RU2795855C2 - Abc transporters for highly efficient production of rebaudiosides - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: genetically modified host cell is proposed that produces one or more steviol glycosides and contains a heterologous nucleic acid encoding an ABC transporter. Also proposed is a method for obtaining steviol or one or more steviol glycosides, a method for obtaining Reb D and obtaining Reb M, in which the specified host cell is used.

EFFECT: increase in the production of total steviol glycoside (TSG), Reb D and Reb M.

30 cl, 16 dwg, 6 tbl, 15 ex

Description

1. CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No. 62/796,228, filed Jan. 24, 2019, entitled "ABS TRANSPORTERS FOR HIGH-EFFICIENCY REBAUDIOSIDES", the disclosure of which is incorporated herein by reference in its entirety.

2. FIELD OF TECHNOLOGY

The present disclosure relates to specific ABC transporters, host cells containing them, and methods of using them to produce steviol and/or rebaudiosides, including rebaudioside D and rebaudioside M.

3. GENERAL

[0001] Desirably, reduced calorie sweeteners derived from natural sources limit the health effects of increased sugar intake. The stevia plant (Stevia rebaudiana Bertoni) produces a variety of sweet-tasting glycosylated diterpenes called steviol glycosides. Of all known steviol glycosides, Reb M has the highest potency (approximately 200-300 times sweeter than sucrose) and has the most attractive flavor profile. However, Reb M is produced by the stevia plant only in small amounts and constitutes a small part of the total content of steviol glycosides (<1.0%), which makes it impractical to isolate Reb M from stevia leaves. Alternative methods for obtaining Reb M are needed. One such approach is the use of synthetic biology to create microorganisms (eg yeast) that produce large quantities of Reb M from sustainable sources of raw materials.

[0002] For economical production of a product using synthetic biology, each step in the bioconversion of raw materials into a product must have a high conversion efficiency (ideally >90%). In developing yeast for the production of Reb M, we noted that the cytosolic accumulation of Reb M suppresses the metabolic pathway of steviol glycosides engineered in yeast, thereby limiting the overall yield of the fermentation cycle. This inhibition is likely due to inhibition of the product or inhibition by the end product of one or more of the enzymes involved in the biosynthesis of steviol glycosides. Accordingly, new mechanisms for removing product inhibition are needed to improve the conversion efficiency of the biosynthetic production of Reb M.

4. DISCLOSURE OF THE INVENTION

[0003] Genetically modified host cells, compositions and methods for improved production of Reb M are provided herein. These compositions and methods are based in part on the expression of certain heterologous ABC transporters in host cells that have been genetically modified to produce steviol glycosides such as as Reb M. These ABC transporters are capable of transporting certain steviol glycosides, preferably Reb M and/or the related high molecular weight steviol glycoside rebaudioside D (Reb D), from the cytosol either into the extracellular space or into the lumen of subcellular organelles such as the yeast vacuole. Sequestration of certain steviol glycosides, such as Reb D and Reb M, increases the efficiency of the steviol glycoside metabolic pathway by removing product inhibition caused by accumulation of steviol glycosides.

[0004] In one aspect of the invention, provided herein are genetically modified host cells and methods for using them to produce industrially useful compounds. In one aspect, provided herein is a genetically modified host cell capable of producing one or more steviol glycosides, wherein the host cell contains a heterologous nucleic acid encoding an ABC transporter whose amino acid sequence has at least 80% sequence identity to the amino acid sequence selected from sequences with the following identifiers: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

[0005] In one embodiment of the invention, the ABC transporter has an amino acid sequence having a sequence selected from the group consisting of sequences with the following identifiers: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQID. NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. In another embodiment, the genetically modified host cells of of the invention contain nucleic acids encoding geranylgeranyl pyrophosphate synthase (GGPPS), ent-copalyl pyrophosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene-19-oxidase (KO), ent-kaurenoic acid 13-hydroxylase (CAN), cytochrome p450 reductase (CPR) and one or more UDP-glucosyltransferases (UGT). In a further embodiment, one or more UDP-glucosyltransferases (UGTs) are selected from EUGT11. UGT85C2, UGT74G1, UGT91D like3, UGT76G1 and UGT40087. In a further embodiment of the invention, geranylgeranyl pyrophosphate synthase (GGPPS) has an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 9, ent-copalyl pyrophosphate synthase (CPS) has an amino acid sequence having at least 80% sequence identity with SEQ ID NO: : 10, ent-kaurene synthase (KS) has an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 11, ent-kaurene-19 oxidase (KO) has an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 12, ent-kaurenoic acid 13-hydroxylase (CAN) has an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 13, cytochrome p450 reductase (CPR) has an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 14, and one or more UDP-glucosyltransferases (UGTs) have an amino acid sequence having at least 80% sequence identity with an amino acid sequence selected from the group consisting of sequences with the following identifiers: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 27.

[0006] In a specific embodiment, geranylgeranyl pyrophosphate synthase (GGPPS) has the amino acid sequence of SEQ ID NO: 9, ent-copalyl pyrophosphate synthase (CPS) has the amino acid sequence of SEQ ID NO: 10, ent-kaurene synthase (KS) has the amino acid sequence of SEQ ID NO: 11 , ent-kaurene-19-oxidase (KO) contains the amino acid sequence of SEQ ID NO: 12, ent-kaurenoic acid 13-hydroxylase (CAH) contains the amino acid sequence of SEQ ID NO: 13, cytochrome p450 reductase (CPR) contains the amino acid sequence of SEQ ID NO: 14, and one or more UDP-glucosyltransferases (UGT) contain an amino acid sequence selected from the group consisting of sequences with the following identifiers: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO : 18, SEQ ID NO: 19 and SEQ ID NO: 27.

[0007] In one embodiment, the host cell is selected from a bacterial, fungal, algal, insect, or plant cell. In another embodiment, the host cell is a Saccharomyces cerevisiae cell.

[0008] In one embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 1.

[0009] In another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 2.

[0010] In another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 3.

[UN] In yet another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 4.

[0012] In a further embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 5.

[0013] In another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 6.

[0014] In another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 7.

[0015] In yet another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 8.

[0016] In yet another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 28.

[0017] In yet another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 29.

[0018] In yet another embodiment, the ABC transporter has the amino acid sequence of SEQ ID NO: 30.

[0019] In an embodiment, the one or more steviol glycosides are selected from rebaudioside A (Reb A), rebaudioside B (Reb B), Reb D. rebaudioside E (Reb E), or Reb M. In another embodiment, one or more steviol glycosides include Reb M.

[0020] In one embodiment, most of the one or more steviol glycosides accumulate in the lumen of the organelle. In another embodiment, most of the one or more steviol glycosides accumulate extracellularly.

[0021] In another aspect, the invention provides a nucleic acid sequence for an expression cassette of a heterologous nucleic acid that expresses an ABC transporter. In one embodiment, the nucleotide sequence of the heterologous nucleic acid expression cassette has the coding sequence of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO : 25, SEQ ID NO: 26 or SEQ ID NO: 27, where the coding sequence is operably linked to a heterologous promoter.

[0022] In another aspect, the invention provides a method for producing steviol or one or more steviol glycosides, comprising: culturing a population of host cells of the invention in a carbon source medium under conditions suitable for producing steviol or one or more steviol glycosides to produce a culture broth ; and isolating the steviol or one or more steviol glycosides from the culture broth.

[0023] In another aspect, the invention provides a method for producing Reb D, comprising: culturing a population of host cells of the invention in a carbon source medium under conditions suitable for producing Reb D to form a culture broth; and isolating said Reb D compound from the culture fluid.

[0024] In another aspect, the invention provides a method for producing Reb M, comprising: culturing a population of host cells of the invention in a carbon source medium under conditions suitable for producing Reb M to form a culture broth; and isolating said Reb M compound from the culture broth.

5. BRIEF DESCRIPTION OF GRAPHICS

[0025] In FIG. 1 schematically shows the enzymatic pathway from the native yeast metabolite farnesyl pyrophosphate (FPP) to steviol.

[0026] In FIG. 2 schematically shows the enzymatic pathway from steviol to Rebaudioside M.

[0027] FIG. 3 is a diagram of a DNA landing pad construct used to insert transporters into Reb M strains. Each end of the construct contains a 500 bp DNA sequence. downstream of the yeast SFM1 gene to facilitate homologous recombination at that locus. The introduction of a landing site at this locus does not result in the deletion of any gene. The landing pad contains the full length GAL1 promoter followed by the F-CphI endonuclease recognition site and a terminator from the native yeast HEM 13 gene.

[0028] FIG. 4 is a graph of the percentage of Reb D+Reb M found in the supernatant. Yeast strains with different overexpressed carriers were grown in microtiter plates. Illustrated here is the percentage of Reb D+Reb M (measured in µmol) that is found in the supernatant after cell removal. The parent strain does not contain an overexpressed transporter. The amount of Reb D+Reb M measured in the supernatant is divided by the amount of Reb D+Reb M measured in the entire cell broth to obtain the percentage of Reb D+Reb M in the supernatant.

[0029] FIG. 5 is a graph of total steviol glycosides versus stock in whole cell broth. Yeast strains with different overexpressed carriers were grown in microtiter plates. This illustration shows the total sum of all steviol glycosides (measured in µmol) found in whole cell broth (both cells and supernatant) relative to the parent strain. The parent strain does not contain an overexpressed transporter.

[0030] FIG. 6 is a graph of the amount of Reb D+Reb M versus stock in whole cell broth. Yeast strains with different overexpressed vectors were grown in microtiter plates. This illustration shows the sum of Reb D+Reb M (measured in µmoles) found in whole cell broth (both cells and supernatant) relative to the parent strain. The parent strain does not contain an overexpressed transporter.

[0031] FIG. 7 is a plot of total steviol glycosides relative to parent in the supernatant. Yeast strains with different overexpressed vectors were grown in microtiter plates. This illustration shows the total amount of all steviol glycosides (measured in µmol) found in the supernatant after cell removal, relative to the parent strain. The parent strain does not contain an overexpressed transporter.

[0032] In FIG. 8 shows the percentage of all produced steviol glycosides present in the supernatant. Yeast strains with different overexpressed vectors were grown in microtiter plates. This figure indicates the percentage of all steviol glycosides produced by the cells (measured in µmoles) that is found in the supernatant. The total amount of steviol glycosides measured in the supernatant is divided by the amount of total steviol glycosides measured in the entire cell broth to obtain the percentage of total steviol glycosides in the supernatant.

[0033] FIG. 9 is a graph of the amount of Reb D+Reb M versus stock in whole cell broth. Yeast strains expressing GPB-labeled and unlabeled versions of VPT1 and the T4 Fungal 5 transporter were grown in microtiter plates. The relative activities of the transporter versions with and without GFB labels were compared. The data shows that the ZFB-tagged versions behaved similarly to the untagged transporter versions.

[0034] FIG. 10 is a set of brightfield (A) and fluorescent (B) micrographs of yeast expressing BPT1 labeled with GFB.

[0035] FIG. 11 is a set of brightfield (A) and fluorescent (B) micrographs of yeast expressing the T4 Fungal 5 transporter labeled with GFB.

[0036] FIG. 12 is a plot of Reb M versus parent with T4 Fungal 5 wt in whole cell broth. Yeast strains expressing the T4_Fungal_5 transporters and its variants (Isolate_l-8) obtained by error-prone PCR and selection were grown in microtiter plates. This illustration shows the Reb M titer (measured in µmol) found in whole cell broth (both in cells and in supernatant) of yeast strains expressing mutagenized variants of the T4_Fungal_5 transporter (Isolate_l-8) compared to non-mutagenized T4_Fungal_5. The data demonstrate that expression of Isolates 1-8 resulted in improved production of Reb M by yeast strains compared to T4 Fungal 5.

[0037] FIG. 13 is a graph of the proportion of Reb M total steviol glycosides relative to parent with T4_Fungal_5 wild type in whole cell broth. Yeast strains expressing the Fungal 5 T4 transporters and its variants (Isolate 1-8) obtained by error-prone PCR and selection were grown in microtiter plates. This illustration shows the ratio of Reb M to the total sum of all steviol glycosides (measured in µmoles) found in whole cell broth (both in cells and in supernatant) of yeast strains expressing mutagenized variants of the T4_Fungal_5 (Isolate_l-8) transporter compared to unmutated T4 Fungal 5. The data demonstrate that expression of Isolates 1-8 resulted in an increase in the proportion of Reb M among all steviol glycosides compared to the T4_Fungal_5 transporter. In other words, Isolates_l-8 show an increased substrate preference for Reb M.

[0038] FIG. 14 is a graph of the amount of Reb M in whole cell broth and the supernatant fraction produced by strains expressing the T4_Fungal_5 or Fungal_5_muA transporters. Yeast strains expressing T4 Fungal 5 or Fungal 5 muA under the control of PGAL3 (lower strength than PGAL1) were grown in microtiter plates. This illustration shows the Reb M titer (measured in µmoles) found in whole cell broth (both cells and supernatant) and supernatant fractions of yeast strains. The data confirm that Fungal 5 muA does provide improved performance when expressed in a yeast strain: 30% more Reb M in whole cell broth and 40% more extracellular Reb M is produced by the Fungal_5_muA strain than by the wild-type T4_Fungal_5 strain when both transporters were expressed at lower promoter strength.

[0039] FIG. 15 is a plot of Reb M versus parent with Fungal 5 muA in whole cell broth. Yeast strains expressing the Fungal_5_muA transporter and eight variants thereof, in which one, two or three mutations were reverted to the wild-type T4_Fungal_5 sequence, were grown in microtiter plates. This illustration shows the Reb M titer (measured in µmol) found in whole cell broth (both in cells and in the supernatant) of yeast strains expressing eight Fungal_5_muA variants relative to Fungal_5_muA. The data demonstrate the effect of various mutations on Reb M production, of particular interest is the positive effect of E1320V reversion. [0040] FIG. 16 is a graph of total steviol glycosides versus parent with Fungal_5_muA in whole cell broth. Yeast strains expressing the Fungal_5_muA transporter and eight variants thereof, in which one, two, or three mutations were reverted to the wild-type T4 Fungal 5 sequence, were grown in microtiter plates. This illustration shows the total sum of all steviol glycosides (measured in µmol) found in whole cell broth (both in cells and in supernatant) of yeast strains expressing eight variants of Fungal_5_muA relative to Fungal_5_muA. The data demonstrate the impact of various mutations on TSG production. Together with FIG. 15 he illustrates not only differences in activity but also substrate preference.

6. DETAILED DESCRIPTION OF EMBODIMENTS 6.1 Terminology

[0041] As used herein, the term "heterologous" refers to that which is not normally found in nature. The term "heterologous nucleotide sequence" refers to a nucleotide sequence that does not normally occur naturally in a given cell. As such, a heterologous nucleotide sequence may be: (a) foreign to its host cell (ie "exogenous" to the cell); (b) occurring naturally in the host cell (ie, "endogenously"), but present in the cell in an unnatural amount (ie, more or less than naturally occurring in the host cell); or (c) naturally occurring in the host cell but located outside its natural locus. [0042] On the other hand, the term "native" or "endogenous", as used herein in relation to molecules and, in particular, enzymes and nucleic acids, means molecules that are expressed in the organism in which they originated, or occur in nature. It is understood that the expression of naturally occurring enzymes or polynucleotides can be altered in recombinant microorganisms.

[0043] As used herein, the term "heterologous nucleic acid expression cassette" refers to a nucleic acid sequence that contains a coding sequence operably linked to one or more regulatory elements sufficient for expression of the coding sequence in a host cell. In one embodiment, an "ABC transporter expression cassette" refers to a heterologous nucleic acid expression cassette in which the heterologous nucleic acid contains the coding sequence for an ABC transporter polypeptide. Non-limiting examples of regulatory elements include promoters, enhancers, silencers, terminators, and poly-A signals.

[0044] As used herein, the terms "ABC transporter" and "ATP binding cassette transporter" refer to a superfamily of membrane-associated polypeptides that link the hydrolysis of adenosine triphosphate (ATP) to the movement of various substrates across biological membranes.

[0045] As used herein, the term refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 1):

encoded by the following nucleic acid sequence (sequence identifier SEQ ID NO: 20):

[0046] The term "T4 Fungal 1" as used herein refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 2):

encoded by the following nucleic acid sequence (sequence identifier SEQ ID NO: 21):

[0047] As used herein, the term "T4_Fungal_10" refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 3):

and is encoded by the following nucleic acid sequence (sequence identifier SEQ ID NO: 22):

[0048] As used herein, the term "T4_Fungal_2" refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 4):

encoded by the following nucleic acid sequence (sequence identifier SEQ ID NO: 23):

[0049] As used herein, the term "T4 Fungal 3" refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 5):

[0050] As used herein, the term "T4_Fungal_4" refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 6):

encoded by the following nucleic acid sequence (sequence identifier SEQ ID NO: 25):

[0051] As used herein, the term "T4_Fungal_5" refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 7):

and is encoded by the following nucleic acid sequence (sequence identifier SEQ ID NO: 26):

[0052] The term "T4 Fungal 8" as used herein refers to an ABC transporter having the following amino acid sequence (SEQ ID NO: 8):

[0053] As used herein, the term "parent cell" refers to a cell that has an identical genetic background to the genetically modified host cell described herein, except that it does not contain one or more specific genetic modifications incorporated into the modified cell. host, e.g., one or more modifications selected from the group consisting of: heterologous expression of the steviol pathway enzyme, heterologous expression of the steviol glycosidic pathway enzyme, heterologous expression of geranylgeranyl diphosphate synthase, heterologous expression of copalyl diphosphate synthase, heterologous expression of kaurene synthase, heterologous expression of kaurene oxidase (e.g., kaurene oxidase Pimm sativum), heterologous expression of steviol synthase (kaurenoic acid hydroxylase), heterologous expression of cytochrome P450 reductase, heterologous expression of EUGT11, heterologous expression of UGT74G1, heterologous expression of UGT76G1, heterologous expression of UGT85C2, heterologous expression of UGT91D, and heterologous expression of UGT40087 or a variant thereof .

[0054] As used herein, the term "naturally occurring" refers to what is found in nature. For example, an ABC transporter present in the body that can be isolated from a source in nature and that has not been intentionally modified by humans in the laboratory is a natural ABC transporter. Conversely, in the context of the present description, the term "non-naturally occurring" refers to something that does not occur in nature, but is created as a result of human intervention.

[0055] the Term "environment" refers to the culture medium and/or fermentation medium. [0056] The term "fermentation composition" refers to a composition that includes genetically modified host cells and products or metabolites produced by genetically modified host cells. An example of a fermentation composition is a whole cell broth, which can be the entire contents of a vessel (eg, flask, plate, or fermentor), including cells, an aqueous phase, and compounds derived from genetically modified host cells.

[0057] As used herein, the term "production" generally refers to the amount of steviol or steviol glycoside produced by the genetically modified host cell provided herein. In some embodiments, production is expressed as the yield of steviol or steviol glycoside by the host cell. In other embodiments, production is expressed as the productivity of the host cell to produce steviol or steviol glycoside.

[0058] As used herein, the term "productivity" refers to the production of steviol or steviol glycoside by a host cell, expressed as the amount of steviol or steviol glycoside produced (by weight) per amount of fermentation broth in which the host cell is cultured (by volume) over time (in hour). [0059] As used herein, the term "yield" refers to the production of steviol or steviol glycoside by the host cell, expressed as the amount of steviol or steviol glycoside produced per amount of carbon source consumed by the host cell, by weight.

[0060] As used herein, the term "undetectable level" of a compound (eg, Reb M, steviol glycosides, or other compounds) means a level of a compound that is too low to be measured and/or analyzed by a standard compound measurement method. For example, the term includes a compound level that is not determined by analytical methods known in the art.

[0061] The term "kaurene" refers to a compound of kaurene, including any stereoisomer of kaurene. In specific embodiments, the term refers to the enantiomer known in the art as ent-kaurene. In particular embodiments, the term refers to a compound according to the following structure:

[0062] The term "kaurenol" refers to a kaurenol compound, including any stereoisomer of kaurenol. In specific embodiments, the term refers to the enantiomer known in the art as ent-kaurenol. In particular embodiments, the term refers to a compound according to the following structure.

[0063] The term "kaurenal" refers to a compound kaurenal, including any stereoisomer of kaurenal. In specific embodiments, the term refers to the enantiomer known in the art as ent-caurenal. In particular embodiments, the term refers to a compound according to the following structure.

[0064] The term "kaurenoic acid" refers to a compound of kaurenoic acid, including any stereoisomer of kaurenoic acid. In specific embodiments, the term refers to the enantiomer known in the art as ent-kaurenic acid. In particular embodiments, the term refers to a compound according to the following structure.

[0065] The term "steviol" refers to a compound of steviol, including any stereoisomer of steviol. In particular embodiments, the term refers to a compound according to the following structure.

HE

But

[0066] The term "steviol glycoside(s)" as used herein refers to steviol glycoside, including but not limited to naturally occurring steviol glycosides, e.g. , rebaudioside C, rebaudioside F, rebaudioside A, rebaudioside I, rebaudioside E, rebaudioside H, rebaudioside L, rebaudioside K, rebaudioside J, rebaudioside M, rebaudioside D, rebaudioside N, rebaudioside O, synthetic steviol glycosides, for example, enzymatic steviol glycosides glycosides and their combinations.

[0067] As used herein, the term "Rebaudioside M" refers to a compound of the following structure.

[0068] As used herein, the term "variant" refers to a polypeptide that differs from a specifically designated "reference" polypeptide (e.g., wild-type sequence) in amino acid insertions, deletions, mutations, and/or substitutions, but retains an activity that is substantially similar to the reference polypeptide. In some embodiments, the implementation of the option is created by methods of recombinant DNA or mutagenesis. In some embodiments, the variant polypeptide differs from its reference polypeptide by substituting one basic residue for another (e.g., Arg for Lys), substituting one hydrophobic residue for another (e.g., Leu for He), or substituting one aromatic residue for another (e.g., Phe for Tug), etc. In some embodiments, variants include analogs in which conservative substitutions are made resulting in significant structural similarity to the reference sequence. Examples of such conservative substitutions, without limitation, include glutamic acid for aspartic acid and vice versa, glugamine for asparagine and vice versa, series for threonine and vice versa, lysine for arginine and vice versa, or any of isoleucine, valine, or leucine for each other.

[0069] As used herein, the term "sequence identity" or "percent identity" in the context of two or more nucleic acid or protein sequences refers to two or more sequences or subsequences that are the same or have a certain percentage of amino acid residues or the same nucleotides. For example, the sequence may have a percent identity of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or better identity in the specified region to reference the sequence when compared and aligned for maximum match in the comparison window or designated region when measured using a sequence comparison algorithm or by manual alignment and visual inspection. For example, percent identity is determined by calculating the ratio of the number of identical nucleotides (or amino acid residues) in a sequence divided by the length of all nucleotides (or amino acid residues) minus the lengths of any gaps.

[0070] For convenience, the degree of identity between two sequences can be established using computer programs and mathematical algorithms known in the art. Such algorithms that calculate percent sequence identity typically take into account gaps and sequence mismatches in the region being compared. Programs that compare and align sequences are well suited for this purpose, such as Clustal W (Thompson et al, (1994) Nucleic Acids Res., 22: 4673-4680), ALIGN (Myers et al, (1988) CABIOS, 4: 11-17), FASTA (Pearson et al, (1988) PNAS, 85: 2444-2448; Pearson (1990), Methods Enzymol, 183: 63-98) and gapped BLAST (Altschul et al, (1997) Nucleic Acids Res., 25: 3389-3402). BLAST or BLAST 2.0 (Altschul et al, J. Mot. Biol 215: 403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI) and the Internet, for use in conjunction with the BLASTP, BLASTN sequence analysis programs , BLASTX, TBLASTN and TBLASTX. More information can be found on the NCBI website.

[0071] In some embodiments, sequence alignments and percent identity calculations can be determined using the BLAST program using its standard default settings. For nucleotide sequence alignment and sequence identity calculations, the BLASTN program is used with its default parameters (open gap penalty=5, gap widening penalty=2, nucleo match=2, nucleo mismatch=-3, expected value=10.0, word length= 11, maximum number of matches in query range=0). For polypeptide sequence alignment and sequence identity calculations, the BLASTP program is used with default parameters (Alignment Matrix=BLOSUM62; Gaps Cost: Existence=11, Extension=1; Compositional Adjustments=Conditional Composition Score, Matrix Adjustment; Expected Value=10.0; Size words=6; Maximum number of matches in query range=0). Alternatively, you can use the following program and settings: Align Plus software from Clone Manager Suite, version 5 (Sci-Ed Software); DNA Comparison: Global Comparison, Standard Linear Score Matrix, Mismatch Penalty=2, Open Gap Penalty=4, Gap Expansion Penalty=1. Amino Acid Comparison: Global Comparison, BLOSUM Scoring Matrix 62. In the embodiments described herein, sequence identity is calculated using the BLASTN or BLASTP programs using their default parameters. In the embodiments described herein, sequence alignment of two or more sequences is performed using Clustal W using the proposed default options (Input Sequence De-alignment: No; Mbed-like Cluster Guide Tree: Yes; Mbed-like Clustering Iteration: Yes ; number of merged iterations: default (0): Maximum number of steering tree iterations: default; Maximum number of HMM iterations: default; Order: input).

6.2 ABC transporter, nucleic acids, expression cassettes and host cells

[0072] In one aspect, provided herein are recombinant nucleic acids that express ABC transporters. The ABC transporters of the invention can be identified by sequence-based searches against sequences of known ABC transporters. An exemplary sequence database of known ABC transporters is provided (Kovalchuk and Driessen, Phylogenetic Analysis of Fungal ABC Transporters, BMC Genomics, 2010, 11:177). Databases of BLAST ABC transporters can also be generated from additional organisms. In preferred embodiments, a fungal sequence database from (1) Hansenula polymorpha DL-1 (NRRL-Y-7560), (2) Yarrowia lipolytica ATCC 18945, (3) Arxula adeninivorans ATCC 76597, (4) S. cerevisiae CAT-1 , (5) Lipomyces starkeyi ATCC 58690, (6) Kluyveromyces marxianus, (7) Kluyveromyces marxianus DMKU3-1042, (8) Komagataella phaffii NRRL Y-11430, (9) S. cerevisiae MBG3370, (10) S. cerevisiae MBG3373, (11) K. lactis ATCC 8585, (12) Candida utilis ATCC 22023, (13) Pichia pastoris ATCC 28485, and (14) Aspergillus oryzae NRRL5590 serve as sources of the ABC transporters of the invention.

[0073] ORF nucleotide sequences derived from de novo genomic sequencing, assembly, and annotation of various organisms are analyzed with the tblastn algorithm using Biopython or any other suitable sequence analysis software. The tblastn algorithm aligns protein sequences of known ABC transporters with translated DNA ORF nucleotide sequences for each organism in all 6 possible reading frames using BLAST. Exemplary BLAST parameters are standard with evalue=1e-25 (Tables 4 and 5). Matches can be subsequently filtered to provide a global alignment of at least 2000 nucleotides.

[0074] In other embodiments, the entire proteome of an organism can be retrieved from the Uniprot using the Uniprot API to create a BLAST search database. The blastp algorithm can be applied to a database derived from Uniprot. In one embodiment, the BLAST parameters may be standard with evalue=0.001. In particular embodiments, filtering may be performed based on >40% identity cutoff and >60% aligned length cutoff. In preferred embodiments, the matches must match at least one of the 610 original sequences from the reference.

[0075] Once the nucleotide sequences have been identified, primers can be designed to amplify each complete ORF amplified by PCR. Each PCR primer should ideally have flanking homology to the promoter and terminator DNA promoter and terminator sequences used in the heterologous nucleotide expression cassette, added to the ends to facilitate homologous recombination of the amplified gene into the landing site target site to produce a specific ABC transporter expression cassette. Each ABC transporter gene can be individually transformed as a single copy into the Reb M yeast parental strain described herein and screened for the ability to increase product titers when overexpressed in vivo.

[0076] In some embodiments, the implementation of the recombinant nucleic acids encode a polypeptide, the amino acid sequence of which is represented by any of the sequences with the identifier SEQ ID NO: 1-8. In some embodiments, the implementation of the recombinant nucleic acid contains a nucleotide sequence represented by any of the sequences with the identifier SEQ III NO: 20-27.

[0077] Also provided herein are host cells comprising one or more of the ABC transporter polypeptides or nucleic acids provided herein that are capable of producing steviol glycosides. In some embodiments, the host cells can produce steviol glycosides from a carbon source in the culture medium. In specific embodiments, the host cells can produce steviol from a carbon source in the culture medium and can additionally produce Reb A or Reb D from steviol. In specific embodiments, host cells can further produce Reb M from Reb D. In specific embodiments, Reb D and/or Reb M are transported into the lumen of one or more organelles. In specific embodiments, Reb D and/or Reb M are transported to the extracellular space (ie, supernatant).

[0078] In some embodiments, host cells expressing ABC transporters according to the above embodiments produce at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, not less than 80%, at least 90% or at least 100% more total steviol glycoside (TSG) compared to a parental host cell lacking the ABC transporter expression cassette.

[0079] In some embodiments, host cells expressing ABC transporters according to the above embodiments produce at least 20%, at least 30%, at least 40%, at least 50% , at least 60%, at least 70%, or at least 75% more TSG in the supernatant compared to the parental host cell lacking the ABC transporter expression cassette. In a specific embodiment, host cells expressing the ABC transporters according to the above embodiments produce at least 2-fold, at least 3-fold, at least 4-fold or at least 5-fold TSG in the supernatant compared to a parental host cell lacking the ABC transporter expression cassette.

[0080] In preferred embodiments, the host cell may include one or more enzymatic pathways capable of producing kaurenic acid, these pathways taken individually or together. As described herein, the host cells contain the Stevia rebaudiana kaurenic acid hydroxylase provided herein, which is capable of converting kaurenic acid to steviol. In some embodiments, the host cell further comprises one or more enzymes capable of converting farnesyl diphosphate to geranylgeranyl diphosphate. In some embodiments, the host cell further comprises one or more enzymes capable of converting geranylgeranyl diphosphate to copalyl diphosphate. In some embodiments, the host cell further comprises one or several enzymes capable of converting copalyl diphosphate to kaurene. In some embodiments, the host cell further comprises one or more enzymes capable of converting kaurene to kaurenic acid. In some embodiments, the host cell further comprises one or more enzymes capable of converting steviol to one or more steviol glycosides. In some embodiments, the host cell further comprises one, two, three, four or more enzymes together capable of converting steviol to Reb A. In some embodiments, the host cell further comprises one or more enzymes capable of converting Reb A to Reb D. In some embodiments, the host cell further comprises one or more enzymes capable of converting Reb D to Reb M. Useful enzymes and nucleic acids encoding enzymes are known to those skilled in the art. Particularly useful enzymes and nucleic acids are described in the sections below and are further described in, for example, US 2014/0329281 Al, US 2014/0357588 Al, US 2015/0159188, WO 2016/038095 A2 and US 2016/0198748 Al.

[0081] In further embodiments, the host cells further comprise one or more enzymes capable of producing geranylgeranyl diphosphate from a carbon source. These include enzymes in the DXP pathway and enzymes in the MEV pathway. Useful enzymes and nucleic acids encoding enzymes are known to those skilled in the art. Examples of enzymes of each pathway are described below and are further described, for example, in US 2016/0177341 Al, which is incorporated herein by reference in its entirety.

[0082] In some embodiments, the host cells include one or more or all of the isoprenoid pathway enzymes selected from the group consisting of: (a) an enzyme that condenses two molecules of acetyl coenzyme A to form acetoacetyl CoA (e.g., thiolase acetyl-CoA); (b) an enzyme that condenses acetoacetyl-CoA with another acetyl-CoA molecule to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) (eg, HMG-CoA synthase); (c) an enzyme that converts HMG-CoA to mevalonate (eg HMG-CoA reductase); (d) an enzyme that converts mevalonate to mevalonate-5-phosphate (eg, mevalonate kinase); (e) an enzyme that converts mevalonate-5-phosphate to mevalonate-5-pyrophosphate (eg, phosphomevalonate kinase); (f) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl diphosphate (IPP) (eg, mevalonate pyrophosphate decarboxylase); (g) an enzyme that converts IPP to dimethylallyl pyrophosphate (DMAPP) (eg, IPP isomerase); (h) polyprenyl synthase, which can condense IPP and/or DMAPP molecules to form polyprenyl compounds containing more than five carbons; (i) an enzyme that condenses IPP with DMAPP to form geranyl pyrophosphate (GPP) (eg, GPP synthase); (j) an enzyme that condenses two IPP molecules with one DMAPP molecule (eg FPP synthase); (j) an enzyme that condenses IPP to GPP to form farnesyl pyrophosphate (FPP) (eg, FPP synthase); (1) an enzyme that condenses IPP and DMAPP to form geranylgeranyl pyrophosphate (GGPP); and (t) an enzyme that condenses IPP and FPP to form GGPP. [0083] In some embodiments, the additional enzymes are naturally occurring. In preferred embodiments, the additional enzymes are heterologous. In some embodiments, two or more enzymes can be combined into one polypeptide.

6.3 Cell strains

[0084] Suitable compositions and methods provided herein for host cells include archaeal, prokaryotic, or eukaryotic cells.

[0085] Suitable prokaryotic hosts include, without limitation, any of a variety of Gram-positive, Gram-negative, or Gram-positive bacteria. Examples include, but are not limited to, cells belonging to the genera: Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Arthrobacter, Azobacter, Bacillus. B revi bacterium, Chromatium, Clostridium, Coryneb acterium, Enterobacter, Erwinia, Escheracillobacterium, Lactobactobacter, Erwinia, Escheracillobacterium, Lactobacterium, Microbacterium, Phormidium, Pseudomonas, Rhodobacter, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Salmonella, Scene desmun, Serratia, Shigella, Staphlococcus, Strepromyces, Synnecoccus and Zymomonas. Examples of prokaryotic strains include, but are not limited to: Bacillus subtilis, Bacillus amyloliquefacines, Br evib acterium ammoniagenes, Brevibacterium immariophilum, Clostridium beigerinckii, Enterobacter sakazakii, Escherichia coli, Lactococcus lactis, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomona mevalonii, Pseudomonas pudica, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei and Staphylococcus aureus. In a specific embodiment, the host cell is an Escherichia coli cell.

[0086] Suitable archaeal hosts include, but are not limited to, cells belonging to the genera: Aeropyrum, Archaeglobus, Halobacterium, Methanococcus, Methanobacterium, Pyrococcus, Sulfolobus, and Thermoplasma. Examples of archaeal strains include, but are not limited to: Archaeoglobus fulgidus, Halobacterium sp., Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Thermoplasma acidophilum, Thermoplasma volcanium, Pyrococcus horikoshii, Pyrococcus abyssi, and Aeropyrum pernix.

[0087] Suitable eukaryotic hosts include, but are not limited to, fungal cells, algal cells, insect cells, and plant cells. In some embodiments, yeasts used in the present methods include yeasts deposited in microorganism stores (e.g., IFO, ATCC, etc.) and belonging to the genera Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Galactomyces, Geotrichum , Guilliermondella, Hanseniaspora, Hansenula, Hasegawaea, Holtermannia, Hormoascus, Hyphopichia, Issatchenkia, Kloeckera, Kloeckeraspora, Kluyveromyces, Kondoa, Kuraishia, Kurtzmanomyces, Leucosporidium, Lipomyces, Lodderomyces, Malassezia, Metschnikowia, Mrakia, Myxozyma, Nadsonia, Nakazawaea, Nematospora, Ogata ea, Oosporidium, Pachysolen, Phachytichospora, Phaffia Pichia Rhodosporidium Rhodotorula Saccharomyces Saccharomycodes Saccharomycopsis Saitoella ium, Symbiotaphrina, Sympodiomyces, Sympodiomycopsis, Torulaspora, Trichosporiella, Trichosporon, Trigonopsis, Tsuchiyaea, Udeniomyces, Waltomyces, Wickerhamia, Wickerhamiella, Williopsis, Yamadazyma, Yarrowia, Zygoascus, Zygosaccharomyces, Zygowilliopsis and Zygozyma, among others.

[0088] In some embodiments, the host microorganism is Saccharomyces cerevisiae, Pichia pastoris, Schizosaccharomyces pombe, Dekkera bruxellensis, Kluyveromyces lactis (formerly known as Saccharomyces lactis), Kluveromyces marxianus, Arxula adeninustula polymorus (now known as Pichiaa angienusa polymoris) or Pichia adeninustula polymorns. In some embodiments, the host microorganism is a strain of the genus Candida, such as Candida lipolytica, Candida guilliermondii, Candida krusei, Candida pseudotropicalis, or Candida utilis.

[0089] In a particular embodiment, the host microorganism is Saccharomyces cerevisiae. In some embodiments, the host is a strain of Saccharomyces cerevisiae selected from the group consisting of baker's yeast, CBS 7959, CBS 7960, CBS 7961, CBS 7962, CBS 7963, CBS 7964, IZ-1904, TA, BG-1, CR -1, SA-1, M-26, Y-904, RE-2, RE-5, VR-1, BR-1, BR-2, ME-2, VR-2, MA-3, MA-4 , CAT-1, SV-1, NR-1, BT-1 and AL-1. In some embodiments, the host microorganism is a Saccharomyces cerevisiae strain selected from the group consisting of PE-2, CAT-1, VR-1, BG-1, CR-1, and SA-1. In a specific embodiment, the Saccharomyces cerevisiae strain is PE-2. In another specific embodiment, the Saccharomyces cerevisiae strain is CAT-1. In another specific embodiment, the Saccharomyces cerevisiae strain is BG-1.

[0090] In some embodiments, the host microorganism is a microorganism that is suitable for industrial fermentation. In specific embodiments, the microorganism is conditioned to exist under conditions of high solvent concentration, high temperature, increased substrate utilization, nutrient restriction, osmotic stress due to sugar and salts, acidity, sulfite, and bacterial contamination, or combinations thereof, which are considered to be stressful conditions in an industrial fermentation plant. Wednesday.

6.4 Biosynthetic pathways for steviol and steviol glycosides

[0091] In some embodiments, the steviol biosynthetic pathway and/or the steviol glycoside biosynthetic pathway is activated in the genetically modified host cells provided herein by engineering the cells to express polynucleotides and/or polypeptides encoding one or more enzymes of the pathway. FIG. 1 illustrates an exemplary steviol biosynthetic pathway.

[0092] Thus, in some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having geranylgeranyl diphosphate synthase (GGPPS) activity. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having copalyl diphosphate synthase or eit-copalyl pyrophosphate synthase (CDPS; also referred to as ent-copalyl pyrophosphate synthase or CPS) activity. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having kaurene synthase (KS; also referred to as ent-kaurene synthase) activity. In specific embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having kaurene oxidase (KO; also referred to as ent-kaurene-19 oxidase) activity as described herein. In specific embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having the activity of a kaurenic acid hydroxylase (CAH; also referred to as steviol synthase) polypeptide, according to the embodiments provided herein. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having cytochrome P450 reductase (CPR) activity.

[0093] In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having UGT74G1 activity. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having UGT76G1 activity. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having UGT85C2 activity. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having UGT91D activity. In some embodiments, the genetically modified host cells provided herein comprise a heterologous polynucleotide encoding a polypeptide having UGTad activity. As described below, UGTad refers to a uridine diphosphate-dependent glycosyltransferase capable of transferring a glucose moiety to the C-2' position of the 19-O-glucose of Reb A to form Reb D.

[0094] In some embodiments, the host cell contains a variant enzyme. In some embodiments, the variant may contain up to 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid substitutions relative to the corresponding polypeptide. In some embodiments, a variant may contain up to 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 conservative amino acid substitutions relative to the reference polypeptide. In some embodiments, any of the nucleic acids described herein may be optimized for the host cell, eg, codon optimized.

[0095] Examples of nucleic acids and enzymes of the steviol biosynthetic pathway and/or the steviol glycoside biosynthetic pathway are described below.

6.4.1 Geranylgeranyl diphosphate synthase (GGPPS)

[0096] Geranylgeranyl diphosphate synthases (EC 2.5.1.29) catalyze the conversion of farnesyl pyrophosphate to geranylgeranyl diphosphate. 13), Thalassiosira pseudonana (account number XP 002288339), Streptomyces clavuligerus (Ac. ZP_05004570), Sulfiilobus acidocaldarius (Ac. BAA43200), Synechococcus sp. 92798.1) and described in US 2014/0329281 Al. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these GGPPS nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these GGPPS enzymes.

6.4.2 Copalyl diphosphate synthase (CDPS)

[0097] Copalyl diphosphate synthases (EC 5.5.1.13) catalyze the conversion of geranylgeranyl diphosphate to copalyl diphosphate. 895.1), Zea mays ( accession number AY562490), Arabidopsis thaliana (accession number NM 116512) and Oryza sativa (accession number Q5MQ85.1) and described in US 2014/0329281 Al. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these CDPS nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these CDPS enzymes.

6.4.3 Kaurene synthase (KS)

[0098] Kaurene synthases (EC 4.2.3.19) catalyze the conversion of copalyl diphosphate to kaurene and diphosphate. (accession number 013284), Arabidopsis thaliana (accession number Q9SAK2) and Picea glauca (accession number ADB55711.1) and described in US 2014/0329281 Al. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these KS nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these KS enzymes.

6.4.4 Bifunctional copalyl diphosphate synthase (CDPS) and kaurene synthase (KS)

[0099] The bifunctional CDPS-KS enzymes (EC 5.5.1.13 and EC 4.2.3.19) can also be used. Illustrative examples of enzymes include Phomopsis amygdali (accession number BAG30962), Physcomitrella patens (accession number BAF61135) and Gibberella fujikuroi (accession number Q9UVY5.1) and described in US 2014/0329281 Al, US 2014/0357588 Al, US 2015/0 159188 and WO 2016/038095A2. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these CDPS-KS nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these CDPS-KS enzymes.

