytokines in mice when administered intravenously with the nanoparticle compositions shown in Table 1A at a dose of 0.5 mg/kg were measured after 6 hours. Standard formulation MC3 and control PBS were also tested. As can be seen from Table 7, IL-6 induction was highest for compositions containing compounds 1, 3, 9, 19 and 26, while IP-10 induction was highest for compositions containing compounds 3, 4, 7, 20 and 26. IL-6 induction was lowest for compositions containing compounds 4, 11, 12 and 28. IP-10 induction was lowest for compositions containing compounds 10, 11, 12, 13, 15, 17 and 18.

Table 7 Cytokine induction 6 hours after administration of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), ( IIe), (IIf), (IIg) or (III). Compound IL-6 IP-10 1 267.24 687.14 2 70.95 468.86 3 282.88 2052.87 4 13.1375 2253.09 5 94.07 487.16 6 136.18 316.01 7 116.35 4959.16 9 317.45 366.53 10 88.81 138.16 eleven 0.14 44.84 12 3.88 32.03 13 29.07 126.29 14 75.29 621.49 15 64.65 184.30 16 32.01 206.75 17 138.43 156.41 18 78.76 139.92 19 285.56 1468.94 20 126.83 2468.24 22 90.54 976.50 23 94.00 1015.95 24 163.53 1172.93 25 233.45 1194.13 26 273.56 2330.01 27 161.07 345.56 28 17.47 283.13 29 69.54 1362.81 thirty 152.51 1638.77 136 28.69 887.91 137 130.82 234.35 138 23.38 172.56 139 23.57 153.36 140 282.82 187.83 141 327.15 1072.04 143 6.245 209.63 144 319.46 4220.55 MC3 124.42 504.90

Example 8 Complement Activation Induced by Sample Formulations

[00465] Complement activation promotes the elimination of pathogens from the body. Since it is undesirable for the subject's body to recognize the nanoparticle composition as a foreign object, activation of the low complement system upon administration of such a composition is preferred. The sC5b-9 complex is a marker for the activation of the complement system. Thus, human cells were contacted in vitro with the nanoparticle compositions according to Table 1A and sC5b-9 levels were assessed. Table 8 shows the fold increase in sC5b-9 levels compared to saline for nanoparticle formulations containing compounds 1, 6, 9, 18, 24, 25, 29, and 30. Compositions containing compounds 6 and 18 slightly increase sC5b- 9 compared to saline, while compositions containing compounds 1, 9, 24, 29 and 30 slightly reduced sC5b-9 levels compared to saline.

Table 8. Fold increase in sC5b-9 levels after administration of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId) , (IIe), (IIf), (IIg) or (III). Compound fold increase compared to normal saline 1 0.82 6 1.39 9 0.92 18 1.28 24 0.81 25 1.02 29 0.93 thirty 0.94 136 0.69 139 0.73 140 0.75 141 1.81 MC3 0.73

Example 9 Clinical Chemistry and Hematology

[00466] Sample formulations of nanoparticle compositions containing various lipids were administered intravenously to rats at a dose of 2 mg/kg. Expression of various clinical markers was assessed 48 hours post-dose and compared to that induced by administration of MC3 formulations or sodium phosphate buffer (PBS).

Table 9 Levels of clinical markers induced by administration of nanoparticle compositions containing a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe ), (IIf), (IIg) or (III). Concentration Compound Alanine aminotransferase Aspartate aminotransferase Neutrophils Lymphocytes Monocytes 3 53.5 87.5 3388.5 12051 2103 24 51.5 90 1790.5 14100 1834 25 52 124.5 1998 15924 2122 thirty 56 95 3195 10408.5 877 MC3 339 325 4962.5 19976 1429 PBS 55.5 108 920 8004 276

Example 10 Expression of hEPO Induced by Sample Formulations

[00467] Sample formulations of nanoparticle compositions containing various lipids are typically first evaluated according to in vivo Luc expression. The activity of several of these compositions was further evaluated using mRNA encoding hEPO. Nanoparticle compositions containing compounds 6, 18, 25, 30, 108-112, 60 and 122 or MC3 were prepared according to Example 2. As shown in tables 10 and 1B above, each composition had the same particle size and encapsulation efficiency.

Table 10 . Characteristics of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). Compound Compound Size (nm) PDI EE (%) 6 Compound 6:DSPC:Chol:PEG-DMG (50:10:38.5:1.5) 70.5 0.082 97.84 18 Compound 18:DSPC:Chol:PEG-DMG (50:10:38.5:1.5) 78.6 0.095 97.34 MC3 MC3:DSPC:Chol:PEG-DMG (50:10:38.5:1.5) 73.7 0.114 97.22

[00468] hEPO expression and cytokine induction in mice intravenously injected with the nanoparticle composition at a dose of 0.5 mg/kg were measured after 3, 6 and 24 hours. The resulting levels of hEPO and cytokines are shown in table 11A. Compositions containing compounds 6 and 18 provided higher concentrations of hEPO than MC3 compositions at each time point. The expression of hEPO in mice injected intramuscularly with the nanoparticle composition of Table 1B at a dose of 0.01 mg/kg was measured after 3, 6 and 24 hours. The resulting hEPO levels are shown in Table 11B. Compositions containing compounds 18, 25, 30, 108-112, 60 and 122 provided higher hEPO concentrations than MC3 formulations after 6 hours (see also Fig. 9).

Table 11A . Evaluation of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). hEPO expression (pg/ml) Cytokine expression (pg/ml) Compound 3 h 6 h 24 hours IP-10 (6 h) IL-6 (6 hours) 6 2.31E+06 3.17E+06 1.11E+06 116.66 10.15 18 3.00E+06 3.38E+06 1.80E+06 299.93 10.16 MC3 1.57E+06 1.83E+06 0.81E+06 117.94 19.85

Table 11B . Evaluation of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). Compound Multiple increase in hEPO concentration relative to MC3 18 8.6 25 7.1 thirty 9.2 108 3.7 109 5.3 110 1.2 111 10.6 112 1.6 60 11.2 122 10.7 MC3 1

[00469] Table 12 compares the composition of nanoparticles containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe) , (IIf), (IIg) or (III) with compositions containing MC3 based on expression levels and flux. As can be seen from Table 12, Compounds 6 and 18 both outperform MC3 in both hEPO expression and mean total flux. Thus, these lipids may be useful in nanoparticle composition therapy.

Table 12 . Comparison of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). Compound 6 Compound 18 MC3 Mean hEPO concentration (pg/ml, 6 h) 3.17×10 ⁶ 3.38×10 ⁶ 1.83×10 ⁶ Multiple increase in hEPO concentration relative to MC3 1.73 1.85 1 Average total flow (6 h, ffluc) 7.60×10 ⁹ 2.13×10 ¹⁰ 6.59×10 ⁹ Multiple increase in average total flow relative to MC3 1.15 3.23 1

Example 11: hEPO Expression Induced by Sample Formulations in Rat and Residual Hepatic Lipid Levels

[00470] hEPO expression and cytokine induction in rats intravenously injected with the nanoparticle composition at a dose of 2.0 mg/kg was measured after 6 hours.

[00471] After 48 hours, liver tissue was collected for lipid quantification. Milli-Q water (900 µl of water per 100 mg of tissue) was added to pre-weighed tissues. The tissues were homogenized using an Omni homogenizer until homogeneous. 50 µl of samples and matrix calibration standards were aliquoted into a 96-well plate. 50 µl of blank matrix for matrix controls and negative controls were aliquoted. 400 µl of IS mobilization solution was added manually to all samples except matrix controls. 400 µl 50:50 ACN:IPA were manually added to the matrix controls. The plate was covered and the samples were shaken and centrifuged for 5 minutes at >3000 rpm. 200 µl of samples were transferred to a clean 96-well assay plate. Samples were analyzed on UPLC Waters Acquity using a Higgins Analytical Clipeus C8 column (5 μM, 30 x 2.1 mm) and either 70-95% or 60-95% gradient (mobile phase A: 5 mM ammonium formate in 50: 50:1 H ₂ O:MeOH:formic acid, mobile phase B: 5 mM ammonium formate in 100:1 MeOH:formic acid) for 1.3 min at 1.2 ml/min (column temperature 55°C). Detection was based on electrospray ionization (ESI) in positive mode using a Sciex API5500 mass spectrometer.

Table 13 . Expression of hEPO induced by administration of nanoparticle compositions containing compounds according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIc), (IId), (IIe), ( IIf), (IIg) or (III), 6 h, 2 mg/kg. Compound hEPO expression (pg/ml) 3 1.74E+07 18 9.96E+06 24 1.44E+07 25 3.05E+07 thirty 1.63E+07 MC3 1.33E+07

Table 14 . Cytokine induction 6 hours after administration of hEPO nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe) , (IIf), (IIg) or (III). Compound IP-10 (pg/ml) 3 542 18 517.3 24 323.5 25 533.5 thirty 214.5 MC3 688.3

Table 15 . Liver levels in rats administered compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) after 48 hours. Compound % remaining dose in liver, 48 hours 3 14.2 18 <1 24 <1 25 1.3 thirty <1 MC3 74

[00472] Expression of hEPO in rats intravenously injected with the composition of nanoparticles at a dose of 0.2 mg/kg or 2.0 mg/kg was measured after 6 hours. Table 16 shows the ratio of hEPO expression levels using different nanoparticle formulations compared to hEPO expression level using MC3 formulation, and liver lipid levels measured 48 hours after administration as described above. Tables 17 and 18 show liver and spleen lipid levels measured 48 hours after administration of compounds 28, 33, 53 and 54. Liver and spleen levels are mean values calculated for 3 rats in each group. As shown in tables 17 and 18, less than 10% of compounds 28, 33, 53 and 54 remained in the liver after 48 hours, while more than 60% of MC3 remained.

