RU2796378C2 - Use of porous fibers for obtaining blood or blood derivative deputy in blood cells and platelets from extracellular vesicles - Google Patents
Use of porous fibers for obtaining blood or blood derivative deputy in blood cells and platelets from extracellular vesicles Download PDFInfo
- Publication number
- RU2796378C2 RU2796378C2 RU2020135585A RU2020135585A RU2796378C2 RU 2796378 C2 RU2796378 C2 RU 2796378C2 RU 2020135585 A RU2020135585 A RU 2020135585A RU 2020135585 A RU2020135585 A RU 2020135585A RU 2796378 C2 RU2796378 C2 RU 2796378C2
- Authority
- RU
- Russia
- Prior art keywords
- blood
- porous fibers
- extracellular vesicles
- porosity
- sample
- Prior art date
Links
Images
Abstract
Description
Настоящее изобретение относится к применению пористых волокон, имеющих пористость свыше 20 нм, в частности, полиэфирсульфоновых пористых волокон, для снижения в крови и производных крови концентрации произведенных из крови внеклеточных везикул, в частности, микровезикул, и экзосом и экзомеров, и к способам получения и анализа таких обедненных образцов.The present invention relates to the use of porous fibers having a porosity greater than 20 nm, in particular polyethersulfone porous fibers, for reducing the concentration of blood-derived extracellular vesicles, in particular microvesicles, and exosomes and exomers, in blood and blood derivatives, and to methods for producing and analysis of such depleted samples.
Предпосылки создания изобретенияPrerequisites for the creation of the invention
Внеклеточные везикулы представляют собой 30-нм – 2-мкм мембранные образования клеточного происхождения. Они включают апоптозные тельца (больше 1 мкм), онкосомы (больше 1 мкм), микровезикулы (200 нм – 1 мкм), экзосомы (30-120 нм) и экзомеры (примерно 35 мкм) (Van Der Pol et al., Zhang et al.).Extracellular vesicles are 30-2 µm membrane formations of cellular origin. They include apoptotic bodies (greater than 1 µm), oncosomes (greater than 1 µm), microvesicles (200 nm - 1 µm), exosomes (30-120 nm) and exomers (approximately 35 µm) (Van Der Pol et al., Zhang et al.).
Пористые волокна (HF) являются классом полупроницаемых барьеров, которые применяются, в частности, в области диализа (Ishihara et al.). Их основной характеристикой является их пористость, т.е. средний диаметр пор и распределение пор. В области медицины их типично используют в качестве фильтров при гемодиализе, гемофильтрации и плазмаферезе.Porous fibers (HF) are a class of semi-permeable barriers that are used in particular in the field of dialysis (Ishihara et al.). Their main characteristic is their porosity, i.e. average pore diameter and pore distribution. In the field of medicine, they are typically used as filters in hemodialysis, hemofiltration and plasmapheresis.
Пористые волокна получают с использованием различных материалов, включая целлюлозу, эфир целлюлозы, полисульфон, полиэфирсульфон (PES), полиметилметакрилат (ПММА), полиамид, азотсодержащие полимеры, стекло, диоксид кремния, ацетат целлюлозы, поливинилиденфторид (ПВДФ), поливинилхлорид (ПВХ), политетрафторэтилен (ПТФЭ), сложный полиэфир, керамику, полиимид, полиэфиримид, полиэтиленимин-функционализированный полиамидимид (торлон™), поливиниловый спирт (ПВС). (Seo-Hyun Pak et al.; Xing Yanga et al., Hailin Zhu et. аl.; Amir Dashti et al.; Ze-Lin Qiu et al.; Li FS et al.; Labreche Y et al.; Zhang Y et al.; Higa M. et al., Mock 2007).Porous fibers are made using a variety of materials, including cellulose, cellulose ether, polysulfone, polyethersulfone (PES), polymethyl methacrylate (PMMA), polyamide, nitrogen-containing polymers, glass, silicon dioxide, cellulose acetate, polyvinylidene fluoride (PVDF), polyvinyl chloride (PVC), polytetrafluoroethylene (PTFE), polyester, ceramic, polyimide, polyesterimide, polyethyleneimine-functionalized polyamidimide (Torlon™), polyvinyl alcohol (PVA). (Seo-Hyun Pak et al.; Xing Yanga et al., Hailin Zhu et. al.; Amir Dashti et al.; Ze-Lin Qiu et al.; Li FS et al.; Labreche Y et al.; Zhang Y et al.; Higa M. et al., Mock 2007).
В технике имеется множество примеров того, как можно получить кровь и производные крови для анализа.There are many examples in the art of how blood and blood derivatives can be obtained for analysis.
Получение производных крови обычно страдает от активации тромбоцитов и белых клеток крови и гемолиза. Активации тромбоцитов можно достичь, например, просто встряхивая пробирку, содержащую образец крови (Black et al.). Также присутствие внеклеточных везикул гемопоэтического происхождения является известным запутывающим фактором в случае выделения и молекулярного анализа внеклеточных везикул паренхимного и стромального происхождения, влияющих на отношение сигнал-шум при анализе и на воспроизводимость результатов.Blood derivatives generally suffer from platelet and white blood cell activation and hemolysis. Platelet activation can be achieved, for example, by simply shaking a tube containing a blood sample (Black et al.). Also, the presence of extracellular vesicles of hematopoietic origin is a known confounding factor in the isolation and molecular analysis of extracellular vesicles of parenchymal and stromal origin, affecting the signal-to-noise ratio in the analysis and the reproducibility of the results.
Уровень техникиState of the art
Пористые волокна описаны на известном уровне техники в связи с их способностью удерживать везикулы или не допускать их прохождения из-за своей пористости (WO2007127848, WO2001082958), или потому, что пористые волокна химически модифицированы для того, чтобы связывать везикулы (WO2015130956).Porous fibers have been described in the prior art for their ability to retain or prevent passage of vesicles due to their porosity (WO2007127848, WO2001082958), or because the porous fibers are chemically modified to bind vesicles (WO2015130956).
Краткое описание фигурBrief description of the figures
Фиг. 1. Число наночастиц в плазме, полученной центрифугированием, фильтрацией через устройство с HF с пористостью 200 нм или фильтрацией через устройство с HF с пористостью 20 нм.Fig. 1. The number of nanoparticles in plasma obtained by centrifugation, filtration through a device with HF with a porosity of 200 nm, or filtration through a device with HF with a porosity of 20 nm.
Фиг. 2. Количества экзосом из крови, измеренные в образцах плазмы, полученных фильтрацией через устройство с HF с пористостью 200 нм, или с помощью числа копий (копии/мл) аллельного гена BRAF в плазме трех пациентов с метастастатической меланомой, полученной центрифугированием.Fig. 2. Numbers of exosomes from blood measured in plasma samples obtained by filtration through a HF device with a porosity of 200 nm, or by the copy number (copy/ml) of the BRAF allelic gene in the plasma of three patients with metastatic melanoma obtained by centrifugation.
Фиг. 3. Количества экзосом из крови, измеренные в образцах плазмы, полученных фильтрацией через целлюлозный не-HF фильтр с пористостью 200 нм.Fig. 3. Numbers of exosomes from blood measured in plasma samples obtained by filtration through a non-HF cellulose filter with a porosity of 200 nm.
Фиг. 4. Электрофореграмма малых РНК микровезикул, присутствующих в образцах плазмы, полученных фильтрацией через устройство с HF с пористостью 200 нм, или центрифугированием.Fig. 4. Electrophoregram of small RNA microvesicles present in plasma samples obtained by filtration through an HF device with a porosity of 200 nm, or by centrifugation.
Фиг. 5. Уровни мутации BRAFV600E (A) или отношение BRAFV600E к BRAFWT (B) в экзосомах опухоли, выступивших в крови здоровых доноров, при измерении после центрифугирования или фильтрации через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. 5. Levels of BRAF V600E mutation (A) or the ratio of BRAF V600E to BRAF WT (B) in tumor exosomes released from the blood of healthy donors as measured after centrifugation or filtration through a 200 nm polyethersulfone HF device.
Фиг. 6. Количества CD9- и TM9SF4-положительных экзосом, измеренные в образцах плазмы, полученных фильтрацией через устройство с HF с пористостью 200 нм или центрифугированием.Fig. 6. Numbers of CD9- and TM9SF4-positive exosomes measured in plasma samples obtained by filtration through an HF device with a porosity of 200 nm or by centrifugation.
Фиг. 7. Липемический индекс образцов плазмы здоровых доноров после центрифугирования или фильтрации через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. 7. Lipemic index of plasma samples from healthy donors after centrifugation or filtration through a device with polyethersulfone HF with a porosity of 200 nm.
Фиг. 8. Уровни копий мутации BRAFV600E (копии/мл) в экзосомах опухоли, выступивших в плазме здоровых доноров, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. Fig. 8. Copy levels of the BRAF V600E mutation (copies/ml) in tumor exosomes released from plasma of healthy donors obtained by centrifugation or filtration through a device with polyethersulfone HF with a porosity of 200 nm.
Фиг. 9. Липемический индекс образцов плазмы до и после центрифугирования или фильтрации через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. 9. Lipemic index of plasma samples before and after centrifugation or filtration through a device with polyethersulfone HF with a porosity of 200 nm.
Фиг. 10. Число наночастиц в плазме, полученной из цельной крови с использованием центрифуги или фильтра из полиэфирсульфонового HF с пористостью 200 нм или с пористостью 500 нм.Fig. 10. The number of nanoparticles in plasma obtained from whole blood using a centrifuge or a filter of polyethersulfone HF with a porosity of 200 nm or with a porosity of 500 nm.