6.4.5 Ent-kaurene oxidase (KO)

[00100] Ent-kaurene oxidases (EC 1.14.13.78; also referred to herein as kaurene oxidases) catalyze the conversion of kaurene to kaurenic acid. Illustrative examples of enzymes include Oryza sativa (accession number Q5Z5R4), Gibberella fujikuroi (accession number 094142), Arabidopsis thaliana (accession number Q93ZB2), Stevia rebaudiana (accession number AAQ63464.1) and Pisum sativum (uniprot accession number Q6XAF4) and described in the US 2014/0329281 Al, US 2014/0357588 Al, US 2015/0159188 and WO 2016/038095 A2. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these KO nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these KO enzymes.

6.4.6 Steviol synthase (CAN)

[00101] Steviol synthases or kaurenic acid hydroxylases (CAH) (EC 1.14.13) catalyze the conversion of kaurenic acid to steviol. Illustrative examples of enzymes include Stevia rebaudiana (Access Number ACD93722), Stevia rebaudiana (SEQ ID NO: 10) Arabidopsis thaliana (Access Number NP_197872), Vitis vinifera (Access Number XP 002282091), and Medicago trunculata (Access Number ABC59076) and described in the US 2014/0329281 A1, US 2014/0357588 Al, US 2015/0159188 and WO 2016/038095 A2. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these CAH nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these CAH enzymes.

6.4.7 Cytochrome P450 reductase (CPR)

[00102] Cytochrome P450 reductases (EC 1.6.2.4) are required for KO and/or CAN activity as noted above. Illustrative examples of enzymes include Stevia rebaudiana (Access Number ABB88839) Arabidopsis thaliana (Access Number NP_194183), Gibberella fujikuroi (Account Number CAE09055), and Artemisia annua (Account Number ABC47946.1) and described in US 2014/0329281 Al, US 2014/0357588 Al, US 2015/0159188 and WO 2016/038095A2. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these CPR nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these CPR enzymes.

6.4.8 UDP glycosyltransferase 74G1 (UGT74G1)

[00103] UGT74G1 is able to function as uridine-5'-diphosphoglucosyl:steviol 19-COOH transferase and as uridine-5'-diphosphoglucosyl:steviol-13-O-glucoside 19-COOH transferase. As shown in FIG. 1, UGT74G1 is able to convert steviol to 19-glycoside. UGT74G1 is also capable of converting steviol monoside to rubusoside. UGT74G1 can also convert steviolbioside to stevioside. Illustrative examples of enzymes include Stevia rebaudiana enzymes (eg Richman et al, 2005, Plant J. 41: 56-67 and US 2014/0329281 and WO 2016/038095 A2 and accession number AAR06920.1). Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these UGT74G1 nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these UGT74G1 enzymes.

6.4.9 UDP glycosyltransferase 76G1 (UGT76G1)

[00104] UGT76G1 is able to transfer a glucose moiety to the C-3'C-13-O-glucose acceptor molecule, steviol-1,2 glycoside. Thus, UGT76G1 is able to function as uridine 5'-diphosphoglucosyl: steviol 13-0-1,2 glucoside C-3' glucosyltransferase and uridine 5'-diphosphoglucosyl: steviol-19-O-glucose, 13-0-1,2 bioside C-3' glucosyltransferase. UGT76G1 is able to convert steviolbioside to Reb B. UGT76G1 is also able to convert stevioside to Reb A. UGT76G1 is also able to convert Reb D to Reb M. Illustrative examples of enzymes include the enzymes of Stevia rebaudiana (e.g. those of Richman et al, 2005, Plant J'.41: 56-67 and US 2014/0329281 Al and WO 2016/038095 A2 and accession number AAR06912.1). Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these UGT76G1 nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these UGT76G1 enzymes.

6.4.10 UDP glycosyltransferase 85C2 (UGT85C2)

[00105] UGT85C2 is able to function as uridine-5'-diphosphoglucosyl:steviol 13-OH transferase and uridine-5'-diphosphoglucosyl:steviol-19-O-glucoside 13-OH transferase. UGT85C2 is able to convert steviol to steviol monoside and is also able to convert 19-glycoside to rubusoside. Illustrative examples of enzymes include those of Stevia rebaudiana (eg, Richman et al, 2005, Plant JA\: 56-67 and US 2014/0329281 Al and WO 2016/038095 A2 and accession number AAR06916.1). Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these UGT85C2 nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these UGT85C2 enzymes.

6.4.11 UDP-glycosyltransferase 91D (UGT91D)

[00106] UGT91D is able to function as a uridine-5'-diphosphoglucosyl:steviol-13-O-glucoside transferase, transferring a glucose molecule to the C-2' 13-O-glucose acceptor molecule, steviol-13-O-glucoside (steviol monoside), to obtain steviolbioside. UGT91D is also able to function as a uridine-5'-diphosphoglucosyl: rubusoside transferase, transferring a glucose moiety to the C-2'13-O-glucose acceptor molecule, rubusoside, to produce stevioside. UGT91D is also referred to as UGT91D2, UGT91D2e or UGT91D-like3. Illustrative examples of UGT91D enzymes include those of Stevia rebaudiana (e.g., enzymes with the UGT sequence of accession number ACE87855.1, US 2014/0329281 Al, WO 2016/038095 A2 and SEQ ID NO: 7). Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one of these UGT91D nucleic acids. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these UGT91D enzymes.

6.4.12 Uridine diphosphate-dependent glycosyltransferase capable of converting Reb A to Reb D (UGTad)

[00107] Uridine diphosphate-dependent glycosyltransferase (UGTad) is able to transfer a glucose moiety to the C-2' 19-O-glucose position of Reb A to form Reb D. UGTad is also able to transfer a glucose moiety to the C-2' position of 19-O-glucose of stevioside to form Reb E. Useful examples of UGT include Os UGT 91C1 from Oryza sativa (also referred to as EUGT11 in Houghton-Lars en et al, WO 2013/022989 A2; XP 015629141.1) and S1UGT 101249881 from Solanum lycopersicum also referred to as UGTSL2 in Markosyan et al, WO2014/193888Al; XP 004250485.1). Additional useful UGTs include UGT40087 (XP 004982059.1; as described in WO 2018/031955), sr.UGT_9252778, Bd_UGT10840 (XP 003560669.1), HvUGTVl (BAJ94055.1), Bd_UGT10850 ( XP 010230871.1) and Ob_UGT91Bl_like (XP 006650455.1).

Any UGT or UGT variant can be used in the compositions and methods described herein. Nucleic acids encoding these enzymes are applicable in the cells and methods presented here. In some embodiments, provided herein are cells and methods using a nucleic acid having at least 80%, 85%, 90%, or 95% sequence identity with at least one such UGT. In certain embodiments, provided herein are cells and methods using a nucleic acid encoding a polypeptide having at least 80%, 85%, 90%, 95% sequence identity with at least one of these UGTs. In some embodiments, provided herein is a nucleic acid encoding a UGT variant described herein.

6.5 MEV Pathway Production of FPP and/or GGPP

[00108] In some embodiments, the genetically modified host cell provided herein contains one or more heterologous MEV pathway enzymes useful for the formation of FPP and/or GGPP. In some embodiments, one or more of the MEV pathway enzymes comprise an enzyme that condenses acetyl-CoA with malonyl-CoA to form acetoacetyl-CoA. In some embodiments, one or more of the MEV pathway enzymes comprise an enzyme that condenses two molecules of acetyl-CoA to form acetoacetyl-CoA. In some embodiments, one or more of the MEV pathway enzymes comprise an enzyme that condenses acetoacetyl-CoA to acetyl-CoA to form HMG-CoA. In some embodiments, one or more MEV pathway enzymes contain an enzyme that converts HMG-CoA to mevalonate. In some embodiments, one or more MEV pathway enzymes contain an enzyme that phosphorylates mevalonate to mevalonate-5-phosphate. In some embodiments, one or more of the MEV pathway enzymes comprise an enzyme that converts mevalonate-5-phosphate to mevalonate-5-pyrophosphate. In some embodiments, one or more of the MEV pathway enzymes contain an enzyme that converts mevalonate-5-pyrophosphate to isopentenyl pyrophosphate. In some embodiments, one or more of the MEV pathway enzymes comprise an enzyme that converts isopentenyl pyrophosphate to dimethylallyl diphosphate.

[00109] In some embodiments, one or more MEV pathway enzymes are selected from the group consisting of acetyl-CoA thiolase, acetoacetyl-CoA synthetase, HMG-CoA synthase, HMG-CoA reductase, mevalon kinase, phosphomevalon kinase, mevalonate pyrophosphate decarbonate, and isopentyl diphosphate:dimethylallyl diphosphate isomerase (IDI or IPP isomerase). In some embodiments, for an MEV pathway enzyme capable of catalyzing the formation of acetoacetyl-CoA, the genetically modified host cell contains either an enzyme that condenses two molecules of acetyl-CoA to form acetoacetyl-CoA, such as acetyl-CoA thiolase; or an enzyme that condenses acetyl-CoA with malonyl-CoA to form acetoacetyl-CoA, such as acetoacetyl-CoA synthase. In some embodiments, the genetically modified host cell contains both an enzyme that condenses two molecules of acetyl-CoA to form acetoacetyl-CoA, eg, acetyl-CoA thiolase; and an enzyme that condenses acetyl-CoA with malonyl-CoA to form acetoacetyl-CoA, such as acetoacetyl-CoA synthase.

[00110] In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding more than one MEV pathway enzyme. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding two enzymes of the MEV pathway. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding an enzyme that can convert HMG-CoA to mevalonate and an enzyme that can convert mevalonate to mevalonate-5-phosphate. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding the three enzymes of the MEV pathway. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding the four enzymes of the MEV pathway. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding the five enzymes of the MEV pathway. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding the six enzymes of the MEV pathway. In some embodiments, the host cell contains one or more heterologous nucleotide sequences encoding the seven enzymes of the MEV pathway. In some embodiments, the host cell contains a plurality of heterologous nucleic acids encoding all of the enzymes of the MEV pathway.

[00111] In some embodiments, the genetically modified host cell further comprises a heterologous nucleic acid encoding an enzyme that can convert isopentenyl pyrophosphate (IPP) to dimethylallyl pyrophosphate (DMAPP). In some embodiments, the genetically modified host cell further comprises a heterologous nucleic acid encoding an enzyme that can condense IPP and/or DMAPP molecules to form a polyprenyl compound. In some embodiments, the genetically modified host cell further comprises a heterologous nucleic acid encoding an enzyme that can modify IPP or polyprenyl to form an isoprenoid compound, such as FPP.

6.5.1 Conversion of acetyl-CoA to acetoacetyl-CoA

[00112] In some embodiments, the genetically modified host cell contains a heterologous nucleotide sequence encoding an enzyme that can condense two molecules of acetyl coenzyme A to form acetoacetyl CoA, e.g., acetyl CoA thiolase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (REGION NC 000913: 2324131.2325315; Escherichia coli), (D49362; Paracoccus denitrificans) and (L20428; Saccharomyces cerevisiae).

[00113] Acetyl-CoA thiolase catalyzes the reversible condensation of two molecules of acetyl-CoA to form acetoacetyl-CoA, but this reaction is thermodynamically unfavorable; Thiolysis of acetoacetyl-CoA is preferable to synthesis of acetoacetyl-CoA. Acetoacetyl-CoA synthase (AACS) (also called acetyl-CoA: malonyl-CoA acyltransferase; EC 2.3.1.194) condenses acetyl-CoA with malonyl-CoA to form acetoacetyl-CoA. Unlike acetyl-CoA thiolase, synthesis of acetoacetyl-CoA catalyzed by AACS is essentially an energetically favorable reaction due to the coupled decarboxylation of malonyl-CoA. In addition, AACS does not exhibit thiolysis activity against acetoacetyl-CoA, and thus the reaction is irreversible.

[00114] In host cells containing acetyl-CoA thiolase and heterologous ADA and/or phosphotransacetylase (PTA), a reversible reaction catalyzed by acetyl-CoA thiolase that promotes thiolysis of acetoacetyl-CoA can result in a large pool of acetyl-CoA. Given the reversible activity of ADA, this pool of acetyl-CoA may in turn push ADA to reverse the conversion of acetyl-CoA to acetaldehyde, thereby reducing the benefits provided by ADA in terms of acetyl-CoA production. Similarly, PTA activity is reversible, and thus a large pool of acetyl-CoA can push PTA to reverse acetyl-CoA to acetyl phosphate. PTA, in the MEV pathway of the genetically modified host cell presented herein, uses acetoacetyl-CoA synthase to generate acetoacetyl-CoA from acetyl-CoA and malonyl-CoA.

[00115] In some embodiments, the AACS is from Streptomyces sp., strain CL190 (Okamura et al., Proc Natl Acad Sci USA 107 (25): 11265-70 (2010). Representative AACS nucleotide sequences of Streptomyces sp., strain CL190 include accession number AB540131.1 Representative AACS protein sequences of Streptomyces sp., strain CL190 include accession numbers D7URV0, BAJ10048 Other acetoacetyl-CoA synthases useful for the compositions and methods provided herein include, but are not limited to, Streptomyces sp. (AB183750; KO-3988 BAD86806); S. anulatus, strain 9663 (FN 178498; CAX48662); Streptomyces sp.KO-3988 (AB212624; BAE78983); Actinoplanes sp.A40644 (AB113568; BAD07381); Streptomy ces sp.С ( NZACEW010000640; ZP_05511702): Nocardiopsis dassonvillei DSM 43111 (NZ_ABUI01000023; ZP_04335288); Mycobacterium ulcerans Agy99 (NC 008611; YP 907152); Mycobacterium marinum M (NC 01061 2; YP 001851502); Streptomyces sp. Mgl (NZ DS570501; ZP 05002626); Streptomyces sp.AA4 (NZ_ACEV01000037; ZP_05478992); S. roseosporus NRRL 15998 (NZ ABYB01000295: ZP_04696763); Streptomyces sp.ACTE (NZADFD01000030; ZP_06275834); S viridochromogenes DSM 40736 (NZ ACEZ01000031; ZP 05529691); Frankia sp. CcI3 (NC 007777; YP 480101); Nocardia brasiliensis (NC 018681; YP 006812440.1); nAustwickia chelonae (NZBAGZ01000005; ZP 10950493.1). Additional suitable acetoacetyl-CoA synthases include those described in US Patent Application Publication Nos. 2010/0285549 and 2011/0281315, the contents of which are incorporated by reference in their entirety.

[00116] Acetoacetyl-CoA synthases also used in the compositions and methods provided herein include those molecules that are said to be "derivatives" of any of the acetoacetyl-CoA synthases described herein. Such a "derivative" has the following characteristics: (1) it has significant homology to any of the acetoacetyl-CoA synthases described herein; and (2) is able to catalyze the irreversible condensation of acetyl-CoA with malonyl-CoA to form acetoacetyl-CoA. An acetoacetyl-CoA synthase derivative is considered to have "substantial homology" to acetoacetyl-CoA synthase if the amino acid sequence of the derivative is at least 80%, more preferably at least 90%, and most preferably at least 95% identical to amino acid sequence of acetoacetyl-CoA synthase.

6.5.2 Conversion of acetoacetyl-CoA to HMG-CoA

[00117] In some embodiments, the host cell contains a heterologous nucleotide sequence encoding an enzyme that can condense acetoacetyl-CoA with another acetyl-CoA molecule to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA), e.g., HMG - CoA synthase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (NC 001145; complement 19061.20536; Saccharomyces cerevisiae), (X96617; Saccharomyces cerevisiae), (X83882; Arabidopsis thaliana), (AB037907; Kit007302; Homo sapi ens) and (NC 002758, Locus tag SAV2546, GenelD 1122571; Staphylococcus aureus).

6.5.3 Conversion of HMG-CoA to mevalonate

[00118] In some embodiments, the implementation of the host cell contains a heterologous nucleotide sequence encoding an enzyme that can convert HMG-CoA to mevalonate, for example, HMG-CoA reductase. In some embodiments, the HMG-CoA reductase is a NADH-using hydroxymethylglutaryl-CoA reductase-Co A reductase. HMG-Co A reductases (EC 1.1.1.34: EC 1.1.1.88) catalyze the reductive deacylation of (8)-HMG-CoA to (R)-mevalonate and can be divided into two classes: HMG class I and class P. Class I includes the enzymes of eukaryotes and most archaea, and class II includes the HMG-CoA reductases of some prokaryotes and archaea. In addition to sequence differences, the two classes of enzymes also differ in their cofactor specificity. Unlike class I enzymes, which exclusively use NADPH, class II HMG-CoA reductases differ in their ability to discriminate between NADPH and NADH. See, for example, Hedl et al., Journal of Bacteriology 186 (7): 1927-1932 (2004). Below are the features of cofactors for some HMG-CoA class P reductases.

Features of cofactors for some HMG-CoA class II reductases

Source Coenzyme specificity _Gt NADPH ( _>wM ) K _t ^iAt (µM) P. mevaloni NADH 80 A. fulgidas OVER(F)N 500 160 S. aureus OVER(F)N 70 100 Ε. f(tecalis NADPH thirty

[00119] Suitable HMG-CoA reductases for the compositions and methods provided herein include HMG-CoA reductases that are capable of using NADH as a cofactor, such as HMG-CoA reductase from P. mevalonii, A. fulgidus, or S. aureus. In specific embodiments, the implementation of the HMG-CoA reductase is capable of using only NADH as a cofactor, for example, HMG-CoA reductase from P. mevalonii, S. pomeroyi or D. acidovorans.

[00120] In some embodiments, the HMG-CoA reductase using NADH is from Pseudomonas mevalonii. The sequence of the Pseudomonas mevalonii wild-type mvaA gene, which encodes the HMG-CoA reductase (EC 1.1.1.88), has been described previously. See Beach and Rodwell, J. Bacteriol. 171:2994-3001 (1989). Representative mvaA Pseudomonas mevalonii nucleotide sequences include accession number M24015. Representative protein sequences of Pseudomonas mevalonii HMG-CoA reductase include accession numbers AAA25837, P13702, MVAA PSEMV. [00121] In some embodiments, the HMG-CoA reductase using NADH is derived from Silicibacter pomeroyi. Representative nucleotide sequences of HMG-CoA reductase Silicibacter pomeroyi include accession number NC 006569.1. Representative protein sequences of Silicibacter pomeroyi HMG-CoA reductase include YP accession number 164994.

[00122] In some embodiments, the HMG-CoA reductase using NADH is derived from Delftia acidovorans. Representative nucleotide

the HMG-CoA reductase sequence of Delftia acidovorans includes NC 010002 REGION: complement (319980..321269). Representative sequences for the Delftia acidovorans HMG-CoA reductase protein include YP accession number 001561318. [00123] In some embodiments, the HMG-CoA reductases using NADH are from Solanum tuberosum (Crane et al., J. Plant Physiol. 159: 1301 -1307 (2002)).

[00124] NADH-using HMG-CoA reductases also useful in the compositions and methods provided herein include those molecules said to be "derivatives" of any of the NADH-using HMG-CoA reductases described herein. document, for example, from P. mevalonii, S. pomeroyi and D. acidovorans. Such a "derivative" has the following characteristics: (1) it has significant homology to any of the NADH-using HMG-CoA reductases described herein; and (2) is capable of catalyzing the reductive deacylation of (8)-HMG-CoA to (R)-mevalonate, preferably using NADH as a cofactor. A derivative of an HMG-CoA reductase using NADH has "substantial homology" to an HMG-CoA reductase using NADH if the amino acid sequences of the derivative are at least 80%, and more preferably at least 90%, and most preferably at least , 95%, as in HMG-CoA reductase using NADH.

[00125] In this context, the phrase "using NADH" means that the HMG-CoA reductase using NADH is selective for NADH over NADH as a cofactor, for example, showing higher specific activity for NADH than for NADH. In some embodiments, the selectivity for NADH as a cofactor is expressed as the ratio of s: _C a / ^NADH ^ / sag ^GNADP1 R In some embodiments, _HMG -CoA reductase using ^NADH is related to _s t ⁽ ^ ^ADPH) is at least 5, 10, 15, 20, 25, or greater than 25. In some embodiments, the NADH-using HMG-CoA reductase uses NADH exclusively. For example, HMG-CoA reductase using NADH, which uses NADH exclusively, exhibits some activity with NADH supplied as the sole cofactor in vitro and exhibits no detectable activity when NADPH is provided as the sole cofactor. Any method of determining cofactor specificity known in the art can be used to identify HMG-CoA reductases that prefer NADH as a cofactor, including those described by Kim et al, Protein Science 9: 1226-1234 (2000); and Wilding et al., J. Bacteriol. 182 (18): 5147-52 (2000), the contents of which are incorporated herein in their entirety.

[00126] In some embodiments, the HMG-CoA reductase using NADH is engineered to be selective for NADH over NAPD, for example, by site-directed mutagenesis of the cofactor binding pocket. Methods for constructing NADH selectivity are described in Watanabe et al, Microbiology 153:3044-3054 (2007), and methods for determining the cofactor specificity of HMG-CoA reductases are described in Kim et al, Protein Sci. 9: 1226-1234 (2000), the contents of which are incorporated herein by reference in their entirety.

[00127] In some embodiments, the HMG-CoA reductase using NADH is from a host species that originally includes a mevalonate degradation pathway, e.g., from a host species that catabolizes mevalonate as its sole carbon source. In these embodiments, HMG-CoA reductase using NADH, which typically catalyzes the oxidative acylation of internalized (R)-mevalonate to (8)-HMG-CoA within its native host cell, is used to catalyze the reverse reaction, i.e., reductive deacylation (8)-HMG-CoA to (K)-mevalonate in a genetically modified host cell, including the mevalonate biosynthetic pathway. Prokaryotes capable of growing on mevalonate as the sole carbon source have been described: Anderson et al., J. Bacteriol, 171 (12): 6468-6472 (1989); Beach et al., J. Bacteriol. 171: 2994-3001 (1989); Bensch et al., J. Biol. Chem. 245:3755-3762; Fimongnari et al., Biochemistry 4:2086-2090 (1965); Siddiqi et al., Biochem. Biophys. Res. commun. 8:110-113 (1962); Siddiqi et al., J. Bacteriol. 93:207-214 (1967); and Takatsuji et al., Biochem. Biophys. Res. commun. 110:187-193 (1983), the contents of which are incorporated herein by reference in their entirety. [00128] In some embodiments of the compositions and methods provided herein, the host cell contains both HMGr using NADH and HMG-CoA reductase using NADPH. Illustrative examples of nucleotide sequences encoding an HMG-CoA reductase using NADPH include, but are not limited to: (NM 206548; Drosophila melanogaster), (NC 002758, locus tag SAV2545, GenelD 1122570; Staphylococcus aureus), (ABO 15627; Streptomyces sp. KO 3988), (AX 128213 providing a sequence encoding a truncated HMG-CoA reductase; Saccharomyces cerevisiae) and (NC_001145: complement (115734.118898: Saccharomyces cerevisiae).

6.5.4 Conversion of mevalonate to mevalonate-5-phosphate

[00129] In some embodiments, the host cell contains a heterologous nucleotide sequence encoding an enzyme that can convert mevalonate to mevalonate-5-phosphate, such as mevalonate kinase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (L77688; Arabidopsis thaliana) and (X55875; Saccharomyces cerevisiae).

6.5.5 Conversion of mevalonate-5-phosphate to mevalonate-5-pyrophosphate

[00130] In some embodiments, the host cell contains a heterologous nucleotide sequence encoding an enzyme that can convert mevalonate-5-phosphate to mevalonate-5-pyrophosphate, such as phosphomevalonate kinase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (AF429385; Hevea brasiliensis), (NM_006556; Homo sapiens) and (NC_001145. complement 712315.713670; Saccharomyces cerevisiae).

6.5.6 Conversion of mevalonate-5-pyrophosphate to IPP

[00131] In some embodiments, the host cell contains a heterologous nucleotide sequence encoding an enzyme that can convert mevalonate-5-pyrophosphate to isopentenyl diphosphate (1PP) > eg, mevalonate pyrophosphate decarboxylase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (X97557; Saccharomyces cerevisiae), (AF290095; Enterococcus faecium) and (U49260; Homo sapiens).

6.5.7 Converting IPP to DMAPP

[00132] In some embodiments, the host cell further comprises a heterologous nucleotide sequence encoding an enzyme that can convert IPP generated by the MEV pathway to dimethylallyl pyrophosphate (DMAPP), eg, IPP isomerase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (NC_000913, 3031087.3031635; Escherichia coli) and (AF082326; Haematococcus pluvialis).

6.5.8 Polyprenyl synthase

[00133] In some embodiments, the host cell further comprises a heterologous nucleotide sequence encoding a polyprenyl synthase that can condense IPP and/or DMAPP molecules to form polyprenyl compounds having more than five carbon atoms. [00134] In some embodiments, the host cell contains a heterologous nucleotide sequence encoding an enzyme that can condense one molecule of IPP with one molecule of DMAPP to form one molecule of geranyl pyrophosphate ("GPP"), e.g., GPP synthase. Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (AF513111; Abies grandis), (AF513112; Abies grandis), (AF513113: Abies grandis), (AY534686; Antirrhinum majus), (AY534687; Antirrhinum majus) , (Y17376: Arabidopsis thaliana), (AE016877, Locus AP11092; Bacillus cereus; ATCC 14579), (AJ243739; Citrus sinensis), (AY534745; Clarkia breweri), (AY953508; Ipspini) ), (AF182828 ; Mentha x piperita) , Locus AAF12843; Zymomonas mobilis).

[00135] In some embodiments, the host cell contains a heterologous nucleotide sequence encoding an enzyme that can fuse two IPP molecules with one DMAPP molecule or add an IPP molecule to a GPP molecule to form a farnesyl pyrophosphate (“FPP”) molecule, e.g., FPP synthase . Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (ATU80605; Arabidopsis thaliana), (ATHFPS2R; Arabidopsis thaliana), (AAU36376; Artemisia annua), (AF461050; Bos taurus), (D00694; Escherichia coli K -12), (AE009951, Locus AAL95523; Fusobacterium nucleatum subsp. nucleatum ATCC 25586), (GFFPPSGEN; Gibberella fujikuroi), (CP000009, Locus AAW60034; Gluconobacter oxydans 621H), (AF019892; Helianthus annuus), (HUMFA PS; Homo sapiens) , (KLPFPSQCR; Kluyveromyces lactis), (LAU15777; Lupinus albus), (LAU20771; Lupinus albus), (AF309508; Mus musculus), (NCFPPSGEN; Neurospora crassa), (PAFPS1; Parthenium argentatum), (PAFPS2; Parthenium argentatum), (RATFAPS; Rattus norvegicus) YP 598856 Streptococcus pyogenes MGAS10270), (NC 008023, Locus YP 600845; Streptococcus pyogenes MGAS2096), (NC 008024, Locus YP_602832; Streptococcus pyogenes MGAS 10750), (MZEFPS; Zea mays), (AE000657, Locus AAC06913; Aquifex aeolicus VF5), (NM_202836; Arabidopsis thaliana), (D 84432, Locus BAA12575, Bacillus subtilis), (U12678, Locus AAC28894; Bradyrhizobium japonicum USDA 110), (BACFDPS; Geobacillus stear other mophilus), (NC_002940, Locus NP_873754: Haemophilus ducreyi 35000HP), (L42023, Locus AAC23087; Haemophilus influenzae R d KW20), (J05262; Homo sapiens), (YP 395294; Lactobacillus sakei subsp. sakei 23K), (NC_005823, Locus YP_000273; Leptospira interrogans serovar Copenhageni str. Fiocruz Ll-130), (AB003187; Micrococcus luteus), (NC_002946, Locus YV_2 0W6% Neisseria gonorrhoeae FA 1090), (U00090, Locus AAB91752; Rhizobium sp.NGR234), (J05091; Saccharomyces cerevisae), (CP000031, locus AAV93568; Silicibacter pomeroyi DSS-3), (AE008481, locus AAK99890; Streptococcus pneumoniae R6 ) and (NC_004556, locus NP 779706; Xylella fastidiosa Temeculal).

[00136] In some embodiments, the host cell further comprises a heterologous nucleotide sequence encoding an enzyme that can combine IPP and DMAPP or IPP and FPP to form geranylgeranyl pyrophosphate ("GGPP"). Illustrative examples of nucleotide sequences encoding such an enzyme include, but are not limited to: (ATHGERPYRS; Arabidopsis thaliana), (BT005328; Arabidopsis thaliana), (NM_119845; Arabidopsis thaliana), (NZ_AAJM01000380, Locus ZP_00743052; Bacillus thuringiensis sero var israelensis, ATCC 35646 sql563), (CRGGPPS; Catharanthus roseus), (NZ AABF02000074, Locus ZP 00144509; Fusobacterium nucleatum subsp.vincentii, ATCC 49256), (GFGGPPSGN; Gibberella fujikuroi), (AY371321; Ginkgo biloba), (ABO55496; Hevea brasiliensis), ( AB017971; Homo sapiens), (MCI276129; Mucor circinelloides f. lusitanicus), (ABO 16044; Mus musculus), (AABX01000298, Locus NCU01427; Neurospora crassa), (NCU20940; Neurospora crassa), (NZ AAKL01000008 , Locus ZP 00943566; Ralstonia solanacearum UW551), (AB118238; Rattus norvegicus), (SCU31632; Saccharomyces cerevisiae) itrophicus SB) , (NC_006840, Locus YP_204095; Vibrio fischeri ESI 14), (NM_112315; Arabidopsis thaliana), (ERWCRTE; Pantoea agglomerans), (D90087, Locus BAA14124; Pantoea ananatis), (X52291, Locus CAA36538; Rhodobacter capsulatus), (AF195122, Locus AAF24294; Rhodob actor sphaeroides) and (NC_004350, Locus NP_721015; Streptococcus mutans UA159).

[00137] Although examples of mevalonate pathway enzymes are described above, in some embodiments, DXP pathway enzymes can be used as an alternative or additional pathway for the production of DMAPP and IPP in host cells, the compositions and methods described herein. Enzymes and nucleic acids encoding DXP pathway enzymes are well known and characterized in the art, for example WO 2012/135591 A2.

6.6 Processes for the preparation of steviol glycosides

[00138] In another aspect, provided herein is a method for producing steviol glycoside, which includes the steps of: (a) culturing a population of any of the genetically modified host cells described herein that are capable of producing steviol glycoside in an environment with a carbon source under conditions, suitable for preparing the steviol glycosidic compound; and (b) isolating said steviol glycosidic compound from the medium.

[00139] In some embodiments, the genetically modified host cell produces an increased amount of steviol glycoside compared to a parent cell that does not contain one or more modifications, or a parent cell that contains only a subset of one or more modifications of the genetically modified host cell, but otherwise genetically identical. In some embodiments, the increased amount is at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65 .%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100%, as measured, for example, by yield, production volume and/or productivity, in grams per liter of cell culture, milligrams per gram of dry cell weight, per unit volume of cell culture, per unit weight of dry cells, per unit volume of cell culture per unit time, or per unit weight of dry cells per unit time.

[00140] In some embodiments, the host cell produces an elevated level of steviol glycoside that is greater than about 1 gram per liter of fermentation medium. In some embodiments, the host cell produces an elevated level of steviol glycoside that is greater than about 5 grams per liter of fermentation medium. In some embodiments, the host cell produces an elevated level of steviol glycoside that is greater than about 10 grams per liter of fermentation medium. In some embodiments, the steviol glycoside is manufactured in an amount of about 10 to about 50 grams, about 10 to about 15 grams, more than about 15 grams, more than about 20 grams, more than about 25 grams, or more than about 30 grams per liter. cell culture.

[00141] In some embodiments, the host cell produces an elevated level of steviol glycoside that is greater than about 50 milligrams per gram of cell dry weight. In some such embodiments, the steviol glycoside is manufactured in an amount of from about 50 to about 1500 milligrams, more than about 100 milligrams, more than about 150 milligrams, more than about 200 milligrams, more than about 250 milligrams, more than about 500 milligrams, more than about 750 milligrams or more than about 1000 milligrams per gram of cell dry weight.

[00142] In some embodiments, the host cell produces an elevated level of steviol glycoside that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more, higher than the level steviol glycoside produced by the parent cell, per unit volume of the cell culture.

[00143] In some embodiments, the host cell produces an elevated level of steviol glycoside that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more, higher than the level steviol glycoside produced by the parent cell, per unit mass of dry cell.

[00144] In some embodiments, the host cell produces an elevated level of steviol glycoside that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more, higher than the level steviol glycoside produced by the parent cell, per unit volume of the cell culture per unit time. [00145] In some embodiments, the host cell produces an elevated level of steviol glycoside that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more, higher than the level steviol glycoside produced by the parent cell, per unit of dry mass of the cell per unit of time. [00146] In most embodiments, the production of elevated levels of steviol glycoside by the host cell is induced by the presence of an inducing compound. Such a host cell can be easily manipulated in the absence of an inducing compound. An inducing compound is then added to induce the production of elevated levels of steviol glycoside by the host cell. In other embodiments, production of an increased level of steviol glycoside by the host cell is induced by changing culture conditions such as, for example, growth temperature, medium composition, and the like.

6.7 Culture media and conditions

[00147] Materials and methods for maintaining and growing microbial cultures are well known to those skilled in microbiology or fermentation science (see, for example, Bailey et al, Biochemical Engineering Fundamentals, Second Edition, McGraw Hill, New York, 1986). Suitable culture media, pH, temperature, and requirements for aerobic, microaerobic, or anaerobic conditions must be considered, depending on the specific requirements of the host cell, fermentation, and process.

[00148] The methods for producing steviol glycosides provided herein can be performed in a suitable culture medium (e.g., with or without the addition of pantothenate) in a suitable container, including, but not limited to, a cell culture plate, a microtiter plate, a flask, or fermenter. In addition, the methods can be performed at any fermentation scale known in the art to support industrial production of microbial products. Any suitable fermenter may be used, including a stirred fermenter, an airlift fermenter, a bubble fermenter, or any combination thereof. In specific embodiments using Saccharomyces cerevisiae as the host cell, the strains can be grown in a fermenter as detailed by Kosaric et al. in Ullmann's Encyclopedia of Industrial Chemistry, Sixth Edition, Volume 12, Pages 398-473 Wiley-VCH Verlag GmbH & Co. KDaA, Weinheim, Germany.

[00149] In some embodiments, the culture medium is any culture medium in which a genetically modified microorganism capable of producing steviol glycoside, i. support growth and vitality. In some embodiments, the culture medium is an aqueous medium containing sources of assimilable carbon, nitrogen, and phosphate. Such an environment may also include appropriate salts, minerals, metals, and other nutrients. In some embodiments, the carbon source and each of the essential cell nutrients are added to the fermentation medium gradually or continuously, and each essential nutrient is maintained at substantially the minimum level necessary for efficient assimilation by growing cells, e.g., following a predetermined cell growth curve. based on the metabolic or respiratory function of the cells that convert the carbon source into biomass.

[00150] Suitable conditions and suitable media for culturing microorganisms are well known in the art. In some embodiments, a suitable environment is supplemented with one or more additional agents, such as, for example, an inducer (for example, when one or more nucleotide sequences encoding a gene product are under the control of an inducible promoter), a repressor (for example, when one or more nucleotide sequences coding for the gene product are under the control of a repressed promoter) or a selection agent (for example, an antibiotic for the selection of microorganisms containing genetic modifications).

[00151] In some embodiments, the carbon source is a monosaccharide (simple sugar), a disaccharide, a polysaccharide, a non-fermentable carbon source, or one or more combinations thereof. Non-limiting examples of suitable monosaccharides include glucose, galactose, mannose, fructose, xylose, ribose, and combinations thereof. Non-limiting examples of suitable disaccharides include sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof. Non-limiting examples of suitable polysaccharides include starch, glycogen, cellulose, chitin, and combinations thereof. Non-limiting examples of suitable non-fermentable carbon sources include acetate and glycerol.

[00152] The concentration of a carbon source, such as glucose, in the culture medium is sufficient to stimulate cell growth, but not so high as to inhibit the growth of the microorganisms used. Typically, cultivation is carried out with a carbon source, such as glucose, added in amounts that provide the desired level of growth and biomass. In other embodiments, the concentration of a carbon source, such as glucose, in the culture medium is greater than about 1 g/L, preferably greater than about 2 g/L, and more preferably greater than about 5 g/L. In addition, the concentration of a carbon source such as glucose in the culture medium is typically less than about 100 g/L, preferably less than about 50 g/L, and more preferably less than about 20 g/L. It should be noted that references to concentrations of culture components may refer to both initial and/or current concentrations of components. In some cases, it may be desirable to allow the growth medium to deplete from the carbon source during culture.

[00153] Assimilated nitrogen sources that can be used in a suitable culture medium include, but are not limited to, simple nitrogen sources, organic nitrogen sources, and complex nitrogen sources. Such nitrogen sources include anhydrous ammonia, ammonium salts, and substances of animal, vegetable and/or microbial origin. Suitable nitrogen sources include, but are not limited to, protein hydrolysates, microbial biomass hydrolysates, peptone, yeast extract, ammonium sulfate, urea, and amino acids. Typically, the concentration of nitrogen sources in the culture medium is greater than about 0.1 g/L, preferably greater than about 0.25 g/L, and more preferably greater than about 1.0 g/L. However, beyond certain concentrations, the addition of a nitrogen source to the culture medium does not promote microbial growth. As a result, the concentration of nitrogen sources in the culture medium is less than about 20 g/L, preferably less than about 10 g/L, and more preferably less than about 5 g/L. In addition, in some cases it may be desirable to allow the growth medium to be depleted from nitrogen sources during cultivation.

[00154] An effective nutrient medium may contain other compounds such as inorganic salts, vitamins, trace metals, or growth promoters. Such other compounds may also be present in the carbon, nitrogen, or mineral sources in the effective medium, or may be added specifically to the medium.

[00155] The nutrient medium may also contain a suitable source of phosphate. Such phosphate sources include both inorganic and organic phosphate sources. Preferred phosphate sources include, but are not limited to, phosphate salts such as mono- or dibasic sodium and potassium phosphates, ammonium phosphate, and mixtures thereof. Typically, the phosphate concentration in the culture medium is greater than about 1.0 g/L, preferably greater than about 2.0 g/L, and more preferably greater than about 5.0 g/L. However, above certain concentrations, the addition of phosphate to the culture medium does not promote the growth of microorganisms. Accordingly, the phosphate concentration in the culture medium is typically less than about 20 g/L, preferably less than about 15 g/L, and more preferably less than about 10 g/L.

[00156] A suitable culture medium may also include a magnesium source, preferably in the form of a physiologically acceptable salt such as magnesium sulfate heptahydrate, although other magnesium sources can be used at concentrations that contribute similar amounts of magnesium. Typically, the concentration of magnesium in the culture medium is greater than about 0.5 g/L, preferably greater than about 1.0 g/L, and more preferably greater than about 2.0 g/L. However, when certain concentrations are exceeded, the addition of magnesium to the culture medium does not promote the growth of microorganisms. Accordingly, the concentration of magnesium in the culture medium is typically less than about 10 g/L, preferably less than about 5 g/L, and more preferably less than about 3 g/L. In addition, in some cases it may be desirable to allow the culture medium to be depleted from the magnesium source during culture.

[00157] In some embodiments, the culture medium may also include a biologically acceptable chelating agent, such as trisodium citrate dihydrate. In such a case, the concentration of the chelating agent in the culture medium is greater than about 0.2 g/L, preferably greater than about 0.5 g/L, and more preferably greater than about 1 g/L. However, when certain concentrations are exceeded, the addition of a chelating agent to the culture medium does not promote the growth of microorganisms. Accordingly, the concentration of the chelating agent in the culture medium is typically less than about 10 g/L, preferably less than about 5 g/L, and more preferably less than about 2 g/L.

[00158] The culture medium may also initially include a biologically acceptable acid or base to maintain the desired pH of the culture medium. Biologically acceptable acids include, but are not limited to, hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, and mixtures thereof. Biologically acceptable bases include, but are not limited to, ammonium hydroxide, sodium hydroxide, potassium hydroxide, and mixtures thereof. In some embodiments, the base used is ammonium hydroxide.

[00159] The culture medium may also include a biologically acceptable source of calcium, including but not limited to calcium chloride. Typically, the concentration of a calcium source, such as calcium chloride, calcium dihydrate, in the culture medium is in the range of about 5 mg/l to about 2000 mg/l, preferably in the range of about 20 mg/l to about 1000 mg/l, and more preferably in range from about 50 mg/l to about 500 mg/l.

[00160] The nutrient medium may also include sodium chloride. Typically, the concentration of sodium chloride in the culture medium is in the range of about 0.1 g/l to about 5 g/l, preferably in the range of about 1 g/l to about 4 g/l, and more preferably in the range of about 2 g/l /l to about 4 g/l.

[00161] In some embodiments, the implementation of the culture medium may also include trace amounts of metals. Such trace amounts of metals may be added to the culture medium as a stock solution, which for convenience may be prepared separately from the rest of the culture medium. Typically, the amount of such metal trace element solution added to the culture medium is greater than about 1 ml/l, preferably greater than about 5 ml/l, and more preferably greater than about 10 ml/l. However, when certain concentrations are exceeded, the addition of trace metals to the culture medium does not promote the growth of microorganisms. Accordingly, the amount of such a trace metal solution added to the culture medium is typically less than about 100 ml/l, preferably less than about 50 ml/l, and more preferably less than about 30 ml/l. It should be noted that, in addition to adding trace metals to the main solution, the individual components can be added separately, each within ranges, regardless of the amount of components dictated by the above ranges of the trace metal solution.

[00162] The culture medium may include other vitamins such as pantothenate, biotin, calcium, pantothenate, inositol, pyridoxine-HCl, and thiamine-HCl. Such vitamins can be added to the culture medium as a stock solution, which for convenience can be prepared separately from the rest of the culture medium. However, when certain concentrations are exceeded, the addition of vitamins to the culture medium does not promote the growth of microorganisms.

