RU2796949C2 - Non-human animals containing the humanized asgr1 locus - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to a non-human animal containing a genetically modified endogenous Asgr1 locus that contains an endogenous Asgr1 promoter, wherein the non-human animal is a rodent and the endogenous Asgr1 promoter is operably linked to a nucleic acid encoding modified Asgr1 protein, modified Asgr1 protein contains a cytoplasmic domain, a transmembrane domain and an extracellular domain, the extracellular domain contains a supercoiled domain.

EFFECT: invention is effective for evaluating delivery of a therapeutic complex to the liver via human ASGR1-mediated internalization in vivo, as well as for evaluating the effectiveness of a therapeutic molecule for protein targeting in relation to liver internalization via human ASGR1 in vivo.

31 cl, 9 dwg, 4 tbl, 4 ex

Description

[0001] The sequence listing recorded in file 10362WO01_ST25.txt has a size of 50 kilobytes, was created on June 26, 2018, and is incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002] The treatment of many diseases is not effective enough due to poor targeting of therapeutic molecules to the appropriate tissue or organ. Delivery of biologically active agents is often limited due to difficulties in getting the components to reach the target cell or tissue.

[0003] Cell-type-specific internalization effectors, such as cell-type-specific receptors, e.g., human ASGR1, that are indirectly or directly internalized by a target cell, can be used to facilitate and improve the delivery of therapeutic molecules to specific target cells in vivo. Similarly, such cell type-specific internalization effectors can be used therapeutically to facilitate the internalization of a cell surface target receptor or soluble target proteins in vivo. However, there remains a need for suitable models to evaluate the effectiveness of such delivery mechanisms and therapeutic mechanisms in vivo.

SHORT DESCRIPTION

[0004] Non-human animals comprising a humanized Asgr1 locus and expressing a humanized or chimeric ASGR1 protein at the humanized Asgr1 locus are provided, as well as methods for using such non-human animals (e.g., a rodent, e.g., rat or mouse), cells and /or tissues derived from such non-human animals, and nucleotides (eg, targeting vectors, genomes, etc.) useful for making such animals.

[0005] In one aspect, non-human animals are provided comprising a genetically modified endogenous Asgr1 locus encoding a modified Asgr1 protein, wherein the modified Asgr1 protein comprises a cytoplasmic domain, a transmembrane domain, and an extracellular domain, and all or part of the extracellular domain is encoded by a segment an endogenous Asgr1 locus that has been deleted and replaced with an orthologous human ASGR1 sequence. In some of these non-human animals, the extracellular domain contains a supercoiled domain and a C-type lectin domain, and all or part of the C-type lectin domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced by an orthologous human ASGR1 sequence. Optionally, the C-type lectin domain is the C-type lectin domain of human ASGR1. Optionally, the C-type lectin domain contains the sequence set forth under SEQ ID NO: 28.

[0006] In some of these animals, the extracellular domain contains a supercoiled domain and a C-type lectin domain, and all or part of the supercoiled domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced with an orthologous human ASGR1 sequence. Optionally, the supercoiled domain is the human ASGR1 supercoiled domain. Optionally, the supercoiled domain contains the sequence set forth under SEQ ID NO: 27.

[0007] In some such animals, either the entire supercoil domain or the entire C-type lectin domain, or part of both, is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced by an orthologous human ASGR1 sequence. Optionally, the C-type lectin domain is a human ASGR1 C-type lectin domain, and the supercoiled domain is a human ASGR1 supercoiled domain. Optionally, the C-type lectin domain contains the sequence set forth in SEQ ID NO: 28 and the supercoiled domain contains the sequence set forth in SEQ ID NO: 27.

[0008] In some of these animals, the orthologous human ASGR1 sequence contains exons 3-8 of the human ASGR1 gene. Optionally, the orthologous human ASGR1 sequence encodes an ASGR1 protein segment containing the sequence set forth under SEQ ID NO: 31.

[0009] In some of these animals, all or part of the cytoplasmic domain is encoded by the endogenous Asgr1 sequence of the non-human animal. In some of these animals, all or part of the transmembrane domain is encoded by the endogenous Asgr1 sequence of the non-human animal. Optionally, all of the cytoplasmic domain and all of the transmembrane domain, or part of both, are encoded by the endogenous Asgr1 sequence of the non-human animal.

[0010] In another aspect, non-human animal cells or tissues (e.g., hepatocytes, embryonic stem (ES) cells, or other non-human pluripotent cells, such as germline cells) containing a humanized Asgr1 locus are provided, and compositions in vitro containing them. In one aspect, non-human animal cells are provided comprising a genetically modified endogenous Asgr1 locus encoding a modified Asgr1 protein, wherein the modified Asgr1 protein comprises a cytoplasmic domain, a transmembrane domain, and an extracellular domain, and all or part of the extracellular domain is encoded by a segment of the endogenous locus. Asgr1 that was deleted and replaced with an orthologous human ASGR1 sequence. In some of these non-human animal cells, the extracellular domain contains a supercoiled domain and a C-type lectin domain, and all or part of the C-type lectin domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced by an orthologous human ASGR1 sequence. Optionally, the C-type lectin domain is the C-type lectin domain of human ASGR1. Optionally, the C-type lectin domain contains the sequence set forth under SEQ ID NO: 28.

[0011] In some of these non-human animal cells, the extracellular domain contains a supercoiled domain and a C-type lectin domain, and all or part of the supercoiled domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced with an orthologous human ASGR1 sequence. Optionally, the supercoiled domain is the human ASGR1 supercoiled domain. Optionally, the supercoiled domain contains the sequence set forth under SEQ ID NO: 27.

[0012] In some of these non-human animal cells, both the entire supercoil domain and all of the C-type lectin domain, or part of both, are encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced with an orthologous human ASGR1 sequence. Optionally, the C-type lectin domain is the C-type lectin domain of human ASGR1 and the supercoiled domain is the human ASGR1 supercoiled domain. SEQ ID NO: 27.

[0013] In some of these non-human animal cells, the orthologous human ASGR1 sequence contains exons 3-8 of the human ASGR1 gene. Optionally, the orthologous human ASGR1 sequence encodes an ASGR1 protein segment containing the sequence set forth under SEQ ID NO: 31.

[0014] In some of these non-human cells, all or part of the cytoplasmic domain is encoded by the endogenous non-human Asgr1 sequence. In some of these animal cells, all or part of the transmembrane domain is encoded by the endogenous non-human Asgr1 sequence. Optionally, all of the cytoplasmic domain and all of the transmembrane domain, or part of both, are encoded by the endogenous Asgr1 sequence of the non-human animal.

[0015] Some such animals and/or animal cells are heterozygous for the genetically modified endogenous Asgr1 locus. Some such animals and/or animal cells are homozygous for the genetically modified endogenous Asgr1 locus.

[0016] Some such non-human animals and/or non-human animal cells are mammalian and/or mammalian cells. Optionally, the mammal is a rodent. Optionally, the rodent is a rat or mouse. Optionally, the rodent is a mouse. Optionally, all or part of the cytoplasmic domain is encoded by the endogenous mouse Asgr1 sequence. Optionally, the cytoplasmic domain contains the sequence set forth under SEQ ID NO: 29. Optionally, all or part of the transmembrane domain is encoded by the endogenous mouse Asgr1 sequence. Optionally, the transmembrane domain contains the sequence set forth under SEQ ID NO: 30. Optionally, all of the cytoplasmic domain and all of the transmembrane domain, or part of both, are encoded by endogenous mouse Asgr1 sequence. Optionally, the cytoplasmic domain contains the sequence set forth under SEQ ID NO: 29, and the transmembrane domain contains the sequence set forth under SEQ ID NO: 30. Optionally, the extracellular domain contains a supercoiled domain and a C-type lectin domain, and where both the entire supercoiled domain and the entire C-type lectin domain, or part of both, is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced by the orthologous human ASGR1 sequence, while both the entire cytoplasmic domain and the entire transmembrane domain, or part of both, are encoded by the endogenous sequence mouse asgr1. Optionally, the C-type lectin domain is the C-type lectin domain of human ASGR1 and the supercoil domain is the human ASGR1 supercoil domain, the cytoplasmic domain is the mouse Asgr1 cytoplasmic domain, and the transmembrane domain is the mouse Asgr1 transmembrane domain. Optionally, the C-type lectin domain contains the sequence set forth in SEQ ID NO: 28, the supercoiled domain contains the sequence set forth in SEQ ID NO: 27, the cytoplasmic domain contains the sequence set forth in SEQ ID NO: 29, and the transmembrane domain contains the sequence set forth in SEQ ID NO: 29 under SEQ ID NO: 30. Optionally, the modified Asgr1 protein contains the sequence set forth under SEQ ID NO: 3.

[0017] In another aspect, methods are provided for assessing liver delivery of a therapeutic complex via human ASGR1-mediated internalization in vivo. Some such methods include: (a) administering the therapeutic complex to any of the above non-human animals, wherein the therapeutic complex comprises the therapeutic molecule and an antigen binding protein or ligand that specifically binds human ASGR1; and (b) evaluating delivery of the therapeutic molecule to the liver of a non-human animal. Optionally, the therapeutic molecule is a lysosomal replacement protein or an enzyme or nucleic acid encoding a lysosomal replacement protein or enzyme, and step (b) involves assessing the presence or activity of the lysosomal replacement protein or enzyme in the liver of a non-human animal. Optionally, the therapeutic molecule is a nucleic acid encoding a therapeutic secreted protein, and step (b) involves assessing serum levels or activity of the therapeutic secreted protein in a non-human animal.

[0018] In another aspect, methods are provided for evaluating the efficacy of a therapeutic molecule targeting a liver cell surface protein or a soluble protein in the liver for internalization by human ASGR1 in vivo. Some such methods include: (a) administering the therapeutic molecule to any of the above non-human animals, wherein the therapeutic molecule comprises a bispecific antigen-binding protein that specifically binds a liver cell surface protein or soluble protein and specifically binds human ASGR1; and (b) assessing the cell surface levels or activity of a liver cell surface protein in the liver of a non-human animal, or assessing the expression or activity of a soluble protein in the liver of a non-human animal.

[0019] In another aspect, nucleic acids, e.g., targeting vectors, are provided to generate a humanized Asgr1 locus as described herein, an endogenous Asgr1 locus of a non-human animal expressing a humanized or chimeric ASGR1 protein, and/or a genome a non-human animal containing the human Asgr1 locus described herein. Some such nucleic acids contain a sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, and combinations thereof. Some such nucleic acids contain a sequence that encodes the amino acid sequence set forth under SEQ ID NO: 3, for example, contain the sequence set forth under SEQ ID NO: 24.

BRIEF DESCRIPTION OF GRAPHICS

[0020] The file with the patent or application contains at least one graphic material, made in color. Copies of this patent or the publication of the patent application with color(s) of graphic(s) material(s) will be made available to the Office upon request and upon payment of the required fee.

[0021] Figure 1A shows a schematic representation of the human ASGR1 locus. The eight exons are indicated by black boxes, the untranslated regions (UTRs) are indicated by white boxes, and the transmembrane, supercoiled, and C-type lectin domains are indicated at the top of the figure. Asterisks indicate the locations of the 5' primer (7302hTU) and 3' primer (7302hTD) for allele acquisition analysis. The fragment to be included in the mouse Asgr1 locus to allow for humanization is shown below.

[0022] Figure 1B shows a schematic representation of the mouse Asgr1 locus. The eight exons are indicated by black boxes, the UTRs are indicated by white boxes, and the transmembrane, supercoiled, and C-type lectin domains are indicated at the top of the figure. Asterisks indicate the locations of the 3' primer (7302mTU) and 3' primer (7302mTD) for allele loss analysis. The fragment to be deleted and replaced with the corresponding fragment from the human ASGR1 locus is shown below.

[0023] Figure 2A shows a schematic of a large targeting vector for generating a humanized Asgr1 allele (allele 7302) containing a self-removing cassette containing a hygromycin resistance gene. Mouse exons are indicated by gray boxes, human exons are indicated by black boxes, and UTRs are indicated by white boxes. The boundaries between the different sites (mouse/human, human/cassette, and cassette/mouse) are indicated by lines, respectively labeled A, B, and C, at the bottom of the figure.

[0024] Figure 2B shows a schematic representation of the cassette-deleted humanized Asgr1 allele variant in Figure 2A. Mouse exons are indicated by gray boxes, human exons are indicated by black boxes, and UTRs are indicated by white boxes. The boundaries between the different sites (5'-mouse/human interface, 3'-human/mouse interface) are indicated by lines, respectively labeled A, D, at the bottom of the figure.

[0025] Figure 3 shows the alignment of human ASGR1 protein (hASGR1; SEQ ID NO: 1), mouse Asgr1 protein (mAsgr1; SEQ ID NO: 2), and humanized mouse Asgr1 protein (7302 humln; SEQ ID NO: 3). The underlined residues are those that are encoded by the introduced human exons. The framed residues constitute the transmembrane domain. The dotted line indicates the C-type lectin domain. The solid thick line denotes the supercoiled region.

[0026] Figure 4 shows that Asgr1 humanized mice (Asgr1 ^hu/hu ) have plasma lipid profiles (including total cholesterol, triglycerides, LDL-C and HDL-C) similar to those of their wild-type littermates (Asgr1 ^+/+ ).

[0027] Figure 5 shows that Asgr1 humanized mice (Asgr1 ^hu/hu ) have body weight and blood glucose levels similar to those of their wild-type littermates.

[0028] Figure 6 shows that humanized Asgr1 protein from Asgr1 humanized mice (Asgr1 ^hu/hu ) co-localizes in liver cell membranes similar to mouse Asgr1. Transferrin receptor (TRFR) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as loading controls for membrane and cytosolic liver fractions, respectively. Shown N=4 per group.

[0029] Figure 7 shows the alignment of human ASGR1 protein (SEQ ID NO: 1), Macaca fascicularis (cynomolgus macaque) (SEQ ID NO: 39), mouse Asgr1 protein (SEQ ID NO: 2), and rat Asgr1 protein (SEQ ID NO: 41). The underlined residues are those that are encoded by the introduced human exons. There is 97.6% sequence identity between human and cynomolgus ASGR1 proteins (98.3% sequence identity in the extracellular domain), 77% sequence identity between human and mouse ASGR1 proteins, and 78.4% sequence identity between human and rat ASGR1 proteins.

[0030] Figures 8A - 8C are immunofluorescence microscopy images of liver (A), spleen (B), or kidney (C) samples taken from C57BL/6 mice transgenically modified to express human ASGR1 by liver cells ( i-iv), or wild-type C57BL/6 mice (v-viii) ten days after intravenous administration of 1×10 ¹¹ wild-type scAAV2-CMV-eGFP (i, v), saline (ii, vi), 1× 10 ¹¹ scAAV2-N587myc-CMV-eGFP viral vectors alone (iii, vii) or scAAV2-N587myc-CMV-eGFP viral vectors with a bispecific anti-myc-ASGR1 antibody (iv, viii).

[0031] Figures 9A - 9R are immunofluorescence microscopy images of liver samples taken from C57BL/6 mice transgenically modified to express human ASGR1 in liver cells (Figure 9D - 9F, 9J - 9L, 9P - 9R) , or wild-type C57BL/6 mice (Figures 9A-9C, 9G-9I, 9M-90) four weeks after intravenous administration of wild-type 2.18×10 ¹¹ ssAAV2-CAGG-eGFP (Figures 9B, 9C, 9E, 9F ), saline (Figures 9A, 9D), 2.18×10 ¹¹ ssAAV2-N587myc-CAGG-eGFP viral vectors alone (Figures 9G-9I, 9J-9L) or ssAAV2-N587myc-CAGG-eGFP viral vectors with a bispecific antibody to myc-ASGR1 (Figures 9M - 90, 9P - 9R). Each image represents one mouse.

DEFINITIONS

[0032] The terms "protein", "polypeptide" and "peptide", used interchangeably herein, include polymeric forms of amino acids of any length, including encoded and non-encoded amino acids and chemically or biochemically modified or derivatized amino acids. The terms also include polymers that have been modified, such as polypeptides containing modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide having a particular function or structure.

[0033] Proteins are considered to have an "N-terminus" and a "C-terminus". The term "N-terminus" refers to the beginning of a protein or polypeptide ending in an amino acid with a free amino group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (of a protein or polypeptide) ending in a free carboxyl group (-COOH).

[0034] The terms "nucleic acid" and "polynucleotide", used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified variants thereof. These include single-, double-, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers containing purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases.

[0035] Nucleic acids are considered to have "5'-ends" and "3'-ends" because mononucleotides react to form oligonucleotides such that the 5'-phosphate of the pentose ring of one mononucleotide is attached to the 3'-oxygen its neighbor in one direction through a phosphodiester bond. The end of an oligonucleotide is called the "5' end" if its 5' phosphate is not bonded to the 3' oxygen of the pentose ring of the mononucleotide. The end of an oligonucleotide is called the "3' end" if its 3' oxygen is not bonded to the 5' phosphate of the pentose ring of another mononucleotide. It can also be said that a nucleic acid sequence, even if it is within a larger oligonucleotide, has 5' and 3' ends. In a linear or circular DNA molecule, discrete elements are referred to as "upstream" or in the 5' direction relative to "downstream" elements or elements in the 3' direction.

[0036] The term "genomically integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence is integrated into the cell's genome and is capable of being inherited by its offspring. Any protocol can be used to stably incorporate a nucleic acid into a cell's genome.

[0037] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced by homologous recombination, non-homologous end joining mediated ligation, or any other method of recombination to a target location in a cell's genome.

[0038] The term "viral vector" refers to a recombinant nucleic acid that includes at least one element of viral origin and includes elements sufficient to package or allow packaging into a viral vector particle. The vector and/or particle can be used to transfer DNA, RNA or other nucleic acids into cells ex vivo or in vivo. Numerous forms of viral vectors are known.

[0039] The term "wild type" includes objects having the structure and/or activity found in the normal state (as opposed to mutated, damaged, altered, etc.) or environment. Wild-type genes and polypeptides often exist in several different forms (eg, alleles).

[0040] The term "endogenous" refers to a nucleic acid sequence that occurs naturally within a non-human cell or animal. For example, an endogenous non-human Asgr1 sequence refers to a native Asgr1 sequence that occurs naturally at the Asgr1 locus of a non-human animal.

[0041] "Exogenous" molecules or sequences include molecules or sequences that are not normally present in the cell in such form. Presence in the normal state includes the presence of a relatively certain developmental stage and environmental conditions of the cell. For example, an exogenous molecule or sequence may include a mutant variant of the corresponding endogenous sequence in the cell, such as a humanized variant of the endogenous sequence, or may include a sequence corresponding to the endogenous sequence in the cell, but in a different form (i.e., not on a chromosome). Conversely, endogenous molecules or sequences include molecules or sequences that are normally present in such form in a particular cell at a particular developmental stage under certain environmental conditions.

[0042] The term "heterologous" when used in the context of a nucleic acid or protein indicates that the nucleic acid or protein contains at least two parts that do not naturally occur together in the same molecule. For example, the term "heterologous" when used with respect to parts of a nucleic acid or parts of a protein indicates that the nucleic acid or protein contains two or more subsequences that do not naturally occur in the same ratio to each other (eg, combined together). As one example, a "heterologous" region of a nucleic acid vector is a segment of a nucleic acid within or attached to another nucleic acid molecule that does not naturally occur in association with another molecule. For example, a heterologous region of a nucleic acid vector may include a coding sequence flanked by sequences that do not naturally occur in association with the coding sequence. Similarly, a "heterologous" region of a protein is a segment of amino acids within or attached to another peptide molecule that does not naturally occur in association with another peptide molecule (eg, a fusion protein or a tagged protein). Similarly, a nucleic acid or protein may contain a heterologous tag or a heterologous secretion or localization sequence.

[0043] "Codon optimization" takes advantage of codon degeneracy, which manifests itself in the multiplicity of combinations of three base pair codons that define an amino acid, and typically involves the process of modifying a nucleic acid sequence to improve expression in certain host cells by substitution at at least one native sequence codon by a codon that is more frequently or most frequently involved in the genes of a given host cell, while retaining the native amino acid sequence. For example, a nucleic acid encoding a Cas9 protein can be modified to change codons to codons that have a higher frequency of use in a given prokaryotic or eukaryotic cell, including a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, or any other host cell, compared to a naturally occurring nucleic acid sequence. Codon usage lists are publicly available, for example in the Codon Usage Database). These tables can be adapted in a number of ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292, incorporated herein by reference in its entirety for all purposes. Also available are computer algorithms for optimizing codons of a particular sequence for expression in a particular host, see, for example, Gene Forge.

[0044] The term "locus" refers to a specific location of a gene (or sequence of interest), a DNA sequence, a polypeptide coding sequence, or a position on a chromosome of an organism's genome. For example, an "Asgr1 locus" may refer to a specific location of an Asgr1 gene, an Asgr1 DNA sequence, an Asgr1 coding sequence, or an Asgr1 position on a chromosome of an organism's genome that has been identified as such a position at which such a sequence is located. An "Asgr1 locus" may contain a regulatory element of the Asgr1 gene, including, for example, an enhancer, a promoter, a 5' and/or 3' untranslated region (UTR), or a combination thereof.

[0045] The term "gene" refers to a DNA sequence on a chromosome that encodes a product (e.g., an RNA product and/or a polypeptide product) and includes a coding region interrupted by non-coding introns and a sequence located adjacent to the coding region as 5'- end, and at the 3'-end, so that the gene corresponds to full-length mRNA (including 5'- and 3'-untranslated sequences). The term "gene" also includes other non-coding sequences, including regulatory sequences (eg, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulator sequences, and matrix attachment sites. These sequences may be located close to the coding region of the gene (eg, within 10 kb) or at distant sites, and they affect the level or rate of transcription and translation of the gene.

