RU2797510C2 - SILENSING OF TGF-BETA 1 AND Cox-2 USING siRNA DELIVERED IN A POLYPEPTIDE NANOPARTICLE, SINGLE AND IN COMBINATION WITH IMMUNE CHECKPOINT INHIBITORS FOR THE TREATMENT OF MALIGNANT NEOPLASM - Google Patents

Abstract

FIELD: medicine; pharmaceuticals.

SUBSTANCE: invention relates to a method for the destruction of malignant cells in an individual, comprising administering to the individual a therapeutically effective amount of a combination of siRNA against TGF-beta 1 and siRNA against Cox-2, where the combination is administered together with an inhibitor of immune checkpoints for the treatment of malignant neoplasms.

EFFECT: treatment of a malignant neoplasm using miRNA molecules that inhibit TGF-beta 1 and Cox-2 in combination with an inhibitor of immune checkpoints.

27 cl, 8 dwg, 2 tbl, 1 ex

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application No. 62/785647, filed December 27, 2018, incorporated herein by reference in its entirety.

SEQUENCE LIST

This application contains a sequence listing filed electronically in ASCII format and is thus incorporated herein by reference in its entirety. The specified ASCII copy was created on February 14, 2020, named 4690_0016i_SL.txt and has a size of 8518 bytes.

FIELD OF THE INVENTION

The present invention relates to certain pharmaceutical molecules and compositions and their use in the treatment of cancer and, in particular, the use of small interfering RNA (siRNA) molecules that inhibit TGF-beta 1 and Cox-2, alone or in combination with immune checkpoint inhibitors. for the treatment of malignant neoplasm.

BACKGROUND OF THE INVENTION

In recent work, immune checkpoint inhibitors have been identified as important targets for the fight against malignant neoplasms. Receptors such as PD-1 (on the surface of T cells) can interact with ligands (such as PD-L1) on the surface of tumor cells, and binding between these molecules results in signaling to the T cell that the tumor should not be destroyed. Thus, this signal transduction mechanism has been extensively investigated in order to study and identify ways to block it and thus stimulate recognition of tumors by the immune system, leading to increased tumor killing.

There are many breakpoints discovered including CTLA4, Lag3, Tim3, PD-1 and PD-L1. For example, anti-PD-1 or anti-PD-L1 antibodies have been shown to block the interaction between the PD-1 receptor and the PD-L1 ligand, and this inhibits the "don't eat me" signal from the tumor cell to the T cell, which otherwise prevents the action of the T cell to carry out its normal response to tumors and other foreign cells through the release of cell-killing enzymes.

With the introduction of these antibodies (pembrolizumab, Keytruda, etc.) in the clinical setting, it has been found that treating patients with these agents can promote a very strong immune response in approximately 30% of patients, resulting in a long-term cure for these patients. However, it is not clear why this response was seen in only 30% of treated patients, and thus research has focused on other signaling pathways and mechanisms that may play a role in inhibiting the immune response and the ability of T cells to kill tumor cells.

RNA interference (RNAi) is a sequence-specific RNA degradation process that provides a relatively simple and direct route to knockdown or silencing, in theory, any gene containing a homologous sequence. In natural RNAi, double-stranded RNA (dsRNA) is cleaved by the RNase III/helicase protein, Dicer, into small interfering RNA (siRNA) molecules, dsRNAs of 19-27 nucleotides (bp) with 2-nucleotide sticky 3' ends. The siRNA is then incorporated into a multicomponent ribonuclease called the RNA-induced silencing complex (RISC). One strand of siRNA remains associated with RISC to guide the complex towards a cognate RNA having a sequence complementary to the guide ss-miRNA in RISC. This siRNA-directed endonuclease cleaves RNA, resulting in shortening and inactivation of the target RNA. Recent studies have shown the utility of a chemically synthesized 21-27 bp siRNA demonstrating the effects of RNAi in mammalian cells and demonstrating that the thermodynamic stability of siRNA hybridization (at the ends or in the middle) plays a central role in determining the function of molecules. More detailed characteristics of RISC, miRNA and RNAi molecules are described in the scientific literature.

The usefulness of RNAi in the downregulation of gene expression in mammalian cells has been successfully demonstrated in the laboratory using chemically synthesized siRNA or endogenously expressed siRNA. Endogenous siRNA is first expressed as small hairpin RNA (shRNA) by an expression vector (plasmid or viral vector) and then processed by Dicer to become a functional siRNA.

In order for miRNA to have activity and be able to perform silencing of target genes, it can be delivered to cells where silencing should occur by transfection of these cells. One way to deliver miRNAs to these cells is to use nanoparticles that can carry miRNAs and allow the capture of miRNAs through the outer membrane of the cell, gaining access to the cytoplasm. The release of siRNA into the cytoplasm allows these residues to interact with the RISC complex, where the antisense strand is separated from the sense strand, the sense strand is degraded, and the antisense strand is used by the RISC complex to track the mRNA in the cell by sequence with complementarity to the antisense sequence. This makes it possible for the two sequences to hybridize, and then the mRNA is cleaved by the Dicer enzyme.

The mRNA provides the template responsible for translating the mRNA sequence into an active protein required by the cell. Cleavage of mRNA reduces the cell's ability to produce the peptide or protein encoded by the mRNA. Gene silencing under the action of miRNAs can demonstrate a prolonged effect and depends on turnover and the balance between the rate of synthesis, the amount of mRNA, and the rate of degradation of mRNA and/or the protein itself. It has been shown that miRNA has a powerful silencing effect on the target gene, and then this can lead to a prolonged decrease (from days to weeks) of the protein product.

Elevated levels of TGF-beta 1 contribute to the inhibition of T-cell entry into areas near tumors [1-3].

For example, in tumors from patients with colon cancer [1,2] or metastatic urothelial cancer treated with an anti-PD-L1 antibody (atezolizumab), the lack of response has been associated with transforming growth factor β (TGFβ) signaling in fibroblasts. This was mainly observed in tumors showing the exclusion of CD8 ⁺ T cells from the tumor parenchyma and the accumulation of these T cells in the fibroblast and collagen rich peritumoral stroma, which is a common phenotype among patients with metastatic urothelial cancer. Co-administration of a TGFβ-blocking antibody with antibodies against PD-L1 reduced TGFβ signaling in stromal cells, and this, in turn, allows T-cells to enter the center of tumors, which provokes antitumor immunity and tumor regression in this model [3].