[00163] The fermentation methods described herein can be performed under conventional culture modes, which include, but are not limited to, batch, fed-batch, cell recycling, continuous, and semi-continuous. In some embodiments, the fermentation is carried out in a fed-batch mode. In this case, some components of the medium are depleted during cultivation, including pantothenate during the production stage of fermentation. In some embodiments, relatively high concentrations of such components may be added to the culture at the start of, for example, the production step so that growth and/or production of steviol glycosides is maintained for a period of time before additions are required. The preferred ranges of these components are maintained throughout the culture by adding supplements as levels become depleted in the culture. The levels of the components in the culture medium can be monitored, for example, by periodically sampling the culture medium and analyzing the concentrations. Alternatively, once a standard culture procedure has been developed, additions can be made at specific time intervals corresponding to known levels at specific times in culture. As will be appreciated by those skilled in the art, the rate of nutrient uptake increases during culture as cell density in the medium increases. Moreover, in order to avoid the entry of foreign microorganisms into the culture medium, the addition is carried out using aseptic addition methods known in the art. In addition, a small amount of defoamer can be added during cultivation.

[00164] The temperature of the culture medium can be any temperature suitable for the growth of genetically modified cells and/or the production of steviol glycoside. For example, prior to inoculation of the culture medium with the inoculum, the culture medium may be brought to a temperature in the range of about 20°C to about 45°C, preferably to a temperature in the range of about 25°C to about 40°C, and more preferably in the range of about 28°C to about 32°C.

[00165] The pH of the culture medium can be controlled by adding an acid or base to the culture medium. In such cases, when ammonia is used to adjust the pH, it also conveniently serves as a source of nitrogen in the culture medium. Preferably, the pH is maintained from about 3.0 to about 8.0, more preferably from about 3.5 to about 7.0, and most preferably from about 4.0 to about 6.5.

[00166] In some embodiments, the concentration of a carbon source, such as the concentration of glucose in the culture medium, is monitored during culture. The glucose concentration in the culture medium can be monitored using known methods, such as, for example, using the glucose oxidase enzyme test or high pressure liquid chromatography, which can be used to monitor the glucose concentration in the supernatant, for example, in the cell-free component of the culture medium. The concentration of the carbon source is usually maintained below the level at which inhibition of cell growth occurs. Although this concentration may vary from organism to organism, for glucose as a carbon source, inhibition of cell growth occurs at glucose concentrations greater than about 60 g/l and can be easily determined by testing. Accordingly, when glucose is used as a carbon source, the glucose is preferably fed to the fermenter and maintained below detection limits. Alternatively, the glucose concentration in the culture medium is maintained in the range of about 1 g/L to about 100 g/L, more preferably in the range of about 2 g/L to about 50 g/L, and most preferably in the range of about 5 g/l up to about 20 g/l. Although the concentration of the carbon source can be maintained at desired levels by adding, for example, a substantially pure glucose solution, it is acceptable and may be preferable to maintain the concentration of the carbon source in the culture medium by adding aliquots of the original nutrient medium. The use of aliquots of the original culture medium may be desirable since the concentrations of other nutrients in the medium (eg nitrogen and phosphate sources) can be maintained simultaneously. Similarly, trace metal concentrations can be maintained in the culture medium by adding aliquots of the trace metal solution.

[00167] Other suitable fermentation media and methods are described, for example, in WO 2016/196321.

6.8 Fermentation compositions

[00168] In another aspect, provided herein are fermentation formulations comprising the genetically modified host cell described herein and steviol glycosides derived from the genetically modified host cell. The fermentation compositions may additionally contain a medium. In some embodiments, the fermentation compositions contain a genetically modified host cell and further comprise Reb A, Reb D, and Reb M. In certain embodiments, the fermentation compositions provided herein contain Reb M as the main component of steviol glycosides derived from modified host cell. In some embodiments, the fermentation compositions contain Reb A, Reb D, and Reb M in a ratio of at least 1:7:50. In some embodiments, the fermentation formulations contain Reb A, Reb D, and Reb M in a ratio of at least 1:7:50 to 1:100:1000. In some embodiments, the fermentation compositions contain a ratio of at least 1:7:50 to 1:200:2000. In some embodiments, the ratio of Reb A, Reb D, and Reb M is based on the total content of steviol glycosides associated with the genetically modified host cell and environment. In some embodiments, the ratio of Reb A, Reb D, and Reb M is based on the total content of steviol glycosides in the medium. In some embodiments, the ratio of Reb A, Reb D, and Reb M is based on the total content of steviol glycosides associated with the genetically modified host cell.

[00169] In some embodiments, the fermentation compositions provided herein contain Reb M2 at an undetectable level. In some embodiments, the fermentation formulations provided herein contain non-natural steviol glycosides at an undetectable level.

6.9 Recovery of steviol glycosides

[00170] Once the steviol glycoside is produced by the host cell, it can be isolated or isolated for later use using any suitable separation and purification methods known in the art. In some embodiments, the clarified aqueous phase containing the steviol glycoside is separated from the fermentation by centrifugation. In other embodiments, the clarified aqueous phase containing the steviol glycoside is separated from the fermentation by adding a demulsifier to the fermentation reaction. Illustrative examples of demulsifiers include flocculants and coagulants.

[00171] The steviol glycoside produced in these cells may be present in the culture supernatant and/or associated with the host cells. In embodiments where a portion of the steviol glycosides is bound to the host cell, isolating the steviol glycosides may include a method of improving the release of the steviol glycosides from the cells. In some embodiments, this may take the form of hot water washing or buffering of the cells, with or without a surfactant, and with or without the addition of buffers or salts. In some embodiments, the temperature is any temperature deemed appropriate for the release of steviol glycosides. In some embodiments, the implementation of the temperature is in the range from 40 to 95°C; or from 60 to 90°C; or from 75 to 85°C. In some embodiments, the temperature is 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, or 95°C. In some embodiments of the invention, physical or chemical disruption of the cell is used to increase the release of steviol glycosides from the host cell. Alternatively and/or subsequently, the steviol glycoside in the culture medium can be recovered using isolation unit operations including but not limited to solvent extraction, membrane purification, membrane concentration, adsorption, chromatography, evaporation, chemical derivatization, crystallization, and drying.

6.10 Methods for creating genetically modified cells

[00172] Also provided herein are methods for obtaining a host cell that has been genetically engineered and contains one or more of the modifications described above, for example, one or more nucleic heterologous nucleic acids encoding Stevia rebaudiana kaurenoic acid hydroxylase, and/ or enzymes of the biosynthetic pathway, for example, for the connection of steviol glycosides. Expression of a heterologous enzyme in a host cell can be achieved by introducing into the host cells a nucleic acid containing a nucleotide sequence encoding the enzyme under the control of regulatory elements that allow expression in the host cell. In some embodiments, the nucleic acid is an extrachromosomal plasmid. In other embodiments, the implementation of the nucleic acid is a vector of chromosomal integration, which can integrate the nucleotide sequence into the chromosome of the host cell. In other embodiments, the nucleic acid is a linear piece of double-stranded DNA that can integrate, via homology, a nucleotide sequence into the chromosome of a host cell.

[00173] Nucleic acids encoding these proteins can be introduced into the host cell by any method known to the person skilled in the art, without limitation (see, for example, Hinnen et al. (1978) Proc. National Academy of Sciences USA 75:1292 -3 Cregg et al (1985) Mol Cell Biol 5:3376-3385 Goeddel et al eds, 1990, Methods in Enzymology Vol.185, Academic Press, Inc., CA ; Krieger, 1990, Gene Transfer and Expression ~ A Laboratory Manual, Stockton Press, NY; Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory, NY; and Ausubel et at, eds., Current Edition, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY). Examples of techniques include, but are not limited to, spheroplasting, electroporation, PEG 1000 mediated transformation, and lithium acetate or lithium chloride mediated transformation.

[00174] The amount of the enzyme in the host cell can be changed by changing the transcription of the gene encoding the enzyme. This can be achieved, for example, by changing the copy number of the nucleotide sequence encoding the enzyme (for example, by using an expression vector with more or less copies of the nucleotide sequence, or by introducing additional copies of the nucleotide sequence into the genome of the host cell, or by removing or disruption of the nucleotide sequence in the genome of the host cell), by changing the order of the coding sequences in the polycistronic mRNA of the operon, or splitting the operon into separate genes, each with its own control elements, or by increasing the strength of the promoter or operator to which the nucleotide sequence is operably linked . Alternatively or in addition, the number of copies of the enzyme in the host cell can be changed by changing the level of translation of the mRNA encoding the enzyme. This can be achieved, for example, by changing the stability of the mRNA, changing the sequence of the ribosome binding site, changing the distance or sequence between the ribosome binding site and the start codon of the coding sequence of the enzyme, changing the entire intercistronic region located "above" or near the 5'-side of the start codon of the coding region of the enzyme, stabilizing the 3'-end of the mRNA transcript using hairpins and specialized sequences, changing the use of codons of the enzyme, changing the expression used tRNA rare codons in the biosynthesis of the enzyme and/or increasing the stability of the enzyme, for example, by mutating its coding sequence.

[00175] The activity of the enzyme in the host cell can be altered in various ways, including, in particular, the expression of a modified form of the enzyme having increased or decreased solubility in the host cell, the expression of an altered form of the enzyme in which there is no domain through which the activity of the enzyme is inhibited , the expression of an altered form of an enzyme that has a higher or lower Kcat or a lower or higher Km for the substrate, or the expression of an altered form of an enzyme that is more or less up- or down-regulated by another molecule in the pathway.

[00176] In some embodiments, the nucleic acid used to genetically modify the host cell contains one or more selectable markers useful for selecting transformed host cells and for applying selective pressure on the host cell to retain foreign DNA.

[00177] In some embodiments, the selectable marker is an antibiotic resistance marker. Illustrative examples of antibiotic resistance markers include, but are not limited to, BLA, NAT], PAT, AUR1-C, PDR4, SMR1, CAT, mouse dhfr, HPH, DSDA, KAN ^R , and SH BLE gene products. The BLA gene product from E. coli confers resistance to beta-lactam antibiotics (eg, narrow-spectrum cephalosporins, cephamycins and carbapenems (ertapenem), cefamandole and cefoperazone) and to all antigram-negative bacterial penicillins except temocillin; the NAT1 gene product from S. noursei confers resistance to norseothricin; the PAT gene product from S. viridochromogenes Ti94 confers resistance to bialophos; the AURI-C gene product from Saccharomyces cerevisiae confers resistance to Auerobasidin A (ALA); the PDR4 gene product confers resistance to cerulenin; the SMR1 gene product confers resistance to sulfometuronmethyl; the CAT gene product from the Tn9 transposon confers resistance to chloramphenicol; the mouse dhfr gene product confers resistance to methotrexate; the HPH gene product of Klebsiella pneumonia confers resistance to hygromycin B; the E. coli tqu&DSDA product allows cells to grow on plates with D-serine as the sole source of nitrogen; the KAN ^R gene of the Tp903 transposon confers resistance to G418; and the SHBLE gene product from Streptoalloteichus hindustanus confers resistance to zeocin (bleomycin). In some embodiments, the antibiotic resistance marker is removed after the genetically modified host cell described herein is isolated.

[00178] In some embodiments, the implementation of the selectable marker eliminates auxotrophy (eg, nutritional auxotrophy) in a genetically modified microorganism. In such embodiments, the parent microorganism includes a functional disorder in one or more gene products that function in the amino acid or nucleotide biosynthetic pathway, and where the non-functionality renders the parent cell unable to grow in the medium without the addition of one or more nutrients. Such gene products include, but are not limited to, the HIS3, LEU2, LYS1, LYS2, MET 15, TRP1, ADE2, and URA3 gene products in yeast. The auxotrophic phenotype can then be rescued by transforming the parent cell with an expression vector or chromosome integration construct encoding a functional copy of the disrupted gene product, and the genetically modified host cell generated can be selected based on the loss of the auxotrophic phenotype of the parent cell. The use of the URA3, TRP1, and LYS2 genes as selectable markers has a significant advantage, since both positive and negative selection is possible. Positive selection is carried out by auxotrophic complementation of URA3, TRP1 and LYS2 mutations, while negative selection is based on specific inhibitors, for example, 5-fluororotic acid (FOA), 5-fluoroanthranilic acid and aminoadipic acid (aAA), respectively, which prevent the growth of prototrophic strains but allow the growth of URA3, TRP1 and LYS2 mutants, respectively. In other embodiments, the selectable marker eliminates other non-lethal deficiencies or phenotypes that can be identified by a known selection method.

[00179] This document describes specific genes and proteins that can be used in the methods, compositions and organisms according to the present disclosure; however, it will be recognized that the absolute identity of such genes is not necessary. For example, changes can be made to a particular gene or polynucleotide comprising the sequence encoding the polypeptide or enzyme and screened for activity. Typically, such changes include conservative mutations and silent mutations. Such modified or mutated polynucleotides and polypeptides can be tested for functional enzyme expression using methods known in the art. [00180] Due to the inherent degeneracy of the genetic code, other polynucleotides that encode substantially the same or functionally equivalent polypeptides can also be used to clone and express the polynucleotides. encoding these enzymes.

[00181] As will be appreciated by those skilled in the art, it may be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is duplicated by 64 possible codons, but most organisms typically use a subset of these codons. The codons that are used most often in a species are called optimal codons, while those that are not used very often are classified as rare or rarely used codons. Codons can be swapped to reflect the host's preferred codon usage, in a process sometimes referred to as "codon optimization" or "species codon bias control". Codon optimization for other host cells can be easily determined using codon usage tables or can be performed using commercially available software such as CodonOp (www.idtdna.com/CodonOptfrom) from Integrated DNA Technologies.

[00182] Optimized coding sequences containing codons preferred for a particular prokaryotic or eukaryotic host (Murray et al., 1989, Nucl Acids Res. RNA transcripts with desirable properties, such as a longer half-life, compared to transcripts derived from a non-optimized sequence. Translation stop codons can also be changed to reflect host preferences. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. A typical stop codon for monocot plants is UGA, while insects and E. coli typically use UAA as the stop codon (Dalphin et at, 1996, Nucl Acids Res. 24: 216-8).

[00183] Those skilled in the art will appreciate that, due to the degenerate nature of the genetic code, many DNA molecules differing in their nucleotide sequences can be used to encode a given enzyme as described herein. The native DNA sequence encoding the biosynthetic enzymes described above is mentioned here merely to illustrate an embodiment of the present disclosure, and this disclosure includes DNA molecules of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes used in the methods of describing the invention. Similarly, a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of the desired activity. The description includes such polypeptides with amino acid sequences different from the specific proteins described here, provided that the modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. In addition, the amino acid sequences encoded by the DNA sequences shown herein are merely illustrative of embodiments of the present disclosure.

[00184] In addition, the description covers the homologues of enzymes applicable to the compositions and methods presented herein. In some embodiments, two proteins (or a region of proteins) are substantially homologous if the amino acid sequences contain at least about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical areas. To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for purposes of optimal comparison (e.g., gaps can be introduced in one or both of the first and second amino acid or nucleic sequences for optimal alignment, and non-homologous sequences can be ignored for comparison purposes). In one embodiment, the length of the reference sequence aligned for comparison purposes is at least 30%, typically at least 40%, more typically at least 50%, even more typically at least 60%, and even more typically at least 70%, 80%, 90%, 100% of the reference sequence length. The amino acid residues or nucleotides at the respective amino acid positions or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (in this case, "identity" of amino acids or nucleic acids is equivalent to "homology" of amino acids or nucleic acids). The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of spaces and the length of each space that must be entered to optimally align the two sequences.

[00185] When the term "homologous" is used in relation to proteins or peptides, it is believed that non-identical residue positions are often distinguished by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is replaced by another amino acid residue having a side chain (R group) with similar chemical properties (eg, charge or hydrophobicity). As a rule, conservative amino acid substitution does not significantly change the functional properties of the protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be increased to correct for the conservative nature of the substitution. Methods for making this adjustment are well known to those skilled in the art (see, for example, Pearson W.R., 1994, Methods inMol Biol 25: 365-89).

[00186] Each of the following six groups contains amino acids that are conservative substitutions for each other: 1) series (S), threonine (T); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), alanine (A), valine (V) and 6) phenylalanine (F), tyrosine (Y), tryptophan (W).

[00187] Polypeptide sequence homology, also referred to as percent sequence identity, is typically measured using sequence analysis software. A typical algorithm used to compare the sequence of a molecule against a database containing a large number of sequences from different organisms is the BLAST computer program. When searching a database containing sequences from a large number of different organisms, it is common to compare amino acid sequences.

[00188] In addition, any of the genes encoding the aforementioned enzymes (or any others mentioned here (or any of the regulatory elements that control or modulate their expression)) can be optimized by genetic/protein engineering methods such as directed evolution or rational mutagenesis, which are known to those skilled in the art. This action allows those skilled in the art to optimize the expression and activity of enzymes in yeast.

[00189] In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed to modulate this pathway. Various organisms can serve as sources of these enzymes, including but not limited to Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis and K. marxianus, Pichia spp., Hansenula spp. , including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. spp.stipitis, Torulasporapretoriensis, Issatchenkia orientalis, Schizosaccharomyces spp. or Ustilago spp. Anaerobic fungal gene sources include, but are not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Prokaryotic enzyme sources that may be used include, but are not limited to, Escherichia coli, Zymomonas mobilis, Staphylococcus aureus, Bacillus spp., Clostridium spp., Coryneb acterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp. and Salmonella spp.

[00190] Methods known to those skilled in the art may be suitable for identifying additional homologous genes and homologous enzymes. Typically, similar genes and/or similar enzymes can be identified by functional analysis and will have functional similarities. Methods known to those skilled in the art may be suitable for identifying similar genes and similar enzymes. For example, to identify homologous or similar UDP glycosyltransferases, CANs, or any genes, proteins, or enzymes of the biosynthetic pathway, methods may include, but are not limited to, gene cloning by PCR using primers based on the published sequence of the gene/enzyme of interest, or with using degenerate PCR using degenerate primers designed to amplify a conserved region within the gene of interest. In addition, one of skill in the art can use methods to identify homologous or similar genes, proteins, or enzymes with functional homology or similarity. Methods include testing a cell or cell culture for the catalytic activity of an enzyme using in vitro enzyme assays for said activity (for example, as described here or in Kiritani, K., Branched-Chain Amino Acids Methods Enzymology, 1970), then isolating an enzyme with said activity by purification, determining the protein sequence of the enzyme using methods such as Edman degradation, designing PCR primers for a putative nucleic acid sequence, amplifying said DNA sequence by PCR, and cloning said nucleic acid sequence. In order to identify homologous or similar genes and/or homologous or similar enzymes, analogous genes and/or analogous enzymes or proteins, the methods also include comparing the candidate gene or enzyme data with databases such as BRENDA, KEGG or MetaCYC. A candidate gene or enzyme can be identified in the aforementioned databases in accordance with the ideas set forth here.

7. EXAMPLES

Example 1 Yeast Transformation Methods

[00191] Each DNA construct was integrated into Saccharomyces cerevisiae (CEN.PK2) using standard molecular biology techniques for optimized transformation with lithium acetate. Briefly, cells were grown overnight in peptone dextrose (YPD) yeast extract medium at 30°C with shaking (200 rpm), diluted to OD600 0.1 in 100 ml YPD and grown to OD600 0.6-0 ,8. For each transformation, 5 ml of culture was collected by centrifugation, washed in 5 ml of sterile water, centrifuged again, resuspended in 1 ml of 100 mM lithium acetate and transferred to a microcentrifuge tube. The cells were centrifuged (13,000 g) for 30 seconds, the supernatant was removed and the cells were resuspended in a transformation mixture consisting of 240 µl 50% PEG, 36 µl 1 M lithium acetate, 10 µl boiled salmon sperm DNA and 74 µl donor DNA. The donor DNA included a plasmid carrying the F-CphI endonuclease gene expressed for expression under the yeast TDH3 promoter (see example 4). After heat shock at 42° C. for 40 minutes, cells were isolated overnight in YPD medium containing the appropriate antibiotic to select cells that had taken up the F-Cphl plasmid. After overnight recovery, cells were briefly centrifuged and plated on YPD medium containing the appropriate antibiotic to select cells that had taken up the F-Cphl plasmid. DNA integration was confirmed by colony PCR with integration-specific primers.

Example 2 Preparation of a Basic Yeast Strain Capable of High Hydraulic Permeability to Farnesyl Pyrophosphate (FPP) and Farnesene Isoprenoid

[00192] A farnesene-producing strain was generated from a wild-type strain of Saccharomyces cerevisiae (CEN.PK2) by expression of the mevalonate pathway genes under the control of the GAL1 or GAL10 promoters. This strain included the following chromosomally integrated genes of the mevalonate pathway from S. cerevisiae: acetyl-CoA thiolase HMG-CoA synthase, HMG-CoA reductase mevalonate kinase, phosphomevalonate kinase, mevalonate pyrophosphate decarboxylase, and IPP:DMAPP isomerase. In addition, the strain contained many copies of farnesene synthase from Artemisia annua, also under the control of the GAL1 or GAL10 promoters. All heterologous genes described here have been codon optimized using publicly available or other suitable algorithms. The strain also contained a deletion of the GAL80 gene, and the ERG9 gene encoding squalene synthase was downgraded by replacing the native promoter with the yeast MET3 gene promoter (Westfall et al. Proceedings of the National Academy of Sciences USA 109(3), 2012, pp. E111-E118 ). Examples of how to create S. cerevisiae strains with high hydraulic permeability to isoprenoids are described in US Pat. No. 8,415,136 and US Pat. No. 8,236,512, which are incorporated herein in their entirety.

Example 3 Preparation of a basic yeast strain capable of high hydraulic permeability to Reb M

[00193] FIG. 1 shows an example biosynthetic pathway from FPP to steviol. FIG. 2 shows an exemplary biosynthetic pathway from steviol to Reb M glycoside. To convert the farnesene-based strain described above into one that has high hydraulic permeability to C20 isoprenoid kaurene, four copies of geranylgeranyl pyrophosphate synthase (GGPPS) were integrated into the genome, for followed by two copies of copalyl diphosphate synthase and one copy of kaurene synthase. At this stage, all copies of farnesene synthase were removed from the strain. Once the new strain was confirmed to produce ent-kaurene, the remaining genes for converting ent-kaurene to Reb M were inserted into the genome. Table 1 lists all genes and promoters used to convert FPP to Reb M. Each gene was integrated as a single copy after kaurene synthase, with the exception of the Sr.KAH enzyme, for which two copies of the gene were integrated. A strain containing all of the genes described in Table 1 produced primarily Reb M.

Table 1. Genes, promoters and amino acid sequences of enzymes used to convert FPP to RebM

Enzyme name SEQ ID NO promoter Bt.GGPPS SEQ ID NO 9 PGAL1 ent-Os,CDPS SEQ ID NO 10 ¹ PGAL1 ent-Pg.Ks SEQ ID NO eleven PGAL1 PS.KO SEQ ID NO 12 PGAL1 Sr. K AN SEQ ID NO 13 PGAL1 At. With PR SEQ ID NO 14 PGAL3 UGT85C2 SEQ ID NO 15 PGAL10 UGT74G1 SEQ ID NO 16 PGAL1 UGT91D IkeZ SEQ ID NO 17 PGAL1 UGT76G1 SEQ ID NO 18 PGAL10 UGT40087 SEQ ID NO 19 PGAL1

First 65 amino acids removed and replaced with methionine

Example 4 Creation of a Strain for Steviol Glycoside Transporter Screening.

[00194] For rapid in vivo screening of steviol glycoside transporters in a strain producing Reb M, a landing pad was inserted into the strain described above. The landing site consisted of 500 bp. locus-targeted DNA sequences at both ends of the construct in the genomic region below the SFM1 open reading frame (see Fig. 3). Inside, the landing site contained the GAL1 promoter and a yeast terminator flanking the endonuclease recognition site (F-Cphl).

Example 5 Yeast Culture Conditions

[00195] Yeast colonies overexpressing the carrier protein were collected in 96-well microtiter plates containing Bird Seed Media (BSM, originally described by van Hoek et al., Biotechnology and Bioengineering (Biotechnology and Bioengineering) 68 (5), 2000, pp. 517-523) with 20 µg/l sucrose, 3.75 g/l ammonium sulfate and 1 g/l lysine. Cells were cultured at 28° C. in a high capacity microtiter plate incubator, shaking at 1000 rpm and 80% humidity for 3 days until the cultures reached carbon depletion. Cultures saturated for growth were subcultured into fresh plates containing BSM with 40 g/l sucrose and 3.75 g/l ammonium sulfate, taking 14.4 μl from saturated cultures and diluting 360 μl with fresh medium. Cells in production medium were cultured at 30° C. in a high performance microtiter plate shaker at 1000 rpm and 80% humidity for an additional 3 days before extraction and analysis.

Example 6 Conditions for preparing a whole cell broth sample for the analysis of steviol glycosides

[00196] To analyze the amount of all steviol glycosides produced in the culture, at the end of the culture, the whole cell broth was diluted with 628 μl of 100% ethanol, sealed with foil, and shaken at 1250 rpm for 30 seconds to extract the steviol glycosides. 314 µl of water was added directly to each well to dilute the extract. The tablet was quickly centrifuged to obtain a precipitate. An internal standard, 208 µl ethanol:water 50:50 containing 0.48 mg/l rebaudioside N, was transferred to a new 250 µl assay plate and 2 µl culture/ethanol mixture was added to the assay plate. Before analysis, the plate was covered with foil.

Example 7 Conditions for Preparation of Culture Supernatant Sample for Analysis of Steviol Glycosides

[00197] To analyze the amount of all steviol glycosides produced and excreted into the culture medium, after completion of the culture, the whole cell broth was centrifuged for 5 minutes at 2000 xg to pellet the cells. A 240 μl aliquot of the resulting supernatant was transferred to an empty 96-well microtiter plate. Supernatant samples were diluted with 480 μl of 100% ethanol, sealed with foil and shaken at 1250 rpm for 30 seconds to extract the steviol glycosides. To dilute the extract, 240 µl of water was added to each well. The plate was quickly centrifuged to precipitate any particulate matter. An internal standard, 208 μl of 50:50 ethanol:water containing 0.48 mg/l rebaudioside N, was transferred to a new 250 μl assay plate and 2 μl of culture/ethanol mixture was added to the assay plate. Before analysis, the plate was covered with foil.

Example 8: Analytical Methods

[00198] Samples for measuring steviol glycosides were analyzed using a mass spectrometer (Agilent 6470-QQQ) with a RapidFire 365 autosampler with a C8 cartridge using the configurations shown in Tables 2 and 3.

Table 2. RapidFire 365 System Configuration

Pump 1, line A 2 mM ammonium formate in water 100% A, 1.5 ml/min Pump 2, line A 35% acetonitrile in water 100% A, 1.5 ml/min Pump 3, line A 80% acetonitrile in water. 100% A, 0.8 ml/min Condition 1: aspiration 600ms State 2: loading / flushing 3000 ms Condition 3: additional flush 1500 ms State 4: elution 5000 ms State 5: rebalancing 1000ms

Table 3. Method 6470-QQQ MS Configurations

ion source AJS ESI Time Filter Peak Width 0.02 min End time Unlimited/as a pump Scan Type MRM (selective registration of selected decay reactions of several ions) changeover valve KMC Delta HIM (+)0/(-)300 Ionic mode (polarity) Negative Gas temperature 250°С Gas flow 11 l/min Spray 30 psi Shielding gas temperature 350°C Shielding gas flow 11 l/min Negative capillary, V 2500 V

[00199] Peak areas from the mass spectrometer chromatogram were used to construct a calibration curve. The molar ratios of the respective compounds were determined by quantifying the mole amount of each compound by external calibration using an authentic standard and then selecting the appropriate ratios.

Example 9 Screening for transporters capable of increasing titers of steviol glycosides in vivo

[00200] In a Reb M producing strain without expression of additional transporters, approximately 80% of the higher molecular weight steviol glycosides Reb D and Reb M were biomass bound (see FIG. 4). This biomass association is likely due to the fact that Reb D and Reb M are not efficiently transported out of the cell and retained in the cytoplasm. Accumulation of Reb D and Reb M can lead to product inhibition, which will reduce the carbon flux through the steviol glycoside metabolic pathway. Therefore, the expression of one or more transporters that will transport steviol glycosides (especially Reb D and Reb M) from the cytoplasm to the medium (supernatant) is expected to attenuate product inhibition and thus increase carbon flux through this pathway, leading to increase in titers of steviol glycosides. In order to identify transporters capable of exporting higher molecular weight steviol glycosides from the cell and thus reversing product inhibition, we tested a number of transporters identified from various fungi for the ability to increase total titers of steviol glycosides, especially the titer of higher molecular weight glycosides. (i.e. Reb D and Reb M).

[00201] All proteins annotated as carriers from the S. cerevisiae genome. amplified by PCR using CEN.PK2 as a source of genomic DNA. Each PCR primer was 40 bp. flanking homology to PGAL1 and landing site yeast terminator DNA sequences (see FIG. 3) added to the ends to facilitate homologous recombination of the amplified gene into the landing site. In addition to screening for all endogenous S. cerevisiae transport proteins found in CEN.PK2, an extensive bioinformatic search for ABC transport proteins from a small number of fungi and additional S. cerevisiae strains was performed.

[00202] To create a library of fungal ABC transporters, we first obtained the amino acid sequences from Kovalchuk and Driessen's Phylogenetic Analysis of Fungal ABC Transporters (Kovalchuk and Driessen, BMC Genomics, 11, 2010, pp. 177-197) to Phylogenetic Analysis ABC-transporters were carried out for 27 species of mushrooms. A total of 610 amino acid sequences were selected from this literature, which included all transporters designated as belonging to the ABC-C, ABC-D and ABC-G subfamilies. We then developed our own BLAST databases for the following fungi: (1) Hansenula polymorpha DL-1 (NRRL-Y-7560), (2) Yarrowia lipolytica ATCC 18945, (3) Arxula adeninivorans ATCC 76597, (4)5'. cerevisiae CAT-1, (5) Lipomyces starkeyi ATCC 58690, (6) Kluyveromyces marxianus, (7) Kluyveromyces marxianus DMKU3-1042, (8) Komagataella phaffii NRRL Y-11430, (9) S. cerevisiae MBG3370, (10) S cerevisiae MBG3373, (11) Kluyveromyces lactis ATCC 8585, (12) Candida utilis ATCC 22023, (13) Pichia pastoris ATCC 28485, and (14) Aspergillus oryzae NRRL5590.

[00203] For organisms that we already had our own ORF nucleotide sequences from de novo genome sequencing, assembly and annotation efforts, we applied tBLASTn with Biopython. The tBLASTn algorithm allowed rapid alignment of protein sequences (in this case, 610 seed sequences from Kovalchuk and Driessen (BMC Genomics, 11, 2010, pp. 177-197)) with translated DNA ORF nucleotide sequences for each organism in all six possible reading frames using BLAST. The tBLASTn parameters were standard with evalue=1 e" ²⁵ (see Table 4). All calculations were performed via the biopython API (version 1.70 downloaded from PyPI) using Python 2.7.12 and Ubuntu 16.04.5 LTS (GNU/Linux 4.4.0-138-generic x86_64) Matches were subsequently filtered to ensure a global alignment of at least 2000 nucleotides All matches that met these criteria were advanced to the next step in the workflow.

Table 4. tBLASTn Default Parameters

tBLASTn option (version 2.2.31 BLAST+) Setting used word size 3 gapopen eleven gap extend 1 matrix BLOSUM62 threshold 13 seg 12 2.2 2.5 soft masking FALSE lease masking Η/Π db mask Absent db mask Absent xdrop gap final 25 window size 40 db gene code 1 max intron length 0 comp based stats 2

[00204] For the rest of the organisms that did not have their own genomic sequence, the entire proteome of the organism was obtained from Uniprot using the Uniprot API to create a database for BLASTp searches. In most cases, Uniprot had an exact entry for the species for which we have had their own genomic DNA, but in other cases there was a close but not exact match with their own fungal strains. In the latter cases, we relied on a high probability that the gene sequences would be sufficiently similar that the primers designed to compare Uniprot would still amplify internal genomic DNA. We then applied BLASTp with Biopython to a database derived from Uniprot. BLAST parameters were standard, score=0.001 (see Table 5). Subsequent filtering was performed based on percent identity cutoff >40% and percent alignment length cutoff >60%. All calculations were performed via the biopython API (version 1.70 downloaded from PyPI) using Python 2.7.12 and Ubuntu 16.04.5 LTS (GNU/Linux 4.4.0-138-generic x86 64). Matches must match at least one of the 610 source sequences from the link. The matches were then converted to a nucleotide sequence using the Uniprot ID to EMBL ID matching service. The European Molecular Biology Laboratory allows the extraction of nucleotide sequences from the Uniprot record. We have used any cases that meet these criteria in the next step of the workflow.

Table 5. BLASTp default parameters

BLASTp option (version 2.2.31 BLAST+) Setting used word size 3 word size 2 word size 6 gapopen eleven gapextend 1 gapopen 9 gapextend 1 matrix BLOSUM62 matrix PAM30 threshold eleven threshold 16 Threshold 21 comp based stats 2 comp based stats 0 seg No soft masking FALSE lease masking N/A db mask Absent db mask Absent xdrop gap final 25 window size 40 window size 15 use swtback Η/Π

[00205] After all nucleotide sequences were identified, primers were designed to amplify each complete ORF by PCR. Each PCR primer was 40 bp. flanking homology to PGAL1 and yeast terminator DNA sequences in the landing site (FIG. 3) added to the ends to facilitate homologous recombination of the amplified gene into the landing site. Each transporter gene was individually transformed as a single copy into the Reb M producing yeast strain described above and screened for the ability to increase product titers when overexpressed in vivo.

Example 11 Overexpression of Transporters Leading to Increased Production of Steviol Glycosides in Vivo

[00206] An in vivo transporter screening of S. cerevisiae revealed eight transporters that statistically increased total steviol glycoside (TSG) production when overexpressed compared to the Reb M parent strain, which did not contain the overexpressed transporter (see Figure 5). TSG was calculated as the sum in micromoles of all steviol glycosides produced by the cell (as measured by extraction from whole cell broth). All identified transporters fall into the class of transporters known as ABC transporters. Overexpression of these transporters increased TSG from 20% to twofold compared to the parent. The increase in TSG due to transporter overexpression may be due to increased transport of all steviol glycosides or only a subset of steviol glycosides. Therefore, the data were also analyzed to determine the effect of transporter overexpression on only the higher molecular weight steviol glycosides Reb D and Reb M. Of the eight transporters that increased TSG, seven of them also increased the total production of Reb D and Reb M, as shown in FIG. .6. The increase in Reb D and Reb M with transporter overexpression ranged from 30% to a two-fold increase.

Example 12 Extracellular and Intracellular Transport of Steviol Glycosides

[00207] Seven of the eight strains of Reb M carrying overexpressed transporters resulting in an increase in total steviol glycosides in total cell broth also increased total steviol glycosides in the supernatant (FIG. 7). While the four transporters almost doubled the total amount of steviol glycosides in the whole cell broth (FIG. 5), the typical increase in TSG in the supernatant was less, ranging from 35 to 70% (FIG. 7). However, the T4 transporter Fungal 5 increased TSG in the supernatant by about five times (FIG. 7). The data presented in FIG. 5 and 7 demonstrate that strains with some overexpressed transporters produce more in terms of TSG, but the increase in TSG is not always reflected by a linear increase in TSG in the supernatant.

[00208] A detailed analysis of the proportion of total produced steviol glycosides found in the supernatant (FIG. 8) shows that most of the transporters (six out of eight) showed a lower proportion of TSG in the supernatant compared to the parent. This suggests that the transporters removed steviol glycosides from the cytosol, thereby removing the inhibition of the product and providing more product formation, but they did not transfer steviol glycosides to the medium. Instead, these transporters most likely transport the steviol glycosides into the vacuole or some other cellular compartment. In contrast, the T4_Fungal_5 transporter resulted in nearly 100% of the TSG produced being in the supernatant (FIG. 8). This indicates that T4 Fungal 5 is probably a plasma membrane transporter that is able to remove steviol glycosides from the cell cytoplasm and transfer them from the cell to the environment. In addition, the data in FIG. 4 show that the T4_Fungal_5 transporter transports the higher molecular weight steviol glycosides Reb D and Reb M from the cell into the medium; indeed, almost 100% of both Reb D and Reb M were in the supernatant fraction.

[00209] One result of the transporter screening was the endogenous S. cerevisiae BPT1 ABC transporter. This protein has been annotated in the Saccharomyces genome database for vacuole localization. The T4 Fungal 2 and T4 Fungal 4 transporters have protein sequences that are 99% identical to BPT1 CEN.PK2 and originate from S. cerevisiae CAT-1 and MBG3373 strains, respectively; they are alleles of VPT1. All other transporters are 30-43% identical in sequence to the BPT1 protein and are novel ABC transporters that can transport steviol glycosides across membranes (see Table 6). Of the remaining non-BPT1 transporters that carry steviol glycosides, none of the protein sequences is more than 53% identical to any other protein, indicating that the remaining five proteins are unique sequences.

Table 6. Percent identity of all transporters that increase the titers of steviol glycosides

T4_ Fungal 8 T4_Fungall T4_ Fungal_3 T4_FungalS T4 FungalO CENPK BPT1 T4_ Fungal_2 T4_Fungal_4 T4_Fungal_8 100 47.56 52.95 30.27 31.50 30.50 30.57 30.64 T4_Fungal_l 100 53.12 30.05 31.29 30.41 30.34 30.41 T4_Fungal_3 100 31.53 33.43 32.36 32.43 32.50 T4_Fungal_5 100 31.74 31.05 30.89 30.89 T4_Fungal_10 100 43.47 43.40 43.40 CENPK BPT1 100 99.49 99.55 T4_Fungal_2 100 99.81 T4_Fungal_4 100

Example 13: Cellular Localization of BPT1 and T4_Fungal_5

[00210] To determine the cellular localization of overexpressed BPTI and T4 Fungal 5 proteins in Reb M producing strains, we created transporter-GFP fusion proteins. Each transporter protein (BPT1 or T4_Fungal_5) had a GFP protein fused to the C-terminus of the transporter; the GFP fusion proteins were expressed through the GAL1 promoter and contained the yeast terminator. The strains were constructed as described in Example 4, with the only difference being that a transporter-GFP fusion protein was used instead of a simple transporter protein. Cells with correctly integrated transporter-GFP constructs were confirmed by colony PCR, cultured as in Example 5, and confirmed to be equivalent in activity to strains containing the transporter without the GFP C-terminal tag (FIG. 9).

[00211] To visualize protein localization with GFP, cells were expanded as in Example 5 but harvested 2 days later in production environment for observation. Cells were washed twice with equal volumes of PBS (phosphate-buffered saline) and then resuspended to ODeoo 1.0 in PBS. Cells were fixed using 1% agarose pads mounted on a glass slide and visualized at 100x oil immersion using a standard fluorescent microscope at 488 nm excitation or bright field. Cells expressing BPT1 labeled at the C-terminus of GFB showed fluorescence patterns consistent with vacuole localization of the fusion protein (FIG. 10). This was an expected result, since it has been reported that BPT1 is usually localized in the yeast vacuole (Sharma et al., Eukaryot. Cell 1 (3), 2002, pp. 391-400). The C-terminally labeled T4 Fungal 5 protein showed a different localization of GFP, consistent with the localization of the protein on the plasma membrane (Fig. 11).

Example 14 Guided Evolution of the T4_Fungal_5 Protein Using Error-Prone PCR and Growth Selection

[00212] Transporter T4 Fungal 5 actively removes both Reb D and Reb M from the cytoplasm (see FIG. 4). Reb D is a direct substrate for Reb M (FIG. 2), thus removal of Reb D from the cytosol reduces the total amount of Reb M produced by yeast. Thus, T4 Fungal 5 was enzymatically evolved to increase both its overall activity and its specificity for Reb M. The T4_Fungal_5 DNA coding sequence (CDS) was mutated by error-prone PCR using the GeneMorph II random mutagenesis kit (Agilent Technologies, Inc.) and the resulting DNA library were transformed into a Reb M yeast strain similar to that used in the vector screening mentioned in Example 11, but having two additional copies of UGT76G1, both expressed under GAL1 promoters. Additional transformation using the wild-type T4_Fungal_5 transporter was performed as a control. Transformations were performed as described in Example 1. After overnight reconstitution, cultures were transferred to production medium supplemented with a selective antibiotic to continue growth. The OD6oo of the cultures was determined and serial dilutions of the cultures were made with fresh production medium containing the antibiotic to avoid carbon starvation. Culture samples were taken daily for both stock glycerol archives and plated to form single colonies on YPD agar plates containing the antibiotic. TSG and Reb M titers of 88 colonies from each daily sample were assessed and compared using the methods described in examples 6, 7 and 8. Based on these data, the point in time was identified when the highest percentage of colonies producing TSG equal to or greater than than the control strain (expressing T4 Fungal 5 wt). Additional colonies from this point in time were seeded from glycerol and 900 colonies were selected and screened. The screening identified eight isolates that increased Reb M titers by 26% to 47% and increased the Reb M/TSG ratio by 10% compared to controls (FIGS. 12 and 13). The data in FIG. 12 and 13 show that the mutations identified in the Fungal 5 T4 transporter increase both overall steviol glycoside activity and Reb M specificity.

[00213] Sanger sequencing of the T4_Fungal_5 gene showed that all eight isolates contained the same nucleic acid substitutions, resulting in four amino acid substitutions: V666A, Y942N, L956P and E1320V. This mutant allele was named "Fungal 5 muA". To test the causality of Fungal 5 muA with improved titer and specificity, a mutant allele was amplified from one of the isolates and reintroduced into the parent strain. The resulting strain replicated the phenotypes and demonstrated the use of Fungal_5_muA to improve the production and specificity of steviol glycosides. When T4 Fungal 5 and Fungal 5 muA were expressed under the weaker GAL3 promoter, the Fungal 5 muA strain produced 30% more Reb M in whole cell broth and 40% more extracellular Reb M than the wild type T4_Fungal_5 strain (Fig. 14) , which is consistent with earlier data.