[0046] The term "allele" refers to a variant form of a gene. Some genes have many different forms that are located in the same position or genetic locus on a chromosome. A diploid organism has two alleles at each genetic locus. Each pair of alleles represents the genotype of a particular genetic locus. Genotypes are described as homozygous if a particular locus contains two identical alleles, and as heterozygous if the two alleles are different.

[0047] A "promoter" is a DNA regulatory region, typically containing a TATA box, capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular polynucleotide sequence. The promoter may additionally contain other regions that affect the rate of transcription initiation. The promoter sequences described herein modulate the transcription of an operably linked polynucleotide. A promoter may be active in one or more of the cell types disclosed herein (e.g., eukaryotic cell, non-human mammalian cell, human cell, rodent cell, pluripotent cell, single cell stage embryo, differentiated cell, or combinations thereof). The promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally limited promoter (eg, a developmental promoter), or a spatially limited promoter (eg, a cell-specific or tissue-specific promoter). Examples of promoters can be found, for example, in WO 2013/176772, incorporated herein by reference in its entirety for all purposes.

[0048] The terms "operably linked" or "operably linked" include matching two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow for the possibility that at least one of the components may mediate a function that affects at least one of the other components. For example, a promoter may be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A functional linkage may include those sequences that are contiguous to each other or are active in trans (eg, a regulatory sequence may act at a distance to control transcription of a coding sequence).

[0049] The term "variant" refers to a nucleotide sequence that is different from the sequence most common in the population (eg, one nucleotide), or a protein sequence that is different from the sequence most common in the population (eg, one amino acid).

[0050] The term "fragment" in relation to a protein means a protein that is shorter or contains fewer amino acids than a full-length protein. The term "fragment" when applied to a nucleic acid means a nucleic acid that is shorter or contains fewer nucleotides than a full-length nucleic acid. A fragment may be, for example, an N-terminal fragment (ie, removal of part of the C-terminus of the protein), a C-terminal fragment (ie, removal of part of the N-terminus of the protein), or an internal fragment.

[0051] "Sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to residues in two sequences that are the same when aligned for maximum match in a specified comparison window. When percent sequence identity is used with proteins, positions of residues that are not identical are often distinguished by conservative amino acid substitutions, where amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule . When two or more amino acid sequences differ by conservative substitutions, the percent identity can be increased to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have "sequence similarity" or "similarity". Means for such adjustment are well known. Typically, they include the evaluation of conservative substitution as a partial rather than a complete mismatch, thereby increasing the percentage of sequence identity. Thus, for example, when an identical amino acid is assigned a score of 1 and a non-conservative substitution is assigned a score of zero, the conservative substitution is given a score from zero to 1. The score of conservative substitutions is calculated in such a manner as, for example, implemented in the PC/GENE program (Intelligenetics , Mountain View, California, USA)

[0052] "Percent sequence identity" includes a value determined by comparing two optimally aligned in the comparison window sequences (highest number of perfectly matching residues), where part of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e. gaps) compared with a reference sequence (which contains no additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or identical amino acid residue occurs in both sequences to obtain the number of positions with matches, dividing the number of positions with matches by the total number of positions in the comparison window, and multiplying the result by 100 to obtain a percentage sequence identity. Unless otherwise noted (eg, the shorter sequence includes an associated heterologous sequence), the comparison window is the full length of the shorter of the two comparison sequences.

[0053] Unless otherwise noted, sequence identity/similarity values include the value obtained using the GAP version 10 program using the following parameters: % identity and % similarity for the nucleotide sequence using a gap opening penalty of 50 and a gap extension penalty of 3 and substitution matrices nwsgapdna.cmp; % identity and % similarity for an amino acid sequence using a gap opening penalty of 8 and a gap extension penalty of 2 and a BLOSUM62 substitution matrix or any equivalent program. An "equivalent program" includes any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity compared to the corresponding alignment obtained using GAP version 10.

[0054] The term "conservative amino acid substitution" refers to the replacement of an amino acid that is normally present in a sequence with another amino acid of similar size, charge, or polarity. Examples of conservative substitutions include replacing a non-polar (hydrophobic) moiety such as isoleucine, valine, or leucine with another non-polar moiety. Similarly, examples of conservative substitutions include replacing one polar (hydrophilic) residue with another, such as arginine with lysine, glutamine with asparagine, or glycine with serine. Furthermore, substitution of a basic residue such as lysine, arginine or histidine with another, or substitution of one acidic residue such as aspartic acid or glutamic acid with another acidic residue are further examples of conservative substitutions. Examples of non-conservative substitutions include replacing a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, or methionine with a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid, or lysine, and/or a polar residue with a non-polar residue. A typical categorization of amino acids is summarized below.

[0055] A "homologous" sequence (e.g., a nucleic acid sequence) includes a sequence that is either identical to or substantially similar to a known reference sequence such that it is, for example, at least 50%, at least 55% ), at least 60%, at least 65%), at least 70%, at least 75%, at least 80%, at least 85%, at least 90 %, at least 95%), at least 96%, at least 97%, at least 98%), at least 99%, or 100% identical to the known reference sequence. Homologous sequences may include, for example, orthologous sequences and paralogous sequences. For example, homologous genes are usually passed down from a common ancestral DNA sequence, either through a speciation event (orthologous genes) or through a genetic duplication event (paralogous genes). "Orthologous" genes include genes from different species that have evolved from a common ancestral gene through speciation. Orthologues usually retain the same function over the course of evolution. "Paralogous" genes include genes linked by duplication in the genome. Paralogs may have new functions in the course of evolution.

[0056] The term "in vitro" includes an artificial environment and processes or reactions that occur in an artificial environment (eg, in a test tube). The term "t vivo" includes the natural environment (eg, cell, organism or body) and processes or reactions that occur in the natural environment. The term "ex vivo" includes cells that have been removed from the human body, as well as processes or reactions that occur within such cells.

[0057] The term "reporter gene" refers to a nucleic acid having a sequence encoding a gene product (typically an enzyme) that is readily quantifiable when the construct containing the reporter gene sequence operably linked to a heterologous promoter and/or enhancer the element is introduced into cells containing (or which may contain) the factors necessary for the activation of promoter and/or enhancer elements. Examples of reporter genes include, but are not limited to, genes encoding beta-galactosidase (lacZ), bacterial chloramphenicol acetyltransferase (cat) genes, firefly luciferase genes, genes encoding beta-glucuronidase (GUS), and genes encoding fluorescent proteins. "Reporter white" refers to a protein encoded by a reporter gene.

[0058] As used herein, the term "fluorescent reporter protein" means a reporter protein that is detectable by fluorescence, wherein the fluorescence may arise either directly from the reporter protein, or as a result of the activity of the reporter protein on a fluorogenic substrate, or from a protein with a binding affinity with a fluorescently labeled compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, azurite, mKalamal, GFPuv, Sapphire, and T-sapphire), blue fluorescent proteins (e.g., CFP, eCFP, sky blue, CyPet, AmCyanl and Midoriishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, AsRed2, eqFP611, mRaspberry, m Strawberry, and Jred ), orange fluorescent proteins (eg, mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine and tdTomato) and any other suitable fluorescent protein whose presence in cells can be detected using flow cytometry techniques.

[0059] The term "recombination" includes any process of exchange of genetic information between two polynucleotides and can occur through any mechanism. Recombination in response to double strand breaks (DSBs) occurs primarily through two conservative DNA repair pathways: nonhomologous end joining (NHEJ) and homologous recombination (HR). See Kasparek & Humphrey (2011) Seminars in Cell & Dev. Biol. 22:886-897, incorporated herein by reference in its entirety for all purposes. Similarly, repair of a target nucleic acid mediated by an exogenous donor nucleic acid may include any exchange of genetic information between two polynucleotides.

[0060] NHEJ involves the repair of double-strand breaks in nucleic acid by direct ligation of the break ends to each other or to an exogenous sequence without the need for a homologous template. Ligation of non-contiguous sequences with NHEJ can often result in deletions, insertions or translocations near the double strand break site. For example, NHEJ can also result in targeted integration of the exogenous donor nucleic acid by direct ligation of the break ends to the ends of the exogenous donor nucleic acid (ie, NHEJ-based capture). Such NHEJ-mediated targeted integration may be preferred for exogenous donor nucleic acid insertion when homologous repair (HDR) pathways cannot always be used (e.g., in non-dividing cells, primary cells, and cells in which DNA homologous repair is not efficient enough). In addition, unlike homologous repair, information about the relatively large regions of sequence identity flanking the cleavage site is not required, which can be useful when attempting targeted insertion into organisms with genomes whose genomic sequence knowledge is limited. Integration can occur by ligating "blunt ends" of the exogenous donor nucleic acid and the cleaved genomic sequence, or by ligating "sticky ends" (i.e., having 5' or 3' overhanging ends) using the exogenous donor nucleic acid that is flanked by overhanging ends that are compatible with such ends generated by the nuclease agent in the cleaved genomic sequence. See, for example, US 2011/020722, WO 2014/033644, WO 2014/089290 and Maresca et al. (2013) Genome Res. 23(3): 539-546, each of which is incorporated herein by reference in its entirety for all purposes. If the "blunt ends" are ligated, the target and/or donor may need to be excised to obtain the microhomologies needed to join the fragments, which may lead to undesirable changes in the target sequence.

[0061] Recombination can also occur via homologous repair (HDR) or homologous recombination (HR). HDR or HR includes a form of nucleic acid repair that may require nucleotide sequence homology, the use of a "donor" molecule as a template for the repair of a "target" molecule (i.e., one in which a double-strand break has occurred), and which results in the transfer of genetic information from donor to target. Without being limited to any particular theory, such transfer may include correcting the heteroduplex DNA mismatch that forms between the damaged target and the donor, and/or fusion-dependent strand annealing, in which the donor is used to resynthesize genetic information that will become part of the target and /or related processes. In some cases, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target DNA. See Wang et al. (2013) Cell 153:910-918; Mandalos et al. (2012) PLOS ONE 7:e45768:1-9; and Wang et al. (2013) Nat Biotechnol. 31:530-532, each of which is incorporated herein by reference in its entirety for all purposes.

[0062] The term "antigen binding protein" includes any protein that binds to an antigen. Examples of antigen-binding proteins include an antibody, an antigen-binding fragment of an antibody, a polyspecific antibody (e.g., a bispecific antibody), scFV, bis-scFV, diabody, triatebody, tetrabody, V-NAR, VHH, VL, F(ab), F(ab) ₂ . DVD (antigen-binding protein with two variable domains), SVD (antigen-binding protein with a single variable domain), bispecific T-cell recruiter (BiTE), or Davisbody (U.S. Patent No. 8,586,713, incorporated herein by reference in its entirety for all purposes) .

[0063] The term "multispecific" or "bispecific" in relation to an antigen binding protein means that the protein recognizes different epitopes, either on the same antigen or on different antigens. The multispecific antigen binding molecule may be a single multifunctional polypeptide or may be a multimeric complex of two or more polypeptides covalently or non-covalently linked to each other. For example, an antibody or fragment thereof may be operably linked (eg, by chemical coupling, genetic fusion, non-covalent association, or others) to one or more other molecular entities, such as a protein or fragment thereof, to produce a bispecific or polyspecific antigen-binding molecule with a second specificity. binding.

[0064] The term "antigen" refers to a substance, an entire molecule, or a domain within a molecule that is capable of initiating the production of antibodies with binding specificity for that substance. The term antigen also includes substances that, in wild-type hosts, do not induce antibody production through self recognition, but can induce such a response in the host animal with appropriate genetic modifications designed to break immunological tolerance.

[0065] The term "epitope" refers to a site on an antigen to which an antigen-binding protein (eg, antibody) binds. An epitope may be formed from contiguous amino acids or non-contiguous amino acids brought together by the folding of one or more proteins into a tertiary structure. Epitopes formed by contiguous amino acids (also known as linear epitopes) are generally retained upon exposure to denaturing solvents, while epitopes formed by folding into a tertiary structure (also known as conformational epitopes) are generally lost upon exposure to denaturing solvents. Typically, an epitope comprises at least 3, and usually at least 5 or 8 to 10 amino acids in a unique spatial conformation. Methods for determining the spatial conformation of epitopes include, for example, x-ray crystallography and 2D nuclear magnetic resonance. See, for example, Epitope Mapping Protocols, in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996), incorporated herein by reference in its entirety for all purposes.

[0066] An antibody paratope as described herein typically contains at least a complementarity determining region (CDR) that specifically recognizes a heterologous epitope (eg, heavy and/or light chain variable domain CDR3 region).

[0067] The term "antibody" refers to immunoglobulin molecules containing four polypeptide chains, two heavy (H) chains, and two light (L) chains linked together by disulfide bonds. Each heavy chain contains a heavy chain variable domain and a heavy chain constant region (C _H ). The heavy chain constant region contains three domains: C _H 1 , C _H 2 and C _H 3. Each light chain contains a light chain variable domain and a light chain constant region (C _L ). The heavy chain and light chain variable domains can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs) interspersed with more conserved regions called framework regions (FRs). Each heavy and light chain variable domain contains three CDRs and four FRs, arranged from amino to carboxy in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs may be abbreviated as HCDR1, HCDR2, and HCDR3; light chain CDRs may be abbreviated as LCDR1, LCDR2, and LCDR3). The term "high affinity" antibody refers to an antibody that has a Kd relative to its target epitope of about 10 ^-9 M or less (e.g., about 1 x 10 ^-9 M, 1 x 10 ^-10 M, 1 x 10 ^-11 M or approximately 1×10 ^-12 M). In one embodiment, Kd is measured using surface plasmon resonance, for example, BIACORE™; in another embodiment, Kd is measured using ELISA.

[0068] The term "bispecific antibody" includes an antibody that can selectively bind two or more epitopes. Bispecific antibodies usually contain two different heavy chains, with each heavy chain specifically binding to a different epitope, either on two different molecules (for example, on two different antigens) or on the same molecule (for example, on the same antigen) . If the bispecific antibody is capable of selectively binding to two different epitopes (a first epitope and a second epitope), then the first heavy chain's affinity for the first epitope will typically be at least one, two, or three, or four orders of magnitude lower than the first heavy chain's affinity for relation to the second epitope, and vice versa. Epitopes recognized by a bispecific antibody may be on the same or different target (eg, on the same or different protein). Bispecific antibodies can be obtained, for example, by combining heavy chains that recognize different epitopes of the same antigen. For example, nucleic acid sequences encoding those heavy chain variable sequences that recognize different epitopes of the same antigen can be fused to nucleic acid sequences encoding different heavy chain constant regions, and such sequences can be expressed in a cell that expresses the immunoglobulin light chain. A typical bispecific antibody has two heavy chains, each containing three heavy chain CDRs, followed (from N-terminus to C-terminus) by a CH1 domain, a hinge region, a CH2 domain, and a CH3 domain, and an immunoglobulin light chain, which either does not confer antigen-binding specificity, but which may associate with each heavy chain, or which may associate with each heavy chain and which may bind to one or more epitopes that bind antigen-binding regions of the heavy chain, or which may associate with each heavy chain and allow either one or both heavy chains to bind to one or both epitopes.

[0069] The term "heavy chain" or "immunoglobulin heavy chain" includes an immunoglobulin heavy chain sequence, including an immunoglobulin heavy chain constant region sequence, from any organism. Heavy chain variable domains contain three heavy chain CDRs and four FR regions, unless otherwise noted. Heavy chain fragments include CDR, CDR and FR and combinations thereof. A typical heavy chain after the variable domain (N-terminus to C-terminus) contains a C _H 1 domain, a hinge region, a C _H 2 domain, and a C _H 3 domain. A functional heavy chain fragment includes a fragment that is capable of specifically recognizing an epitope (eg, recognizing an epitope with a Kd in the micromolar, nanomolar, or picomolar range), that is capable of being expressed and secreted from a cell, and that contains at least one CDR. Heavy chain variable domains are encoded by the nucleotide sequence of the variable region, which typically contains V _H , D _H and J _H segments derived from the repertoire of V _H , D _H and J _H segments present in germline antibodies. Sequences, locations and nomenclature for the V, D and J segments of the heavy chain for various organisms can be found in the IMGT database, which is available via the Internet on the World Wide Web (www) at the resource address on the network "imgt.org".

[0070] The term "light chain" includes an immunoglobulin light chain sequence from any organism, and unless otherwise indicated, includes kappa (κ) and lambda (λ) human and VpreB light chains, as well as surrogate light chains. Light chain variable domains typically include three light chain CDRs and four framework (FR) regions unless otherwise noted. Typically, a full-length light chain includes, in the amino-to-carboxyl-terminal direction, a variable domain that includes FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 and the amino acid sequence of the light chain constant region. The light chain variable domains are encoded by the nucleotide sequence of the light chain variable region, which typically includes the V _L light chain and J _L light chain gene segments derived from the repertoire of V and J light chain gene segments present in germline antibodies. Sequences, locations, and nomenclature for the V and J light chain gene segments for various organisms can be found in the IMGT database, which is available via the Internet on the World Wide Web (www) at the web resource address Error! Invalid hyperlink object. . Light chains include, for example, chains that selectively bind neither the first nor the second epitopes selectively bound by the epitope-binding protein in which they occur. Light chains also include those chains that bind and recognize or assist the heavy chain in binding and recognizing one or more epitopes selectively bound by the epitope binding protein in which they are found.

[0071] As used herein, the term "complementarity determining region" or "CDR" refers to the amino acid sequence encoded by the nucleic acid sequence of the immunoglobulin genes of an organism, which is usually (i.e., in a wild-type animal) located between two framework regions in the variable region of the lung or the heavy chains of an immunoglobulin molecule (eg, antibody or T cell receptor). The CDR may be encoded by, for example, a germline sequence or a rearranged sequence, and, for example, a naive or mature B cell or T cell. The CDR may be somatically mutated (eg, different from the sequence encoded in the animal's germline), humanized, and/or modified by amino acid substitutions, additions, or deletions. In some cases (for example, in the case of CDR3), CDRs may be encoded by two or more sequences (for example, germline sequences) that are not contiguous (for example, in the case of a non-rearranged nucleic acid sequence), but they are contiguous in the nucleic acid sequence in B cell, for example, as a result of splicing or joining sequences (eg, V-D-J recombination to form heavy chain CDR3).

[0072] Specific binding of an antigen binding protein to its target antigen includes binding with an affinity of at least 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ^{9 ,} or 10 ¹⁰ M ^-1 . Specific binding is clearly superior and distinct from non-specific binding occurring to at least one unrelated target. Specific binding may result from the formation of bonds between certain functional groups or a certain spatial correspondence (for example, lock and key interactions), while non-specific binding is usually the result of van der Waals forces. However, specific binding does not necessarily imply that the antigen binding protein binds to one and only one target.

[0073] Compositions or methods "comprising" or "comprising" one or more of the listed elements may include other elements that are not specifically indicated. For example, a composition that "comprises" or "comprises" a protein may contain the protein alone or in combination with other ingredients. The transitional phrase "consisting essentially of" means that the scope of the claims should be interpreted as covering the specified elements listed in the claims, and those elements that do not significantly affect the main and new characteristic (characteristics) of the claimed invention. Thus, the expression "consisting essentially of" when used in the claims of the present invention is not intended to be construed as equivalent to the expression "comprising".

[0074] "Optional" or "optional" means that the subsequent event or circumstance described may or may not occur, and that the description includes cases where the event or circumstance occurs and cases where it does not occur.

[0075] The range designation includes all integers defining the range and all or within subranges defined by integers within the range.

[0076] Unless otherwise clear from the context, the expression "approximately" covers values within the standard margin of error of measurement (eg, SEM) of the specified value.

[0077] The conjunctions "and/or" refer to and encompass any possible combinations of one or more of the related listed elements, as well as the absence of combinations when interpreted as an alternative ("or").

[0078] The union "or" refers to any one representative of a particular list, and also includes any combination of representatives of this list.

[0079] Singular forms include references to plural forms unless the context clearly indicates otherwise. For example, the terms "protein" or "at least one protein" can include many proteins, including mixtures thereof.

[0080] Statistically significant means p≤0.05.

DETAILED DESCRIPTION OF THE INVENTION

I. Overview

[0081] Disclosed herein are non-human and non-human animal cells containing a humanized Asgr1 locus and methods of using such non-human and non-human animal cells. Non-human or non-human animal cells containing a humanized Asgr1 locus express a human ASGR1 protein or a chimeric Asgr1 protein containing one or more human ASGR1 protein fragments (e.g., all or part of the human ASGR1 extracellular domain). As a highly efficient liver-specific endocytosis receptor, human ASGR1 can be used for liver-specific delivery of therapeutic agents such as antibodies, small molecules (as part of antibody-drug conjugates), and DNA. However, antigen-binding proteins or bispecific antigen-binding proteins that specifically bind human ASGR1 will often not bind to orthologous non-human Asgr1 proteins, such as mouse Asgr1, due to sequence differences between human ASGR1 and non-human Asgr1. For example, antibodies raised against the extracellular domain of human ASGR1 do not bind to the mouse Asgr1 orthologue (data not shown). For this reason, the effectiveness of in vivo human ASGR1-mediated delivery mechanisms or therapeutic mechanisms cannot be effectively assessed in non-human animals with unmodified endogenous (ie, native) Asgr1 loci. Asgr1 humanized non-human animals (eg, Asgr1 humanized mice) can be used to validate liver-specific delivery of various therapeutic agents through human ASGR1-mediated internalization using a number of different approaches. For example, non-human animals containing a humanized Asgr1 locus can be used to assess the in vivo efficacy of human ASGR1 mediated delivery of therapeutic molecules or therapeutic complexes to the liver. Similarly, non-human animals containing a humanized Asgr1 locus can be used to evaluate the efficacy of therapeutic molecules or therapeutic complexes acting through mechanisms mediated by human ASGR1.