Фиг. 11. Количества CD9-, CD45-, CD 61- и CD 235-положительных экзосом, измеренные в образцах плазмы, полученных или центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 500 нм.Fig. 11. Numbers of CD9-, CD45-, CD61- and CD235-positive exosomes measured in plasma samples obtained by either centrifugation or filtration through a 500 nm polyethersulfone HF device.
Фиг. 12. Уровни копий (копии/мл) гена BRAF в плазме пациентов с метастастатической меланомой, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. 12. Copy levels (copies/ml) of the BRAF gene in plasma of patients with metastatic melanoma obtained by centrifugation or filtration through a 200 nm polyethersulfone HF device.
Фиг. 13. Частоты аллелей копий (копии/мл) гена BRAF в плазме пациентов с метастастатической меланомой, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. 13. Allele frequencies of copies (copies/ml) of the BRAF gene in plasma of patients with metastatic melanoma obtained by centrifugation or filtration through a device with polyethersulfone HF with a porosity of 200 nm.
Фиг. 14. Количества TM9SF4-положительных экзосом, измеренные в образцах плазмы с выбросом экзосом опухоли, и полученных фильтрацией через устройство с HF с пористостью 200 нм или центрифугированием.Fig. 14. Numbers of TM9SF4-positive exosomes measured in tumor exosome ejection plasma samples obtained by filtration through a 200 nm HF device or by centrifugation.
Подробное описание изобретенияDetailed description of the invention
Авторы изобретения неожиданно обнаружили, что использование пористых волокон, имеющих пористость выше 20 нм, при гравитационной фильтрации дает возможность снизить концентрацию внеклеточных везикул, происходящих из некоторых компонентов крови и имеющих размер, который меньше пористости пористых волокон.The inventors have unexpectedly found that the use of porous fibers having a porosity above 20 nm in gravity filtration makes it possible to reduce the concentration of extracellular vesicles derived from certain blood components and having a size that is smaller than the porosity of the porous fibers.
В первом аспекте настоящее изобретение относится к применению in vitro пористых волокон, имеющих пористость выше 20 нм, для снижения в образце крови или происходящей из крови жидкости, путем гравитационной фильтрации, концентрации внеклеточных везикул, причем такие внеклеточные везикулы имеют размер, который меньше пористости пористых волокон, и происходят из компонентов крови, выбранных из группы, включающей красные клетки крови, белые клетки крови, тромбоциты и их комбинации.In a first aspect, the present invention relates to the in vitro use of porous fibers having a porosity above 20 nm to reduce, in a blood sample or a blood-derived fluid, by gravity filtration, the concentration of extracellular vesicles, such extracellular vesicles having a size that is smaller than the porosity of the porous fibers. , and are derived from blood components selected from the group consisting of red blood cells, white blood cells, platelets, and combinations thereof.
Во втором аспекте настоящее изобретение относится к способу получения in vitro крови или производного крови, существенно обедненного внеклеточными везикулами, происходящими из компонентов крови, выбранных из группы, включающей красные клетки крови, белые клетки крови, тромбоциты и их любую комбинацию, причем способ включает стадии гравитационной фильтрации образца крови или происходящей из крови жидкости через фильтр, включающий пористые волокна, имеющие пористость выше 20 нм, причем таким образом получают кровь или производное крови, существенно обедненное внеклеточными везикулами, причем такие внеклеточные везикулы имеют размер, который меньше пористости пористых волокон.In a second aspect, the present invention relates to a method for in vitro production of blood or a blood derivative substantially depleted in extracellular vesicles derived from blood components selected from the group consisting of red blood cells, white blood cells, platelets, and any combination thereof, the method comprising the steps of gravity filtering a blood sample or a blood-derived fluid through a filter comprising porous fibers having a porosity above 20 nm, thereby obtaining blood or a blood derivative significantly depleted in extracellular vesicles, such extracellular vesicles having a size that is smaller than the porosity of the porous fibers.
В третьем аспекте настоящее изобретение относится к способу анализа in vitro содержания внеклеточных везикул в образце крови или происходящей из крови жидкости, причем такой способ включаетIn a third aspect, the present invention relates to a method for in vitro analysis of the content of extracellular vesicles in a blood sample or a blood-derived fluid, which method includes
а) гравитационную фильтрацию образца крови или происходящей из крови жидкости через фильтр из пористых волокон, имеющих пористость выше 20 нм, причем посредством этого получают фильтрат,a) gravity filtering the blood sample or blood-derived fluid through a porous fiber filter having a porosity above 20 nm, whereby a filtrate is obtained,
b) анализ содержания внеклеточных везикул в фильтрате, полученном на стадии а).b) analysis of the content of extracellular vesicles in the filtrate obtained in step a).
Специалисту будет известно, какой анализ выполнять и как его выполнять в зависимости от обстоятельств и на основе его собственного опыта и литературы, доступной в этой области. Такой анализ может быть направлен, например, на измерение количеств внеклеточных везикул, которые удерживают определенный белок на своей поверхности, при использовании твердофазного иммуноферментного анализа (ELISA) или проточной цитометрии (FACS). Другие анализы могут быть направлены на подсчет числа всех наночастиц в образце через анализ трекинга наночастиц (NTA) или измерение экспрессии генов с помощью количественной полимеразной цепной реакции в реальном времени (кПЦР (qRT-PCR) или секвенирования следующего поколения (NGS).The person skilled in the art will know what analysis to perform and how to perform it, depending on the circumstances and based on his own experience and the literature available in this field. Such an assay can be directed, for example, to measuring the amounts of extracellular vesicles that retain a particular protein on their surface using enzyme-linked immunosorbent assay (ELISA) or flow cytometry (FACS). Other assays may aim to enumerate the number of all nanoparticles in a sample via nanoparticle tracking assay (NTA) or measure gene expression using quantitative real-time polymerase chain reaction (qRT-PCR) or next generation sequencing (NGS).
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна включают полиэфирсульфоновые пористые волокна.In an embodiment in accordance with any aspect of the present invention, the porous fibers include polyethersulfone porous fibers.
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна состоят из полиэфирсульфоновых пористых волокон.In an embodiment in accordance with any aspect of the present invention, the porous fibers are composed of polyethersulfone porous fibers.
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна включают материал, выбранный из списка, включающего целлюлозу, эфир целлюлозы, полисульфон, полиэфирсульфон (PES), полиметилметакрилат (ПММА), полиамид, азотсодержащие полимеры, стекло, диоксид кремния, ацетат целлюлозы, поливинилиденфторид (ПВДФ), поливинилхлорид (ПВХ), политетрафторэтилен (ПТФЭ), сложный полиэфир, керамику, полиимид, полиэфиримид, полиэтиленимин-функционализированный полиамидимид (торлон™) и поливиниловый спирт (ПВС).In an embodiment in accordance with any aspect of the present invention, the porous fibers comprise a material selected from the list of cellulose, cellulose ether, polysulfone, polyethersulfone (PES), polymethyl methacrylate (PMMA), polyamide, nitrogen-containing polymers, glass, silicon dioxide, cellulose acetate, polyvinylidene fluoride. (PVDF), polyvinyl chloride (PVC), polytetrafluoroethylene (PTFE), polyester, ceramic, polyimide, polyetherimide, polyethyleneimine-functionalized polyamidimide (torlon™) and polyvinyl alcohol (PVA).
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна заключаются в материале, выбранном из списка, включающего целлюлозу, эфир целлюлозы, полисульфон, полиэфирсульфон (PES), полиметилметакрилат (ПММА), полиамид, азотсодержащие полимеры, стекло, диоксид кремния, ацетат целлюлозы, поливинилиденфторид (ПВДФ), поливинилхлорид (ПВХ), политетрафторэтилен (ПТФЭ), сложный полиэфир, керамику, полиимид, полиэфиримид, полиэтиленимин-функционализированный полиамидимид (торлон™) и поливиниловый спирт (ПВС).In an embodiment in accordance with any aspect of the present invention, the porous fibers are comprised of a material selected from a list including cellulose, cellulose ether, polysulfone, polyethersulfone (PES), polymethyl methacrylate (PMMA), polyamide, nitrogen-containing polymers, glass, silica, cellulose acetate, polyvinylidene fluoride (PVDF), polyvinyl chloride (PVC), polytetrafluoroethylene (PTFE), polyester, ceramic, polyimide, polyetherimide, polyethyleneimine-functionalized polyamidimide (torlon™) and polyvinyl alcohol (PVA).
В воплощении в соответствии с любым аспектом настоящего изобретения пористость выбирают из списка, включающего пористость выше 20 нм, выше 25 нм, выше 30 нм, выше 35 нм, выше 40 нм, выше 45 нм, выше 50 нм, выше 55 нм, выше 60 нм, выше 65 нм, выше 70 нм, выше 75 нм, выше 80 нм, выше 85 нм, выше 90 нм, выше 95 нм, выше 100 нм, выше 105 нм, выше 110 нм, выше 115 нм, выше 120 нм, выше 125 нм, выше 130 нм, выше 135 нм, выше 140 нм, выше 145 нм, выше 150 нм, выше 155 нм, выше 160 нм, выше 165 нм, выше 170 нм, выше 175 нм, выше 180 нм, выше 185 нм, выше 190 нм, выше 195 нм и выше 200 нм.In an embodiment in accordance with any aspect of the present invention, the porosity is selected from a list including porosity above 20 nm, above 25 nm, above 30 nm, above 35 nm, above 40 nm, above 45 nm, above 50 nm, above 55 nm, above 60 nm, above 65 nm, above 70 nm, above 75 nm, above 80 nm, above 85 nm, above 90 nm, above 95 nm, above 100 nm, above 105 nm, above 110 nm, above 115 nm, above 120 nm, above 125 nm, above 130 nm, above 135 nm, above 140 nm, above 145 nm, above 150 nm, above 155 nm, above 160 nm, above 165 nm, above 170 nm, above 175 nm, above 180 nm, above 185 nm, above 190 nm, above 195 nm and above 200 nm.