Example 15: Further improvement of Fungal_5_muA

[00214] To further improve Fungal_5_muA by removing potentially deleterious mutations, we generated additional Fungal 5 T4 mutant variants with one, two, or three amino acid substitutions identified in Fungal S muA and introduced them into the yeast strain used to screen the Fungal 5 T4 mutagenesis library in Example 14. Although a single reversion of V666A to Fungal 5 muA had little effect on TSG or Reb M production, E1320V reversion was beneficial and the V666A Y942N L956P triple mutant produced 14% more TSG and 12% more Reb M than the Fungal strain. 5 muA (Fig. 15 and 16). However, further reversion of L956P in the triple mutant (V666A Y942N) resulted in a 10% decrease in Reb M and a 19% decrease in TSG production compared to the V666A Y942N L956P triple mutant. Compared to the Fungal_5_muA strain, a single Y942N mutant strain produced 21% more TSG but 10% less Reb M. These data demonstrate that the Y942N mutation improved the overall activity of T4 Fungal 5 in the export of steviol glycosides, but had a negative effect on its specificity for Reb M.

[00215] All publications, patents, and patent applications referred to in this specification are incorporated herein by reference, as if each individual publication, patent, or patent application were specifically and separately indicated as being incorporated by reference. Although the foregoing embodiments have been described in detail for purposes of illustration and example for clarity of understanding, it will be clear to a person skilled in the art in light of the disclosure of the present invention that certain changes and modifications may be made to the invention without departing from the spirit or scope of the appended claims.

--->

SEQUENCE LISTING

<110> AMYRIS, INC.

<120> ABC TRANSPORTERS FOR THE HIGH EFFICIENCY PRODUCTION OF

REBAUDIOSIDES

<130> 107345.00779

<140> PCT/US2020/014859

<141> 2020-01-23

<150> US 62/796,228

<151> 2019-01-24

<160> 30

<170>PatentIn version 3.5

<210> 1

<211> 1559

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: CEN.PK.BPT1 ABC-transporter