Although studies [1] and [2] focus on colon cancer and [3] show effects on urothelial cancer, no attempt has been made to investigate the synergy between TGFβ1 and PD-L1 inhibition on the immune response when both targets are inhibited simultaneously. The present inventors investigated polypeptide nanoparticles (PNPs) for delivering siRNA targeted to TGFβ1 and Cox-2 to the liver to investigate whether this effect would improve the efficacy of anti-PD-L1 antibodies in this disease. Delivery to endothelial cells, as well as normal hepatocytes, suggests the possibility of silencing of two genes near the tumor.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 . Localization of injected IV STP707 in liver cells. Fluorescently labeled AF647 siRNA was formulated with HKP to obtain a nanoparticle. The nanoparticles were administered to mice by IV injection (injection through the tail vein). At the time points indicated in the figure, the animals were sacrificed, the liver was removed and excised, and the dissociated cells were subjected to flow cytometry using labeled antibodies, which made it possible to distinguish between the different cell types present. Cell types are listed from left to right under each time point: Kupffer cells (KC), dendritic cells (DC), liver sinusoidal endothelial cells (LSEC), hepatocytes, Ly6c ^High cells (inflammatory monocytes), Ly6c ^Low cells, polymorphonuclear leukocytes (PMN ), lymphocytes, and stellate cells. This figure shows that hepatocytes, Kupffer cells and LSEC cells initially took up STP707 after 1 hour. The population of stellate cells in the liver was only 1.4% of the cell population. Although some signs of uptake were observed by flow cytometry, the signal was too low, so the present inventors validated uptake in primary human stellate cells and demonstrated exceptional uptake and gene silencing in these cells.

Fig. 2. Using the substrate luciferin administered to anesthetized animals, the volume of tumors was assessed by measuring the light output from each animal (measured using a digital imaging system). Animals were assigned to a cohort taking into account the normalization of tumors among all test groups. This figure shows the initial values obtained when attributing to groups, indicating the homogeneity of tumor sizes between cohorts before treatment.

Fig. 3. The body weight of the animals was monitored after each administration and the body weight was averaged among all animals in the cohort. The data was plotted as % of pre-dose baseline body weight.

Sorafenib alone (red squares) induced little change in body weight. However, all other treatment regimens (STP707 alone or+anti-PD-L1 antibodies) were well tolerated and no significant weight loss was observed in the treatment groups.

Fig. 4. Tumor-associated bioluminescence (TABL) measurements were performed by administering a luciferase substrate (luciferin) to anesthetized animals and then visualizing the light generated by the IVIS Live Animal Imaging System. Animals were treated throughout the administration phase (grey area) or otherwise monitored without treatment at other time points.

Animals treated with control (vehicle) showed rapid growth of tumors, which was determined by a greater light signal. Administration of sorafenib and anti-PD-L1 mAb showed a static effect on tumor growth during the administration phase. STP707 alone (40 μg per injection or ~2 mg/kg) or with anti-PD-L1 mAb showed a significant reduction in tumor cells after 5-6 doses. Tumors were not visible in these treatment groups.

Fig. 5. In control animals (which were injected with the vehicle), a significant effect of uncontrolled tumor growth on the viability of the animals was observed. 50% of untreated animals died or were euthanized as a result of increased tumor burden during the administration phase of the experiment. 1 animal was sacrificed after 37 days in the sorafenib group. No animals died in any other treatment group.

Fig. 6. The data suggest that control samples (PNPs loaded with non-silencing (NS) siRNA) showed a significant increase in tumor cell growth as measured by out-of-animal flow readings using the IVIS imaging system. The anti-PD-L1 antibody showed a weak inhibitory effect on tumor growth. STP707 alone (1 mg/kg) showed even greater tumor growth inhibition than the anti-PD-L1 Ab, and in the presence of the anti-PD-L1 mAb, STP707 completely killed the tumor after 6 doses, suggesting an additive effect in the case of the antibody.

Fig. 7. STP707 was administered at 3 doses of 1 mg/kg to animals with syngeneic orthotopic HCC tumor, and then the liver was removed, sectioned and stained (with hematoxylin and eosin) to demonstrate tumor location and size. It should be noted a significant reduction in tumor size with the introduction of STP707 during this short period of time. In the areas shown in white boxes, CD4 ⁺ and CD8 ⁺ T cells were quantified by staining and counting stained spots. These areas are shown on an enlarged scale to the right of each figure, and it can be clearly seen that administration of STP707 resulted in a significant increase in the number of CD4 ⁺ and CD8 ⁺ T cells present in the area of the border of the liver and tumor, which suggests that the administration of STP707 makes it possible greater penetration of T cells into the tumor.

Fig. 8. Using images similar to those shown in FIG. 7, T cells were quantified in different segments by measuring them at a distance from the tumor boundary - inward, towards the tumor, or outward, towards the liver. In each segment (50 μm thick), T cells were quantified and plotted as shown. The introduction of STP707 together with Ab against PD-L1 caused a 2-fold increase in CD8 ⁺ T cells at a depth of 500 μm in the tumor compared with the introduction of the vehicle alone. An increase in CD8 ⁺ T cells in the liver near the tumor has also been shown, suggesting possible T cell recruitment induced by a decrease in the TGF-beta wall surrounding the tumor.

DESCRIPTION OF THE INVENTION

The invention relates to the use of small interfering RNA (siRNA) molecules that inhibit TGF-beta 1 and Cox-2 in an individual, alone or in combination with immune checkpoint inhibitors, for the treatment of cancer in an individual. In the context of the invention, the term "individual" refers to any mammal, including humans. The individual may be a laboratory animal such as a rodent, a ferret, or a non-human primate. Preferably, the individual is a human.

In one embodiment, the invention relates to a method for killing malignant cells in an individual by administering to the individual a therapeutically effective amount of anti-TGF-beta 1 siRNA. In one aspect of this embodiment, anti-TGF-beta 1 siRNA is administered intravenously to the individual. In another aspect of this embodiment, the anti-TGF-beta 1 siRNA is introduced into the individual's tumor. In another aspect of this embodiment, the anti-TGF-beta 1 siRNA is administered near the tumor or systemically in a vehicle that allows delivery to the tumor.