В воплощении в соответствии с любым аспектом настоящего изобретения пористость составляет ниже 500 нм.In an embodiment in accordance with any aspect of the present invention, the porosity is below 500 nm.
В воплощении в соответствии с любым аспектом настоящего изобретения пористость выбирают из списка, включающего пористость примерно 150 нм, примерно 200 нм, примерно 250 нм, примерно 300 нм, примерно 350 нм, примерно 400 нм, примерно 450 нм, примерно 500 нм и в любом интервале, включающем эти величины.In an embodiment in accordance with any aspect of the present invention, the porosity is selected from a list including porosity of about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, and in any interval including these values.
В воплощении в соответствии с любым аспектом настоящего изобретения пористость выбирают из списка, включающего пористость 150 нм, 200 нм, 250 нм, 300 нм, 350 нм, примерно 400 нм, 450 нм, 500 нм и в любом интервале, включающем эти величины.In an embodiment in accordance with any aspect of the present invention, the porosity is selected from a list including 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, about 400 nm, 450 nm, 500 nm, and any range including these values.
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна имеют пористость, выбранную из группы интервалов, включающих примерно 150 – примерно 250 нм, примерно 150 – примерно 300 нм, примерно 150 – примерно 350 нм, примерно 150 – примерно 400 нм, примерно 150 – примерно 450 нм, примерно 150 – примерно 500 нм, примерно 200 – примерно 250 нм, примерно 200 – примерно 300 нм, примерно 200 – примерно 350 нм, примерно 200 – примерно 400 нм, примерно 200 – примерно 450 нм и примерно 200 – примерно 500 нм.In an embodiment in accordance with any aspect of the present invention, the porous fibers have a porosity selected from the group of ranges including about 150-about 250 nm, about 150-about 300 nm, about 150-about 350 nm, about 150-about 400 nm, about 150 - approx. 450 nm, approx. 150 - approx. 500 nm, approx. 200 - approx. 250 nm, approx. 200 - approx. 300 nm, approx. 200 - approx. 350 nm, approx. approximately 500 nm.
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна имеют пористость, выбранную из группы интервалов, включающих 150 – 250 нм, 150 – 300 нм, 150 – 350 нм, 150 – 400 нм, 150 – 450 нм, 150 – 500 нм, 200 – 250 нм, 200 – 300 нм, 200 – 350 нм, 200 – 400 нм, 200 – 450 нм и 200 – 500 нм.In an embodiment in accordance with any aspect of the present invention, the porous fibers have a porosity selected from the group of ranges including 150-250 nm, 150-300 nm, 150-350 nm, 150-400 nm, 150-450 nm, 150-500 nm, 200 - 250 nm, 200 - 300 nm, 200 - 350 nm, 200 - 400 nm, 200 - 450 nm and 200 - 500 nm.
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна имеют пористость примерно 200 нм.In an embodiment in accordance with any aspect of the present invention, the porous fibers have a porosity of about 200 nm.
В воплощении в соответствии с любым аспектом настоящего изобретения пористые волокна имеют пористость, равную 200 нм.In an embodiment according to any aspect of the present invention, the porous fibers have a porosity of 200 nm.
В воплощении в соответствии с любым аспектом настоящего изобретения образец происходящей из крови жидкости является образцом плазмы.In an embodiment in accordance with any aspect of the present invention, the blood-derived fluid sample is a plasma sample.
В воплощении в соответствии с любым аспектом настоящего изобретения внеклеточные везикулы выбирают из группы, включающей микровезикулы, экзосомы, экзомеры и их комбинации.In an embodiment in accordance with any aspect of the present invention, the extracellular vesicles are selected from the group consisting of microvesicles, exosomes, exomers, and combinations thereof.
Все воплощения можно комбинировать для генерации новых воплощений в соответствии с любым из указанных выше аспектов изобретения.All embodiments can be combined to generate new embodiments in accordance with any of the above aspects of the invention.
ПримерыExamples
Теперь изобретение будет описываться с помощью не ограничивающих его примеров.Now the invention will be described using non-limiting examples.
Материалы и методыMaterials and methods
А) Сбор кровиA) blood collection
Все пациенты голодают с полуночи до забора крови утром. Кровь собирают или в мешок для крови, содержащий CPD (CompoFlow; Fresenius Kabi), или собирают в пробирки с K2-EDTA для плазмы (VACUTAINER® Becton Dickinson, пурпурная крышка, REF 367864, 6,0 мл). Затем пробирки K2-EDTA переворачивают 5 или 6 раз, оставляют в вертикальном положении и хранят при комнатной температуре (20-25°C) до дальнейшей обработки.All patients fast from midnight until blood sampling in the morning. Blood is collected either in a blood bag containing CPD (CompoFlow; Fresenius Kabi) or collected in plasma K2-EDTA tubes (VACUTAINER® Becton Dickinson, purple cap, REF 367864, 6.0 ml). The K2-EDTA tubes are then inverted 5 or 6 times, left upright and stored at room temperature (20-25°C) until further processing.
В) Получение плазмы с помощью центрифугиC) Obtaining plasma using a centrifuge
Получение плазмы с помощью центрифуги выполняют в пределах часа от сбора крови путем центрифугирования цельной крови при 1500 g в течение 10 минут при 20-25°C. Плазму собирают с использованием одноразовой пипетки Пастера (Steroglass, REF: LPMW032653; 5 мл), избегая ее ресуспендирования, остановившись на 3-4 мм выше лейкоцитной пленки. Образцы проверяют визуально на следы липидов, желчь (Itterum) или гемолиз. Плазму собирают в 15-мл пробирки типа Фалькон, осторожно переворачивают, помещают аликвоты в меченные криопробирки (кат.номер n°BSM 535, Biosigma) и хранят при -20°C.Plasma is obtained by centrifugation within an hour of blood collection by centrifuging whole blood at 1500 g for 10 minutes at 20-25°C. Plasma is collected using a disposable Pasteur pipette (Steroglass, REF: LPMW032653; 5 ml), avoiding resuspension by stopping 3-4 mm above the buffy coat. Samples are checked visually for traces of lipids, bile (Itterum), or hemolysis. Plasma was collected in 15 ml Falcon tubes, gently inverted, aliquots placed in labeled cryovials (Cat. No. n°BSM 535, Biosigma) and stored at -20°C.
С) Плазма, полученная фильтрацией через целлюлозный не-HF фильтр с пористостью 200 нмC) Plasma obtained by filtration through a non-HF cellulose filter with a porosity of 200 nm
Плазму получают центрифугированием, как описано ранее, и фильтруют через целлюлозный не-HF фильтр с пористостью 200 нм (кат.номер 190-9920; Nalgene). Фильтрованную плазму собирают в 15-мл пробирки типа Фалькон, помещают аликвоты в 2-мл микроцентрифужные пробирки и хранят при -20°C для дальнейшего использования.Plasma is obtained by centrifugation as previously described and filtered through a 200 nm non-HF cellulose filter (Cat. No. 190-9920; Nalgene). The filtered plasma is collected in 15 ml Falcon tubes, aliquoted into 2 ml microcentrifuge tubes and stored at -20° C. for later use.
D) Плазма, полученная фильтрацией через устройства с полиэфирсульфоновыми волокнами с пористостью 20/200 нмD) Plasma obtained by filtration through devices with polyethersulfone fibers with a porosity of 20/200 nm
Плазму получают с использованием вариантов коммерчески доступного устройства с полиэфирсульфоновыми волокнами с пористостью 20 нм или 200 нм, обычно используемого для гемодиализа (Plasmart 50; Medica Srl, Italy). Устройство модифицировано путем уменьшения длины от 150 мм до 60 мм, причем таким образом уменьшается объем крови, требуемой для примирования. Коротко, один из двух боковых выводов соединяют с мешком с цельной кровью или пробиркой K2-EDTA, в то время как другой вывод с противоположной стороны устройства соединяют с пустым мешком. Третий боковой вывод соединяют с пустым мешком для сбора фильтрованной плазмы. Мешок с кровью оставляют при RT в течение по меньшей мере 30 минут и осторожно перемешивают перед применением.Plasma is obtained using variants of a commercially available 20 nm or 200 nm polyethersulfone fiber device commonly used for hemodialysis (
Сорок миллилитров цельной крови фильтруют через устройство путем гравитационной фильтрации, собирают в боковом мешке 15 мл (30%) плазмы, переносят в 50-мл пробирку типа Фалькон, распределяют аликвотами в 2-мл микроцентрифужные пробирки и хранят при -20°C. Цельную кровь и ее клеточные компоненты в ретентате концентрируют, собирают в боковой мешок и отбрасывают.Forty milliliters of whole blood is filtered through the device by gravity filtration, collected in a side bag of 15 ml (30%) plasma, transferred to a 50 ml Falcon tube, aliquoted into 2 ml microcentrifuge tubes and stored at -20°C. Whole blood and its cellular components in the retentate are concentrated, collected in a side bag and discarded.