<400> 1

Met Ser Ser Leu Glu Val Val Asp Gly Cys Pro Tyr Gly Tyr Arg Pro

1 5 10 15

Tyr Pro Asp Ser Gly Thr Asn Ala Leu Asn Pro Cys Phe Ile Ser Val

20 25 30

Ile Ser Ala Trp Gln Ala Val Phe Phe Leu Leu Ile Gly Ser Tyr Gln

35 40 45

Leu Trp Lys Leu Tyr Lys Asn Asn Lys Val Pro Pro Arg Phe Lys Asn

50 55 60

Phe Pro Thr Leu Pro Ser Lys Ile Asn Ser Arg His Leu Thr His Leu

65 70 75 80

Thr Asn Val Cys Phe Gln Ser Thr Leu Ile Ile Cys Glu Leu Ala Leu

85 90 95

Val Ser Gln Ser Ser Asp Arg Val Tyr Pro Phe Ile Leu Lys Lys Ala

100 105 110

Leu Tyr Leu Asn Leu Leu Phe Asn Leu Gly Ile Ser Leu Pro Thr Gln

115 120 125

Tyr Leu Ala Tyr Phe Lys Ser Thr Phe Ser Met Gly Asn Gln Leu Phe

130 135 140

Tyr Tyr Met Phe Gln Ile Leu Leu Gln Leu Phe Leu Ile Leu Gln Arg

145 150 155 160

Tyr Tyr His Gly Ser Ser Asn Glu Arg Leu Thr Val Ile Ser Gly Gln

165 170 175

Thr Ala Met Ile Leu Glu Val Leu Leu Leu Phe Asn Ser Val Ala Ile

180 185 190

Phe Ile Tyr Asp Leu Cys Ile Phe Glu Pro Ile Asn Glu Leu Ser Glu

195 200 205

Tyr Tyr Lys Lys Asn Gly Trp Tyr Pro Pro Val His Val Leu Ser Tyr

210 215 220

Ile Thr Phe Ile Trp Met Asn Lys Leu Ile Val Glu Thr Tyr Arg Asn

225 230 235 240

Lys Lys Ile Lys Asp Pro Asn Gln Leu Pro Leu Pro Pro Val Asp Leu

245 250 255

Asn Ile Lys Ser Ile Ser Lys Glu Phe Lys Ala Asn Trp Glu Leu Glu

260 265 270

Lys Trp Leu Asn Arg Asn Ser Leu Trp Arg Ala Ile Trp Lys Ser Phe

275 280 285

Gly Arg Thr Ile Ser Val Ala Met Leu Tyr Glu Thr Thr Ser Asp Leu

290 295 300

Leu Ser Val Val Gln Pro Gln Phe Leu Arg Ile Phe Ile Asp Gly Leu

305 310 315 320

Asn Pro Glu Thr Ser Ser Lys Tyr Pro Pro Leu Asn Gly Val Phe Ile

325 330 335

Ala Leu Thr Leu Phe Val Ile Ser Val Val Ser Val Phe Leu Thr Asn

340 345 350

Gln Phe Tyr Ile Gly Ile Phe Glu Ala Gly Leu Gly Ile Arg Gly Ser

355 360 365

Leu Ala Ser Leu Val Tyr Gln Lys Ser Leu Arg Leu Thr Leu Ala Glu

370 375 380

Arg Asn Glu Lys Ser Thr Gly Asp Ile Leu Asn Leu Met Ser Val Asp

385 390 395 400

Val Leu Arg Ile Gln Arg Phe Phe Glu Asn Ala Gln Thr Ile Ile Gly

405 410 415

Ala Pro Ile Gln Ile Ile Val Val Leu Thr Ser Leu Tyr Trp Leu Leu

420 425 430

Gly Lys Ala Val Ile Gly Gly Leu Val Thr Met Ala Ile Met Met Pro

435 440 445

Ile Asn Ala Phe Leu Ser Arg Lys Val Lys Lys Leu Ser Lys Thr Gln

450 455 460

Met Lys Tyr Lys Asp Met Arg Ile Lys Thr Ile Thr Glu Leu Leu Asn

465 470 475 480

Ala Ile Lys Ser Ile Lys Leu Tyr Ala Trp Glu Glu Pro Met Met Ala

485 490 495

Arg Leu Asn His Val Arg Asn Asp Met Glu Leu Lys Asn Phe Arg Lys

500 505 510

Ile Gly Ile Val Ser Asn Leu Ile Tyr Phe Ala Trp Asn Cys Val Pro

515 520 525

Leu Met Val Thr Cys Ser Thr Phe Gly Leu Phe Ser Leu Phe Ser Asp

530 535 540

Ser Pro Leu Ser Pro Ala Ile Val Phe Pro Ser Leu Ser Leu Phe Asn

545 550 555 560

Ile Leu Asn Ser Ala Ile Tyr Ser Val Pro Ser Met Ile Asn Thr Ile

565 570 575

Ile Glu Thr Ser Val Ser Met Glu Arg Leu Lys Ser Phe Leu Leu Ser

580 585 590

Asp Glu Ile Asp Asp Ser Phe Ile Glu Arg Ile Asp Pro Ser Ala Asp

595 600 605

Glu Arg Ala Leu Pro Ala Ile Glu Met Asn Asn Ile Thr Phe Leu Trp

610 615 620

Lys Ser Lys Glu Val Leu Thr Ser Ser Gln Ser Gly Asp Asn Leu Arg

625 630 635 640

Thr Asp Glu Glu Ser Ile Ile Gly Ser Ser Gln Ile Ala Leu Lys Asn

645 650 655

Ile Asp His Phe Glu Ala Lys Arg Gly Asp Leu Val Cys Val Val Gly

660 665 670

Arg Val Gly Ala Gly Lys Ser Thr Phe Leu Lys Ala Ile Leu Gly Gln

675 680 685

Leu Pro Cys Met Ser Gly Ser Arg Asp Ser Ile Pro Pro Lys Leu Ile

690 695 700

Ile Arg Ser Ser Ser Val Ala Tyr Cys Ser Gln Glu Ser Trp Ile Met

705 710 715 720

Asn Ala Ser Val Arg Glu Asn Ile Leu Phe Gly His Lys Phe Asp Gln

725 730 735

Asp Tyr Tyr Asp Leu Thr Ile Lys Ala Cys Gln Leu Leu Pro Asp Leu

740 745 750

Lys Ile Leu Pro Asp Gly Asp Glu Thr Leu Val Gly Glu Lys Gly Ile

755 760 765

Ser Leu Ser Gly Gly Gln Lys Ala Arg Leu Ser Leu Ala Arg Ala Val

770 775 780

Tyr Ser Arg Ala Asp Ile Tyr Leu Leu Asp Asp Ile Leu Ser Ala Val

785 790 795 800

Asp Ala Glu Val Ser Lys Asn Ile Ile Glu Tyr Val Leu Ile Gly Lys

805 810 815

Thr Ala Leu Leu Lys Asn Lys Thr Ile Ile Leu Thr Thr Asn Thr Val

820 825 830

Ser Ile Leu Lys His Ser Gln Met Ile Tyr Ala Leu Glu Asn Gly Glu

835 840 845

Ile Val Glu Gln Gly Asn Tyr Glu Asp Val Met Asn Arg Lys Asn Asn

850 855 860

Thr Ser Lys Leu Lys Lys Leu Leu Glu Glu Phe Asp Ser Pro Ile Asp

865 870 875 880

Asn Gly Asn Glu Ser Asp Val Gln Thr Glu His Arg Ser Glu Ser Glu

885 890 895

Val Asp Glu Pro Leu Gln Leu Lys Val Thr Glu Ser Glu Thr Glu Asp

900 905 910

Glu Val Val Thr Glu Ser Glu Leu Glu Leu Ile Lys Ala Asn Ser Arg

915 920 925

Arg Ala Ser Leu Ala Thr Leu Arg Pro Arg Pro Phe Val Gly Ala Gln

930 935 940

Leu Asp Ser Val Lys Lys Thr Ala Gln Lys Ala Glu Lys Thr Glu Val

945 950 955 960

Gly Arg Val Lys Thr Lys Ile Tyr Leu Ala Tyr Ile Lys Ala Cys Gly

965 970 975

Val Leu Gly Val Val Leu Phe Phe Leu Phe Met Ile Leu Thr Arg Val

980 985 990

Phe Asp Leu Ala Glu Asn Phe Trp Leu Lys Tyr Trp Ser Glu Ser Asn

995 1000 1005

Glu Lys Asn Gly Ser Asn Glu Arg Val Trp Met Phe Val Gly Val

1010 1015 1020

Tyr Ser Leu Ile Gly Val Ala Ser Ala Ala Phe Asn Asn Leu Arg

1025 1030 1035

Ser Ile Met Met Leu Leu Tyr Cys Ser Ile Arg Gly Ser Lys Lys

1040 1045 1050

Leu His Glu Ser Met Ala Lys Ser Val Ile Arg Ser Pro Met Thr

1055 1060 1065

Phe Phe Glu Thr Thr Pro Val Gly Arg Ile Ile Asn Arg Phe Ser

1070 1075 1080

Ser Asp Met Asp Ala Val Asp Ser Asn Leu Gln Tyr Ile Phe Ser

1085 1090 1095

Phe Phe Phe Lys Ser Ile Leu Thr Tyr Leu Val Thr Val Ile Leu

1100 1105 1110

Val Gly Tyr Asn Met Pro Trp Phe Leu Val Phe Asn Met Phe Leu

1115 1120 1125

Val Val Ile Tyr Ile Tyr Tyr Gln Thr Phe Tyr Ile Val Leu Ser

1130 1135 1140

Arg Glu Leu Lys Arg Leu Ile Ser Ile Ser Tyr Ser Pro Ile Met

1145 1150 1155

Ser Leu Met Ser Glu Ser Leu Asn Gly Tyr Ser Ile Ile Asp Ala

1160 1165 1170

Tyr Asp His Phe Glu Arg Phe Ile Tyr Leu Asn Tyr Glu Lys Ile

1175 1180 1185

Gln Tyr Asn Val Asp Phe Val Phe Asn Phe Arg Ser Thr Asn Arg

1190 1195 1200

Trp Leu Ser Val Arg Leu Gln Thr Ile Gly Ala Thr Ile Val Leu

1205 1210 1215

Ala Thr Ala Ile Leu Ala Leu Ala Thr Met Asn Thr Lys Arg Gln

1220 1225 1230

Leu Ser Ser Gly Met Val Gly Leu Leu Met Ser Tyr Ser Leu Glu

1235 1240 1245

Val Thr Gly Ser Leu Thr Trp Ile Val Arg Thr Thr Val Thr Ile

1250 1255 1260

Glu Thr Asn Ile Val Ser Val Glu Arg Ile Val Glu Tyr Cys Glu

1265 1270 1275

Leu Pro Pro Glu Ala Gln Ser Ile Asn Pro Glu Lys Arg Pro Asp

1280 1285 1290

Glu Asn Trp Pro Ser Lys Gly Gly Ile Glu Phe Lys Asn Tyr Ser

1295 1300 1305

Thr Lys Tyr Arg Glu Asn Leu Asp Pro Val Leu Asn Asn Ile Asn

1310 1315 1320

Val Lys Ile Glu Pro Cys Glu Lys Val Gly Ile Val Gly Arg Thr

1325 1330 1335

Gly Ala Gly Lys Ser Thr Leu Ser Leu Ala Leu Phe Arg Ile Leu

1340 1345 1350

Glu Pro Thr Glu Gly Lys Ile Ile Ile Asp Gly Ile Asp Ile Ser

1355 1360 1365

Asp Ile Gly Leu Phe Asp Leu Arg Ser His Leu Ala Ile Ile Pro

1370 1375 1380

Gln Asp Ala Gln Ala Phe Glu Gly Thr Val Lys Thr Asn Leu Asp

1385 1390 1395

Pro Phe Asn Arg Tyr Ser Glu Asp Glu Leu Lys Arg Ala Val Glu

1400 1405 1410

Gln Ala His Leu Lys Pro His Leu Glu Lys Met Leu His Ser Lys

1415 1420 1425

Pro Arg Gly Asp Asp Ser Asn Glu Glu Asp Gly Asn Val Asn Asp

1430 1435 1440

Ile Leu Asp Val Lys Ile Asn Glu Asn Gly Ser Asn Leu Ser Val

1445 1450 1455

Gly Gln Arg Gln Leu Leu Cys Leu Ala Arg Ala Leu Leu Asn Arg

1460 1465 1470

Ser Lys Ile Leu Val Leu Asp Glu Ala Thr Ala Ser Val Asp Met

1475 1480 1485

Glu Thr Asp Lys Ile Ile Gln Asp Thr Ile Arg Arg Glu Phe Lys

1490 1495 1500

Asp Arg Thr Ile Leu Thr Ile Ala His Arg Ile Asp Thr Val Leu

1505 1510 1515

Asp Ser Asp Lys Ile Ile Val Leu Asp Gln Gly Ser Val Arg Glu

1520 1525 1530

Phe Asp Ser Pro Ser Lys Leu Leu Ser Asp Lys Thr Ser Ile Phe

1535 1540 1545

Tyr Ser Leu Cys Glu Lys Gly Gly Tyr Leu Lys

1550 1555

<210> 2

<211> 1620

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_1 ABC transporter

<400> 2

Met Ser Leu Glu Leu Ser Asn Ser Thr Leu Cys Asp Ser Tyr Trp Ala

1 5 10 15

Val Asp Asp Phe Thr Ala Cys Gly Arg Gln Leu Val Glu Ser Trp Val

20 25 30

Ser Val Pro Leu Val Leu Ser Ala Leu Val Val Ala Phe Asn Leu Leu

35 40 45

Arg Asn Ser Leu Ala Ser Glu Lys Thr Asp Pro Tyr Ser Lys Leu Asp

50 55 60

Ala Glu Gln Gln Pro Leu Leu Gln Asn Gly His Ala Leu Tyr Thr Ser

65 70 75 80

Ser Ile Glu Ser Asp Asn Thr Asp Ile Phe Gln Arg His Phe Asp Ile

85 90 95

Ala Leu Leu Lys Pro Val Lys Asp Asp Gly Lys Pro Ile Gly Val Val

100 105 110

Arg Ile Val Tyr Arg Asp Thr Ala Glu Lys Leu Lys Val Ala Leu Glu

115 120 125

Glu Ile Leu Leu Ile Ser Gln Thr Val Leu Ala Phe Leu Ala Leu Ser

130 135 140

Arg Leu Glu Asp Ile Ser Glu Ser Arg Phe Leu Leu Val Lys Tyr Ile

145 150 155 160

Asn Phe Ser Leu Trp Leu Tyr Leu Thr Val Ile Thr Ser Ala Arg Leu

165 170 175

Leu Asn Val Thr Lys Gly Phe Ser Ala Asn Arg Val Asp Leu Trp Tyr

180 185 190

His Cys Ala Ile Leu Tyr Asn Leu Gln Trp Phe Asn Ser Val Met Leu

195 200 205

Phe Arg Ser Ala Leu Leu His Val Ser Gly Thr Tyr Gly Tyr Trp

210 215 220

Phe Tyr Val Thr Gln Phe Val Ile Asn Thr Leu Leu Cys Leu Thr Asn

225 230 235 240

Gly Leu Glu Lys Leu Ser Asp Lys Pro Ala Ile Val Tyr Glu Glu Glu

245 250 255

Gly Val Ile Pro Ser Pro Glu Thr Thr Ser Ser Leu Ile Asp Ile Met

260 265 270

Thr Tyr Gly Tyr Leu Asp Lys Met Val Phe Ser Ser Tyr Trp Lys Pro

275 280 285

Ile Thr Met Glu Glu Val Trp Gly Leu Arg Tyr Asp Asp Tyr Ser His

290 295 300

Asp Val Leu Ile Arg Phe His Lys Leu Lys Ser Ser Ile Arg Phe Thr

305 310 315 320

Leu Arg Leu Phe Leu Gln Phe Lys Lys Glu Leu Ala Leu Gln Thr Leu

325 330 335

Cys Thr Cys Ile Glu Ala Leu Leu Ile Phe Val Pro Pro Leu Cys Leu

340 345 350

Lys Lys Ile Leu Glu Tyr Ile Glu Ser Pro His Thr Lys Ser Arg Ser

355 360 365

Met Ala Trp Phe Tyr Val Leu Ile Met Phe Gly Ser Gly Val Ile Ala

370 375 380

Cys Ser Phe Ser Gly Arg Gly Leu Phe Leu Gly Arg Arg Ile Cys Thr

385 390 395 400

Arg Met Arg Ser Ile Leu Ile Gly Glu Ile Tyr Ser Lys Ala Leu Arg

405 410 415

Arg Arg Leu Gly Ser Thr Asp Lys Glu Lys Thr Thr Glu Glu Glu Asp

420 425 430

Asp Lys Ser Ala Lys Ser Lys Lys Glu Asp Glu Pro Ser Asn Lys Glu

435 440 445

Leu Gly Gly Ile Ile Asn Leu Met Ala Val Asp Ala Phe Lys Val Ser

450 455 460

Glu Ile Gly Gly Tyr Leu His Tyr Phe Pro Asn Ser Phe Val Met Ala

465 470 475 480

Ala Val Ala Ile Tyr Met Leu Tyr Lys Leu Leu Gly Trp Ser Ser Leu

485 490 495

Ile Gly Thr Ala Thr Leu Ile Ala Ile Leu Pro Ile Asn Tyr Met Leu

500 505 510

Val Glu Lys Leu Ser Lys Tyr Gln Lys Gln Met Leu Leu Val Thr Asp

515 520 525

Lys Arg Ile Gln Lys Thr Asn Glu Ala Phe Gln Asn Ile Arg Ile Ile

530 535 540

Lys Tyr Phe Ala Trp Glu Asp Lys Phe Ala Asp Thr Ile Met Lys Ile

545 550 555 560

Arg Glu Glu Glu Leu Gly Tyr Leu Val Gly Arg Cys Val Val Trp Ala

565 570 575

Leu Leu Ile Phe Leu Trp Leu Val Val Pro Thr Ile Val Thr Leu Ile

580 585 590

Thr Phe Tyr Ala Tyr Thr Val Ile Gln Gly Asn Pro Leu Thr Ser Pro

595 600 605

Ile Ala Phe Thr Ala Leu Ser Leu Phe Thr Leu Leu Arg Gly Pro Leu

610 615 620

Asp Ala Leu Ala Asp Met Leu Ser Met Val Met Gln Cys Lys Val Ser

625 630 635 640

Leu Asp Arg Val Glu Asp Phe Leu Asn Glu Pro Glu Thr Thr Lys Tyr

645 650 655

Gln Gln Leu Ser Ala Pro Arg Gly Pro Asn Ser Pro Leu Ile Gly Phe

660 665 670

Glu Asn Ala Thr Phe Tyr Trp Ser Lys Asn Ser Lys Ala Glu Phe Ala

675 680 685

Leu Lys Asp Leu Asn Ile Asp Phe Lys Val Gly Lys Leu Asn Val Val

690 695 700

Ile Gly Pro Thr Gly Ser Gly Lys Ser Ser Leu Leu Leu Ala Leu Leu

705 710 715 720

Gly Glu Met Asp Leu Asp Lys Gly Asn Val Phe Leu Pro Gly Ala Ile

725 730 735

Pro Arg Asp Asp Leu Thr Pro Asn Pro Val Thr Gly Leu Met Glu Ser

740 745 750

Val Ala Tyr Cys Ser Gln Thr Ala Trp Leu Leu Asn Ala Thr Val Lys

755 760 765

Asp Asn Ile Ile Phe Ala Ser Pro Phe Asn Gln Glu Arg Tyr Asp Ala

770 775 780

Val Ile His Ala Cys Gly Leu Thr Arg Asp Leu Ser Ile Leu Glu Ala

785 790 795 800

Gly Asp Glu Thr Glu Ile Gly Glu Lys Gly Ile Thr Leu Ser Gly Gly

805 810 815

Gln Lys Gln Arg Val Ser Leu Ala Arg Ala Leu Tyr Ser Ser Ala Ser

820 825 830

Tyr Leu Leu Leu Asp Asp Cys Leu Ser Ala Val Asp Ser His Thr Ala

835 840 845

Val His Ile Tyr Asp Tyr Cys Ile Asn Gly Glu Leu Met Lys Gly Arg

850 855 860

Thr Cys Ile Leu Val Ser His Asn Val Ser Leu Thr Val Lys Glu Ala

865 870 875 880

Asp Phe Val Val Met Met Asp Asn Gly Arg Ile Lys Ala Gln Gly Ser

885 890 895

Val Asp Glu Leu Met Gln Glu Gly Leu Leu Asn Glu Glu Val Val Lys

900 905 910

Ser Val Met Gln Ser Arg Ser Ala Ser Thr Ala Asn Leu Ala Ala Leu

915 920 925

Asp Asp Asn Ser Pro Ile Ser Ser Glu Ala Ile Ala Glu Gly Leu Ala

930 935 940

Lys Lys Thr Gln Lys Pro Glu Gln Ser Lys Lys Ser Lys Leu Ile Glu

945 950 955 960

Asp Glu Thr Lys Ser Asp Gly Ser Val Lys Pro Glu Ile Tyr Tyr Ala

965 970 975

Tyr Phe Arg Tyr Phe Gly Asn Pro Ala Leu Trp Ile Met Ile Ala Phe

980 985 990

Leu Phe Ile Gly Ser Gln Ser Val Asn Val Tyr Gln Ser Tyr Trp Leu

995 1000 1005

Arg Arg Trp Ser Ala Ile Glu Asp Lys Arg Asp Leu Ser Ala Phe

1010 1015 1020

Ser Asn Ser Asn Asp Met Thr Leu Phe Leu Phe Pro Thr Phe His

1025 1030 1035

Ser Ile Asn Trp His Arg Pro Leu Val Asn Tyr Ala Leu Gln Pro

1040 1045 1050

Phe Gly Leu Ala Val Glu Glu Arg Ser Thr Met Tyr Tyr Ile Thr

1055 1060 1065

Ile Tyr Thr Leu Ile Gly Leu Ala Phe Ala Thr Leu Gly Ser Ser

1070 1075 1080

Arg Val Ile Leu Thr Phe Ile Gly Gly Leu Asn Val Ser Arg Lys

1085 1090 1095

Ile Phe Lys Asp Leu Leu Asp Lys Leu Leu His Ala Lys Leu Arg

1100 1105 1110

Phe Phe Asp Gln Thr Pro Ile Gly Arg Ile Met Asn Arg Phe Ser

1115 1120 1125

Lys Asp Ile Glu Ala Ile Asp Gln Glu Leu Ala Leu Tyr Ala Glu

1130 1135 1140

Glu Phe Val Thr Tyr Leu Ile Ser Cys Leu Ser Thr Leu Val Val

1145 1150 1155

Val Cys Ala Val Thr Pro Ala Phe Leu Val Ala Gly Val Leu Ile

1160 1165 1170

Leu Leu Val Tyr Tyr Gly Val Gly Val Leu Tyr Leu Glu Leu Ser

1175 1180 1185

Arg Asp Leu Lys Arg Phe Glu Ser Ile Thr Lys Ser Pro Ile His

1190 1195 1200

Gln His Phe Ser Glu Thr Leu Val Gly Met Thr Thr Ile Arg Ala

1205 1210 1215

Tyr Gly Asp Glu Arg Arg Phe Leu Lys Gln Asn Phe Glu Lys Ile

1220 1225 1230

Asp Val Asn Asn Arg Pro Phe Trp Tyr Val Trp Val Asn Asn Arg

1235 1240 1245

Trp Leu Ala Tyr Arg Ser Asp Met Ile Gly Ala Phe Ile Ile Phe

1250 1255 1260

Phe Ala Ala Ala Phe Ala Val Ala Tyr Ser Asp Lys Ile Asp Ala

1265 1270 1275

Gly Leu Ala Gly Ile Ser Leu Ser Phe Ser Val Ser Phe Arg Tyr

1280 1285 1290

Thr Ala Val Trp Val Val Arg Met Tyr Ala Tyr Val Glu Met Ser

1295 1300 1305

Met Asn Ser Val Glu Arg Val Gln Glu Tyr Ile Glu Gln Thr Pro

1310 1315 1320

Gln Glu Pro Pro Lys Tyr Leu Pro Gln Asp Pro Val Asn Ser Trp

1325 1330 1335

Pro Ser Asn Gly Val Ile Asp Val Gln Asn Ile Cys Ile Arg Tyr

1340 1345 1350

Ser Pro Glu Leu Pro Arg Val Ile Asp Asn Val Ser Phe His Val

1355 1360 1365

Asn Ala Gly Glu Lys Ile Gly Val Val Gly Arg Thr Gly Ala Gly

1370 1375 1380

Lys Ser Thr Ile Ile Thr Ser Phe Phe Arg Phe Val Asp Leu Glu

1385 1390 1395

Ser Gly Ser Ile Lys Ile Asp Gly Leu Asp Ile Ser Lys Ile Gly

1400 1405 1410

Leu Lys Pro Leu Arg Lys Gly Leu Thr Ile Ile Pro Gln Asp Pro

1415 1420 1425

Thr Leu Phe Ser Gly Thr Ile Arg Ser Asn Leu Asp Ile Phe Gly

1430 1435 1440

Glu Tyr Gly Asp Leu Gln Met Phe Glu Ala Leu Arg Arg Val Asn

1445 1450 1455

Leu Ile Ser Val Asp Asp Tyr Gln Arg Ile Val Asp Gly Asn Gly

1460 1465 1470

Ala Ala Val Ala Asp Glu Thr Ala Gln Ala Arg Gly Asp Asn Val

1475 1480 1485

Asn Lys Phe Leu Asp Leu Asp Ser Thr Val Ser Glu Gly Gly Gly

1490 1495 1500

Asn Leu Ser Gln Gly Glu Arg Gln Leu Leu Cys Leu Ala Arg Ser

1505 1510 1515

Ile Leu Lys Met Pro Lys Ile Leu Met Leu Asp Glu Ala Thr Ala

1520 1525 1530

Ser Ile Asp Tyr Glu Ser Asp Ala Lys Ile Gln Ala Thr Ile Arg

1535 1540 1545

Glu Glu Phe Ser Ser Ser Thr Val Leu Thr Ile Ala His Arg Leu

1550 1555 1560

Lys Thr Ile Ile Asp Tyr Asp Lys Ile Leu Leu Leu Asp His Gly

1565 1570 1575

Lys Val Lys Glu Tyr Asp His Pro Tyr Lys Leu Ile Thr Asn Lys

1580 1585 1590

Lys Ser Asp Phe Arg Lys Met Cys Gln Asp Thr Gly Glu Phe Asp

1595 1600 1605

Asp Leu Val Asn Leu Ala Lys Gln Ala Tyr Arg Lys

1610 1615 1620

<210> 3

<211> 1515

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_10 ABC transporter

<400> 3

Met Gly Gln Ser Glu Arg Ala Ala Leu Ile Ala Phe Ala Ser Arg Asn

1 5 10 15

Thr Thr Glu Cys Trp Leu Cys Arg Asp Lys Glu Gly Phe Gly Pro Ile

20 25 30

Ser Tyr Tyr Gly Asp Phe Thr Val Cys Phe Ile Asp Gly Val Leu Leu

35 40 45

Asn Phe Ala Ala Leu Phe Met Leu Ile Phe Gly Thr Tyr Gln Val Val

50 55 60

Lys Leu Ser Lys Lys Glu His Pro Gly Ile Lys Tyr Arg Arg Asp Trp

65 70 75 80

Leu Leu Phe Ser Arg Ile Thr Leu Val Gly Cys Phe Leu Leu Phe Thr

85 90 95

Ser Met Ala Ala Tyr Tyr Ser Ser Glu Lys His Glu Ser Ile Ala Leu

100 105 110

Thr Ser Gln Tyr Thr Leu Thr Leu Met Ser Ile Phe Val Ala Leu Met

115 120 125

Leu His Trp Val Glu Tyr His Arg Ser Arg Ile Ser Asn Gly Ile Val

130 135 140

Leu Phe Tyr Trp Leu Phe Glu Thr Leu Phe Gln Gly Ser Lys Trp Val

145 150 155 160

Asn Phe Ser Ile Arg His Ala Tyr Asn Leu Asn His Glu Trp Pro Val

165 170 175

Ser Tyr Ser Val Tyr Ile Leu Thr Ile Phe Gln Thr Ile Ser Ala Phe

180 185 190

Met Ile Leu Ile Leu Glu Ala Gly Phe Glu Lys Pro Leu Pro Ser Tyr

195 200 205

Gln Arg Val Ile Glu Ser Tyr Ser Lys Gln Lys Arg Asn Pro Val Asp

210 215 220

Asn Ser His Ile Phe Gln Arg Leu Ser Phe Ser Trp Met Thr Glu Leu

225 230 235 240

Met Lys Thr Gly Tyr Lys Lys Tyr Leu Thr Glu Gln Asp Leu Tyr Lys

245 250 255

Leu Pro Lys Ser Phe Gly Ala Lys Glu Ile Ser His Lys Phe Ser Glu

260 265 270

Arg Trp Gln Tyr Gln Leu Lys His Lys Ala Asn Pro Ser Leu Ala Trp

275 280 285

Ala Leu Leu Ser Thr Phe Gly Gly Lys Ile Leu Leu Gly Gly Ile Phe

290 295 300

Lys Val Ala Tyr Asp Ile Leu Gln Phe Thr Gln Pro Gln Leu Leu Arg

305 310 315 320

Ile Leu Ile Lys Phe Val Ser Asp Tyr Thr Ser Thr Pro Glu Pro Gln

325 330 335

Leu Pro Leu Val Arg Gly Val Met Leu Ser Ile Ala Met Phe Val Val

340 345 350

Ser Val Val Gln Thr Ser Ile Leu His Gln Tyr Phe Leu Asn Ala Phe

355 360 365

Asp Thr Gly Met His Ile Lys Ser Gly Met Thr Ser Val Ile Tyr Gln

370 375 380

Lys Ala Leu Val Leu Ser Ser Glu Ala Ser Ala Ser Ser Ser Thr Gly

385 390 395 400

Asp Ile Val Asn Leu Met Ser Val Asp Val Gln Arg Leu Gln Asp Leu

405 410 415

Thr Gln Trp Gly Gln Ile Ile Trp Ser Gly Pro Phe Gln Ile Ile Leu

420 425 430

Cys Leu Val Ser Leu Tyr Lys Leu Leu Gly Pro Cys Met Trp Val Gly

435 440 445

Val Ile Ile Met Ile Ile Met Ile Pro Ile Asn Ser Val Ile Val Arg

450 455 460

Ile Gln Lys Lys Leu Gln Lys Ile Gln Met Lys Asn Lys Asp Glu Arg

465 470 475 480

Thr Arg Val Thr Ser Glu Ile Leu Asn Asn Ile Lys Ser Leu Lys Val

485 490 495

Tyr Gly Trp Glu Ile Pro Tyr Lys Ala Lys Leu Asp His Val Arg Asn

500 505 510

Asp Lys Glu Leu Lys Asn Leu Lys Lys Met Gly Cys Thr Leu Ala Leu

515 520 525

Ala Ser Phe Gln Phe Asn Ile Val Pro Phe Leu Val Ser Cys Ser Thr

530 535 540

Phe Ala Val Phe Val Phe Thr Glu Asp Arg Pro Leu Ser Thr Asp Leu

545 550 555 560

Val Phe Pro Ala Leu Thr Leu Phe Asn Leu Leu Ser Phe Pro Leu Ala

565 570 575

Val Val Pro Asn Ala Ile Ser Ser Phe Ile Glu Ala Ser Val Ser Val

580 585 590

Asn Arg Leu Tyr Ala Phe Leu Thr Asn Glu Glu Leu Gln Thr Asp Ala

595 600 605

Val His Arg Glu Pro Lys Val Asn Asn Ile Gly Asp Glu Gly Val Lys

610 615 620

Val Ser Asp Ala Thr Phe Leu Trp Gln Arg Lys Pro Glu Tyr Lys Val

625 630 635 640

Ala Leu Lys Asn Ile Asn Phe Ser Ala Lys Lys Gly Glu Leu Thr Cys

645 650 655

Ile Val Gly Lys Val Gly Ser Gly Lys Ser Ala Leu Ile Gln Ser Leu

660 665 670

Leu Gly Asp Leu Ile Arg Val Lys Gly Tyr Ala Ala Val His Gly Ser

675 680 685

Val Ala Tyr Val Ser Gln Val Ala Trp Ile Met Asn Gly Thr Val Lys

690 695 700

Asp Asn Ile Ile Phe Gly His Lys Tyr Asp Pro Glu Phe Tyr Glu Leu

705 710 715 720

Thr Ile Lys Ala Cys Ala Leu Ala Ile Asp Leu Ser Met Leu Pro Asp

725 730 735

Gly Asp Gln Thr Leu Val Gly Glu Lys Gly Ile Ser Leu Ser Gly Gly

740 745 750

Gln Lys Ala Arg Leu Ser Leu Ala Arg Ala Val Tyr Ala Arg Ala Asp

755 760 765

Thr Tyr Leu Leu Asp Asp Pro Leu Ala Ala Val Asp Glu His Val Ala

770 775 780

Lys His Leu Ile Glu His Val Leu Gly Pro His Gly Leu Leu His Ser

785 790 795 800

Lys Thr Lys Val Leu Ala Thr Asn Lys Ile Ser Val Leu Ser Ile Ala

805 810 815

Asp Ser Ile Thr Leu Met Glu Asn Gly Glu Ile Ile Gln Gln Gly Thr

820 825 830

Tyr Glu Glu Thr Asn Asn Thr Thr Asp Ser Pro Leu Ser Lys Leu Ile

835 840 845

Ser Glu Phe Gly Lys Lys Gly Lys Ala Thr Pro Ser Gln Ser Thr Thr

850 855 860

Ser Leu Thr Lys Leu Ala Thr Ser Asp Leu Gly Ser Ser Ser Asp Ser

865 870 875 880

Lys Val Ser Asp Val Ser Ile Asp Val Ser Gln Leu Asp Thr Glu Asn

885 890 895

Leu Thr Glu Ala Glu Glu Leu Lys Ser Leu Arg Arg Ala Ser Met Ala

900 905 910

Thr Leu Gly Ser Ile Gly Phe Asp Asp Asp Glu Asn Ile Ala Arg Arg

915 920 925

Glu His Arg Glu Gln Gly Lys Val Lys Trp Asp Ile Tyr Met Glu Tyr

930 935 940

Ala Arg Ala Cys Asn Pro Arg Ser Val Cys Val Phe Leu Phe Phe Ile

945 950 955 960

Val Leu Ser Met Leu Leu Ser Val Leu Gly Asn Phe Trp Leu Lys His

965 970 975

Trp Ser Glu Val Asn Thr Gly Glu Gly Tyr Asn Pro His Ala Ala Arg

980 985 990

Tyr Leu Leu Ile Tyr Phe Ala Leu Gly Val Gly Ser Ala Leu Ala Thr

995 1000 1005

Leu Ile Gln Thr Ile Val Leu Trp Val Phe Cys Thr Ile His Gly

1010 1015 1020

Ser Arg Tyr Leu His Asp Ala Met Ala Thr Ser Val Leu Lys Ala

1025 1030 1035

Pro Met Ser Phe Phe Glu Thr Thr Pro Ile Gly Arg Ile Leu Asn

1040 1045 1050

Arg Phe Ser Asn Asp Ile Tyr Lys Val Asp Glu Val Leu Gly Arg

1055 1060 1065

Thr Phe Ser Gln Phe Phe Ala Asn Val Val Lys Val Ser Phe Thr

1070 1075 1080

Ile Ile Val Ile Cys Met Ala Thr Trp Gln Phe Ile Phe Ile Ile

1085 1090 1095

Leu Pro Leu Ser Val Leu Tyr Ile Tyr Tyr Gln Gln Tyr Tyr Leu

1100 1105 1110

Arg Thr Ser Arg Glu Leu Arg Arg Leu Asp Ser Val Thr Arg Ser

1115 1120 1125

Pro Ile Tyr Ala His Phe Gln Glu Thr Leu Gly Gly Leu Thr Thr

1130 1135 1140

Ile Arg Gly Tyr Ser Gln Gln Thr Arg Phe Val His Ile Asn Gln

1145 1150 1155

Thr Arg Val Asp Asn Asn Met Ser Ala Phe Tyr Pro Ser Val Asn

1160 1165 1170

Ala Asn Arg Trp Leu Ala Phe Arg Leu Glu Phe Ile Gly Ser Ile

1175 1180 1185

Ile Ile Leu Gly Ser Ser Met Leu Ala Val Ile Arg Leu Gly Asn

1190 1195 1200

Gly Thr Leu Thr Ala Gly Met Ile Gly Leu Ser Leu Ser Phe Ala

1205 1210 1215

Leu Gln Ile Thr Gln Ser Leu Asn Trp Ile Val Arg Met Thr Val

1220 1225 1230

Glu Val Glu Thr Asn Ile Val Ser Val Glu Arg Ile Lys Glu Tyr

1235 1240 1245

Ala Glu Leu Lys Ser Glu Ala Pro Tyr Ile Ile Glu Asp His Arg

1250 1255 1260

Pro Pro Ala Ser Trp Pro Glu Lys Gly Asp Val Lys Phe Val Asn

1265 1270 1275

Tyr Ser Thr Arg Tyr Arg Pro Glu Leu Glu Leu Ile Leu Lys Asp

1280 1285 1290

Ile Asn Leu His Ile Leu Pro Lys Glu Lys Ile Gly Ile Val Gly

1295 1300 1305

Arg Thr Gly Ala Gly Lys Ser Ser Leu Thr Leu Ala Leu Phe Arg

1310 1315 1320

Ile Ile Glu Ala Ala Ser Gly His Ile Ile Ile Asp Gly Ile Pro

1325 1330 1335

Ile Asp Ser Ile Gly Leu Ala Asp Leu Arg His Arg Leu Ser Ile

1340 1345 1350

Ile Pro Gln Asp Ser Gln Ile Phe Glu Gly Thr Ile Arg Glu Asn

1355 1360 1365

Ile Asp Pro Ser Lys Gln Tyr Thr Asp Glu Gln Ile Trp Asp Ala

1370 1375 1380

Leu Glu Leu Ser His Leu Lys Asn His Val Lys Asn Met Gly Pro

1385 1390 1395

Asp Gly Leu Glu Thr Met Leu Ser Glu Gly Gly Gly Asn Leu Ser

1400 1405 1410

Val Gly Gln Arg Gln Leu Met Cys Leu Ala Arg Ala Leu Leu Ile

1415 1420 1425

Ser Ser Lys Ile Leu Val Leu Asp Glu Ala Thr Ala Ala Val Asp

1430 1435 1440

Val Glu Thr Asp Gln Leu Ile Gln Lys Thr Ile Arg Glu Ala Phe

1445 1450 1455

Lys Glu Arg Thr Ile Leu Thr Ile Ala His Arg Ile Asn Thr Ile

1460 1465 1470

Met Asp Ser Asp Arg Ile Ile Val Leu Asp Lys Gly Arg Val Thr

1475 1480 1485

Glu Phe Asp Thr Pro Ala Asn Leu Leu Asn Lys Lys Asp Ser Ile

1490 1495 1500

Phe Tyr Ser Leu Cys Val Glu Ala Gly Leu Ala Glu

1505 1510 1515

<210> 4

<211> 1559

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_2 ABC-transporter

<400> 4

Met Ser Ser Leu Glu Val Val Asp Gly Cys Pro Tyr Gly Tyr Arg Pro

1 5 10 15

Tyr Pro Asp Ser Gly Thr Asn Ala Leu Asn Pro Cys Phe Ile Ser Val

20 25 30

Ile Ser Ala Trp Gln Ala Val Phe Phe Leu Leu Ile Gly Ser Tyr Gln

35 40 45

Leu Trp Lys Leu Tyr Lys Asn Asn Lys Val Pro Pro Arg Phe Lys Asn

50 55 60

Phe Pro Thr Leu Pro Ser Lys Ile Asn Ser Arg His Leu Thr His Leu

65 70 75 80

Thr Asn Val Cys Phe Gln Ser Thr Leu Ile Ile Cys Glu Leu Ala Leu

85 90 95

Val Ser Gln Ser Ser Asp Arg Val Tyr Pro Phe Ile Leu Lys Lys Ala

100 105 110

Leu Tyr Leu Asn Leu Leu Phe Asn Leu Gly Ile Ser Leu Pro Thr Gln

115 120 125

Tyr Leu Ala Tyr Phe Lys Ser Thr Phe Ser Met Gly Asn Gln Leu Phe

130 135 140

Tyr Tyr Met Phe Gln Ile Leu Leu Gln Leu Phe Leu Ile Leu Gln Arg

145 150 155 160

Tyr Tyr His Gly Ser Ser Asn Glu Arg Leu Thr Val Ile Ser Gly Gln

165 170 175

Thr Ala Met Ile Leu Glu Val Leu Leu Leu Phe Asn Ser Val Ala Ile

180 185 190

Phe Ile Tyr Asp Leu Cys Ile Phe Glu Pro Ile Asn Glu Leu Ser Glu

195 200 205

Tyr Tyr Lys Lys Asn Gly Trp Tyr Pro Pro Val His Val Leu Ser Tyr

210 215 220

Ile Thr Phe Ile Trp Met Asn Lys Leu Ile Val Glu Thr Tyr Arg Asn

225 230 235 240

Lys Lys Ile Lys Asp Pro Asn Gln Leu Pro Leu Pro Pro Val Asp Leu

245 250 255

Asn Ile Lys Ser Ile Ser Lys Glu Phe Lys Ala Asn Trp Glu Leu Glu

260 265 270

Lys Trp Leu Asn Arg Asn Ser Leu Trp Arg Ala Ile Trp Lys Ser Phe

275 280 285

Gly Arg Thr Ile Ser Val Ala Met Leu Tyr Glu Thr Thr Ser Asp Leu

290 295 300

Leu Ser Val Val Gln Pro Gln Phe Leu Arg Ile Phe Ile Asp Gly Phe

305 310 315 320

Asn Pro Glu Thr Ser Ser Lys Tyr Pro Pro Leu Asn Gly Val Phe Ile

325 330 335

Ala Leu Thr Leu Phe Val Ile Ser Val Val Ser Val Phe Leu Thr Asn

340 345 350

Gln Phe Tyr Ile Gly Ile Phe Glu Ala Gly Leu Gly Ile Arg Gly Ser

355 360 365

Leu Ala Ser Leu Val Tyr Gln Lys Ser Leu Arg Leu Thr Leu Ala Glu

370 375 380

Arg Asn Glu Lys Ser Thr Gly Asp Ile Leu Asn Leu Met Ser Val Asp

385 390 395 400

Val Leu Arg Ile Gln Arg Phe Phe Glu Asn Ala Gln Thr Ile Ile Gly

405 410 415

Ala Pro Ile Gln Ile Ile Val Val Leu Thr Ser Leu Tyr Trp Leu Leu

420 425 430

Gly Lys Ala Val Val Gly Gly Leu Val Thr Met Ala Ile Met Met Pro

435 440 445

Ile Asn Ala Phe Leu Ser Arg Lys Val Lys Lys Leu Ser Lys Thr Gln

450 455 460

Met Lys Tyr Lys Asp Met Arg Ile Lys Thr Ile Thr Glu Leu Leu Asn

465 470 475 480

Ala Ile Lys Ser Ile Lys Leu Tyr Ala Trp Glu Glu Pro Met Met Ala

485 490 495

Arg Leu Asn His Val Arg Asn Asp Met Glu Leu Lys Asn Phe Arg Lys

500 505 510

Ile Gly Ile Val Ser Asn Leu Ile Tyr Phe Ala Trp Asn Cys Val Pro

515 520 525

Leu Met Val Thr Cys Ser Thr Phe Gly Leu Phe Ser Leu Phe Ser Asp

530 535 540

Ser Pro Leu Ser Pro Ala Ile Val Phe Pro Ser Leu Ser Leu Phe Asn

545 550 555 560

Ile Leu Asn Ser Ala Ile Tyr Ser Val Pro Ser Met Ile Asn Thr Ile

565 570 575

Ile Glu Thr Ser Val Ser Met Glu Arg Leu Lys Ser Phe Leu Leu Ser

580 585 590

Asp Glu Ile Asp Asp Ser Phe Ile Glu Arg Ile Asp Pro Ser Ala Asp

595 600 605

Glu Arg Ala Leu Pro Ala Ile Glu Met Asn Asn Ile Thr Phe Leu Trp

610 615 620

Lys Ser Lys Glu Val Leu Ala Ser Ser Gln Ser Gly Asp Asn Leu Arg

625 630 635 640

Thr Asp Glu Glu Ser Ile Ile Gly Ser Ser Gln Ile Ala Leu Lys Asn

645 650 655

Ile Asp His Phe Glu Ala Lys Arg Gly Asp Leu Val Cys Val Val Gly

660 665 670

Arg Val Gly Ala Gly Lys Ser Thr Phe Leu Lys Ala Ile Leu Gly Gln

675 680 685

Leu Pro Cys Met Ser Gly Ser Arg Asp Ser Ile Pro Pro Lys Leu Ile

690 695 700

Ile Arg Ser Ser Ser Val Ala Tyr Cys Ser Gln Glu Ser Trp Ile Met

705 710 715 720

Asn Ala Ser Val Arg Glu Asn Ile Leu Phe Gly His Lys Phe Asp Gln

725 730 735