In another embodiment, the invention relates to a method of treating cancer in an individual by administering to the individual a therapeutically effective amount of anti-TGF-beta 1 siRNA. In one aspect of this embodiment, anti-TGF-beta 1 siRNA is administered intravenously to the individual. In another aspect of this embodiment, the anti-TGF-beta 1 siRNA is introduced into the individual's tumor. In another aspect of this embodiment, the anti-TGF-beta 1 siRNA is administered near the tumor or systemically in a vehicle that allows delivery to the tumor.

A malignant neoplasm (and malignant cells) is any malignant neoplasm from which an individual suffers. Such malignancies include liver cancer, colon cancer, pancreatic cancer, lung cancer and bladder cancer. Liver cancer may be a primary liver cancer or a malignant neoplasm that has metastasized to the liver from another tissue. Primary liver cancer includes hepatocellular carcinoma and hepatoblastoma. Metastasizing malignancies include colon cancer and pancreatic cancer.

Anti-TGF-beta 1 siRNA molecules include the sequences shown in Table 1.

Table 1: Anti-TGF-beta 1 miRNA sequences

hmTF-25-1: sense 5'-r(GGAUCCACGAGCCCAAGGGCUACCA)-3' (SEQ ID NO: 1)

antisense 5'-r(UGGUAGCCCUUGGGCUCGUGGAUCC)-3 (SEQ ID NO: 2)

hmTF-25-2: sense 5'-r(CCCAAGGGCUACCAUGCCAACUUCU)-3' (SEQ ID NO: 3)

antisense 5'-r(AGAAGUUGGCAUGGUAGCCCUUGGG)-3' (SEQ ID NO: 4)

hmTF-25-3:sense 5'-r(GAGCCCAAGGGCUACCAUGCCAACU)-3' (SEQ ID NO: 5)

antisense 5'-r(AGUUGGCAUGGUAGCCCUUGGGCUC)-3' (SEQ ID NO: 6)

hmTF25-4: sense, 5'-r(GAUCCACGAGCCCAAGGGCUACCAU)-3' (SEQ ID NO: 7)

antisense, 5'-r(AUGGUAGCCCUUGGGCUCGUGGAUC)-3' (SEQ ID NO: 8)

hmTF25-5: sense, 5'-r(CACGAGCCCAAGGGCUACCAUGCCA)-3' (SEQ ID NO: 9)

antisense, 5'-r(UGGCAUGGUAGCCCUUGGGCUCGUG)-3' (SEQ ID NO: 10)

hmTF25-6: sense, 5'-r(GAGGUCACCCGCGUGCUAAUGGUGG)-3' (SEQ ID NO: 11)

antisense, 5'-r(CCACCAUUAGCACGCGGGUGACCUC)-3' (SEQ ID NO: 12)

hmTF25-7: sense, 5'-r(GUACAACAGCACCCGCGACCGGGUG)-3' (SEQ ID NO: 13)

antisense, 5'-r(CACCCGGUCGCGGGUGCUGUUGUAC)-3' (SEQ ID NO: 14)

hmTF25-8: sense, 5'-r(GUGGAUCCACGAGCCCAAGGGCUAC)-3' (SEQ ID NO: 15)

antisense, 5'-r(GUAGCCCUUGGGCUCGUGGAUCCAC)-3' (SEQ ID NO: 16)

In one aspect, the anti-TGF-beta 1 siRNA contains the following sequences: sense: 5'-cccaagggcuaccaugccaacuucu-3' (SEQ ID NO: 3); antisense: 5'-agaaguuggcaugguagcccuuggg-3' (SEQ ID NO: 4).

The anti-TGF-beta 1 siRNA is administered to the subject in a pharmaceutically acceptable vehicle. Such carriers include branched histidine-lysine polymers. In one embodiment of such polymers, the polymer has the formula (R)K(R)-K(R)-(R)K(X), where R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 17) or R=KHHHKHHHKHHHHKHHHK (SEQ ID NO : 18), X=C(O)NH ₂ , K=lysine and H=histidine. Such polymers form an anti-TGF-beta 1 siRNA nanoparticle. The nanoparticle can be administered intravenously or intratumorally to an individual.

In another embodiment, the invention relates to a method of killing malignant cells in an individual by administering to the individual a therapeutically effective amount of an immune checkpoint inhibitor with a therapeutically effective amount of an anti-TGF-beta 1 siRNA. In one aspect of this embodiment, administering an immune checkpoint inhibitor with an anti-TGF siRNA -beta 1 increases the effectiveness of siRNA against TGF-beta 1.

In another embodiment, the invention relates to a method of treating cancer in an individual by administering to the individual a therapeutically effective amount of an immune checkpoint inhibitor with a therapeutically effective amount of an anti-TGF-beta 1 siRNA. In one aspect of this embodiment, administering an immune checkpoint inhibitor with an anti-TGF siRNA -beta 1 increases the effectiveness of siRNA against TGF-beta 1.

As indicated above, the immune checkpoint and anti-TGF-beta 1 siRNA inhibitor is administered to an individual intravenously, into the individual's tumor, near the tumor, or systemically in a vehicle that allows delivery to the tumor.

In one aspect of this embodiment, the immune checkpoint inhibitor is a monoclonal antibody that blocks interaction between receptors such as PD-1, PD-L1, CTLA4, Lag3, and Tim3 and ligands of these receptors on mammalian cells, such as human cells. In a specific aspect, the monoclonal antibody is an anti-PD-1 or PD-L1 monoclonal antibody. Examples of monoclonal antibodies include atezolizumab, durvalumab, nivolumab, pembrolizumab, and ipilimumab.

In another aspect of this embodiment, the immune checkpoint inhibitor is a small molecule compound that blocks interaction between receptors such as PD-1, PD-L1, CTLA4, Lag3, and Tim3 and ligands of these receptors on mammalian cells, such as human cells. In a specific aspect, the small molecule compound blocks binding between PD-1 and PD-L1. BMS202 and similar ligands are examples of such small molecule compounds.

In a further embodiment, the invention relates to a method for killing cancer cells in an individual by administering to the individual a therapeutically effective amount of an anti-Cox-2 siRNA with a therapeutically effective amount of an anti-TGF-beta 1 siRNA. In one aspect of this embodiment, the combination is administered intravenously to the individual. In another aspect of this embodiment, the combination is administered to the individual's tumor. In another aspect of this embodiment, the combination is administered near the tumor or systemically in a vehicle that allows delivery to the tumor.