II. Non-human animals containing a humanized Asgr1 locus

[0082] Non-human cells and animals disclosed herein contain the humanized Asgr1 locus. Non-human cells or animals containing a humanized Asgr1 locus express a human ASGR1 protein or a partially humanized Asgr1 chimeric protein in which one or more fragments of the native Asgr1 protein have been replaced with corresponding fragments from human ASGR1 (e.g., all or part of the extracellular domain) .

A. Asialoglycoprotein receptor 1 (ASGR1)

[0083] The non-human cells and animals described herein contain the humanized Asgr1 locus. Asialoglycoprotein receptor 1 (a member of the H1 family of 4 proteins with a C-type lectin domain, liver lectin H1, HL-1, ASGP-R 1, ASGPR 1, ASGR1) is encoded by the ASGR1 gene (CLEC4H1) and is the main subunit of the asialoglycoprotein receptor (ASGPR or ASGR ). ASGPR is a heterooligomeric protein expressed primarily on the cell surface of hepatocytes, with approximately 1-5×10 ⁵ binding sites/cell, which plays an important role in the internalization and cleavage of desialylated glycoproteins and their removal from the circulation. ASGPR is a well-studied C-type hepatic lectin expressed primarily on the sinusoidal surface of hepatocytes. ASGPR is responsible for the selective binding and internalization of glycoproteins to terminal galactose or N-acetylgalactosamine residues by liver parenchymal cells via receptor-mediated endocytosis. It contains two proteins, asialoglycoprotein receptors 1 and 2 (ASGR1 and ASGR2), encoded by the ASGR1 and ASGR2 genes. Both subunits are single pass type II proteins that typically contain an N-terminal cytoplasmic domain, one transmembrane domain, and a C-terminal extracellular carbohydrate recognition domain (CRD). ASGR1 contains an N-terminal cytoplasmic domain (~40 amino acids), a single-pass transmembrane domain (~20 amino acids), an extracellular supercoiled stem region (oligomerization) (~80 amino acids), and a functional C-type carbohydrate recognition domain (calcium-dependent) (lectin domains C-type) (*-140 amino acids). CRD binds to glycoproteins with terminal galactose or N-acetylgalactosamine (GalNac) motifs. CRD is characterized by low affinity for desialylated glycoproteins in the monomeric state.

[0084] The genes encoding ASGR1 and ASGR2 (ASGR1 and ASGR2, respectively) are located on the short arm of chromosome 17 at a distance of approximately 58.6 kb (i.e.) from each other. The genes are evolutionarily related, but differ significantly in their structural organization: ASGR1 contains 8 exons and is approximately 6 kb long, and ASGR2 contains 9 exons and is approximately 13.5 kb long.

[0085] An exemplary coding sequence for human ASGR1 has been assigned accession number NM_001671 (SEQ ID NO: 5) by the NCBI. An exemplary coding sequence for mouse Asgr1 has been assigned accession number NM_009714 (SEQ ID NO: 4) at NCBI. An exemplary human ASGR1 protein has been assigned UniProt accession number P07306 (SEQ ID NO: 1). An exemplary mouse Asgr1 protein has been assigned UniProt accession number P34927 (SEQ ID NO: 2). An exemplary mouse Asgr1 protein with a humanized supercoil domain and a C-type lectin domain is set forth under SEQ ID NO: 3. An exemplary rat Asgr1 protein has been assigned accession number: P02706 in UniProt. An exemplary orangutan Asgr1 protein has been assigned UniProt accession number Q5RBQ8.

B. Humanized Asgr1 loci

[0086] A humanized Asgr1 locus may be an Asgr1 locus in which the entire Asgr1 gene is replaced by a corresponding orthologous human ASGR1 sequence, or it may be an Asgr1 locus in which only a portion of the Asgr1 gene is replaced by a corresponding orthologous human ASGR1 sequence, (i.e. humanized). Optionally, the corresponding human ASGR1 orthologous sequence is modified to optimize codons based on codon usage in non-human animals. Replaced (ie, humanized) regions may include coding regions, such as an exon, non-coding regions, such as an intron, an untranslated region, or a regulatory region (eg, a promoter, enhancer, or transcriptional repressor binding element), or any combination thereof. As one example, exons corresponding to exons 1, 2, 3, 4, 5, 6, 7 or all 8 of the human ASGR1 gene can be humanized. For example, exons corresponding to exons 3-8 of the human ASGR1 gene can be humanized. Alternatively, the Asgr1 region encoding the epitope recognized by the antigen-binding protein, which is an antibody to human ASGR1, can be humanized. As another example, one or more or all of the domains, including an N-terminal cytoplasmic domain, a transmembrane domain, a supercoiled domain, or a C-type lectin domain, can be humanized. For example, all or part of the Asgr1 locus encoding a supercoiled domain can be humanized, all or part of the Asgr1 locus encoding a C-type lectin domain can be humanized, all or part of the Asgr1 locus encoding a transmembrane domain can be humanized. be humanized, and/or all or part of the Asgr1 locus encoding the cytoplasmic domain can be humanized. In one example, only all or part of the Asgr1 locus encoding the supercoil domain is humanized, only all or part of the Asgr1 locus encoding the C-type lectin domain is humanized, or only all or part of the Asgr1 locus encoding the extracellular region ( i.e. supercoiled domain and C-type lectin domain). For example, regions of the Asgr1 locus encoding a supercoiled domain and a C-type lectin domain can be humanized such that the Asgr1 chimeric protein is produced with an endogenous N-terminal cytoplasmic domain, an endogenous transmembrane domain, a humanized supercoiled domain, and a humanized C-type lectin domain. . Similarly, introns corresponding to introns 1, 2, 3, 4, 5, 6 or all 7 of the human ASGR1 gene can be humanized. Flanking non-translated regions, including regulatory sequences, can also be humanized. For example, the 5'-UTR, 3'-UTR or both 5'-UTR and 3'-UTR can be humanized, or 5'-UTR, 3'-UTR or both 5'-UTR and 3 -'UTRs may remain endogenous. In one specific example, the 3-'UTR is humanized, but the 5'-UTR remains endogenous. Depending on the degree of replacement by orthologous sequences, regulatory sequences such as a promoter may be endogenous or provided by a replacement human orthologous sequence. For example, a humanized Asgr1 locus may include the endogenous Asgr1 promoter of a non-human animal.

[0087] The Asgr1 protein encoded by the humanized Asgr1 locus may contain one or more domains derived from the human ASGR1 protein. For example, the Asgr1 protein may comprise one or more domains including the human ASGR1 supercoil domain, the human ASGR1 C-type lectin domain, the human ASGR1 transmembrane domain, and the human ASGR1 cytoplasmic domain, or all of them. As one example, an Asgr1 protein may contain only the human ASGR1 supercoiled domain, only the human ASGR1 C-type lectin domain, or only the human ASGR1 extracellular domain (ie, the supercoiled domain and the C-type lectin domain). Optionally, the Asgr1 protein encoded by the humanized Asgr1 locus may also contain one or more domains derived from endogenous (ie, native) Asgr1 protein of a non-human animal. As one example, the Asgr1 protein encoded by the humanized Asgr1 locus may comprise a supercoiled domain from the human ASGR1 protein, a C-type lectin domain from the human ASGR1 protein, an N-terminal cytoplasmic domain from the endogenous (i.e., native) Asgr1 protein of an animal other than from a human, and a transmembrane domain from the endogenous (ie, native) Asgr1 protein of a non-human animal. Domains from the human ASGR1 protein may be encoded by a fully humanized sequence (i.e., the entire sequence encoding that domain is replaced by an orthologous human ASGR1 sequence), or may be encoded by a partially humanized sequence (i.e., some of the domain-coding sequences are replaced by an orthologous ASGR1 sequence). human, and the remaining endogenous (i.e., native) sequence encoding this domain encodes the same amino acids as the orthologous sequence of human ASGR1, such that the encoded domain is identical to this domain in the human ASGR1 protein).

[0088] As one example, the Asgr1 protein encoded by the humanized Asgr1 locus may contain the human ASGR1 supercoil domain. Optionally, the human ASGR1 supercoil domain contains, consists essentially of, or consists of a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence under SEQ ID NO : 27, while the Asgr1 protein retains the activity of native Asgr1 (i.e. retains the ability to selectively bind and internalize glycoproteins to terminal galactose or N-acetylgalactosamine residues via receptor-mediated endocytosis). As another example, the Asgr1 protein encoded by the humanized Asgr1 locus may contain a C-type lectin domain from human ASGR1. Optionally, the C-type lectin domain of human ASGR1 contains, consists essentially of, or consists of a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence under SEQ ID NO: 28, while the Asgr1 protein retains the activity of native Asgr1. For example, a portion of the Asgr1 protein that is derived from human ASGR1 may contain, consist essentially of, or consist of a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence under SEQ ID NO: 31, while the Asgr1 protein retains the activity of native Asgr1. As another example, the Asgr1 protein encoded by the humanized Asgr1 locus may contain the endogenous Asgr1 cytoplasmic domain of a non-human animal (eg, mouse Asgr1 cytoplasmic domain). Optionally, the non-human Asgr1 cytoplasmic domain contains, consists essentially of, or consists of a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical sequence under SEQ ID NO: 29, and while the Asgr1 protein retains the activity of native Asgr1. As another example, the Asgr1 protein encoded by the humanized Asgr1 locus may contain an endogenous Asgr1 transmembrane domain of a non-human animal (eg, a mouse Asgr1 transmembrane domain). Optionally, the non-human Asgr1 transmembrane domain consists essentially of or consists of a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence under SEQ ID NO: 30, while the Asgr1 protein retains the activity of native Asgr1. For example, the Asgr1 protein encoded by the humanized Asgr1 locus may contain, consist essentially of, or consist of a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% is identical to the sequence under SEQ ID NO: 3, and when the Asgr1 protein retains the activity of native Asgr1.

[0089] Optionally, the humanized Asgr1 locus may contain other elements. Examples of such elements may include selectable marker cassettes, reporter genes, recombinase recognition sites, or other elements. Alternatively, other elements may be absent from the humanized Asgr1 locus (eg, a selectable marker or selectable marker cassette may be missing). Examples of suitable reporter genes and reporter proteins are disclosed elsewhere in this document. Examples of suitable selectable markers include neomycin phosphotransferase (neo _r ), hygromycin B-phosphotransferase (hyg _r ), puromycin N-acetyltransferase (puro _r ), blasticidin S-deaminase (bsr _r ), xanthine/guanine phosphoribosyltransferase (gpt ) and herpes simplex virus thymidine kinase (HSV-k). Examples of recombinases include Cre, Flp and Dre recombinases. One example of a Cre recombinase gene is Crei, in which two exons encoding Cre recombinase are separated by an intron to prevent its expression in a prokaryotic cell. Such recombinases may additionally contain an intranuclear localization signal to provide nuclear localization (eg, NLS-Crei). Recombinase recognition sites include nucleotide sequences that are recognized by a site-specific recombinase and can serve as a substrate for a recombination event. Examples of recombinase recognition sites include FRT, FRT11, FRT71, attp, art, rox and lox sites such as loxP, lox511, lox2272, lox66, lox71, loxM2 and lox5171.

[0090] Other elements, such as reporter genes or selectable marker cassettes, may be self-removing cassettes flanked by recombinase recognition sites. See, for example, US 8697851 and US 2013/0312129, each of which is incorporated herein by reference in its entirety for all purposes. As an example, a self-removing cassette may contain the Crei gene (contains two exons encoding Cre recombinase separated by an intron) operably linked to the mouse Prm1 promoter and a neomycin resistance gene operably linked to the human ubiquitin promoter. By using the Prm1 promoter, the self-removing cassette can be specifically removed in male germline F0 animal germline. A polynucleotide encoding a selectable marker may be operably linked to an active promoter in the target cell. Examples of promoters are described elsewhere in this document. As another specific example, a self-removing selectable marker cassette may contain a sequence encoding a hygromycin resistance gene operably linked to one or more promoters (e.g., both the human ubiquitin promoter and the EM7 promoters), followed by a polyadenylation signal, followed by followed by a Crei coding sequence operably linked to one or more promoters (eg, the mPrm1 promoter), followed by another polyadenylation signal where the entire cassette is flanked by loxP sites.

[0091] The humanized Asgr1 locus can also be a conditional allele. For example, the conditional allele may be the multifunctional allele described in US 2011/0104799, incorporated herein by reference in its entirety for all purposes. For example, a conditional allele may contain: (a) an initiator sequence in sense orientation relative to transcription of the target gene; (b) a selectable drug resistance (DSC) gene cassette in sense or antisense orientation; (c) the nucleotide sequence of interest (NSI) in antisense orientation; and (d) an inversion driven module (COIN, which uses an exon-separating intron and an inverted "gene trap"-like module) in reverse orientation. See, for example, US 2011/0104799. The conditional allele may further comprise recombinable units that recombine when exposed to the first recombinase to form a conditional allele that (i) lacks an initiator sequence and DSC; and (ii) contains NSI in sense orientation and COIN in antisense orientation. See, for example, US 2011/0104799.

[0092] One exemplary humanized Asgr1 locus (eg, the mouse humanized Asgr1 locus) is a locus in which coding exons 3-8 have been replaced with the corresponding human sequence. These exons encode the supercoiled domain and the C-type lectin domain of Asgr1. Optionally, the humanized sequence may pass through the stop codon and the 3'UTR, and optionally into the sequence immediately below the 3'UTR. Optionally, the portion of the intron upstream of coding exon 3 is also humanized. See figures 2A and 2B and SEQ ID NOs: 21 and 24.

C. Non-human cells and non-human animals containing the humanized Asgr1 locus

[0093] Non-human and non-human animal cells containing the humanized Asgr1 locus described elsewhere herein are provided. Non-human cells or animals may be heterozygous or homozygous for the humanized Asgr1 locus. A diploid organism has two alleles at each genetic locus. Each pair of alleles represents the genotype of a specific genetic locus. Genotypes are described as homozygous if a particular locus contains two identical alleles, and as heterozygous if the two alleles are different.

[0094] Non-human animal cells provided herein can be, for example, any non-human cell containing the Asgr1 locus or a genomic locus homologous or orthologous to the human ASGR1 locus. The cells may be eukaryotic cells, which include, for example, fungal (eg, yeast), plant cells, animal cells, mammalian cells, non-human mammalian cells, and human cells. The term "animal" includes mammals, fish and birds. The mammalian cell is, for example, a non-human mammalian cell, a rodent cell, a rat cell, a mouse cell, or a hamster cell. Other non-human mammals include, for example, non-human primates, non-human apes, great apes, orangutans, cats, dogs, rabbits, horses, bulls, deer, bison, livestock (e.g., bovine species such as such as cows, bulls, etc., bovid species such as sheep, goats, etc., and pig species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, ducks, and so on. Also included are pets and farm animals. The term "other than human" excludes humans.

[0095] Cells can also be of any type in an undifferentiated or differentiated state. For example, the cell may be a totipotent cell, a pluripotent cell (eg, a human pluripotent cell or a non-human pluripotent cell such as a mouse embryonic stem (ES) cell or a rat ES cell), or a non-pluripotent cell. Totipotent cells include undifferentiated cells that can give rise to any type of cell, and pluripotent cells include undifferentiated cells that have the ability to develop into more than one type of differentiated cell. Such pluripotent and/or totipotent cells may be, for example, ES cells or ES-like cells such as induced pluripotent stem (iPS) cells. ES cells include totipotent or pluripotent cells of embryonic origin that are capable of contributing to any tissue in the developing embryo when introduced into the embryo. ES cells can be derived from the inner cell mass of the blastocyst and are capable of differentiating into cells from any of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[0096] The cells provided herein can also be germline cells (eg, spermatozoa or oocytes). The cells may be mitotically competent cells or mitotically inactive cells, meiotically competent cells or meiotically inactive cells. Similarly, the cells may also be primary somatic cells or cells that are not primary somatic cells. Somatic cells include any cell that is not a gamete, germline cell, gametocyte, or undifferentiated stem cell. For example, the cells may be liver cells such as hepatoblasts or hepatocytes.

[0097] Suitable cells provided herein also include primary cells. Primary cells include cells or cell cultures that have been isolated directly from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortalized. They include any cell derived from an organism, organ, or tissue that has not previously been passaged in tissue culture, or has previously been passaged in tissue culture, but is not capable of being passaged indefinitely in tissue culture. Such cells can be isolated using conventional techniques and include, for example, hepatocytes.

[0098] Other suitable cells provided herein include immortalized cells. Immortalized cells are cells of a multicellular organism that would not normally reproduce indefinitely, but due to a mutation or change have escaped normal cellular aging and can instead continue to divide further. Such mutations or changes may occur naturally or may be deliberately initiated. A specific example of an immortalized cell line is the HepG2 human liver cancer cell line. Many types of immortalized cells are well known. Immortalized or primary cells include cells that are commonly used for culture or for the expression of recombinant genes or proteins.

[0099] The cells provided herein also include embryos at the single cell stage (ie, fertilized oocytes or zygotes). Such single cell stage embryos can be obtained from any genetic background (e.g. BALB/c, C57BL/6, 129, or combinations thereof in mice), can be fresh or frozen, and can be obtained from natural breeding or in vitro fertilization. .

[00100] The cells provided herein may be normal, healthy cells, or may be diseased or mutated cells.

[00101] Non-human animals containing the humanized Asgr1 locus described herein can be obtained using the methods described elsewhere in this document. The term "animal" includes mammals, fish and birds. Non-human mammals include, for example, non-human primates, non-human apes, great apes, orangutans, cats, dogs, horses, bulls, deer, bison, sheep, rabbits, rodents (e.g., mice, rats, hamsters, and guinea pigs) and livestock (e.g. cattle species such as cows and bulls; bovid species such as sheep and goats; and pig species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese and ducks. Also included are pets and farm animals. The term "animal other than man" excludes humans. Preferred non-human animals include, for example, rodents such as mice and rats.

[00102] Non-human animals can be derived from any genetic background. For example, suitable mice can be obtained from the 129 line, the C57BL/6 line, the 129 and C57BL/6 cross, the BALB/c line, or the Swiss Webster line. Examples of lines 129 include 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129Sl/Svlm), 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac), 12 9S7, 129S8, 129T1 and 129T2. See, for example, Festing et al. (1999) Mammalian Genome 10:836, incorporated herein by reference in its entirety for all purposes. Examples of C57BL lineages include C57BL/A, C57BL/An, C57BL/GrFa, C57BL/Kal_wN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr and C57BL/ Ola. Suitable mice can also be obtained from a cross between the aforementioned 129 line and the aforementioned C57BL/6 line (eg 50% 129 and 50% C57BL/6). Similarly, suitable mice can be obtained from a cross between the aforementioned 129 lines or a cross between the aforementioned BL/6 lines (eg, the 129S6 (129/SvEvTac) line).

[00103] Similarly, rats can be obtained from any strain of rats, including, for example, ACI rats, Dark Agouti (DA) rats, Wistar rats, LEA rats, Sprague Dawley (SD) rats, or Fischer lines such as the Fisher F344 or Fisher F6. Rats can also be obtained from a line that is a cross between two or more of the lines listed above. For example, a suitable rat can be obtained from the DA line or the ACI line. Rats of the ACI line are characterized by the presence of the color "black agouti" with a white belly and limbs and haplotype RT1 ^av1 . Such lines are available from a variety of sources, including Harlan Laboratories. The Dark Agouti (DA) rat line is characterized by the presence of agouti coloration and the RT1 ^av1 haplotype. Such rats are available from a variety of sources, including Charles River and Harlan Laboratories. Some suitable rats can be obtained from inbred lines of rats. See, for example, US 2014/0235933, incorporated herein by reference in its entirety for all purposes.

III. Methods for using non-human animals containing a humanized Asgr1 locus to assess the in vivo efficacy of human ASGR1 mediated delivery of therapeutic complexes to the liver and therapeutic molecules acting through human ASGR1 mediated mechanisms

[00104] Various methods are provided for using non-human animals containing the humanized Asgr1 locus described elsewhere in this document to assess the in vivo efficacy of human ASGR1-mediated delivery of therapeutic molecules or complexes to the liver or human ASGR1-mediated therapeutic mechanisms. Because non-human animals contain a humanized Asgr1 locus, non-human animals will more accurately mimic human ASGR1-mediated delivery or human ASGR1-mediated therapeutic mechanisms than non-human animals with a non-humanized Asgr1 locus. As one example, these methods can evaluate delivery of a therapeutic complex to the liver via human ASGR1-mediated internalization in vivo, which involves administering the therapeutic complex to a non-human animal containing a humanized Asgr1 locus, wherein the therapeutic complex comprises the therapeutic molecule and an antigen-binding protein or ligand, that specifically binds human ASGR1, and then assessing delivery of the therapeutic molecule to the liver of a non-human animal. As another example, these methods can evaluate the in vivo efficacy of therapeutic molecules or complexes intended to be mediated by human ASGR1 internalization, such as therapeutic complexes designed to internalize a liver cell surface protein by human ASGR1.

A. Methods for evaluating in vivo efficiency in delivering therapeutic molecules to the liver via human ASGR1-mediated internalization

[00105] Various methods are provided for using non-human animals containing the humanized Asgr1 locus described elsewhere in this document to evaluate the in vivo efficiency of delivering therapeutic molecules to the liver via human ASGR1 mediated internalization. For example, such methods may include: (a) administering a therapeutic complex to a non-human animal comprising a humanized Asgr1 locus, wherein the therapeutic complex comprises a therapeutic molecule and an antigen-binding protein or ligand that specifically binds human ASGR1; and (b) evaluating delivery of the therapeutic molecule to the liver of a non-human animal.