Е) Анализ трекинга наночастиц (NTA)E) Nanoparticle Tracking Analysis (NTA)
Перед анализом образцы плазмы центрифугируют при 13000g для устранения более крупных везикул, которые могут повлиять на анализ, и дополнительно разбавляют PBS 1:10000. NTA выполняют с использованием прибора LM10 Nanosight (Malvern, UK), устанавливая уровень камеры на 16 и затвор на 13000. Концентрацию частиц вычисляют как среднее из трех независимых измерений.Prior to analysis, plasma samples are centrifuged at 13,000g to eliminate larger vesicles that may interfere with analysis, and further diluted with PBS 1:10,000. NTA is performed using an LM10 Nanosight instrument (Malvern, UK), setting the chamber level to 16 and shutter to 13000. Particle concentration is calculated as the average of three independent measurements.
F) Определение количества экзосом ELISAF) Exosome Counting ELISA
Образцы плазмы оттаивают при RT, и к каждому образцу добавляют 1 мкл коктейля ингибиторов протеаз (1000×; Sigma, кат.ном. P-834) для сохранения белковых биомаркеров. Образцы плазмы центрифугируют при 1200g в течение 20 минут при комнатной температуре (RT) для устранения оставшихся красных клеток крови и клеточного дебриса. Полученный супернатант собирают и разбавляют фосфатным буфером (PBS) в объемном соотношении 1:1.Plasma samples are thawed at RT and 1 μl of a protease inhibitor cocktail (1000x; Sigma, cat. no. P-834) is added to each sample to preserve protein biomarkers. Plasma samples are centrifuged at 1200g for 20 minutes at room temperature (RT) to eliminate remaining red blood cells and cell debris. The resulting supernatant is collected and diluted with phosphate buffer (PBS) in a 1:1 volume ratio.
Коротко, 100 мкл разбавленной плазмы инкубируют в течение ночи при 4°С в 96-луночных планшетах, предварительно сенсибилизированных 0,1 мкг/лунка антителом анти-CD9 (кат.ном. HBM-CD9-100, HansaBioMed Life Sciences Ltd), анти-CD45 антителом (кат.ном. 610265, BD), анти-CD61 антителом (кат.ном. 555752, BD); анти-CD235 антителом (кат.ном. 555569, BD) и анти-TM9SF4 антителом (2 мкг/мл). После трех промывок буфером для промывки (PBS-твин 0,05%) планшеты инкубируют с биотинилированным анти-CD9 антителом (кат.ном. 558749, BD Pharmigen), инкубируют в течение 2 час при 4°С, трижды промывают буфером для промывки, инкубируют в течение одного часа при 4°С с совместимым с конъюгатом поли-HRP-стрептавидин вторичным антителом (кат.ном. 21140, Pierce) и трижды промывают буфером для промывки. Колориметрическую реакцию начинают, добавляя в каждую лунку 100 мкл раствора субстрата (TMBlue POD; раствор A и B, 1:1, Pierce), инкубируя 10 минут в темноте при RT, и останавливают, добавляя 100 мкл стоп-раствора (1N серная кислота). Регистрируют поглощение O/D при 450 нм с помощью M1000 Tecan, и результаты выражают в виде отношения сигнала к шуму (StB).Briefly, 100 µl of diluted plasma is incubated overnight at 4°C in 96-well plates previously sensitized with 0.1 µg/well of anti-CD9 antibody (cat. no. HBM-CD9-100, HansaBioMed Life Sciences Ltd), anti -CD45 antibody (cat. no. 610265, BD), anti-CD61 antibody (cat. no. 555752, BD); anti-CD235 antibody (cat. no. 555569, BD) and anti-TM9SF4 antibody (2 μg/ml). After three washes with wash buffer (PBS-Tween 0.05%), plates are incubated with biotinylated anti-CD9 antibody (Cat. No. 558749, BD Pharmigen), incubated for 2 hours at 4°C, washed three times with wash buffer, incubated for one hour at 4° C. with poly-HRP-streptavidin conjugate compatible secondary antibody (Cat. No. 21140, Pierce) and washed three times with wash buffer. The colorimetric reaction is started by adding 100 µl of substrate solution (TMBlue POD; solution A and B, 1:1, Pierce) to each well, incubating for 10 minutes in the dark at RT, and stopping by adding 100 µl of stop solution (1N sulfuric acid) . The O/D absorbance at 450 nm is recorded with the M1000 Tecan and the results are expressed as signal to noise ratio (StB).
G) Получение осадка микровезикулG) Precipitation of microvesicles
Плазму, полученную центрифугированием, и плазму, полученную фильтрацией через пористые волокна, дополнительно центрифугируют при 10000g в течение 30 минут при RT, и получают осадок микровезикул (MV). Осадок MV ресуспендируют в 100 мкл PBS перед дальнейшей обработкой.The plasma obtained by centrifugation and the plasma obtained by filtration through porous fibers are further centrifuged at 10,000g for 30 minutes at RT, and a microvesicle pellet (MV) is obtained. The MV pellet is resuspended in 100 µl PBS before further processing.
Н) Экстрагирование малых РНК из осадка MV и анализ электрофореграммыH) Extraction of small RNAs from the MV pellet and analysis of the electrophoregram
РНК экстрагируют из осадков MV с использованием набора для общего иммунозахвата экзосом и экстрагирования РНК (Overall Exosome Immunocapture and RNA extraction) из биожидкостей человека и сред для клеток (кат.ном. HBM-RNA-BOF-20; HansaBioMed Life Sciences Ldt, Estonia) и элюируют в 15 мл буфера для элюирования согласно инструкциям изготовителя. Пять микролитров экстрагированных РНК загружают в набор RNA 6000 Pico Kit (кат.ном. 5067-1513; Agilent Technologies) и пропускают на приборе Bioanalyzer, и получают электрофореграмму РНК.RNA is extracted from MV pellets using the Overall Exosome Immunocapture and RNA extraction kit from human biofluids and cell media (Cat. No. HBM-RNA-BOF-20; HansaBioMed Life Sciences Ldt, Estonia) and elute in 15 ml of elution buffer according to the manufacturer's instructions. Five microliters of the extracted RNAs are loaded into an RNA 6000 Pico Kit (Cat. No. 5067-1513; Agilent Technologies) and run on a Bioanalyzer to obtain an RNA electropherogram.
I) Добавление к образцам крови с BRAFV600E-положительных экзосом опухоли и выделение экзосом-ассоциированной ДНК.I) Addition of BRAF V600E -positive tumor exosomes to blood samples and isolation of exosome-associated DNA.
Десять миллилитров цельной крови здоровых пациентов-доноров «понизывают» 80 мкл BRAFV600E-положительных экзосом опухоли, закупленных у коммерческого поставщика (5,5 мкл/мкл, клеточная линия COLO1, HansaBioMed Life Sciences Ldt).Ten milliliters of whole blood from healthy donor patients "downgrade" 80 µl of BRAF V600E -positive tumor exosomes purchased from a commercial supplier (5.5 µl/µl, COLO1 cell line, HansaBioMed Life Sciences Ldt).
Из добавленных экзосом опухоли экстрагируют экзосом-ассоциированную ДНК (экзо-ДНК (Exo-DNA)) и очищают с использованием коммерчески доступного набора для экстрагирования циркулирующей ДНК (seleCTEVTM low input DNA; Exosomics Siena Spa, Italy). Коротко, экзосомы захватываются из плазмы с использованием пептида из набора и осаждаются после 2-часовой инкубации. Осадки экзосом лизируют с помощью буфера для лизиса из набора и расщепляют протеиназой К для высвобождения ДНК из белковых комплексов K. Затем к образцу добавляют этанол, загружают в спин-колонку с кремнеземной мембраной и центрифугируют при 10000g в течение 1 минуты. После центрифугирования свободную жидкость отбрасывают. Выполняют две стадии промывки согласно инструкциям изготовителя для того, чтобы перед элюированием избавиться от загрязнений растворителей и происходящих из плазмы ингибиторов. Экзо-ДНК элюируют в 50 мкл буфера для элюирования и хранят при -20°C до использования.Exosome-associated DNA (exo-DNA (Exo-DNA)) is extracted from the added tumor exosomes and purified using a commercially available circulating DNA extraction kit (seleCTEV ™ low input DNA; Exosomics Siena Spa, Italy). Briefly, exosomes are captured from plasma using a peptide from the kit and precipitated after a 2 hour incubation. The exosome pellets are lysed with the lysis buffer from the kit and digested with proteinase K to release the DNA from the K protein complexes. Ethanol is then added to the sample, loaded onto a silica membrane spin column and centrifuged at 10,000g for 1 minute. After centrifugation, the free liquid is discarded. Perform two washing steps according to the manufacturer's instructions to remove solvent impurities and plasma-derived inhibitors prior to elution. Exo-DNA is eluted in 50 µl of elution buffer and stored at -20°C until use.