In another further embodiment, the invention relates to a method of treating cancer in an individual by administering to the individual a therapeutically effective amount of an anti-Cox-2 siRNA with a therapeutically effective amount of an anti-TGF-beta 1 siRNA. In one aspect of this embodiment, the combination is administered intravenously to the individual. In another aspect of this embodiment, the combination is administered to the individual's tumor. In another aspect of this embodiment, the combination is administered near the tumor or systemically in a vehicle that allows delivery to the tumor.

Anti-Cox-2 siRNA molecules include the sequences shown in Table 2.

Table 2: Anti-Cox-2 miRNA sequences

hmCX-25-1: sense 5'-r(GGUCUGGUGCCUGGUCUGAUGAUGU)-3' (SEQ ID NO: 19)

antisense 5'-r(ACAUCAUCAGACCAGGCACCAGACC)-3' (SEQ ID NO: 20)

hmCX-25-2: sense 5'-r(GAGCACCAUUCUCCUUGAAAGGACU)-3' (SEQ ID NO: 21)

antisense 5'-r(AGUCCUUUCAAGGAGAAUGGUGCUC)-3' (SEQ ID NO: 22)

hmCX-25-3: sense 5'-r(CCUCAAUUCAGUCUCUCAUCUGCAA)-3' (SEQ ID NO: 23)

antisense 5'-r(UUGCAGAUGAGAGACUGAAUUGAGG)-3' (SEQ ID NO: 24)

hmCX25-4: sense, 5'-r(GAUGUUUGCAUUCUUUGCCCAGCAC)-3' (SEQ ID NO: 25)

antisense, 5'-r(GUGCUGGGCAAAGAAUGCAAACAUC)-3' (SEQ ID NO: 26)

hmCX25-5: sense, 5'-r(GUCUUUGGUCUGGUGCCUGGUCUGA)-3' (SEQ ID NO: 27)

antisense, 5'-r(UCAGACCAGGCACCAGACCAAAGAC)-3' (SEQ ID NO: 29)

hmCX25-6: sense, 5'-r(GUGCCUGGUCUGAUGAUGUAUGCCA)-3' (SEQ ID NO: 29)

antisense, 5'-r(UGGCAUACAUCAUCAGACAGGCAC)-3' (SEQ ID NO: 30)

hmCX25-7: sense, 5'-r(CACCAUUCUCCUUGAAAGGACUUAU)-3' (SEQ ID NO: 31)

antisense, 5'-r(AUAAGUCCUUUCAAGGAGAAUGGUG)-3' (SEQ ID NO: 32)

hmCX25-8: sense, 5'-r(CAAUUCAGUCUCUCAUCUGCAAUAA)-3' (SEQ ID NO: 33)

antisense, 5'-r(UUAUUGCAGAUGAGAGACUGAAUUG)-3' (SEQ ID NO: 34)

In one aspect, the anti-Cox-2 siRNA contains the following sequences: sense: 5'-ggucuggugccuggucugaugaugu-3' (SEQ ID NO: 19); antisense: 5'-acaucaucagaccaggcaccagacc-3' (SEQ ID NO: 20).

Anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA are administered in a pharmaceutically acceptable carrier. Such carriers include branched histidine-lysine polymers. In one embodiment of such polymers, the polymer has the formula (R)K(R)-K(R)-(R)K(X), where R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 17) or R=KHHHKHHHKHHHHKHHHK (SEQ ID NO : 18), X=C(O)NH ₂ , K=lysine, H=histidine and N=asparagine. Such polymers form a nanoparticle with anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA. The nanoparticle can be administered to an individual intravenously or intratumorally.

As noted above with respect to anti-TGF-beta 1 siRNA, the cancer (and cancer cells) targeted by the combination of anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA can be any cancer that an individual suffers from. Such malignancies include liver cancer, colon cancer, pancreatic cancer, lung cancer and bladder cancer. Liver cancer may be a primary liver cancer or a malignant neoplasm that has metastasized to the liver from another tissue. Primary liver cancer includes hepatocellular carcinoma and hepatoblastoma. Metastasizing malignancies include colon cancer and pancreatic cancer.

In a further embodiment, the invention relates to a method for killing malignant cells in an individual by administering to the individual a therapeutically effective amount of an immune checkpoint inhibitor with a therapeutically effective amount of an anti-TGF-beta 1 siRNA and a therapeutically effective amount of an anti-Cox-2 siRNA. The malignant cells and malignant neoplasms targeted by the method are any malignant neoplasm from which an individual suffers, including those described above. In one aspect of this embodiment, administration of an immune checkpoint inhibitor with anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA enhances the efficacy of either siRNA alone.

In another further embodiment, the invention relates to a method of treating cancer in an individual by administering to the individual a therapeutically effective amount of an immune checkpoint inhibitor with a therapeutically effective amount of an anti-TGF-beta 1 siRNA and a therapeutically effective amount of an anti-Cox-2 siRNA. The malignant cells and malignant neoplasms targeted by the method are any malignant neoplasm from which an individual suffers, including those described above. In one aspect of this embodiment, administration of an immune checkpoint inhibitor with an anti-TGF-beta 1 siRNA and an anti-Cox-2 siRNA enhances the efficacy of either siRNA alone.

As indicated above, the immune checkpoint inhibitor, anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA are administered intravenously to an individual, into an individual's tumor, near the tumor, or systemically in a vehicle that allows delivery to the tumor.

The immune checkpoint inhibitor administered with the combination of siRNA molecules is a monoclonal antibody or a small molecule as described above. It can be administered before, after or simultaneously with the combination of siRNA molecules.

The invention relates to certain pharmaceutical compositions. In one embodiment, the composition comprises an anti-TGF-beta 1 siRNA as described herein in a pharmaceutically acceptable carrier as described herein.

In another embodiment, this pharmaceutical composition is used in combination with an immune checkpoint inhibitor as described herein. Thus, this embodiment of the invention relates to a therapeutic drug combination comprising an immune checkpoint inhibitor and a pharmaceutical composition comprising anti-TGF-beta 1 siRNA in a pharmaceutically acceptable carrier as described herein.

In another embodiment, the invention relates to a therapeutic drug combination comprising an immune checkpoint inhibitor and a pharmaceutical composition comprising an anti-TGF-beta 1 siRNA, an anti-Cox-2 siRNA and a pharmaceutically acceptable carrier as described herein.