[00106] A therapeutic molecule can be any biological or chemical agent used in the treatment or prevention of any disease or disorder. For example, the therapeutic molecule may be therapeutic nucleic acids (eg, CRISPR/Cas guide RNAs, short hairpin RNAs (shRNA) or small interfering RNAs (siRNA)) or nucleic acids encoding therapeutic proteins (eg, Cas proteins, such as , Cas9 proteins, replacement enzymes, secreted therapeutic proteins, etc.). Alternatively, the therapeutic molecule can be a therapeutic protein, a therapeutic antibody or antigen binding protein, or any other therapeutic large molecule or small molecule.

[00107] The therapeutic molecule and the human antigen-binding protein or ligand of ASGR1 may be complexed with each other by any means. For example, the therapeutic molecule and a human ASGR1 antigen-binding protein or ligand may be joined via direct covalent conjugation, or may be linked via a linker such as a peptide linker or a chemical linker. The therapeutic molecule and the human ASGR1 antigen-binding protein or ligand can also be complexed with each other through the formation of bonds between certain functional groups or through certain spatial correspondence (eg, lock and key interactions). As a specific example, a human ASGR1 antigen-binding protein can be a bispecific antigen-binding protein that also specifically binds a therapeutic molecule.

[00108] Administration of the therapeutic complex may be by any route, as described in more detail elsewhere in this document, and by any route of administration. Means for delivering therapeutic complexes and molecules and routes of administration are disclosed in more detail elsewhere in this document.

[00109] Human ASGR1 antigen-binding proteins or human ASGR1 ligands that specifically bind human ASGR1 can be used. Because the human ASGR1 protein is a transmembrane protein that mediates endocytosis of certain glycoproteins in the liver, molecules that complex with human ASGR1 can be internalized along with human ASGR1. Examples of suitable antigen binding proteins include receptor fusion molecule, decoy molecule, Fc receptor fusion molecule, antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single chain Fv (scFv) molecule, dAb fragment, isolated complementarity determining region (CDR), CDR3 peptide, conformationally restricted FR3-CDR3-FR4 peptide, domain-specific antibody, single domain antibody, domain deleted antibody, chimeric antibody, CDR grafted antibody, diabody, triatelo, tetrabody , minibody, nanobody, monovalent nanobody, divalent nanobody, small size modular protein (SMIP) immunopharmaceutical, camel antibody (heavy chain VHH homodimeric antibody), shark IgNAR variable domain, and others. In one specific example, an antigen binding protein is a bispecific antibody that binds human ASGR1 and a therapeutic molecule (eg, a replacement protein or enzyme or delivery vehicle such as AAV). Alternatively, a ligand or portion of a ligand that specifically interacts with human ASGR1 (eg, asialorosomucoid (ASOR) or beta-Ga1NAc or its receptor-binding portion for ASGR1) can be used.

[00110] Evaluation of delivery of a therapeutic molecule to the liver of a non-human animal can be performed using any known method. As one example, the presence of a therapeutic molecule in the liver can be assessed. For example, if the therapeutic molecule is a therapeutic protein, then the presence of the therapeutic protein in the liver of a non-human animal can be assessed using known protein detection assays. Similarly, if the therapeutic molecule is a nucleic acid encoding a therapeutic protein, evaluation of nucleic acid expression (eg, mRNA expression or protein expression) in the liver of a non-human animal can be performed using known assays. If the encoded therapeutic protein is a secreted protein, then serum levels of the therapeutic protein can be measured using known assays, or the activity of the secreted therapeutic protein can be assessed against the intended target cell type, target tissue type, or target organ type. Evaluation of the activity of a therapeutic molecule in the liver of a non-human animal can be performed using known assays, depending on the intended function of the therapeutic molecule. For example, if a genome editing tool such as CRISPR/Cas is administered, known assays can be used to evaluate genome editing at a particular target genomic locus.

[00111] In a specific example, the therapeutic complex may contain compositions based on viral vectors (eg, compositions based on liver-specific viral vectors). Such viral vector compositions may have reduced or eliminated natural tropism and are designed to target human ASGR1 to target the liver. For example, such a modified viral vector complex may comprise: (i) a modified viral vector containing a nucleic acid encoding a therapeutic nucleic acid or therapeutic protein, wherein the modified viral vector has abolished or reduced natural tropism and contains a heterologous epitope; and (ii) a retargeting fragment comprising: (1) a paratope of an antigen-binding protein (eg, antibody) that specifically binds the heterologous epitope; and (2) a targeting ligand that specifically binds human ASGR1.

[00112] As one example of how to achieve this, a protein labeling system such as SpyCatcher-SpyTag can be used to covalently bind antibodies to the surface of a virus. Alternatively, bispecific antigen binding proteins (eg, bispecific antibodies in which one arm of the antibody binds to the virus and the other arm mediates binding to human ASGR1) can be used. In a specific example, the retargeting fragment is a bispecific antigen-binding protein (e.g., a bispecific antibody) containing first and second antigen-binding domains, wherein the first antigen-binding domain contains a paratope that specifically binds a heterologous epitope incorporated into/surface-expressed from a recombinant human viral capsid protein. help, and a second antigen-binding domain that specifically binds human ASGR1.

[00113] An example of a suitable heterologous epitope is a Myc tag. For example, a Myc tag may be inserted after N587 in AAV2. This insert abolishes the natural ligand-binding activity of AAV2 and also allows the anti-Myc antibody to recognize the modified AAV. The use of a bispecific antibody that specifically binds to both Myc and human ASGR1 can then retarget AAV (eg, AAV2 N587 Myc) to liver cells expressing human ASGR1 (or humanized Asgr1).

[00114] In another example, the therapeutic complex comprises a lysosomal replacement enzyme or protein, or a nucleic acid encoding a lysosomal replacement enzyme or protein. Lysosomal storage diseases are a class of rare diseases that affect the breakdown of various substrates in the lysosome, including sphingolipids, mucopolysaccharides, glycoproteins, glycogen, and oligosaccharides, which can accumulate in affected cells, leading to cell death. Organs affected by lysosomal storage diseases include the liver. The pathogenesis of these diseases is explained by the accumulation of incomplete cleavage products in the lysosome, usually due to loss of protein function. Lysosomal storage diseases are usually caused by loss-of-function or attenuated variants in proteins whose normal function is to cleave or coordinate the cleavage of lysosome contents. Examples of lysosomal storage diseases are presented in WO 2017/100467, incorporated herein by reference in its entirety for all purposes. For example, one of the most common lysosomal storage diseases is Pompe disease. Pompe disease is caused by a defective lysosomal enzyme, alpha-glucosidase (GAA), which results in inadequate processing of glycogen in lysosomes. The accumulation of lysosomal glycogen occurs mainly in skeletal, cardiac and hepatic tissues.

[00115] One treatment option for lysosomal storage diseases is enzyme or protein replacement therapy. Replacement enzymes or proteins can be efficiently delivered to the lysosome of a specific target cell when they are therapeutically complexed with an antigen binding protein or ligand that specifically binds human ASGR1. See WO 2017/100467, incorporated herein by reference in its entirety for all purposes. Such a therapeutic complex may be administered to a subject, wherein the therapeutic complex may enter the lysosome of a target cell in the subject and provide an enzymatic activity that replaces an enzymatic activity associated with lysosomal storage disease. The human ASGR1 protein is a transmembrane protein that mediates endocytosis and lysosomal cleavage of glycoproteins with accessible terminal galactose or N-acetylgalactosamine residues in the liver. Therefore, proteins that bind and internalize together with human ASGR1 will be targeted to the lysosome. Proper delivery methods that target therapeutic molecules or complexes to human ASGR1 can be used to target therapeutic agents to lysosomes (eg, lysosomes in the liver).

[00116] Accordingly, some of the methods provided herein are methods for evaluating delivery of a therapeutic complex containing a lysosomal replacement protein or enzyme to the liver via human ASGR1 in vivo. For example, such methods may include (a) administering a therapeutic molecule or therapeutic complex to non-human animals described elsewhere herein, wherein the therapeutic molecule or therapeutic complex comprises a lysosomal replacement protein or enzyme (or a nucleic acid encoding a lysosomal replacement protein or an enzyme) and an antigen-binding protein that specifically binds human ASGR1, where ASGR1 mediates cell binding and uptake by the lysosomal compartment; and (b) assessing the presence or activity of a lysosomal replacement protein or enzyme in the liver of a non-human animal. The activity of a replacement protein or enzyme in the liver of a non-human animal can be assessed using known assays for a particular replacement protein or enzyme, or by measuring the degradation of various disease substrates in the lysosome using known assays.

[00117] As another example, the therapeutic molecule may be a nucleic acid encoding a therapeutic secreted protein. The liver plays an important role in the production of proteins that are secreted into the blood, including major plasma proteins, hemostasis and fibrinolysis factors, transport proteins, hormones, prohormones, and apolipoproteins. The human ASGR1 protein is a transmembrane protein that mediates endocytosis of certain glycoproteins in the liver. Therefore, molecules that complex with human ASGR1 can be internalized together with human ASGR1. Thus, a nucleic acid encoding a secreted therapeutic protein can be targeted to the liver by delivering it in a complex that targets human ASGR1. The nucleic acid can be internalized by ASGR1 and the liver can synthesize and secrete the therapeutic protein.

[00118] Accordingly, some of the methods provided herein are methods for evaluating delivery of a nucleic acid encoding a therapeutic secreted protein to the liver by human ASGR1 in vivo. For example, such methods may include (a) administering a nucleic acid (e.g., DNA) encoding a therapeutic secreted protein to a non-human animal described elsewhere herein, wherein the nucleic acid is delivered in a therapeutic complex that specifically binds to human ASGR1 , while ASGR1 mediates the internalization of the complex; and (b) assessing secreted levels (eg, serum levels) or activity of the therapeutic secreted protein in the non-human animal.

[00119] The production and secretion of a therapeutic protein can be assessed using any known methods. For example, expression of the introduced nucleic acid can be assessed by measuring the levels of the encoded mRNA in the liver of a non-human animal or the levels of the encoded therapeutic protein in the liver of a non-human animal using known assays. Secretion of a therapeutic protein can be assessed by measuring serum levels of the encoded therapeutic protein in a non-human animal using known assays. In addition, if the secreted therapeutic protein acts on a specific cell type, tissue, or organ, then the activity of the secreted therapeutic protein can be assessed in the target cell type, tissue, or organ.

B. Methods for evaluating the in vivo efficacy of a therapeutic complex in internalizing a liver cell surface target protein or a soluble target protein in the liver via human ASGR1-mediated internalization

[00120] Various methods are provided for using non-human animals containing the humanized Asgr1 locus described elsewhere in this document to evaluate the in vivo efficacy of a therapeutic complex designed to internalize a liver cell surface target protein or a soluble target protein in the liver via human ASGR1. Therapies often require the inactivation or blocking of one or more target molecules that act near or on the cell's surface. For example, antibody-based therapeutics often perform their function by binding to a specific antigen expressed on the cell surface or to a soluble ligand, thereby preventing the normal biological activity of the antigen. Therapeutic agents of this type typically perform their function by blocking the interaction between a cytokine and its receptor to attenuate or suppress cellular signaling. However, in certain cases it would be therapeutically advantageous to inactivate or inhibit the activity of the target molecule in a manner that does not necessarily include blocking its physical interaction with another component. One way to achieve such attenuation, not associated with blocking the target molecule, may be to reduce the extracellular concentration of the target molecule or on the cell surface. For example, the target molecule can be weakened or inactivated by facilitating or providing a physical link between the target molecule and an internalizing effector protein such as ASGR1. This can be achieved, for example, by using a polyspecific (eg, bispecific) antigen-binding molecule containing a first antigen-binding domain and a second antigen-binding domain. Each antigen-binding domain binds a separate molecule: the first specifically binds the target molecule, and the second specifically binds ASGR1. Through this type of physical intermolecular binding, the target molecule can be forcibly internalized into the cell along with ASGR1 and processed through an intracellular cleavage mechanism or otherwise attenuated, isolated or inactivated. See WO 2013/138400 and US 2013/0243775, which are incorporated herein by reference in their entirety for all purposes.

[00121] Because the human ASGR1 protein is a transmembrane protein that mediates endocytosis and lysosomal cleavage of glycoproteins with accessible terminal galactose or N-acetylgalactosamine residues in the liver, cell surface proteins that complex with human ASGR1 can be internalized along with human ASGR1, redirecting the cell surface target protein or soluble target protein to a cleavage compartment; or sequestering the cell surface target protein or soluble target protein in internal compartments or exosomes.

[00122] Accordingly, this document provides methods for using non-human animals containing a humanized Asgr1 locus, as described elsewhere in this document, to evaluate the in vivo efficacy of a therapeutic complex designed to internalize a liver cell surface target protein or soluble protein. -targets in the liver by human ASGR1. For example, such methods may include (a) administering a therapeutic complex to a non-human animal described elsewhere herein, wherein the therapeutic complex comprises a bispecific antigen-binding protein that specifically binds to a cell surface target protein or a soluble target protein and specifically binds with human ASGR1, where ASGR1 mediates the internalization of a cell surface target protein or a soluble target protein; and (b) assessing liver cell surface protein levels or activity of a liver cell surface target protein, or assessing expression levels or activity of a soluble target protein in the liver of a non-human animal. Administration of the therapeutic complex may be by any suitable method, as described elsewhere in this document.

[00123] Target cell surface proteins can include any cell surface protein expressed in the liver. Soluble target proteins may include any soluble protein expressed in the liver. Cell surface protein levels or activity of a liver cell surface target protein in the liver of a non-human animal can be assessed using known assays to measure levels of cell surface receptors and other proteins. Likewise, soluble protein levels can be assessed using known assays.

C. Administration of molecules to non-human animals

[00124] The methods disclosed herein include administering to a non-human animal various molecules (therapeutic molecules or complexes), including nucleic acids, proteins or protein complexes. The introduction may be by any method. For example, such molecules can be administered to a non-human animal, for example, via vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implantable-mediated delivery. device. As specific examples, the molecule can be introduced into a non-human cell or animal in a carrier such as a poly(lactic acid) (PLA) microsphere, a D,L-lactic acid-glycolic acid (PLGA) microsphere ), liposome, micelle, reverse micelle, lipid cochleate, or lipid microtubule. Some specific examples of delivery to a non-human animal include hydrodynamic delivery, virus-mediated delivery (eg, adeno-associated virus (AAV)-mediated delivery), and lipid nanoparticle-mediated delivery.

[00125] Administration of nucleic acids, proteins, or other components to non-human animals can be accomplished by hydrodynamic delivery (HDD). Hydrodynamic delivery has proven to be an ideal method for intracellular DNA delivery in vivo. To deliver the gene to parenchymal cells through the chosen blood vessel, only the required DNA sequences should be introduced, eliminating the safety concerns associated with current viral and synthetic vectors. When injected into the bloodstream, DNA is able to reach cells in the various tissues available to the blood. Hydrodynamic delivery uses the force generated by rapidly injecting a large volume of solution into non-compressible blood in the circulation to overcome the physical barriers of the endothelium and cell membranes that prevent large, non-membrane-penetrating compounds from entering parenchymal cells. In addition to DNA delivery, this method is applicable for efficient intracellular delivery of RNA, proteins and other small compounds in vivo. See, for example, Bonamassa et al. (2011) Pharm. Res. 28(4):694-701, incorporated herein by reference in its entirety for all purposes.

[00126] Administration of nucleic acids can also be accomplished by virus-mediated delivery, such as AAV-mediated delivery or lentivirus-mediated delivery. Other exemplary viruses/viral vectors include retroviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. Viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. Viruses may integrate into the host genome or alternatively not integrate into the host genome. Such viruses can also be engineered to weaken the immune system. Viruses may be replication competent or may be replication defective (eg, defective in one or more genes required for additional rounds of replication and/or virion packaging). Viruses can initiate transient expression, long-term expression (eg, at least 1 week, 2 weeks, 1 month, 2 months, or 3 months), or persistent expression (eg, Cas9 and/or gRNA). Exemplary viral titers (eg, AAV titers) include 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , and 10 ¹⁶ vector genomes/ml.

[00127] The ssDNA of the AAV genome consists of two open reading frames, Rep and Cap, and is flanked by two inverted terminal repeats that allow the synthesis of a complementary strand of DNA. When constructing a plasmid for transfer with AAV, the transgene is placed between two ITRs, and Rep and Cap can be provided in trans form. In addition to Rep and Cap, AAV may require a helper plasmid containing adenovirus genes. These genes (E4, E2a and VA) mediate AAV replication. For example, a transfer plasmid, Rep/Cap, and a helper plasmid can be transfected into HEK293 cells containing the adenovirus E1+ gene to generate infectious AAV particles. Alternatively, Rep, Cap, and adenovirus helper genes can be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses such as retroviruses.

[00128] Many AAV serotypes have been identified. These serotypes differ in the cell types they infect (ie, tropism), which allows certain cell types to be preferentially transduced. Serotypes for liver tissue include AAV7, AAV8 and AAV9, and in particular AAV8.

[00129] Tropism can be further refined using pseudotyping, which is the mixing of the capsid and genome of different viral serotypes. The use of pseudotyped viruses can improve transduction efficiency as well as alter tropism. Hybrid capsids derived from different serotypes can also be used to modify viral tropism. For example, AAV-DJ contains a hybrid capsid of eight serotypes and shows high infectivity in a wide range of cell types in vivo. AAV serotypes can also be changed through mutations. Other pseudotyped/modified AAV variants include AAV2/1, AAV2/6, AAV2/7, AAV2/8, AAV2/9, AAV2.5, AAV8.2 and AAV/SASTG.

[00130] Self-complementary AAV variants (scAAV) can be used to accelerate transgene expression. Since AAV is dependent on the cell's DNA replication mechanism, for the synthesis of the complementary strand of single-stranded DNA of the AAV genome, transgene expression can be slowed down. To eliminate this delay, scAAVs containing complementary sequences that are capable of spontaneous annealing upon infection can be used, eliminating the need for host cell DNA synthesis.

[00131] To increase packaging capacity, longer transgenes can be split between two AAV transfer plasmids, the first with a 3' splicing donor and the second with a 5' splicing acceptor. When the cells are co-infected, these viruses form concatemers, undergo splicing, and a full-length transgene can be expressed. While this allows longer transgene expression, such expression is less efficient. Similar methods for increasing capacity use homologous recombination. For example, a transgene can be split between two transfer plasmids, but with significant sequence overlap, so that co-expression induces homologous recombination and expression of the full-length transgene.

[00132] Administration of nucleic acids and proteins can also be accomplished by lipid nanoparticle (LNP) mediated delivery. For example, LNP-mediated delivery can be used to deliver guide RNA in the form of RNA. Delivery by such methods results in transient presence of guide RNA and biodegradable lipids improve clearance, improve tolerability and reduce immunogenicity. Lipid formulations can protect biological molecules from degradation while improving their uptake by cells. Lipid nanoparticles are particles containing many lipid molecules physically connected to each other by intermolecular forces. These include microspheres (including monolayer and multilayer vesicles, eg liposomes), dispersed phase in emulsion, micelles or internal phase in suspension. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins to be delivered. Compositions that contain cationic lipids are useful for delivering polyanions such as nucleic acids. Other lipids that may be included are neutral lipids (ie, uncharged or zwitterionic lipids), anionic lipids, helper lipids that improve transfection, and stealth lipids that increase the lifetime of the nanoparticles in vivo. Examples of suitable cationic lipids, neutral lipids, anionic lipids, helper lipids and invisible lipids can be found in WO 2016/010840 A1, incorporated herein by reference in its entirety for all purposes. An exemplary lipid nanoparticle may contain a cationic lipid and one or more other components. In one example, the other component may include a helper lipid such as cholesterol. In another example, other components may include a helper lipid such as cholesterol and a neutral lipid such as DSPC. In another example, other components may include a helper lipid such as cholesterol, an optional neutral lipid such as DSPC, and a stealth lipid such as S010, S024, S027, S031, or S033.

[00133] The delivery method may be selected to reduce immunogenicity. Different methods can impart different pharmacodynamic or pharmacokinetic properties to the molecule delivered to the subject. For example, different methods may result in different tissue distributions, different half-lives, or different time distributions. Some delivery modes (for example, delivery of a vector that is a nucleic acid that persists in the cell through autonomous replication or genomic integration) result in more stable expression and presence of the molecule, while other modes are transient and less stable (for example, delivery of RNA or protein). Delivery of components via a more erratic mechanism, such as RNA or protein, can ensure that the components are present and only active for a short period of time, and can reduce immunogenicity.

[00134] In vivo administration may be by any suitable route, including, for example, parenteral, intravenous, subcutaneous, intra-arterial, or intraperitoneal. Systemic routes of administration include, for example, parenteral routes such as intravenous, intra-arterial, subcutaneous and intraperitoneal routes. A specific example is intravenous infusion. Topical routes of administration may also be used.

[00135] Compositions containing nucleic acids or proteins can be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients, or excipients. The composition may depend on the chosen route of administration. The term "pharmaceutically acceptable" means that the carrier, diluent, excipient or excipient is compatible with the other ingredients of the formulation and is not substantially harmful to the patient receiving it.

[00136] The frequency of administration and the number of doses, among other factors, may depend on the half-life of the administered components and the route of administration. Administration of nucleic acids or proteins to a non-human animal may be performed one or more times over a given period of time. For example, the administration can be performed at least twice within a certain period of time, at least three times within a certain period of time, at least four times within a certain period of time, at least five times within a certain period of time, according to at least six times within a specified period of time, at least seven times within a specified period of time, at least eight times within a specified period of time, at least nine times within a specified period of time, at least ten times within a specified period of time a certain period of time, at least eleven times, at least twelve times within a certain period of time, at least thirteen times within a certain period of time, at least fourteen times within a certain period of time, at least fifteen times within a certain period of time a specified period of time, at least sixteen times during a specified period of time, at least seventeen times during a specified period of time, at least eighteen times during a specified period of time, at least nineteen times during a specified period of time, or at least at least twenty times in a given period of time.