Table 16 . Ratio of expression levels of hEPO and lipids remaining in the liver after 48 hours. Compound the ratio of conc. hEPO lipid/MC3 % lipid remaining
in the liver, 48 h* 0.2 mg/kg 2 mg/kg 2 mg/kg MC3 1 1 87 18 But. 0.81 0.018 25 2.41 2.13 1.32 24 1.75 1.01 0.016 thirty 1.87 1.14 <0.01 3 2.41 1.21 14 26 But. 4.95 20 48 5.39 3.84 7.22 49 4.13 3.28 12.6 50 3.41 3.03 15.9 *Assuming 300 g rat and 15 g liver

Table 17 . Liver levels in rats administered a 0.2 mg/kg dose of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc ), (IId), (IIe), (IIf), (IIg) or (III) after 48 hours. Compound Liver level (ng/g) Spleen level (ng/g) 28 49.6 268 33 But. 115 53 4810 1181 54 6067 6357 MC3 25033 9440

Table 18 . Liver levels in rats administered a 2 mg/kg dose of compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) after 48 hours. Compound Liver level (ng/g) Spleen level (ng/g) 28 665 551 33 103 287 53 47033 201333 54 56100 49367 MC3 285333 129000

Table 19A shows hEPO expression, IP-10 induction, liver and spleen levels, and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) measured by intravenous administration of formulations containing compounds 48, 49 and 50 to rats at 0.2 and 2 mg/kg and hEPO mRNA. hEPO concentrations were measured 6 hours after administration, while cytokine induction and liver and spleen levels were measured 48 hours after administration. hEPO and IP-10 concentrations are presented in pg/mL and liver levels are presented in ng/g. ALT and AST levels are presented in international units.

Table 19A hEPO expression, IP-10 induction and liver levels measured after administration of compositions containing compounds of one of formulas (I), (IA), (IB), (II), (IIa), (IIb), ( IIc), (IId), (IIe), (IIf), (IIg) or (III). Compound 48 Compound 49 Compound 50 MC3 0.2 mg/kg 2 mg/kg 0.2 mg/kg 2 mg/kg 0.2 mg/kg 2 mg/kg 0.2 mg/kg 2 mg/kg hEPO expression (pg/
ml) 4.06E+06 3.57E+07 3.17E+06 3.04E+07 2.62E+06 2.81E+07 7.68E+06 9.29E+06 Induction IP-10 (pg/
ml) 134 970 66 932 20 1065 2 596 Liver level (ng/g) 5448 34520 6490 61400 5822 79200 11300 140520 Spleen level (ng/g) 0.31 0.21 0.36 0.37 0.22 0.17 0.74 0.65 ALT 59.6 66.0 54.0 77.8 59.2 78.8 63.6 79.6 AST 140.8 131.2 99.4 132.4 143.2 158.4 134.8 139.0

Table 19B. hEPO expression and liver levels measured after administration of compositions containing compounds according to one of the formulas (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III). Lipid [hEPO] (pg/ml) lipid/MC3 AUC
(pg/ml*h) AUC lipid/MC3 % of dose remaining in the liver, 24 hours 147 5.45E+06 3.69 7.28E+07 3.94 0.00 184 1.05E+07 7.13 1.41E+08 7.64 0.04 189 3.01E+06 3.01E+06 4.35E+07 2.35 0.00 200 1.72E+06 1.72E+06 2.40E+07 1.30 0.36 232 7024.114 0.83 7.38E+04 <0.01 0.00 233 9.80E+03 0.00664 1.29E+05 0.01 0.07 234 3.56E+06 2.41211 5.17E+07 2.79 0.03 235 1.27E+06 0.86015 1.71E+07 0.93 0.06 237 3.47E+06 2.35174 4.09E+07 2.21 0.14 243 4.06E+04 0.02755 4.45E+05 0.02 0.05 MC3 1.48E+04 3.46E+07 44

Example 12 Dose Dependence of Sample Formulations in Rats

[00473] hEPO expression induced by intravenous administration of nanoparticle compositions to rats at various doses was measured at time points of 2, 4, 6, 8, 24, and 48 hours. On FIG. 3-6 show, respectively, the results of hEPO expression measured by intravenous administration of nanoparticle formulations containing compounds 26, 18, 25 and MC3 to rats. Compound 26 lipid levels in the liver after 48 hours were about 19%.

[00474] In Fig. 7 shows the area under the curve for compositions containing compounds 18, 25 and 26 and MC3 at various dosages: 0.005 mg/kg, 0.01 mg/kg, 0.025 mg/kg, 0.05 mg/kg, 0.1 mg /kg, 0.25 mg/kg, 0.5 mg/kg, 1 mg/kg or 2 mg/kg.

Example 13 Pharmacokinetics of formulation samples in rats

[00475] hEPO expression and lipid levels in the liver and spleen of rats intravenously injected with the nanoparticle composition at a dose of 0.2 mg/kg were measured at various time points. Compounds 18 and 25 were selected for comparison with MC3. Lipids were prepared according to the standard MC3 formulation described above. Rats were injected intravenously with a single dose of 0.2 mg/kg, and expression was monitored at 0.25, 0.5, 1, 2, 4, 8, 24 and 48 hours after administration.

Table 20 . hEPO expression induced by administration of nanoparticle compositions to rat, 6 h, 0.2 mg/kg. hEPO expression (pg/ml) Compound 18 Compound 25 MC3 0.25 h 20227 0 0 0.5 h 20743 19553 42457 1 hour 194353 434299 93720 2 h 238107 2042807 524093 4 h 514807 3176560 601307 8 h 915320 2631633 1536833 24 hours 412051 869374 703619 48 h 52361 103089 64687

Table 21 . Lipid levels in the liver induced by administration of nanoparticle compositions to rat, 6 h, 0.2 mg/kg. Lipid level (ng/g) Compound 18 Compound 25 MC3 0.25 h 5374 12037 13180 0.5 h 6023 16447 20500 1 hour 6053 17900 16777 2 h 2037 11733 25967 4 h 839 6687 24730 8 h 296 2357 32633 24 hours 5 199 33000 48 h 5374 12037 13180

[00476]

Table 22 . Lipid levels in the spleen induced by the administration of nanoparticle compositions to the rat, 6 h, 0.2 mg/kg. Lipid level (ng/g) Compound 18 Compound 25 MC3 0.25 h 1230 4037 4100 0.5 h 2017 6880 6237 1 hour 3213 8590 4197 2 h 3070 13733 8613 4 h 3770 20400 11920 8 h 1345 10787 21200 24 hours 271 2023 19067 48 h 92 1547 11563

Example 14 Optimization of lipid:therapeutic agent ratio

[00477] The relative amounts of the lipid component and the therapeutic and/or prophylactic agent in the nanoparticle composition can be optimized according to efficacy and tolerability considerations. For compositions containing RNA as a therapeutic and/or prophylactic agent, the N:P ratio may be a suitable indicator.

[00478] Because the N:P ratio of the nanoparticle composition controls both expression and tolerance, nanoparticle compositions with a low N:P ratio and strong expression are desirable. The N:P ratios vary depending on the ratio of lipids to RNA in the nanoparticles. Thus, the ratio wt./wt. total lipid to RNA varies between 10:1, 15:1, 20:1, 32:1, 40:1, 50:1 and 60:1 for a lipid composition containing about 50 mole % of a compound of formula (I), ( IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) about 10% moles of phospholipids (e.g. DOPE or DSPC), about 38.5 mole % structural lipids (eg cholesterol) and about 1.5 mole % PEG lipids (eg PEG-DMG). The N:P ratios are calculated for each nanoparticle preparation, taking into account one protonated nitrogen atom. The encapsulation efficiency (EE), size and polydispersity ratio of each formulation are also measured.

[00479] Generally, compositions with a higher overall lipid:RNA ratio produce smaller particles with higher encapsulation efficiency, both of which are desirable. However, the N:P ratio for such preparations is typically greater than 4. Current standards in the art, such as the MC3 preparation described above, have N:P ratios of 5.67. Thus, a balance must be struck between N:P ratio, size and encapsulation efficiency.

[00480] To investigate the efficacy of nanoparticle formulations with various N:P ratios, the expression of luciferase (Luc) or human erythropoietin (hEPO) in mice was examined after a low (0.05 mg/kg) or high (0.5 mg/kg) dose intravenously administered compositions of nanoparticles. The concentration of expressed Luc or hEPO is measured 3, 6 and/or 24 hours after administration.

Example 15: Optimization of the content of the compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III)

[00481] Since smaller particles with higher encapsulation efficiency are generally desirable, the relative amounts of different elements in the lipid components of nanoparticle compositions are optimized according to these parameters.