The therapeutic drug combination provided herein can also be used to enhance the antitumor efficacy of an immune checkpoint inhibitor in an individual with cancer. A therapeutically effective amount of a pharmaceutical composition comprising an anti-TGF-beta 1 siRNA and an anti-Cox-2 siRNA is administered to a subject together with a therapeutically effective amount of a checkpoint inhibitor. Anti-TGF-beta 1 siRNA reduces an individual's inflammatory response to cancer and allows T cells and other immune cells to better enter the tumor. It also results in a stronger immune response to cancer in the individual than the immune response elicited by the checkpoint inhibitor alone. This response includes higher T cell activation and their ability to invade the malignancy. An anti-Cox-2 siRNA reduces an individual's inflammatory response to a cancer and/or reduces the production of depleted T cells or regulatory T cells around the cancer.

The combination of therapeutic drugs provided herein can also be used to antigenically prime T cells to recognize and kill cancer cells in an individual and stimulate T cell immunity against cancer in an individual. The subject is administered a therapeutically effective amount of the combination. Malignant neoplasms are malignant neoplasms presented in the present description.

In one specific embodiment, the invention relates to a method of treating liver cancer in an individual by administering to the individual a therapeutically effective amount of a pharmaceutical composition of the invention or a combination of therapeutic drugs of the invention. In one aspect of this embodiment, the liver cancer is a primary liver cancer. In a specific aspect, the primary liver cancer is hepatocellular carcinoma or hepatoblastoma. In another aspect of this embodiment, liver cancer is a malignant neoplasm that has metastasized to the liver from another tissue in the individual's body. Such metastatic malignancies include colon cancer and pancreatic cancer. In one aspect of this embodiment, the individual is a human.

In another specific embodiment, the invention relates to a method of killing hepatocellular carcinoma cells in a human, comprising administering to a human a therapeutically effective amount of a pharmaceutical composition comprising an anti-TGF-beta 1 siRNA and an anti-Cox-2 siRNA in a pharmaceutically acceptable carrier containing a branched histidine-lysine polymer, forming a nanoparticle with miRNA against TGF-beta 1 and miRNA against Cox-2, where miRNA against TGF-beta 1 contains the sequences: sense: 5'-cccaagggcuaccaugccaacuucu-3' (SEQ ID NO: 3); antisense: 5'-agaaguuggcaugguagcccuuggg-3' (SEQ ID NO: 4), and anti-Cox-2 siRNA contains the sequences: sense: 5'-ggucuggugccuggucugaugaugu-3' (SEQ ID NO: 19); antisense: 5'-acaucaucagaccaggcaccagacc-3' (SEQ ID NO: 20).

In another specific embodiment, the invention relates to a method of killing hepatocellular carcinoma cells in a human, comprising administering to a human a therapeutically effective amount of an immune checkpoint inhibitor and a pharmaceutical composition comprising an anti-TGF-beta 1 siRNA and an anti-Cox-2 siRNA in a pharmaceutically acceptable carrier containing a branched a histidine-lysine polymer forming a nanoparticle with an anti-TGF-beta 1 siRNA and an anti-Cox-2 siRNA, wherein the anti-TGF-beta 1 siRNA contains the sequences: sense: 5'-cccaagggcuaccaugccaacuucu-3' (SEQ ID NO: 3); antisense: 5'-agaaguuggcaugguagcccuuggg-3' (SEQ ID NO: 5), and anti-Cox-2 siRNA contains the sequences: sense: 5'-ggucuggugccuggucugaugaugu-3' (SEQ ID NO: 19); antisense: 5'-acaucaucagaccaggcaccagacc-3' (SEQ ID NO: 20) and wherein the checkpoint inhibitor contains a monoclonal antibody that can bind to and block interactions between PD-1 and PD-L1. Such monoclonal antibodies include atezolizumab, durvalumab, nivolumab, pembrolizumab and ipilimumab.

In a further specific embodiment, the invention relates to a therapeutic drug combination comprising an immune checkpoint inhibitor and a pharmaceutical composition comprising an anti-TGF-beta 1 siRNA and an anti-Cox-2 siRNA in a pharmaceutically acceptable carrier, wherein the checkpoint inhibitor comprises a monoclonal antibody selected from of the group consisting of atezolizumab, durvalumab, nivolumab, pembrolizumab, and ipilimumab, the anti-TGF-beta 1 siRNA contains the sequences: sense: 5'-cccaagggcuaccaugccaacuucu-3' (SEQ ID NO: 3); antisense: 5'-agaaguuggcaugguagcccuuggg-3' (SEQ ID NO: 4), anti-Cox-2 miRNA contains the sequences: sense: 5'-ggucuggugccuggucugaugaugugu-3' (SEQ ID NO: 19); antisense: 5'-acaucaucagaccaggcaccagacc-3' (SEQ ID NO: 20), and the pharmaceutically acceptable carrier contains a branched histidine-lysine polymer forming a nanoparticle with anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA. In one aspect of this embodiment, the branched histidine-lysine polymer has the formula (R)K(R)-K(R)-(R)K(X), where R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 17) or KHHHKHHHKHHHHKHHHK (SEQ ID NO: 18), X=C(O)NH ₂ , K=lysine, H=histidine and N=asparagine.

Definitions

Liver cancer is any primary malignant neoplasm in the liver, i.e. arising in the liver; or any secondary malignant neoplasm in the liver, ie. a malignant neoplasm that metastasizes to the liver from another tissue in the body of a mammal. An example of primary liver cancer is hepatocellular carcinoma. An example of secondary liver cancer is colon cancer.

A malignant neoplasm is any malignant tumor.

A malignant tumor is a mass of neoplastic cells.

Treatment is killing some or all of the cancer cells, reducing the size of the cancer, inhibiting the growth of the cancer, or reducing the growth rate of the cancer in the individual.

An anti-TGF-beta 1 siRNA is an siRNA molecule that reduces or prevents the expression of a gene in a mammalian cell that encodes the synthesis of the TGF-beta 1 protein.

An anti-Cox-2 siRNA is an siRNA molecule that reduces or prevents the expression of a gene in a mammalian cell encoding the synthesis of the Cox-2 protein.

The miRNA molecule is a duplex oligonucleotide, which is a short, double-stranded polynucleotide that opposes gene expression in the cell after the molecule has been inserted into the cell. For example, it targets and binds to a complementary nucleotide sequence in a single-stranded target RNA molecule. The siRNA molecules are chemically synthesized or otherwise engineered by methods known to those skilled in the art. Such methods are described in US Pat. Nos. 5,898,031; 6,107,094; 6,506,559; As is known in the art, when an siRNA molecule is identified by a particular nucleotide sequence, the term "sequence" refers to the sense strand of the duplex molecule. One or more ribonucleotides that make up the molecule can be chemically modified by methods known in this field. In addition to modification at the level of one or more of the individual nucleotides, the oligonucleotide backbone can be modified. Additional modifications include the use of small molecules (eg, sugar molecules), amino acids, peptides, cholesterol, and other large molecules for conjugation on the siRNA molecule.