IV. Methods for obtaining non-human animals containing a humanized Asgr1 locus

[00137] Various methods are provided for obtaining a non-human animal containing the humanized Asgr1 locus disclosed elsewhere in this document. Any conventional method or protocol for producing a genetically modified organism is suitable for producing such a genetically modified non-human animal. See, for example, Cho et al. (2009) Current Protocols in Cell Biology 42:19.11:19.11.1-19.11.22 and Gama Sosa et al. (2010) Brain Struct. Funct. 214(2-3):91-109, each of which is incorporated herein by reference in its entirety for all purposes. Such genetically modified non-human animals can be obtained, for example, by knocking a gene at the target Asgr1 locus.

[00138] For example, a method for obtaining a non-human animal containing a humanized Asgr1 locus may include: (1) modifying the genome of a pluripotent cell to insert a humanized Asgr1 locus; (2) identifying or selecting a genetically modified pluripotent cell containing a humanized Asgr1 locus; (3) introducing the genetically modified pluripotent cell into a non-human host animal embryo; and (4) implantation and gestation of a host embryo by a surrogate mother. Optionally, a host embryo containing a modified pluripotent cell (eg, a non-human ES cell) may be incubated to the blastocyst stage prior to implantation and gestation in a surrogate mother to produce a non-human F0 animal. The surrogate mother can then produce an F0 generation non-human animal containing the humanized Asgr1 locus.

[00139] The methods may further comprise identifying a cell or animal having a modified target genomic locus. Various methods can be used to identify cells and animals having the targeted genetic modification.

[00140] The screening step may include, for example, a quantitative analysis to assess the modification of the allele (MOA) in the parent chromosome. For example, quantitative analysis can be performed using quantitative PCR, such as real-time PCR (qPCR). Real-time PCR may use a first primer set that recognizes a target locus and a second primer set that recognizes a non-target reference locus. The primer set may contain a fluorescent probe that recognizes the amplified sequence.

[00141] Other examples of suitable quantitative assays include fluorescence-mediated in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization with immobilized probe(s), INVADER® probes, TAQMAN® probes from Molecular Beacon, or probe technology ECLIPSE™ (see, for example, US 2005/0144655, incorporated herein by reference in its entirety for all purposes).

[00142] An example of a suitable pluripotent cell is an embryonic stem (ES) cell (eg, mouse ES cell or rat ES cell). A modified pluripotent cell can be obtained, for example, by recombination by (a) introducing into the cell one or more targeting vectors containing an intercalated nucleic acid flanked by 5' and 3' homology arms corresponding to the 5' and 3' target sites where the insertion nucleic acid contains the humanized Asgr1 locus; and (b) identifying at least one cell containing in its genome an intercalated nucleic acid integrated into a target genomic locus. Alternatively, a modified pluripotent cell can be obtained by (a) introducing into the cell: (i) a nuclease-based agent, wherein the nuclease-based agent induces a single or double strand break at a recognition site within the target genomic locus; and (ii) one or more targeting vectors comprising an intercalary nucleic acid flanked by 5' and 3' homology arms corresponding to 5' and 3' target sites sufficiently close to the recognition site where the intercalation nucleic acid contains a humanized locus Asgr1; and (c) identifying at least one cell containing the modification (eg, an integrated insertion nucleic acid) at the target genomic locus. Any nuclease-based agent that induces a single or double strand break at the desired recognition site can be used. Examples of suitable nucleases include transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), meganuclease, and regularly spaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems or components of such systems (e.g. , CRISPR/Cas9). See, for example, US 2013/0309670 and US 2015/0159175, each of which is incorporated herein by reference in its entirety for all purposes.

[00143] The donor cell can be introduced into the host embryo at any stage, such as the blastocyst stage or early morula stage (ie, 4 cell stage or 8 cell stage). Get offspring capable of transmitting the genetic modification through the germ line. See, for example, US Pat. No. 7,294,754, which is incorporated herein by reference in its entirety for all purposes.

[00144] Alternatively, the method for producing non-human animals described elsewhere herein may include: (1) modifying the single cell stage embryonic genome to insert a humanized Asgr1 locus using the methods described above to modify pluripotent cells; (2) selection of genetically modified embryos; and (3) implantation and gestation of a genetically modified embryo by a surrogate mother. Get offspring capable of transmitting the genetic modification through the germ line.

[00145] Nuclear transfer techniques can also be used to produce non-human mammalian animals. Briefly, nuclear transfer methods may include the steps of: (1) enucleating an oocyte or providing an enucleated oocyte; (2) isolating or providing donor cells or nuclei to be combined with the enucleated oocyte; (3) inserting a cell or nucleus into an enucleated oocyte to obtain a reconstructed cell; (4) implanting the reshaped cell into the uterus of a non-human animal to produce an embryo; and (5) allowing the embryo to develop. In such methods, oocytes are usually obtained from euthanized animals, although they can also be isolated from the fallopian tubes and/or ovaries of living animals. Prior to enucleation, oocytes can be incubated in a variety of well known media in order to mature them. Enucleation of the oocyte can be accomplished by a number of well known methods. Insertion of a donor cell or nucleus into an enucleated oocyte to obtain a remodeled cell can be achieved by microinjection of the donor cell under the zona pellucida prior to fusion. Fusion can be induced by applying a DC electrical pulse to the contact/fusion surface (electrofusion), by exposing cells to fusion-promoting chemicals such as polyethylene glycol, or by using an inactivated virus such as Sendai virus. The reconstructed cell can be activated by electrical and/or non-electrical methods before, during and/or after the fusion of the nuclear donor and the recipient oocyte. Activation methods include electrical impulses, chemically induced shock, sperm insertion, increased levels of divalent cations in the oocyte, and decreased cellular protein phosphorylation (eg, with kinase inhibitors) in the oocyte. Activated remodeled cells or embryos can be cultured in well known media and then transferred into the uterus of an animal. See, for example, US 2008/0092249, WO 1999/005266, US 2004/0177390 and WO 2008/017234 and US Pat. No. 7,612,250, each of which is incorporated by reference in its entirety for all purposes.

[00146] The various methods provided herein produce a non-human genetically modified F0 animal, wherein the cells of the genetically modified F0 animal contain the humanized Asgr1 locus. It should be noted that depending on the method used to obtain the F0 animal, the number of cells in the F0 animal that have the humanized Asgr1 locus will vary. The introduction of donor ES cells into an early morula embryo from an appropriate organism (e.g., a mouse embryo at the 8 cell stage), for example, using the VELOCIMOUSE® method, allows to obtain a larger percentage of the cell population of F0 animals containing cells having a nucleotide sequence of interest, containing the targeted genetic modification. For example, at least 50%, 60%), 65%), 70%, 75%), 85%, 86%, 87%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cellular contribution of the non-human F0 animal may contain a cell population having the target modification.

[00147] The cells of the genetically modified F0 animal may be heterozygous for the humanized Asgr1 locus or may be homozygous for the humanized Asgr1 locus.

[00148] All patent applications, websites, other publications, serial numbers and the like mentioned above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated for inclusion by reference. If different sequence variants are associated with an access number at different times, then the variant associated with the access number at the actual filing date of this application is implied. Valid filing date means the earliest valid filing date or priority application filing date, with reference to an access number, if applicable. Similarly, if different versions of a publication, website, and the like are published at different times, the earliest published version on the actual filing date is assumed, unless otherwise indicated. Any feature, step, element, embodiment, or aspect of the present invention may be used in conjunction with any other, unless specifically noted otherwise. Although for the purpose of clarity of understanding the present invention has been described in some detail by means of illustrations and examples, it will be obvious that certain changes and modifications can be made in practice within the scope of the appended claims.

BRIEF DESCRIPTION OF SEQUENCES

[00149] The nucleotide and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and a three-letter code for amino acids. Nucleotide sequences are given according to standard rules, starting at the 5' end of the sequence and moving forward (ie, from left to right on each line) to the 3' end. Only one strand of each nucleotide sequence is shown, but the complementary strand is considered to be included by any reference in the sequence shown. Amino acid sequences are given according to the standard rules, starting from the amino end of the sequence and moving forward (ie from left to right in each line) to the carboxy end.

[00150] Table 1. Description of sequences

EXAMPLES

Example 1 Generation of mice containing the humanized Asgr1 locus

[00151] The asialoglycoprotein receptor (Ashwell receptor, ASGR) is a predominantly hepatic membrane-bound carbohydrate-binding protein receptor (~33 kDa) belonging to the class of C-type lectin receptors. ASGR binds to glycoproteins with terminal galactose or N-acetylgalactosamine (GalNac) motifs. It can remove desialylated glycoproteins from the bloodstream via receptor-mediated endocytosis. The ligand undergoes lysosomal cleavage while the ASGR returns to the cell surface. The receptor is a heterooligomer of two subunits, ASGR1 and ASGR2 (H1 and H2). As a highly efficient liver-specific endocytosis receptor, ASGR1 can be used for liver-specific delivery of therapeutic agents such as antibodies, small molecules (as part of antibody-drug conjugates), and DNA. However, the antibodies and bispecific antibodies to the extracellular domain of human ASGR1 that we have obtained do not bind to the mouse Asgr1 orthologue (Biacore data not shown). Asgr1 humanized mice were thus prepared for use in validating liver-specific delivery of various therapeutic agents using a number of different approaches.

[00152] Received a large targeting vector containing a 5'-arm homology containing 24 T. O. from bMQ-69B11, and a 3' homology arm containing 67 kb. from bMQ-69B11, to replace coding exons 3-8 (through the stop codon and 3'-UTR to the sequence immediately following the 3'-UTR) of mouse Asgr1 with the corresponding sequence of human ASGR1. The encoded Asgr1 protein will contain a mouse Asgr1 transmembrane domain followed by a supercoiled domain and a human C-type lectin domain. See Figures 2A and 3. To generate the mutant allele, components of the CRISPR/Cas9 system were introduced into F1H4 mouse embryonic stem cells along with a large targeting vector. To detect endogenous mouse allele loss, allele loss assays were performed using the primers and probes shown in Table 2, and to detect humanized allele acquisition, allele acquisition assays were performed using the primers and probes shown in Table 3. Allele loss assays and allele acquisition assays are described, for example, in US 2014/0178879; US 2016/0145646; WO 2016/081923 and Frendewey et al. (2010) Methods Enzymol. 476:295-307, which are incorporated herein by reference in their entirety for all purposes.

[00153] Table 2. Mouse TAQMAN® allele loss assays

[00154] Table 3. Human TAQMAN® Allele Acquisition Assays

[00155] F0 mice were then generated using the VELOCIMOUSE® method. See, for example, US 7576259; US 7659442; US 7294754; US 2008/007800 and Poueymirou et al. (2007) Nature Biotech. 25(1):91-99, which are incorporated herein by reference in their entirety for all purposes. The portion of the intron upstream of coding exon 3 was also humanized. Total 1863 b.p. the mouse Asgr1 sequence was changed to 3907 bp. human ASGR1 sequences. The cassette loxP-hUb1-em7-hygromycin resistance gene-polyadenylation signal-mPrm 1-Crei-polyadenylation signal-1oxP (5218 bp) was also inserted downstream of the human 3'-UTR with an intermediate sequence of about 190 bp. From the human 3' sequence, the 3' UTR just before the cassette. The resulting partially humanized mouse Asgr1 allele with a self-removing hygromycin resistance cassette is set forth in SEQ ID NO: 21 (designated as allele 7302). The boundary portions of the sequence A, B and C in figure 2A set out under SEQ ID NO: 18, 19 and 20, respectively. Comparison of human ASGR1 protein (SEQ ID NO: 1), mouse Asgr1 protein (SEQ ID NO: 2) and partially humanized mouse Asgr1 protein (SEQ ID NO: 3) is shown in Figure 3.

[00156] After removal of the self-removing Cre recombinase cassette, loxP and cloning sites (77 bp) remain below the human 3'-UTR with an intermediate sequence of approximately 190 bp. from the human 3' sequence after the 3'UTR just before the remaining loxP. See Figure 2B. The resulting partially humanized cassette-deleted mouse Asgr1 allele is set forth in SEQ ID NO: 24 (designated allele 7303). Boundary sections of the sequence A and C in figure 2B set out under SEQ ID NO: 22 and 23, respectively.

Example 2 Validation of mice containing the humanized Asgr1 locus

[00157] To validate Asgr1 humanized mice (Asgr1 ^hu/hu ) as a valid model, Asgr1 ^hu/hu mice were phenotyped and their phenotype compared to that of wild-type littermates. Asgr1 ^hu/hu mice showed no difference in plasma lipid levels (total cholesterol, triglycerides, HDL-C, LDL-C) compared to wild-type littermates. See Figure 4. Similarly, Asgr1 ^hu/hu mice showed no difference in body weight or blood glucose levels compared to wild-type littermates. See Figure 5. The human ASGR1 protein was co-localized to liver cell membranes, similar to mouse Asgr1. See Figure 6. Finally, Asgr1 ^hu/hu mice express human ASGR1 protein on liver cell membranes and have a normal plasma lipid profile.

Ways

[00158] Evaluation of circulating lipid levels in Asgr1 humanized mice. Plasma from male Asgr1 humanized mice (Asgr1 ^hu/hu ) and their wild-type littermates (Asgr1 ^+/+ ) was collected on an empty stomach and analyzed for serum lipids (triglycerides (TG)), total cholesterol, low-density lipoprotein cholesterol ( LDL)-C)), high-density lipoprotein cholesterol (HDL-C)) using an ADVIA® Chemistry XPT System (Siemens) serum biochemical analyzer. N=8/group, age 11 weeks. Data expressed as mean ± SEM for each.

[00159] Blood glucose assessment. Blood glucose was measured in blood collected from the tip of the tail using an Accu-Chek (Roche) glucometer on an empty stomach (16-hour fast) and after a meal (not on an empty stomach).

[00160] Western blotting of Asgr1. Whole livers were harvested from Asgr1 humanized and WT mice (n=8/genotype) and stored frozen at 80° C. until processing. For each whole liver sample, a piece of frozen liver weighing ~40 mg was cut out and each piece was placed in a Dounce homogenizer and homogenized until a homogeneous suspension was obtained. The cytosolic and membrane fractions of each liver sample were separated using a commercial detergent kit (Thermo #89842) according to the manufacturer's soft tissue protocol. After the cytosolic fraction and the membrane fraction of each sample were isolated, BCA protein quantitation (Thermo #23225) was analyzed for two fractions from each sample according to the microplate procedure kit protocol. Western blot samples were prepared for each cytosolic fraction and membrane fraction of each sample using 5X reduction dye. All samples were prepared at 0.8 μg/μl and 20 μg total protein from each sample was loaded onto western blot gels. hASGR1 was detected using an anti-hASGR1 rabbit polyclonal antibody (Abgent #AP16133a, diluted 1:1000 in 2.5% blocking milk in TBS-T). Because the antibody was cross-reactive with mouse protein, mouse Asgr1 in litter mice was detected using the same antibody. The secondary antibody for hASGR1 detection was donkey anti-rabbit IgG-HRP (Jackson #711-035-152, at 0.1 μg/ml in 2.5% blocking milk in TBS-T). As a loading control for cytosolic fractions, GAPDH was detected in all samples using a rabbit anti-GAPDH monoclonal antibody (Cell Signaling #2118S, diluted 1:10,000 in 2.5% blocking milk in TBS-T). The secondary antibody for GAPDH detection was donkey anti-rabbit IgG-HRP (Jackson #711-035-152, at 0.1 μg/ml in 2.5% blocking milk in TBS-T). As a loading control for membrane fractions, transferrin receptor was detected in all samples using a rabbit polyclonal anti-transferrin receptor antibody (R&D #AF2472, at a concentration of 0.25 μg/ml in 2.5% blocking milk in TBS-T). The secondary antibody for transferrin receptor detection was donkey anti-goat IgG-HRP (Jackson #705-035-147, at 0.2 μg/mL in 2.5%) blocking milk in TBS-T).

Example 3. Obtaining vectors based on adeno-associated virus with a heterologous epitope

[00161] An experiment was then performed to determine if the myc-ASGR1 bispecific antibody could retarget scAAV-N587myc viral particles to liver cells expressing humanized ASGR1 in vivo in mice obtained in Example 1. To test this, viral particles.

[00162] AAV capsid proteins were modified to contain one of several heterologous epitopes: FLAG, c-myc, hexahistidine, etc. by PCR to obtain a plasmid encoding the recombinant capsid protein. Briefly, the sequence encoding FLAG, c-myc or hexahistidine was inserted in-frame after the codon encoding AAV2 N587 or Q585 of the AAV6 VP1 capsid protein.

[00163] Production of adeno-associated viruses was performed using the HEK293 cell triple transfection method (see, for example, Erik Arden and Joseph M. Metzger, J Biol Methods. 2016; 3(2)). Cells were seeded one day prior to PEFpro-mediated (Polyplus transfection, New York, NY) transfection with the appropriate vectors:

- helper plasmid, pHelper (Agilent, Cat. No. 240074);

- a plasmid encoding the wild-type or modified AAV rep/cap gene (pAAV RC2 (Cell biolabs, Cat. No. VPK-422)), for example, pAAV RC2/6 (Cell Biolabs, Cat. No. VPK-426), pAAV RC2- N587myc, pAAV RC2/6-Q585myc, etc.; And

- a plasmid encoding the AAV nucleotide sequence and ITR sequences of interest, e.g. pscAAV-CMV-eGFP, pAAV-CMVGFP (Agilent cat. no. 240074), pAAV-EF 1a-eGFP or pAAV-CAGG-eGFP, etc.

[00164] Seventy-two hours after transfection, medium was harvested and cells were lysed in buffer [50 mM Tris-HCl, 150 mM NaCl, and 0.5% sodium deoxycholate (Sigma, cat. no. D6750-100G)]. Then, prior to incubation at 37° C. for 60 minutes, benzonase (Sigma, St. Louis, MO) was added to both the medium and the cell lysate to a final concentration of 0.5 U/μl. The cell lysate was centrifuged at 4000 rpm for 30 min. Cell lysate and medium were combined and precipitated with PEG 8000 (Teknova, cat. no. P4340) at a final concentration of 8%. The pellet was resuspended in 400 mM NaCl and centrifuged at 10,000 g for 10 minutes. Viruses in the supernatant were pelleted by ultracentrifugation at 149,000 g for 3 hours and titrated using qPCR.

[00165] In a qPCR titration of AAV genomes, AAV samples were treated with DNase I (Thermofisher Scientific, cat. no. EN0525) at 37° C. for one hour and lysed using the DNA extract All Reagents kit (Thermofisher Scientific, cat. no. 4403319). Encapsulated viral genomes were quantified using the QuantStudio 3 Real-Time PCR System (Thermofisher Scientific) using AAV2 ITR primers. The AAV2 ITR primer sequences are 5'-GGAACCCCTAGTGATGGAGTT-3' (forward primer for ITR; SEQ ID NO: 36) and 5'-CGGCCTCAGTGAGCGA-3' (reverse primer for ITR; SEQ ID NO: 37) (Aurnhammer et al ., 2012) derived from the left internal inverted repeat (ITR) sequence from AAV and the right internal inverted repeat (ITR) sequence from AAV, respectively. The probe sequence for AAV2 ITR is 5'-6-FAM-CACTCCCTCTCTGCGCGCTCG-TAMRA-3' (SEQ ID NO: 38) (Aurnhammer et al. (2012) Hum. Gene Ther. Methods 23:18 28). After the activation step at 95°C for 10 minutes, a two-stage PCR cycle was performed at 95°C for 15 seconds and 60°C for 30 seconds for 40 cycles. TaqMan Universal PCR Master Mix (Thermofisher Scientific, cat. no. 4304437) was used for qPCR. Plasmid DNA (Agilent, Cat. No. 240074) was used as a standard for determining absolute titers.

[00166] Received vectors based on adeno-associated virus containing a capsid with an inserted c-myc epitope. In this example, a c-myc epitope (EQKLISEEDL; SEQ ID NO: 25) was inserted between amino acids N587 and R588 of the VP1 AAV2 capsid protein, i. the nucleotide sequence encoding the c-myc epitope (GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG; SEQ ID NO: 26) was inserted into the pAAV RC2 plasmid (Cell Biolabs, Inc., San Diego, CA, USA), and modified pAAV RC2-N587Myc plasmid was used to encode a modified capsid protein for tropism neutralized AAV viral vectors.

[00167] Specifically, a first polymerase chain reaction (PCR) product containing (5' to 3') a BsiWl restriction site, a nucleotide sequence between positions 3050 and 3773 of pAAV RC2, and a nucleotide sequence of a c-myc epitope with sticky ends, and a second PCR product containing (from 5' to 3') the nucleotide sequence of the c-myc epitope with sticky ends, the nucleotide sequence between positions 3774 and 4370 of pAAV RC2, and the Pme1 restriction site was generated using the primers set forth in Table 4. Plasmid pAAV RC2-N587Myc (i.e., pAAV RC2 plasmid modified to encode the c-myc epitope between amino acids N587 and R588 of the VP1 capsid protein) was generated by digesting pAAV RC2 with BsiW1 (New England Biolabs, R0553L) and Pmel (New England Biolabs, R0560L) and inserting two PCR products by ligation-independent cloning as described in Li et al. (2012) Methods Mol. Biol. 852:51-59.