[00482] A compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or ( III) choose for optimization. The relative amount of a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III ) ranges from 30 to 60 mole % in compositions containing DOPE or DSPC as phospholipids to determine the optimal amount of a compound of formula (I), (IA), (IB), (II), (IIa), (IIb), ( IIc), (IId), (IIe), (IIf), (IIg) or (III) in these preparations. Preparations were prepared using a standardized method with a 3:1 ratio of water to ethanol in a lipid-mRNA solution and a lipid solution infusion rate of 12 ml/min into the mRNA solution in a NanoAssemblr-based microfluidic system. This method causes nano-precipitation and particle formation. Alternative processes, including but not limited to T-junction or direct injection, can also be used to achieve the same nanodeposition.

[00483] Formulations for producing the finest particles with the highest encapsulation efficiency are generally preferred, however, larger or smaller particle sizes may be desirable based on the particular application (eg, based on the fenestration size of the target organ). Compositions are also evaluated for their Luc or hEPO expression levels and cytokine profiles.

Example 16 Phospholipid Optimization

[00484] The relative amount of phospholipid in the lipid component of the nanoparticle composition was equally varied to further optimize the composition. A compound of Formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) were chosen for use in the composition of nanoparticles, and DOPE and DSPC were chosen as phospholipids. Additional phospholipids may also be evaluated. Compositions of nanoparticles were prepared with a relative content of phospholipids in the range from 0 to 30 mol. %. The compositions are evaluated for size, encapsulation efficiency, Luc or hEPO expression levels, and cytokine profiles.

Example 17 Structural Lipid Optimization

[00485] The relative amount of structural lipid in the lipid component of the nanoparticle composition was equally varied to further optimize the composition. A compound of Formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) was chosen for use in the composition of nanoparticles, and cholesterol was chosen as a structural lipid. Additional structural lipids may also be evaluated. Compositions of nanoparticles were prepared with a relative content of structural lipids in the range from 18.5 to 48.5 mol. %. The compositions were evaluated for size, encapsulation efficiency, Luc or hEPO expression levels, and cytokine profiles.

Example 18 PEG Lipid Optimization

[00486] The relative amount of PEG lipid in the lipid component of the nanoparticle composition was equally varied to further optimize the composition. A compound of Formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) was chosen for use in the composition of nanoparticles, and PEG-DMG was chosen as the PEG lipid. Additional PEG lipids may also be evaluated. Compositions of nanoparticles were prepared with a relative lipid content of PEG in the range from 0 to 10 mol. %. The compositions were evaluated for size, encapsulation efficiency, Luc or hEPO expression levels, and cytokine profiles.

[00487] Exemplary formulations useful for optimizing nanoparticle formulations are shown in Table 23.

Table 23 Exemplary formulations containing compounds according to Formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf ), (IIg) or (III). Composition (% mol) Components 40:20:38.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 45:15:38.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 50:10:38.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 55:5:38.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 60:5:33.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 45:20:33.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 50:20:28.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 55:20:23.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 60:20:18.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 40:15:43.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 50:15:33.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 55:15:28.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 60:15:23.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 40:10:48.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 45:10:43.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 55:10:33.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 60:10:28.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 40:5:53.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 45:5:48.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 50:5:43.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 40:20:40:0 Compound : Phospholipid : Cholesterol : PEG-DMG 45:20:35:0 Compound : Phospholipid : Cholesterol : PEG-DMG 50:20:30:0 Compound : Phospholipid : Cholesterol : PEG-DMG 55:20:25:0 Compound : Phospholipid : Cholesterol : PEG-DMG 60:20:20:0 Compound : Phospholipid : Cholesterol : PEG-DMG 40:15:45:0 Compound : Phospholipid : Cholesterol : PEG-DMG 45:15:40:0 Compound : Phospholipid : Cholesterol : PEG-DMG 50:15:35:0 Compound : Phospholipid : Cholesterol : PEG-DMG 55:15:30:0 Compound : Phospholipid : Cholesterol : PEG-DMG 60:15:25:0 Compound : Phospholipid : Cholesterol : PEG-DMG 40:10:50:0 Compound : Phospholipid : Cholesterol : PEG-DMG 45:10:45:0 Compound : Phospholipid : Cholesterol : PEG-DMG 50:0:48.5:1.5 Compound : Phospholipid : Cholesterol : PEG-DMG 50:10:40:0 Compound : Phospholipid : Cholesterol : PEG-DMG 55:10:35:0 Compound : Phospholipid : Cholesterol : PEG-DMG 60:10:30:0 Compound : Phospholipid : Cholesterol : PEG-DMG

Example 19 Particle Size Optimization

[00488] Fenestration sizes for various body organs often vary; for example, the kidneys are known to have a smaller fenestration than the liver. Thus, targeted delivery of a therapeutic and/or prophylactic agent (eg, specific delivery) to a particular organ or group of organs may require the administration of nanoparticle compositions with different particle sizes. To investigate this effect, compositions of nanoparticles with formulations such as those included in Table 23 are prepared with various particle sizes using the Nanoassemblr tool. The nanoparticle compositions contained RNA encoding Luc. Each composition of nanoparticles of various sizes was equally administered to mice to evaluate the effect of particle size on delivery selectivity. The expression of Luc in two or more organs or groups of organs can be measured using bioluminescence to assess the relative expression in each organ.

Example 20 Administration after pre-administration

[00489] Administration of nanoparticle compositions to subjects may result in inflammation, infusion-related reactions, and other undesirable effects indicative of poor tolerability. These effects can be attributed to undesirable immunoactivity.

[00490] To combat adverse effects, nanoparticle compositions are administered to subjects in association with one or more agents (eg, co-drugs or additional therapeutic and/or prophylactic agents). Potentially useful additional therapeutic and/or prophylactic agents include steroids (eg, corticosteroids), antihistamines, H1 receptor blockers, H2 receptor blockers, anti-inflammatory compounds, statins, BTK (Bruton's tyrosine kinase) inhibitors, S1P1 agonists, glucocorticoid receptor modulators (GRM), and estradiols. . The non-human primate is pre-administered with one or more additional therapeutic agents selected from dexamethasone and acetaminophen. The additional therapeutic agent is administered either 24 hours, 1 hour, or both 24 hours and 1 hour prior to administration of the nanoparticle composition. Sample protocols are shown in Table 24. Cytokine profiles, inflammation, and other parameters were measured and compared to evaluate pretreatment efficacy.

Table 24 . Sample protocols for pre-treatment study. Group Pretreatment time Additional therapeutic agent(s) administered 1 Absent Absent 2 24 hours Dexamethasone 3 24 hours Acetaminophen 4 24 hours Dexamethasone and Acetaminophen 5 1 hour Dexamethasone 6 1 hour Acetaminophen 7 1 hour Dexamethasone and Acetaminophen 8 24h and 1h Dexamethasone 9 24h and 1h Acetaminophen 10 24h and 1h Dexamethasone and Acetaminophen

[00491] For example, a suitable course of therapeutic treatment may include the administration of an additional therapeutic and/or prophylactic agent both the day before and on the day (one hour before) administration of the nanoparticle composition at a dose level of 1.3 mg/kg. Additional therapeutic and/or prophylactic agents may be formulated to be delivered in a variety of ways. For example, dexamethasone can be delivered orally. Typically, additional therapeutic and/or prophylactic agents are administered at clinically approved or typical dosage levels.

Example 21: Administration to non-human primates

[00492] The tolerability and efficacy of the nanoparticle compositions in non-human primates was evaluated in cynomolgus monkeys. Monkeys were injected with an optimized nanoparticle composition containing mRNA encoding hEPO once a week for four weeks. hEPO protein levels, mRNA and cytokine profiles were measured using ELISA-based methods before and 2, 6, 12, 24, 48, 72 and 120 hours after each administration.

[00493] Pre-treatment effects in non-human primates were evaluated using a standard MC3 composition containing mRNA encoding hEPO. The study design is shown in Table 25. Male monkeys were administered the nanoparticle composition once a week for four weeks at a rate of 5 ml/kg/h and were pretreated with either methotrexate or dexamethasone.

Table 25 . Pre-treatment protocol for cynomolgus monkeys. Group test material Dose level (mg/kg) Administered Additional Therapeutic Agent Dose concentration (mg/ml) Number of monkeys 1 MC3 0 Absent 0 3 2 hEPO mRNA in MC3 0.3 Absent 0.06 3 3 hEPO mRNA in MC3 0.3 Methotrexate 0.06 3 4 hEPO mRNA in MC3 0.3 Dexamethasone 0.06 3

[00494] The results of the pre-treatment study are shown in FIG. 1. As shown, in the absence of any prior treatment, peak expression levels decreased by almost 70% over the course of the study. Methotrexate did not have any particular positive effect. However, dexamethasone pretreatment resulted in increased protein expression compared to non-pretreatment treatments. Notably, a minimal decrease in plasma/serum protein expression was observed over time in animals pretreated with dexamethasone. These results suggest that pre-administration of corticosteroids such as dexamethasone improves the tolerability and efficacy of nanoparticle formulations containing, for example, a compound of formula (I), (IA), (IB), (II), (IIa), (IIb) , (IIc), (IId), (IIe), (IIf), (IIg) or (III).