The branched histidine-lysine polymer is a peptide composed of the amino acids histidine and lysine. When many amino acids are synthesized from a common lysine core, the peptide consists of 4 chain arms or branches. Such polymers are described in US Pat. No. 7,070,807 B2 published July 4, 2006;

An immune checkpoint inhibitor is a drug that blocks certain proteins produced by certain types of cells in the immune system, such as T cells, and certain cancer cells. These checkpoint proteins help control immune responses and may keep T cells from killing malignant cells. If these checkpoint proteins are blocked, it releases the brakes on the immune system, and T cells are better able to destroy malignant cells. Examples of checkpoint proteins found on T cells or cancer cells include PD-1/PD-L1 and CTLA-4/B7-1/B7-2.

The expression "near the cancer" means "in the tissue or cells adjacent to or surrounding the tumor or tumor cell series".

The expression "increased anti-tumor efficacy" means providing a greater reduction in the growth rate of tumor cells, a greater effect of killing tumor cells and/or reducing tumor mass, and ultimately achieving a better therapeutic effect by prolonging the life of an individual with a tumor. Such effects may be mediated by direct action on the tumor cells themselves, or by an increase in T cell activity, or by a mechanism whereby T cells gain better access to tumor cells and/or are activated to stimulate a stronger immune response against the tumor with increased ability to recognize tumor cells. even with or without initial treatment.

The following examples illustrate some aspects of the invention, but should not be construed as limiting the scope of the present invention.

EXAMPLES

Experimental results

STP707 consists of 2 siRNAs (targeting the TGF-beta 1 and Cox-2 genes) protected by a delivery polypeptide nanoparticle consisting of a branched HKP (histidine-lysine polymer) polypeptide. STP707 are described in U.S. Patent No. 9,642,873 B2, published May 9, 2017, and superseding U.S. Patent No. RE46873 E, published May 29, 2018, the descriptions of which are incorporated herein by reference in their entirety.

Using a branched polypeptide nanoparticle composed of the amino acids histidine and lysine (HKP), the present inventors have shown that IV injection allows the nanoparticles to be taken up by cells in the liver with higher efficiency. Using flow cytometry to measure the uptake of fluorescently labeled siRNA from nanoparticles, the present inventors demonstrated delivery to specific cell types in the liver, including stellate cells, LSEC cells and hepatocytes, as well as Kupffer cells (FIG. 1). Thus, this allows the inventors of the present invention to assume that it is possible to achieve very good efficiencies in delivering siRNA to these liver cells and thus silencing the targets of interest in these cells.

The present inventors investigated STP707 as monotherapy and in combination with an anti-PD-L1 monoclonal antibody (mAb) (anti-PD-L1 monoclonal Ab clone 10F.9G2 from BioXcell, West Lebanon, NH 03784) in an orthotopic mouse model of hepatocellular carcinoma using bioluminescent variant of the Hepa 1-6 cell line to monitor tumor burden over time.

The present inventors used an orthotopic implant model where HCC liver cancer cells (Hepa 1-6 cells) were surgically implanted in the organ from which they were obtained (liver). A mouse liver cancer cell line was modified to express luciferase (Hepa 1-6-Lux). Then, after the administration of the substrate to the animals, the degree of tumor growth in the liver of these animals can be monitored using a luminescence detection system. This allows tumor growth to be measured in a non-invasive manner without harming the animals. The authors of the present invention monitored tumors by this method. The present inventors examined the growth rate in the absence of any treatment (control group), using the gold standard treatment for human hepatocellular carcinoma (sorafenib, a kinase inhibitor; 50 mg/kg administered by QD) and a validated mouse anti-PD-L1 antibody as shown to inhibit tumor growth in animals with orthotopic Hepa 1-6 tumors (administered with BIW at a dose of 5 mg/kg).

The present inventors also compared the effect of siRNA shown to inhibit TGF-beta and Cox-2 (STP707) delivered using HKP peptide nanoparticles (administered IV BIW at a dose of 40 μg or 20 μg per injection). The present inventors further analyzed the effect of STP707 when administered with an anti-PD-L1 antibody.

The present inventors investigated STP707 for efficacy in the treatment of HCC using a syngeneic, orthotopic mouse model of hepatocellular carcinoma using a bioluminescent variant of the Hepa 1-6 cell line to monitor tumor burden over time.

Experiments were carried out using the C57BL/6J mouse line from Charles River Labs.

Vehicle (HKP+non-silencing siRNA; control) or STP707 was administered intravenously (iv).

8 animals were randomly assigned to each treatment group. The treatment groups were as follows:

1. Carrier only

2. Sorafenib (50 mg/kg) p.o., QD

3. Anti-PD-L1 antibody (5 mg/kg), i.p., BIW

4. Anti-PD-L1 antibody (5mg/kg), i.p., BIW+20µg STP707/BIW IV injection

5. Anti-PD-L1 antibody (5mg/kg), i.p., BIW+40µg STP707/BIW IV injection

6. 40 µg STP707/IV BIW Injection alone

Animals were randomized at the start of the experiment based on body weight. Randomization provided a very similar weight distribution among the selected animals in each group, as shown in FIG. 2.

The body weight of the animals was measured daily during the administration phase of the efficacy study. Built a graph of the average body weights of each group (figure 3). Sorafenib alone induced little change in body weight. However, all other treatment regimens (STP707 alone or +vs PD-L1) were well tolerated and no significant weight loss was observed in the treatment groups.

Tumor growth was monitored by bioluminescent imaging and tumor-associated bioluminescence (TABL) quantification. A TABL chart was built by day of the study, shown in Figure 4.

After completion of the planned administration phase, tumor growth was monitored in groups 2-6. No tumor re-growth was observed before the last day of the study (Day 50), suggesting that the treatment was very effective in inhibiting tumor growth and preventing re-growth, suggesting a significant effect on tumor viability.