Asn Tyr Tyr Asp Leu Thr Ile Lys Ala Cys Gln Leu Leu Pro Asp Leu

740 745 750

Lys Ile Leu Pro Asp Gly Asp Glu Thr Leu Val Gly Glu Lys Gly Ile

755 760 765

Ser Leu Ser Gly Gly Gln Lys Ala Arg Leu Ser Leu Ala Arg Ala Val

770 775 780

Tyr Ser Arg Ala Asp Ile Tyr Leu Leu Asp Asp Ile Leu Ser Ala Val

785 790 795 800

Asp Ala Glu Val Ser Lys Asn Ile Ile Glu Tyr Val Leu Ile Gly Lys

805 810 815

Thr Ala Leu Leu Lys Asn Lys Thr Ile Ile Leu Thr Thr Asn Thr Val

820 825 830

Ser Ile Leu Lys His Ser Gln Met Ile Tyr Ala Leu Glu Asn Gly Glu

835 840 845

Ile Val Glu Gln Gly Asn Tyr Glu Asp Val Met Asn Arg Lys Asn Asn

850 855 860

Thr Ser Lys Leu Lys Lys Leu Leu Glu Glu Phe Asp Ser Pro Ile Asp

865 870 875 880

Asn Gly Asn Glu Ser Asp Val Gln Thr Glu His Arg Ser Glu Ser Glu

885 890 895

Val Asp Glu Pro Leu Gln Leu Lys Val Thr Glu Ser Glu Thr Glu Asp

900 905 910

Glu Val Val Thr Glu Ser Glu Leu Glu Leu Ile Lys Ala Asn Ser Arg

915 920 925

Arg Ala Ser Leu Ala Thr Leu Arg Pro Arg Pro Phe Val Gly Ala Gln

930 935 940

Leu Asp Ser Val Lys Lys Thr Ala Gln Glu Ala Glu Lys Thr Glu Val

945 950 955 960

Gly Arg Val Lys Thr Lys Val Tyr Leu Ala Tyr Ile Lys Ala Cys Gly

965 970 975

Val Leu Gly Val Val Leu Phe Phe Leu Phe Met Ile Leu Thr Arg Val

980 985 990

Phe Asp Leu Ala Glu Asn Phe Trp Leu Lys Tyr Trp Ser Glu Ser Asn

995 1000 1005

Glu Lys Asn Gly Ser Asn Glu Arg Val Trp Met Phe Val Gly Val

1010 1015 1020

Tyr Ser Leu Ile Gly Val Ala Ser Ala Ala Phe Asn Asn Leu Arg

1025 1030 1035

Ser Ile Met Met Leu Leu Tyr Cys Ser Ile Arg Gly Ser Lys Lys

1040 1045 1050

Leu His Glu Ser Met Ala Lys Ser Val Ile Arg Ser Pro Met Thr

1055 1060 1065

Phe Phe Glu Thr Thr Pro Val Gly Arg Ile Ile Asn Arg Phe Ser

1070 1075 1080

Ser Asp Met Asp Ala Val Asp Ser Asn Leu Gln Tyr Ile Phe Ser

1085 1090 1095

Phe Phe Phe Lys Ser Ile Leu Thr Tyr Leu Val Thr Val Ile Leu

1100 1105 1110

Val Gly Tyr Asn Met Pro Trp Phe Leu Val Phe Asn Met Phe Leu

1115 1120 1125

Val Val Ile Tyr Ile Tyr Tyr Gln Thr Phe Tyr Ile Val Leu Ser

1130 1135 1140

Arg Glu Leu Lys Arg Leu Ile Ser Ile Ser Tyr Ser Pro Ile Met

1145 1150 1155

Ser Leu Met Ser Glu Ser Leu Asn Gly Tyr Ser Ile Ile Asp Ala

1160 1165 1170

Tyr Asp His Phe Glu Arg Phe Ile Tyr Leu Asn Tyr Glu Lys Ile

1175 1180 1185

Gln Tyr Asn Val Asp Phe Val Phe Asn Phe Arg Ser Thr Asn Arg

1190 1195 1200

Trp Leu Ser Val Arg Leu Gln Thr Ile Gly Ala Thr Ile Val Leu

1205 1210 1215

Ala Thr Ala Ile Leu Ala Leu Ala Thr Met Asn Thr Lys Arg Gln

1220 1225 1230

Leu Ser Ser Gly Met Val Gly Leu Leu Met Ser Tyr Ser Leu Glu

1235 1240 1245

Val Thr Gly Ser Leu Thr Trp Ile Val Arg Thr Thr Val Met Ile

1250 1255 1260

Glu Thr Asn Ile Val Ser Val Glu Arg Ile Val Glu Tyr Cys Glu

1265 1270 1275

Leu Pro Pro Glu Ala Gln Ser Ile Asn Pro Glu Lys Arg Pro Asp

1280 1285 1290

Glu Asn Trp Pro Ser Lys Gly Gly Ile Glu Phe Lys Asn Tyr Ser

1295 1300 1305

Thr Lys Tyr Arg Glu Asn Leu Asp Pro Val Leu Asn Asn Ile Asn

1310 1315 1320

Val Lys Ile Glu Pro Cys Glu Lys Val Gly Ile Val Gly Arg Thr

1325 1330 1335

Gly Ala Gly Lys Ser Thr Leu Ser Leu Ala Leu Phe Arg Ile Leu

1340 1345 1350

Glu Pro Thr Glu Gly Lys Ile Ile Ile Asp Gly Ile Gly Ile Ser

1355 1360 1365

Asp Ile Gly Leu Phe Asp Leu Arg Ser His Leu Ala Ile Ile Pro

1370 1375 1380

Gln Asp Ala Gln Ala Phe Glu Gly Thr Val Lys Thr Asn Leu Asp

1385 1390 1395

Pro Phe Asn Arg Tyr Ser Glu Asp Glu Leu Lys Arg Ala Val Glu

1400 1405 1410

Gln Ala His Leu Lys Pro His Leu Glu Lys Met Leu His Ser Lys

1415 1420 1425

Pro Arg Gly Asp Asp Ser Asn Glu Glu Asp Gly Asn Val Asn Asp

1430 1435 1440

Ile Leu Asp Val Lys Ile Asn Glu Asn Gly Ser Asn Leu Ser Val

1445 1450 1455

Gly Gln Arg Gln Leu Leu Cys Leu Ala Arg Ala Leu Leu Asn Arg

1460 1465 1470

Ser Lys Ile Leu Val Leu Asp Glu Ala Thr Ala Ser Val Asp Met

1475 1480 1485

Glu Thr Asp Lys Ile Ile Gln Asp Thr Ile Arg Arg Glu Phe Lys

1490 1495 1500

Asp Arg Thr Ile Leu Thr Ile Ala His Arg Ile Asp Thr Val Leu

1505 1510 1515

Asp Ser Asp Lys Ile Ile Val Leu Asp Gln Gly Ser Val Arg Glu

1520 1525 1530

Phe Asp Ser Pro Ser Lys Leu Leu Ser Asp Lys Thr Ser Ile Phe

1535 1540 1545

Tyr Ser Leu Cys Glu Lys Gly Gly Tyr Leu Lys

1550 1555

<210> 5

<211> 1638

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_3 ABC-transporter

<400> 5

Met Asn Ser Tyr Asn Glu Ser Ala Pro Thr Gly Cys Ser Phe Trp Asp

1 5 10 15

Asn Asp Asp Ile Ser Pro Cys Ile Arg Lys Ser Leu Leu Asp Ser Tyr

20 25 30

Leu Pro Ala Ala Ile Val Val Gly Ser Leu Leu Tyr Leu Leu Leu Ile

35 40 45

Gly Ala Gln Gln Ile Lys Thr His Arg Lys Leu Tyr Ala Lys Asp Glu

50 55 60

Thr Gln Pro Leu Leu Glu Pro Ala Asn Gly Ser Pro Thr Asp Tyr Ser

65 70 75 80

Asn Thr Tyr Gly Thr Ile Asp Tyr Glu Glu Glu Gln Ser Thr Ala Glu

85 90 95

Leu Thr Thr Ser Gln Lys His Phe Asp Ile Ser Arg Leu Glu Pro Leu

100 105 110

Lys Asp Asp Gly Thr Pro Leu Gly Leu Val Lys Tyr Val Gln Arg Asp

115 120 125

Gly Trp Glu Lys Val Lys Leu Ile Leu Glu Phe Val Ile Leu Ile Phe

130 135 140

Gln Leu Val Ile Ala Val Val Ala Leu Phe Val Pro Ser Leu Asn Gln

145 150 155 160

Glu Trp Glu Gly Tyr Lys Leu Thr Pro Ile Val Arg Val Phe Val Trp

165 170 175

Ile Phe Leu Phe Ala Leu Gly Ser Ile Arg Ala Leu Asn Lys Ser Gly

180 185 190

Pro Phe Pro Leu Ala Asn Ile Ser Leu Leu Tyr Tyr Ile Val Asn Ile

195 200 205

Val Pro Ser Ala Leu Ser Phe Arg Ser Val Leu Ile His Pro Gln Asn

210 215 220

Ser Gln Leu Val Asn Tyr Tyr Tyr Ser Phe Gln Phe Ile Asn Asn Thr

225 230 235 240

Leu Leu Phe Leu Leu Leu Gly Ser Ala Arg Val Phe Asp His Pro Ser

245 250 255

Val Leu Phe Asp Thr Asp Asp Gly Val Lys Pro Ser Pro Glu Asn Asn

260 265 270

Ser Asn Phe Phe Glu Ile Val Thr Tyr Ser Trp Ile Asp Pro Leu Ile

275 280 285

Phe Lys Ala Tyr Lys Thr Pro Leu Gln Phe Asn Asp Ile Trp Gly Leu

290 295 300

Arg Ile Asp Asp Tyr Ala Tyr Phe Leu Leu Arg Arg Phe Lys Asp Leu

305 310 315 320

Gly Phe Thr Arg Thr Phe Thr Tyr Lys Ile Phe Tyr Phe Ser Lys Gly

325 330 335

Asp Leu Ala Ala Gln Ala Leu Trp Ala Ser Ile Asp Ser Met Leu Ile

340 345 350

Phe Gly Pro Ser Leu Leu Leu Lys Arg Ile Leu Glu Tyr Val Asp Asn

355 360 365

Pro Gly Met Thr Ser Arg Asn Met Ala Trp Leu Tyr Val Leu Thr Met

370 375 380

Phe Phe Ile Gln Ile Ser Asp Ser Leu Val Ser Gly Arg Ser Leu Tyr

385 390 395 400

Leu Gly Arg Arg Val Cys Ile Arg Met Lys Ala Leu Ile Ile Gly Glu

405 410 415

Val Tyr Ala Lys Ala Leu Arg Arg Arg Met Thr Ser Pro Glu Glu Leu

420 425 430

Ile Glu Glu Val Asp Pro Lys Asp Gly Lys Ala Pro Ile Ala Asp Gln

435 440 445

Thr Ser Lys Glu Glu Ser Lys Ser Thr Glu Leu Gly Gly Ile Ile Asn

450 455 460

Leu Met Ala Val Asp Ala Ser Lys Val Ser Glu Leu Cys Ser Tyr Leu

465 470 475 480

His Phe Phe Val Asn Ser Phe Phe Met Ile Ile Val Ala Val Thr Leu

485 490 495

Leu Tyr Arg Leu Leu Gly Trp Ser Ala Leu Ala Gly Ser Ser Ser Ile

500 505 510

Leu Ile Leu Leu Pro Leu Asn Tyr Lys Leu Ala Ser Lys Ile Gly Glu

515 520 525

Phe Gln Lys Glu Met Leu Gly Ile Thr Asp Asn Arg Ile Gln Lys Leu

530 535 540

Asn Glu Ala Phe Gln Ser Ile Arg Ile Ile Lys Phe Phe Ala Trp Glu

545 550 555 560

Glu Asn Phe Ala Lys Glu Ile Met Lys Val Arg Asn Glu Glu Ile Arg

565 570 575

Tyr Leu Arg Tyr Arg Val Ile Val Trp Thr Cys Ser Ala Phe Val Trp

580 585 590

Phe Ile Thr Pro Thr Leu Val Thr Leu Ile Ser Phe Tyr Phe Tyr Val

595 600 605

Val Phe Gln Gly Lys Ile Leu Thr Pro Val Ala Phe Thr Ala Leu

610 615 620

Ser Leu Phe Asn Leu Leu Arg Ser Pro Leu Asp Gln Leu Ser Asp Met

625 630 635 640

Leu Ser Phe Met Val Gln Ser Lys Val Ser Leu Asp Arg Val Gln Lys

645 650 655

Phe Leu Glu Glu Gln Glu Ser Asp Lys Tyr Glu Gln Leu Thr His Thr

660 665 670

Arg Gly Ala Asn Ser Pro Glu Val Gly Phe Glu Asn Ala Thr Leu Ser

675 680 685

Trp Asn Lys Gly Ser Lys Asn Asp Phe Gln Leu Lys Asp Ile Asp Ile

690 695 700

Ala Phe Lys Val Gly Lys Leu Asn Val Ile Ile Gly Pro Thr Gly Ser

705 710 715 720

Gly Lys Thr Ser Leu Leu Leu Gly Leu Leu Gly Glu Met Gln Leu Thr

725 730 735

Asn Gly Lys Ile Phe Leu Pro Gly Ser Thr Pro Arg Asp Glu Leu Ile

740 745 750

Pro Asn Pro Glu Thr Gly Met Thr Glu Ala Val Ala Tyr Cys Ser Gln

755 760 765

Ile Ala Trp Leu Leu Asn Asp Thr Val Lys Asn Asn Ile Val Phe Ala

770 775 780

Ala Pro Phe Asn Gln Gln Arg Tyr Asp Ala Val Ile Asp Ala Cys Gly

785 790 795 800

Leu Thr Arg Asp Leu Lys Val Leu Asp Ala Gly Asp Ala Thr Glu Ile

805 810 815

Gly Glu Lys Gly Ile Thr Leu Ser Gly Gly Gln Lys Gln Arg Val Ser

820 825 830

Leu Ala Arg Ala Leu Tyr Ser Asn Ala Arg His Val Leu Leu Asp Asp

835 840 845

Cys Leu Ser Ala Val Asp Ser His Thr Ala Ala Trp Ile Tyr Glu Asn

850 855 860

Cys Ile Thr Gly Pro Leu Met Lys Asp Arg Thr Cys Ile Leu Val Ser

865 870 875 880

His Asn Val Ala Leu Thr Val Arg Asp Ala Ala Trp Ile Val Ala Met

885 890 895

Asp Asn Gly Arg Val Leu Glu Gln Gly Thr Cys Glu Asp Leu Leu Ser

900 905 910

Ser Gly Ser Leu Gly His Asp Asp Leu Val Ser Thr Val Ile Ser Ser

915 920 925

Arg Ser Gln Ser Ser Val Asn Leu Lys Gln Leu Asn Val Ser Asp Thr

930 935 940

Ser Glu Ile His Gln Lys Leu Lys Lys Ile Ala Glu Ser Asp Lys Ala

945 950 955 960

Asp Gln Leu Asp Glu Glu Arg Leu Ser Pro Arg Gly Lys Leu Ile Glu

965 970 975

Asp Glu Thr Lys Ser Ser Gly Ala Val Ser Trp Glu Val Tyr Lys Phe

980 985 990

Tyr Gly Arg Ala Phe Gly Gly Val Phe Ile Trp Phe Val Phe Val Ala

995 1000 1005

Ala Phe Ala Ala Ser Gln Gly Ser Asn Ile Met Gln Ser Val Trp

1010 1015 1020

Leu Lys Ile Trp Ala Ala Ala Asn Asp Lys Leu Val Ser Pro Ala

1025 1030 1035

Phe Thr Met Ser Ile Asp Arg Ser Leu Asn Ala Leu Lys Glu Gly

1040 1045 1050

Phe Arg Ala Ser Val Ala Ser Val Glu Trp Ser Arg Pro Leu Gly

1055 1060 1065

Gly Glu Met Phe Arg Val Tyr Gly Glu Glu Ser Ser His Ser Ser

1070 1075 1080

Gly Tyr Tyr Ile Thr Ile Tyr Ala Leu Ile Gly Leu Ser Tyr Ala

1085 1090 1095

Leu Ile Ser Ala Phe Arg Val Tyr Val Val Phe Met Gly Gly Ile

1100 1105 1110

Val Ala Ser Asn Lys Ile Phe Glu Asp Met Leu Thr Lys Ile Phe

1115 1120 1125

Asn Ala Lys Leu Arg Phe Phe Asp Ser Thr Pro Ile Gly Arg Ile

1130 1135 1140

Met Asn Arg Phe Ser Lys Asp Thr Glu Ser Ile Asp Gln Glu Leu

1145 1150 1155

Ala Pro Tyr Ala Glu Gly Phe Ile Val Ser Val Leu Gln Cys Gly

1160 1165 1170

Ala Thr Ile Leu Leu Ile Cys Ile Ile Thr Pro Gly Phe Ile Val

1175 1180 1185

Phe Ala Ala Phe Ile Val Ile Ile Tyr Tyr Tyr Ile Gly Ala Leu

1190 1195 1200

Tyr Leu Ala Ser Ser Arg Glu Leu Lys Arg Tyr Asp Ser Ile Thr

1205 1210 1215

Val Ser Pro Ile His Gln His Phe Ser Glu Thr Leu Val Gly Val

1220 1225 1230

Thr Thr Ile Arg Ala Tyr Gly Asp Glu Arg Arg Phe Met Arg Gln

1235 1240 1245

Asn Leu Glu Lys Ile Asp Asn Asn Asn Arg Ser Phe Phe Tyr Leu

1250 1255 1260

Trp Val Ala Asn Arg Trp Leu Ala Leu Arg Val Asp Phe Val Gly

1265 1270 1275

Ala Leu Val Ser Leu Leu Ser Ala Ala Phe Val Met Leu Ser Ile

1280 1285 1290

Gly His Ile Asp Ala Gly Met Ala Gly Leu Ser Leu Ser Tyr Ala

1295 1300 1305

Ile Ala Phe Thr Gln Ser Ala Leu Trp Val Val Arg Leu Tyr Ser

1310 1315 1320

Val Val Glu Met Asn Met Asn Ser Val Glu Arg Leu Glu Glu Tyr

1325 1330 1335

Leu Asn Ile Asp Gln Glu Pro Asp Arg Glu Ile Pro Asp Asn Lys

1340 1345 1350

Pro Pro Ser Ser Trp Pro Glu Thr Gly Glu Ile Glu Val Asp Asp

1355 1360 1365

Val Ser Leu Arg Tyr Ala Pro Ser Leu Pro Lys Val Ile Lys Asn

1370 1375 1380

Val Ser Phe Lys Val Glu Pro Arg Ser Lys Ile Gly Ile Val Gly

1385 1390 1395

Arg Thr Gly Ala Gly Lys Ser Thr Ile Ile Thr Ala Phe Phe Arg

1400 1405 1410

Phe Val Asp Pro Glu Ser Gly Ser Ile Lys Ile Asp Gly Ile Asp

1415 1420 1425

Ile Thr Ser Ile Gly Leu Lys Asp Leu Arg Asn Ala Val Thr Ile

1430 1435 1440

Ile Pro Gln Asp Pro Thr Leu Phe Thr Gly Thr Ile Arg Ser Asn

1445 1450 1455

Leu Asp Pro Phe Asn Gln Tyr Ser Asp Ala Glu Ile Phe Glu Ser

1460 1465 1470

Leu Lys Arg Val Asn Leu Val Ser Thr Asp Glu Pro Thr Ser Gly

1475 1480 1485

Ser Ser Ser Asp Asn Ile Glu Asp Ser Asn Glu Asn Val Asn Lys

1490 1495 1500

Phe Leu Asn Leu Asn Asn Thr Val Ser Glu Gly Gly Ser Asn Leu

1505 1510 1515

Ser Gln Gly Gln Arg Gln Leu Thr Cys Leu Ala Arg Ser Leu Leu

1520 1525 1530

Lys Ser Pro Lys Ile Ile Leu Leu Asp Glu Ala Thr Ala Ser Ile

1535 1540 1545

Asp Tyr Asn Thr Asp Ser Lys Ile Gln Thr Thr Ile Arg Glu Glu

1550 1555 1560

Phe Ser Asp Ser Thr Ile Leu Thr Ile Ala His Arg Leu Arg Ser

1565 1570 1575

Ile Ile Asp Tyr Asp Lys Ile Leu Val Met Asp Ala Gly Arg Val

1580 1585 1590

Val Glu Tyr Asp Asp Pro Tyr Lys Leu Ile Ser Asp Gln Asn Ser

1595 1600 1605

Leu Phe Tyr Ser Met Cys Ser Asn Ser Gly Glu Leu Asp Thr Leu

1610 1615 1620

Val Lys Leu Ala Lys Glu Ala Phe Ile Ala Lys Arg Asn Lys Lys

1625 1630 1635

<210> 6

<211> 1559

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_4 ABC-transporter

<400> 6

Met Ser Ser Leu Glu Val Val Asp Gly Cys Pro Tyr Gly Tyr Arg Pro

1 5 10 15

Tyr Pro Asp Ser Gly Thr Asn Ala Leu Asn Pro Cys Phe Ile Ser Val

20 25 30

Ile Ser Ala Trp Gln Ala Val Phe Phe Leu Leu Ile Gly Ser Tyr Gln

35 40 45

Leu Trp Lys Leu Tyr Lys Asn Asn Lys Val Pro Pro Arg Phe Lys Asn

50 55 60

Phe Pro Thr Leu Pro Ser Lys Ile Asn Ser Arg His Leu Thr His Leu

65 70 75 80

Thr Asn Val Cys Phe Gln Ser Thr Leu Ile Ile Cys Glu Leu Ala Leu

85 90 95

Val Ser Gln Ser Ser Asp Arg Val Tyr Pro Phe Ile Leu Lys Lys Ala

100 105 110

Leu Tyr Leu Asn Leu Leu Phe Asn Leu Gly Ile Ser Leu Pro Thr Gln

115 120 125

Tyr Leu Ala Tyr Phe Lys Ser Thr Phe Ser Met Gly Asn Gln Leu Phe

130 135 140

Tyr Tyr Met Phe Gln Ile Leu Leu Gln Leu Phe Leu Ile Leu Gln Arg

145 150 155 160

Tyr Tyr His Gly Ser Ser Asn Glu Arg Leu Thr Val Ile Ser Gly Gln

165 170 175

Thr Ala Met Ile Leu Glu Val Leu Leu Leu Phe Asn Ser Val Ala Ile

180 185 190

Phe Ile Tyr Asp Leu Cys Ile Phe Glu Pro Ile Asn Glu Leu Ser Glu

195 200 205

Tyr Tyr Lys Lys Asn Gly Trp Tyr Pro Pro Val His Val Leu Ser Tyr

210 215 220

Ile Thr Phe Ile Trp Met Asn Lys Leu Ile Val Glu Thr Tyr Arg Asn

225 230 235 240

Lys Lys Ile Lys Asp Pro Asn Gln Leu Pro Leu Pro Pro Val Asp Leu

245 250 255

Asn Ile Lys Ser Ile Ser Lys Glu Phe Lys Ala Asn Trp Glu Leu Glu

260 265 270

Lys Trp Leu Asn Arg Asn Ser Leu Trp Arg Ala Ile Trp Lys Ser Phe

275 280 285

Gly Arg Thr Ile Ser Val Ala Met Leu Tyr Glu Thr Thr Ser Asp Leu

290 295 300

Leu Ser Val Val Gln Pro Gln Phe Leu Arg Ile Phe Ile Asp Gly Phe

305 310 315 320

Asn Pro Glu Thr Ser Ser Lys Tyr Pro Pro Leu Asn Gly Val Phe Ile

325 330 335

Ala Leu Thr Leu Phe Val Ile Ser Val Val Ser Val Phe Leu Thr Asn

340 345 350

Gln Phe Tyr Ile Gly Ile Phe Glu Ala Gly Leu Gly Ile Arg Gly Ser

355 360 365

Leu Ala Ser Leu Val Tyr Gln Lys Ser Leu Arg Leu Thr Leu Ala Glu

370 375 380

Arg Asn Glu Lys Ser Thr Gly Asp Ile Leu Asn Leu Met Ser Val Asp

385 390 395 400

Val Leu Arg Ile Gln Arg Phe Phe Glu Asn Ala Gln Thr Ile Ile Gly

405 410 415

Ala Pro Ile Gln Ile Ile Val Val Leu Thr Ser Leu Tyr Trp Leu Leu

420 425 430

Gly Lys Ala Val Ile Gly Gly Leu Val Thr Met Ala Ile Met Met Pro

435 440 445

Ile Asn Ala Phe Leu Ser Arg Lys Val Lys Lys Leu Ser Lys Thr Gln

450 455 460

Met Lys Tyr Lys Asp Met Arg Ile Lys Thr Ile Thr Glu Leu Leu Asn

465 470 475 480

Ala Ile Lys Ser Ile Lys Leu Tyr Ala Trp Glu Glu Pro Met Met Ala

485 490 495

Arg Leu Asn His Val Arg Asn Asp Met Glu Leu Lys Asn Phe Arg Lys

500 505 510

Ile Gly Ile Val Ser Asn Leu Ile Tyr Phe Ala Trp Asn Cys Val Pro

515 520 525

Leu Met Val Thr Cys Ser Thr Phe Gly Leu Phe Ser Leu Phe Ser Asp

530 535 540

Ser Pro Leu Ser Pro Ala Ile Val Phe Pro Ser Leu Ser Leu Phe Asn

545 550 555 560

Ile Leu Asn Ser Ala Ile Tyr Ser Val Pro Ser Met Ile Asn Thr Ile

565 570 575

Ile Glu Thr Ser Val Ser Met Glu Arg Leu Lys Ser Phe Leu Leu Ser

580 585 590

Asp Glu Ile Asp Asp Ser Phe Ile Glu Arg Ile Asp Pro Ser Ala Asp

595 600 605

Glu Arg Ala Leu Pro Ala Ile Glu Met Asn Asn Ile Thr Phe Leu Trp

610 615 620

Lys Ser Lys Glu Val Leu Ala Ser Ser Gln Ser Arg Asp Asn Leu Arg

625 630 635 640

Thr Asp Glu Glu Ser Ile Ile Gly Ser Ser Gln Ile Ala Leu Lys Asn

645 650 655

Ile Asp His Phe Glu Ala Lys Arg Gly Asp Leu Val Cys Val Val Gly

660 665 670

Arg Val Gly Ala Gly Lys Ser Thr Phe Leu Lys Ala Ile Leu Gly Gln

675 680 685

Leu Pro Cys Met Ser Gly Ser Arg Asp Ser Ile Pro Pro Lys Leu Ile

690 695 700

Ile Arg Ser Ser Ser Val Ala Tyr Cys Ser Gln Glu Ser Trp Ile Met

705 710 715 720

Asn Ala Ser Val Arg Glu Asn Ile Leu Phe Gly His Lys Phe Asp Gln

725 730 735

Asn Tyr Tyr Asp Leu Thr Ile Lys Ala Cys Gln Leu Leu Pro Asp Leu

740 745 750

Lys Ile Leu Pro Asp Gly Asp Glu Thr Leu Val Gly Glu Lys Gly Ile

755 760 765

Ser Leu Ser Gly Gly Gln Lys Ala Arg Leu Ser Leu Ala Arg Ala Val

770 775 780

Tyr Ser Arg Ala Asp Ile Tyr Leu Leu Asp Asp Ile Leu Ser Ala Val

785 790 795 800

Asp Ala Glu Val Ser Lys Asn Ile Ile Glu Tyr Val Leu Ile Gly Lys

805 810 815

Thr Ala Leu Leu Lys Asn Lys Thr Ile Ile Leu Thr Thr Asn Thr Val

820 825 830

Ser Ile Leu Lys His Ser Gln Met Ile Tyr Ala Leu Glu Asn Gly Glu

835 840 845

Ile Val Glu Gln Gly Asn Tyr Glu Asp Val Met Asn Arg Lys Asn Asn

850 855 860

Thr Ser Lys Leu Lys Lys Leu Leu Glu Glu Phe Asp Ser Pro Ile Asp

865 870 875 880

Asn Gly Asn Glu Ser Asp Val Gln Thr Glu His Arg Ser Glu Ser Glu

885 890 895

Val Asp Glu Pro Leu Gln Leu Lys Val Thr Glu Ser Glu Thr Glu Asp

900 905 910

Glu Val Val Thr Glu Ser Glu Leu Glu Leu Ile Lys Ala Asn Ser Arg

915 920 925

Arg Ala Ser Leu Ala Thr Leu Arg Pro Arg Pro Phe Val Gly Ala Gln

930 935 940

Leu Asp Ser Val Lys Lys Thr Ala Gln Glu Ala Glu Lys Thr Glu Val

945 950 955 960

Gly Arg Val Lys Thr Lys Val Tyr Leu Ala Tyr Ile Lys Ala Cys Gly

965 970 975

Val Leu Gly Val Val Leu Phe Phe Leu Phe Met Ile Leu Thr Arg Val

980 985 990

Phe Asp Leu Ala Glu Asn Phe Trp Leu Lys Tyr Trp Ser Glu Ser Asn

995 1000 1005

Glu Lys Asn Gly Ser Asn Glu Arg Val Trp Met Phe Val Gly Val

1010 1015 1020

Tyr Ser Leu Ile Gly Val Ala Ser Ala Ala Phe Asn Asn Leu Arg

1025 1030 1035

Ser Ile Met Met Leu Leu Tyr Cys Ser Ile Arg Gly Ser Lys Lys

1040 1045 1050

Leu His Glu Ser Met Ala Lys Ser Val Ile Arg Ser Pro Met Thr

1055 1060 1065

Phe Phe Glu Thr Thr Pro Val Gly Arg Ile Ile Asn Arg Phe Ser

1070 1075 1080

Ser Asp Met Asp Ala Val Asp Ser Asn Leu Gln Tyr Ile Phe Ser

1085 1090 1095

Phe Phe Phe Lys Ser Ile Leu Thr Tyr Leu Val Thr Val Ile Leu

1100 1105 1110

Val Gly Tyr Asn Met Pro Trp Phe Leu Val Phe Asn Met Phe Leu

1115 1120 1125

Val Val Ile Tyr Ile Tyr Tyr Gln Thr Phe Tyr Ile Val Leu Ser

1130 1135 1140

Arg Glu Leu Lys Arg Leu Ile Ser Ile Ser Tyr Ser Pro Ile Met

1145 1150 1155

Ser Leu Met Ser Glu Ser Leu Asn Gly Tyr Ser Ile Ile Asp Ala

1160 1165 1170

Tyr Asp His Phe Glu Arg Phe Ile Tyr Leu Asn Tyr Glu Lys Ile

1175 1180 1185

Gln Tyr Asn Val Asp Phe Val Phe Asn Phe Arg Ser Thr Asn Arg

1190 1195 1200

Trp Leu Ser Val Arg Leu Gln Thr Ile Gly Ala Thr Ile Val Leu

1205 1210 1215

Ala Thr Ala Ile Leu Ala Leu Ala Thr Met Asn Thr Lys Arg Gln

1220 1225 1230

Leu Ser Ser Gly Met Val Gly Leu Leu Met Ser Tyr Ser Leu Glu

1235 1240 1245

Val Thr Gly Ser Leu Thr Trp Ile Val Arg Thr Thr Val Met Ile

1250 1255 1260

Glu Thr Asn Ile Val Ser Val Glu Arg Ile Val Glu Tyr Cys Glu

1265 1270 1275

Leu Pro Pro Glu Ala Gln Ser Ile Asn Pro Glu Lys Arg Pro Asp

1280 1285 1290

Glu Asn Trp Pro Ser Lys Gly Gly Ile Glu Phe Lys Asn Tyr Ser

1295 1300 1305

Thr Lys Tyr Arg Glu Asn Leu Asp Pro Val Leu Asn Asn Ile Asn

1310 1315 1320

Val Lys Ile Glu Pro Cys Glu Lys Val Gly Ile Val Gly Arg Thr

1325 1330 1335

Gly Ala Gly Lys Ser Thr Leu Ser Leu Ala Leu Phe Arg Ile Leu

1340 1345 1350

Glu Pro Thr Glu Gly Lys Ile Ile Ile Asp Gly Ile Asp Ile Ser

1355 1360 1365

Asp Ile Gly Leu Phe Asp Leu Arg Ser His Leu Ala Ile Ile Pro

1370 1375 1380

Gln Asp Ala Gln Ala Phe Glu Gly Thr Val Lys Thr Asn Leu Asp

1385 1390 1395

Pro Phe Asn Arg Tyr Ser Glu Asp Glu Leu Lys Arg Ala Val Glu

1400 1405 1410

Gln Ala His Leu Lys Pro His Leu Glu Lys Met Leu His Ser Lys

1415 1420 1425

Pro Arg Gly Asp Asp Ser Asn Glu Glu Asp Gly Asn Val Asn Asp

1430 1435 1440

Ile Leu Asp Val Lys Ile Asn Glu Asn Gly Ser Asn Leu Ser Val

1445 1450 1455

Gly Gln Arg Gln Leu Leu Cys Leu Ala Arg Ala Leu Leu Asn Arg

1460 1465 1470

Ser Lys Ile Leu Val Leu Asp Glu Ala Thr Ala Ser Val Asp Met

1475 1480 1485

Glu Thr Asp Lys Ile Ile Gln Asp Thr Ile Arg Arg Glu Phe Lys

1490 1495 1500

Asp Arg Thr Ile Leu Thr Ile Ala His Arg Ile Asp Thr Val Leu

1505 1510 1515

Asp Ser Asp Lys Ile Ile Val Leu Asp Gln Gly Ser Val Arg Glu

1520 1525 1530

Phe Asp Ser Pro Ser Lys Leu Leu Ser Asp Lys Thr Ser Ile Phe

1535 1540 1545

Tyr Ser Leu Cys Glu Lys Gly Gly Tyr Leu Lys

1550 1555

<210> 7

<211> 1381

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_5 ABC-transporter

<400> 7

Met Thr Ser Pro Gly Ser Glu Lys Cys Thr Pro Arg Ser Asp Glu Asp

1 5 10 15

Leu Glu Arg Ser Glu Pro Gln Leu Gln Arg Arg Leu Leu Thr Pro Phe

20 25 30

Leu Leu Ser Lys Lys Val Pro Pro Ile Pro Lys Glu Asp Glu Arg Lys

35 40 45

Pro Tyr Pro Tyr Leu Lys Thr Asn Pro Leu Ser Gln Ile Leu Phe Trp

50 55 60

Trp Leu Asn Pro Leu Leu Arg Val Gly Tyr Lys Arg Thr Leu Asp Pro

65 70 75 80

Asn Asp Phe Tyr Tyr Leu Glu His Ser Gln Asp Ile Glu Thr Thr Tyr

85 90 95

Ser Asn Tyr Glu Met His Leu Ala Arg Ile Leu Glu Lys Asp Arg Ala

100 105 110

Lys Ala Arg Ala Lys Asp Pro Thr Leu Thr Asp Glu Asp Leu Lys Asn

115 120 125

Arg Glu Tyr Pro Lys Asn Ala Val Ile Lys Ala Leu Phe Leu Thr Phe

130 135 140

Lys Trp Lys Tyr Leu Trp Ser Ile Phe Leu Lys Leu Leu Ser Asp Ile

145 150 155 160

Val Leu Val Leu Asn Pro Leu Leu Ser Lys Ala Leu Ile Asn Phe Val

165 170 175

Asp Glu Lys Met Tyr Asn Pro Asp Met Ser Val Gly Arg Gly Val Gly

180 185 190

Tyr Ala Ile Gly Val Thr Phe Met Leu Gly Thr Ser Gly Ile Leu Ile

195 200 205

Asn His Phe Leu Tyr Leu Ser Leu Thr Val Gly Ala His Cys Lys Ala

210 215 220

Val Leu Thr Thr Ala Ile Met Asn Lys Ser Phe Arg Ala Ser Ala Lys

225 230 235 240

Ser Lys His Glu Tyr Pro Ser Gly Arg Val Thr Ser Leu Met Ser Thr

245 250 255

Asp Leu Ala Arg Ile Asp Leu Ala Ile Gly Phe Gln Pro Phe Ala Ile

260 265 270

Thr Val Pro Val Pro Ile Gly Val Ala Ile Ala Leu Leu Ile Val Asn

275 280 285

Ile Gly Val Ser Ala Leu Ala Gly Ile Ala Val Phe Leu Val Cys Ile

290 295 300

Val Val Ile Ser Ala Ser Ser Lys Ser Leu Leu Lys Met Arg Lys Gly

305 310 315 320

Ala Asn Gln Tyr Thr Asp Ala Arg Ile Ser Tyr Met Arg Glu Ile Leu

325 330 335

Gln Asn Met Arg Ile Ile Lys Phe Tyr Ser Trp Glu Asp Ala Tyr Glu

340 345 350

Lys Ser Val Val Thr Glu Arg Asn Ser Glu Met Ser Ile Ile Leu Lys

355 360 365

Met Gln Ser Ile Arg Asn Phe Leu Leu Ala Leu Ser Leu Ser Leu Pro

370 375 380

Ala Ile Ile Ser Met Val Ala Phe Leu Val Leu Tyr Gly Val Ser Asn

385 390 395 400

Asp Lys Asn Pro Gly Asn Ile Phe Ser Ser Ile Ser Leu Phe Ser Val

405 410 415

Leu Ala Gln Gln Thr Met Met Leu Pro Met Ala Leu Ala Thr Gly Ala

420 425 430

Asp Ala Lys Ile Gly Leu Glu Arg Leu Arg Gln Tyr Leu Gln Ser Gly

435 440 445

Asp Ile Glu Lys Glu Tyr Glu Asp His Glu Lys Pro Gly Asp Arg Asp

450 455 460

Val Val Leu Pro Asp Asn Val Ala Val Glu Leu Asn Asn Ala Ser Phe

465 470 475 480

Ile Trp Glu Lys Phe Asp Asp Ala Asp Asp Asn Asp Gly Asn Ser Glu

485 490 495

Lys Thr Lys Glu Val Val Val Thr Ser Lys Ser Ser Leu Thr Asp Ser

500 505 510

Ser His Ile Asp Lys Ser Thr Asp Ser Ala Asp Gly Glu Tyr Ile Lys

515 520 525

Ser Val Phe Glu Gly Phe Asn Asn Ile Asn Leu Thr Ile Lys Lys Gly

530 535 540

Glu Phe Val Ile Ile Thr Gly Pro Ile Gly Ser Gly Lys Ser Ser Leu

545 550 555 560

Leu Val Ala Leu Ala Gly Phe Met Lys Lys Thr Ser Gly Thr Leu Gly

565 570 575

Val Asn Gly Thr Met Leu Leu Cys Gly Gln Pro Trp Val Gln Asn Cys

580 585 590

Thr Val Arg Asp Asn Ile Leu Phe Gly Leu Glu Tyr Asp Glu Ala Arg

595 600 605

Tyr Asp Arg Val Val Glu Val Cys Ala Leu Gly Asp Asp Leu Lys Met

610 615 620

Phe Thr Ala Gly Asp Gln Thr Glu Ile Gly Glu Arg Gly Ile Thr Leu

625 630 635 640

Ser Gly Gly Gln Lys Ala Arg Ile Asn Leu Ala Arg Ala Val Tyr Ala

645 650 655

Asn Lys Asp Ile Ile Leu Leu Asp Asp Val Leu Ser Ala Val Asp Ala

660 665 670

Arg Val Gly Lys Leu Ile Val Asp Asp Cys Leu Thr Ser Phe Leu Gly

675 680 685

Asp Lys Thr Arg Ile Leu Ala Thr His Gln Leu Ser Leu Ile Glu Ala

690 695 700

Ala Asp Arg Val Ile Tyr Leu Asn Gly Asp Gly Thr Ile His Ile Gly

705 710 715 720

Thr Val Gln Glu Leu Leu Glu Ser Asn Glu Gly Phe Leu Lys Leu Met

725 730 735

Glu Phe Ser Arg Lys Ser Glu Ser Glu Asp Glu Glu Asp Val Glu Ala

740 745 750

Ala Asn Glu Lys Asp Val Ser Leu Gln Lys Ala Val Ser Val Val Gln

755 760 765

Glu Gln Asp Ala His Ala Gly Val Leu Ile Gly Gln Glu Glu Glu Arg Ala

770 775 780

Val Asn Gly Ile Glu Trp Asp Ile Tyr Lys Glu Tyr Leu His Glu Gly

785 790 795 800

Arg Gly Lys Leu Gly Ile Phe Ala Ile Pro Thr Ile Ile Met Leu Leu

805 810 815

Val Leu Asp Val Phe Thr Ser Ile Phe Val Asn Val Trp Leu Ser Phe

820 825 830

Trp Ile Ser His Lys Phe Lys Ala Arg Ser Asp Gly Phe Tyr Ile Gly

835 840 845

Leu Tyr Val Met Phe Val Ile Leu Ser Val Ile Trp Ile Thr Ala Glu

850 855 860

Phe Val Val Met Gly Tyr Phe Ser Ser Thr Ala Ala Arg Arg Leu Asn

865 870 875 880

Leu Lys Ala Met Lys Arg Val Leu His Thr Pro Met His Phe Leu Asp

885 890 895

Val Thr Pro Met Gly Arg Ile Leu Asn Arg Phe Thr Lys Asp Thr Asp

900 905 910

Val Leu Asp Asn Glu Ile Gly Glu Gln Ala Arg Met Phe Leu His Pro

915 920 925

Ala Ala Tyr Val Ile Gly Val Leu Ile Leu Cys Ile Ile Tyr Ile Pro

930 935 940

Trp Phe Ala Ile Ala Ile Pro Pro Leu Ala Ile Leu Phe Thr Phe Ile

945 950 955 960

Thr Asn Phe Tyr Ile Ala Ser Ser Arg Glu Val Lys Arg Ile Glu Ala

965 970 975

Ile Gln Arg Ser Leu Val Tyr Asn Asn Phe Asn Glu Val Leu Asn Gly

980 985 990

Leu Gln Thr Leu Lys Ala Tyr Asn Ala Thr Ser Arg Phe Met Glu Lys

995 1000 1005

Asn Lys Arg Leu Leu Asn Arg Met Asn Glu Ala Tyr Leu Leu Val

1010 1015 1020

Ile Ala Asn Gln Arg Trp Ile Ser Val Asn Leu Asp Leu Val Ser

1025 1030 1035

Cys Cys Phe Val Phe Leu Ile Ser Met Leu Ser Val Phe Arg Val

1040 1045 1050

Phe Asp Ile Asn Ala Ser Ser Val Gly Leu Val Val Thr Ser Val

1055 1060 1065

Leu Gln Ile Gly Gly Leu Met Ser Leu Ile Met Arg Ala Tyr Thr

1070 1075 1080

Thr Val Glu Asn Glu Met Asn Ser Val Glu Arg Leu Cys His Tyr

1085 1090 1095

Ala Asn Lys Leu Glu Gln Glu Ala Pro Tyr Ile Met Asn Glu Thr

1100 1105 1110

Lys Pro Arg Pro Thr Trp Pro Glu His Gly Ala Ile Glu Phe Lys

1115 1120 1125

His Ala Ser Met Arg Tyr Arg Glu Gly Leu Pro Leu Val Leu Lys

1130 1135 1140

Asp Leu Thr Ile Ser Val Lys Gly Gly Glu Lys Ile Gly Ile Cys

1145 1150 1155

Gly Arg Thr Gly Ala Gly Lys Ser Thr Ile Met Asn Ala Leu Tyr

1160 1165 1170

Arg Leu Thr Glu Leu Ala Glu Gly Ser Ile Thr Ile Asp Gly Val

1175 1180 1185

Glu Ile Ser Gln Leu Gly Leu Tyr Asp Leu Arg Ser Lys Leu Ala

1190 1195 1200

Ile Ile Pro Gln Asp Pro Val Leu Phe Arg Gly Thr Ile Arg Lys

1205 1210 1215

Asn Leu Asp Pro Phe Gly Gln Asn Asp Asp Glu Thr Leu Trp Asp

1220 1225 1230

Ala Leu Arg Arg Ser Gly Leu Val Glu Gly Ser Ile Leu Asn Thr

1235 1240 1245

Ile Lys Ser Gln Ser Lys Asp Asp Pro Asn Phe His Lys Phe His

1250 1255 1260

Leu Asp Gln Thr Val Glu Asp Glu Gly Ala Asn Phe Ser Leu Gly

1265 1270 1275

Glu Arg Gln Leu Ile Ala Leu Ala Arg Ala Leu Val Arg Asn Ser

1280 1285 1290

Lys Ile Leu Ile Leu Asp Glu Ala Thr Ser Ser Val Asp Tyr Glu

1295 1300 1305

Thr Asp Ser Lys Ile Gln Lys Thr Ile Ser Thr Glu Phe Ser His

1310 1315 1320

Cys Thr Ile Leu Cys Ile Ala His Arg Leu Lys Thr Ile Leu Thr

1325 1330 1335

Tyr Asp Arg Ile Leu Val Leu Glu Lys Gly Glu Val Glu Glu Phe

1340 1345 1350

Asp Thr Pro Arg Val Leu Tyr Ser Lys Asn Gly Val Phe Arg Gln

1355 1360 1365

Met Cys Glu Arg Ser Glu Ile Thr Ser Ala Asp Phe Val

1370 1375 1380

<210> 8

<211> 1650

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: T4_Fungal_8 ABC-transporter