[00495] The tolerability and efficacy of the nanoparticle compositions to non-human primates was also investigated using a sample formulation containing Compound 18. The formulation was prepared according to the standard MC3 formulation described above and contained hEPO mRNA. Primates were given a single dose of 0.05 (Group 1), 0.3 (Group 2), or 1.0 (Group 3) mg/kg by intravenous infusion over 60 minutes. Three primates were administered each dose. hEPO expression was measured pre-dose and 2, 6, 24, 48 and 96 hours post-dose (Table 26). Pharmacokinetic parameters, including T _max , C _max , and AUC were also determined and are shown in table 27. Table 28 shows the levels of indicators of complement activation, and table 29 shows data on the induction of cytokines.

Table 26. hEPO expression measured at different time points after administration of the nanoparticle compositions to non-human primates. hEPO concentration (pg/ml) Group 1
(0.05 mg/kg) Group 2
(0.3 mg/kg) Group 3
(1.0 mg/kg) Level before injection 1000 1000 1000 2 h 142588 363272 312006 6 h 379362 341285 502663 24 hours 103055 148789 467598 48 h 25382 57095 175953 96 h 2084 6095 24795

Table 27 . Pharmacokinetic parameters measured upon administration of the nanoparticle compositions to non-human primates. Group 1
(0.05 mg/kg) Group 2
(0.3 mg/kg) Group 3
(1.0 mg/kg) T _max (h) Average 6.00 3.33 12.0 SD 0.00 2.31 10.4 CV% 0.00 69.3 86.6 _Cmax (pg/ml) Average 3.79E+05 3.84E+05 5.51E+05 SD 2.64E+05 2.45E+05 6.24E+04 CV% 69.7 63.8 11.3 AUC _total (h⋅pg/ml) Average 7.72E+06 1.02E+07 2.32E+07 SD 6.26E+06 7.34E+06 4.20E+06 CV% 81.1 72.3 18.1

Table 28 . Complement activation indicators measured at various time points after administration of the nanoparticle compositions to non-human primates. Time point Group 1
(0.05 mg/kg) Group 2
(0.3 mg/kg) Group 3
(1.0 mg/kg) C3a (ng/ml) Level before injection 10600 9827 12792 2 h 19236 42897 75936 6 h 12385 32436 51996 24 hours 11596 19721 35843 Day 5 11945 16207 19101 Fragment Bb (ng/ml) Level before injection 1375 1461 1529 2 h 5341 5356 8849 6 h 3037 7157 12820 24 hours 1496 3680 8601 Day 5 1273 2400 2834 C5b9 (ng/ml) Level before injection 169 157 238 2 h 1959 393 801 6 h 786 1333 2928 24 hours 265 614 4798 Day 5 163 405 534

Table 29 . Cytokine induction measured at various time points after administration of the nanoparticle compositions to non-human primates. Time point Group 1
(0.05 mg/kg) Group 2
(0.3 mg/kg) Group 3
(1.0 mg/kg) IFN-gamma (pg/ml) Level before injection 18.8 18.8 18.8 2 h 18.8 18.8 35.8 6 h 18.8 18.8 38.9 24 hours 18.8 18.8 18.8 Day 5 39.3 18.8 18.8 IFN-alpha (pg/ml) Level before injection 18.8 18.8 18.8 2 h 18.8 18.8 18.8 6 h 18.8 18.8 18.8 24 hours 18.8 18.8 18.8 Day 5 18.8 18.8 18.8 IL-1b (pg/ml) Level before injection 18.8 18.8 18.8 2 h 18.8 18.8 33.4 6 h 18.8 18.8 18.8 24 hours 18.8 18.8 18.8 Day 5 18.8 18.8 18.8 IL-6 (pg/ml) Level before injection 18.8 18.8 18.8 2 h 18.8 191 834 6 h 18.8 33.0 398 24 hours 18.8 18.8 31.4 Day 5 18.8 18.8 18.8 MCP-1 (pg/ml) Level before injection 192 168 235 2 h 342 3018 4221 6 h 543 2011 3945 24 hours 236 404 1444 Day 5 232 211 225 TNF-α (pg/ml) Level before injection 18.8 18.8 18.8 2 h 18.8 38.2 18.8 6 h 41.5 32.5 18.8 24 hours 17.6 59.6 46.2 Day 5 63.5 18.8 41.9

[00496] In general, the formulation was tolerated similarly to formulation MC3 with dose-response effects. Aspartate aminotransferase (AST) increased in the high dose group on day 2 and returned to baseline on day 5. However, alanine aminotransferase (ALT) levels did not increase. In general, lower doses were better tolerated. High doses induced fever and a hunched posture, which is similar to the behavior seen in primates treated with higher doses of MC3 formulations. The number of white blood cells was slightly increased in animals in the high dose group, however, in all groups there was a marked increase in the number of reticulocytes on day 5, indicating a strong pharmacological response. Complement activation and release of cytokines (IL-6 and MCP-1) were dose-dependent and reversible within 24 hours for the low and medium dose groups and by day 5 in the high dose group. hEPO levels were higher than those measured with comparable doses of MC3 formulations in non-human primates.

Example 22: Administration to non-human primates

[00497] The tolerability and efficacy of non-human primate nanoparticle formulations was also examined using sample formulations containing compounds 18, 25, 26 and 48 and MC3 to determine if these compounds differentiate in terms of protein expression. The formulations were prepared according to the standard MC3 formulation described above and contained hEPO mRNA. Table 30 provides details of the compositions tested, and Table 31 shows the relative expression of Luc mRNA and hEPO in mice and rats. Expression was measured 6 hours after administration.

Table 30 . Characteristics of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). Compound Size (nm) PDI EE (%) pH Osmolality (mosm/kg) Zeta potential (mV) 18 102.6 0.230 85.56 7.64 312 -3.53 25 98.8 0.230 87.01 7.60 304 -3.88 26 79.2 0.120 95.60 7.54 305 -3.73 48 70.6 0.176 91.92 7.58 311 -3.61 MC3 106.0 0.220 91.66 7.52 318 -3.64 But. = not defined

Table 31 . Comparison of nanoparticle compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg ) or (III). Compound 18 Compound 25 Compound 26 Compound 48 MC3 expression Luc lipid/MC3
(dose 0.5 mg/kg mice) 3.23 1.89 4.24 10.0 1 hEPO lipid/MC3 expression
(dose 0.2 mg/kg in rats) But. 2.41 But. 5.39 1 hEPO lipid/MC3 expression
(dose 2 mg/kg in rats) 0.81 2.13 4.95 3.84 1 % lipid remaining in the liver after 48 hours 0.018 1.32 20 11.4 87 But. = not defined

[00498] In FIG. 2 shows hEPO mRNA expression measured after intravenous administration of 0.01 mg/kg at a 60 minute infusion to naïve cynomolgus monkeys. As seen in the figure, expression was highest at 6 hours post administration for all formulations tested and was highest for those formulations containing Compound 18.

[00499] Table 32 shows pharmacokinetic parameters measured at doses of 0.01 mg/kg of the formulations to non-human primates.

Table 32 . Pharmacokinetic parameters measured upon administration of compositions containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf ), (IIg) or (III) non-human primates. Lipid T _max (h) C _max (ng/ml) AUC _0-t (h*ng/ml) AUC lipid ratio
/MC3 Average Average SD CV% Average SD CV% MC3 8 14.1 2.36 16.8 284 97.4 34.2 1.0 Compound 18 8 91 34.7 38.1 1690 1060 63.1 6.0 Compound 25 6 56.9 15.1 26.5 930 249 26.8 3.3 Compound 26 6 28.2 17.7 62.7 365 302 82.7 1.3 Compound 48 6 17.7 9.49 53.6 245 117 47.9 0.9

Example 23: Administration to non-human primates

[00500] The results of hEPO expression studies were confirmed using a standard MC3 composition and a nanoparticle composition containing compound 18 containing mRNA encoding an antibody against hemagglutinin (anti-HA). Cynomolgus monkeys were administered a single dose of 0.1 mg/kg or 0.3 mg/kg of a nanoparticle composition containing Compound 18 (see Table 33; prepared according to Example 2) including mRNA encoding an anti-HA antibody by intravenous infusion over 60 minutes.

Table 33 Lipid EE (%) Diameter (nm) PDI Compound 18 79.3 76.8 0.16

[00501] The results of anti-HA (anti-hemagglutinin) antibody expression are shown in Table 34 and FIG. eleven.

Table 34 Lipid Dose
(mg/kg) AUC (µg/ml*h) AUC ratio Compound 18/MC3 MC3 0.1 77.05 - Compound 18 0.1 354.3 4.6 MC3 0.3 235.7 - Compound 18 0.3 1055 4.5

[00502] A five-fold higher protein expression was observed with the nanoparticle formulation containing Compound 18 compared to the MC3 analog, and a clear dose-response between 0.1 and 0.3 mg/kg was found for Compound 18 (e.g., AUC 0, 3 mg/kg is about three times more than the 0.1 mg/kg dose).

Example 24 Methods of Treating Diseases and Disorders

[00503] A nanoparticle composition formulation having high tolerability (eg, causing a low immune response) and efficacy (eg, promoting efficient and effective encapsulation of the therapeutic and/or prophylactic agent and delivery of the agent to the desired target) was selected for use. The therapeutic and/or prophylactic agent for nanoparticulate formulations is selected for use depending on the condition of the subject. For example, an mRNA encoding vascular endothelial growth factor A (VEGF-A) may be selected to promote angiogenesis for the treatment of atherosclerotic renovascular disease, while an mRNA capable of downregulating apolipoprotein B (apoB) expression may be selected to treat a metabolic disease or disorder. such as dyslipidemia.