The effect of the combined treatment methods was further confirmed in a survival analysis (using human surrogate endpoints) of all mice in the study (Figure 5). The human endpoint for termination of the study was defined as tumors reaching the maximum allowed size or tumors showing undesirable clinical signs. All treatment regimens resulted in statistically significantly improved survival as evidenced by the log-rank test (Mantel-Cox) (p=0.0001) and Gehan-Breslow-Wilcoxon test (p=0.0002). No significant differences in survival among treatment groups were observed.

To validate the results obtained, the authors of the present invention repeated the study using a lower dose of STP707 (1 mg/kg) (Fig. 6).

The data obtained confirm the observation that STP707 exhibits a monotherapeutic effect against the tumor - a decrease in growth relative to the control (untreated) cohort. The STP707 group showed better efficacy than the antibody (PD-L1) group alone.

In this study, STP707 showed monotherapeutic activity, exceeding the activity of antibodies against PD-L1 alone. However, combining STP707 with the antibody reduced the tumor to undetectable levels after 4 doses.

Because did not observe tumors in any of the treatment groups using STP707, the authors of the present invention repeated the study, but using only 3 doses of STP707 1 mg/kg. After the third dose, the animals were sacrificed, the liver was removed, sectioned and stained for CD4 ⁺ and CD8 ⁺ T cells by immunohistochemistry.

Even in these reduced dose studies, we observed a significant difference between untreated (control) samples and STP707 treated samples in terms of overall tumor size. In untreated animals, the tumor almost completely matched the size of the liver, while in samples from the STP707 groups, the tumors were significantly reduced (Fig. 7).

In addition, IHC staining for CD4 ⁺ and CD8 ⁺ T cells showed a significant increase in these tumor invading T cells in samples from the STP707 treated groups (Fig. 7 and Fig. 8).

Image analysis was performed to quantify CD4 ⁺ and CD8 ⁺ T cells at the border between the tumor and the liver, shown by colored lines on tumor samples. These lines were drawn at a distance of 50 μm from the border of the tumor - in the direction of the tumor or outward, from the tumor, but towards the liver. All CD8 ⁺ T cells in each 50 μm segment were counted by image analysis and the data plotted as shown in Figure 8.

The introduction of STP707 together with Ab against PD-L1 demonstrated a 2-fold increase in CD8 ⁺ T cells at a distance of 500 μm in the tumor. It also demonstrated an increase in CD8 ⁺ T cells in the liver of the tumor, suggesting possible T cell recruitment induced by a decrease in the TGF-beta "wall" surrounding the tumor.

conclusions

The primary objective of this study was to determine the tolerability and efficacy of STP707 (HKP polypeptide nanoparticles containing anti-TGF-beta 1 and Cox-2 siRNA) as monotherapy and in combination with an anti-PD-L1 antibody in an orthotopic mouse model of hepatocellular carcinoma using a bioluminescent variant. cell lines Hepa 1-6.

All treatment regimens were well tolerated at the doses and formulations tested; no adverse clinical signs or weight loss were observed in any of the treatment groups.

All treatment regimens resulted in a statistically significant reduction in tumor growth compared to controls. However, STP707 monotherapy (2 mg/kg) resulted in a reduction in tumor growth, which was also observed when combined with an anti-PD-L1 Ab. Reducing the dose of STP707 to 1 mg/kg resulted in a lower effect of STP707 alone, but in this case its additivity with Ab against PD-L1 becomes more evident.

The combination of anti-PD-L1 antibody 5 mg/kg and STP705 (20 µg per injection (1 mg/kg)) appeared to be more effective than STP705 alone, which is more effective than anti-PD-L1 antibody 5 mg/kg .

Other results indicated that STP707 enhanced the effect of the anti-PD-L1 antibody resulting in a significant decrease in tumor viability without tumor cell return even after 2+ weeks of administration was discontinued. The fact that the present inventors have demonstrated delivery to the liver using this IV formulation leads the present inventors to believe that it is possible to treat liver tumors using this treatment regimen. This would include any tumors naturally occurring in the liver (hepatoblastoma or hepatocellular carcinoma (HCC)) or tumors that metastasize to the liver (eg colon cancer).

In addition, in previous studies, the authors of the present invention have shown the possibility of reducing the expression of these 2 target genes, if the product is administered by injection (eg intradermally). This allows the authors of the present invention to assume that the same therapeutic benefit from the stimulation of the immune response in tumors, when the product is administered by injection near the tumor. This can be used for skin cancers (eg, non-melanoma skin cancers or melanoma skin tumors) or in tumors in other organs, where the material can be injected close to the tumor site to stimulate the same effect.

LINKS

[1] Liu et al., Cancer Cell Int (2015) 15:106-112 "Cyclooxygenase-2 promotes tumor growth and suppresses tumor immunity"

[2] Zelenay et al., Cell (2015) 162: 1257-1270 "Cyclooxygenase-Dependent Tumor Growth through Evasion of Immunity"

[3] Mariathasan et al., Nature (2018) 554; 544-548 "TGFβ attenuates tumor response to PD-L1blockade by contributing to exclusion of T cells"

All publications referred to in this specification, including issued patents and published patent applications, and all database entries identified with URLs or registration numbers, are incorporated herein by reference in their entirety.

While the present invention has been described with respect to certain embodiments and many of the details are for illustrative purposes, those skilled in the art will appreciate that further embodiments of the invention are possible and that some of the details provided herein may vary without deviating from the basic principles of the invention.

--->

SEQUENCE LIST

<110> SIPHKOMICS, INC.