Амплификация генов BRAFV600E и BRAFWT кПЦРAmplification of BRAF V600E and BRAF WT genes qPCR
Смесь для каждой кПЦР включает 10 мкл очищенной экзо-ДНК, универсальные зонды 1X SsoAdvanced Universal Probes Mastermix (Biorad; US), 0,625 мкл праймеров (10 мкM) и 0,3125 мкл флуоресцентного зонда (10 мкM) в общем объеме 25мкл. Используют следующие праймер и зонды:The mix for each qPCR includes 10 µl of purified exo-DNA, 1X SsoAdvanced Universal Probes Mastermix (Biorad; US), 0.625 µl of primers (10 µM) and 0.3125 µl of fluorescent probe (10 µM) in a total volume of 25 µl. Use the following primer and probes:
a) BRAFWT FW: TAGGTGATTTTGGTCTAGCTACAG+T; a) BRAF WT FW: TAGGTGATTTTGGTCTAGCTACAG+T;
b) BRAFWT RW: TTAATCAGTGGAAAAATAGCCTCA; b) BRAF WT RW: TTAATCAGTGGAAAAATAGCCTCA;
c) BRAFV600E FW: TAGGTGATTTTGGTCTAGCTACAG+A; c) BRAF V600E FW: TAGGTGATTTTGGTCTAGCTACAG+A;
d) BRAFV600E RW TTAATCAGTGGAAAAATAGCCTCA;d) BRAF V600E RW TTAATCAGTGGAAAAATAGCCTCA;
e) зонд 5’-FAM CCGAAGGGGATC+CAGACAA+CTGTTCAAACTGCCTTCGG-3BHQ1 -3.e) 5'-FAM probe CCGAAGGGGATC+CAGACAA+CTGTTCAAACTGCCTTCGG-3BHQ1 -3.
После тщательного перемешивания каждую реакционную смесь загружают, при трехкратном повторе, в 96-луночный планшет для ПЦР, и запускают следующую программу кПЦР: 95°C в течение 3', 40 циклов при 95°C в течение 5'' и 60°C в течение 30’', за которыми следует конечная стадия выдержки при 4°C. Для того, чтобы вычислить % восстановленного BRAFV600E, используют следующую формулу: = [2^(Ct загрузка –Ct выделение )]%.After thorough mixing, each reaction mixture is loaded, in triplicate, into a 96-well PCR plate and the following qPCR program is run: 95°C for 3', 40 cycles at 95°C for 5'' and 60°C for for 30'', followed by a final holding step at 4°C. To calculate the % of recovered BRAF V600E , use the following formula: = [2 ^(Ct load -Ct allocation ) ]%.
L) Детекция копий гена BRAFV600E цифровой капельной ПЦРL) Detection of copies of the BRAF V600E gene by digital droplet PCR
Реакционная смесь для каждой цифровой капельной ПЦР включает 10 мкл очищенной экзо-ДНК, 2Х набора ddPCR Supermix для зондов (кат.ном. 186301; Biorad), 20X анализа для детекции мутаций BRAF V600E (анализ ID: dHsaMDV2010027; Biorad) и 5 мкл воды без ДНКазы. Каждую реакционную смесь загружают согласно инструкциям изготовителя, и запускают следующую программу с ddPCR: 95°C в течение 10', 40 циклов при 95°C в течение 30'' и 56°C в течение 1', с последующей конечной стадией выдержки при 4°C. Копии гена BRAF V600E и частоты аллелей вычисляют с использованием программы QuantaSoft (Biorad).Reaction mix for each digital PCR droplet includes 10 µl of purified exo-DNA, 2X ddPCR Supermix probe kit (cat. no. 186301; Biorad), 20X BRAF V600E mutation detection assay (assay ID: dHsaMDV2010027; Biorad) and 5 µl of water without DNase. Each reaction mixture was loaded according to the manufacturer's instructions and the following program was run with ddPCR: 95°C for 10', 40 cycles at 95°C for 30'' and 56°C for 1', followed by a final soak step at 4 °C BRAF V600E gene copies and allele frequencies were calculated using the QuantaSoft program (Biorad).
М) Количественное определение липемического индекса образцов плазмыM) Quantitative determination of the lipemic index of plasma samples
Липемический индекс измеряют в 500 мкл плазмы с использованием набора Serum Index Gen.2 на приборе Cobas согласно инструкциям изготовителя (кат.ном. 05172179190; Roche).The lipemic index is measured in 500 µl of plasma using the Serum Index Gen.2 kit on a Cobas instrument according to the manufacturer's instructions (cat. no. 05172179190; Roche).
Пример 1. Устройство с пористым волокном (HF) с 200-нм порами эффективно сепарирует богатую наночастицами плазму из кровиExample 1 A porous fiber (HF) device with 200 nm pores effectively separates nanoparticle-rich plasma from blood
Фиг. 1 показывает число наночастиц с помощью анализа трекинга наночастиц (NTA) плазмы, полученной из цельной крови с использованием центрифуги, центрифуги плюс целлюлозный не-HF 200-нм фильтр или полиэфирсульфонового пористого волокна с пористостью 200 нм или пористостью 20 нм.Fig. 1 shows the number of nanoparticles by nanoparticle tracking analysis (NTA) of plasma obtained from whole blood using a centrifuge, centrifuge plus
Таким образом, показано, что способ по изобретению позволяет получить число наночастиц, схожее с использованием центрифуги плюс целлюлозный не-HF фильтр.Thus, the method of the invention has been shown to produce a number of nanoparticles similar to using a centrifuge plus a cellulose non-HF filter.
Пример 2. Плазма, полученная при фильтрации цельной крови через 200-нм HF, имеет меньше внеклеточных везикул, происходящих из красных и белых клеток крови, чем плазма, полученная на центрифугеExample 2 Plasma obtained by filtering whole blood through 200 nm HF has fewer extracellular vesicles derived from red and white blood cells than plasma obtained by centrifugation
Фиг. 2 показывает количества внеклеточных везикул, захваченных из плазмы здоровых доноров, полученной центрифугированием или фильтрацией через устройство с полиэфирсульновым HF с пористостью 200 нм, с использованием анти-CD9 антитела (общий маркер EV), анти-CD45 антитела (общий маркер белых клеток крови), анти-CD61 антитела (общий маркер тромбоцитов) или анти-CD235 антитела (общий маркер эритроцитов).Fig. 2 shows the numbers of extracellular vesicles captured from plasma of healthy donors obtained by centrifugation or filtration through a 200 nm polyethersulfonic HF device using anti-CD9 antibody (common EV marker), anti-CD45 antibody (common marker of white blood cells), anti-CD61 antibodies (common marker of platelets) or anti-CD235 antibodies (common marker of erythrocytes).
Таким образом, показано, что использование устройства с полиэфирсульновым HF с пористостью 200 нм обедняет образец внеклеточными везикулами, происходящими или из белых клеток крови, или из красных клеток крови или тромбоцитов.Thus, it has been shown that the use of a 200 nm PES HF device depletes the sample of extracellular vesicles derived from either white blood cells or red blood cells or platelets.
Пример 3. Целлюлозный 200-нм не-HF фильтр не отсекает выбранные субпопуляции внеклеточных везикулExample 3 Cellulose 200nm non-HF filter fails to cut off selected subpopulations of extracellular vesicles
Фиг. 3 показывает количества внеклеточных везикул, захваченных из плазмы, полученной центрифугированием или фильтрацией через целлюлозный 200-нм не-HF фильтр, с использованием анти-CD9 антитела (общий маркер EV), анти-CD45 антитела (общий маркер белых клеток крови), анти-CD61 антитела (общий маркер тромбоцитов) или анти-CD235 антитела (общий маркер эритроцитов).Fig. 3 shows the numbers of extracellular vesicles captured from plasma obtained by centrifugation or filtration through a
Таким образом, показано, что такой фильтр не обедняет образец внеклеточными везикулами, происходящими или из белых клеток крови, или из красных клеток крови или тромбоцитов.Thus, it has been shown that such a filter does not deplete the sample of extracellular vesicles derived either from white blood cells or from red blood cells or platelets.
Пример 4. Устройство с 200-нм HF действительно отбирает частицы размером меньше указанногоExample 4: The 200nm HF device actually picks up particles smaller than the specified size
Фиг. 4 показывает электрофореграмму малых РНК микровезикул, полученную с (А) образцом плазмы, полученным центрифугированием цельной крови, и (В) образцом плазмы, полученным фильтрацией цельной крови через устройство с полиэфирсульфоновым HF с пористостью 200 нм.Fig. 4 shows an electrophoregram of small RNA microvesicles obtained with (A) a plasma sample obtained by whole blood centrifugation and (B) a plasma sample obtained by filtering whole blood through a 200 nm polyethersulfone HF device.
Такие результаты показывают, что плазма, полученная фильтрацией через устройство с HF, очищена от некоторых микровезикул, которые присутствуют в плазме, полученной центрифугированием. Из литературы известно, что эти микровезикулы крупнее 200 нм (Van der Pol et al.), следовательно, пористость 200 нм действительно отбирает частицы размером меньше указанного.These results indicate that the plasma obtained by filtration through the HF device is cleared of some of the microvesicles that are present in the plasma obtained by centrifugation. It is known from the literature that these microvesicles are larger than 200 nm (Van der Pol et al.), hence the 200 nm porosity does select particles smaller than indicated.
Пример 5. BRAFV600E–положительные экзосомы опухоли эффективно восстанавливаются в плазме, полученной из цельной крови после фильтрации с помощью устройства с 200-нм HFExample 5 BRAF V600E -positive tumor exosomes are efficiently reconstituted in plasma derived from whole blood after filtration with a 200-nm HF device
Фиг. 5 показывает уровни мутации BRAFV600E (A) или соотношение BRAFV600E против BRAFWT (B) в экзосомах опухоли при измерении после центрифурования или фильтрации через устройство с полиэфирсульфоновым HF с пористостью 200 нм образца цельной крови, который «пронзен» такими экзосомами опухоли, как описано выше в разделе «Материалы и методы».Fig. 5 shows the levels of BRAF V600E mutation (A) or the ratio of BRAF V600E vs. BRAF WT (B) in tumor exosomes as measured after centrifugation or filtration through a 200 nm porosity polyethersulfone HF device of a whole blood sample that has been "pierced" by tumor exosomes such as described above in the Materials and Methods section.