[00504] The subject in need of treatment was pre-administered with a small dose of dexamethasone one or more hours prior to administration of the nanoparticle composition. The nanoparticle composition is preferably administered intravenously to the subject, however, intramuscular, intradermal, subcutaneous, intranasal, or inhalation routes are also acceptable. Treatment is provided at a dose of about 0.001 mg/kg to about 10 mg/kg of the therapeutic and/or prophylactic agent and is repeated daily, weekly, biweekly, or monthly, as required by the subject.

Example 25 Subcutaneous Administration

[00505] The effect of the lipids of the invention on protein expression when administered subcutaneously was investigated. Formulations containing lipids of the invention and mRNA expressing luciferase or hEPO were administered subcutaneously to female CD-1 mice in an amount equal to 0.5 mg/kg. Expression levels were obtained by whole body luminescent imaging (BLI) at 3, 6, and 24 hours post-injection, and expression levels in the liver, spleen, and injection site were assessed ex vivo 24 hours later. Reverse esters were found to be superior to MC3, for example 6.5 times (compound 30). See also tables 35 and 36 and FIG. 19 and 27.

[00506] Table 35 shows luciferase expression levels using various nanoparticle compositions of this invention and luciferase expression levels using various nanoparticle compositions of this invention compared to luciferase expression levels using MC3 formulation after subcutaneous administration as described above.

[00507] Table 36 shows the levels of hEPO expression using various nanoparticle compositions of this invention compared to the level of hEPO expression using a composition containing MC3 or Compound 18 following subcutaneous administration as described above.

Table 35. Luciferase expression levels measured after subcutaneous administration of compositions containing compounds according to one of the formulas (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId) , (IIe), (IIf), (IIg) or (III). Lipid AUC (p/s)*h AUC lipid/MC3 ratio 20 6.8926E+10 4.02 24 8.9281E+10 5.21 25 2.9156E+10 1.70 thirty 1.0932E+11 6.38 72 3.4417E+10 2.01 75 5.2262E+10 3.05 110 1.2968E+10 0.76 112 2.0339E+10 1.19 113 7.3721E+10 4.30 122 5.8576E+10 3.42 MC3 1.7127E+10 1

Table 36 . Expression of hEPO upon subcutaneous administration of formulations containing compounds of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf) , (IIg) or (III), regarding the introduction of formulations containing MC3 or compound 18. Comm. Lipid/MC3 ratio Lipid/Compound ratio 18 6 h AUC 6 h AUC 18 2.63 1.88 1 1 thirty 6.53 6.38 1.35 1.27 96 1.98 1.72 98 0.69 0.69 151 0.73 0.71 163 0.99 0.96 164 0.50 0.56 165 0.63 0.64

Example 26 Development of Novel Amino Lipids with Improved Endosomal Yield and Sustained Efficacy and Safety in Non-Human Primates

Materials and methods

[00508] mRNA Synthesis : The mRNA used in the experiments described herein was synthesized in vitro by T7 polymerase transcription from a linearized DNA template that contains 5' and 3' untranslated regions (UTRs), including poly- And the tail. mRNA was purified and resuspended in citrate buffer at the desired concentration. The donor methyl group S-adenosylmethionine (SAM) was added to the methylated capped RNA (cap-0), resulting in cap-1 to increase the efficiency of mRNA translation.

[00509] Lipid synthesis: The lipid compounds tested in the experiments described herein were synthesized as described in Example 1.

[00510] Preparation of LNP formulations: Lipids were dissolved in ethanol in molar ratios of 50:10:38.5:1.5 (ionizable lipid: DSPC: cholesterol:PEG lipid). The lipid mixture was combined with 6.25 mM sodium acetate buffer (pH 5) containing mRNA in a ratio of 3:1 (water:ethanol) using a microfluidic mixer. The formulations were dialyzed against sodium phosphate buffer (pH 7.4) in dialysis cassettes for at least 18 hours. The compositions were concentrated by centrifugal filtration, passed through a 0.22 μm filter and stored at 4° C. until use. All formulations were tested for particle size, RNA encapsulation and endotoxin and were found to be 80 nm to 100 nm in size, with greater than 90% encapsulation and <1 U/ml endotoxin. The putative pK _{a of} the LNP composition was determined by TNS analysis.

[00511]TNS analysis: A stock solution of the main buffer (10 mM sodium phosphate, 10 mM sodium borate, 10 mM sodium citrate, 150 mM sodium chloride) was prepared and used to prepare buffers at various pH values to determine the estimated pK _a LNP compositions. Using sodium hydroxide (1 M) and hydrochloric acid (1 M), 21 unique buffers were prepared from the master buffer stock solution at pH values between about 3 and 12. Then a stock solution of 300 μM sodium salt of 6-(p-toluidino)-2- naphthalenesulfonic acid (TNS reagent) in DMSO and LNP was mixed with a buffer of the desired composition at a concentration of 0.04 mg/ml mRNA. This assay was validated in 1x PBS and 20 mM Tris with 8% sucrose buffer. Buffer solutions at different pH values were added to a 96-well plate in triplicate for each pH. 3.26 μl of LNP sample at 0.04 mg/ml mRNA concentration and 2.0 μl of 300 mM TNS reagent solution were added to each well. After thorough mixing, the obtained fluorescence values were read for each plate to create a sigmoid plot of fluorescence values versus buffer pH. The log of the inflection point of this curve is the estimated pK _a LNP composition.

In vivo studies

[00512] Administration of LNP to animals: LNP mRNA diluted in sodium phosphate buffer (PBS) was administered intravenously (5 ml/kg) to female CD-1 mice (18 to 22 g by body weight) and male Sprague-Dawley rats (225-250 g body weight) via the tail vein using 29 g, 3/10 ^cc insulin syringes (mice) or 27 g, 1 ml syringes (rats) after gently warming the animals using a heat lamp for 3 minutes.

[00513] Whole Body and Ex Vivo Bioluminescent Imaging in Mice: CD-1 mice were injected 15 minutes prior to imaging, ip with 200 µl Xenolight salt D-luciferin K+ diluted in PBS, just prior to use, to a concentration of equal to 15 mg/ml. Ex vivo organ imaging was completed within 25 minutes of luciferin administration. All images were quantified by region of interest for the total stream.

[00514] Blood collection and analysis for hEPO. Mice or rats were bled via tail vein and hEPO concentrations were determined using hEPO ELISA assay.

[00515] NHP studies: Studies in non-human primates were performed using naive cynomolgus monkeys (cynos), 2-4 years old, weighing 2-6 kg. None of the animal studies were randomized or blinded. The sample sizes were determined by the resource equation method. For injection, mRNA-LNP in "sodium phosphate buffer" (PBS) was administered as a 60-minute intravenous infusion using a temporary cavitary catheter inserted into a peripheral vein.

[00516] hEPO ELISA for NHP samples: Human Epo levels were measured using a human erythropoietin immunoassay. Cytokine levels were measured using a non-human primate cytokine array.

[00517] Human IgG assay for NHP samples: A 10.0 μl aliquot of template was transferred to a 96-well low protein binding plate. A 25.0 µl aliquot of internal standard working solution was added and the sample aliquot was diluted with loading buffer. Human IgG and its internal standard were isolated using protein A magnetic beads. After washing, captured proteins were denatured with Rapigest, reduced with DTT, alkylated with iodoacetic acid, and digested with trypsin. The final extract was analyzed by HPLC with MS/MS detection using positive ion electrospray. Least squares linear regression algorithm 1/concentration² was used to quantify unknown samples.

[00518] Serum ALT and AST levels: Samples were analyzed using a Modular Analytics analyzer.

[00519] Serum C5b9 levels: Analysis of a C5b9 sample was performed using the ELISA method. The kit used was the Human C5b-9 ELISA Kit and Reagent Kit B from BD Bioscience. The test samples were analyzed in a 1/100 dilution.

[00520] rDNA to measure mRNA levels: mRNA sample analysis (rDNA method (branched DNA - bDNA - branched DNA)) was performed using the QuantiGene® 2.0 reagent system kit from Affymetrix. Study samples were lysed prior to analysis using the QuantiGene Sample Processing Kit (blood samples). The test samples were analyzed in duplicate diluted between 1/100 and 1/1250000.

[00521] Lipid quantification by LC-MS/MS: Liver samples were homogenized after adding 19 eq. (w/v) water (DF=20). The protein was precipitated and analyzed against calibration standards prepared in an appropriate blank. Chromatographic separation and quantification was carried out using an LC-MS/MS system. Samples were injected and separated by HPLC. A triple quadrupole MS/MS system operating in the positive ion mode was used to detect the signal.

[00522] Metabolite Identification: Compound 18 (10 μM) was incubated with human plasma (29.0 mg protein/incubation) in incubation mixtures (final incubation volume 200 μl) which consisted of 50/50 v/v. pure plasma (undiluted)/substrate solution in 50 mM phosphate buffer pH 7.4). Plasma was obtained from male and female donors and contained the anticoagulant K2EDTA. Reactions were started by adding a substrate solution to human plasma and stopped at four designated time points (0, 30, 60 and 90 min) by adding 600 μl stop reagent (acetonitrile). Stopped incubation samples were centrifuged (e.g., 10,000 x g for 10 minutes at 10°C) and supernatant fractions were analyzed by LC-MS/MS to characterize metabolites formed from compound 18. Additional incubations were performed with positive control procaine (5 μM) to establish the competence of the test system. Samples were analyzed by LC-MS/MS.