[00168] Table 4

[00169] Specifically, a gblock DNA fragment containing positions 3700 and 3940 from pAAV RC2/6 with a c-myc epitope sequence inserted between 3757 and 3758 was ordered from Integrated DNA Technologies (Coralville, Iowa). Plasmid pAAV RC2/6-Q585Myc was generated by inserting a gblock fragment into pAAV RC2/6 digested with MscI (New England Biolabs cat. no. R0534L) and AflII (New England Biolabs cat. no. R0520L) by ligation-independent cloning described in Li et al. (2012) Methods Mol. Biol. 852:51-59.

[00170] In particular, pscAAV-CMV-eGFP was generated by introducing a GFP fragment into the pscAAV MCS vector (Cell Biolabs, cat. no. VPK-430) using a restriction site for BamHI and NotI. Plasmid pAAV-EF1a-eGFP and pAAV-CAGG-eGFP were synthesized de novo at Thermofisher Scientific (Waltham, MA).

Example 4 Bispecific Antibody Mediated Internalization of scAAV-N587Myc Particles in Mice with a Humanized ASGR1 Loci in Vivo

[00171] To determine if an anti-myc-ASGR1 bispecific antibody can retarget scAAV2-N587myc-CMV-eGFP viral vectors to hASGR1-expressing liver cells in vivo in mice genetically engineered such that their liver cells express hASGR1 in the presence of C57BL/6 , and wild-type C57BL/6 control mice were intravascularly injected with 1×10 ¹¹ (titrated with qPCR) wild-type scAAV2-CMV-eGFP alone or scAAV2-N587myc-CMV-eGFP viral vectors in combination with myc-ASGR1 bispecific antibody at a ratio of 1:8 viral genome and antibody molecules. Controls included mice treated with saline [250 mM NaCl] or scAAV2-N587myc-CMV-eGFP viral vector alone. Ten days after injection, mice were sacrificed and transcardially perfused using 4% PFA. Organs such as liver, kidney and heart were harvested and dehydrated in 15% sucrose and then in 30% sucrose. Organs were then cryosectioned on glass slides and stained with chicken anti-EGFP antibody (Jackson ImmunoResearch Labs, Inc., West Grove, PA, USA) and secondary antibody to chicken antibody conjugated to Alexa-488 (Jackson ImmunoResearch Labs, Inc., West Grove, Pennsylvania) (Figures 8A-8C). GFP-positive cells were detected in the liver of transgenic animals modified to express ASGR1 in the liver and injected with wild-type scAAV2-CMV-eGFP or scAAV2-N587myc-CMV-eGFP in combination with an anti-myc-ASGR1 bispecific antibody (Figures 8A(i) and 8A(iv)), and in the liver of wild-type C57BL/6 mice injected with wild-type scAAV2-CMV-eGFP (Figure 8A(v)). GFP was not detected in either spleen or kidney samples (Figures 8B and 8C), nor in liver, spleen or kidney samples taken from any animal injected with saline or the scAAV2-N587myc-CMV-eGFP viral vectors alone (Figures 8A( ii, iii, vi, vii)), nor in liver samples taken from wild-type C57BL/6 animals injected with scAAV2-N587myc-CMV-eGFP in combination with an anti-myc-ASGR1 bispecific antibody (Figure 8A(viii)). Thus, the combination of the scAAV2-N587myc-CMV-eGFP viral vectors and the myc-ASGR1 bispecific antibody only infected those (liver) cells expressing hASGR1, strongly suggesting that the scAAV2-CMV-eGFP viral vector was inactivated by capsid protein modification, for example, the natural tropism of a scAAV-based viral vector can be neutralized, for example, with a c-myc epitope, and such viral vectors can be specifically reactivated, for example, specifically retargeted, for example, to liver cells in vivo, for example, with bispecific antibodies to myc-ASGR1.

[00172] Similarly, to determine whether anti-myc-ASGR1 bispecific antibodies can retarget ssAAV2-N587myc-CAGG-eGFP viral vectors to hASGR1-expressing liver cells in vivo, mice genetically modified such that their liver cells express hASGR1 in the presence of C57BL /6, and wild-type C57BL/6 control mice were intravascularly injected with 2.18×10 ¹¹ (titrated by qPCR) wild-type ssAAV2-CAGG-eGFP alone or ssAAV2-N587myc-CAGG-eGFP viral vectors in combination with a bispecific antibody to myc -ASGR1 at a ratio of 1:4 of the viral genome and antibody molecules. Controls included mice treated with PBS or the ssAAV2-N587myc-CAGG-eGFP viral vector alone. Four weeks after injection, mice were sacrificed and transcardially perfused using 4% PFA. Organs such as liver, kidney and heart were harvested and dehydrated in 15% sucrose and then in 30% sucrose. Organs were then cryosectioned on glass slides and stained with chicken anti-EGFP antibody (Jackson ImmunoResearch Labs, Inc., West Grove, PA, USA) and secondary antibody to chicken antibody conjugated to Alexa-488 (Jackson ImmunoResearch Labs, Inc., West Grove, PA) (Figures 9A-90). GFP-positive cells were detected in the liver of transgenic animals modified to express ASGR1 in the liver and injected with wild-type ssAAV2-CAGG-eGFP or ssAAV2-N587myc-CAGG-eGFP in combination with an anti-myc-ASGR1 bispecific antibody (Figures 9E-9F, 9P - 9R), and in the liver of wild-type C57BL/6 mice injected with wild-type ssAAV2-CAGG-eGFP (Figure 9B - 9C). Surprisingly, the efficiency of infection with ssAAV2-N587myc-CAGG-eGFP in combination with an anti-myc-ASGR1 bispecific antibody is much higher than with WT ssAAV2-CAGG-GFP (Figures 9E-9F, 9P-9R). GFP was not detected or practically not detected either in liver samples from any animal injected with saline or only with the ssAAV2-N587myc-CAGG-eGFP viral vector (Figures 9A, 9D, 9G-9L)), nor in liver samples taken from animals C57BL/6 wild-type, which were injected with ssAAV2-N587myc-CAGG-eGFP in combination with bispecific antibody to myc-ASGR1 (figure 9M - 90). Thus, the combination of the scAAV2-N587myc-CAGG-eGFP viral vectors and the myc-ASGR1 bispecific antibody infected only those cells (liver) expressing hASGR1, strongly suggesting that the ssAAV2-N587myc-CAGG-eGFP viral vector was inactivated by modification of the capsid protein, e.g., the natural tropism of a scAAV-based viral vector can be neutralized, e.g., by a c-myc epitope, and such viral vectors can be specifically reactivated, e.g. using bispecific antibodies to myc-ASGR1.

[00173] This example demonstrates that ASGR1 humanized mice can be used to test potential therapeutics that specifically bind to human ASGR1 for targeted delivery to liver cells.

--->

SEQUENCE LIST

110 Regeneron Pharmaceuticals, Inc.

Mujika, Alejo

Gusarov, Victoria

Wang, Cheng

Kyratsus, Christ

Streams, Terra

Signar, Katherine

Martin, Joel

120 NON-HUMAN ANIMALS CONTAINING THE HUMANIZED ASGR1 LOCUS

130 009108.362WO1

150 62525.524

151 2017-06-27

160 42

170 Patent In version 3.5

210 1

211 291

212 PROTEIN

213

220

221 OTHER_CHARACTERISTICS

222 (1)..(40)

223 Cytoplasmic domain

220

221 OTHER_CHARACTERISTICS

222 (41)..(61)

223 Transmembrane domain

220

221 OTHER_CHARACTERISTICS

222 (61)..(123)

223 Supercoiled domain

220

221 OTHER_CHARACTERISTICS

222 (161)..(278)

223 C-type lectin domain

400 1

Met Thr Lys Glu Tyr Gln Asp Leu Gln His Leu Asp Asn Glu Glu Ser

1 5 10 15

Asp His His Gln Leu Arg Lys Gly Pro Pro Pro Pro Gln Pro Leu Leu

20 25 30

Gln Arg Leu Cys Ser Gly Pro Arg Leu Leu Leu Leu Ser Leu Gly Leu

35 40 45

Ser Leu Leu Leu Leu Val Val Val Cys Val Ile Gly Ser Gln Asn Ser

50 55 60

Gln Leu Gln Glu Glu Leu Arg Gly Leu Arg Glu Thr Phe Ser Asn Phe

65 70 75 80

Thr Ala Ser Thr Glu Ala Gln Val Lys Gly Leu Ser Thr Gln Gly Gly

85 90 95

Asn Val Gly Arg Lys Met Lys Ser Leu Glu Ser Gln Leu Glu Lys Gln

100 105 110

Gln Lys Asp Leu Ser Glu Asp His Ser Ser Leu Leu Leu His Val Lys

115 120 125

Gln Phe Val Ser Asp Leu Arg Ser Leu Ser Cys Gln Met Ala Ala Leu

130 135 140

Gln Gly Asn Gly Ser Glu Arg Thr Cys Cys Pro Val Asn Trp Val Glu

145 150 155 160

His Glu Arg Ser Cys Tyr Trp Phe Ser Arg Ser Gly Lys Ala Trp Ala

165 170 175

Asp Ala Asp Asn Tyr Cys Arg Leu Glu Asp Ala His Leu Val Val Val

180 185 190

Thr Ser Trp Glu Glu Gln Lys Phe Val Gln His His Ile Gly Pro Val

195 200 205

Asn Thr Trp Met Gly Leu His Asp Gln Asn Gly Pro Trp Lys Trp Val

210 215 220

Asp Gly Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Glu Gln

225 230 235 240

Pro Asp Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala

245 250 255

His Phe Thr Asp Asp Gly Arg Trp Asn Asp Asp Val Cys Gln Arg Pro

260 265 270

Tyr Arg Trp Val Cys Glu Thr Glu Leu Asp Lys Ala Ser Gln Glu Pro

275 280 285

Pro Leu Leu

290

210 2

211 284

212 PRT

213 Mus muscle

220

221 OTHER_CHARACTERISTICS

222(1)..(39)

223 Cytoplasmic domain

220

221 OTHER_CHARACTERISTICS

222 (40)..(60)

223 Transmembrane domain

220

221 OTHER_CHARACTERISTICS

222 (60)..(122)

223 Supercoiled domain

220

221 OTHER_CHARACTERISTICS

222 (160)..(277)

223 C-type lectin domain

400 2

Met Thr Lys Asp Tyr Gln Asp Phe Gln His Leu Asp Asn Asp Asn Asp

1 5 10 15

His His Gln Leu Arg Arg Gly Pro Pro Thr Pro Arg Leu Leu Gln

20 25 30

Arg Leu Cys Ser Gly Ser Arg Leu Leu Leu Leu Ser Ser Ser Ser Leu Ser

35 40 45

Ile Leu Leu Leu Val Val Val Cys Val Ile Thr Ser Gln Asn Ser Gln

50 55 60

Leu Arg Glu Asp Leu Leu Ala Leu Arg Gln Asn Phe Ser Asn Leu Thr

65 70 75 80

Val Ser Thr Glu Asp Gln Val Lys Ala Leu Ser Thr Gln Gly Ser Ser

85 90 95

Val Gly Arg Lys Met Lys Leu Val Glu Ser Lys Leu Glu Lys Gln Gln

100 105 110

Lys Asp Leu Thr Glu Asp His Ser Ser Leu Leu Leu His Val Lys Gln

115 120 125

Leu Val Ser Asp Val Arg Ser Leu Ser Cys Gln Met Ala Ala Phe Arg

130 135 140

Gly Asn Gly Ser Glu Arg Thr Cys Cys Pro Ile Asn Trp Val Glu Tyr

145 150 155 160

Glu Gly Ser Cys Tyr Trp Phe Ser Ser Val Arg Pro Trp Thr Glu

165 170 175

Ala Asp Lys Tyr Cys Gln Leu Glu Asn Ala His Leu Val Val Val Thr

180 185 190

Ser Arg Asp Glu Gln Asn Phe Leu Gln Arg His Met Gly Pro Leu Asn

195 200 205

Thr Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Lys Trp Val Asp

210 215 220

Gly Thr Asp Tyr Glu Thr Gly Phe Gln Asn Trp Arg Pro Glu Gln Pro

225 230 235 240

Asp Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His

245 250 255

Phe Thr Thr Asp Gly Arg Trp Asn Asp Asp Val Cys Arg Arg Pro Tyr

260 265 270

Arg Trp Val Cys Glu Thr Lys Leu Asp Lys Ala Asn

275 280

210 3

211 290

212 PROTEIN

213 Artificial sequence

220

223 Synthetic

220

221 OTHER_CHARACTERISTICS

222(1)..(39)

223 Cytoplasmic domain

220

221 OTHER_CHARACTERISTICS

222 (40)..(60)

223 Transmembrane domain

220

221 OTHER_CHARACTERISTICS

222 (60)..(122)

223 Supercoiled domain

220

221 OTHER_CHARACTERISTICS

222 (62)..(290)

223 Residues encoded by the introduced human exon

220

221 OTHER_CHARACTERISTICS

222 (160)..(277)

223 C-type lectin domain

400 3

Met Thr Lys Asp Tyr Gln Asp Phe Gln His Leu Asp Asn Asp Asn Asp

1 5 10 15

His His Gln Leu Arg Arg Gly Pro Pro Thr Pro Arg Leu Leu Gln

20 25 30

Arg Leu Cys Ser Gly Ser Arg Leu Leu Leu Leu Ser Ser Ser Ser Leu Ser

35 40 45

Ile Leu Leu Leu Val Val Val Cys Val Ile Thr Ser Gln Asn Ser Gln

50 55 60

Leu Gln Glu Glu Leu Arg Gly Leu Arg Glu Thr Phe Ser Asn Phe Thr

65 70 75 80

Ala Ser Thr Glu Ala Gln Val Lys Gly Leu Ser Thr Gln Gly Gly Asn

85 90 95

Val Gly Arg Lys Met Lys Ser Leu Glu Ser Gln Leu Glu Lys Gln Gln

100 105 110

Lys Asp Leu Ser Glu Asp His Ser Ser Leu Leu Leu His Val Lys Gln

115 120 125

Phe Val Ser Asp Leu Arg Ser Leu Ser Cys Gln Met Ala Ala Leu Gln

130 135 140

Gly Asn Gly Ser Glu Arg Thr Cys Cys Pro Val Asn Trp Val Glu His

145 150 155 160

Glu Arg Ser Cys Tyr Trp Phe Ser Arg Ser Gly Lys Ala Trp Ala Asp

165 170 175

Ala Asp Asn Tyr Cys Arg Leu Glu Asp Ala His Leu Val Val Val Thr

180 185 190

Ser Trp Glu Glu Gln Lys Phe Val Gln His His Ile Gly Pro Val Asn

195 200 205

Thr Trp Met Gly Leu His Asp Gln Asn Gly Pro Trp Lys Trp Val Asp

210 215 220

Gly Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Glu Gln Pro

225 230 235 240

Asp Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His

245 250 255

Phe Thr Asp Asp Gly Arg Trp Asn Asp Asp Val Cys Gln Arg Pro Tyr

260 265 270

Arg Trp Val Cys Glu Thr Glu Leu Asp Lys Ala Ser Gln Glu Pro Pro

275 280 285

Leu Leu

290

210 4

211 855

212 DNA

213 Mus muscle

400 4

atgacaaagg attatcaaga tttccagcac ctggacaatg ataatgacca tcatcaactc 60

cggagagggc cgcctcccac tccacggctc ttgcagcgac tctgctctgg atcccgcctc 120

ctcctgctct cctcgagcct cagcattctg ttgctggtgg ttgtctgtgt gatcacatcc 180

caaaattccc aactccggga agatctgctg gctctaaggc agaatttcag caacctcact 240

gtgagcactg aggaccaggt caaggccctg agcacccagg gaagtagtgt gggaagaaag 300

atgaagttag tggagtcgaa gctggaaaaa cagcagaagg atctgactga agatcactcc 360

agtttgctac tgcacgtgaa gcagttagtg tctgacgtgc gaagcttgag ctgccagatg 420

gctgcatttc ggggcaatgg ctctgaaagg acctgctgcc ccatcaactg ggtggagtat 480

gaaggcagct gctactggtt ctccagctct gtgaggcctt ggactgaagc tgacaagtac 540

tgccagctgg aaaatgccca tctggtggtg gtgacctcca gggatgagca gaacttcctc 600

cagcgccaca tgggcccctt aaacacttgg attggcctaa ctgaccagaa cgggccctgg 660

aaatgggtgg atggaacaga ctacgagaca ggcttccaga attggagacc agagcagcca 720

gataactggt acggacatgg gcttggagga ggcgaggact gtgcccactt cacgacggat 780

ggccgctgga atgacgacgt ctgcaggagg ccctaccgct gggtctgtga gacaaagttg 840

gataaggcta attag 855

210 5

211 876

212 DNA

213 Homo sapiens

400 5

atgaccaagg agtatcaaga ccttcagcat ctggacaatg aggagagtga ccaccatcag 60

ctcagaaaag ggccacctcc tccccagccc ctcctgcagc gtctctgctc cggacctcgc 120

ctcctcctgc tctccctggg cctcagcctc ctgctgcttg tggttgtctg tgtgatcgga 180

tcccaaaact cccagctgca ggaggagctg cggggcctga gagagacgtt cagcaacttc 240

acagcgagca cggaggccca ggtcaagggc ttgagcaccc agggaggcaa tgtgggaaga 300

aagatgaagt cgctagagtc ccagctggag aaacagcaga aggacctgag tgaagatcac 360

tccagcctgc tgctccacgt gaagcagttc gtgtctgacc tgcggagcct gagctgtcag 420

atggcggcgc tccagggcaa tggctcagaa aggacctgct gcccggtcaa ctgggtggag 480

cacgagcgca gctgctactg gttctctcgc tccgggaagg cctgggctga cgccgacaac 540

tactgccggc tggaggacgc gcacctggtg gtggtcacgt cctgggagga gcagaaattt 600

gtccagcacc acataggccc tgtgaacacc tggatgggcc tccacgacca aaacgggccc 660

tggaagtggg tggacgggac ggactacgag acgggcttca agaactggag gccggagcag 720

ccggacgact ggtacggcca cgggctcgga ggaggcgagg actgtgccca cttcaccgac 780

gacggccgct ggaacgacga cgtctgccag aggccctacc gctgggtctg cgagacagag 840

ctggacaagg ccagccagga gccacctctc ctttaa 876

210 6

211 19

212 DNA

213 Artificial sequence

220

223 Synthetic

400 6

tcccaactccgggaagatc 19

210 7

211 24

212 DNA

213 Artificial sequence

220

223 Synthetic

400 7

tgctggctctaaggcagaatttca 24

210 8

211 20

212 DNA

213 Artificial sequence

220

223 Synthetic

400 8

tcagtgctcacagtgaggtt 20

210 9

211 22

212 DNA

213 Artificial sequence

220

223 Synthetic

400 9

gggttggctcatgttaggaagg 22

210 10

211 20

212 DNA

213 Artificial sequence

220

223 Synthetic

400 10

tcagcagccgagctgtgaaa 20

210 11

211 22

212 DNA

213 Artificial sequence

220

223 Synthetic

400 11

caggctgtgctacccaaagttc 22

210 12

211 21

212 DNA

213 Artificial sequence

220

223 Synthetic

400 12

ggaggcaatgtgggaagaaag 21

210 13

211 24

212 DNA

213 Artificial sequence

220

223 Synthetic

400 13

tgaagtcgctagagtcccagctgg 24

210 14

211 20

212 DNA

213 Artificial sequence

220

223 Synthetic

400 14

tcaggtccttctgctgtttc 20

210 15

211 20

212 DNA

213 Artificial sequence

220

223 Synthetic

400 15

gattgggaatccgcccatct 20

210 16

211 29

212 DNA

213 Artificial sequence

220

223 Synthetic

400 16

cctcttctgctttctcgggaattttcatc 29

210 17

211 20

212 DNA

213 Artificial sequence

220

223 Synthetic

400 17

aaagcgccacgggtttcaag 20

210 18

211 120

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(60)

223 Mouse sequence

220

221 other_characteristics

222 (61)..(120)

223 Human Sequence

400 18

catcccaaagtgggtggccagggctgggcagagaaagggggcaacttcgggtgtgtgtga 60

120

210 19

211 160

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(60)

223 Human Sequence

220

221 other_characteristics

222 (61)..(66)

223 XhoI

220

221 other_characteristics

222 (67)..(100)

223 loxP

220

221 other_characteristics

222 (101)..(160)

223 Cassette

400 19

tgttatttcagatacgtgagtttgggcaaattattgttctctgtgtcccagctgtaaac 60

ctcgagataacttcgtataatgtatgctatacgaagttatatgcatggcctccgcgccgg 120

160

210 20

211 191

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(60)

223 Cassette

220

221 other_characteristics

222 (61)..(94)

223 loxP

220

221 other_characteristics

222 (100)..(125)

223 I-CeuI

220

221 other_characteristics

222 (126)..(131)

223 NheI

220

221 other_characteristics

222 (132)..(191)

223 Mouse sequence

400 20

tttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgga 60

ataacttcgtataatgtatgctatacgaagttatgctagtaactataacggtcctaaggt 120

180

gtggaagatg 191

210 21

211 9692

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(69)

223 Mouse sequence

220

221 other_characteristics

222 (70)..(3976)

223 Human Sequence

220

221 other_characteristics

222 (3977)..(3982)

223 XhoI

220

221 other_characteristics

222 (3983)..(4016)

223 loxP

220

221 other_characteristics

222 (4023)..(5235)

223 Human ubiquitin promoter

220

221 other_characteristics

222 (5236)..(5302)

223 EM7 promoter

220

221 other_characteristics

222 (5303)..(6328)

223 Hygromycin resistance gene

220

221 other_characteristics

222 (6329)..(6813)

223 PGK polyA

220

221 other_characteristics

222 (6825)..(7506)