Видно, что способ по изобретению не изменяет существенно уровни экзосом опухоли, обнаруженные в образце плазмы, соотносительно с классическим способом центрифугирования.It can be seen that the method of the invention does not significantly alter the levels of tumor exosomes found in the plasma sample relative to the classical centrifugation method.
Кроме того, различие на фиг. 5В ясно показывает, как способ по изобретению снижает уровень BRAFWT как следствие обеднения BRAFWT–несущими внеклеточными везикулами.In addition, the difference in Fig. 5B clearly shows how the method of the invention reduces the level of BRAF WT as a consequence of the depletion of BRAF WT -bearing extracellular vesicles.
Пример 6. Фильтрация через HF с пористостью 200 нм устраняет ложный положительный сигнал маркера метаболизма ТМ9SF4Example 6 200 nm HF Filtration Eliminates False Positive Metabolism Marker TM9SF4
Фиг. 6 показывает количества экзосом, захваченных из плазмы здоровых доноров, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм, с использованием анти-CD9 антитела (общий маркер EV) или анти-TM9SF4 антитела (маркер метаболизма, экспрессированный на экзосомах, происходящих как из опухолевых паренхимных, так и стромальных клеток, претерпевающих переключение гликолиза (Lozupone et al. 2009; Lozupone et al. 2015), но также из активированных гемопоэтических клеток (Paolillo et al).Fig. 6 shows the numbers of exosomes captured from healthy donor plasma obtained by centrifugation or filtration through a 200 nm polyethersulfone HF device using an anti-CD9 antibody (a common EV marker) or an anti-TM9SF4 antibody (a metabolic marker expressed on exosomes originating from both tumor parenchymal and stromal cells undergoing glycolysis switching (Lozupone et al. 2009; Lozupone et al. 2015), but also from activated hematopoietic cells (Paolillo et al).
Видно, что уровни TM9SF4-положительных экзосом из плазмы здоровых доноров, полученной способом по изобретению, ниже диагностического порога (пунктирная линия), установленного для положительной детекции. Напротив, уровни TM9SF4-положительных экзосом из плазмы здоровых доноров, полученной центрифугированием, выше такого диагностического порога, что приводит к ложной положительной детекции. Результат предполагает, что фильтрация через HF значительно снижает запутывающий эффект из-за активации клеток крови, облегчающей детекцию биомаркера на экзосомах из паренхимных и стромальных клеток.It can be seen that the levels of TM9SF4-positive exosomes from the plasma of healthy donors, obtained by the method according to the invention, are below the diagnostic threshold (dashed line) set for positive detection. In contrast, levels of TM9SF4-positive exosomes from centrifuged plasma of healthy donors are above such a diagnostic threshold, resulting in a false positive detection. The result suggests that HF filtration significantly reduces the confusing effect due to blood cell activation facilitating biomarker detection on exosomes from parenchymal and stromal cells.
Пример 7. Фильтрация крови через HF снижает липемический индекс плазмыExample 7 HF Blood Filtration Reduces Plasma Lipemic Index
Фиг. 7 показывает липемический индекс трех образцов плазмы, полученной из крови здоровых доноров после центрифугирования или фильтрации через устройство с полиэфирсульфоновым HF с пористостью 200 нм. Результаты показывают, что фильтрация через HF снижает липемический индекс всех трех образцов плазмы по сравнению с центрифугированием. Такой результат можно, по меньшей мере частично, объяснить снижением числа богатых триглицеридами хиломикронов – везикул, которые имеют диаметр, колеблющийся от 70 нм до 1000 нм (De Haene et al.).Fig. 7 shows the lipemic index of three samples of plasma obtained from the blood of healthy donors after centrifugation or filtration through a device with polyethersulfone HF with a porosity of 200 nm. The results show that HF filtration reduces the lipemic index of all three plasma samples compared to centrifugation. This result can be explained, at least in part, by a decrease in the number of triglyceride-rich chylomicrons, vesicles that range in diameter from 70 nm to 1000 nm (De Haene et al.).
Пример 8. Снижение липемического индекса фильтрацией через HF улучшает извлечение мутацийExample 8 Lowering Lipemic Index by HF Filtration Improves Mutation Recovery
Фиг. 8 показывает уровни копий мутации BRAFV600E (копии/мл) в экзосомах опухоли, добавленных в плазму здоровых доноров, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм. Результаты показывают, что больше копий мутаций извлекается из фильтрованной через HF плазмы, чем из центрифугированной плазмы. Улучшенное извлечение мутаций коррелирует с наблюдаемым уменьшением липемического индекса, наблюдаемого в том же наборе образов плазмы.Fig. 8 shows copy levels of the BRAF V600E mutation (copies/ml) in tumor exosomes added to healthy donor plasma obtained by centrifugation or filtration through a 200 nm polyethersulfone HF device. The results show that more mutation copies are recovered from HF-filtered plasma than from centrifuged plasma. The improved recovery of mutations correlates with the observed decrease in lipemic index observed in the same set of plasma samples.
Пример 9. Фильтрация через HF образцов липемической плазмы снижает их липемический индексExample 9 HF Filtration of Lipemic Plasma Samples Lowers Their Lipemic Index
Фиг. 9 показывает липемический индекс образцов плазмы до и после центрифугирования или фильтрации через устройство с полиэфирсульфоновым HF с пористостью 200 нм. Результаты показывают, что фильтрация через HF снижает липемический индекс всех трех образцов липемической плазмы по сравнению с центрифугированием, что совпадает со способностью устройства снижать уровни богатых триглицеридами хиломикронов.Fig. 9 shows the lipemic index of plasma samples before and after centrifugation or filtration through a 200 nm polyethersulfone HF device. The results show that HF filtration reduces the lipemic index of all three lipemic plasma samples compared to centrifugation, which is consistent with the ability of the device to reduce levels of triglyceride-rich chylomicrons.
Пример 10. Устройство с пористым волокном (HF) с 500-нм порами эффективно сепарирует богатую наночастицами плазму из кровиExample 10 500nm Pore Fiber (HF) Device Efficiently Separates Nanoparticle-Rich Plasma from Blood
Фиг. 10 показывает число наночастиц в плазме с помощью анализа трекинга наночастиц (NTA) плазмы, полученной из цельной крови с использованием центрифуги или фильтра из полиэфирсульфонового HF с пористостью 200 нм или с пористостью 500 нм.Fig. 10 shows the number of nanoparticles in plasma by nanoparticle tracking analysis (NTA) of plasma obtained from whole blood using a centrifuge or a 200 nm or 500 nm polyethersulfone HF filter.
Таким образом показано, что фильтр из HF с пористостью 500 нм позволяет получить схожее число наночастиц при сравнении с центрифугой и фильтром из HF с пористостью 200 нм. Как ожидалось, средний размер наночастиц незначительно увеличивается с фильтром из 500-нм HF по сравнению с центрифугой и фильтром из HF с пористостью 200 нм.Thus, it is shown that the HF filter with a porosity of 500 nm allows obtaining a similar number of nanoparticles when compared with a centrifuge and a HF filter with a porosity of 200 nm. As expected, the average nanoparticle size increases slightly with the 500 nm HF filter compared to the centrifuge and the 200 nm HF filter.
Пример 11. Плазма, полученная фильтрацией цельной крови через 500-нм HF, имеет меньше внеклеточных везикул из красных и белых клеток крови, чем плазма, полученная центрифугированиемExample 11 Plasma obtained by filtering whole blood through 500 nm HF has fewer extracellular vesicles from red and white blood cells than plasma obtained by centrifugation
Фиг. 11 показывает количества внеклеточных везикул, захваченных из плазмы здоровых доноров, полученной или центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 500 нм, с использованием анти-CD9 антитела (общий маркер EV), анти-CD45 антитела (общий маркер белых клеток крови), анти-CD61 антитела (общий маркер тромбоцитов) или анти-CD235 антитела (общий маркер эритроцитов).Fig. 11 shows the numbers of extracellular vesicles captured from healthy donor plasma obtained either by centrifugation or filtration through a 500 nm polyethersulfone HF device using anti-CD9 antibody (common EV marker), anti-CD45 antibody (common marker of white blood cells) , anti-CD61 antibodies (common marker of platelets) or anti-CD235 antibodies (common marker of erythrocytes).
Таким образом, показано, что использование устройства с полиэфирсульфоновым HF с пористостью 500 нм очищает образец от внеклеточных везикул, происходящих или из белых клеток крови или из красных клеток крови, но не имеет существенно действия на происходящие из тромбоцитов внеклеточные везикулы.Thus, the use of a 500 nm polyethersulfone HF device was shown to clear the sample of extracellular vesicles derived from either white blood cells or red blood cells, but had no significant effect on platelet-derived extracellular vesicles.