[00523] Microscopic assay to quantify endosomal yield efficiency: Fluorescently labeled LNPs (0.1% Rhodamine DOPE) encapsulating firefly luciferase, chemically modified in vitro transcribed mRNA (Rhod-Luc LNP) were used to quantify LNP uptake, and a single the FISH molecule (smFISH) made it possible to quantify the amount of cytosolic mRNA molecules. HeLa cells were seeded in 96-well plates using ATCC DMCC culture medium, and after reaching 80% confluence, cells were incubated with labels for cytoplasmic and nuclear detection, followed by transfection with LNP Rhod-Luc at 25 ng (mRNA) per well in a volume of 100 μl. Cells were incubated with LNP for 4 h, then the samples were fixed in 4% paraformaldehyde and visualized in a high screening system with confocal imaging (Opera High Screening System).

[00524] In parallel, cells were electroporated with unformed luciferase mRNA. The electroporated cells were seeded in the wells next to the LNP-treated wells and the entire plate was fixed at the same time. After imaging the LNP uptake plate, the samples were processed for smFISH hybridization. The plate was visualized using confocal imaging and object analysis was used to quantify the amount of a single cytosolic mRNA molecule (R released from endocytic organelles) in LNP treated samples using electroporated samples as a reference. Co-staining with endocytic markers EEA1 (early endosomes) and Lamp1 (lysosomes) was used to confirm the intensity based analysis.

[00525] Rhod-Luc LNPs were plated directly onto glass and imaged using the same collection parameters used for LNP-treated cells. Intracellular LNP uptake (number of LNPs per cell, L) was calculated as the ratio between the sum of the fluorescence intensity per cell in the rhodamine channel (CellInt) and the average fluorescence intensity of individual LNP objects on the slide (LNPint). The endosomal escape ratio (EER), defined as the ratio between the amount of cytosolic mRNA and internalized LNPs (R/L), was used to compare endosomal escape efficiency between the two formulations used in this study (compound 18 and MC3).

[00526] Statistical analysis: Means were compared using conventional one-way ANOVA with post hoc tests for multiple comparisons (Dunnett for comparing multiple conditions against a single reference or Šídák for comparing pairs of conditions). Areas under the curve (AUC) were calculated using the trapezoid rule and the z-value calculated. For all tests, two-tailed P values <0.05 were considered statistically significant and are shown in FIG. as * < 0.05, ** < 0.005 or *** < 0.001. Used Prism 7.0b

Lipid Tail Optimization

[00527] An initial screening of a wide chemical space identified ethanolamine as the amino group of the lipid tail, which could effectively stimulate mRNA encapsulation and provide LNP with excellent physicochemical properties. Combining the ethanolamine head group with the dilinole lipid tails (compound 281) resulted in LNPs with high luciferase mRNA encapsulation, small particle size, and low polydispersity index. Compound 281 LNP had a surface pKa (apparent value for a particle) in the range that has been shown to be optimal for siRNA delivery. (Cm.Semple, S.C. et al., Nature Biotech. 2010. 28, 172-176, Jayaraman, M., et al. Angew. Chem. Int. Ed. 2012,51, 8529-8533, the contents of each of which are incorporated herein by reference in their entirety). To evaluate the effectiveness of the new aminolipids, LNP using the new compounds was tested in vivo in mice using luciferase mRNA as a reporter. MC3 LNP was included as a control in each experiment, allowing LNP to be compared from experiment to experiment. The measured luciferase activity also made it possible to determine the biodistribution of the protein. Intravenous delivery of 0.5 mg/kg (mRNA dose) of Compound 281 based LNP to mice resulted in luciferase activity two times lower than control MC3 LNP (FIG. 29A). Whole body imaging showed that most of the protein expression was localized in the liver. The lipid had a similar clearance to MC3 from liver tissue, with 66% of the original dose remaining in mouse liver tissue 24 hours post-dose (Table 37).

[00528] The effect of ester bonds in lipid tails on tissue clearance was tested (compounds 138 and 136). Ester bonds have previously been reported to induce metabolism by esterasesin vivo.(See Fukami, T. et al. Drug Metab. Pharmacokinet. 2012,27, 466-477, the entire contents of which are incorporated herein by reference). This strategy has been shown to improve lipid clearance in the MC3 lipid structure. (Cm.Maier M.A., Mol.Ther. 2013,21, 1570-1578, the entire contents of which are incorporated herein by reference). First, the chemical stability of lipids was evaluated by measuring the stability of ethanol at room temperature and a temperature of 37°C (Table 39). A purity change of less than 1% was observed for all lipids tested. The LNPs formed with Compound 138 were larger, with a surface pKa > 7. Rapid tissue clearance was observed for these LNPs, no lipids were detected after 24 hours (Table 37). Removal of one ester function (compound 136) gave LNP with improved physicochemical characteristics and lower surface pK _a LNP.

[00529] An improvement in protein expression was observed with the introduction of a branched ester (compound 6). Equivalent expression was observed for MC3 LNP, but the clearance rate was lower than for compounds 138 and 136 (67% lipid remained, Table 37). Replacement of the linoleic tail with a lipid tail containing a primary ester (compound 18) provided increased expression (3 times higher than MC3) and optimal tissue clearance (no lipid detected after 24 hours, Table 37). To further increase expression, an additional branched ester (compound 29) was introduced, but this resulted in a decrease in surface pK _a to 6.00 and a decrease in luciferase activity. In addition, the compound had a significantly slower tissue clearance, with 68% remaining at 24 hours.

[00530] Compound 14 is one illustrative example in which the alcohol functional group has been replaced by dimethylamine. This gave an LNP with comparable physicochemical properties to compound 18, but with a complete loss of delivery efficiency (FIG. 29A).

[00531] The relationship between lipid tail activity and structure has been further studied, in particular the position of the primary ester and its effect on delivery efficiency and tissue clearance (compare Compound 18, Compounds 25 and 26, Table 37). In mice using luciferase mRNA, we observed higher expression compared to MC3 after 0.5 mg/kg intravenous delivery with Compound 25 and Compound 26, with Compound 26 providing the highest luciferase activity in the series (FIG. 29A). Similar results were obtained in Sprague-Dawley rats using mRNA encoding human erythropoietin (hEPO) (Fig. 29C). When determining baseline hepatic aminolipid levels at the end of the rat study (48 hours post-dose), clearance was found to decrease as the primary ester approaches nitrogen (<1% for Compound 18, Compound 25 and 20% for Compound 26, Table 37). Compound 18 and compound 25 provided a good balance of delivery efficiency and pharmacokinetics.

[00532] While not wishing to be bound by theory, multiple amino lipid structural motifs have been found to be important for efficient in vivo operation of mRNA-containing lipid nanoparticles, including surface charge, ester structure and position in lipid tails, and head group structure. Lipids that provided a high level of protein expression exhibited rapid tissue clearance and resulted in a toxicity profile that supported chronic therapeutic indications. Variation was observed on the surface of pK _a particles, which was tracked by the efficiency of expression. The mean value of 6.6 was determined to be optimal. However, having an optimal pK _a range was not the only requirement for efficient delivery, as compound 14 showed low levels of luciferase expression (Table 37). Primary ester administration, similar to that observed in the MC3-based series, provided lipids that show rapid in vivo clearance. Studies on the identification of metabolites with compound 18 showed that hydrolysis of the primary ester is the first step in lipid metabolism. For this hydrolysis to be effective, the steric and electronics of the ester must be balanced. More substituted esters (Compound 29) and less electrophilic esters (Compound 26) each showed slower clearance in the liver. The combination of an ethanolamine head group, a primary ester at the C8 position in one lipid tail, and a secondary ester in the second lipid tail appears to provide a good balance of in vivo lipid clearance and protein expression.

Pharmacokinetic study

[00533] A pharmacokinetic study was conducted in rats comparing Compound 18 and Compound 25 with MC3 (FIG. 29B). Unlike MC3, which was still present at high concentrations for 48 hours, compound 18 and compound 25 were effectively cleared from liver tissue after 24 hours. Compound 18 was cleared from liver tissue faster than compound 25 with a half-life in liver tissue of 5.8 h versus 6.9 h, respectively (for complete PK parameters, see Table 40). This rapid clearance was in sharp contrast to the >50 h half-life of MC3. Favorable in vivo lipid degradation for Compound 18 and Compound 25 was also observed in spleen and plasma (Table 40).

[00534] Re-dosing mRNA into MC3-based LNPs for a therapeutic indication is expected to result in accumulation of MC3 in tissues based on the measured half-life. Therefore, it was investigated whether the favorable single dose pharmacokinetics of Compound 18 was maintained at weekly dosing. Clearance of MC3 and compound 18 from a variety of mouse tissues was measured after administration of 0.05 mg/kg mRNA on days 1, 8 and 15 (FIG. 30A). After dosing with LNP MC3, the lipid was detected in the liver, spleen, plasma, kidney, heart and lungs, with the highest concentrations in the liver and spleen (Fig. 30A, see Fig. 35A for a complete list of tissues). Accumulation of MC3 was observed after each dose. Liver and spleen had the highest levels of compound 18, but significantly lower levels than MC3. Compound 18 was also detected in plasma, lungs and kidneys, but not in the heart (Fig. 35A). Consistent levels of expression were observed when hEPO mRNA 0.5 mg/kg was administered intravenously to mice in Compound 18 based LNP (FIG. 30B), demonstrating the possibility of repeated dosing.