223 Promoter Prm

220

221 other_characteristics

222 (7507)..(8646)

223 Crei

220

221 other_characteristics

222 (8909)..(9119)

223 SV40 polyA

220

221 other_characteristics

222 (9124)..(9157)

223 loxP

220

221 other_characteristics

222 (9163)..(9188)

223 I-CeuI

220

221 other_characteristics

222 (9189)..(9194)

223 NheI

220

221 other_characteristics

222 (9195)..(9692)

223 Mouse sequence

400 21

gtgtgatcacatcccaaagtgggtggccagggctgggcagagaaagggggcaacttcggg 60

120

180

240

tgagggcgct ggggcggggc tggggctggg gctggggctg gggggctgtc gggaacgctg 300

agcgagcctc tcccgcagga ggcaatgtgg gaagaaagat gaagtcgcta gagtcccagc 360

tggagaaaca gcagaaggac ctgagtgaag gtcagagagg gagtgtgtgt gtgtgtgtgt 420

gtgtgtgaaa gagagtgaga atgtgtggat gtgtgtgaga aagtgtgagt gtgtgtggat 480

gtgtgtgaga atgagaggga gtgtgtgtgt gtgtgagtct gtgtgtgaga atgaggggga 540

600

atgtctgtga gtgtgagaat gagatggagt gtgtgtgagt ctgtgtgtga gaatgaggtg 660

tgtgtgtgtg agaatgagat ggtgtgtgtg tgggaatgag agggggtgtg tgtctgagtg 720

tgagaatgag

agtgtgagaa tgacggagtg tgtctgtgag tgtgataatg aggtgtgtgt gagtctgagt 840

gtaagaatga gatggggtgt gtgtgtctgt gagtgtgaga gtgtgagaat gaggggtgtt 900

tgtgtctgag tgtgagtctg tgagtgtgag aatgagatgg ggtgtgtgag tgagtgtgag 960

1020

ggggtgtgtg tgagtgtgag aatgagatgg ggtgtgtgtc tgtgtgtgag aatgagatgg 1080

gtgtgtgtgt gacagagtct gagtgtgaga atgagaggga gtgtgtgtga gtgtgagaat 1140

1200

1260

1320

tgagatggag tgtctgtgag actgtgtgtg aggagtggga gaatgagatg 1380

ggtgtgtgtg tctgagtgtg tgtctgtgag aatgagaggg agtgtgtgtg tgtgtgagag 1440

cctgtgtgaa aatgagaagg agtgtggatg ggtgtttgtg agtgggagag tctgtgtgtt 1500

1560

1620

gtaagtatat gtgtaagtgc atgtgagtgt gtgtatgtgc gtgttgtgtg aatgtgcatt 1680

gtgtgtgcat gtgtgaaaga gtatatgtgt gttgtgggtg agtgtgtgtg gtgtgtgtag 1740

1800

1860

ttgtgtgtgt gtgtgggtga aggtgtgttg tgtgtgtcgt gggtgaaggt gtgttgtgtg 1920

1980 tgtagtgact gtagattagg gtgtgttccg tgtgtgtgtg

gttttgtgtg tgagtgggtg tgtaagggtg tgttgtgtgt atgtgggtta aggtgtgtta 2040

tgcgtgaggg tgtattgtgt gtgtgttttg tgtgtgttgt gtgtatgtgg gttagggtgt 2100

2160

2220

gtgtgttgtg tctatgtatg tgtgtgtaag ggtgtgttgt gtgtctgtgg gtgtgttttg 2280

2340

gtgggttatg tgtgttgtgt gtgttgtgga tgtatgtggg ttagggtgtg ttgtgtgtct 2400

2460

gtgttgtccg tgtgtgtgta tgtgggttag gttgtgtgtg tgtgtgttgt atattgtctg 2520

2580

tgtgtaggag tgtgtgtgtg tgtgtgtatg ggggtctctc aggccaactc cgctgctgtt 2640

tgtggcaatg cgacgggtgt tcgggtccca gcaggaggat gtagggctga cctcgtttcc 2700

cgtttccctc cccgtggttt ccgcatctcc tcccgctccc ctccgcccgg tctccccaga 2760

tcactccagc ctgctgctcc acgtgaagca gttcgtgtct gacctgcgga gcctgagctg 2820

tcagatggcg gcgctccagg gcaatggtaa ggaggccagc ccggcccgct ctctgcctcc 2880

ccccttctct gggcagcgct tagcccctgc gccccgtttc tcccgctcag gctcagaaag 2940

gacctgctgc ccggtcaact gggtggagca cgagcgcagc tgctactggt tctctcgctc 3000

cgggaaggcc tgggctgacg ccgacaacta ctgccggctg gaggacgcgc acctggtggt 3060

ggtcacgtcc tgggaggagc aggtgaggac ccggagggtc tgggaggctg gctggcctcg 3120

3180

tgaacacctg gatgggcctc cacgaccaaa acgggccctg gaagtgggtg gacgggacgg 3240

actacgagac gggcttcaag tgagtgcgcg ccctccctcg gcctgggtcc ggccgccttc 3300

gcgccctggg gccctgggct gaggagtctg gagcgacccg cctgcggatc cgacctcctg 3360

gggccccacag ctggctctgt ccccaggaac tggaggccgg agcagccgga cgactggtac 3420

ggccacgggc tcggaggagg cgaggactgt gcccacttca ccgacgacgg ccgctggaac 3480

gacgacgtct gccagaggcc ctaccgctgg gtctgcgaga cagagctgga caaggccagc 3540

caggagccac ctctccttta atttatttct tcaatgcctc gacctgccgc aggggtccgg 3600

3660

tttaagggaa ggggaaggat agggtgatgt tccgaaggtg aggagcttga aacccgtggc 3720

gctttctgca gtttgcaggt tatcattgtg aacttttttt ttttaagagt aaaaagaaat 3780

atacctaaac cttctgttag ttgtctggtt attggggatt cggaagcagg agtgggctgg 3840

ttggcattac gaagccttag cgggtgctgt ggcatcatga gaactgtgtg ggctttgggc 3900

3960

tgtcccagct gtaaacctcg agataacttc gtataatgta tgctatacga agttatatgc 4020

atggcctccg cgccgggttt tggcgcctcc cgcgggcgcc cccctcctca cggcgagcgc 4080

tgccacgtca gacgaagggc gcagcgagcg tcctgatcct tccgcccggga cgctcaggac 4140

agcggcccgc tgctcataag actcggcctt agaaccccag tatcagcaga aggacatttt 4200

aggacgggac ttgggtgact ctagggcact ggttttcttt ccagagagcg gaacaggcga 4260

ggaaaagtag tcccttctcg gcgattctgc ggagggatct ccgtggggcg gtgaacgccg 4320

atgattatat aaggacgcgc cgggtgtggc acagctagtt ccgtcgcagc cgggatttgg 4380

gtcgcggttc ttgtttgtgg atcgctgtga tcgtcacttg gtgagtagcg ggctgctggg 4440

ctggccgggg ctttcgtggc cgccgggccg ctcggtggga cggaagcgtg tggagagacc 4500

gccaagggct gtagtctgggg tccgcgagca aggttgccct gaactggggg ttggggggag 4560

4620

gaggtcgttg aaacaaggtg gggggcatgg tgggcggcaa gaacccaagg tcttgaggcc 4680

ttcgctaatg cgggaaagct cttattcggg tgagatgggc tggggcacca tctggggacc 4740

ctgacgtgaa gtttgtcact gactggagaa ctcggtttgt cgtctgttgc gggggcggca 4800

4860

tcgtgacgtc acccgttctg ttggcttata atgcagggtg gggccacctg ccggtaggtg 4920

tgcggtaggc ttttctccgt cgcaggacgc agggttcggg cctagggtag gctctcctga 4980

atcgacaggc gccggacctc tggtgagggg agggataagt gaggcgtcag tttctttggt 5040

cggttttatg tacctatctt cttaagtagc tgaagctccg gttttgaact atgcgctcgg 5100

ggttggcgag tgtgttttgt gaagtttttt aggcaccttt tgaaatgtaa tcatttgggt 5160

5220

5280

cgacaaggtg aggaactaaa ccatgaaaaa gcctgaactc accgcgacgt ctgtcgagaa 5340

gtttctgatc gaaaagttcg acagcgtgtc cgacctgatg cagctctcgg agggcgaaga 5400

atctcgtgct ttcagcttcg atgtaggagg gcgtggatat gtcctgcggg taaatagctg 5460

cgccgatggt ttctacaaag atcgttatgt ttatcggcac tttgcatcgg ccgcgctccc 5520

gattccggaa gtgcttgaca ttggggaatt cagcgagagc ctgacctatt gcatctcccg 5580

ccgtgcacag ggtgtcacgt tgcaagacct gcctgaaacc gaactgcccg ctgttctgca 5640

gccggtcgcg gaggccatgg atgcgattgc tgcggccgat cttagccaga cgagcgggtt 5700

cggcccattc ggaccgcaag gaatcggtca atacactaca tggcgtgatt tcatatgcgc 5760

gattgctgat ccccatgtgt atcactggca aactgtgatg gacgacaccg tcagtgcgtc 5820

cgtcgcgcag gctctcgatg agctgatgct ttgggccgag gactgccccg aagtccggca 5880

cctcgtgcac gcggatttcg gctccaacaa tgtcctgacg gacaatggcc gcataacagc 5940

ggtcattgac tggagcgagg cgatgttcgg ggattcccaa tacgaggtcg ccaacatctt 6000

6060

tccggagctt gcaggatcgc cgcggctccg ggcgtatatg ctccgcattg gtcttgacca 6120

actctatcag agcttggttg acggcaattt cgatgatgca gcttgggcgc agggtcgatg 6180

cgacgcaatc gtccgatccg gagccgggac tgtcgggcgt acacaaatcg cccgcagaag 6240

cgcggccgtc tggaccgatg gctgtgtaga agtactcgcc gatagtggaa accgacgccc 6300

6360

6420

gaagggtgag aacagagtac ctacattttg aatggaagga ttggagctac gggggtgggg 6480

gtggggtggg attagataaa tgcctgctct ttactgaagg ctctttacta ttgctttatg 6540

ataatgtttc atagttggat atcataattt aaacaagcaa aaccaaatta agggccagct 6600

cattcctccc actcatgatc tatagatcta tagatctctc gtgggatcat tgtttttctc 6660

ttgattccca ctttgtggtt ctaagtactg tggtttccaa atgtgtcagt ttcatagcct 6720

gaagaacgag atcagcagcc tctgttccac atacacttca ttctcagtat tgttttgcca 6780

agttctaatt ccatcagacc tcgacctgca gcccctagcc cgggcgccag tagcagcacc 6840

cacgtccacc ttctgtctag taatgtccaa cacctccctc agtccaaaca ctgctctgca 6900

tccatgtggc tcccatttat acctgaagca cttgatgggg cctcaatgtt ttactagagc 6960

ccacccccct gcaactctga gaccctctgg atttgtctgt cagtgcctca ctggggcgtt 7020

ggataatttc ttaaaaggtc aagttccctc agcagcattc tctgagcagt ctgaagatgt 7080

gtgcttttca cagttcaaat ccatgtggct gtttcaccca cctgcctggc cttgggttat 7140

ctatcaggac ctagcctaga agcaggtgtg tggcacttaa cacctaagct gagtgactaa 7200

ctgaacactc aagtggatgc catctttgtc acttcttgac tgtgacacaa gcaactcctg 7260

atgccaaagc cctgcccacc cctctcatgc ccatatttgg acatggtaca ggtcctcact 7320

ggccatggtc tgtgaggtcc tggtcctctt tgacttcata attcctaggg gccactagta 7380

tctataagag gaagagggtg ctggctccca ggccacagcc cacaaaattc cacctgctca 7440

caggttggct ggctcgaccc aggtggtgtc ccctgctctg agccagctcc cggccaagcc 7500

agcaccatgg gtacccccaa gaagaagagg aaggtgcgta ccgatttaaa ttccaattta 7560

ctgaccgtac accaaaattt gcctgcatta ccggtcgatg caacgagtga tgaggttcgc 7620

aagaacctga tggacatgtt cagggatcgc caggcgtttt ctgagcatac ctggaaaatg 7680

cttctgtccg tttgccggtc gtgggcggca tggtgcaagt tgaataaccg gaaatggttt 7740

cccgcagaac ctgaagatgt tcgcgattat cttctatatc ttcaggcgcg cggtctggca 7800

gtaaaaacta tccagcaaca tttgggccag ctaaacatgc ttcatcgtcg gtccgggctg 7860

ccacgaccaa gtgacagcaa tgctgtttca ctggttatgc ggcggatccg aaaagaaaac 7920

gttgatgccg gtgaacgtgc aaaacaggct ctagcgttcg aacgcactga tttcgaccag 7980

gttcgttcac tcatggaaaa tagtgatcgc tgccaggata tacgtaatct ggcatttctg 8040

gggattgctt ataacaccct gttacgtata gccgaaattg ccaggatcag ggttaaagat 8100

atctcacgta ctgacggtgg gagaatgtta atccatattg gcagaacgaa aacgctggtt 8160

agcaccgcag gtgtagagaa ggcacttagc ctgggggtaa ctaaactgggt cgagcgatgg 8220

atttccgtct ctggtgtagc tgatgatccg aataactacc tgttttgccg ggtcagaaaa 8280

aatggtgttg ccgcgccatc tgccaccagc cagctatcaa ctcgcgccct ggaagggatt 8340

tttgaagcaa ctcatcgatt gatttacggc gctaaggtaa atataaaatt tttaagtgta 8400

taatgtgtta aactactgat tctaattgtt tgtgtatttt aggatgactc tggtcagaga 8460

tacctggcct ggtctggaca cagtgcccgt gtcggagccg cgcgagatat ggcccgcgct 8520

ggagtttcaa taccggagat catgcaagct ggtggctgga ccaatgtaaa tattgtcatg 8580

aactatatcc gtaacctgga tagtgaaaca ggggcaatgg tgcgcctgct ggaagatggc 8640

gattgatcta gataagtaat gatcataatc agccatatca catctgtaga ggttttactt 8700

gctttaaaaa acctcccaca cctccccctg aacctgaaac ataaaatgaa tgcaattgtt 8760

gttgttaaac ctgccctagt tgcggccaat tccagctgag cgtgcctccg caccattacc 8820

agttggtctg gtgtcaaaaa taataataac cgggcagggg ggatctaagc tctagataag 8880

taatgatcat aatcagccat atcacatctg tagaggtttt acttgcttta aaaaacctcc 8940

cacacctccc cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt aacttgttta 9000

ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat 9060

ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct 9120

ggaataactt cgtataatgt atgctatacg aagttatgct agtaactata acggtcctaa 9180

ggtagcgagc tagccgtgga cagatacagc aacgtgagct agttattctg tcctaaagtc 9240

tcagttggaa gatgggagga tttttgacct ctgtctgctg ggggcaggac caaccaccag 9300

ggaactgcag cccccctgtg ctgagtgcat cagagacttg gaatggaaca cactggcctg 9360

cgacactcat cacaacgaac agaaactgct ttgtacactg aataaacgca gtgaataccc 9420

agctcaggat cacagacaca tgaatgcaaa gttatattag tataaccaag ggtgggaatg 9480

agggcaatta cagataactt atagacatga attactaaca aaacagggca aaatgtttgc 9540

tcataaataa catgaaaata caatatatag tcatatgtat atatacatgt atatatataa 9600

atgacataat atgtatatat ttttacaaat acactgcagg aaaataatat ttttcctcta 9660

cagaagagat tggcaaatct gacatctaaa at 9692

210 22

211 160

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(90)

223 Mouse sequence

220

221 other_characteristics

222 (91)..(160)

223 Human Sequence

400 22

catgatgttt ctttcttagg aaagccaggg catttctcta ttctccaatc tcttggctca 60

atgcccttgg cctctctttt gttcctag tgaagcctct ccagccaggg gctgaggtcc 120

cggtggtgtg ggcccaggag ggggctcctg cccagctccc 160

210 23

211 197

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(60)

223 Human Sequence

220

221 other_characteristics

222 (61)..(66)

223 XhoI

220

221 other_characteristics

222 (67)..(100)

223 loxP

220

221 other_characteristics

222 (106)..(131)

223 I-CeuI

220

221 other_characteristics

222 (132)..(137)

223 NheI

220

221 other_characteristics

222 (138)..(197)

223 Mouse sequence

400 23

tgttatttac agatacgtga gtttgggcaa attattgttc tctgtgtccc agctgtaaac 60

ctcgagataa cttcgtataa tgtatgctat acgaagttat gctagtaact ataacggtcc 120

taaggtagcg agctagccgt ggacagatac agcaacgtga gctagtttatt ctgtcctaaa 180

gtctcagttg gaagatg 197

210 24

211 4551

212 DNA

213 Artificial sequence

220

223 Synthetic

220

221 other_characteristics

222 (1)..(69)

223 Mouse sequence

220

221 other_characteristics

222 (70)..(3976)

223 Human Sequence

220

221 other_characteristics

222 (3977)..(3982)

223 XhoI

220

221 other_characteristics

222 (3983)..(4016)

223 LoxP

220

221 other_characteristics

222 (4022)..(4047)

223 I-CeuI

220

221 other_characteristics

222 (4048)..(4053)

223 NheI

220

221 other_characteristics

222 (4054)..(4551)