<400> 8

Met Ser Gly Ser Asn Ser Asn Ser Asn Leu Asp Ala Ile Ser Asp Ser

1 5 10 15

Cys Pro Phe Trp Arg Tyr Asp Asp Ile Thr Glu Cys Gly Arg Val Gln

20 25 30

Tyr Ile Asn Tyr Tyr Leu Pro Ile Thr Leu Val Gly Val Ser Leu Leu

35 40 45

Tyr Leu Phe Lys Asn Ala Ile Gln His Tyr Tyr Arg Lys Pro Gln Glu

50 55 60

Ile Lys Pro Ser Val Ala Ser Glu Leu Leu Gly Ser Asn Leu Thr Asp

65 70 75 80

Leu Pro Asn Glu Asn Lys Pro Leu Leu Ser Glu Ser Thr Gln Ala Leu

85 90 95

Tyr Thr Asn Pro Asp Ser Asn Lys Thr Gly Phe Ser Leu Lys Glu Glu

100 105 110

His Phe Ser Ile Asn Lys Val Thr Leu Thr Glu Ile His Ser Asn Lys

115 120 125

His Asp Ala Val Lys Ile Val Arg Arg Asn Trp Leu Glu Lys Leu Arg

130 135 140

Val Phe Leu Glu Trp Val Leu Cys Ala Leu Gln Leu Cys Ile Tyr Ile

145 150 155 160

Ser Val Trp Ser Lys Tyr Thr Asn Thr Gln Glu Asp Phe Pro Met His

165 170 175

Ala Ser Ile Ser Gly Leu Met Leu Trp Ser Leu Leu Leu Leu Val Val

180 185 190

Ser Leu Arg Leu Ala Asn Ile Asn Gln Asn Ile Ser Trp Ile Asn Ser

195 200 205

Gly Pro Gly Asn Leu Trp Ala Leu Ser Phe Ala Cys Tyr Leu Ser Leu

210 215 220

Phe Cys Gly Ser Val Leu Pro Leu Arg Ser Ile Tyr Ile Gly His Ile

225 230 235 240

Thr Asp Glu Ile Ala Ser Thr Phe Tyr Lys Leu Gln Phe Tyr Leu Ser

245 250 255

Leu Thr Leu Phe Leu Leu Leu Phe Thr Ser Gln Ala Gly Asn Arg Phe

260 265 270

Ala Ile Ile Tyr Lys Ser Thr Pro Asp Ile Thr Pro Ser Pro Glu Pro

275 280 285

Ile Val Ser Ile Ala Ser Tyr Ile Thr Trp Ala Trp Val Asp Lys Phe

290 295 300

Leu Trp Lys Ala His Gln Asn Tyr Ile Glu Met Lys Asp Val Trp Gly

305 310 315 320

Leu Met Val Glu Asp Tyr Ser Ile Leu Val Ile Lys Arg Phe Asn His

325 330 335

Phe Val Gln Asn Lys Thr Lys Ser Arg Thr Phe Ser Phe Asn Leu Ile

340 345 350

His Phe Phe Met Lys Phe Ile Ala Ile Gln Gly Ala Trp Ala Thr Ile

355 360 365

Ser Ser Val Ile Ser Phe Val Pro Thr Met Leu Leu Arg Arg Ile Leu

370 375 380

Glu Tyr Val Glu Asp Gln Ser Thr Ala Pro Leu Asn Leu Ala Trp Met

385 390 395 400

Tyr Ile Phe Leu Met Phe Leu Ala Arg Ile Leu Thr Ala Ile Cys Ala

405 410 415

Ala Gln Ala Leu Phe Leu Gly Arg Arg Val Cys Ile Arg Met Lys Ala

420 425 430

Ile Ile Ile Ser Glu Ile Tyr Ser Lys Ala Leu Arg Arg Lys Ile Ser

435 440 445

Pro Asn Ser Thr Lys Glu Pro Thr Asp Val Val Asp Pro Gln Glu Leu

450 455 460

Asn Asp Lys Gln His Val Asp Gly Asp Glu Glu Ser Ala Thr Thr Ala

465 470 475 480

Asn Leu Gly Ala Ile Ile Asn Leu Met Ala Val Asp Ala Phe Lys Val

485 490 495

Ser Glu Ile Cys Ala Tyr Leu His Ser Phe Ile Glu Ala Ile Ile Met

500 505 510

Thr Ile Val Ala Leu Phe Leu Leu Tyr Arg Leu Ile Gly Trp Ser Ala

515 520 525

Leu Val Gly Ser Ala Met Ile Ile Cys Phe Leu Pro Leu Asn Phe Lys

530 535 540

Leu Ala Ser Leu Leu Gly Thr Leu Gln Lys Lys Ser Leu Ala Ile Thr

545 550 555 560

Asp Lys Arg Ile Gln Lys Leu Asn Glu Ala Phe Gln Ala Ile Arg Ile

565 570 575

Ile Lys Phe Phe Ser Trp Glu Glu Asn Phe Glu Lys Asp Ile Gln Asn

580 585 590

Thr Arg Asp Glu Glu Leu Asn Met Leu Leu Lys Arg Ser Ile Val Trp

595 600 605

Ala Leu Ser Ser Leu Val Trp Phe Ile Thr Pro Ser Ile Val Thr Ser

610 615 620

Ala Ser Phe Ala Val Tyr Ile Tyr Val Gln Gly Gln Thr Leu Thr Thr

625 630 635 640

Pro Val Ala Phe Thr Ala Leu Ser Leu Phe Ala Leu Leu Arg Asn Pro

645 650 655

Leu Asp Met Leu Ser Asp Met Leu Ser Phe Val Ile Gln Ser Lys Val

660 665 670

Ser Leu Asp Arg Val Gln Glu Phe Leu Asn Glu Glu Glu Glu Thr Lys Lys

675 680 685

Tyr Glu Gln Leu Thr Val Ser Arg Asn Lys Leu Gly Leu Gln Asn Ala

690 695 700

Thr Phe Thr Trp Asp Lys Asn Asn Gln Asp Phe Lys Leu Lys Asn Leu

705 710 715 720

Thr Ile Asp Phe Lys Ile Gly Lys Leu Asn Val Ile Val Gly Pro Thr

725 730 735

Gly Ser Gly Lys Thr Ser Leu Leu Met Gly Leu Leu Gly Glu Met Glu

740 745 750

Leu Leu Asn Gly Lys Val Phe Val Pro Ser Leu Asn Pro Arg Glu Glu

755 760 765

Leu Val Val Glu Ala Asp Gly Met Thr Asn Ser Ile Ala Tyr Cys Ser

770 775 780

Gln Ala Ala Trp Leu Leu Asn Asp Thr Val Arg Asn Asn Ile Leu Phe

785 790 795 800

Asn Ala Pro Tyr Asn Glu Asn Arg Tyr Asn Ala Val Ile Ser Ala Cys

805 810 815

Gly Leu Lys Arg Asp Phe Glu Ile Leu Ser Ala Gly Asp Gln Thr Glu

820 825 830

Ile Gly Glu Lys Gly Ile Thr Leu Ser Gly Gly Gln Lys Gln Arg Val

835 840 845

Ser Leu Ala Arg Ser Leu Tyr Ser Ser Ser Arg His Leu Leu Leu Asp

850 855 860

Asp Cys Leu Ser Ala Val Asp Ser His Thr Ala Leu Trp Ile Tyr Glu

865 870 875 880

Asn Cys Ile Thr Gly Pro Leu Met Glu Gly Arg Thr Cys Val Leu Val

885 890 895

Ser His Asn Val Ala Leu Thr Leu Lys Asn Ala Asp Trp Val Ile Ile

900 905 910

Met Glu Asn Gly Arg Val Lys Glu Gln Gly Glu Pro Val Glu Leu Leu

915 920 925

Gln Lys Gly Ser Leu Gly Asp Asp Ser Met Val Lys Ser Ser Ile Leu

930 935 940

Ser Arg Thr Ala Ser Ser Val Asn Ile Ser Glu Thr Asn Ser Lys Ile

945 950 955 960

Ser Ser Gly Pro Lys Ala Pro Ala Glu Ser Asp Asn Ala Asn Glu Glu

965 970 975

Ser Thr Thr Cys Gly Asp Arg Ser Lys Ser Ser Gly Lys Leu Ile Ala

980 985 990

Glu Glu Thr Lys Ser Asn Gly Val Val Ser Leu Asp Val Tyr Lys Trp

995 1000 1005

Tyr Ala Val Phe Phe Gly Gly Trp Lys Met Ile Ser Phe Leu Cys

1010 1015 1020

Phe Ile Phe Leu Phe Ala Gln Met Ile Ser Ile Ser Gln Ala Trp

1025 1030 1035

Trp Leu Arg Ala Trp Ala Ser Asn Asn Thr Leu Lys Val Phe Ser

1040 1045 1050

Asn Leu Gly Leu Gln Thr Met Arg Pro Phe Ala Leu Ser Leu Gln

1055 1060 1065

Gly Lys Glu Ala Ser Pro Val Thr Leu Ser Ala Val Phe Pro Asn

1070 1075 1080

Gly Ser Leu Thr Thr Ala Thr Glu Pro Asn His Ser Asn Ala Tyr

1085 1090 1095

Tyr Leu Ser Ile Tyr Leu Gly Ile Gly Val Phe Gln Ala Leu Cys

1100 1105 1110

Ser Ser Ser Lys Ala Ile Ile Asn Phe Val Ala Gly Ile Arg Ala

1115 1120 1125

Ser Arg Lys Ile Phe Asn Leu Leu Leu Lys Asn Val Leu Tyr Ala

1130 1135 1140

Lys Leu Arg Phe Phe Asp Ser Thr Pro Ile Gly Arg Ile Met Asn

1145 1150 1155

Arg Phe Ser Lys Asp Ile Glu Ser Ile Asp Gln Glu Leu Thr Pro

1160 1165 1170

Tyr Met Glu Gly Ala Phe Gly Ser Leu Ile Gln Cys Val Ser Thr

1175 1180 1185

Ile Ile Val Ile Ala Tyr Ile Thr Pro Gln Phe Leu Ile Val Ala

1190 1195 1200

Ala Ile Val Met Leu Leu Phe Tyr Phe Val Ala Tyr Phe Tyr Met

1205 1210 1215

Ser Gly Ala Arg Glu Leu Lys Arg Leu Glu Ser Met Ser Arg Ser

1220 1225 1230

Pro Ile His Gln His Phe Ser Glu Thr Leu Val Gly Ile Thr Thr

1235 1240 1245

Ile Arg Ala Phe Ser Asp Glu Arg Arg Phe Leu Val Asp Asn Met

1250 1255 1260

Lys Lys Ile Asp Asp Asn Asn Arg Pro Phe Phe Tyr Leu Trp Val

1265 1270 1275

Cys Asn Arg Trp Leu Ser Tyr Arg Ile Glu Leu Ile Gly Ala Leu

1280 1285 1290

Ile Val Leu Ala Ala Gly Ser Phe Ile Leu Leu Asn Ile Lys Ser

1295 1300 1305

Ile Asp Ser Gly Leu Ala Gly Ile Ser Leu Gly Phe Ala Ile Gln

1310 1315 1320

Phe Thr Asp Gly Ala Leu Trp Val Val Arg Leu Tyr Ser Asn Val

1325 1330 1335

Glu Met Asn Met Asn Ser Val Glu Arg Leu Lys Glu Tyr Thr Thr

1340 1345 1350

Ile Glu Gln Glu Pro Ser Asn Val Gly Ala Leu Val Pro Pro Cys

1355 1360 1365

Glu Trp Pro Gln Asn Gly Lys Ile Glu Val Lys Asp Leu Ser Leu

1370 1375 1380

Arg Tyr Ala Ala Gly Leu Pro Lys Val Ile Lys Asn Val Thr Phe

1385 1390 1395

Thr Val Asp Ser Lys Cys Lys Val Gly Ile Val Gly Arg Thr Gly

1400 1405 1410

Ala Gly Lys Ser Thr Ile Ile Thr Ala Leu Phe Arg Phe Leu Asp

1415 1420 1425

Pro Glu Thr Gly Tyr Ile Lys Ile Asp Asp Val Asp Ile Thr Thr

1430 1435 1440

Ile Gly Leu Lys Arg Leu Arg Gln Ser Ile Thr Ile Ile Pro Gln

1445 1450 1455

Asp Pro Thr Leu Phe Thr Gly Thr Leu Lys Thr Asn Leu Asp Pro

1460 1465 1470

Tyr Asn Glu Tyr Ser Glu Ala Glu Ile Phe Glu Ala Leu Lys Arg

1475 1480 1485

Val Asn Leu Val Ser Ser Glu Glu Leu Gly Asn Pro Ser Thr Ser

1490 1495 1500

Asp Ser Thr Ser Val His Ser Ala Asn Met Asn Lys Phe Leu Asp

1505 1510 1515

Leu Glu Asn Glu Val Ser Glu Gly Gly Ser Asn Leu Ser Gln Gly

1520 1525 1530

Gln Arg Gln Leu Ile Cys Leu Ala Arg Ser Leu Leu Arg Cys Pro

1535 1540 1545

Lys Val Ile Leu Leu Asp Glu Ala Thr Ala Ser Ile Asp Tyr Asn

1550 1555 1560

Ser Asp Ser Lys Ile Gln Ala Thr Ile Arg Glu Glu Phe Ser Asn

1565 1570 1575

Ser Thr Ile Leu Thr Ile Ala His Arg Leu Arg Ser Ile Ile Asp

1580 1585 1590

Tyr Asp Lys Ile Leu Val Met Asp Ala Gly Glu Val Lys Glu Tyr

1595 1600 1605

Asp His Pro Tyr Ser Leu Leu Leu Asn Arg Asp Ser Ile Phe Tyr

1610 1615 1620

His Met Cys Glu Asp Ser Gly Glu Leu Glu Val Leu Ile Gln Leu

1625 1630 1635

Ala Lys Glu Ser Phe Val Lys Lys Leu Asn Ala Asn

1640 1645 1650

<210> 9

<211> 320

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Bt.GGPPS

<400> 9

Met Leu Thr Ser Ser Lys Ser Ile Glu Ser Phe Pro Lys Asn Val Gln

1 5 10 15

Pro Tyr Gly Lys His Tyr Gln Asn Gly Leu Glu Pro Val Gly Lys Ser

20 25 30

Gln Glu Asp Ile Leu Leu Glu Pro Phe His Tyr Leu Cys Ser Asn Pro

35 40 45

Gly Lys Asp Val Arg Thr Lys Met Ile Glu Ala Phe Asn Ala Trp Leu

50 55 60

Lys Val Pro Lys Asp Asp Leu Ile Val Ile Thr Arg Val Ile Glu Met

65 70 75 80

Leu His Ser Ala Ser Leu Leu Ile Asp Asp Val Glu Asp Asp Ser Val

85 90 95

Leu Arg Arg Gly Val Pro Ala Ala His His Ile Tyr Gly Thr Pro Gln

100 105 110

Thr Ile Asn Cys Ala Asn Tyr Val Tyr Phe Leu Ala Leu Lys Glu Ile

115 120 125

Ala Lys Leu Asn Lys Pro Asn Met Ile Thr Ile Tyr Thr Asp Glu Leu

130 135 140

Ile Asn Leu His Arg Gly Gln Gly Met Glu Leu Phe Trp Arg Asp Thr

145 150 155 160

Leu Thr Cys Pro Thr Glu Lys Glu Phe Leu Asp Met Val Asn Asp Lys

165 170 175

Thr Gly Gly Leu Leu Arg Leu Ala Val Lys Leu Met Gln Glu Ala Ser

180 185 190

Gln Ser Gly Thr Asp Tyr Thr Gly Leu Val Ser Lys Ile Gly Ile His

195 200 205

Phe Gln Val Arg Asp Asp Tyr Met Asn Leu Gln Ser Lys Asn Tyr Ala

210 215 220

Asp Asn Lys Gly Phe Cys Glu Asp Leu Thr Glu Gly Lys Phe Ser Phe

225 230 235 240

Pro Ile Ile His Ser Ile Arg Ser Asp Pro Ser Asn Arg Gln Leu Leu

245 250 255

Asn Ile Leu Lys Gln Arg Ser Ser Ser Ile Glu Leu Lys Gln Phe Ala

260 265 270

Leu Gln Leu Leu Glu Asn Thr Asn Thr Phe Gln Tyr Cys Arg Asp Phe

275 280 285

Leu Arg Val Leu Glu Lys Glu Ala Arg Glu Glu Ile Lys Leu Leu Gly

290 295 300

Gly Asn Ile Met Leu Glu Lys Ile Met Asp Val Leu Ser Val Asn Glu

305 310 315 320

<210> 10

<211> 736

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Ent-Os.CDPS

<400> 10

Met Glu His Ala Arg Pro Pro Gly Gly Asp Asp Asp Val Ala Ala

1 5 10 15

Ser Thr Ser Glu Leu Pro Tyr Met Ile Glu Ser Ile Lys Ser Lys Leu

20 25 30

Arg Ala Ala Arg Asn Ser Leu Gly Glu Thr Thr Val Ser Ala Tyr Asp

35 40 45

Thr Ala Trp Ile Ala Leu Val Asn Arg Leu Asp Gly Gly Gly Glu Arg

50 55 60

Ser Pro Gln Phe Pro Glu Ala Ile Asp Trp Ile Ala Arg Asn Gln Leu

65 70 75 80

Pro Asp Gly Ser Trp Gly Asp Ala Gly Met Phe Ile Val Gln Asp Arg

85 90 95

Leu Ile Asn Thr Leu Gly Cys Val Val Ala Leu Ala Thr Trp Gly Val

100 105 110

His Glu Glu Gln Arg Ala Arg Gly Leu Ala Tyr Ile Gln Asp Asn Leu

115 120 125

Trp Arg Leu Gly Glu Asp Asp Glu Glu Trp Met Met Val Gly Phe Glu

130 135 140

Ile Thr Phe Pro Val Leu Leu Glu Lys Ala Lys Asn Leu Gly Leu Asp

145 150 155 160

Ile Asn Tyr Asp Asp Pro Ala Leu Gln Asp Ile Tyr Ala Lys Arg Gln

165 170 175

Leu Lys Leu Ala Lys Ile Pro Arg Glu Ala Leu His Ala Arg Pro Thr

180 185 190

Thr Leu Leu His Ser Leu Glu Gly Met Glu Asn Leu Asp Trp Glu Arg

195 200 205

Leu Leu Gln Phe Lys Cys Pro Ala Gly Ser Leu His Ser Ser Pro Ala

210 215 220

Ala Ser Ala Tyr Ala Leu Ser Glu Thr Gly Asp Lys Glu Leu Leu Glu

225 230 235 240

Tyr Leu Glu Thr Ala Ile Asn Asn Phe Asp Gly Gly Ala Pro Cys Thr

245 250 255

Tyr Pro Val Asp Asn Phe Asp Arg Leu Trp Ser Val Asp Arg Leu Arg

260 265 270

Arg Leu Gly Ile Ser Arg Tyr Phe Thr Ser Glu Ile Glu Glu Tyr Leu

275 280 285

Glu Tyr Ala Tyr Arg His Leu Ser Pro Asp Gly Met Ser Tyr Gly Gly

290 295 300

Leu Cys Pro Val Lys Asp Ile Asp Asp Thr Ala Met Ala Phe Arg Leu

305 310 315 320

Leu Arg Leu His Gly Tyr Asn Val Ser Ser Ser Val Phe Asn His Phe

325 330 335

Glu Lys Asp Gly Glu Tyr Phe Cys Phe Ala Gly Gln Ser Ser Gln Ser

340 345 350

Leu Thr Ala Met Tyr Asn Ser Tyr Arg Ala Ser Gln Ile Val Phe Pro

355 360 365

Gly Asp Asp Asp Gly Leu Glu Gln Leu Arg Ala Tyr Cys Arg Ala Phe

370 375 380

Leu Glu Glu Arg Arg Ala Thr Gly Asn Leu Arg Asp Lys Trp Val Ile

385 390 395 400

Ala Asn Gly Leu Pro Ser Glu Val Glu Tyr Ala Leu Asp Phe Pro Trp

405 410 415

Lys Ala Ser Leu Pro Arg Val Glu Thr Arg Val Tyr Leu Glu Gln Tyr

420 425 430

Gly Ala Ser Glu Asp Ala Trp Ile Gly Lys Gly Leu Tyr Arg Met Thr

435 440 445

Leu Val Asn Asn Asp Leu Tyr Leu Glu Ala Ala Lys Ala Asp Phe Thr

450 455 460

Asn Phe Gln Arg Leu Ser Arg Leu Glu Trp Leu Ser Leu Lys Arg Trp

465 470 475 480

Tyr Ile Arg Asn Asn Leu Gln Ala His Gly Val Thr Glu Gln Ser Val

485 490 495

Leu Arg Ala Tyr Phe Leu Ala Ala Ala Asn Ile Phe Glu Pro Asn Arg

500 505 510

Ala Ala Glu Arg Leu Gly Trp Ala Arg Thr Ala Ile Leu Ala Glu Ala

515 520 525

Ile Ala Ser His Leu Arg Gln Tyr Ser Ala Asn Gly Ala Ala Asp Gly

530 535 540

Met Thr Glu Arg Leu Ile Ser Gly Leu Ala Ser His Asp Trp Asp Trp

545 550 555 560

Arg Glu Ser Asn Asp Ser Ala Ala Arg Ser Leu Leu Tyr Ala Leu Asp

565 570 575

Glu Leu Ile Asp Leu His Ala Phe Gly Asn Ala Ser Asp Ser Leu Arg

580 585 590

Glu Ala Trp Lys Gln Trp Leu Met Ser Trp Thr Asn Glu Ser Gln Gly

595 600 605

Ser Thr Gly Gly Asp Thr Ala Leu Leu Leu Val Arg Thr Ile Glu Ile

610 615 620

Cys Ser Gly Arg His Gly Ser Ala Glu Gln Ser Leu Lys Asn Ser Glu

625 630 635 640

Asp Tyr Ala Arg Leu Glu Gln Ile Ala Ser Ser Met Cys Ser Lys Leu

645 650 655

Ala Thr Lys Ile Leu Ala Gln Asn Gly Gly Ser Met Asp Asn Val Glu

660 665 670

Gly Ile Asp Gln Glu Val Asp Val Glu Met Lys Glu Leu Ile Gln Arg

675 680 685

Val Tyr Gly Ser Ser Ser Asn Asp Val Ser Ser Val Thr Arg Gln Thr

690 695 700

Phe Leu Asp Val Val Lys Ser Phe Cys Tyr Val Ala His Cys Ser Pro

705 710 715 720

Glu Thr Ile Asp Gly His Ile Ser Lys Val Leu Phe Glu Asp Val Asn

725 730 735

<210> 11

<211> 757

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Ent-Pg.KS

<400> 11

Met Lys Arg Glu Gln Tyr Thr Ile Leu Asn Glu Lys Glu Ser Met Ala

1 5 10 15

Glu Glu Leu Ile Leu Arg Ile Lys Arg Met Phe Ser Glu Ile Glu Asn

20 25 30

Thr Gln Thr Ser Ala Ser Ala Tyr Asp Thr Ala Trp Val Ala Met Val

35 40 45

Pro Ser Leu Asp Ser Ser Gln Gln Pro Gln Phe Pro Gln Cys Leu Ser

50 55 60

Trp Ile Ile Asp Asn Gln Leu Leu Asp Gly Ser Trp Gly Ile Pro Tyr

65 70 75 80

Leu Ile Ile Lys Asp Arg Leu Cys His Thr Leu Ala Cys Val Ile Ala

85 90 95

Leu Arg Lys Trp Asn Ala Gly Asn Gln Asn Val Glu Thr Gly Leu Arg

100 105 110

Phe Leu Arg Glu Asn Ile Glu Gly Ile Val His Glu Asp Glu Tyr Thr

115 120 125

Pro Ile Gly Phe Gln Ile Ile Phe Pro Ala Met Leu Glu Glu Ala Arg

130 135 140

Gly Leu Gly Leu Glu Leu Pro Tyr Asp Leu Thr Pro Ile Lys Leu Met

145 150 155 160

Leu Thr His Arg Glu Lys Ile Met Lys Gly Lys Ala Ile Asp His Met

165 170 175

His Glu Tyr Asp Ser Ser Leu Ile Tyr Thr Val Glu Gly Ile His Lys

180 185 190

Ile Val Asp Trp Asn Lys Val Leu Lys His Gln Asn Lys Asp Gly Ser

195 200 205

Leu Phe Asn Ser Pro Ser Ala Thr Ala Cys Ala Leu Met His Thr Arg

210 215 220

Lys Ser Asn Cys Leu Glu Tyr Leu Ser Ser Met Leu Gln Lys Leu Gly

225 230 235 240

Asn Gly Val Pro Ser Val Tyr Pro Ile Asn Leu Tyr Ala Arg Ile Ser

245 250 255

Met Ile Asp Arg Leu Gln Arg Leu Gly Leu Ala Arg His Phe Arg Asn

260 265 270

Glu Ile Ile His Ala Leu Asp Asp Ile Tyr Arg Tyr Trp Met Gln Arg

275 280 285

Glu Thr Ser Arg Glu Gly Lys Ser Leu Thr Pro Asp Ile Val Ser Thr

290 295 300

Ser Ile Ala Phe Met Leu Leu Arg Leu His Gly Tyr Asp Val Pro Ala

305 310 315 320

Asp Val Phe Cys Cys Tyr Asp Leu His Ser Ile Glu Gln Ser Gly Glu

325 330 335

Ala Val Thr Ala Met Leu Ser Leu Tyr Arg Ala Ser Gln Ile Met Phe

340 345 350

Pro Gly Glu Thr Ile Leu Glu Glu Ile Lys Thr Val Ser Arg Lys Tyr

355 360 365

Leu Asp Lys Arg Lys Glu Asn Gly Gly Ile Tyr Asp His Asn Ile Val

370 375 380

Met Lys Asp Leu Arg Gly Glu Val Glu Tyr Ala Leu Ser Val Pro Trp

385 390 395 400

Tyr Ala Ser Leu Glu Arg Ile Glu Asn Arg Arg Tyr Ile Asp Gln Tyr

405 410 415

Gly Val Asn Asp Thr Trp Ile Ala Lys Thr Ser Tyr Lys Ile Pro Cys

420 425 430

Ile Ser Asn Asp Leu Phe Leu Ala Leu Ala Lys Gln Asp Tyr Asn Ile

435 440 445

Cys Gln Ala Ile Gln Gln Lys Glu Leu Arg Glu Leu Glu Arg Trp Phe

450 455 460

Ala Asp Asn Lys Phe Ser His Leu Asn Phe Ala Arg Gln Lys Leu Ile

465 470 475 480

Tyr Cys Tyr Phe Ser Ala Ala Ala Thr Leu Phe Ser Pro Glu Leu Ser

485 490 495

Ala Ala Arg Val Val Trp Ala Lys Asn Gly Val Ile Thr Thr Val Val

500 505 510

Asp Asp Phe Phe Asp Val Gly Gly Ser Ser Glu Glu Ile His Ser Phe

515 520 525

Val Glu Ala Val Arg Val Trp Asp Glu Ala Ala Thr Asp Gly Leu Ser

530 535 540

Glu Asn Val Gln Ile Leu Phe Ser Ala Leu Tyr Asn Thr Val Asp Glu

545 550 555 560

Ile Val Gln Gln Ala Phe Val Phe Gln Gly Arg Asp Ile Ser Ile His

565 570 575

Leu Arg Glu Ile Trp Tyr Arg Leu Val Asn Ser Met Met Thr Glu Ala

580 585 590

Gln Trp Ala Arg Thr His Cys Leu Pro Ser Met His Glu Tyr Met Glu

595 600 605

Asn Ala Glu Pro Ser Ile Ala Leu Glu Pro Ile Val Leu Ser Ser Leu

610 615 620

Tyr Phe Val Gly Pro Lys Leu Ser Glu Glu Ile Ile Cys His Pro Glu

625 630 635 640

Tyr Tyr Asn Leu Met His Leu Leu Asn Ile Cys Gly Arg Leu Leu Asn

645 650 655

Asp Ile Gln Gly Cys Lys Arg Glu Ala His Gln Gly Lys Leu Asn Ser

660 665 670

Val Thr Leu Tyr Met Glu Glu Asn Ser Gly Thr Thr Met Glu Asp Ala

675 680 685

Ile Val Tyr Leu Arg Lys Thr Ile Asp Glu Ser Arg Gln Leu Leu Leu

690 695 700

Lys Glu Val Leu Arg Pro Ser Ile Val Pro Arg Glu Cys Lys Gln Leu

705 710 715 720

His Trp Asn Met Met Arg Ile Leu Gln Leu Phe Tyr Leu Lys Asn Asp

725 730 735

Gly Phe Thr Ser Pro Thr Glu Met Leu Gly Tyr Val Asn Ala Val Ile

740 745 750

Val Asp Pro Ile Leu

755

<210> 12

<211> 499

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Ps.KO

<400> 12

Met Asp Thr Leu Thr Leu Ser Leu Gly Phe Leu Ser Leu Phe Leu Phe

1 5 10 15

Leu Phe Leu Leu Lys Arg Ser Thr His Lys His Ser Lys Leu Ser His

20 25 30

Val Pro Val Val Pro Gly Leu Pro Val Ile Gly Asn Leu Leu Gln Leu

35 40 45

Lys Glu Lys Lys Pro His Lys Thr Phe Thr Lys Met Ala Gln Lys Tyr

50 55 60

Gly Pro Ile Phe Ser Ile Lys Ala Gly Ser Ser Lys Ile Ile Val Leu

65 70 75 80

Asn Thr Ala His Leu Ala Lys Glu Ala Met Val Thr Arg Tyr Ser Ser

85 90 95

Ile Ser Lys Arg Lys Leu Ser Thr Ala Leu Thr Ile Leu Thr Ser Asp

100 105 110

Lys Cys Met Val Ala Met Ser Asp Tyr Asn Asp Phe His Lys Met Val

115 120 125

Lys Lys His Ile Leu Ala Ser Val Leu Gly Ala Asn Ala Gln Lys Arg

130 135 140

Leu Arg Phe His Arg Glu Val Met Met Glu Asn Met Ser Ser Lys Phe

145 150 155 160

Asn Glu His Val Lys Thr Leu Ser Asp Ser Ala Val Asp Phe Arg Lys

165 170 175

Ile Phe Val Ser Glu Leu Phe Gly Leu Ala Leu Lys Gln Ala Leu Gly

180 185 190

Ser Asp Ile Glu Ser Ile Tyr Val Glu Gly Leu Thr Ala Thr Leu Ser

195 200 205

Arg Glu Asp Leu Tyr Asn Thr Leu Val Val Asp Phe Met Glu Gly Ala

210 215 220

Ile Glu Val Asp Trp Arg Asp Phe Phe Pro Tyr Leu Lys Trp Ile Pro

225 230 235 240

Asn Lys Ser Phe Glu Lys Lys Ile Arg Arg Val Asp Arg Gln Arg Lys

245 250 255

Ile Ile Met Lys Ala Leu Ile Asn Glu Gln Lys Lys Arg Leu Thr Ser

260 265 270

Gly Lys Glu Leu Asp Cys Tyr Tyr Asp Tyr Leu Val Ser Glu Ala Lys

275 280 285

Glu Val Thr Glu Glu Gln Met Ile Met Leu Leu Trp Glu Pro Ile Ile

290 295 300

Glu Thr Ser Asp Thr Thr Leu Val Thr Thr Glu Trp Ala Met Tyr Glu

305 310 315 320

Leu Ala Lys Asp Lys Asn Arg Gln Asp Arg Leu Tyr Glu Glu Leu Leu

325 330 335

Asn Val Cys Gly His Glu Lys Val Thr Asp Glu Glu Leu Ser Lys Leu

340 345 350

Pro Tyr Leu Gly Ala Val Phe His Glu Thr Leu Arg Lys His Ser Pro

355 360 365

Val Pro Ile Val Pro Leu Arg Tyr Val Asp Glu Asp Thr Glu Leu Gly

370 375 380

Gly Tyr His Ile Pro Ala Gly Ser Glu Ile Ala Ile Asn Ile Tyr Gly

385 390 395 400

Cys Asn Met Asp Ser Asn Leu Trp Glu Asn Pro Asp Gln Trp Ile Pro

405 410 415

Glu Arg Phe Leu Asp Glu Lys Tyr Ala Gln Ala Asp Leu Tyr Lys Thr

420 425 430

Met Ala Phe Gly Gly Gly Lys Arg Val Cys Ala Gly Ser Leu Gln Ala

435 440 445

Met Leu Ile Ala Cys Thr Ala Ile Gly Arg Leu Val Gln Glu Phe Glu

450 455 460

Trp Glu Leu Gly His Gly Glu Glu Glu Asn Val Asp Thr Met Gly Leu

465 470 475 480

Thr Thr His Arg Leu His Pro Leu Gln Val Lys Leu Lys Pro Arg Asn

485 490 495

Arg Ile Tyr

<210> 13

<211> 500

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Sr.KAH

<400> 13

Met Glu Ala Ser Tyr Leu Tyr Ile Ser Ile Leu Leu Leu Leu Ala Ser

1 5 10 15

Tyr Leu Phe Thr Thr Gln Leu Arg Arg Lys Ser Ala Asn Leu Pro Pro

20 25 30

Thr Val Phe Pro Ser Ile Pro Ile Ile Gly His Leu Tyr Leu Leu Lys

35 40 45

Lys Pro Leu Tyr Arg Thr Leu Ala Lys Ile Ala Ala Lys Tyr Gly Pro

50 55 60

Ile Leu Gln Leu Gln Leu Gly Tyr Arg Arg Val Leu Val Ile Ser Ser

65 70 75 80

Pro Ser Ala Ala Glu Glu Cys Phe Thr Asn Asn Asp Val Ile Phe Ala

85 90 95

Asn Arg Pro Lys Thr Leu Phe Gly Lys Ile Val Gly Gly Thr Ser Leu

100 105 110

Gly Ser Leu Ser Tyr Gly Asp Gln Trp Arg Asn Leu Arg Arg Val Ala

115 120 125

Ser Ile Glu Ile Leu Ser Val His Arg Leu Asn Glu Phe His Asp Ile

130 135 140

Arg Val Asp Glu Asn Arg Leu Leu Ile Arg Lys Leu Arg Ser Ser Ser

145 150 155 160

Ser Pro Val Thr Leu Ile Thr Val Phe Tyr Ala Leu Thr Leu Asn Val

165 170 175

Ile Met Arg Met Ile Ser Gly Lys Arg Tyr Phe Asp Ser Gly Asp Arg

180 185 190

Glu Leu Glu Glu Glu Gly Lys Arg Phe Arg Glu Ile Leu Asp Glu Thr

195 200 205

Leu Leu Leu Ala Gly Ala Ser Asn Val Gly Asp Tyr Leu Pro Ile Leu

210 215 220

Asn Trp Leu Gly Val Lys Ser Leu Glu Lys Lys Leu Ile Ala Leu Gln

225 230 235 240

Lys Lys Arg Asp Asp Phe Phe Gln Gly Leu Ile Glu Gln Val Arg Lys

245 250 255

Ser Arg Gly Ala Lys Val Gly Lys Gly Arg Lys Thr Met Ile Glu Leu

260 265 270

Leu Leu Ser Leu Gln Glu Ser Glu Pro Glu Tyr Tyr Thr Asp Ala Met

275 280 285

Ile Arg Ser Phe Val Leu Gly Leu Leu Ala Ala Gly Ser Asp Thr Ser

290 295 300

Ala Gly Thr Met Glu Trp Ala Met Ser Leu Leu Val Asn His Pro His

305 310 315 320

Val Leu Lys Lys Ala Gln Ala Glu Ile Asp Arg Val Ile Gly Asn Asn

325 330 335

Arg Leu Ile Asp Glu Ser Asp Ile Gly Asn Ile Pro Tyr Ile Gly Cys

340 345 350

Ile Ile Asn Glu Thr Leu Arg Leu Tyr Pro Ala Gly Pro Leu Leu Phe

355 360 365

Pro His Glu Ser Ser Ala Asp Cys Val Ile Ser Gly Tyr Asn Ile Pro

370 375 380

Arg Gly Thr Met Leu Ile Val Asn Gln Trp Ala Ile His His Asp Pro

385 390 395 400

Lys Val Trp Asp Asp Pro Glu Thr Phe Lys Pro Glu Arg Phe Gln Gly

405 410 415

Leu Glu Gly Thr Arg Asp Gly Phe Lys Leu Met Pro Phe Gly Ser Gly

420 425 430

Arg Arg Gly Cys Pro Gly Glu Gly Leu Ala Ile Arg Leu Leu Gly Met

435 440 445

Thr Leu Gly Ser Val Ile Gln Cys Phe Asp Trp Glu Arg Val Gly Asp

450 455 460

Glu Met Val Asp Met Thr Glu Gly Leu Gly Val Thr Leu Pro Lys Ala

465 470 475 480

Val Pro Leu Val Ala Lys Cys Lys Pro Arg Ser Glu Met Thr Asn Leu

485 490 495

Leu Ser Glu Leu

500

<210> 14

<211> 711

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: At.CPR

<400> 14

Met Ser Ser Ser Ser Ser Ser Ser Ser Thr Ser Met Ile Asp Leu Met Ala

1 5 10 15

Ala Ile Ile Lys Gly Glu Pro Val Ile Val Ser Asp Pro Ala Asn Ala

20 25 30

Ser Ala Tyr Glu Ser Val Ala Ala Glu Leu Ser Ser Met Leu Ile Glu

35 40 45

Asn Arg Gln Phe Ala Met Ile Val Thr Thr Ser Ile Ala Val Leu Ile

50 55 60

Gly Cys Ile Val Met Leu Val Trp Arg Arg Ser Gly Ser Gly Asn Ser

65 70 75 80

Lys Arg Val Glu Pro Leu Lys Pro Leu Val Ile Lys Pro Arg Glu Glu

85 90 95

Glu Ile Asp Asp Gly Arg Lys Lys Val Thr Ile Phe Phe Gly Thr Gln

100 105 110

Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Gly Glu Glu Ala Lys

115 120 125

Ala Arg Tyr Glu Lys Thr Arg Phe Lys Ile Val Asp Leu Asp Asp Tyr

130 135 140

Ala Ala Asp Asp Asp Glu Tyr Glu Glu Lys Leu Lys Lys Glu Asp Val

145 150 155 160

Ala Phe Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn

165 170 175

Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Gly Asn Asp Arg Gly Glu

180 185 190

Trp Leu Lys Asn Leu Lys Tyr Gly Val Phe Gly Leu Gly Asn Arg Gln

195 200 205

Tyr Glu His Phe Asn Lys Val Ala Lys Val Val Asp Asp Ile Leu Val

210 215 220

Glu Gln Gly Ala Gln Arg Leu Val Gln Val Gly Leu Gly Asp Asp Asp

225 230 235 240

Gln Cys Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Ala Leu Trp Pro

245 250 255

Glu Leu Asp Thr Ile Leu Arg Glu Glu Gly Asp Thr Ala Val Ala Thr

260 265 270

Pro Tyr Thr Ala Ala Val Leu Glu Tyr Arg Val Ser Ile His Asp Ser

275 280 285

Glu Asp Ala Lys Phe Asn Asp Ile Asn Met Ala Asn Gly Asn Gly Tyr

290 295 300

Thr Val Phe Asp Ala Gln His Pro Tyr Lys Ala Asn Val Ala Val Lys

305 310 315 320

Arg Glu Leu His Thr Pro Glu Ser Asp Arg Ser Cys Ile His Leu Glu

325 330 335

Phe Asp Ile Ala Gly Ser Gly Leu Thr Tyr Glu Thr Gly Asp His Val

340 345 350

Gly Val Leu Cys Asp Asn Leu Ser Glu Thr Val Asp Glu Ala Leu Arg

355 360 365

Leu Leu Asp Met Ser Pro Asp Thr Tyr Phe Ser Leu His Ala Glu Lys

370 375 380

Glu Asp Gly Thr Pro Ile Ser Ser Ser Leu Pro Pro Pro Phe Pro Pro

385 390 395 400

Cys Asn Leu Arg Thr Ala Leu Thr Arg Tyr Ala Cys Leu Leu Ser Ser

405 410 415

Pro Lys Lys Ser Ala Leu Val Ala Leu Ala Ala His Ala Ser Asp Pro

420 425 430

Thr Glu Ala Glu Arg Leu Lys His Leu Ala Ser Pro Ala Gly Lys Asp

435 440 445

Glu Tyr Ser Lys Trp Val Val Glu Ser Gln Arg Ser Leu Leu Glu Val

450 455 460

Met Ala Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala

465 470 475 480

Gly Val Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser Ser Ser

485 490 495

Pro Lys Ile Ala Glu Thr Arg Ile His Val Thr Cys Ala Leu Val Tyr

500 505 510

Glu Lys Met Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr Trp

515 520 525

Met Lys Asn Ala Val Pro Tyr Glu Lys Ser Glu Asn Cys Ser Ser Ala

530 535 540

Pro Ile Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asp Ser Lys

545 550 555 560

Val Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg

565 570 575

Gly Phe Leu Gln Glu Arg Leu Ala Leu Val Glu Ser Gly Val Glu Leu

580 585 590

Gly Pro Ser Val Leu Phe Phe Gly Cys Arg Asn Arg Arg Met Asp Phe

595 600 605

Ile Tyr Glu Glu Glu Glu Leu Gln Arg Phe Val Glu Ser Gly Ala Leu Ala

610 615 620

Glu Leu Ser Val Ala Phe Ser Arg Glu Gly Pro Thr Lys Glu Tyr Val

625 630 635 640

Gln His Lys Met Met Asp Lys Ala Ser Asp Ile Trp Asn Met Ile Ser

645 650 655

Gln Gly Ala Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala Arg

660 665 670

Asp Val His Arg Ser Leu His Thr Ile Ala Gln Glu Gln Gly Ser Met

675 680 685

Asp Ser Thr Lys Ala Glu Gly Phe Val Lys Asn Leu Gln Thr Ser Gly

690 695 700

Arg Tyr Leu Arg Asp Val Trp

705 710

<210> 15

<211> 481

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: UGT85C2

<400> 15

Met Asp Ala Met Ala Thr Thr Glu Lys Lys Pro His Val Ile Phe Ile

1 5 10 15

Pro Phe Pro Ala Gln Ser His Ile Lys Ala Met Leu Lys Leu Ala Gln

20 25 30

Leu Leu His His Lys Gly Leu Gln Ile Thr Phe Val Asn Thr Asp Phe

35 40 45

Ile His Asn Gln Phe Leu Glu Ser Ser Gly Pro His Cys Leu Asp Gly

50 55 60

Ala Pro Gly Phe Arg Phe Glu Thr Ile Pro Asp Gly Val Ser His Ser

65 70 75 80

Pro Glu Ala Ser Ile Pro Ile Arg Glu Ser Leu Leu Arg Ser Ile Glu

85 90 95

Thr Asn Phe Leu Asp Arg Phe Ile Asp Leu Val Thr Lys Leu Pro Asp

100 105 110

Pro Pro Thr Cys Ile Ile Ser Asp Gly Phe Leu Ser Val Phe Thr Ile

115 120 125

Asp Ala Ala Lys Lys Leu Gly Ile Pro Val Met Met Tyr Trp Thr Leu

130 135 140

Ala Ala Cys Gly Phe Met Gly Phe Tyr His Ile His Ser Leu Ile Glu

145 150 155 160

Lys Gly Phe Ala Pro Leu Lys Asp Ala Ser Tyr Leu Thr Asn Gly Tyr

165 170 175

Leu Asp Thr Val Ile Asp Trp Val Pro Gly Met Glu Gly Ile Arg Leu

180 185 190

Lys Asp Phe Pro Leu Asp Trp Ser Thr Asp Leu Asn Asp Lys Val Leu

195 200 205

Met Phe Thr Thr Glu Ala Pro Gln Arg Ser His Lys Val Ser His His

210 215 220

Ile Phe His Thr Phe Asp Glu Leu Glu Pro Ser Ile Ile Lys Thr Leu

225 230 235 240

Ser Leu Arg Tyr Asn His Ile Tyr Thr Ile Gly Pro Leu Gln Leu Leu

245 250 255

Leu Asp Gln Ile Pro Glu Glu Lys Lys Gln Thr Gly Ile Thr Ser Leu

260 265 270

His Gly Tyr Ser Leu Val Lys Glu Glu Pro Glu Cys Phe Gln Trp Leu

275 280 285

Gln Ser Lys Glu Pro Asn Ser Val Val Tyr Val Asn Phe Gly Ser Thr

290 295 300

Thr Val Met Ser Leu Glu Asp Met Thr Glu Phe Gly Trp Gly Leu Ala

305 310 315 320

Asn Ser Asn His Tyr Phe Leu Trp Ile Ile Arg Ser Asn Leu Val Ile

325 330 335

Gly Glu Asn Ala Val Leu Pro Pro Glu Leu Glu Glu His Ile Lys Lys

340 345 350

Arg Gly Phe Ile Ala Ser Trp Cys Ser Gln Glu Lys Val Leu Lys His

355 360 365

Pro Ser Val Gly Gly Phe Leu Thr His Cys Gly Trp Gly Ser Thr Ile

370 375 380

Glu Ser Leu Ser Ala Gly Val Pro Met Ile Cys Trp Pro Tyr Ser Trp

385 390 395 400

Asp Gln Leu Thr Asn Cys Arg Tyr Ile Cys Lys Glu Trp Glu Val Gly

405 410 415

Leu Glu Met Gly Thr Lys Val Lys Arg Asp Glu Val Lys Arg Leu Val

420 425 430

Gln Glu Leu Met Gly Glu Gly Gly His Lys Met Arg Asn Lys Ala Lys

435 440 445

Asp Trp Lys Glu Lys Ala Arg Ile Ala Ile Ala Pro Asn Gly Ser Ser

450 455 460

Ser Leu Asn Ile Asp Lys Met Val Lys Glu Ile Thr Val Leu Ala Arg

465 470 475 480

Asn

<210> 16

<211> 460

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: UGT74G1

<400> 16

Met Ala Glu Gln Gln Lys Ile Lys Lys Ser Pro His Val Leu Leu Ile

1 5 10 15

Pro Phe Pro Leu Gln Gly His Ile Asn Pro Phe Ile Gln Phe Gly Lys

20 25 30

Arg Leu Ile Ser Lys Gly Val Lys Thr Thr Leu Val Thr Thr Ile His

35 40 45

Thr Leu Asn Ser Thr Leu Asn His Ser Asn Thr Thr Thr Thr Ser Ile

50 55 60

Glu Ile Gln Ala Ile Ser Asp Gly Cys Asp Glu Gly Gly Phe Met Ser

65 70 75 80

Ala Gly Glu Ser Tyr Leu Glu Thr Phe Lys Gln Val Gly Ser Lys Ser

85 90 95

Leu Ala Asp Leu Ile Lys Lys Leu Gln Ser Glu Gly Thr Thr Ile Asp

100 105 110

Ala Ile Ile Tyr Asp Ser Met Thr Glu Trp Val Leu Asp Val Ala Ile

115 120 125

Glu Phe Gly Ile Asp Gly Gly Ser Phe Phe Thr Gln Ala Cys Val Val

130 135 140

Asn Ser Leu Tyr Tyr His Val His Lys Gly Leu Ile Ser Leu Pro Leu

145 150 155 160

Gly Glu Thr Val Ser Val Pro Gly Phe Pro Val Leu Gln Arg Trp Glu

165 170 175

Thr Pro Leu Ile Leu Gln Asn His Glu Gln Ile Gln Ser Pro Trp Ser

180 185 190

Gln Met Leu Phe Gly Gln Phe Ala Asn Ile Asp Gln Ala Arg Trp Val

195 200 205

Phe Thr Asn Ser Phe Tyr Lys Leu Glu Glu Glu Val Ile Glu Trp Thr

210 215 220

Arg Lys Ile Trp Asn Leu Lys Val Ile Gly Pro Thr Leu Pro Ser Met

225 230 235 240

Tyr Leu Asp Lys Arg Leu Asp Asp Asp Lys Asp Asn Gly Phe Asn Leu

245 250 255

Tyr Lys Ala Asn His Glu Cys Met Asn Trp Leu Asp Asp Lys Pro

260 265 270

Lys Glu Ser Val Val Tyr Val Ala Phe Gly Ser Leu Val Lys His Gly

275 280 285

Pro Glu Gln Val Glu Glu Ile Thr Arg Ala Leu Ile Asp Ser Asp Val

290 295 300

Asn Phe Leu Trp Val Ile Lys His Lys Glu Glu Gly Lys Leu Pro Glu

305 310 315 320

Asn Leu Ser Glu Val Ile Lys Thr Gly Lys Gly Leu Ile Val Ala Trp

325 330 335

Cys Lys Gln Leu Asp Val Leu Ala His Glu Ser Val Gly Cys Phe Val

340 345 350

Thr His Cys Gly Phe Asn Ser Thr Leu Glu Ala Ile Ser Leu Gly Val

355 360 365

Pro Val Val Ala Met Pro Gln Phe Ser Asp Gln Thr Thr Asn Ala Lys

370 375 380

Leu Leu Asp Glu Ile Leu Gly Val Gly Val Arg Val Lys Ala Asp Glu

385 390 395 400

Asn Gly Ile Val Arg Arg Gly Asn Leu Ala Ser Cys Ile Lys Met Ile

405 410 415

Met Glu Glu Glu Glu Arg Gly Val Ile Ile Arg Lys Asn Ala Val Lys Trp

420 425 430

Lys Asp Leu Ala Lys Val Ala Val His Glu Gly Gly Ser Ser Asp Asn

435 440 445

Asp Ile Val Glu Phe Val Ser Glu Leu Ile Lys Ala

450 455 460

<210> 17

<211> 485

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: UGT91D_like3

<400> 17

Met Tyr Asn Val Thr Tyr His Gln Asn Ser Lys Ala Met Ala Thr Ser

1 5 10 15

Asp Ser Ile Val Asp Asp Arg Lys Gln Leu His Val Ala Thr Phe Pro

20 25 30

Trp Leu Ala Phe Gly His Ile Leu Pro Tyr Leu Gln Leu Ser Lys Leu

35 40 45

Ile Ala Glu Lys Gly His Lys Val Ser Phe Leu Ser Thr Thr Arg Asn

50 55 60

Ile Gln Arg Leu Ser Ser His Ile Ser Pro Leu Ile Asn Val Val Gln

65 70 75 80

Leu Thr Leu Pro Arg Val Gln Glu Leu Pro Glu Asp Ala Glu Ala Thr

85 90 95

Thr Asp Val His Pro Glu Asp Ile Pro Tyr Leu Lys Lys Ala Ser Asp

100 105 110

Gly Leu Gln Pro Glu Val Thr Arg Phe Leu Glu Gln His Ser Pro Asp

115 120 125

Trp Ile Ile Tyr Asp Tyr Thr His Tyr Trp Leu Pro Ser Ile Ala Ala

130 135 140

Ser Leu Gly Ile Ser Arg Ala His Phe Ser Val Thr Thr Pro Trp Ala

145 150 155 160

Ile Ala Tyr Met Gly Pro Ser Ala Asp Ala Met Ile Asn Gly Ser Asp

165 170 175

Gly Arg Thr Thr Val Glu Asp Leu Thr Thr Pro Pro Lys Trp Phe Pro

180 185 190

Phe Pro Thr Lys Val Cys Trp Arg Lys His Asp Leu Ala Arg Leu Val

195 200 205

Pro Tyr Lys Ala Pro Gly Ile Ser Asp Gly Tyr Arg Met Gly Leu Val

210 215 220

Leu Lys Gly Ser Asp Cys Leu Leu Ser Lys Cys Tyr His Glu Phe Gly

225 230 235 240

Thr Gln Trp Leu Pro Leu Leu Glu Thr Leu His Gln Val Pro Val Val

245 250 255

Pro Val Gly Leu Leu Pro Glu Ile Pro Gly Asp Glu Lys Asp Glu

260 265 270

Thr Trp Val Ser Ile Lys Lys Trp Leu Asp Gly Lys Gln Lys Gly Ser

275 280 285

Val Val Tyr Val Ala Leu Gly Ser Glu Val Leu Val Ser Gln Thr Glu

290 295 300

Val Val Glu Leu Ala Leu Gly Leu Glu Leu Ser Gly Leu Pro Phe Val

305 310 315 320

Trp Ala Tyr Arg Lys Pro Lys Gly Pro Ala Lys Ser Asp Ser Val Glu

325 330 335

Leu Pro Asp Gly Phe Val Glu Arg Thr Arg Asp Arg Gly Leu Val Trp

340 345 350

Thr Ser Trp Ala Pro Gln Leu Arg Ile Leu Ser His Glu Ser Val Cys

355 360 365

Gly Phe Leu Thr His Cys Gly Ser Gly Ser Ile Val Glu Gly Leu Met

370 375 380

Phe Gly His Pro Leu Ile Met Leu Pro Ile Phe Gly Asp Gln Pro Leu

385 390 395 400

Asn Ala Arg Leu Leu Glu Asp Lys Gln Val Gly Ile Glu Ile Pro Arg

405 410 415

Asn Glu Glu Asp Gly Cys Leu Thr Lys Glu Ser Val Ala Arg Ser Leu

420 425 430

Arg Ser Val Val Val Glu Lys Glu Gly Glu Ile Tyr Lys Ala Asn Ala

435 440 445

Arg Glu Leu Ser Lys Ile Tyr Asn Asp Thr Lys Val Glu Lys Glu Tyr

450 455 460

Val Ser Gln Phe Val Asp Tyr Leu Glu Lys Asn Ala Arg Ala Val Ala

465 470 475 480

Ile Asp His Glu Ser

485

<210> 18

<211> 458

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: UGT76G1

<400> 18

Met Glu Asn Lys Thr Glu Thr Thr Val Arg Arg Arg Arg Arg Ile Ile

1 5 10 15

Leu Phe Pro Val Pro Phe Gln Gly His Ile Asn Pro Ile Leu Gln Leu

20 25 30

Ala Asn Val Leu Tyr Ser Lys Gly Phe Ser Ile Thr Ile Phe His Thr

35 40 45

Asn Phe Asn Lys Pro Lys Thr Ser Asn Tyr Pro His Phe Thr Phe Arg

50 55 60

Phe Ile Leu Asp Asn Asp Pro Gln Asp Glu Arg Ile Ser Asn Leu Pro

65 70 75 80

Thr His Gly Pro Leu Ala Gly Met Arg Ile Pro Ile Ile Asn Glu His

85 90 95

Gly Ala Asp Glu Leu Arg Arg Glu Leu Glu Leu Leu Met Leu Ala Ser

100 105 110

Glu Glu Asp Glu Glu Val Ser Cys Leu Ile Thr Asp Ala Leu Trp Tyr

115 120 125

Phe Ala Gln Ser Val Ala Asp Ser Leu Asn Leu Arg Arg Leu Val Leu

130 135 140

Met Thr Ser Ser Leu Phe Asn Phe His Ala His Val Ser Leu Pro Gln

145 150 155 160

Phe Asp Glu Leu Gly Tyr Leu Asp Pro Asp Asp Lys Thr Arg Leu Glu

165 170 175

Glu Gln Ala Ser Gly Phe Pro Met Leu Lys Val Lys Asp Ile Lys Ser

180 185 190

Ala Tyr Ser Asn Trp Gln Ile Leu Lys Glu Ile Leu Gly Lys Met Ile

195 200 205

Lys Gln Thr Lys Ala Ser Ser Gly Val Ile Trp Asn Ser Phe Lys Glu

210 215 220

Leu Glu Glu Ser Glu Leu Glu Thr Val Ile Arg Glu Ile Pro Ala Pro

225 230 235 240

Ser Phe Leu Ile Pro Leu Pro Lys His Leu Thr Ala Ser Ser Ser Ser

245 250 255

Leu Leu Asp His Asp Arg Thr Val Phe Gln Trp Leu Asp Gln Gln Pro

260 265 270

Pro Ser Ser Val Leu Tyr Val Ser Phe Gly Ser Thr Ser Glu Val Asp

275 280 285

Glu Lys Asp Phe Leu Glu Ile Ala Arg Gly Leu Val Asp Ser Lys Gln

290 295 300

Ser Phe Leu Trp Val Val Arg Pro Gly Phe Val Lys Gly Ser Thr Trp

305 310 315 320

Val Glu Pro Leu Pro Asp Gly Phe Leu Gly Glu Arg Gly Arg Ile Val

325 330 335

Lys Trp Val Pro Gln Gln Glu Val Leu Ala His Gly Ala Ile Gly Ala

340 345 350

Phe Trp Thr His Ser Gly Trp Asn Ser Thr Leu Glu Ser Val Cys Glu

355 360 365

Gly Val Pro Met Ile Phe Ser Asp Phe Gly Leu Asp Gln Pro Leu Asn

370 375 380

Ala Arg Tyr Met Ser Asp Val Leu Lys Val Gly Val Tyr Leu Glu Asn

385 390 395 400

Gly Trp Glu Arg Gly Glu Ile Ala Asn Ala Ile Arg Arg Val Met Val

405 410 415

Asp Glu Glu Gly Glu Tyr Ile Arg Gln Asn Ala Arg Val Leu Lys Gln

420 425 430

Lys Ala Asp Val Ser Leu Met Lys Gly Gly Ser Ser Tyr Glu Ser Leu

435 440 445

Glu Ser Leu Val Ser Tyr Ile Ser Ser Leu

450 455

<210> 19

<211> 436

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: UGT40087

<400> 19

Met Asp Ala Ser Asp Ser Ser Pro Leu His Ile Val Ile Phe Pro Trp

1 5 10 15

Leu Ala Phe Gly His Met Leu Ala Ser Leu Glu Leu Ala Glu Arg Leu

20 25 30

Ala Ala Arg Gly His Arg Val Ser Phe Val Ser Thr Pro Arg Asn Ile

35 40 45

Ser Arg Leu Arg Pro Val Pro Pro Ala Leu Ala Pro Leu Ile Asp Phe

50 55 60

Val Ala Leu Pro Leu Pro Arg Val Asp Gly Leu Pro Asp Gly Ala Glu

65 70 75 80

Ala Thr Ser Asp Ile Pro Pro Gly Lys Thr Glu Leu His Leu Lys Ala

85 90 95

Leu Asp Gly Leu Ala Ala Pro Phe Ala Ala Phe Leu Asp Ala Ala Cys

100 105 110

Ala Asp Gly Ser Thr Asn Lys Val Asp Trp Leu Phe Leu Asp Asn Phe

115 120 125

Gln Tyr Trp Ala Ala Ala Ala Ala Ala Asp His Lys Ile Pro Cys Ala

130 135 140

Leu Asn Leu Thr Phe Ala Ala Ser Thr Ser Ala Glu Tyr Gly Val Pro

145 150 155 160

Arg Val Glu Pro Pro Val Asp Gly Ser Thr Ala Ser Ile Leu Gln Arg

165 170 175

Phe Val Leu Thr Leu Glu Lys Cys Gln Phe Val Ile Gln Arg Ala Cys

180 185 190

Phe Glu Leu Glu Pro Glu Pro Leu Pro Leu Leu Ser Asp Ile Phe Gly

195 200 205

Lys Pro Val Ile Pro Tyr Gly Leu Val Pro Pro Cys Pro Pro Ala Glu

210 215 220

Gly His Lys Arg Glu His Gly Asn Ala Ala Leu Ser Trp Leu Asp Lys

225 230 235 240

Gln Gln Pro Glu Ser Val Leu Phe Ile Ala Leu Gly Ser Glu Pro Pro

245 250 255

Val Thr Val Glu Gln Leu His Glu Ile Ala Leu Gly Leu Glu Glu Leu Ala

260 265 270

Gly Thr Thr Phe Leu Trp Ala Leu Lys Lys Pro Asn Gly Leu Leu Leu

275 280 285

Glu Ala Asp Gly Asp Ile Leu Pro Pro Gly Phe Glu Glu Arg Thr Arg

290 295 300

Asp Arg Gly Leu Val Ala Met Gly Trp Val Pro Gln Pro Ile Ile Leu

305 310 315 320

Ala His Ser Ser Val Gly Ala Phe Leu Thr His Gly Gly Trp Ala Ser

325 330 335

Thr Ile Glu Gly Val Met Ser Gly His Pro Met Leu Phe Leu Thr Phe

340 345 350

Leu Asp Glu Gln Arg Ile Asn Ala Gln Leu Ile Glu Arg Lys Lys Ala

355 360 365

Gly Leu Arg Val Pro Arg Arg Glu Lys Asp Gly Ser Tyr Asp Arg Gln

370 375 380

Gly Ile Ala Gly Ala Ile Arg Ala Val Met Cys Glu Glu Glu Ser Lys

385 390 395 400

Ser Val Phe Ala Ala Asn Ala Lys Lys Met Gln Glu Ile Val Ser Asp

405 410 415

Arg Asn Cys Gln Glu Lys Tyr Ile Asp Glu Leu Ile Gln Arg Leu Gly

420 425 430

Ser Phe Glu Lys

435

<210> 20

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 20

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 21

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 21

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 22

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 22

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 23

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 23

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 24

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 24

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 25

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 25

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 26

<211> 4680

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 26

atgtcttcac tagaagtggt agatgggtgc ccctatggat accgaccata tccagatagt 60