Пример 12. Фильтрация через HF снижает уровни гена BRAF дикого типа в плазме пациентов с метастастатической меланомойExample 12 HF Filtration Reduces Wild-Type BRAF Gene Levels in Plasma of Patients with Metastatic Melanoma
Фиг. 12 показывает уровни копий (копии/мл) гена BRAF дикого типа в плазме пациентов с метастастатической меланомой, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм. Результаты показывают, что 4 из пяти образцов плазмы, полученной с помощью устройства с HF, имеют значительно меньше копий гена BRAF, чем образцы, полученные центрифугированием. Такой результат показывает, что фильтрация через HF снижает уровни гена BRAF дикого типа в плазме больных раком.Fig. 12 shows copy levels (copies/mL) of the wild-type BRAF gene in plasma from patients with metastatic melanoma obtained by centrifugation or filtration through a 200 nm polyethersulfone HF device. The results show that 4 out of five plasma samples obtained with the HF device have significantly fewer copies of the BRAF gene than samples obtained by centrifugation. This result indicates that HF filtration reduces the levels of the wild-type BRAF gene in the plasma of cancer patients.
Пример 13. Фильтрация через HF улучшает частоту аллелей мутации BRAFV600E в плазме пациентов с метастастатической меланомойExample 13 HF Filtration Improves BRAF V600E Mutation Allele Frequency in the Plasma of Patients with Metastatic Melanoma
Фиг. 13 показывает частоту аллелей мутации гена BRAFV600E в плазме трех пациентов с метастастатической меланомой, полученной центрифугированием или фильтрацией через устройство с полиэфирсульфоновым HF с пористостью 200 нм. Результаты показывают, что фильтрация через HF улучшает частоту аллелей BRAFV600E в каждом образце. Такой результат совпадает со снижением уровней копий гена BRAF дикого типа, наблюдаемым в этих образцах.Fig. 13 shows the allele frequency of the BRAF V600E gene mutation in the plasma of three patients with metastatic melanoma obtained by centrifugation or filtration through a 200 nm polyethersulfone HF device. The results show that HF filtering improves the BRAF V600E allele frequency in each sample. This result is consistent with the reduction in wild-type BRAF gene copy levels observed in these samples.
Пример 14. Фильтрация через HF с пористостью 200 нм облегчает детекцию экзосом опухоли в плазмеExample 14 200 nm HF Filtration Facilitates Detection of Tumor Exosomes in Plasma
Фиг. 14 показывает количества экзосом опухоли, захваченных из плазмы, полученной из крови с добавленными экзосомами опухоли или центрифугированием или фильтрацией через устройство с HF с пористостью 200 нм, с использованием анти-TM9SF4 антитела – маркера метаболизма, экспрессированного экзосомами, происходящими как из паренхимных, так и стромальных опухолевых клеток, претерпевающих переключение гликолиза.Fig. 14 shows the numbers of tumor exosomes captured from plasma obtained from blood with added tumor exosomes or by centrifugation or filtration through a HF device with a porosity of 200 nm using an anti-TM9SF4 antibody, a metabolic marker expressed by exosomes derived from both parenchymal and stromal tumor cells undergoing a glycolysis switch.
Показано, что уровни TM9SF4-положительных экзосом опухоли повышаются в плазме, полученной из «пронзенной» экзосомами опухоли крови фильтрацией через устройство с HF с пористостью 200 нм. Напротив, не наблюдается изменения в уровнях TM9SF4-положительных экзосом опухоли в плазме, полученной центрифугированием, из-за высокого фонового шума, генерированного происходящими из крови везикулами. Результат предполагает, что фильтрация через HF значительно ослабляет запутывающий эффект из-за активации, облегчающей детекцию биомаркера на экзосомах опухоли.It has been shown that the levels of TM9SF4-positive tumor exosomes are increased in plasma obtained from tumor exosome-pierced blood by filtration through a HF device with a porosity of 200 nm. In contrast, there is no change in the levels of TM9SF4-positive tumor exosomes in centrifuged plasma due to high background noise generated by blood-derived vesicles. The result suggests that HF filtration significantly attenuates the confusing effect due to activation, facilitating biomarker detection on tumor exosomes.
БиблиографияBibliography
Black A, Pienimaeki-Roemer A, Kenyon O, Orsó E, Schmitz G. Platelet-derived extracellular vesicles in plateletpheresis concentrates as a quality control approach. Transfusion. 2015, Sep.55(9): 2184-96. Black A, Pienimaeki-Roemer A, Kenyon O, Orsó E, Schmitz G. Platelet-derived extracellular vesicles in plateletpheresis concentrates as a quality control approach. Transfusion. 2015, Sep.55(9): 2184-96.
Ishihara K, Hasegawa T, Watanabe J, Iwasaki Y. Artif. Organs. 2002, Dec.26(12): 1014-9.Ishihara K, Hasegawa T, Watanabe J, Iwasaki Y. Artif. Organs. 2002, Dec.26(12): 1014-9.
Van der Pol E, Böing AN, Harrison P, Sturk A, Nieuwland R. Classification, functions, and clinical relevance of extracellular vesicles. Pharmacol. Rev., 2012, Jul, 64(3): 676-705. Van der Pol E, Böing AN, Harrison P, Sturk A, Nieuwland R. Classification, functions, and clinical relevance of extracellular vesicles. Pharmacol. Rev., 2012, Jul, 64(3): 676-705.
Mock I., Membrane Processes, Vol.1, Encyclopedia of Desalination and Water Resources, http://www.desware.net/Sample-Chapters/D05/D09-006.pdfMock I., Membrane Processes, Vol.1, Encyclopedia of Desalination and Water Resources, http://www.desware.net/Sample-Chapters/D05/D09-006.pdf
Zhang H, Freitas D, Kim HS, Fabijanic K, Li Z, Chen H, Mark MT, Molina H, Martin AB, Bojmar L, Fang J, Rampersaud S, Hoshino A, Matei I, Kenific CM, Nakajima M, Mutvei AP, Sansone P, Buehring W, Wang H, Jimenez JP, Cohen-Gould L, Paknejad N, Brendel M, Manova-Todorova K, Magalhães A, Ferreira JA, Osório H, Silva AM, Massey A, Cubillos-Ruiz JR, Galletti G, Giannakakou P, Cuervo AM, Blenis J, Schwartz R, Brady MS, Peinado H, Bromberg J, Matsui H, Reis CA, Lyden D. Identification of distinct nanoparticles and subsets of extracellular vesicles by asymmetric flow field-flow fractionation. Nat. Cell Biol., 2018, Mar. 20(3): 332-343. Zhang H, Freitas D, Kim HS, Fabijanic K, Li Z, Chen H, Mark MT, Molina H, Martin AB, Bojmar L, Fang J, Rampersaud S, Hoshino A, Matei I, Kenific CM, Nakajima M, Mutvei AP , Sansone P, Buehring W, Wang H, Jimenez JP, Cohen-Gould L, Paknejad N, Brendel M, Manova-Todorova K, Magalhães A, Ferreira JA, Osório H, Silva AM, Massey A, Cubillos-Ruiz JR, Galletti G, Giannakakou P, Cuervo AM, Blenis J, Schwartz R, Brady MS, Peinado H, Bromberg J, Matsui H, Reis CA, Lyden D. Identification of distinct nanoparticles and subsets of extracellular vesicles by asymmetric flow field-flow fractionation. Nat. Cell Biol., 2018, Mar. 20(3): 332-343.
Lozupone F, Perdicchio M, Brambilla D, Borghi M, Meschini S, Barca S, Marino ML, Logozzi M, Federici C, Iessi E, de Milito A, Fais S. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells. EMBO Rep. 2009, Dec.10(12): 1348-54. Lozupone F, Perdicchio M, Brambilla D, Borghi M, Meschini S, Barca S, Marino ML, Logozzi M, Federici C, Iessi E, de Milito A, Fais S. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells. EMBO Rep. 2009, Dec.10(12): 1348-54.
Lozupone F, Borghi M, Marzoli F, Azzarito T, Matarrese P, Iessi E, Venturi G, Meschini S, Canitano A, Bona R, Cara A, Fais S. TM9SF4 is a novel V-ATPase-interacting protein that modulates tumor pH alterations asso ciated with drug resistance and invasiveness of colon cancer cells. Oncogene, 2015, Oct 1; 34(40): 5163-74.Lozupone F, Borghi M, Marzoli F, Azzarito T, Matarrese P, Iessi E, Venturi G, Meschini S, Canitano A, Bona R, Cara A, Fais S. TM9SF4 is a novel V-ATPase-interacting protein that modulates tumor pH alterations associated with drug resistance and invasiveness of colon cancer cells. Oncogene, 2015,
Paolillo R, Spinello I, Quaranta MT, Pasquini L, Pelosi E, Lo Coco F, Testa U, Labbaye C. Human TM9SF4 Is a New Gene Down-Regulated by Hypoxia and Involved in Cell Adhesion of Leukemic Cells. PLoS One. 2015, May 11; 10(5): e0126968. Paolillo R, Spinello I, Quaranta MT, Pasquini L, Pelosi E, Lo Coco F, Testa U, Labbaye C. Human TM9SF4 Is a New Gene Down-Regulated by Hypoxia and Involved in Cell Adhesion of Leukemic Cells. PLOS One. May 11, 2015; 10(5): e0126968.