223 Mouse sequence

400 24

gtgtgatcac atcccaaagt gggtggccag ggctgggcag agaaagggggg caacttcggg 60

tgtgtgtgac aagggagtgg tgggtgcagt ggtggcggac acagcgatcc cgttttcttc 120

tctctgcacg ctgtcctggc cagactccca gctgcaggag gagctgcggg gcctgagaga 180

gacgttcagc aacttcacag cgagcacggga ggcccaggtc aagggcttga gcacccaggg 240

tgagggcgct ggggcggggc tggggctggg gctggggctg gggggctgtc gggaacgctg 300

agcgagcctc tcccgcagga ggcaatgtgg gaagaaagat gaagtcgcta gagtcccagc 360

tggagaaaca gcagaaggac ctgagtgaag gtcagagagg gagtgtgtgt gtgtgtgtgt 420

gtgtgtgaaa gagagtgaga atgtgtggat gtgtgtgaga aagtgtgagt gtgtgtggat 480

gtgtgtgaga atgagaggga gtgtgtgtgt gtgtgagtct gtgtgtgaga atgaggggga 540

600

atgtctgtga gtgtgagaat gagatggagt gtgtgtgagt ctgtgtgtga gaatgaggtg 660

tgtgtgtgtg agaatgagat ggtgtgtgtg tgggaatgag agggggtgtg tgtctgagtg 720

tgagaatgag

agtgtgagaa tgacggagtg tgtctgtgag tgtgataatg aggtgtgtgt gagtctgagt 840

gtaagaatga gatggggtgt gtgtgtctgt gagtgtgaga gtgtgagaat gaggggtgtt 900

tgtgtctgag tgtgagtctg tgagtgtgag aatgagatgg ggtgtgtgag tgagtgtgag 960

1020

ggggtgtgtg tgagtgtgag aatgagatgg ggtgtgtgtc tgtgtgtgag aatgagatgg 1080

gtgtgtgtgt gacagagtct gagtgtgaga atgagaggga gtgtgtgtga gtgtgagaat 1140

1200

1260

1320

tgagatggag tgtctgtgag actgtgtgtg aggagtggga gaatgagatg 1380

ggtgtgtgtg tctgagtgtg tgtctgtgag aatgagaggg agtgtgtgtg tgtgtgagag 1440

cctgtgtgaa aatgagaagg agtgtggatg ggtgtttgtg agtgggagag tctgtgtgtt 1500

1560

1620

gtaagtatat gtgtaagtgc atgtgagtgt gtgtatgtgc gtgttgtgtg aatgtgcatt 1680

gtgtgtgcat gtgtgaaaga gtatatgtgt gttgtgggtg agtgtgtgtg gtgtgtgtag 1740

1800

1860

ttgtgtgtgt gtgtgggtga aggtgtgttg tgtgtgtcgt gggtgaaggt gtgttgtgtg 1920

1980 tgtagtgact gtagattagg gtgtgttccg tgtgtgtgtg

gttttgtgtg tgagtgggtg tgtaagggtg tgttgtgtgt atgtgggtta aggtgtgtta 2040

tgcgtgaggg tgtattgtgt gtgtgttttg tgtgtgttgt gtgtatgtgg gttagggtgt 2100

2160

2220

gtgtgttgtg tctatgtatg tgtgtgtaag ggtgtgttgt gtgtctgtgg gtgtgttttg 2280

2340

gtgggttatg tgtgttgtgt gtgttgtgga tgtatgtggg ttagggtgtg ttgtgtgtct 2400

2460

gtgttgtccg tgtgtgtgta tgtgggttag gttgtgtgtg tgtgtgttgt atattgtctg 2520

2580

tgtgtaggag tgtgtgtgtg tgtgtgtatg ggggtctctc aggccaactc cgctgctgtt 2640

tgtggcaatg cgacgggtgt tcgggtccca gcaggaggat gtagggctga cctcgtttcc 2700

cgtttccctc cccgtggttt ccgcatctcc tcccgctccc ctccgcccgg tctccccaga 2760

tcactccagc ctgctgctcc acgtgaagca gttcgtgtct gacctgcgga gcctgagctg 2820

tcagatggcg gcgctccagg gcaatggtaa ggaggccagc ccggcccgct ctctgcctcc 2880

ccccttctct gggcagcgct tagcccctgc gccccgtttc tcccgctcag gctcagaaag 2940

gacctgctgc ccggtcaact gggtggagca cgagcgcagc tgctactggt tctctcgctc 3000

cgggaaggcc tgggctgacg ccgacaacta ctgccggctg gaggacgcgc acctggtggt 3060

ggtcacgtcc tgggaggagc aggtgaggac ccggagggtc tgggaggctg gctggcctcg 3120

3180

tgaacacctg gatgggcctc cacgaccaaa acgggccctg gaagtgggtg gacgggacgg 3240

actacgagac gggcttcaag tgagtgcgcg ccctccctcg gcctgggtcc ggccgccttc 3300

gcgccctggg gccctgggct gaggagtctg gagcgacccg cctgcggatc cgacctcctg 3360

gggccccacag ctggctctgt ccccaggaac tggaggccgg agcagccgga cgactggtac 3420

ggccacgggc tcggaggagg cgaggactgt gcccacttca ccgacgacgg ccgctggaac 3480

gacgacgtct gccagaggcc ctaccgctgg gtctgcgaga cagagctgga caaggccagc 3540

caggagccac ctctccttta atttatttct tcaatgcctc gacctgccgc aggggtccgg 3600

3660

tttaagggaa ggggaaggat agggtgatgt tccgaaggtg aggagcttga aacccgtggc 3720

gctttctgca gtttgcaggt tatcattgtg aacttttttt ttttaagagt aaaaagaaat 3780

atacctaaac cttctgttag ttgtctggtt attggggatt cggaagcagg agtgggctgg 3840

ttggcattac gaagccttag cgggtgctgt ggcatcatga gaactgtgtg ggctttgggc 3900

3960

tgtcccagct gtaaacctcg agataacttc gtataatgta tgctatacga agttatgcta 4020

gtaactataa cggtcctaag gtagcgagct agccgtggac agatacagca acgtgagcta 4080

gttattctgt cctaaagtct cagttggaag atgggaggat ttttgacctc tgtctgctgg 4140

gggcaggacc aaccaccagg gaactgcagc ccccctgtgc tgagtgcatc agagacttgg 4200

aatggaacac actggcctgc gacactcatc acaacgaaca gaaactgctt tgtacactga 4260

ataaacgcag tgaataccca gctcaggatc acagacacat gaatgcaaag ttatattagt 4320

ataaccaagg gtgggaatga gggcaattac agataactta tagacatgaa ttactaacaa 4380

aacagggcaa aatgtttgct cataaataac atgaaaatac aatatatagt catatgtata 4440

tatacatgta tatatataaa tgacataata tgtatatatt tttacaaata cactgcagga 4500

aaataatatt ttttcctctac agaagagatt ggcaaatctg acatctaaaa t 4551

210 25

211 10

212 PROTEIN

213 Artificial sequence

220

223 Synthetic

400 25

Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu

1 5 10

210 26

211 30

212 DNA

213 Artificial sequence

220

223 Synthetic

400 26

gaacaaaaac tcatctcaga agaggatctg 30

210 27

211 63

212 PROTEIN

213 Homo sapiens

400 27

Ser Gln Asn Ser Gln Leu Gln Glu Glu Leu Arg Gly Leu Arg Glu Thr

1 5 10 15

Phe Ser Asn Phe Thr Ala Ser Thr Glu Ala Gln Val Lys Gly Leu Ser

20 25 30

Thr Gln Gly Gly Asn Val Gly Arg Lys Met Lys Ser Leu Glu Ser Gln

35 40 45

Leu Glu Lys Gln Gln Lys Asp Leu Ser Glu Asp His Ser Ser Leu

50 55 60

210 28

211 118

212 PROTEIN

213 Homo sapiens

400 28

His Glu Arg Ser Cys Tyr Trp Phe Ser Arg Ser Gly Lys Ala Trp Ala

1 5 10 15

Asp Ala Asp Asn Tyr Cys Arg Leu Glu Asp Ala His Leu Val Val Val

20 25 30

Thr Ser Trp Glu Glu Gln Lys Phe Val Gln His His Ile Gly Pro Val

35 40 45

Asn Thr Trp Met Gly Leu His Asp Gln Asn Gly Pro Trp Lys Trp Val

50 55 60

Asp Gly Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Glu Gln

65 70 75 80

Pro Asp Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala

85 90 95

His Phe Thr Asp Asp Gly Arg Trp Asn Asp Asp Val Cys Gln Arg Pro

100 105 110

Tyr Arg Trp Val Cys Glu

115

210 29

211 39

212 PROTEIN

213 Mus muscle

400 29

Met Thr Lys Asp Tyr Gln Asp Phe Gln His Leu Asp Asn Asp Asn Asp

1 5 10 15

His His Gln Leu Arg Arg Gly Pro Pro Thr Pro Arg Leu Leu Gln

20 25 30

Arg Leu Cys Ser Gly Ser Arg

35

210 30

211 21

212 PROTEIN

213 Mus muscle

400 30

Leu Leu Leu Leu Ser Ser Ser Leu Ser Ile Leu Leu Leu Val Val Val

1 5 10 15

Cys Val Ile Thr Ser

20

210 31

211 229

212 PROTEIN

213 Homo sapiens

400 31

Asn Ser Gln Leu Gln Glu Glu Leu Arg Gly Leu Arg Glu Thr Phe Ser

1 5 10 15

Asn Phe Thr Ala Ser Thr Glu Ala Gln Val Lys Gly Leu Ser Thr Gln

20 25 30

Gly Gly Asn Val Gly Arg Lys Met Lys Ser Leu Glu Ser Gln Leu Glu

35 40 45

Lys Gln Gln Lys Asp Leu Ser Glu Asp His Ser Ser Leu Leu Leu His

50 55 60

Val Lys Gln Phe Val Ser Asp Leu Arg Ser Leu Ser Cys Gln Met Ala

65 70 75 80

Ala Leu Gln Gly Asn Gly Ser Glu Arg Thr Cys Cys Pro Val Asn Trp

85 90 95

Val Glu His Glu Arg Ser Cys Tyr Trp Phe Ser Arg Ser Gly Lys Ala

100 105 110

Trp Ala Asp Ala Asp Asn Tyr Cys Arg Leu Glu Asp Ala His Leu Val

115 120 125

Val Val Thr Ser Trp Glu Glu Gln Lys Phe Val Gln His His Ile Gly

130 135 140

Pro Val Asn Thr Trp Met Gly Leu His Asp Gln Asn Gly Pro Trp Lys

145 150 155 160

Trp Val Asp Gly Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro

165 170 175

Glu Gln Pro Asp Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp

180 185 190

Cys Ala His Phe Thr Asp Asp Gly Arg Trp Asn Asp Asp Val Cys Gln

195 200 205

Arg Pro Tyr Arg Trp Val Cys Glu Thr Glu Leu Asp Lys Ala Ser Gln

210 215 220

Glu Pro Pro Leu Leu

225

210 32

211 20

212 DNA

213 Artificial sequence

220

223 Synthetic

400 32

ggagtaccag ctcccgtacg 20

210 33

211 43

212 DNA

213 Artificial sequence

220

223 Synthetic

400 33

ctcttctgagg atgagttttt gttcgttgcc tctctgggagg ttg 43

210 34

211 43

212 DNA

213 Artificial sequence

220

223 Synthetic

400 34

aaactcatct cagaagagga tctgagacaa gcagctaccg cag 43

210 35

211 18

212 DNA

213 Artificial sequence

220

223 Synthetic

400 35

tccgcccgct gtttaaac 18

210 36

211 21

212 DNA

213 Artificial sequence

220

223 Synthetic

400 36

ggaacccta gtgatggagt t 21

210 37

211 16

212 DNA

213 Artificial sequence

220

223 Synthetic

400 37

cggcctcagt gagcga 16

210 38

211 21

212 DNA

213 Artificial sequence

220

223 Synthetic

400 38

cactccctct ctgcgcgctc g 21

210 39

211 291

212 PROTEIN

213 Macaca fascicularis

400 39

Met Thr Lys Glu Tyr Gln Asp Leu Gln His Leu Asp Asn Glu Glu Ser

1 5 10 15

Asp His His Gln Leu Gly Lys Gly Pro Pro Pro Pro Gln Ser Leu Leu

20 25 30

Arg Arg Leu Cys Ser Gly Pro Arg Leu Leu Leu Leu Ser Leu Gly Leu

35 40 45

Ser Leu Leu Leu Leu Val Val Val Cys Val Ile Gly Ser Gln Asn Ala

50 55 60

Gln Leu Gln Arg Glu Leu Arg Gly Leu Arg Glu Thr Leu Ser Asn Phe

65 70 75 80

Thr Ala Ser Thr Glu Ala Gln Val Lys Gly Leu Ser Thr Gln Gly Gly

85 90 95

Asn Val Gly Arg Lys Met Lys Ser Leu Glu Ser Gln Leu Glu Lys Gln

100 105 110

Gln Lys Asp Leu Ser Glu Asp His Ser Ser Leu Leu Leu His Val Lys

115 120 125

Gln Phe Val Ser Asp Leu Arg Ser Leu Ser Cys Gln Met Ala Ala Leu

130 135 140

Gln Gly Asn Gly Ser Glu Arg Ala Cys Cys Pro Val Asn Trp Val Glu

145 150 155 160

His Glu Arg Ser Cys Tyr Trp Phe Ser Arg Ser Gly Lys Ala Trp Ala

165 170 175

Asp Ala Asp Asn Tyr Cys Arg Leu Glu Asp Ala His Leu Val Val Val

180 185 190

Thr Ser Trp Glu Glu Gln Lys Phe Val Gln His His Ile Gly Pro Val

195 200 205

Asn Thr Trp Met Gly Leu His Asp Gln Asn Gly Pro Trp Lys Trp Val

210 215 220

Asp Gly Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Glu Gln

225 230 235 240

Pro Asp Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala

245 250 255

His Phe Thr Asp Asp Gly Arg Trp Asn Asp Asp Val Cys Gln Arg Pro

260 265 270

Tyr Arg Trp Val Cys Glu Thr Glu Leu Asp Lys Ala Ser Gln Glu Pro

275 280 285

Pro Leu Leu

290

210 40

211 876

212 DNA

213 Macaca fascicularis

400 40

atgaccaagg agtatcagga cctgcagcat ctggacaatg aggagagtga ccaccatcag 60

ctcggaaaag ggccacctcc tccgcagtcc ctcctgcggc gtctctgctc cggccctcgc 120

ctcctcctgc tctccctggg cctcagcctc ctgctgctgg tggttgtctg tgtgatcgga 180

tcccaaaacg cccagctgca gcgggagctg cggggcctga gagagacgct cagcaacttc 240

acagcgagca ccgaggccca ggtcaagggc ttgagcaccc agggaggcaa tgtgggaaga 300

aagatgaagt cgctggagtc ccagctggag aaacagcaga aggacttgag tgaagatcac 360

tccagcctgc tgctccacgt gaagcagttc gtgtctgacc tgcggagcct gagctgtcag 420

atggcggcgc tccagggcaa tggctcggaa agggcctgct gcccagtcaa ctgggtggag 480

cacgagcgca gctgctactg gttctctcgc tccgggaagg cctgggccga cgccgacaac 540

tactgccggc tggaggacgc gcacctggtg gtggtcacgt cctgggagga gcagaaattt 600

gtccagcacc acataggtcc tgtgaacacc tggatgggcc tccacgacca aaacgggccc 660

tggaagtggg tggacgggac ggactacgag acgggcttca agaactggag accggagcag 720

ccggacgact ggtacggcca cgggctcggg ggaggggagg actgtgccca cttcaccgac 780

gacggccgct ggaacgacga cgtctgccag aggccctacc gctgggtctg cgagacagag 840

ctggacaagg ccagtcagga gccacctctc ctttaa 876

210 41

211 284

212 PROTEIN

213 Rattus norvegicus

400 41

Met Thr Lys Asp Tyr Gln Asp Phe Gln His Leu Asp Asn Glu Asn Asp

1 5 10 15

His His Gln Leu Gln Arg Gly Pro Pro Pro Ala Pro Arg Leu Leu Gln

20 25 30

Arg Leu Cys Ser Gly Phe Arg Leu Phe Leu Leu Ser Leu Gly Leu Ser

35 40 45

Ile Leu Leu Leu Val Val Val Cys Val Ile Thr Ser Gln Asn Ser Gln

50 55 60

Leu Arg Glu Asp Leu Arg Val Leu Arg Gln Asn Phe Ser Asn Phe Thr

65 70 75 80

Val Ser Thr Glu Asp Gln Val Lys Ala Leu Thr Thr Gln Gly Glu Arg

85 90 95

Val Gly Arg Lys Met Lys Leu Val Glu Ser Gln Leu Glu Lys His Gln

100 105 110

Glu Asp Leu Arg Glu Asp His Ser Arg Leu Leu Leu His Val Lys Gln

115 120 125

Leu Val Ser Asp Val Arg Ser Leu Ser Cys Gln Met Ala Ala Leu Arg

130 135 140

Gly Asn Gly Ser Glu Arg Ile Cys Cys Pro Ile Asn Trp Val Glu Tyr

145 150 155 160

Glu Gly Ser Cys Tyr Trp Phe Ser Ser Ser Val Lys Pro Trp Thr Glu

165 170 175

Ala Asp Lys Tyr Cys Gln Leu Glu Asn Ala His Leu Val Val Val Thr

180 185 190

Ser Trp Glu Glu Gln Arg Phe Val Gln Gln His Met Gly Pro Leu Asn

195 200 205

Thr Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Lys Trp Val Asp

210 215 220

Gly Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Gly Gln Pro

225 230 235 240

Asp Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His

245 250 255

Phe Thr Thr Asp Gly His Trp Asn Asp Asp Val Cys Arg Arg Pro Tyr

260 265 270

Arg Trp Val Cys Glu Thr Glu Leu Gly Lys Ala Asn

275 280

210 42

211 855

212 DNA

213 Rattus norvegicus

400 42

atgacaaagg attatcaaga tttccagcac ttggacaatg agaacgacca ccatcaactc 60

cagagagggc cacctcccgc tccaaggctc ttgcagcgac tctgctctgg attccgtctc 120

ttcctgcttt ccctggggcct cagcatcctg ctgctggtgg ttgtctgtgt gatcacatcc 180

caaaattccc aactccggga agatctgcgg gttctaaggc agaatttcag caactttacc 240

gtgagcactg aggaccaggt caaggccctg accacccagg gagagagagt gggaagaaag 300

atgaagttag tcgagtcaca gctggaaaaa catcaggagg atctgaggga agaccactct 360

agattgctac tgcatgtaaa gcagttagtg tctgacgtgc gaagcttgag ctgccagatg 420

gccgcacttc ggggcaatgg ctctgaaagg atctgctgcc ccatcaactg ggtggagtat 480

gaaggcagct gctactggtt ctccagctct gtgaagcctt ggacggaagc tgacaagtac 540

tgccagctgg agaacgccca cctggtggtg gtgacttcct gggaggagca gagattcgtc 600

cagcaacaca tgggcccctt aaatacttgg attggcctaa ctgaccagaa cggaccctgg 660

aaatgggtgg atgggacaga ctatgagaca ggcttcaaga actggagacc agggcagcca 720

gatgactggt acggacatgg gcttggaggg ggtgaagact gtgcccactt caccaccgat 780

ggccactgga atgatgacgt ctgcaggagg ccctaccgct gggtctgtga gacagagttg 840

ggcaaggcca attag 855

<---

Claims (39)

1. A non-human animal comprising a genetically modified endogenous Asgr1 locus that contains an endogenous Asgr1 promoter, wherein the non-human animal is a rodent, wherein the endogenous Asgr1 promoter is operably linked to a nucleic acid encoding a modified Asgr1 protein, wherein the modified Asgr1 protein contains a cytoplasmic domain, a transmembrane domain and an extracellular domain, where the extracellular domain contains a supercoiled domain, Where: (i) the entire extracellular domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced with an orthologous human ASGR1 sequence, or (ii) the entire supercoil domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced with an orthologous human ASGR1 sequence, and wherein the non-human animal expresses the modified Asgr1 protein. 2. A non-human animal according to claim 1, wherein the extracellular domain comprises a supercoiled domain and a C-type lectin domain, and all or part of the C-type lectin domain is encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced by an orthologous human ASGR1 sequence . 3. The non-human animal of claim 2, wherein the C-type lectin domain is the C-type lectin domain of human ASGR1. 4. A non-human animal according to claim 2 or 3, wherein the C-type lectin domain contains the sequence set forth under SEQ ID NO: 28. 5. An animal other than a human, according to any one of paragraphs. 1-4, where the supercoiled domain contains the sequence set forth under SEQ ID NO: 27. 6. An animal other than a human, according to any one of paragraphs. 2-5, wherein the C-type lectin domain contains the sequence set forth in SEQ ID NO: 28 and the supercoiled domain contains the sequence set forth in SEQ ID NO: 27. 7. A non-human animal according to any one of the preceding claims, wherein the orthologous human ASGR1 sequence comprises exons 3-8 of the human ASGR1 gene. 8. The non-human animal of claim 7, wherein the orthologous human ASGR1 sequence encodes an ASGR1 protein segment containing the sequence set forth under SEQ ID NO: 31. 9. A non-human animal according to any one of the preceding claims, wherein all or part of the cytoplasmic domain is encoded by the endogenous Asgr1 sequence of the non-human animal. 10. A non-human animal according to any one of the preceding claims, wherein all or part of the transmembrane domain is encoded by the endogenous Asgr1 sequence of the non-human animal. 11. A non-human animal according to claim 9 or 10, wherein both the entire cytoplasmic domain and the entire transmembrane domain, or part of both, are encoded by the endogenous Asgr1 sequence of the non-human animal. 12. The non-human animal according to any one of the preceding claims, wherein the non-human animal is heterozygous for the genetically modified endogenous Asgr1 locus. 13. An animal other than a human, according to any one of paragraphs. 1-11, wherein the non-human animal is homozygous for the genetically modified endogenous Asgr1 locus. 14. An animal other than a human, according to any one of paragraphs. 1-13, where the non-human animal is a rat or mouse. 15. An animal other than a human, according to any one of paragraphs. 1-4, where the non-human animal is a mouse. 16. The non-human animal of claim 15, wherein all or part of the cytoplasmic domain is encoded by the endogenous murine Asgr1 sequence. 17. A non-human animal according to claim 16, wherein the cytoplasmic domain contains the sequence set forth under SEQ ID NO: 29. 18. The non-human animal of claim 15, wherein all or part of the transmembrane domain is encoded by the endogenous mouse Asgr1 sequence. 19. A non-human animal according to claim 18, wherein the transmembrane domain contains the sequence set forth under SEQ ID NO: 30. 20. An animal other than a human, according to any one of paragraphs. 16-19, where either all of the cytoplasmic domain or all of the transmembrane domain, or part of both, is encoded by the endogenous mouse Asgr1 sequence. 21. A non-human animal according to claim 20, wherein the cytoplasmic domain contains the sequence set forth in SEQ ID NO: 29 and the transmembrane domain contains the sequence set forth in SEQ ID NO: 30. 22. An animal other than a human, according to any one of paragraphs. 14-21, where the extracellular domain contains a supercoiled domain and a C-type lectin domain, and where both the entire supercoil domain and the entire C-type lectin domain, or part of both, are encoded by a segment of the endogenous Asgr1 locus that has been deleted and replaced by an orthologous sequence Human ASGR1, and both the entire cytoplasmic domain and the entire transmembrane domain, or part of both, are encoded by the endogenous mouse Asgr1 sequence. 23. An animal other than a human, according to any one of paragraphs. 14-22, wherein the C-type lectin domain is the C-type lectin domain of human ASGR1 and the supercoil domain is the human ASGR1 supercoil domain, the cytoplasmic domain is the mouse Asgr1 cytoplasmic domain, and the transmembrane domain is the mouse Asgr1 transmembrane domain. 24. A non-human animal according to claim 22 or 23, wherein the C-type lectin domain contains the sequence set forth in SEQ ID NO: 28, the supercoiled domain contains the sequence set forth in SEQ ID NO: 27, the cytoplasmic domain contains the sequence set forth under SEQ ID NO: 29, and the transmembrane domain contains the sequence set forth under SEQ ID NO: 30. 25. A non-human animal according to claim 24, wherein the modified Asgr1 protein contains the sequence set forth under SEQ ID NO: 3. 26. A method for assessing the delivery of a therapeutic complex to the liver through human ASGR1-mediated internalization in vivo, comprising: (a) administering a therapeutic complex to a non-human animal according to any one of paragraphs. 1-25, wherein the therapeutic complex comprises a therapeutic molecule and an antigen-binding protein or ligand that specifically binds human ASGR1; And (b) evaluating delivery of the therapeutic molecule to the liver of a non-human animal. 27. The method of claim 26, wherein the therapeutic molecule is a lysosomal replacement protein or enzyme or nucleic acid encoding a lysosomal replacement protein or enzyme, and step (b) involves assessing the presence or activity of the lysosomal replacement protein or enzyme in the animal's liver, different from man. 28. The method of claim 26, wherein the therapeutic molecule is a nucleic acid encoding a therapeutic secreted protein, and step (b) involves assessing serum levels or activity of the therapeutic secreted protein in a non-human animal. 29. A method for evaluating the effectiveness of a therapeutic molecule for targeting a protein with respect to internalization in the liver by human ASGR1 in vivo, comprising: (a) administering a therapeutic molecule to a non-human animal according to any one of paragraphs. 1-25, wherein the therapeutic molecule comprises a bispecific antigen-binding protein that specifically binds the protein and specifically binds human ASGR1; And (b) assessing cell surface levels, activity, or expression of a protein in the liver of a non-human animal. 30. The method of claim 29, wherein the protein is a liver cell surface protein and step (b) is to assess cell surface protein levels or activity in the liver of a non-human animal. 31. The method of claim 29, wherein the protein is a soluble protein and step (b) involves assessing the expression or activity of the soluble protein in the liver of a non-human animal.

Images