ggcacaaatg cattaaatcc atgttttata tcagtaatat ccgcctggca agccgtcttt 120

ttcctattga ttggtagcta tcaattgtgg aaactttata agaacaataa agtaccaccc 180

agatttaaga actttcctac attaccaagt aaaatcaaca gtcgacatct aacgcatttg 240

accaatgttt gctttcagtc cacgcttata atttgtgaac tggccttggt atcccaatct 300

agcgataggg tttatccatt tatactaaag aaggctctgt acttgaatct ccttttcaat 360

ttgggtattt ctctccctac tcaatactta gcttatttta aaagtacatt ttcaatgggc 420

aaccagcttt tctattacat gtttcaaatt cttctacagc tcttcttgat attgcagagg 480

tactatcatg gttctagtaa cgaaaggctt actgttatta gcggacaaac tgctatgatt 540

ttagaagtgc tccttctttt caattctgtg gcaattttta tttatgatct atgcattttt 600

gagccaatta acgaattatc tgaatactac aagaaaaatg ggtggtatcc ccccgttcat 660

gtactatcct atattacatt tatctggatg aacaaactga ttgtggaaac ttaccgtaac 720

aagaaaatca aagatcctaa ccagttacca ttgccgccag tagatctgaa tattaagtcg 780

ataagtaagg aatttaaggc taactgggaa ttggaaaaat ggttgaatag aaattctctt 840

tggagggcca tttggaagtc atttggtagg actatttctg tggctatgct gtatgaaacg 900

acatctgatt tactttctgt agtacagccc cagtttctac ggatattcat agatggtttg 960

aacccgggaaa catcttctaa atatcctcct ttaaatggtg tatttattgc tctaaccctt 1020

ttcgtaatca gcgtggtttc tgtgttcctc accaatcaat tttatattgg aatttttgag 1080

gctggtttgg ggataagagg ctctttagct tctttagtgt atcagaagtc cttaagattg 1140

acgctagcag agcgtaacga aaaatctact ggtgacatct taaatttgat gtctgtggat 1200

1260

attattgttg tattaacttc cctgtactgg ttgctaggaa aggctgttat tggagggttg 1320

gttactatgg ctattatgat gcctatcaat gccttcttat ctagaaaggt aaaaaagcta 1380

tcaaaaactc aaatgaagta taaggacatg agaatcaaga ctattacaga gcttttgaat 1440

gctataaaat ctattaaatt atacgcctgg gaggaaccta tgatggcaag attgaatcat 1500

1560

tattttgcgt ggaattgtgt acctttaatg gtgacatgtt ccacatttgg cttattttct 1620

ttatttagtg attctccgtt atctcctgcc attgtcttcc cttcattatc tttatttaat 1680

attttgaaca gtgccatcta ttccgttcca tccatgataa ataccattat agagacaagc 1740

gtttctatgg aaagattaaa gtcattccta cttagtgacg aaattgatga ttcgttcatc 1800

gaacgtattg atccttcagc ggatgaaaga gcgttacctg ctatagagat gaataatatt 1860

acatttttat ggaaatcaaa agaagtatta acatctagcc aatctggaga taatttgagg 1920

acagatgaag agtctattat cggatcttct caaattgcgt tgaagaatat cgatcatttt 1980

2040

tttttgaagg caattcttgg tcaacttcct tgcatgagtg gttctagggga ctcgatacca 2100

cctaaactga tcattagatc atcgtctgta gcctactgtt cacaagaatc ctggataatg 2160

aacgcatctg taagagaaaa cattctattt ggtcacaagt tcgaccaaga ttattatgac 2220

ctcactatta aagcatgtca attgctaccc gatttgaaaa tactaccaga tggtgatgaa 2280

actttggtag gtgaaaaggg catttcccta tcaggcggtc agaaggcccg tctttcatta 2340

gccagagcgg tgtactcgag agcagatatt tatttgttgg atgacatttt atctgctgtt 2400

2460

2520

2580

cgtaagaaca atacttcaaa actgaaaaaa ttactagagg aatttgattc tccgattgat 2640

aatggaaatg aaagcgatgt ccaaactgaa caccgatccg aaagtgaagt ggatgaacct 2700

ctgcagctta aagtaactga atcagaaact gaggatgagg ttgttactga gagtgaatta 2760

2820

gtgggagcac aattggattc cgtgaagaaa acggcgcaaa aggccgagaa gacagaggtg 2880

ggaagagtca aaacaaagat ttatcttgcg tatattaagg cttgtggagt tttaggtgtt 2940

gttttatttt tcttgtttat gatattaaca agggttttcg acttagcaga gaatttttgg 3000

3060

gttggtgtgt attccttaat cggagtagca tcggccgcat tcaataattt acggagtatt 3120

atgatgctac tgtattgttc tattaggggt tctaagaaac tgcatgaaag catggccaaa 3180

3240

aggttctcat ctgatatgga tgcagtggac agtaatctac agtacatttt ctcctttttt 3300

3360

3420

gtgctatcta gggagctaaa aagattgatc agtatatctt actctccgat tatgtcctta 3480

atgagtgaga gcttgaacgg ttattctatt attgatgcat acgatcattt tgagagattc 3540

atctatctaa attatgaaaa aatccaatac aacgttgatt ttgtcttcaa ctttagatca 3600

3660

gcaatcttag cactagcaac aatgaatact aaaaggcaac taagttcggg tatggttggt 3720

ctactaatga gctattcatt agaggttaca ggttcattga cttggattgt aaggacaact 3780

gtgacgattg aaaccaacat tgtatcagtg gagagaattg ttgagtactg cgaattacca 3840

ccctgaagcac agtccattaa ccctgaaaag aggccagatg aaaattggcc atcaaagggt 3900

ggtattgaat tcaaaaacta ttccacaaaa tacagagaaa atttggatcc agtgctgaat 3960

aatattaacg tgaagattga gccatgtgaa aaggttggga ttgttggcag aacaggtgca 4020

gggaagtcta cactgagcct ggcattattt agaatactag aacctaccga aggtaaaatt 4080

attattgacg gcattgatat atccgacata ggtctgttcg atttaagaag ccatttggca 4140

attattcctc aggatgcaca agcttttgaa ggtacagtaa agaccaattt ggaccctttc 4200

aatcgttatt cagaagatga acttaaaagg gctgttgagc aggcacattt aaagcctcat 4260

ctggaaaaaa tgctgcacag taaaccaaga ggtgatgatt ctaatgaaga ggatggcaat 4320

gttaatgata ttctggatgt caagattaat gagaacggta gtaacttgtc agtggggcaa 4380

agacaactac tatgtttggc aagagcgctg ctaaaccgtt ccaaaatatt ggtccttgat 4440

4500

gaatttaagg accgtaccat cttaacaatt gcacatcgta tcgacactgt attggacagt 4560

gataagataa ttgttcttga ccagggtagt gtgagggaat tcgattcacc ctcgaaattg 4620

ttatccgata aaacgtctat tttttacagt ctttgtgaga aaggtgggta tttgaaataa 4680

<210> 27

<211> 4953

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic: nucleic acid sequence

<400> 27

atgtcaggtt caaattcgaa ttcaaatcta gatgcaataa gtgattcatg cccattttgg 60

cgctatgatg atattacaga gtgtggaaga gtgcagtata tcaattacta ccttccaata 120

acattggtag gcgtttctctcttgtattta ttcaaaaacg cgatccaaca ttattacaga 180

aagcctcaag aaattaagcc tagtgttgct tccgaattat tgggctcaaa tctcacagac 240

cttccgaatg aaaacaagcc tttactatcg gagagtacac aagcattata cactaatccg 300

gattcgaata agacaggatt ctctctaaaa gaggagcatt tctctataaa taaagttaca 360

cttacggaaa ttcattccaa taagcatgac gctgtgaaga tcgtaaggag aaactggctt 420

gaaaaattaa gagtgttctt agaatggggtt ctatgcgcct tacaactttg catctacatt 480

tcagtctggt cgaaatacac taatacccaa gaggatttcc caatgcacgc atctatctca 540

ggtctaatgt tatggtctct actcttgtta gtagtgtcat tgaggttggc aaacatcaac 600

cagaatataa gctggatcaa ttcaggaccg ggaaacttat gggccctttc atttgcatgt 660

tatctatcac tattctgcgg atccgttttg ccattgagat ctatctatat cggtcatatc 720

acagatgaaa ttgcatcaac attttataag ttgcaatttt acctaagttt gacactattc 780

ttgttacttt tcacctctca agcgggaaat cggtttgcca ttatctataa aagtacacca 840

gatataacac cgtctcctga acctattgtg tcgattgcaa gttatatcac ttgggcatgg 900

gtagataaat ttctttggaa agcgcatcaa aattatatcg aaatgaaaga tgtttggggt 960

ctaatggtgg aagactattc cattctcgta ataaagagat tcaatcattt tgttcagaat 1020

aaaaccaagt ctaggacatt ttcatttaac ttaatccact ttttcatgaa atttatcgcc 1080

attcaaggtg cctgggcaac aatttcgtca gttattagtt ttgttccaac aatgttgctc 1140

agacgtattt tggagtatgt tgaagatcaa tcaactgctc cattaaattt ggcttggatg 1200

tatatttttc ttatgttcct tgccagaatt ttaactgcca tatgtgctgc tcaggcgcta 1260

tttttagggga gaagggtttg tatcagaatg aaggctatca taatttctga aatctactcc 1320

1380

ccacaggaat taaatgacaa acaacacgtt gatggagatg aagaatcagc aaccactgca 1440

aatcttggtg ctatcattaa tttgatggcg gtggatgctt tcaaagtatc cgaaatatgt 1500

1560

tatcggttaa taggctggtc tgctttagtt ggtagtgcaa tgattatttg cttcttacca 1620

ttgaacttca aacttgccag cttgttaggg acactccaaa agaaatcctt ggcaatcaca 1680

gataaaagaa ttcagaaact aaacgaagct ttccaggcca ttcgtattat caaattcttc 1740

tcttgggaag agaattttga aaaggacata caaaacacaa gggatgaaga attaaatatg 1800

cttttaaaaa ggtctatcgt ttgggctctt tcttctcttg tttggttcat taccccctct 1860

attgtcacat ccgcttcttt tgcagtctat atttatgtgc aaggccaaac tttaactact 1920

ccggtagcat ttactgcact atctctattt gctctactaa gaaatccgtt agacatgctt 1980

tctgatatgt tgtcttttgt tattcaatcc aaggtctctt tggatagagt ccaagaattt 2040

ttaaatgaag aggagacgaa aaagtatgag caattaaccg tatcaagaaa taaacttggg 2100

ttgcaaaacg ctacttttac atgggataaa aataatcaag atttcaagtt aaaaaaccta 2160

actattgatt tcaaaattgg gaaattaaac gttattgtag gtccaactgg atctggtaaa 2220

acatcattgt taatgggatt attgggtgaa atggagctat tgaacggaaa agttttcgtc 2280

ccttcgctca atcctaggga agagttggtt gtagaggccg atggaatgac taattcaatc 2340

gcgtactgct cccaagctgc ctggttgcta aatgatactg tcaggaacaa tattctattc 2400

aatgcgcctt ataatgagaa tagatataat gccgtcatct ctgcgtgtgg tttgaaacgc 2460

gacttcgaga tcttaagcgc tggtgatcag acagagattg gcgaaaaggg tataacactt 2520

tctggtggtc aaaaacaaag agtctcgttg gccagatcat tgtattcttc atcaagacat 2580

ttgctgttag atgattgttt gagtgccgta gactcgcaca cggccttatg gatctacgaa 2640

aattgtataa caggcccatt aatggaagga agaacatgtg tattggtttc tcacaatgtt 2700

2760

caaggcgaac cagtagaatt gctacagaag gggtcccttg gggatgactc catggtgaaa 2820

tcatcaattt tgtcccgtac ggcgtcctca gttaatattt cagaaactaa cagtaagatt 2880

tctagtggtc cgaaggctcc agcggaatcg gataatgcca atgaggagtc caccacctgt 2940

ggagatcgtt caaagtcaag cggcaagcta atcgctgaag aaacaaaatc aaacggtgtt 3000

gtttccctgg acgtctataa gtggtatgcc gtgtttttcg gtggatggaa gatgatatca 3060

tttttgtgtt tcattttctt gtttgcccaa atgatcagta tttcacaggc ctggtggttg 3120

cgtgcttggg cctccaacaa cactctaaaa gttttctcca accttggatt gcaaacaatg 3180

aggccattcg ctttgtcctt acaaggaaaa gaagcttctc ctgtgactct tagtgctgtt 3240

ttcccaaatg gcagtctaac aacagccacg gaaccaaatc actcgaacgc gtattatcta 3300

3360

3420 aactttgtgg ccggtattag agcttccagg

3480

tctaaagaca tcgaatcaat agatcaagaa ttgactcctt atatggaagg tgcatttggt 3540

tccttaatac aatgtgtttc cacaattatc gtcattgcat acattactcc ccaatttttg 3600

attgtcgcgg cgattgtcat gttattgttt tattttgttg cctactttta catgtcagga 3660

gcaagagaat taaagcgtct tgaatcgatg tcacgctctc ctattcatca gcacttctct 3720

gagactcttg tgggtatcac gactattcga gcattttctg acgagcggcg ttttctggtt 3780

3840

agatggctat cttacagaat cgagctgata ggcgccctta ttgttttggc tgcaggtagt 3900

ttcatcttat tgaacataaa atcgatcgat tctggtttgg ccggtatttc attgggtttc 3960

gctatacaat ttaccgatgg tgccctttgg gttgttaggt tatattccaa cgttgaaatg 4020

aatatgaatt ccgtcgaaag gttaaaagag tacaccacca tcgagcaaga accttctaac 4080

gttggtgcct tggtacctcc ttgcgaatgg ccacaaaatg gtaaaatcga agtcaaggat 4140

ttatctttac gctatgcagc tggtctacca aaggttataa aaaatgtcac attcaccgtc 4200

gattcaaagt gtaaagtagg tattgttggc aggactggtg ctggtaaatc tactattatc 4260

acagcccttt tcagattctt agaccctgaa actggttata tcaaaatcga tgacgttgat 4320

ataacaacca ttggtttaaa acgtttgcgc caatctatca ctattattcc acaggaccca 4380

acccttttca ccggtacttt gaaaaccaat ctcgatccat acaacgaata ttcggaagct 4440

gaaattttcg aagctctaaa acgtgtcaac cttgtttcct cagaagaact tggtaatcct 4500

tctacttcgg attcaacctc ggtacattca gcaaatatga ataagttttt ggatttggaa 4560

aatgaagtca gtgaaggtgg ttccaacctc tcacaaggac aacgtcaatt gatatgtttg 4620

gcccgttcat tattgcggtg tccaaaggta attctacttg atgaagccac agcttcaatc 4680

gattataact cagactctaa aatccaggct actataaggg aagaattcag taatagtacc 4740

attctcacga ttgctcatcg tttacgatca attattgatt atgataaaat acttgttatg 4800

gatgctgggg aggttaaaga atatgatcat ccttactcct tattgttgaa tcgtgatagt 4860

atattctatc atatgtgtga agatagtgga gaattagaag tcttgataca attagccaaa 4920

gaatcatttg tcaaaaagct caatgcaaat tga 4953

<210> 28

<211> 1381

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Fungal_5_muA

<400> 28

Met Thr Ser Pro Gly Ser Glu Lys Cys Thr Pro Arg Ser Asp Glu Asp

1 5 10 15

Leu Glu Arg Ser Glu Pro Gln Leu Gln Arg Arg Leu Leu Thr Pro Phe

20 25 30

Leu Leu Ser Lys Lys Val Pro Pro Ile Pro Lys Glu Asp Glu Arg Lys

35 40 45

Pro Tyr Pro Tyr Leu Lys Thr Asn Pro Leu Ser Gln Ile Leu Phe Trp

50 55 60

Trp Leu Asn Pro Leu Leu Arg Val Gly Tyr Lys Arg Thr Leu Asp Pro

65 70 75 80

Asn Asp Phe Tyr Tyr Leu Glu His Ser Gln Asp Ile Glu Thr Thr Tyr

85 90 95

Ser Asn Tyr Glu Met His Leu Ala Arg Ile Leu Glu Lys Asp Arg Ala

100 105 110

Lys Ala Arg Ala Lys Asp Pro Thr Leu Thr Asp Glu Asp Leu Lys Asn

115 120 125

Arg Glu Tyr Pro Lys Asn Ala Val Ile Lys Ala Leu Phe Leu Thr Phe

130 135 140

Lys Trp Lys Tyr Leu Trp Ser Ile Phe Leu Lys Leu Leu Ser Asp Ile

145 150 155 160

Val Leu Val Leu Asn Pro Leu Leu Ser Lys Ala Leu Ile Asn Phe Val

165 170 175

Asp Glu Lys Met Tyr Asn Pro Asp Met Ser Val Gly Arg Gly Val Gly

180 185 190

Tyr Ala Ile Gly Val Thr Phe Met Leu Gly Thr Ser Gly Ile Leu Ile

195 200 205

Asn His Phe Leu Tyr Leu Ser Leu Thr Val Gly Ala His Cys Lys Ala

210 215 220

Val Leu Thr Thr Ala Ile Met Asn Lys Ser Phe Arg Ala Ser Ala Lys

225 230 235 240

Ser Lys His Glu Tyr Pro Ser Gly Arg Val Thr Ser Leu Met Ser Thr

245 250 255

Asp Leu Ala Arg Ile Asp Leu Ala Ile Gly Phe Gln Pro Phe Ala Ile

260 265 270

Thr Val Pro Val Pro Ile Gly Val Ala Ile Ala Leu Leu Ile Val Asn

275 280 285

Ile Gly Val Ser Ala Leu Ala Gly Ile Ala Val Phe Leu Val Cys Ile

290 295 300

Val Val Ile Ser Ala Ser Ser Lys Ser Leu Leu Lys Met Arg Lys Gly

305 310 315 320

Ala Asn Gln Tyr Thr Asp Ala Arg Ile Ser Tyr Met Arg Glu Ile Leu

325 330 335

Gln Asn Met Arg Ile Ile Lys Phe Tyr Ser Trp Glu Asp Ala Tyr Glu

340 345 350

Lys Ser Val Val Thr Glu Arg Asn Ser Glu Met Ser Ile Ile Leu Lys

355 360 365

Met Gln Ser Ile Arg Asn Phe Leu Leu Ala Leu Ser Leu Ser Leu Pro

370 375 380

Ala Ile Ile Ser Met Val Ala Phe Leu Val Leu Tyr Gly Val Ser Asn

385 390 395 400

Asp Lys Asn Pro Gly Asn Ile Phe Ser Ser Ile Ser Leu Phe Ser Val

405 410 415

Leu Ala Gln Gln Thr Met Met Leu Pro Met Ala Leu Ala Thr Gly Ala

420 425 430

Asp Ala Lys Ile Gly Leu Glu Arg Leu Arg Gln Tyr Leu Gln Ser Gly

435 440 445

Asp Ile Glu Lys Glu Tyr Glu Asp His Glu Lys Pro Gly Asp Arg Asp

450 455 460

Val Val Leu Pro Asp Asn Val Ala Val Glu Leu Asn Asn Ala Ser Phe

465 470 475 480

Ile Trp Glu Lys Phe Asp Asp Ala Asp Asp Asn Asp Gly Asn Ser Glu

485 490 495

Lys Thr Lys Glu Val Val Val Thr Ser Lys Ser Ser Leu Thr Asp Ser

500 505 510

Ser His Ile Asp Lys Ser Thr Asp Ser Ala Asp Gly Glu Tyr Ile Lys

515 520 525

Ser Val Phe Glu Gly Phe Asn Asn Ile Asn Leu Thr Ile Lys Lys Gly

530 535 540

Glu Phe Val Ile Ile Thr Gly Pro Ile Gly Ser Gly Lys Ser Ser Leu

545 550 555 560

Leu Val Ala Leu Ala Gly Phe Met Lys Lys Thr Ser Gly Thr Leu Gly

565 570 575

Val Asn Gly Thr Met Leu Leu Cys Gly Gln Pro Trp Val Gln Asn Cys

580 585 590

Thr Val Arg Asp Asn Ile Leu Phe Gly Leu Glu Tyr Asp Glu Ala Arg

595 600 605

Tyr Asp Arg Val Val Glu Val Cys Ala Leu Gly Asp Asp Leu Lys Met

610 615 620

Phe Thr Ala Gly Asp Gln Thr Glu Ile Gly Glu Arg Gly Ile Thr Leu

625 630 635 640

Ser Gly Gly Gln Lys Ala Arg Ile Asn Leu Ala Arg Ala Val Tyr Ala

645 650 655

Asn Lys Asp Ile Ile Leu Leu Asp Asp Ala Leu Ser Ala Val Asp Ala

660 665 670

Arg Val Gly Lys Leu Ile Val Asp Asp Cys Leu Thr Ser Phe Leu Gly

675 680 685

Asp Lys Thr Arg Ile Leu Ala Thr His Gln Leu Ser Leu Ile Glu Ala

690 695 700

Ala Asp Arg Val Ile Tyr Leu Asn Gly Asp Gly Thr Ile His Ile Gly

705 710 715 720

Thr Val Gln Glu Leu Leu Glu Ser Asn Glu Gly Phe Leu Lys Leu Met

725 730 735

Glu Phe Ser Arg Lys Ser Glu Ser Glu Asp Glu Glu Asp Val Glu Ala

740 745 750

Ala Asn Glu Lys Asp Val Ser Leu Gln Lys Ala Val Ser Val Val Gln

755 760 765

Glu Gln Asp Ala His Ala Gly Val Leu Ile Gly Gln Glu Glu Glu Arg Ala

770 775 780

Val Asn Gly Ile Glu Trp Asp Ile Tyr Lys Glu Tyr Leu His Glu Gly

785 790 795 800

Arg Gly Lys Leu Gly Ile Phe Ala Ile Pro Thr Ile Ile Met Leu Leu

805 810 815

Val Leu Asp Val Phe Thr Ser Ile Phe Val Asn Val Trp Leu Ser Phe

820 825 830

Trp Ile Ser His Lys Phe Lys Ala Arg Ser Asp Gly Phe Tyr Ile Gly

835 840 845

Leu Tyr Val Met Phe Val Ile Leu Ser Val Ile Trp Ile Thr Ala Glu

850 855 860

Phe Val Val Met Gly Asn Phe Ser Ser Thr Ala Ala Arg Arg Leu Asn

865 870 875 880

Leu Lys Ala Met Lys Arg Val Leu His Thr Pro Met His Phe Leu Asp

885 890 895

Val Thr Pro Met Gly Arg Ile Leu Asn Arg Phe Thr Lys Asp Thr Asp

900 905 910

Val Leu Asp Asn Glu Ile Gly Glu Gln Ala Arg Met Phe Leu His Pro

915 920 925

Ala Ala Tyr Val Ile Gly Val Leu Ile Leu Cys Ile Ile Asn Ile Pro

930 935 940

Trp Phe Ala Ile Ala Ile Pro Pro Leu Ala Ile Pro Phe Thr Phe Ile

945 950 955 960

Thr Asn Phe Tyr Ile Ala Ser Ser Arg Glu Val Lys Arg Ile Glu Ala

965 970 975

Ile Gln Arg Ser Leu Val Tyr Asn Asn Phe Asn Glu Val Leu Asn Gly

980 985 990

Leu Gln Thr Leu Lys Ala Tyr Asn Ala Thr Ser Arg Phe Met Glu Lys

995 1000 1005

Asn Lys Arg Leu Leu Asn Arg Met Asn Glu Ala Tyr Leu Leu Val

1010 1015 1020

Ile Ala Asn Gln Arg Trp Ile Ser Val Asn Leu Asp Leu Val Ser

1025 1030 1035

Cys Cys Phe Val Phe Leu Ile Ser Met Leu Ser Val Phe Arg Val

1040 1045 1050

Phe Asp Ile Asn Ala Ser Ser Val Gly Leu Val Val Thr Ser Val

1055 1060 1065

Leu Gln Ile Gly Gly Leu Met Ser Leu Ile Met Arg Ala Tyr Thr

1070 1075 1080

Thr Val Glu Asn Glu Met Asn Ser Val Glu Arg Leu Cys His Tyr

1085 1090 1095

Ala Asn Lys Leu Glu Gln Glu Ala Pro Tyr Ile Met Asn Glu Thr

1100 1105 1110

Lys Pro Arg Pro Thr Trp Pro Glu His Gly Ala Ile Glu Phe Lys

1115 1120 1125

His Ala Ser Met Arg Tyr Arg Glu Gly Leu Pro Leu Val Leu Lys

1130 1135 1140

Asp Leu Thr Ile Ser Val Lys Gly Gly Glu Lys Ile Gly Ile Cys

1145 1150 1155

Gly Arg Thr Gly Ala Gly Lys Ser Thr Ile Met Asn Ala Leu Tyr

1160 1165 1170

Arg Leu Thr Glu Leu Ala Glu Gly Ser Ile Thr Ile Asp Gly Val

1175 1180 1185

Glu Ile Ser Gln Leu Gly Leu Tyr Asp Leu Arg Ser Lys Leu Ala

1190 1195 1200

Ile Ile Pro Gln Asp Pro Val Leu Phe Arg Gly Thr Ile Arg Lys

1205 1210 1215

Asn Leu Asp Pro Phe Gly Gln Asn Asp Asp Glu Thr Leu Trp Asp

1220 1225 1230

Ala Leu Arg Arg Ser Gly Leu Val Glu Gly Ser Ile Leu Asn Thr

1235 1240 1245

Ile Lys Ser Gln Ser Lys Asp Asp Pro Asn Phe His Lys Phe His

1250 1255 1260

Leu Asp Gln Thr Val Glu Asp Glu Gly Ala Asn Phe Ser Leu Gly

1265 1270 1275

Glu Arg Gln Leu Ile Ala Leu Ala Arg Ala Leu Val Arg Asn Ser

1280 1285 1290

Lys Ile Leu Ile Leu Asp Glu Ala Thr Ser Ser Val Asp Tyr Glu

1295 1300 1305

Thr Asp Ser Lys Ile Gln Lys Thr Ile Ser Thr Val Phe Ser His

1310 1315 1320

Cys Thr Ile Leu Cys Ile Ala His Arg Leu Lys Thr Ile Leu Thr

1325 1330 1335

Tyr Asp Arg Ile Leu Val Leu Glu Lys Gly Glu Val Glu Glu Phe

1340 1345 1350

Asp Thr Pro Arg Val Leu Tyr Ser Lys Asn Gly Val Phe Arg Gln

1355 1360 1365

Met Cys Glu Arg Ser Glu Ile Thr Ser Ala Asp Phe Val

1370 1375 1380

<210> 29

<211> 1381

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Fungal_5_muA2

<400> 29

Met Thr Ser Pro Gly Ser Glu Lys Cys Thr Pro Arg Ser Asp Glu Asp

1 5 10 15

Leu Glu Arg Ser Glu Pro Gln Leu Gln Arg Arg Leu Leu Thr Pro Phe

20 25 30

Leu Leu Ser Lys Lys Val Pro Pro Ile Pro Lys Glu Asp Glu Arg Lys

35 40 45

Pro Tyr Pro Tyr Leu Lys Thr Asn Pro Leu Ser Gln Ile Leu Phe Trp

50 55 60

Trp Leu Asn Pro Leu Leu Arg Val Gly Tyr Lys Arg Thr Leu Asp Pro

65 70 75 80

Asn Asp Phe Tyr Tyr Leu Glu His Ser Gln Asp Ile Glu Thr Thr Tyr

85 90 95

Ser Asn Tyr Glu Met His Leu Ala Arg Ile Leu Glu Lys Asp Arg Ala

100 105 110

Lys Ala Arg Ala Lys Asp Pro Thr Leu Thr Asp Glu Asp Leu Lys Asn

115 120 125

Arg Glu Tyr Pro Lys Asn Ala Val Ile Lys Ala Leu Phe Leu Thr Phe

130 135 140

Lys Trp Lys Tyr Leu Trp Ser Ile Phe Leu Lys Leu Leu Ser Asp Ile

145 150 155 160

Val Leu Val Leu Asn Pro Leu Leu Ser Lys Ala Leu Ile Asn Phe Val

165 170 175

Asp Glu Lys Met Tyr Asn Pro Asp Met Ser Val Gly Arg Gly Val Gly

180 185 190

Tyr Ala Ile Gly Val Thr Phe Met Leu Gly Thr Ser Gly Ile Leu Ile

195 200 205

Asn His Phe Leu Tyr Leu Ser Leu Thr Val Gly Ala His Cys Lys Ala

210 215 220

Val Leu Thr Thr Ala Ile Met Asn Lys Ser Phe Arg Ala Ser Ala Lys

225 230 235 240

Ser Lys His Glu Tyr Pro Ser Gly Arg Val Thr Ser Leu Met Ser Thr

245 250 255

Asp Leu Ala Arg Ile Asp Leu Ala Ile Gly Phe Gln Pro Phe Ala Ile

260 265 270

Thr Val Pro Val Pro Ile Gly Val Ala Ile Ala Leu Leu Ile Val Asn

275 280 285

Ile Gly Val Ser Ala Leu Ala Gly Ile Ala Val Phe Leu Val Cys Ile

290 295 300

Val Val Ile Ser Ala Ser Ser Lys Ser Leu Leu Lys Met Arg Lys Gly

305 310 315 320

Ala Asn Gln Tyr Thr Asp Ala Arg Ile Ser Tyr Met Arg Glu Ile Leu

325 330 335

Gln Asn Met Arg Ile Ile Lys Phe Tyr Ser Trp Glu Asp Ala Tyr Glu

340 345 350

Lys Ser Val Val Thr Glu Arg Asn Ser Glu Met Ser Ile Ile Leu Lys

355 360 365

Met Gln Ser Ile Arg Asn Phe Leu Leu Ala Leu Ser Leu Ser Leu Pro

370 375 380

Ala Ile Ile Ser Met Val Ala Phe Leu Val Leu Tyr Gly Val Ser Asn

385 390 395 400

Asp Lys Asn Pro Gly Asn Ile Phe Ser Ser Ile Ser Leu Phe Ser Val

405 410 415

Leu Ala Gln Gln Thr Met Met Leu Pro Met Ala Leu Ala Thr Gly Ala

420 425 430

Asp Ala Lys Ile Gly Leu Glu Arg Leu Arg Gln Tyr Leu Gln Ser Gly

435 440 445

Asp Ile Glu Lys Glu Tyr Glu Asp His Glu Lys Pro Gly Asp Arg Asp

450 455 460

Val Val Leu Pro Asp Asn Val Ala Val Glu Leu Asn Asn Ala Ser Phe

465 470 475 480

Ile Trp Glu Lys Phe Asp Asp Ala Asp Asp Asn Asp Gly Asn Ser Glu

485 490 495

Lys Thr Lys Glu Val Val Val Thr Ser Lys Ser Ser Leu Thr Asp Ser

500 505 510

Ser His Ile Asp Lys Ser Thr Asp Ser Ala Asp Gly Glu Tyr Ile Lys

515 520 525

Ser Val Phe Glu Gly Phe Asn Asn Ile Asn Leu Thr Ile Lys Lys Gly

530 535 540

Glu Phe Val Ile Ile Thr Gly Pro Ile Gly Ser Gly Lys Ser Ser Leu

545 550 555 560

Leu Val Ala Leu Ala Gly Phe Met Lys Lys Thr Ser Gly Thr Leu Gly

565 570 575

Val Asn Gly Thr Met Leu Leu Cys Gly Gln Pro Trp Val Gln Asn Cys

580 585 590

Thr Val Arg Asp Asn Ile Leu Phe Gly Leu Glu Tyr Asp Glu Ala Arg

595 600 605

Tyr Asp Arg Val Val Glu Val Cys Ala Leu Gly Asp Asp Leu Lys Met

610 615 620

Phe Thr Ala Gly Asp Gln Thr Glu Ile Gly Glu Arg Gly Ile Thr Leu

625 630 635 640

Ser Gly Gly Gln Lys Ala Arg Ile Asn Leu Ala Arg Ala Val Tyr Ala

645 650 655

Asn Lys Asp Ile Ile Leu Leu Asp Asp Ala Leu Ser Ala Val Asp Ala

660 665 670

Arg Val Gly Lys Leu Ile Val Asp Asp Cys Leu Thr Ser Phe Leu Gly

675 680 685

Asp Lys Thr Arg Ile Leu Ala Thr His Gln Leu Ser Leu Ile Glu Ala

690 695 700

Ala Asp Arg Val Ile Tyr Leu Asn Gly Asp Gly Thr Ile His Ile Gly

705 710 715 720

Thr Val Gln Glu Leu Leu Glu Ser Asn Glu Gly Phe Leu Lys Leu Met

725 730 735

Glu Phe Ser Arg Lys Ser Glu Ser Glu Asp Glu Glu Asp Val Glu Ala

740 745 750

Ala Asn Glu Lys Asp Val Ser Leu Gln Lys Ala Val Ser Val Val Gln

755 760 765

Glu Gln Asp Ala His Ala Gly Val Leu Ile Gly Gln Glu Glu Glu Arg Ala

770 775 780

Val Asn Gly Ile Glu Trp Asp Ile Tyr Lys Glu Tyr Leu His Glu Gly

785 790 795 800

Arg Gly Lys Leu Gly Ile Phe Ala Ile Pro Thr Ile Ile Met Leu Leu

805 810 815

Val Leu Asp Val Phe Thr Ser Ile Phe Val Asn Val Trp Leu Ser Phe

820 825 830

Trp Ile Ser His Lys Phe Lys Ala Arg Ser Asp Gly Phe Tyr Ile Gly

835 840 845

Leu Tyr Val Met Phe Val Ile Leu Ser Val Ile Trp Ile Thr Ala Glu

850 855 860

Phe Val Val Met Gly Asn Phe Ser Ser Thr Ala Ala Arg Arg Leu Asn

865 870 875 880

Leu Lys Ala Met Lys Arg Val Leu His Thr Pro Met His Phe Leu Asp

885 890 895

Val Thr Pro Met Gly Arg Ile Leu Asn Arg Phe Thr Lys Asp Thr Asp

900 905 910

Val Leu Asp Asn Glu Ile Gly Glu Gln Ala Arg Met Phe Leu His Pro

915 920 925

Ala Ala Tyr Val Ile Gly Val Leu Ile Leu Cys Ile Ile Asn Ile Pro

930 935 940

Trp Phe Ala Ile Ala Ile Pro Pro Leu Ala Ile Pro Phe Thr Phe Ile

945 950 955 960

Thr Asn Phe Tyr Ile Ala Ser Ser Arg Glu Val Lys Arg Ile Glu Ala

965 970 975

Ile Gln Arg Ser Leu Val Tyr Asn Asn Phe Asn Glu Val Leu Asn Gly

980 985 990

Leu Gln Thr Leu Lys Ala Tyr Asn Ala Thr Ser Arg Phe Met Glu Lys

995 1000 1005

Asn Lys Arg Leu Leu Asn Arg Met Asn Glu Ala Tyr Leu Leu Val

1010 1015 1020

Ile Ala Asn Gln Arg Trp Ile Ser Val Asn Leu Asp Leu Val Ser

1025 1030 1035

Cys Cys Phe Val Phe Leu Ile Ser Met Leu Ser Val Phe Arg Val

1040 1045 1050

Phe Asp Ile Asn Ala Ser Ser Val Gly Leu Val Val Thr Ser Val

1055 1060 1065

Leu Gln Ile Gly Gly Leu Met Ser Leu Ile Met Arg Ala Tyr Thr

1070 1075 1080

Thr Val Glu Asn Glu Met Asn Ser Val Glu Arg Leu Cys His Tyr

1085 1090 1095

Ala Asn Lys Leu Glu Gln Glu Ala Pro Tyr Ile Met Asn Glu Thr

1100 1105 1110

Lys Pro Arg Pro Thr Trp Pro Glu His Gly Ala Ile Glu Phe Lys

1115 1120 1125

His Ala Ser Met Arg Tyr Arg Glu Gly Leu Pro Leu Val Leu Lys

1130 1135 1140

Asp Leu Thr Ile Ser Val Lys Gly Gly Glu Lys Ile Gly Ile Cys

1145 1150 1155

Gly Arg Thr Gly Ala Gly Lys Ser Thr Ile Met Asn Ala Leu Tyr

1160 1165 1170

Arg Leu Thr Glu Leu Ala Glu Gly Ser Ile Thr Ile Asp Gly Val

1175 1180 1185

Glu Ile Ser Gln Leu Gly Leu Tyr Asp Leu Arg Ser Lys Leu Ala

1190 1195 1200

Ile Ile Pro Gln Asp Pro Val Leu Phe Arg Gly Thr Ile Arg Lys

1205 1210 1215

Asn Leu Asp Pro Phe Gly Gln Asn Asp Asp Glu Thr Leu Trp Asp

1220 1225 1230

Ala Leu Arg Arg Ser Gly Leu Val Glu Gly Ser Ile Leu Asn Thr

1235 1240 1245

Ile Lys Ser Gln Ser Lys Asp Asp Pro Asn Phe His Lys Phe His

1250 1255 1260

Leu Asp Gln Thr Val Glu Asp Glu Gly Ala Asn Phe Ser Leu Gly

1265 1270 1275

Glu Arg Gln Leu Ile Ala Leu Ala Arg Ala Leu Val Arg Asn Ser

1280 1285 1290

Lys Ile Leu Ile Leu Asp Glu Ala Thr Ser Ser Val Asp Tyr Glu

1295 1300 1305

Thr Asp Ser Lys Ile Gln Lys Thr Ile Ser Thr Glu Phe Ser His

1310 1315 1320

Cys Thr Ile Leu Cys Ile Ala His Arg Leu Lys Thr Ile Leu Thr

1325 1330 1335

Tyr Asp Arg Ile Leu Val Leu Glu Lys Gly Glu Val Glu Glu Phe

1340 1345 1350

Asp Thr Pro Arg Val Leu Tyr Ser Lys Asn Gly Val Phe Arg Gln

1355 1360 1365

Met Cys Glu Arg Ser Glu Ile Thr Ser Ala Asp Phe Val

1370 1375 1380

<210> 30

<211> 1381

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic: Fungal_5_muA3

<400> 30

Met Thr Ser Pro Gly Ser Glu Lys Cys Thr Pro Arg Ser Asp Glu Asp

1 5 10 15

Leu Glu Arg Ser Glu Pro Gln Leu Gln Arg Arg Leu Leu Thr Pro Phe

20 25 30

Leu Leu Ser Lys Lys Val Pro Pro Ile Pro Lys Glu Asp Glu Arg Lys

35 40 45

Pro Tyr Pro Tyr Leu Lys Thr Asn Pro Leu Ser Gln Ile Leu Phe Trp

50 55 60

Trp Leu Asn Pro Leu Leu Arg Val Gly Tyr Lys Arg Thr Leu Asp Pro

65 70 75 80

Asn Asp Phe Tyr Tyr Leu Glu His Ser Gln Asp Ile Glu Thr Thr Tyr

85 90 95

Ser Asn Tyr Glu Met His Leu Ala Arg Ile Leu Glu Lys Asp Arg Ala

100 105 110

Lys Ala Arg Ala Lys Asp Pro Thr Leu Thr Asp Glu Asp Leu Lys Asn

115 120 125

Arg Glu Tyr Pro Lys Asn Ala Val Ile Lys Ala Leu Phe Leu Thr Phe

130 135 140

Lys Trp Lys Tyr Leu Trp Ser Ile Phe Leu Lys Leu Leu Ser Asp Ile

145 150 155 160

Val Leu Val Leu Asn Pro Leu Leu Ser Lys Ala Leu Ile Asn Phe Val

165 170 175

Asp Glu Lys Met Tyr Asn Pro Asp Met Ser Val Gly Arg Gly Val Gly

180 185 190

Tyr Ala Ile Gly Val Thr Phe Met Leu Gly Thr Ser Gly Ile Leu Ile

195 200 205

Asn His Phe Leu Tyr Leu Ser Leu Thr Val Gly Ala His Cys Lys Ala

210 215 220

Val Leu Thr Thr Ala Ile Met Asn Lys Ser Phe Arg Ala Ser Ala Lys

225 230 235 240

Ser Lys His Glu Tyr Pro Ser Gly Arg Val Thr Ser Leu Met Ser Thr

245 250 255

Asp Leu Ala Arg Ile Asp Leu Ala Ile Gly Phe Gln Pro Phe Ala Ile

260 265 270

Thr Val Pro Val Pro Ile Gly Val Ala Ile Ala Leu Leu Ile Val Asn

275 280 285

Ile Gly Val Ser Ala Leu Ala Gly Ile Ala Val Phe Leu Val Cys Ile

290 295 300

Val Val Ile Ser Ala Ser Ser Lys Ser Leu Leu Lys Met Arg Lys Gly

305 310 315 320

Ala Asn Gln Tyr Thr Asp Ala Arg Ile Ser Tyr Met Arg Glu Ile Leu

325 330 335

Gln Asn Met Arg Ile Ile Lys Phe Tyr Ser Trp Glu Asp Ala Tyr Glu

340 345 350

Lys Ser Val Val Thr Glu Arg Asn Ser Glu Met Ser Ile Ile Leu Lys

355 360 365

Met Gln Ser Ile Arg Asn Phe Leu Leu Ala Leu Ser Leu Ser Leu Pro

370 375 380

Ala Ile Ile Ser Met Val Ala Phe Leu Val Leu Tyr Gly Val Ser Asn

385 390 395 400

Asp Lys Asn Pro Gly Asn Ile Phe Ser Ser Ile Ser Leu Phe Ser Val

405 410 415

Leu Ala Gln Gln Thr Met Met Leu Pro Met Ala Leu Ala Thr Gly Ala

420 425 430

Asp Ala Lys Ile Gly Leu Glu Arg Leu Arg Gln Tyr Leu Gln Ser Gly

435 440 445

Asp Ile Glu Lys Glu Tyr Glu Asp His Glu Lys Pro Gly Asp Arg Asp

450 455 460

Val Val Leu Pro Asp Asn Val Ala Val Glu Leu Asn Asn Ala Ser Phe

465 470 475 480

Ile Trp Glu Lys Phe Asp Asp Ala Asp Asp Asn Asp Gly Asn Ser Glu

485 490 495

Lys Thr Lys Glu Val Val Val Thr Ser Lys Ser Ser Leu Thr Asp Ser

500 505 510

Ser His Ile Asp Lys Ser Thr Asp Ser Ala Asp Gly Glu Tyr Ile Lys

515 520 525

Ser Val Phe Glu Gly Phe Asn Asn Ile Asn Leu Thr Ile Lys Lys Gly

530 535 540

Glu Phe Val Ile Ile Thr Gly Pro Ile Gly Ser Gly Lys Ser Ser Leu

545 550 555 560

Leu Val Ala Leu Ala Gly Phe Met Lys Lys Thr Ser Gly Thr Leu Gly

565 570 575

Val Asn Gly Thr Met Leu Leu Cys Gly Gln Pro Trp Val Gln Asn Cys

580 585 590

Thr Val Arg Asp Asn Ile Leu Phe Gly Leu Glu Tyr Asp Glu Ala Arg

595 600 605

Tyr Asp Arg Val Val Glu Val Cys Ala Leu Gly Asp Asp Leu Lys Met

610 615 620

Phe Thr Ala Gly Asp Gln Thr Glu Ile Gly Glu Arg Gly Ile Thr Leu

625 630 635 640

Ser Gly Gly Gln Lys Ala Arg Ile Asn Leu Ala Arg Ala Val Tyr Ala

645 650 655

Asn Lys Asp Ile Ile Leu Leu Asp Asp Ala Leu Ser Ala Val Asp Ala

660 665 670

Arg Val Gly Lys Leu Ile Val Asp Asp Cys Leu Thr Ser Phe Leu Gly

675 680 685

Asp Lys Thr Arg Ile Leu Ala Thr His Gln Leu Ser Leu Ile Glu Ala

690 695 700

Ala Asp Arg Val Ile Tyr Leu Asn Gly Asp Gly Thr Ile His Ile Gly

705 710 715 720

Thr Val Gln Glu Leu Leu Glu Ser Asn Glu Gly Phe Leu Lys Leu Met

725 730 735

Glu Phe Ser Arg Lys Ser Glu Ser Glu Asp Glu Glu Asp Val Glu Ala

740 745 750

Ala Asn Glu Lys Asp Val Ser Leu Gln Lys Ala Val Ser Val Val Gln

755 760 765

Glu Gln Asp Ala His Ala Gly Val Leu Ile Gly Gln Glu Glu Glu Arg Ala

770 775 780

Val Asn Gly Ile Glu Trp Asp Ile Tyr Lys Glu Tyr Leu His Glu Gly

785 790 795 800

Arg Gly Lys Leu Gly Ile Phe Ala Ile Pro Thr Ile Ile Met Leu Leu

805 810 815

Val Leu Asp Val Phe Thr Ser Ile Phe Val Asn Val Trp Leu Ser Phe

820 825 830

Trp Ile Ser His Lys Phe Lys Ala Arg Ser Asp Gly Phe Tyr Ile Gly

835 840 845

Leu Tyr Val Met Phe Val Ile Leu Ser Val Ile Trp Ile Thr Ala Glu

850 855 860

Phe Val Val Met Gly Asn Phe Ser Ser Thr Ala Ala Arg Arg Leu Asn

865 870 875 880

Leu Lys Ala Met Lys Arg Val Leu His Thr Pro Met His Phe Leu Asp

885 890 895

Val Thr Pro Met Gly Arg Ile Leu Asn Arg Phe Thr Lys Asp Thr Asp

900 905 910

Val Leu Asp Asn Glu Ile Gly Glu Gln Ala Arg Met Phe Leu His Pro

915 920 925

Ala Ala Tyr Val Ile Gly Val Leu Ile Leu Cys Ile Ile Asn Ile Pro

930 935 940

Trp Phe Ala Ile Ala Ile Pro Pro Leu Ala Ile Leu Phe Thr Phe Ile

945 950 955 960

Thr Asn Phe Tyr Ile Ala Ser Ser Arg Glu Val Lys Arg Ile Glu Ala

965 970 975

Ile Gln Arg Ser Leu Val Tyr Asn Asn Phe Asn Glu Val Leu Asn Gly

980 985 990

Leu Gln Thr Leu Lys Ala Tyr Asn Ala Thr Ser Arg Phe Met Glu Lys

995 1000 1005

Asn Lys Arg Leu Leu Asn Arg Met Asn Glu Ala Tyr Leu Leu Val

1010 1015 1020

Ile Ala Asn Gln Arg Trp Ile Ser Val Asn Leu Asp Leu Val Ser

1025 1030 1035

Cys Cys Phe Val Phe Leu Ile Ser Met Leu Ser Val Phe Arg Val

1040 1045 1050

Phe Asp Ile Asn Ala Ser Ser Val Gly Leu Val Val Thr Ser Val

1055 1060 1065

Leu Gln Ile Gly Gly Leu Met Ser Leu Ile Met Arg Ala Tyr Thr

1070 1075 1080

Thr Val Glu Asn Glu Met Asn Ser Val Glu Arg Leu Cys His Tyr

1085 1090 1095

Ala Asn Lys Leu Glu Gln Glu Ala Pro Tyr Ile Met Asn Glu Thr

1100 1105 1110

Lys Pro Arg Pro Thr Trp Pro Glu His Gly Ala Ile Glu Phe Lys

1115 1120 1125

His Ala Ser Met Arg Tyr Arg Glu Gly Leu Pro Leu Val Leu Lys

1130 1135 1140

Asp Leu Thr Ile Ser Val Lys Gly Gly Glu Lys Ile Gly Ile Cys

1145 1150 1155

Gly Arg Thr Gly Ala Gly Lys Ser Thr Ile Met Asn Ala Leu Tyr

1160 1165 1170

Arg Leu Thr Glu Leu Ala Glu Gly Ser Ile Thr Ile Asp Gly Val

1175 1180 1185

Glu Ile Ser Gln Leu Gly Leu Tyr Asp Leu Arg Ser Lys Leu Ala

1190 1195 1200

Ile Ile Pro Gln Asp Pro Val Leu Phe Arg Gly Thr Ile Arg Lys

1205 1210 1215

Asn Leu Asp Pro Phe Gly Gln Asn Asp Asp Glu Thr Leu Trp Asp

1220 1225 1230

Ala Leu Arg Arg Ser Gly Leu Val Glu Gly Ser Ile Leu Asn Thr

1235 1240 1245

Ile Lys Ser Gln Ser Lys Asp Asp Pro Asn Phe His Lys Phe His

1250 1255 1260

Leu Asp Gln Thr Val Glu Asp Glu Gly Ala Asn Phe Ser Leu Gly

1265 1270 1275

Glu Arg Gln Leu Ile Ala Leu Ala Arg Ala Leu Val Arg Asn Ser

1280 1285 1290

Lys Ile Leu Ile Leu Asp Glu Ala Thr Ser Ser Val Asp Tyr Glu

1295 1300 1305

Thr Asp Ser Lys Ile Gln Lys Thr Ile Ser Thr Glu Phe Ser His

1310 1315 1320

Cys Thr Ile Leu Cys Ile Ala His Arg Leu Lys Thr Ile Leu Thr

1325 1330 1335

Tyr Asp Arg Ile Leu Val Leu Glu Lys Gly Glu Val Glu Glu Phe

1340 1345 1350

Asp Thr Pro Arg Val Leu Tyr Ser Lys Asn Gly Val Phe Arg Gln

1355 1360 1365

Met Cys Glu Arg Ser Glu Ile Thr Ser Ala Asp Phe Val

1370 1375 1380

<---

Claims (36)

1. A genetically modified host cell producing one or more steviol glycosides, wherein the genetically modified host cell contains a heterologous nucleic acid encoding an ABC transporter, and wherein the genetically modified host cell with an ABC transporter produces more total steviol glycoside (TSG) compared to a host cell lacking an ABC transporter, wherein the ABC transporter contains an amino acid sequence having at least 90% sequence identity with an amino acid sequence selected from the group consisting of sequences with the following identifiers: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30. 2. Genetically modified host cell according to claim 1, characterized in that the ABC transporter contains an amino acid sequence having a sequence selected from the group consisting of sequences with the following identifiers: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8. 3. Genetically modified host cell according to any one of the preceding claims, further comprising a nucleic acid encoding geranylgeranyl pyrophosphate synthase (GGPPS), ent-copalyl pyrophosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene-19-oxidase (KO), 13 ent-kaurenoic acid α-hydroxylase (KAH), cytochrome p450 reductase (CPR) and one or more UDP-glucosyltransferases (UGT). 4. Genetically modified host cell according to claim 3, characterized in that one or more UDP-glucosyltransferases (UGT) are selected from the group consisting of UGT85C2, UGT74G1, UGT91D_like3, UGT76G1, EUGT11 and UGT40087. 5. Genetically modified host cell according to claim 4, characterized in that geranylgeranyl pyrophosphate synthase (GGPPS) contains an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 9, ent-copalyl pyrophosphate synthase (CPS) contains an amino acid sequence, having at least 80% sequence identity with SEQ ID NO: 10, ent-kaurene synthase (KS) includes an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 11, ent-kauren-19- oxidase (KO) contains an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 12, ent-kaurenoic acid 13-hydroxylase (KAH) contains an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 13, cytochrome p450 reductase (CPR) contains an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 14, and one or more UDP-glucosyltransferases (UGTs) contain an amino acid sequence, having at least 80% sequence identity to an amino acid sequence selected from the group consisting of sequences with the following identifiers: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19. 6. Genetically modified host cell according to claim 5, characterized in that geranylgeranyl pyrophosphate synthase (GGPPS) contains an amino acid sequence with SEQ ID NO: 9, ent-copalyl pyrophosphate synthase (CPS) contains an amino acid sequence with SEQ ID NO: 10, ent- kaurene synthase (KS) contains the amino acid sequence of SEQ ID NO: 11, ent-kaurene-19-oxidase (KO) contains the amino acid sequence of SEQ ID NO: 12, ent-kaurenoic acid 13-hydroxylase (KAH) contains the amino acid sequence of SEQ ID NO: 13, cytochrome p450 reductase (CPR) contains the amino acid sequence of SEQ ID NO: 14, and one or more UDP glucosyltransferases (UGT) contain an amino acid sequence selected from the group consisting of sequences with the following identifiers : SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19. 7. A genetically modified host cell according to any one of the preceding claims, characterized in that the host cell is selected from a bacterial cell, a fungal cell, an algal cell, an insect cell and a plant cell. 8. A genetically modified host cell according to claim 7, wherein the host cell is a Saccharomyces cerevisiae cell. 9. A genetically modified host cell according to any one of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 1. 10. A genetically modified host cell according to any one of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 2. 11. A genetically modified host cell according to any of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 3. 12. A genetically modified host cell according to any one of the preceding claims, characterized in that the transporter ABC contains an amino acid sequence having the sequence of SEQ ID NO: 4. 13. A genetically modified host cell according to any one of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 5. 14. A genetically modified host cell according to any one of the preceding claims, characterized in that the transporter ABC contains an amino acid sequence having the sequence of SEQ ID NO: 6. 15. A genetically modified host cell according to any of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 7. 16. The genetically modified host cell according to claim 15, characterized in that the ABC transporter contains one or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 7. 17. Genetically modified host cell according to claim 16, characterized in that one or more amino acid substitutions are selected from V666A, Y942N, L956P and E1320V. 18. A genetically modified host cell according to any one of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 8. 19. A genetically modified host cell according to any one of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 28. 20. A genetically modified host cell according to any one of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 29. 21. A genetically modified host cell according to any of the preceding claims, characterized in that the ABC transporter contains an amino acid sequence having the sequence of SEQ ID NO: 30. 22. A genetically modified host cell according to any one of the preceding claims, wherein the one or more steviol glycosides are selected from the group consisting of Reb A, Reb B, Reb D, Reb E and Reb M. 23. A genetically modified host cell according to claim 22, characterized in that one or more steviol glycosides contain Reb M. 24. A method for producing steviol or one or more steviol glycosides, comprising the steps: (a) culturing a population of host cells according to any one of claims 1 to 23 in a medium with a carbon source under conditions suitable for obtaining steviol or one or more steviol glycosides to obtain a culture broth; and (b) isolating said steviol or one or more steviol glycosides from the culture fluid. 25. The method of obtaining Reb D, including the steps: (a) culturing a population of host cells according to any one of claims 1 to 23 in a medium with a carbon source under conditions suitable for obtaining Reb D to obtain a culture broth; and (b) isolating said Reb D compound from the culture broth. 26. The method of obtaining Reb M, including the steps: (a) culturing a population of host cells according to any one of claims 1 to 23 in a medium with a carbon source under conditions suitable for obtaining Reb M to obtain a culture broth; and (b) isolating said Reb M compound from the culture broth. 27. A genetically modified host cell according to claim 1 or 2, characterized in that at least 50% of one or more steviol glycosides accumulate in the lumen of the organelle. 28. A genetically modified host cell according to claim 1 or 2, characterized in that at least 50% of one or more steviol glycosides accumulate extracellularly. 29. A genetically modified host cell according to any one of claims 1 to 23, further comprising a UDP-glucosyl transferase (UGT) having an amino acid sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 18. 30. A genetically modified host cell according to any one of claims 1 to 23, further comprising a UDP-glucosyltransferase (UGT) having the amino acid sequence of SEQ ID NO: 18.

Images