<120> SILENSING TGF-BETA 1 AND COX-2 USING MIRNA DELIVERED TO

POLYPEPTIDE NANOPARTICLE, SINGLE AND IN COMBINATION WITH INHIBITORS

IMMUNE CHECKPOINTS FOR THE TREATMENT OF MALIGNANT NEOPLASMS

<130> 4690.0016I

<140> PCT/US2019/068499

<141> 2019-12-24

<150> 62/785.647

<151> 2018-12-27

<160> 34

<170>PatentIn version 3.5

<210> 1

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 1

ggauccacga gcccaagggc uacca 25

<210> 2

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 2

ugguagcccu ugggcucgug gaucc 25

<210> 3

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 3

cccaagggcu accaugccaa cuucu 25

<210> 4

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 4

agaaguuggc augguagccc uuggg 25

<210> 5

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 5

gagcccaagg gcuaccaugc caacu 25

<210> 6

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 6

aguuggcaug guagcccuug ggcuc 25

<210> 7

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 7

gauccacgag cccaagggcu accau 25

<210> 8

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 8

augguagccc uugggcucgu ggauc 25

<210> 9

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 9

cacgagcca agggcuacca ugcca 25

<210> 10

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 10

uggcauggua gcccuugggc ucgug 25

<210> 11

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 11

gaggucaccc gcgugcuaau ggugg 25

<210> 12

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 12

ccaccauuag cacgcggggug accuc 25

<210> 13

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 13

guacaacagc acccgcgacc gggug 25

<210> 14

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 14

cacccggucg cgggugcugu uguac 25

<210> 15

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 15

guggauccac gagcccaagg gcuac 25

<210> 16

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 16

guagcccuug ggcucgugga uccac 25

<210> 17

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic peptide

<400> 17

Lys His His His Lys His His His Lys His His His Lys His His His

1 5 10 15

Lys

<210> 18

<211> 18

<212> Protein

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic peptide

<400> 18

Lys His His His Lys His His His Lys His His His His Lys His His

1 5 10 15

His Lys

<210> 19

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 19

ggucggugc cuggucugau gaugu 25

<210> 20

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 20

acaucaucag accaggcacc agacc 25

<210> 21

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 21

gagcaccauu cuccuugaaa ggacu 25

<210> 22

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 22

agguccuuuca aggagaaugg ugcuc 25

<210> 23

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 23

ccucaauuca gucucucauc ugcaa 25

<210> 24

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 24

uugcagauga gagacugaau ugagg 25

<210> 25

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 25

gauguuugca uucuuugccc agcac 25

<210> 26

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 26

gugcugggca aagaaugcaa acauc 25

<210> 27

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 27

gucuuugguc uggugccugg ucuga 25

<210> 28

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 28

ucagaccagg caccagacca aagac 25

<210> 29

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 29

gugccugguc ugaugaugua ugcca 25

<210> 30

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 30

uggcauacau caucagacca ggcac 25

<210> 31

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 31

caccauucuc cuugaaagga cuuau 25

<210> 32

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 32

auaaguccuu ucaaggagaa uggug 25

<210> 33

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 33

caauucaguc ucucaucugc aauaa 25

<210> 34

<211> 25

<212> RNA

<213> Artificial sequence

<220>

<223> Artificial sequence description: synthetic oligonucleotide

<400> 34

uuauugcaga ugagagacug aauug 25

<---

Claims (28)

1. A method of killing malignant cells in an individual, comprising administering to the individual a therapeutically effective amount of a combination of anti-TGF-beta 1 siRNA and anti-Cox-2 siRNA, wherein the combination is administered together with an immune checkpoint inhibitor to treat cancer. 2. The method of claim. 1, where the combination is administered intravenously to the individual. 3. The method of claim 1, wherein the cancerous cells constitute the cancerous tumor and the combination is administered in or near the tumor. 4. The method according to any one of paragraphs. 1-3, where the malignancy includes liver cancer. 5. The method of claim 4 wherein the liver cancer includes primary liver cancer. 6. The method of claim 5 wherein the primary liver cancer comprises hepatic cell carcinoma or hepatoblastoma. 7. The method of claim 4, wherein the cancer has metastasized to the liver from another tissue in the individual's body. 8. The method of claim 7 wherein the metastatic cancer comprises colon cancer. 9. The method according to any one of paragraphs. 1-8, wherein the anti-TGF-beta 1 siRNA is selected from the group consisting of SEQ ID NOs: 1-16. 10. The method according to any one of paragraphs. 1-9, where the miRNA against TGF-beta 1 contains the sequences: sense: 5'-cccaagggcuaccaugccaacuucu-3' (SEQ ID NO: 3); antisense: 5'-agaaguuggcaugguagcccuuggg-3' (SEQ ID NO: 4). 11. The method according to any one of paragraphs. 1-10 wherein the combination is administered in a pharmaceutically acceptable carrier. 12. The method of claim 11 wherein the pharmaceutically acceptable carrier comprises a branched histidine-lysine polymer. 13. The method of claim 12, wherein the branched histidine-lysine polymer forms a combination nanoparticle. 14. The method according to claim 12 or 13, where the branched histidine-lysine polymer has the formula (R)K(R)-K(R)-(R)K(X), where R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 17) or R=KHHHKHHHKHHHHKHHHK (SEQ ID NO: 18), X=C(O)NH ₂ , K=lysine, H=histidine. 15. The method of claim 13 or 14, wherein the nanoparticle is administered intravenously to the individual. 16. The method according to any one of paragraphs. 1-12, wherein the anti-Cox-2 siRNA is selected from the group consisting of SEQ ID NOs: 19-24. 17. The method according to p. 16, where miRNA against Cox-2 contains the sequence: sense: 5'-ggucuggugccuggucugaugaugu-3' (SEQ ID NO: 19); antisense: 5'-acaucaucagaccaggcaccagacc-3' (SEQ ID NO: 20). 18. The method of claim 17 wherein the branched histidine-lysine polymer forms a combination nanoparticle. 19. The method according to claim 17 or 18, where the branched histidine-lysine polymer has the formula (R)K(R)-K(R)-(R)K(X), where R=KHHHKHHHKHHHKHHHK (SEQ ID NO: 17) or R=KHHHKHHHKHHHHKHHHK (SEQ ID NO: 18), X=C(O)NH2, K=lysine, H=histidine. 20. The method of claim 18 or 19, wherein the nanoparticle is administered intravenously to the individual. 21. The method according to any one of paragraphs. 1-20, wherein the immune checkpoint inhibitor comprises a monoclonal antibody. 22. The method of claim 21 wherein the monoclonal antibody blocks the interaction between receptors on the individual's cell selected from the group consisting of PD-1, PD-L1, CTLA4, Lag3 and Tim3 and ligands of these receptors. 23. The method of claim 21 wherein the monoclonal antibody is an anti-PD1 or PDL1 monoclonal antibody. 24. The method of claim 21 wherein the monoclonal antibody is selected from the group consisting of atezolizumab, durvalumab, nivolumab, pembrolizumab, and ipilimumab. 25. The method according to any one of paragraphs. 1-24, where the immune checkpoint inhibitor comprises a small molecule compound. 26. The method of claim 25, wherein the small molecular weight compound blocks the interaction between receptors on the individual's cell selected from the group consisting of PD-1, PD-L1, CTLA4, Lag3 and Tim3 and ligands of these receptors. 27. The method of claim 25 wherein the low molecular weight compound blocks binding between PD1 and PDL1. 28. The method of claim 25 wherein the low molecular weight compound is BMS202.

Images