[00535] In vitro metabolite identification studies were also conducted using compound 18. These studies showed that the initial step in the metabolism of compound 18 was the primary hydrolysis of the ester to compound 166 (Tables 41 and 42). Disappearance of parent compound 18 and primary metabolite, compound 166, from mouse liver tissue was measured following 0.25 mg/kg mRNA administration on days 1, 8 and 15. As can be seen in FIG. 30C, rapid clearance of both parent compounds 18 and the metabolite compound 166 was observed.

Expression in non-human primates

Non-human primates more closely approximate clinical responses to LNP-based systems than do rodents (DeRosa, F., Guild, B., Karve, S., Smith, L., Love, K., Dorkin, J.R., et. al. Therapeutic efficacy in a hemophilia B model using a biosynthetic mRNA liver depot system. Gene Ther. 2016, 23, 699-707, the contents of which are incorporated herein by reference in their entirety. To convert rodent data to non-primate data. human (NHP), lipids were tested for NHP.For this purpose, it was evaluated whether the improved expression observed in mouse and rat with LNP containing Compound 18 could also be achieved in NHP after a single administration.Figure 31 shows the results achieved with two different mRNA cargoes A dose of 0.01mg/kg mRNA encoding hEPO was delivered by 60 min intravenous infusion Relative to the MC3 LNP control, five times higher exposure to the hEPO protein was observed (Fig. 31A) Similarly, using the second mRNA cargo encoding human IgG influenza A antibody showed a 5-fold increase in expression and a clear dose response compared to L3P MC3 (Fig. 31B and Fig. 36). A separate study evaluated tissue lipid accumulation in NHP after a single dose. Consistent with rodent results, MC3 residue was found in many tissues 12 hours post-dose, with the highest levels found in the liver and spleen. In contrast, compound 18 was present at significantly lower levels (FIG. 35B). These preliminary data demonstrate the translation of improved delivery efficiency and rapid removal of compound 18 in NHP.

[00536] Experiments demonstrate cross-species translativity. Multiple expression and pharmacokinetic (PK) studies across species have shown similar profiles in mice, rats and non-human primates. Intravenous delivery of mRNA containing Compound 18 based LNP compounds to a primate resulted in efficient expression of multiple proteins (FIGS. 31A and 31B) with similarly improved expression over MC3 as seen in rodents. In addition, rapid lipid clearance from tissue has also been observed with NHP. Efficient expression of Compound 18 with LNP was demonstrated within 5 weeks of dosing (FIG. 31C).

Toxicological study in non-human primates

[00537] The level of expression provided by the LNP of the invention in a primate repeat dose experiment was evaluated. A dose of hEPO mRNA equal to 0.2 mg/kg in Compound 18 based LNP was delivered by 60 minute intravenous infusion to cynomolgus monkeys (n=4) once a week for 5 weeks. There was a constant effect during the experiment (Fig. 31C) consistent with observations in rodents.

[00538] Compound 18 based LNP was then tested for tolerability and safety in vivo. A complete toxicological evaluation of Compound 18 based LNP in both Sprague Dawley rats and cynomolgus monkeys was performed using a standard one-month study with weekly dosing at three dose levels for each species. Rats were dosed at 0.05, 0.5 and 2 mg/kg and non-human primates at 0.1, 0.3 and 1 mg/kg. LNP-related toxicities associated with MC3-based LNP systems are commonly associated with immunological (cytokine and complement activation) and liver damage. The rat did not experience any adverse outcomes with Compound 18. FIG. 32 and 33 are 30-day levels of alanine transferase (ALT, Fig. 32A) and aspartate aminotransferase (AST, Fig. 32B), two indicators of liver injury. There is a minimal increase in any enzyme at any dose level compared to the PBS control and this trend is consistent with all measured clinical chemistry, hematology and immunological markers. This is in stark contrast to the toxicity profile of the MC3-based mRNA containing LNP, where ALT and AST were elevated at the mRNA dose of 0.3 mg/kg and the pathology showed signs of necrosis (Fig. 37).) (Sedic, M., Senn, J.J., Lynn, A., Laska, M., Smith, M., Platz, S.J., et al Safety Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomologus Monkey Vet Pathol 2017, 55 , 341-354., the contents of which are fully incorporated into this description by reference).

[00539] Javan macaques also showed minimal results at all dose levels. Measurement of circulating mRNA levels after each dose showed a consistent effect throughout the experiment (FIG. 37). ALT (FIG. 32C) and AST (FIG. 32D) levels for the 1 mg/kg dose on day 30 were at the same level as the control. A minimal increase in immune activation markers, including complement and cytokines, was not observed. As shown in FIG. 33A, no significant change in the levels of C5b9, a terminal complement activation product, was observed after dose 1 or dose 5. In FIG. 33B shows the slight change above baseline observed for "monocyte chemo-attractive protein" (MCP-1).

[00540] Optimization of the novel aminopolypide range resulted in a significant improvement in tolerability in rats and non-human primates compared to MC3, due in part to an improved metabolic profile. In rats and cynomolgus monkeys at doses up to 2 mg/kg and 1 mg/kg dose, respectively, no evidence of liver damage or complement activation was found after five weeks of weekly dosing. These data show that repeated dosing of the mRNA contained in the lipid nanoparticles of this invention results in maintenance of circulating LNP levels without any signs of toxicity.

Evaluation of the effectiveness of endosomal exit

[00541] Improved delivery efficiency, especially uptake and/or endosomal exit, eg relative to MC3, has been investigated. Expression studies in ApoE knockout mice and LDLr knockout mice with Compound 18 based LNP showed an almost complete loss of expression, indicating that this series of aminopolypids have an uptake mechanism similar to MC3 and function dependent on ApoE-dependent manner LDLr (Fig. 38). (See Akinc, A. et al. Mol. Ther. 2010, 18, 1357-1364, the contents of which are incorporated herein by reference in their entirety). To better understand the efficiency of endosomal exit, an in vitro cell-based assay was developed using rhodamine-labeled LNPs to quantify cellular uptake and fluorescent in situ hybridization (FISH) to detect mRNA that releases endocytic compartments. As can be seen in FIG. 34, cells treated with Compound 18-based LNP have significantly less mRNA aggregated by organelle (red) compared to cells treated with MC3-based LNP. At the same time, the density of single cytosolic mRNA entities is higher in cells treated with Compound 18-based LNP. In order to quantitatively compare the efficiency of endosomal escape for the two LNP formulations, the ratio between the amount of cytosolic mRNAs and the amount of internalized LNP at the single cell level was calculated (Table 38) . The results demonstrate a 6-fold increase in potency for Compound 18 compared to MC3 in LNP (ratio 0.76 and 0.13, respectively).

[00542] It has previously been estimated that less than 2% of siRNA-based LNPs that are taken up by the cell release their cargo into the cytosol. (See Gilleron, J. et al. Nature Biotech. 2013, 31, 638-646, the contents of which are hereby incorporated by reference in their entirety). Using single molecule fluorescence microscopy, endosomal escape efficiency (calculated as the ratio between the number of cytosolic mRNAs and the number of internalized LNPs per cell) was quantified in an in vitro system. It was shown that the efficiency for compound 18 increased by a factor of 6 compared to MC3 (ratio 0.76 and 0.13, respectively). Because these formulations encapsulate approximately 5 mRNA molecules per particle, the endosome escape rates reported herein are 15% and 2.5% endosome escape efficiency for Compound 18 and MC3, respectively.

[00543] The results of the study are shown in tables 37-42. Table 37 shows the physicochemical characteristics of the nanoparticles. Endosomal yield efficiencies are shown in Table 38. Lipid purity is shown in Table 39. Table 40 shows mouse pharmacokinetic parameters. The metabolic profiling results and characterization of Compound 18 incubated with human hepatocytes or human plasma are shown in Tables 41 and 42, respectively.