De Haene H, Taes Y, Christophe A, Delanghe J. Comparison of triglyceride concentration with lipemic index in disorders of triglyceride and glycerol metabolism. Clin. Chem. Lab. Med., 2006; 44(2): 220-2De Haene H, Taes Y, Christophe A, Delanghe J. Comparison of triglyceride concentration with lipemic index in disorders of triglyceride and glycerol metabolism. Clin. Chem. Lab. Med., 2006; 44(2): 220-2
Seo-Hyun Pak, Yong-Woo Jeon, Myung-Seop Shin and Hyung Chul Koh. Preparation of Cellulose Acetate Hollow-Fiber Membranes for CO2/CH4 Separation. Environmental Engineering Science, Vol. 33, No. 1 Original Articles, Volume 369, Issues 1–2, 1 March 2011, Pages 437-447.Seo-Hyun Pak, Yong-Woo Jeon, Myung-Seop Shin and Hyung Chul Koh. Preparation of Cellulose Acetate Hollow-Fiber Membranes for CO2/CH4 Separation. Environmental Engineering Science, Vol. 33, no. 1 Original Articles, Volume 369, Issues 1-2, 1 March 2011, Pages 437-447.
Xing Yanga, Rong Wanga, Lei Shi, Anthony G. Fanea, Marcin Debowski. Performance improvement of PVDF hollow fiber-based membrane distillation process. Journal of Membrane Science. Volume 369, Issues 1–2, 1 March 2011, Pages 437-447. Xing Yanga, Rong Wanga, Lei Shi, Anthony G. Fanea, Marcin Debowski. Performance improvement of PVDF hollow fiber-based membrane distillation process. Journal of Membrane Science. Volume 369, Issues 1-2, 1 March 2011, Pages 437-447.
Hailin Zhu, Hongjie Wanga, Feng Wanga, Yuhai Guo, Huapeng Zhang, Jianyong Chen. Preparation and properties of PTFE hollow fiber membranes for desalination through vacuum membrane distillation. Journal of Membrane Science. Volume 446, 1 November 2013, Pages 145-153.Hailin Zhu, Hongjie Wanga, Feng Wanga, Yuhai Guo, Huapeng Zhang, Jianyong Chen. Preparation and properties of PTFE hollow fiber membranes for desalination through vacuum membrane distillation. Journal of Membrane Science.
Amir Dashti, Morteza Asghari. Recent Progresses in Ceramic Hollow-Fiber Membranes. ChemBioENg Reviews.03 February 2015. https://doi.org/10.1002/cben.201400014 Amir Dashti, Morteza Asghari. Recent Progresses in Ceramic Hollow-Fiber Membranes. ChemBioENg Reviews.03 February 2015. https://doi.org/10.1002/cben.201400014
Ze-Lin Qiu, Xin Kong, Jia-JiaYuan, Yu-Jie Shen, Bao-ku Zhu, Li-Ping Zhu, Zhi-Kan Yao, Chuyang Y. Tang. Cross-linked PVC/hyperbranched polyester composite hollow fiber membranes for dye removal. Reactive and Functional Polymers. Volume 122, January 2018, Pages 51-59.Ze-Lin Qiu, Xin Kong, Jia-JiaYuan, Yu-Jie Shen, Bao-ku Zhu, Li-Ping Zhu, Zhi-Kan Yao, Chuyang Y. Tang. Cross-linked PVC/hyperbranched polyester composite hollow fiber membranes for dye removal. Reactive and Functional Polymers. Volume 122, January 2018, Pages 51-59.
Li FS, Qiu W, Lively RP, Lee JS, Rownaghi AA, Koros WJ. Polyethyleneimine-functionalized polyamide imide (Torlon) hollow-fiber sorbents for post-combustion CO2 capture. ChemSusChem. 2013, Jul;6(7):216-23. Li FS, Qiu W, Lively RP, Lee JS, Rownaghi AA, Koros WJ. Polyethyleneimine-functionalized polyamide imide (Torlon) hollow-fiber sorbents for post-combustion CO2 capture. ChemSusChem. 2013, Jul;6(7):216-23.
Labreche Y, Fan Y, Rezaei F, Lively RP, Jones CW, Koros WJ. Poly(amide-imide)/silica supported PEI hollow fiber sorbents for postcombustion CO(2) capture by RTSA. ACS Appl. Mater Interfaces. 2014, Nov 12; 6(21): 19336-46. Labreche Y, Fan Y, Rezaei F, Lively RP, Jones CW, Koros WJ. Poly(amide-imide)/silica supported PEI hollow fiber sorbents for postcombustion CO(2) capture by RTSA. ACS Appl. mater interfaces.
Zhang Y, Zhong F, Xia S, Wang X, Li J. Autohydrogenotrophic denitrification of drinking water using a polyvinyl chloride hollow fiber membrane biofilm reactor. J Hazard Mater., 2009, Oct 15; 170(1): 203-9. Zhang Y, Zhong F, Xia S, Wang X, Li J. Autohydrogenotrophic denitrification of drinking water using a polyvinyl chloride hollow fiber membrane biofilm reactor. J Hazard Mater., 2009,
Higa M, Kakihana Y, Sugimoto T, Toyota K. Preparation of PVA-Based Hollow Fiber Ion-Exchange Membranes and Their Performance for Donnan Dialysis. Membranes (Basel). 2019, Jan 2;,9(1). pii: E4.Higa M, Kakihana Y, Sugimoto T, Toyota K. Preparation of PVA-Based Hollow Fiber Ion-Exchange Membranes and Their Performance for Donnan Dialysis. Membranes (Basel). 2019,
Claims (24)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18165289 | 2018-03-30 | ||
| EP18165289.2 | 2018-03-30 | ||
| PCT/EP2019/058028 WO2019185874A1 (en) | 2018-03-30 | 2019-03-29 | Use of hollow fibers to obtain blood or a blood derivative impoverished from blood cells and platelets derived extracellular vesicles |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| RU2020135585A RU2020135585A (en) | 2022-05-05 |
| RU2796378C2 true RU2796378C2 (en) | 2023-05-22 |
Family
ID=
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2086296C1 (en) * | 1991-04-12 | 1997-08-10 | Миннтек Корпорейшн | Method of manufacturing asymmetric microporous hollow fibers and asymmetric microporous hollow fibers |
| WO2007127848A1 (en) * | 2006-04-26 | 2007-11-08 | University Of Louisville Research Foundation, Inc | Isolation of membrane vesicles from biological fluids and methods of using same |
| WO2016181300A1 (en) * | 2015-05-11 | 2016-11-17 | 3M Innovative Properties Company | Wound dressing system |
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2086296C1 (en) * | 1991-04-12 | 1997-08-10 | Миннтек Корпорейшн | Method of manufacturing asymmetric microporous hollow fibers and asymmetric microporous hollow fibers |
| WO2007127848A1 (en) * | 2006-04-26 | 2007-11-08 | University Of Louisville Research Foundation, Inc | Isolation of membrane vesicles from biological fluids and methods of using same |
| WO2016181300A1 (en) * | 2015-05-11 | 2016-11-17 | 3M Innovative Properties Company | Wound dressing system |
Non-Patent Citations (1)
| Title |
|---|
| H. HACKSTEIN ET AL., "Prospective quality control study of a novel gravity-driven whole blood separation system suitable for humanitarian crises", VOX SANGUINIS., CH, (20171101), vol. 112, no. 8, abstrac. * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Woo et al. | Urine-based liquid biopsy: non-invasive and sensitive AR-V7 detection in urinary EVs from patients with prostate cancer | |
| Gámez-Valero et al. | Urinary extracellular vesicles as source of biomarkers in kidney diseases | |
| EP2542689B1 (en) | Method for isolating target cells | |
| BR112013002064B1 (en) | DEVICE AND METHODS FOR BLOOD PLASMA FILTERING | |
| JP7337438B2 (en) | Use of hollow fibers to obtain blood or blood derivatives impoverished with extracellular vesicles derived from blood cells and platelets | |
| CA2904593A1 (en) | Plasma separation from blood using a filtration device and methods thereof | |
| RU2796378C2 (en) | Use of porous fibers for obtaining blood or blood derivative deputy in blood cells and platelets from extracellular vesicles | |
| AU2016209694B2 (en) | Column-based device and method for retrieval of rare cells based on size, and uses thereof | |
| Park et al. | Exosomes: nomenclature, isolation, and biological roles in liver diseases | |
| US8932864B2 (en) | Method of identifying glycated protein in sample and device for the glycated protein | |
| JP3796315B2 (en) | Graphite nonwoven fabric as functional layer in diagnostic test kits | |
| Paisrisarn et al. | A Method to Analyze Urinary Extracellular Vesicles | |
| Ho et al. | Sample concentration and purification for point-of-care diagnostics | |
| Salvianti et al. | Detection and characterization of circulating tumor cells by quantitative real-time PCR | |
| EP3172336A1 (en) | Feedback control for improved rare cell detection | |
| US20230070693A1 (en) | Integrated dual-mode chromatography to enrich extracellular vesicles from plasma | |
| Sunkara et al. | Separation and Purification of Extracellular and Bio-fluid Vesicles–State of the Art: Past, Present, and Future of Extracellular Vesicle Separation and Purification | |
| CN211026389U (en) | A centrifuging tube for circulating tumor cell enrichment | |
| EP3885444A1 (en) | A method and device for enriching and detecting microorganisms in a biological sample | |
| Garlin Politis et al. | Translational Opportunities of Extracellular Vesicles in Biomedicine | |
| WO2023187153A1 (en) | Extracellular vesicle (ev) populations in the diagnosis of cancer | |
| Acton | Advances in Blood Research and Application: 2013 Edition | |
| WO2010134567A1 (en) | Method for detection of free nucleic acid in blood | |
| WO2015014974A1 (en) | Flat sheet filter media in the separation of plasma or serum from whole blood | |
| Brunstein | A breath of diagnostic fresh air? July 25, 2017 |