Table 37. Physicochemical characterization of lipid nanoparticles and clearance of lipids from tissue ^a connection no. % encapsulation
lation Size (nm) PDI ^b p K a % Dose remaining in mouse liver tissue, 24 h ^c % Dose remaining in rat liver tissue, 48 h ^d 281 96.9±1.2 93.8±5.6 0.14±0.05 6.79±0.37 66±22 n.i. 138 91.8±0.9 179.4±4.2 0.14±0.05 7.39±0.07 0 ± n.i. 136 90.9±0.9 140.4±2.4 0.11±0.05 6.95±0.13 0 ± n.i. 6 97.6±1.2 73.1±2.1 0.07±0.05 6.32±0.05 67±9.8 n.i. 18 97.5±0.2 86.2±1.7 0.04±0.06 6.56±0.13 0 0.02e 29 97.0±0.6 66.8±1.1 0.11±0.03 6.00±0.24 68±9.2 n.i. 14 95.2±0.5 130.1±3.5 0.15±0.07 6.58±0.11 n.i. n.i. 25 95.8±1.0 85.8±1.0 0.10±0.05 6.68±0.29 n.i. 1.3e 26 97.4±0.2 91.9±1.5 0.16±0.03 6.64±0.14 n.i. 20±4.0f MC3 97.3±1.9 85.6±4.5 0.11±0.04 6.30±0.03 71±27 61e ^a n.i. = not tested, ± SD within one trial run. ^b Polydispersity index. ^c Percent initial lipid dose in CD-1 mouse liver 24 h after 0.5 mg/kg mRNA bolus, n=5±SD ^d Percent initial lipid dose in Sprague Dawley rat liver 48 h after 2 mg bolus /kg mRNA. ^e n=2. ^f n=3±SD

Table 38. Efficiency of endosomal exit ^a State Number of cytosolic mRNAs per cell Number of LNPs per cell Cytosolic mRNA/LNP electroporation 570±19 n.p. n.p. MC3 550± ^19b 4230± ^378b 0.130 Compound 18 717±28 ^s 947±71 ^s 0.758 ^a n.p. = unsuitable. ^b Number of cells analyzed=1439±SEM. ^c Number of cells analyzed=1412±SEM.

Table 39: Lipid Purity Lipid Purity (%) connection no. t=0 t=96 h, 25 °C t=96 h, 37 °C 281 95.17 95.15 96.47 138 97.59 98.64 97.82 136 91.81 93.17 93.86 6 93.80 93.21 94.29 18 94.37 94.71 95.01 29 97.017 97.67 98.10 14 92.08 92.07 91.90 25 95.58 96.23 96.13 26 98.64 97.38 95.72

Table 40 Mouse Pharmacokinetic Parameters Textile Lipid HL (h) T _max (h) C _max (ng/ml) AUCall (h*ng/ml) Average SE Average SE Plasma MC3 8.4 0.5 28900 2350 69100 84.2 compound 18 1.2 0.5 44200 3520 61800 6520 compound 25 2.3 0.5 37500 2540 35400 1470 Liver MC3 52.5* 24 33000 2940 1410000 114000 compound 18 5.8 1 6050 91.3 16900 1930 connection 25 6.9 1 17900 608 89200 5780 Spleen MC3 33.3* 8 21200 5380 787000 61000 compound 18 10.6 4 3770 847 39400 2750 connection 25 15.2 4 20400 4170 259000 7050 *=2 evaluation of data endpoints

PK analysis of individual plasma and tissue concentration data was performed using an unvalidated program (Phoenix WinNonlin®, version 7.0 (Pharsight Corp., Mountain View, CA)). Kinetic parameters were assessed using a non-compartmental model (Plasma (200-202), uniform weighing, extravascular dosing with sparse sampling). AUC was calculated using the linear trapezoid rule.

All derived parameters are presented in 3 significant figures, except for time to peak concentration (Tmax) and half-life (HL), which are presented in one decimal place. No additional statistical analyzes were performed for plasma concentration data or derived pharmacokinetic parameters.

Table 41: Profiling data and characterization of metabolites for compound 18 (10 μM) incubated up to 240 minutes with human hepatocytes (1 million cells/ml) connection no. Proposed biotransformation 0 min 60 min 120 min 240 min 166 Ester hydrolysis at 17 carbon chain But. + + + 18 - + + + + +: Detected; n.d.: not found

Table 42: Profiling data and characterization of metabolites for compound 18 (10 μM) incubated up to 90 minutes with human plasma (29.0 mg protein/incubation) connection no. Proposed biotransformation 0 min 30 min 60 min 90 min 166 Ester hydrolysis at 17 carbon chain But. + + + 18 - + + + + +: Detected; n.d.: not found

Equivalents

It should be understood that although this disclosure has been described in conjunction with its detailed description, the foregoing description is intended to be illustrative and not to limit the scope of this disclosure, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the following claims.

Claims (69)

1. Compound of formula (IA)

(IA) where l is 5; m is 7; M ₁ is M'; R ₄ is -(CH ₂ ) _n Q, where Q is -N(R)R ₈ and n is 3; M and M' are independently selected from -C(O)O- and -OC(O)-; R ₈ is cyclobutenyl substituted with one or more oxo, amino, heterocycloalkyl selected from piperidinyl, morpholinyl and 4-methylpiperazin-1-yl, and mono- or dialkylamino, where mono- and dialkylamino are substituted with one C _1-3 alkoxy or dialkylamino ; R ₂ and R ₃ are independently C _8-10 alkyl; R is H; And R' is C _9-18 alkyl. 2. The compound of claim 1 wherein R ₈ is cyclobutenyl substituted with one or more oxo and mono- or dialkylamino, where the mono- and dialkylamino are substituted with one C _1-3 alkoxy or dialkylamino. 3. A compound according to claim 1 wherein R ₈ is cyclobutenyl substituted with one or more oxo and heterocycloalkyl selected from piperidinyl, morpholinyl and 4-methylpiperazin-1-yl. 4. The compound according to claim 1, where R ₄ is selected from:

,

,

,

,

,

And

. 5. The compound according to claim 1, where the compound is selected from:

6. Compound of formula (IA)

(IA) where l is 5; m is 7; M ₁ is M'; R ₄ is -(CH ₂ ) _n Q, where Q is -N(R)R ₈ and n is 3; R ₈ is cyclobutenyl substituted with one or more oxo and monoalkylamino; M and M' are independently selected from -C(O)O- and -OC(O)-, where at least one of M and M' is -OC(O)-; R ₂ and R ₃ are independently C _8-10 alkyl; R is H; And R' is C _9-18 alkyl. 7. The compound according to claim 6, where the compound is selected from:

8. Compound of formula (IA)

(IA) where l is 5; m is 7; M ₁ is M'; R ₄ is -(CH ₂ ) _n Q, where Q is -N(R)R ₈ and n is 3; R ₈ is cyclobutenyl substituted with one or more oxo and monoalkylamino; M and M' are independently selected from -C(O)O- and -OC(O)-; R ₂ and R ₃ are independently C _8-10 alkyl; R is H; And R' is branched C _9-18 alkyl. 9. The compound according to claim 8, where R' represents

10. The compound according to claim 8, where the compound is:

11. A nanoparticle composition for delivering a therapeutic and/or prophylactic agent to a mammalian cell, containing a lipid component that contains from about 30 mol% to about 60 mol% of the compound according to any one of paragraphs. 1-10; about 0 mole % to about 30 mole % phospholipid, about 18.5 mole % to about 48.5 mole % structural lipid, and about 0 mole % to about 10 mole % PEG-lipid. 12. The composition of nanoparticles according to claim 11, where the phospholipid is selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and their mixtures. 13. The nanoparticle composition of claim 11 wherein the phospholipid is DSPC or DOPE. 14. The nanoparticle composition according to claim 11, wherein the structural lipid is cholesterol. 15. A nanoparticle composition according to claim 11, wherein the PEG-lipid is selected from the group consisting of PEG-modified dialkylamine, PEG-modified diacylglycerol, and mixtures thereof. 16. The nanoparticle composition of claim 11, wherein the lipid component contains from about 35 mol% to about 55 mol % of said compound, from about 5 mol % to about 25 mol % of the phospholipid, from about 30 mol % to about 40 mol % of structural lipid and from about 0 mol% to about 10 mol% PEG lipid. 17. The nanoparticle composition of claim 11, wherein the lipid component contains approximately 50 mole % of said compound, approximately 10 mole % phospholipid, approximately 38.5 mole % structural lipid, and approximately 1.5 mole % PEG-lipid. 18. A nanoparticle composition according to claim 11, wherein the therapeutic and/or prophylactic agent is a nucleic acid. 19. A nanoparticle composition according to claim 11, wherein the therapeutic and/or prophylactic agent is ribonucleic acid (RNA). 20. The composition of nanoparticles according to claim 19, where the RNA is selected from the group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA) and microRNA (miRNA), dicer-substrate RNA (dsRNA), short hairpin RNA (shRNA) , messenger RNA (mRNA), and mixtures thereof. 21. A nanoparticle composition according to claim 19, wherein the RNA is mRNA. 22. The nanoparticle composition of claim 21, wherein the mRNA contains one or more of a 'loop-on-stem', chain-terminating nucleoside, a polyA sequence, a polyadenylation signal, and/or a 5'-cap structure. 23. The composition of nanoparticles according to any one of paragraphs. 16-22, wherein the efficiency of encapsulation of the therapeutic and/or prophylactic agent is at least 80% or at least 90%. 24. The composition of nanoparticles according to any one of paragraphs. 16-22, where wt./wt. the ratio of lipid component to mRNA is from about 10:1 to about 60:1. 25. The composition of nanoparticles according to claim 24, where wt./wt. the ratio of lipid component to mRNA is approximately 20:1. 26. A nanoparticle composition according to any one of claims 16-22, wherein the N:P ratio is from about 5:1 to about 8:1. 27. A method for delivering a therapeutic and/or prophylactic agent to a mammalian cell, comprising administering to a subject a nanoparticle composition according to any one of paragraphs. 16-22, said administration comprising contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the cell. 28. A method for producing a polypeptide of interest in a mammalian cell, comprising contacting said cell with the nanoparticle composition of claim 21, wherein the mRNA encodes the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to form the polypeptide of interest.

Images